#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSM5	54988	genome.wustl.edu	37	16	20422836	20422836	+	Silent	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr16:20422836C>A	ENST00000331849.4	+	2	177	c.30C>A	c.(28-30)ctC>ctA	p.L10L	ACSM5_ENST00000575584.1_Silent_p.L10L	NM_017888.2	NP_060358.2	Q6NUN0	ACSM5_HUMAN	acyl-CoA synthetase medium-chain family member 5	10					fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(2)|large_intestine(6)|lung(28)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	51						ACCTAGTCCTCCAGGCACTGA	0.552																																						dbGAP											0													71.0	62.0	65.0					16																	20422836		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS10585.1	16p12.3	2007-10-17			ENSG00000183549	ENSG00000183549		"""Acyl-CoA synthetase family"""	26060	protein-coding gene	gene with protein product		614361				17762044	Standard	NM_017888		Approved	FLJ20581	uc002dhe.3	Q6NUN0	OTTHUMG00000131551	ENST00000331849.4:c.30C>A	16.37:g.20422836C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AV1|Q96CX8|Q9NWV3	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.L10	ENST00000331849.4	37	c.30	CCDS10585.1	16																																																																																			ACSM5	-	NULL	ENSG00000183549		0.552	ACSM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM5	HGNC	protein_coding	OTTHUMT00000254413.1	34	0.00	0	C	NM_017888		20422836	20422836	+1	no_errors	ENST00000331849	ensembl	human	known	69_37n	silent	20	51.22	21	SNP	0.000	A
ACD	65057	genome.wustl.edu	37	16	67694153	67694153	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr16:67694153G>C	ENST00000393919.4	-	1	493	c.229C>G	c.(229-231)Ccg>Gcg	p.P77A	PARD6A_ENST00000602551.1_5'Flank|PARD6A_ENST00000458121.2_5'Flank|PARD6A_ENST00000219255.3_5'Flank|ACD_ENST00000219251.8_Missense_Mutation_p.P77A			Q96AP0	ACD_HUMAN	adrenocortical dysplasia homolog (mouse)	77					intracellular protein transport (GO:0006886)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of single-stranded telomeric DNA binding (GO:0060381)|positive regulation of telomerase activity (GO:0051973)|protection from non-homologous end joining at telomere (GO:0031848)|protein localization to chromosome, telomeric region (GO:0070198)|telomere assembly (GO:0032202)|telomere capping (GO:0016233)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	17		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0143)|Epithelial(162;0.047)|all cancers(182;0.228)		GGATGCAACGGGCCCGGGTTT	0.706																																						dbGAP											0													24.0	32.0	30.0					16																	67694153		2137	4263	6400	-	-	-	SO:0001583	missense	0			AF070535	CCDS10842.1, CCDS42181.1	16q22	2012-08-23			ENSG00000102977	ENSG00000102977			25070	protein-coding gene	gene with protein product	"""TIN2 interacting protein 1"", ""POT1 and TIN2 organizing protein"""	609377				15231715, 15181449	Standard	NM_001082486		Approved	Ptop, Pip1, Tpp1, Tint1	uc002etq.4	Q96AP0	OTTHUMG00000137547	ENST00000393919.4:c.229C>G	16.37:g.67694153G>C	ENSP00000377496:p.Pro77Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q562H5|Q9H8F9	Missense_Mutation	SNP	pfam_Telomere_Pot1	p.P77A	ENST00000393919.4	37	c.229	CCDS42181.1	16	.	.	.	.	.	.	.	.	.	.	G	0.164	-1.077819	0.01903	.	.	ENSG00000102977	ENST00000219251;ENST00000393919	T;T	0.36699	1.24;1.25	4.46	-3.33	0.04958	.	7739.210000	0.00166	N	0.000000	T	0.20047	0.0482	N	0.14661	0.345	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.27739	-1.0065	10	0.07813	T	0.8	.	9.0397	0.36309	0.1623:0.4861:0.3516:0.0	.	77;77	Q96AP0;Q96AP0-2	ACD_HUMAN;.	A	77	ENSP00000219251:P77A;ENSP00000377496:P77A	ENSP00000219251:P77A	P	-	1	0	ACD	66251654	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.264000	0.00263	-1.334000	0.02244	-2.650000	0.00149	CCG	ACD	-	NULL	ENSG00000102977		0.706	ACD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACD	HGNC	protein_coding	OTTHUMT00000268880.1	13	0.00	0	G	NM_022914		67694153	67694153	-1	no_errors	ENST00000219251	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	0.000	C
ACVRL1	94	genome.wustl.edu	37	12	52307765	52307765	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr12:52307765T>G	ENST00000388922.4	+	5	816	c.533T>G	c.(532-534)cTg>cGg	p.L178R	ACVRL1_ENST00000550683.1_Missense_Mutation_p.L192R|ACVRL1_ENST00000419526.2_Intron	NM_000020.2	NP_000011.2	P37023	ACVL1_HUMAN	activin A receptor type II-like 1	178	GS. {ECO:0000255|PROSITE- ProRule:PRU00585}.				activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|artery development (GO:0060840)|blood circulation (GO:0008015)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|blood vessel maturation (GO:0001955)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|cellular response to transforming growth factor beta stimulus (GO:0071560)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of focal adhesion assembly (GO:0051895)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of blood pressure (GO:0008217)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of DNA replication (GO:0006275)|regulation of endothelial cell proliferation (GO:0001936)|regulation of transcription, DNA-templated (GO:0006355)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|transforming growth factor beta receptor signaling pathway (GO:0007179)|venous blood vessel development (GO:0060841)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)	activin binding (GO:0048185)|activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type I (GO:0005025)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	20				BRCA - Breast invasive adenocarcinoma(357;0.0991)	Adenosine triphosphate(DB00171)	CAGGACCTCCTGGACAGTGAC	0.642																																						dbGAP											0													48.0	40.0	43.0					12																	52307765		2203	4300	6503	-	-	-	SO:0001583	missense	0			L17075	CCDS31804.1	12q13.13	2014-09-17			ENSG00000139567	ENSG00000139567			175	protein-coding gene	gene with protein product		601284		ACVRLK1, ORW2		8397373, 8640225	Standard	NM_000020		Approved	HHT2, ALK1, HHT	uc001rzk.3	P37023	OTTHUMG00000169507	ENST00000388922.4:c.533T>G	12.37:g.52307765T>G	ENSP00000373574:p.Leu178Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGA8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt	p.L192R	ENST00000388922.4	37	c.575	CCDS31804.1	12	.	.	.	.	.	.	.	.	.	.	T	26.4	4.730927	0.89390	.	.	ENSG00000139567	ENST00000388922;ENST00000267008;ENST00000550683	D;D	0.95447	-3.71;-3.71	5.18	5.18	0.71444	Protein kinase-like domain (1);TGF beta receptor, GS motif (3);	0.222189	0.22942	N	0.053762	D	0.96272	0.8784	L	0.55213	1.73	0.80722	D	1	P	0.41546	0.754	P	0.55667	0.781	D	0.96665	0.9492	10	0.87932	D	0	.	14.1472	0.65357	0.0:0.0:0.0:1.0	.	178	P37023	ACVL1_HUMAN	R	178;178;192	ENSP00000373574:L178R;ENSP00000447884:L192R	ENSP00000267008:L178R	L	+	2	0	ACVRL1	50594032	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.770000	0.85390	2.151000	0.67156	0.533000	0.62120	CTG	ACVRL1	-	pfam_TGF_beta_rcpt_GS,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS	ENSG00000139567		0.642	ACVRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVRL1	HGNC	protein_coding	OTTHUMT00000404520.2	41	0.00	0	T			52307765	52307765	+1	no_errors	ENST00000550683	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	0.998	G
AP1G1	164	genome.wustl.edu	37	16	71805063	71805063	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr16:71805063G>T	ENST00000299980.4	-	5	1002	c.561C>A	c.(559-561)aaC>aaA	p.N187K	AP1G1_ENST00000569748.1_Missense_Mutation_p.N187K|AP1G1_ENST00000433195.2_Missense_Mutation_p.N210K|AP1G1_ENST00000423132.2_Missense_Mutation_p.N187K|AP1G1_ENST00000393512.3_Missense_Mutation_p.N187K	NM_001128.5	NP_001119.3	O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit	187					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				CATTACCATGGTTCTTCTCAT	0.383																																						dbGAP											0													94.0	85.0	88.0					16																	71805063		2198	4300	6498	-	-	-	SO:0001583	missense	0			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000299980.4:c.561C>A	16.37:g.71805063G>T	ENSP00000299980:p.Asn187Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75709|O75842|Q9UG09|Q9Y3U4	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.N210K	ENST00000299980.4	37	c.630	CCDS32480.1	16	.	.	.	.	.	.	.	.	.	.	G	21.4	4.149702	0.78001	.	.	ENSG00000166747	ENST00000299980;ENST00000393512;ENST00000423132;ENST00000433195;ENST00000538574;ENST00000425422	T;T;T;T	0.15256	2.44;2.44;2.44;2.44	5.48	5.48	0.80851	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.49047	0.1534	M	0.93197	3.39	0.80722	D	1	D;D;D;D	0.89917	1.0;0.995;0.999;1.0	D;D;D;D	0.77004	0.989;0.923;0.957;0.978	T	0.58463	-0.7632	10	0.72032	D	0.01	-11.2228	9.3482	0.38122	0.0756:0.1456:0.7788:0.0	.	269;187;210;187	B4DS96;O43747;B3KXW5;O43747-2	.;AP1G1_HUMAN;.;.	K	187;187;187;210;58;269	ENSP00000299980:N187K;ENSP00000377148:N187K;ENSP00000409153:N187K;ENSP00000403259:N210K	ENSP00000299980:N187K	N	-	3	2	AP1G1	70362564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.377000	0.59562	2.573000	0.86826	0.655000	0.94253	AAC	AP1G1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP1_complex_gsu	ENSG00000166747		0.383	AP1G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G1	HGNC	protein_coding	OTTHUMT00000434147.1	66	0.00	0	G			71805063	71805063	-1	no_errors	ENST00000433195	ensembl	human	known	69_37n	missense	39	45.07	32	SNP	1.000	T
ARSB	411	genome.wustl.edu	37	5	78181490	78181490	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr5:78181490C>A	ENST00000264914.4	-	5	1595	c.1059G>T	c.(1057-1059)tgG>tgT	p.W353C	ARSB_ENST00000565165.1_Missense_Mutation_p.W353C|ARSB_ENST00000396151.3_Missense_Mutation_p.W353C|ARSB_ENST00000521800.1_5'UTR	NM_000046.3	NP_000037.2	P15848	ARSB_HUMAN	arylsulfatase B	353					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|central nervous system development (GO:0007417)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|lysosomal transport (GO:0007041)|lysosome organization (GO:0007040)|post-translational protein modification (GO:0043687)|response to estrogen (GO:0043627)|response to methylmercury (GO:0051597)|response to nutrient (GO:0007584)|response to pH (GO:0009268)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|rough endoplasmic reticulum (GO:0005791)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)|N-acetylgalactosamine-4-sulfatase activity (GO:0003943)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_lung(232;0.000637)|Lung NSC(167;0.00173)|Ovarian(174;0.0105)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;4.24e-44)|Epithelial(54;3.12e-39)|all cancers(79;3.02e-34)		GTGTTGGCAGCCAGTCAGAGA	0.602																																					Melanoma(169;563 1968 25780 26156 52266)	dbGAP											0													108.0	99.0	102.0					5																	78181490		2203	4300	6503	-	-	-	SO:0001583	missense	0			M32373	CCDS4043.1, CCDS43334.1	5q14.1	2013-02-14			ENSG00000113273	ENSG00000113273	3.1.6.1	"""Arylsulfatase family"""	714	protein-coding gene	gene with protein product		611542				2303452	Standard	NM_000046		Approved		uc003kfq.3	P15848	OTTHUMG00000108129	ENST00000264914.4:c.1059G>T	5.37:g.78181490C>A	ENSP00000264914:p.Trp353Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC20|Q8N322|Q9UDI9	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.W353C	ENST00000264914.4	37	c.1059	CCDS4043.1	5	.	.	.	.	.	.	.	.	.	.	C	24.7	4.559326	0.86335	.	.	ENSG00000113273	ENST00000264914;ENST00000396151	D;D	0.96554	-4.05;-4.05	5.46	5.46	0.80206	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98921	0.9634	H	0.97315	3.98	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99505	1.0954	10	0.87932	D	0	.	18.2841	0.90108	0.0:1.0:0.0:0.0	.	353;353	Q8N322;P15848	.;ARSB_HUMAN	C	353	ENSP00000264914:W353C;ENSP00000379455:W353C	ENSP00000264914:W353C	W	-	3	0	ARSB	78217246	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.773000	0.85462	2.555000	0.86185	0.561000	0.74099	TGG	ARSB	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000113273		0.602	ARSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSB	HGNC	protein_coding	OTTHUMT00000226932.2	24	0.00	0	C	NM_000046		78181490	78181490	-1	no_errors	ENST00000264914	ensembl	human	known	69_37n	missense	16	22.73	5	SNP	1.000	A
ASPN	54829	genome.wustl.edu	37	9	95227293	95227293	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr9:95227293A>T	ENST00000375544.3	-	5	863	c.620T>A	c.(619-621)cTt>cAt	p.L207H	CENPP_ENST00000375587.3_Intron|ASPN_ENST00000375543.1_Missense_Mutation_p.L207H|ASPN_ENST00000395538.3_Missense_Mutation_p.L207H	NM_017680.4	NP_060150	Q9BXN1	ASPN_HUMAN	asporin	207	Interaction with TGFB1. {ECO:0000250}.				bone mineralization (GO:0030282)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9						ATTATTATCAAGAGGGTTTGC	0.433																																						dbGAP											0													134.0	130.0	131.0					9																	95227293		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF316824		9q22.31	2008-05-14	2007-02-15		ENSG00000106819	ENSG00000106819		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	14872	protein-coding gene	gene with protein product	"""asporin proteoglycan"""	608135	"""asporin (LRR class 1)"""				Standard	NM_017680		Approved	FLJ20129, SLRR1C, PLAP1	uc004ase.2	Q9BXN1	OTTHUMG00000020227	ENST00000375544.3:c.620T>A	9.37:g.95227293A>T	ENSP00000364694:p.Leu207His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBF3|Q96K79|Q96LD0|Q9NXP3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pirsf_SLRP_I_decor/aspor/byglycan	p.L207H	ENST00000375544.3	37	c.620		9	.	.	.	.	.	.	.	.	.	.	A	25.6	4.653909	0.88056	.	.	ENSG00000106819	ENST00000375544;ENST00000375543;ENST00000395538	T;T;T	0.69435	-0.4;-0.4;-0.4	5.37	5.37	0.77165	.	0.062125	0.64402	D	0.000004	D	0.87489	0.6190	H	0.96080	3.765	0.43734	D	0.996224	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91518	0.5232	10	0.87932	D	0	.	15.6848	0.77400	1.0:0.0:0.0:0.0	.	207;207	Q5TBF2;Q9BXN1	.;ASPN_HUMAN	H	207	ENSP00000364694:L207H;ENSP00000364693:L207H;ENSP00000378909:L207H	ENSP00000364693:L207H	L	-	2	0	ASPN	94267114	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.962000	0.93254	2.175000	0.68902	0.533000	0.62120	CTT	ASPN	-	smart_Leu-rich_rpt_typical-subtyp,pirsf_SLRP_I_decor/aspor/byglycan	ENSG00000106819		0.433	ASPN-001	KNOWN	basic|appris_principal	protein_coding	ASPN	HGNC	protein_coding	OTTHUMT00000053094.1	40	0.00	0	A	NM_017680		95227293	95227293	-1	no_errors	ENST00000375544	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	1.000	T
ATP11A	23250	genome.wustl.edu	37	13	113481187	113481187	+	Silent	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr13:113481187C>A	ENST00000487903.1	+	12	1291	c.1203C>A	c.(1201-1203)ctC>ctA	p.L401L	ATP11A_ENST00000375630.2_Silent_p.L401L|ATP11A_ENST00000375645.3_Silent_p.L401L|ATP11A_ENST00000283558.8_Silent_p.L401L			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	401					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				CGTCGGACCTCAATGAAGAGC	0.532																																						dbGAP											0													88.0	79.0	82.0					13																	113481187		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1203C>A	13.37:g.113481187C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXT2	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.S376*	ENST00000487903.1	37	c.1127	CCDS32011.1	13	.	.	.	.	.	.	.	.	.	.	C	0.030	-1.342879	0.01277	.	.	ENSG00000068650	ENST00000418678	.	.	.	5.4	-10.8	0.00216	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.3893	0.49804	0.0911:0.3177:0.5239:0.0673	.	.	.	.	X	376	.	.	S	+	2	0	ATP11A	112529188	0.404000	0.25328	0.000000	0.03702	0.013000	0.08279	-0.230000	0.09083	-2.528000	0.00493	-0.929000	0.02709	TCA	ATP11A	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000068650		0.532	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3	45	0.00	0	C	NM_015205		113481187	113481187	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418678	ensembl	human	novel	69_37n	nonsense	23	25.81	8	SNP	0.093	A
BDH1	622	genome.wustl.edu	37	3	197249622	197249622	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr3:197249622C>T	ENST00000392378.2	-	5	608	c.298G>A	c.(298-300)Gac>Aac	p.D100N	BDH1_ENST00000392379.1_Missense_Mutation_p.D100N|BDH1_ENST00000358186.2_Missense_Mutation_p.D100N|BDH1_ENST00000441275.1_Missense_Mutation_p.D13N	NM_004051.4	NP_004042.1	Q02338	BDH_HUMAN	3-hydroxybutyrate dehydrogenase, type 1	100					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|response to cadmium ion (GO:0046686)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to growth hormone (GO:0060416)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	3-hydroxybutyrate dehydrogenase activity (GO:0003858)|phospholipid binding (GO:0005543)			endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|skin(1)	11	all_cancers(143;3.35e-10)|Ovarian(172;0.0418)|Breast(254;0.0437)	Lung NSC(153;0.118)	Epithelial(36;3.52e-24)|all cancers(36;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(49;2.32e-19)|LUSC - Lung squamous cell carcinoma(58;1.02e-06)|Lung(62;1.34e-06)	GBM - Glioblastoma multiforme(93;0.0977)		TTTAGGCTGTCCAGCTCCTTG	0.567																																						dbGAP											0													139.0	102.0	115.0					3																	197249622		2203	4300	6503	-	-	-	SO:0001583	missense	0			M93107	CCDS3328.1	3q29	2011-09-14	2005-11-15	2005-11-15	ENSG00000161267	ENSG00000161267	1.1.1.30	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	1027	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 1"""	603063	"""3-hydroxybutyrate dehydrogenase (heart, mitochondrial)"""	BDH		1639787, 19027726	Standard	XM_005269352		Approved	SDR9C1	uc003fxs.3	Q02338	OTTHUMG00000155478	ENST00000392378.2:c.298G>A	3.37:g.197249622C>T	ENSP00000376183:p.Asp100Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXC0|Q96ET1|Q9BRZ4	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.D100N	ENST00000392378.2	37	c.298	CCDS3328.1	3	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453104	0.63290	.	.	ENSG00000161267	ENST00000392378;ENST00000358186;ENST00000392379;ENST00000441275;ENST00000446746;ENST00000434143;ENST00000432819	D;D;D;D;D;D;D	0.87103	-2.21;-2.21;-2.21;-2.21;-2.21;-2.21;-2.21	4.44	4.44	0.53790	NAD(P)-binding domain (1);	0.047215	0.85682	D	0.000000	T	0.79329	0.4427	N	0.21545	0.675	0.58432	D	0.999996	B	0.31318	0.319	B	0.34301	0.179	T	0.75505	-0.3294	10	0.17369	T	0.5	.	14.9511	0.71074	0.0:1.0:0.0:0.0	.	100	Q02338	BDH_HUMAN	N	100;100;100;13;13;81;100	ENSP00000376183:D100N;ENSP00000350914:D100N;ENSP00000376184:D100N;ENSP00000411014:D13N;ENSP00000387648:D13N;ENSP00000408685:D81N;ENSP00000409849:D100N	ENSP00000350914:D100N	D	-	1	0	BDH1	198734019	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	5.626000	0.67777	2.186000	0.69663	0.549000	0.68633	GAC	BDH1	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR	ENSG00000161267		0.567	BDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BDH1	HGNC	protein_coding	OTTHUMT00000340267.1	43	0.00	0	C	NM_004051		197249622	197249622	-1	no_errors	ENST00000358186	ensembl	human	known	69_37n	missense	20	52.38	22	SNP	1.000	T
BTBD1	53339	genome.wustl.edu	37	15	83686848	83686848	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr15:83686848G>T	ENST00000261721.4	-	8	1622	c.1420C>A	c.(1420-1422)Caa>Aaa	p.Q474K	RP11-382A20.7_ENST00000570202.1_RNA|BTBD1_ENST00000379403.2_3'UTR|RP11-382A20.5_ENST00000566841.1_RNA	NM_001011885.1|NM_025238.3	NP_001011885.1|NP_079514.1	Q9H0C5	BTBD1_HUMAN	BTB (POZ) domain containing 1	474					protein ubiquitination (GO:0016567)|regulation of protein binding (GO:0043393)	cytoplasmic mRNA processing body (GO:0000932)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	10				all cancers(203;0.000186)		TCTGGAATTTGTCCATCTTCT	0.318																																						dbGAP											0													48.0	53.0	51.0					15																	83686848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF355402	CCDS10322.1, CCDS32313.1	15q24	2013-01-08			ENSG00000064726	ENSG00000064726		"""BTB/POZ domain containing"""	1120	protein-coding gene	gene with protein product		608530					Standard	XM_006720573		Approved		uc002bjn.3	Q9H0C5	OTTHUMG00000147364	ENST00000261721.4:c.1420C>A	15.37:g.83686848G>T	ENSP00000261721:p.Gln474Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMI8|Q9BX71|Q9NWN4	Missense_Mutation	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.Q474K	ENST00000261721.4	37	c.1420	CCDS10322.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.115369	0.94339	.	.	ENSG00000064726	ENST00000261721	D	0.84298	-1.83	5.95	5.95	0.96441	PHR (1);	0.056527	0.64402	D	0.000001	D	0.94696	0.8289	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95019	0.8159	10	0.87932	D	0	-18.8499	20.3931	0.98965	0.0:0.0:1.0:0.0	.	474	Q9H0C5	BTBD1_HUMAN	K	474	ENSP00000261721:Q474K	ENSP00000261721:Q474K	Q	-	1	0	BTBD1	81477852	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.755000	0.98912	2.824000	0.97209	0.655000	0.94253	CAA	BTBD1	-	pfam_PHR	ENSG00000064726		0.318	BTBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD1	HGNC	protein_coding	OTTHUMT00000304008.1	38	0.00	0	G			83686848	83686848	-1	no_errors	ENST00000261721	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	1.000	T
C6	729	genome.wustl.edu	37	5	41200004	41200004	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr5:41200004C>A	ENST00000263413.3	-	4	575	c.311G>T	c.(310-312)aGa>aTa	p.R104I	C6_ENST00000337836.5_Missense_Mutation_p.R104I	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	104	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				CAAGACAGATCTAACTTTAGA	0.458																																						dbGAP											0													66.0	62.0	63.0					5																	41200004		2203	4299	6502	-	-	-	SO:0001583	missense	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.311G>T	5.37:g.41200004C>A	ENSP00000263413:p.Arg104Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal-type_dom,superfamily_Complement_control_module,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.R104I	ENST00000263413.3	37	c.311	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	21.6	4.176060	0.78564	.	.	ENSG00000039537	ENST00000337836;ENST00000263413;ENST00000417809	T;T;T	0.80909	-1.43;-1.43;-1.43	6.02	4.19	0.49359	.	0.089519	0.85682	D	0.000000	D	0.92107	0.7498	H	0.96142	3.775	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.92836	0.6284	10	0.87932	D	0	-14.1946	11.4367	0.50072	0.0:0.8041:0.1262:0.0697	.	104	P13671	CO6_HUMAN	I	104	ENSP00000338861:R104I;ENSP00000263413:R104I;ENSP00000396565:R104I	ENSP00000263413:R104I	R	-	2	0	C6	41235761	0.990000	0.36364	0.556000	0.28293	0.799000	0.45148	3.295000	0.51794	0.823000	0.34589	0.650000	0.86243	AGA	C6	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	ENSG00000039537		0.458	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	28	0.00	0	C			41200004	41200004	-1	no_errors	ENST00000263413	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	0.980	A
CCNH	902	genome.wustl.edu	37	5	86695302	86695302	+	Nonsense_Mutation	SNP	T	T	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr5:86695302T>A	ENST00000256897.4	-	7	1005	c.781A>T	c.(781-783)Aag>Tag	p.K261*	CCNH_ENST00000504878.1_Nonsense_Mutation_p.K187*|CCNH_ENST00000508855.1_Nonsense_Mutation_p.K187*	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	261					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		GGTTCATACTTCTTTACTAAG	0.378								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													204.0	185.0	191.0					5																	86695302		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.781A>T	5.37:g.86695302T>A	ENSP00000256897:p.Lys261*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X72|Q8TBL9	Nonsense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_C/H,tigrfam_Cyclin_H	p.K261*	ENST00000256897.4	37	c.781	CCDS4064.1	5	.	.	.	.	.	.	.	.	.	.	T	42	9.650124	0.99229	.	.	ENSG00000134480	ENST00000508855;ENST00000256897;ENST00000504878	.	.	.	5.68	5.68	0.88126	.	0.087286	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-27.3721	15.9323	0.79672	0.0:0.0:0.0:1.0	.	.	.	.	X	187;261;187	.	ENSP00000256897:K261X	K	-	1	0	CCNH	86731058	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	4.431000	0.59915	2.175000	0.68902	0.533000	0.62120	AAG	CCNH	-	superfamily_Cyclin-like,pirsf_Cyclin_C/H,tigrfam_Cyclin_H	ENSG00000134480		0.378	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNH	HGNC	protein_coding	OTTHUMT00000239291.3	59	0.00	0	T	NM_001239		86695302	86695302	-1	no_errors	ENST00000256897	ensembl	human	known	69_37n	nonsense	24	36.84	14	SNP	1.000	A
CDK10	8558	genome.wustl.edu	37	16	89753195	89753195	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr16:89753195C>G	ENST00000353379.7	+	1	120	c.77C>G	c.(76-78)cCg>cGg	p.P26R	RP11-368I7.4_ENST00000567544.1_5'Flank|CDK10_ENST00000505473.1_Intron|CDK10_ENST00000331006.8_Intron|CDK10_ENST00000514965.1_Intron	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	26					negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		ACGGTGCCTCCGGAACACAGG	0.697																																						dbGAP											0													26.0	34.0	31.0					16																	89753195		1991	4169	6160	-	-	-	SO:0001583	missense	0			L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.77C>G	16.37:g.89753195C>G	ENSP00000338673:p.Pro26Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P26R	ENST00000353379.7	37	c.77	CCDS10984.2	16	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315818	0.60524	.	.	ENSG00000185324	ENST00000353379	T	0.70399	-0.48	4.48	4.48	0.54585	Protein kinase-like domain (1);	0.272984	0.37012	N	0.002299	T	0.53126	0.1777	N	0.14661	0.345	0.80722	D	1	P;B;B	0.35242	0.492;0.226;0.285	B;B;B	0.31442	0.13;0.062;0.089	T	0.58120	-0.7692	10	0.40728	T	0.16	-4.7384	15.5261	0.75910	0.0:1.0:0.0:0.0	.	26;26;26	B7Z319;Q15131;B3KQJ3	.;CDK10_HUMAN;.	R	26	ENSP00000338673:P26R	ENSP00000338673:P26R	P	+	2	0	CDK10	88280696	0.125000	0.22332	0.982000	0.44146	0.838000	0.47535	4.225000	0.58600	2.323000	0.78572	0.650000	0.86243	CCG	CDK10	-	superfamily_Kinase-like_dom	ENSG00000185324		0.697	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK10	HGNC	protein_coding	OTTHUMT00000269925.2	30	0.00	0	C			89753195	89753195	+1	no_errors	ENST00000353379	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.995	G
CDK11B	984	genome.wustl.edu	37	1	1573174	1573174	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr1:1573174C>T	ENST00000407249.3	-	14	1422	c.1423G>A	c.(1423-1425)Gag>Aag	p.E475K	CDK11B_ENST00000317673.7_Missense_Mutation_p.E473K|CDK11B_ENST00000341832.6_Missense_Mutation_p.E428K|CDK11B_ENST00000340677.5_Missense_Mutation_p.E462K			P21127	CD11B_HUMAN	cyclin-dependent kinase 11B	485	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(3)|lung(4)|skin(1)|stomach(2)	12						GTGTTGATCTCCCTCAGCGAC	0.552																																						dbGAP											0													305.0	302.0	303.0					1																	1573174		2114	4227	6341	-	-	-	SO:0001583	missense	0			AK000081	CCDS72682.1, CCDS72683.1, CCDS72684.1	1p36.33	2013-09-24	2009-12-16	2009-12-16	ENSG00000248333	ENSG00000248333		"""Cyclin-dependent kinases"""	1729	protein-coding gene	gene with protein product		176873	"""cell division cycle 2-like 1 (PITSLRE proteins)"""	CDC2L1		1774066, 14511641, 19884882	Standard	XM_006711061		Approved	CDK11-p110, CDK11-p58, CDK11-p46	uc001agv.1	P21127	OTTHUMG00000078638	ENST00000407249.3:c.1423G>A	1.37:g.1573174C>T	ENSP00000464036:p.Glu475Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95265|Q12817|Q12818|Q12819|Q12820|Q12822|Q8N530|Q9NZS5|Q9UBJ0|Q9UBQ1|Q9UBR0|Q9UNY2|Q9UP57|Q9UP58|Q9UP59	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E475K	ENST00000407249.3	37	c.1423		1																																																																																			CDK11B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000248333		0.552	CDK11B-204	KNOWN	basic|appris_candidate_longest	protein_coding	CDK11B	HGNC	protein_coding		79	0.00	0	C	NM_001787		1573174	1573174	-1	no_errors	ENST00000407249	ensembl	human	known	69_37n	missense	86	17.31	18	SNP	1.000	T
CLDN16	10686	genome.wustl.edu	37	3	190105967	190105967	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr3:190105967C>G	ENST00000264734.2	+	1	307	c.59C>G	c.(58-60)tCa>tGa	p.S20*	CLDN16_ENST00000468220.1_Intron|CLDN16_ENST00000456423.1_Nonsense_Mutation_p.S20*	NM_006580.3	NP_006571.1	Q9Y5I7	CLD16_HUMAN	claudin 16	20					calcium-independent cell-cell adhesion (GO:0016338)|cellular metal ion homeostasis (GO:0006875)|excretion (GO:0007588)|magnesium ion transport (GO:0015693)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|magnesium ion transmembrane transporter activity (GO:0015095)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|skin(1)	19	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.018)		TACTGCAACTCAAGACACCTG	0.488																																						dbGAP											0													48.0	45.0	46.0					3																	190105967		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF152101	CCDS3296.1	3q28	2008-12-10			ENSG00000113946	ENSG00000113946		"""Claudins"""	2037	protein-coding gene	gene with protein product	"""paracellin-1"", ""hypomagnesemia 3, with hypercalciuria and nephrocalcinosis"""	603959				10390358	Standard	NM_006580		Approved	PCLN1, HOMG3	uc003fsi.3	Q9Y5I7	OTTHUMG00000156215	ENST00000264734.2:c.59C>G	3.37:g.190105967C>G	ENSP00000264734:p.Ser20*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin16,prints_Claudin	p.S20*	ENST00000264734.2	37	c.59	CCDS3296.1	3	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079427	0.76528	.	.	ENSG00000113946	ENST00000264734;ENST00000456423	.	.	.	6.03	-0.797	0.10909	.	0.699234	0.11841	N	0.524226	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.1222	9.748	0.40459	0.0:0.4469:0.0:0.5531	.	.	.	.	X	20	.	ENSP00000264734:S20X	S	+	2	0	CLDN16	191588661	0.077000	0.21312	0.005000	0.12908	0.054000	0.15201	0.094000	0.15107	-0.082000	0.12640	-0.484000	0.04775	TCA	CLDN16	-	NULL	ENSG00000113946		0.488	CLDN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN16	HGNC	protein_coding	OTTHUMT00000343519.1	39	0.00	0	C	NM_006580		190105967	190105967	+1	no_errors	ENST00000264734	ensembl	human	known	69_37n	nonsense	15	48.28	14	SNP	0.006	G
CRTAC1	55118	genome.wustl.edu	37	10	99655137	99655137	+	Missense_Mutation	SNP	G	G	A	rs576681356		TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr10:99655137G>A	ENST00000370597.3	-	11	1706	c.1351C>T	c.(1351-1353)Cgc>Tgc	p.R451C	CRTAC1_ENST00000298819.4_Missense_Mutation_p.R451C|CRTAC1_ENST00000370591.2_Missense_Mutation_p.R451C	NM_018058.6	NP_060528.3	Q9NQ79	CRAC1_HUMAN	cartilage acidic protein 1	451						extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(6)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	35		Colorectal(252;0.24)		Epithelial(162;2.18e-10)|all cancers(201;3.27e-09)		AACCGGGTGCGTGGCACCACT	0.632																																						dbGAP											0													64.0	59.0	61.0					10																	99655137		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276171	CCDS31266.1, CCDS55723.1	10q22	2007-12-03			ENSG00000095713	ENSG00000095713			14882	protein-coding gene	gene with protein product		606276				11139377	Standard	NM_018058		Approved	FLJ10320, CEP-68, ASPIC1	uc001kou.2	Q9NQ79	OTTHUMG00000018871	ENST00000370597.3:c.1351C>T	10.37:g.99655137G>A	ENSP00000359629:p.Arg451Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALN4|Q5T4F8|Q8N4H6|Q8TE52|Q9NQ78|Q9NQ80|Q9NW46	Missense_Mutation	SNP	pfam_FG-GAP,pfam_UnbV_ASPIC,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd	p.R451C	ENST00000370597.3	37	c.1351	CCDS31266.1	10	.	.	.	.	.	.	.	.	.	.	G	18.52	3.642809	0.67244	.	.	ENSG00000095713	ENST00000413387;ENST00000370597;ENST00000298819;ENST00000309155;ENST00000370591	T;T;T;T;T	0.74526	1.39;-0.85;1.38;-0.01;-0.01	5.06	4.15	0.48705	.	0.000000	0.85682	D	0.000000	T	0.82121	0.4968	M	0.77820	2.39	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.994	P;P;P	0.55785	0.784;0.642;0.613	T	0.82508	-0.0422	10	0.38643	T	0.18	-13.1077	14.9568	0.71120	0.0:0.0:0.8561:0.1439	.	451;451;347	Q9NQ79-2;Q9NQ79;Q5T4F6	.;CRAC1_HUMAN;.	C	347;451;451;443;451	ENSP00000408445:R347C;ENSP00000359629:R451C;ENSP00000298819:R451C;ENSP00000310810:R443C;ENSP00000359623:R451C	ENSP00000298819:R451C	R	-	1	0	CRTAC1	99645127	1.000000	0.71417	0.496000	0.27539	0.958000	0.62258	3.896000	0.56266	1.113000	0.41760	0.462000	0.41574	CGC	CRTAC1	-	NULL	ENSG00000095713		0.632	CRTAC1-001	KNOWN	basic|CCDS	protein_coding	CRTAC1	HGNC	protein_coding	OTTHUMT00000049754.1	23	0.00	0	G	NM_018058		99655137	99655137	-1	no_errors	ENST00000370597	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	0.965	A
CSMD2	114784	genome.wustl.edu	37	1	34100819	34100819	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr1:34100819T>C	ENST00000373380.1	-	10	1920	c.1700A>G	c.(1699-1701)gAc>gGc	p.D567G	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.D1694G			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1654	Sushi 3. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CATACCATAGTCCTTGGGCAC	0.468											OREG0013349	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													133.0	106.0	115.0					1																	34100819		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.1700A>G	1.37:g.34100819T>C	ENSP00000362478:p.Asp567Gly	Somatic	845	WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.D1694G	ENST00000373380.1	37	c.5081		1	.	.	.	.	.	.	.	.	.	.	T	22.7	4.323254	0.81580	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.52983	0.64;0.64	5.89	5.89	0.94794	CUB (5);	0.053328	0.64402	D	0.000001	T	0.43344	0.1243	N	0.10707	0.03	0.80722	D	1	P;D;D	0.55800	0.835;0.973;0.973	P;P;P	0.57846	0.693;0.828;0.828	T	0.41484	-0.9506	10	0.22109	T	0.4	.	15.4934	0.75629	0.0:0.0:0.0:1.0	.	567;1654;1694	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	G	1694;567	ENSP00000362479:D1694G;ENSP00000362478:D567G	ENSP00000241312:D1654G	D	-	2	0	CSMD2	33873406	1.000000	0.71417	1.000000	0.80357	0.782000	0.44232	8.040000	0.89188	2.254000	0.74563	0.459000	0.35465	GAC	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.468	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4	41	0.00	0	T	NM_052896		34100819	34100819	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	1.000	C
DAZAP1	26528	genome.wustl.edu	37	19	1432662	1432662	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:1432662C>T	ENST00000233078.4	+	11	1182	c.1021C>T	c.(1021-1023)Cag>Tag	p.Q341*	DAZAP1_ENST00000336761.6_Nonsense_Mutation_p.Q341*	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	341	Pro-rich.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)	p.Q341E(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCCGACAGCTCAGCCAGACTT	0.672																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											68.0	70.0	70.0					19																	1432662		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.1021C>T	19.37:g.1432662C>T	ENSP00000233078:p.Gln341*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MJ3|Q9NRR9	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q341*	ENST00000233078.4	37	c.1021	CCDS12065.1	19	.	.	.	.	.	.	.	.	.	.	C	38	7.120801	0.98077	.	.	ENSG00000071626	ENST00000233078;ENST00000336761	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.11794	T	0.64	.	16.9739	0.86308	0.0:1.0:0.0:0.0	.	.	.	.	X	341	.	ENSP00000233078:Q341X	Q	+	1	0	DAZAP1	1383662	1.000000	0.71417	0.975000	0.42487	0.989000	0.77384	6.041000	0.70988	2.252000	0.74401	0.561000	0.74099	CAG	DAZAP1	-	NULL	ENSG00000071626		0.672	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAZAP1	HGNC	protein_coding	OTTHUMT00000449522.3	23	0.00	0	C	NM_170711		1432662	1432662	+1	no_errors	ENST00000233078	ensembl	human	known	69_37n	nonsense	11	47.62	10	SNP	1.000	T
DHRS13	147015	genome.wustl.edu	37	17	27228573	27228573	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr17:27228573C>G	ENST00000378895.4	-	3	434	c.308G>C	c.(307-309)cGg>cCg	p.R103P	DHRS13_ENST00000426464.2_Intron|DHRS13_ENST00000581974.1_5'Flank|RP11-20B24.4_ENST00000579187.1_RNA|DHRS13_ENST00000394901.3_Missense_Mutation_p.R53P|RP11-20B24.4_ENST00000580603.1_RNA	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	103						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			GGCAAAGGCCCGCACCGAGGC	0.627																																						dbGAP											0													88.0	80.0	83.0					17																	27228573		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.308G>C	17.37:g.27228573C>G	ENSP00000368173:p.Arg103Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BH7	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.R103P	ENST00000378895.4	37	c.308	CCDS11246.2	17	.	.	.	.	.	.	.	.	.	.	C	18.64	3.667498	0.67814	.	.	ENSG00000167536	ENST00000378895;ENST00000394901	D;D	0.87887	-2.31;-2.31	5.6	1.35	0.21983	NAD(P)-binding domain (1);	0.235808	0.43110	D	0.000615	D	0.90930	0.7149	M	0.73430	2.235	0.80722	D	1	D	0.57257	0.979	D	0.63793	0.918	D	0.89870	0.4022	10	0.87932	D	0	.	10.2714	0.43485	0.0:0.6564:0.0:0.3436	.	103	Q6UX07	DHR13_HUMAN	P	103;53	ENSP00000368173:R103P;ENSP00000378361:R53P	ENSP00000368173:R103P	R	-	2	0	DHRS13	24252699	1.000000	0.71417	0.998000	0.56505	0.704000	0.40688	1.868000	0.39509	0.314000	0.23086	-0.300000	0.09419	CGG	DHRS13	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase	ENSG00000167536		0.627	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS13	HGNC	protein_coding	OTTHUMT00000255952.1	26	0.00	0	C	NM_144683		27228573	27228573	-1	no_errors	ENST00000378895	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	1.000	G
DNAH11	8701	genome.wustl.edu	37	7	21920374	21920374	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr7:21920374C>T	ENST00000409508.3	+	75	12281	c.12250C>T	c.(12250-12252)Ctc>Ttc	p.L4084F	DNAH11_ENST00000328843.6_Missense_Mutation_p.L4091F	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4091	AAA 6. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CCTTTTTTCTCTCTGCTACTT	0.463									Kartagener syndrome																													dbGAP											0													143.0	141.0	142.0					7																	21920374		1852	4082	5934	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.12250C>T	7.37:g.21920374C>T	ENSP00000475939:p.Leu4084Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L4091F	ENST00000409508.3	37	c.12271		7	.	.	.	.	.	.	.	.	.	.	C	18.38	3.610444	0.66558	.	.	ENSG00000105877	ENST00000328843	T	0.19806	2.12	5.66	3.86	0.44501	Dynein heavy chain (1);	0.068539	0.64402	D	0.000012	T	0.42653	0.1212	.	.	.	0.58432	D	0.999997	D	0.89917	1.0	D	0.79784	0.993	T	0.37502	-0.9703	9	0.87932	D	0	.	9.0546	0.36397	0.0:0.7809:0.0:0.2191	.	4091	Q96DT5	DYH11_HUMAN	F	4091	ENSP00000330671:L4091F	ENSP00000330671:L4091F	L	+	1	0	DNAH11	21886899	0.651000	0.27340	0.997000	0.53966	0.996000	0.88848	1.349000	0.33998	1.420000	0.47138	0.655000	0.94253	CTC	DNAH11	-	pfam_Dynein_heavy	ENSG00000105877		0.463	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	75	0.00	0	C	NM_003777		21920374	21920374	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.984	T
DPYSL3	1809	genome.wustl.edu	37	5	146785290	146785290	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr5:146785290C>T	ENST00000398514.3	-	8	1065	c.694G>A	c.(694-696)Gaa>Aaa	p.E232K	DPYSL3_ENST00000534907.1_Intron|DPYSL3_ENST00000343218.5_Missense_Mutation_p.E346K	NM_001387.2	NP_001378.1	Q14195	DPYL3_HUMAN	dihydropyrimidinase-like 3	232					actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cell migration (GO:0030336)|negative regulation of neuron projection development (GO:0010977)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron projection development (GO:0010976)|protein homooligomerization (GO:0051260)|pyrimidine nucleobase catabolic process (GO:0006208)|response to axon injury (GO:0048678)	cell body (GO:0044297)|cytosol (GO:0005829)|extracellular space (GO:0005615)|filamentous actin (GO:0031941)|growth cone (GO:0030426)|lamellipodium (GO:0030027)	chondroitin sulfate binding (GO:0035374)|hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)|SH3 domain binding (GO:0017124)			breast(2)|endometrium(1)|kidney(4)|large_intestine(6)|liver(1)|lung(9)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCCTCAGCTTCCAGCTGCAAG	0.517																																						dbGAP											0													227.0	227.0	227.0					5																	146785290		2076	4254	6330	-	-	-	SO:0001583	missense	0			D78014	CCDS43381.1, CCDS56387.1	5q32	2008-02-05							3015	protein-coding gene	gene with protein product		601168				8973361, 9115293	Standard	NM_001197294		Approved	DRP-3, ULIP, CRMP4	uc003loo.3	Q14195		ENST00000398514.3:c.694G>A	5.37:g.146785290C>T	ENSP00000381526:p.Glu232Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3SXQ8|Q93012	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.E232K	ENST00000398514.3	37	c.694	CCDS43381.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.804601	0.96967	.	.	ENSG00000113657	ENST00000398514;ENST00000343218	D;D	0.96200	-3.94;-3.94	5.78	5.78	0.91487	Amidohydrolase 1 (1);Metal-dependent hydrolase, composite domain (1);	0.000000	0.85682	D	0.000000	D	0.98270	0.9427	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	0.997;1.0	D;D	0.85130	0.974;0.997	D	0.98465	1.0598	10	0.72032	D	0.01	-5.1523	20.3668	0.98882	0.0:1.0:0.0:0.0	.	346;232	B3SXQ8;Q14195	.;DPYL3_HUMAN	K	232;346	ENSP00000381526:E232K;ENSP00000343690:E346K	ENSP00000343690:E346K	E	-	1	0	DPYSL3	146765483	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.894000	0.99253	0.655000	0.94253	GAA	DPYSL3	-	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000113657		0.517	DPYSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL3	HGNC	protein_coding	OTTHUMT00000373421.2	49	0.00	0	C	NM_001387		146785290	146785290	-1	no_errors	ENST00000398514	ensembl	human	known	69_37n	missense	29	42.00	21	SNP	1.000	T
ETV5	2119	genome.wustl.edu	37	3	185774898	185774898	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr3:185774898C>T	ENST00000306376.5	-	11	1421	c.1175G>A	c.(1174-1176)cGa>cAa	p.R392Q	ETV5_ENST00000537818.1_Missense_Mutation_p.R434Q|ETV5_ENST00000480706.1_5'UTR|ETV5_ENST00000434744.1_Missense_Mutation_p.R392Q	NM_004454.2	NP_004445.1	P41161	ETV5_HUMAN	ets variant 5	392					cell differentiation (GO:0030154)|cellular response to oxidative stress (GO:0034599)|locomotory behavior (GO:0007626)|male germ-line stem cell asymmetric division (GO:0048133)|neuromuscular synaptic transmission (GO:0007274)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of branching involved in mammary gland duct morphogenesis (GO:0060762)|regulation of synapse organization (GO:0050807)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|large_intestine(7)|lung(9)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	28	all_cancers(143;4.06e-12)|Ovarian(172;0.0386)|Breast(254;0.247)		OV - Ovarian serous cystadenocarcinoma(80;1.62e-24)			CTCCATGCCTCGACCTGTCCA	0.517			T	"""TMPRSS2, SCL45A3"""	Prostate																																	dbGAP		Dom	yes		3	3q28	2119	ets variant gene 5		E	0													91.0	89.0	89.0					3																	185774898		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007333	CCDS33906.1	3q28	2008-09-12	2008-09-12		ENSG00000244405	ENSG00000244405			3494	protein-coding gene	gene with protein product	"""ets-related molecule"""	601600	"""ets variant gene 5 (ets-related molecule)"""			8152800	Standard	NM_004454		Approved	ERM	uc003fpz.3	P41161	OTTHUMG00000156639	ENST00000306376.5:c.1175G>A	3.37:g.185774898C>T	ENSP00000306894:p.Arg392Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH46|B7Z7D7|Q6IBN5	Missense_Mutation	SNP	pfam_ETS_PEA3_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.R434Q	ENST00000306376.5	37	c.1301	CCDS33906.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.602104	0.96614	.	.	ENSG00000244405	ENST00000306376;ENST00000434744;ENST00000537818	T;T;T	0.56444	0.46;0.46;0.46	5.69	5.69	0.88448	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.68439	0.3001	L	0.45581	1.43	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.69327	-0.5174	10	0.72032	D	0.01	.	18.5905	0.91210	0.0:1.0:0.0:0.0	.	392;434	P41161;B7Z7D7	ETV5_HUMAN;.	Q	392;392;434	ENSP00000306894:R392Q;ENSP00000413755:R392Q;ENSP00000441737:R434Q	ENSP00000306894:R392Q	R	-	2	0	ETV5	187257592	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.691000	0.91804	0.655000	0.94253	CGA	ETV5	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	ENSG00000244405		0.517	ETV5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV5	HGNC	protein_coding	OTTHUMT00000344947.1	55	0.00	0	C	NM_004454		185774898	185774898	-1	no_errors	ENST00000537818	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	1.000	T
FAM49A	81553	genome.wustl.edu	37	2	16740738	16740738	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr2:16740738G>C	ENST00000381323.3	-	10	1047	c.827C>G	c.(826-828)tCc>tGc	p.S276C	FAM49A_ENST00000406434.1_Missense_Mutation_p.S276C|FAM49A_ENST00000355549.2_Missense_Mutation_p.S276C	NM_030797.3	NP_110424.1	Q9H0Q0	FA49A_HUMAN	family with sequence similarity 49, member A	276						intracellular (GO:0005622)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|skin(3)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.0734)|all_hematologic(175;0.088)		GBM - Glioblastoma multiforme(3;0.00969)			ATCGATCTTGGATGTCTTGCA	0.473																																						dbGAP											0													148.0	139.0	142.0					2																	16740738		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001942	CCDS1688.1	2p24.3	2008-02-05			ENSG00000197872	ENSG00000197872			25373	protein-coding gene	gene with protein product							Standard	NM_030797		Approved	DKFZP566A1524, FLJ11080	uc002rck.2	Q9H0Q0	OTTHUMG00000090615	ENST00000381323.3:c.827C>G	2.37:g.16740738G>C	ENSP00000370724:p.Ser276Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNZ1|Q53QW2	Missense_Mutation	SNP	pfam_DUF1394	p.S276C	ENST00000381323.3	37	c.827	CCDS1688.1	2	.	.	.	.	.	.	.	.	.	.	G	18.07	3.540553	0.65085	.	.	ENSG00000197872	ENST00000381323;ENST00000406434;ENST00000355549	T;T;T	0.55588	0.51;0.51;0.51	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.68348	0.2991	M	0.86953	2.85	0.80722	D	1	B	0.24651	0.108	B	0.38842	0.283	T	0.71474	-0.4582	10	0.87932	D	0	-9.7098	18.1646	0.89721	0.0:0.0:1.0:0.0	.	276	Q9H0Q0	FA49A_HUMAN	C	276	ENSP00000370724:S276C;ENSP00000384771:S276C;ENSP00000347744:S276C	ENSP00000347744:S276C	S	-	2	0	FAM49A	16604219	1.000000	0.71417	0.994000	0.49952	0.976000	0.68499	9.808000	0.99193	2.611000	0.88343	0.655000	0.94253	TCC	FAM49A	-	pfam_DUF1394	ENSG00000197872		0.473	FAM49A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM49A	HGNC	protein_coding	OTTHUMT00000207203.2	38	0.00	0	G	NM_030797		16740738	16740738	-1	no_errors	ENST00000355549	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	1.000	C
FCRL5	83416	genome.wustl.edu	37	1	157504397	157504397	+	Intron	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr1:157504397C>A	ENST00000361835.3	-	8	1839				FCRL5_ENST00000368191.3_Intron|FCRL5_ENST00000368190.3_Intron|FCRL5_ENST00000368189.3_Missense_Mutation_p.C563F|FCRL5_ENST00000356953.4_Intron	NM_001195388.1|NM_031281.2	NP_001182317.1|NP_112571.2	Q96RD9	FCRL5_HUMAN	Fc receptor-like 5						negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of release of sequestered calcium ion into cytosol (GO:0051280)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				breast(5)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(45)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	85	all_hematologic(112;0.0378)|Hepatocellular(266;0.178)	Prostate(1639;0.231)				AAGAACCCAGCACTTACCAGT	0.488																																						dbGAP											0													43.0	45.0	45.0					1																	157504397		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF369794	CCDS1165.1	1q21	2013-01-11			ENSG00000143297	ENSG00000143297		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18508	protein-coding gene	gene with protein product		605877				11027651, 11290337	Standard	NM_031281		Approved	FCRH5, IRTA2, BXMAS1, CD307e	uc009wsm.3	Q96RD9	OTTHUMG00000017481	ENST00000361835.3:c.1681+6G>T	1.37:g.157504397C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0M2|B7WNT9|B7WP94|Q495Q2|Q495Q4|Q5VYK9|Q6UY46	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.C563F	ENST00000361835.3	37	c.1688	CCDS1165.1	1	.	.	.	.	.	.	.	.	.	.	C	5.476	0.272879	0.10349	.	.	ENSG00000143297	ENST00000368189	T	0.36340	1.26	3.56	-0.716	0.11212	.	.	.	.	.	T	0.05777	0.0151	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.41698	-0.9494	8	0.17369	T	0.5	.	5.0941	0.14723	0.2454:0.1865:0.5681:0.0	.	563	Q96RD9-4	.	F	563	ENSP00000357172:C563F	ENSP00000357172:C563F	C	-	2	0	FCRL5	155771021	0.031000	0.19500	0.020000	0.16555	0.007000	0.05969	0.545000	0.23268	-0.010000	0.14271	-1.458000	0.01028	TGC	FCRL5	-	NULL	ENSG00000143297		0.488	FCRL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL5	HGNC	protein_coding	OTTHUMT00000046263.1	20	0.00	0	C	NM_031281		157504397	157504397	-1	no_errors	ENST00000368189	ensembl	human	known	69_37n	missense	2	77.78	7	SNP	0.002	A
FGFR2	2263	genome.wustl.edu	37	10	123247597	123247597	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr10:123247597C>T	ENST00000358487.5	-	14	2166	c.1894G>A	c.(1894-1896)Gtt>Att	p.V632I	FGFR2_ENST00000369056.1_Missense_Mutation_p.V633I|FGFR2_ENST00000351936.6_Missense_Mutation_p.V630I|FGFR2_ENST00000346997.2_Missense_Mutation_p.V630I|FGFR2_ENST00000369059.1_Missense_Mutation_p.V518I|FGFR2_ENST00000369061.4_Missense_Mutation_p.V520I|FGFR2_ENST00000457416.2_Missense_Mutation_p.V633I|FGFR2_ENST00000369060.4_Missense_Mutation_p.V516I|FGFR2_ENST00000357555.5_Missense_Mutation_p.V543I|FGFR2_ENST00000360144.3_Missense_Mutation_p.V544I|FGFR2_ENST00000356226.4_Missense_Mutation_p.V515I|FGFR2_ENST00000478859.1_Missense_Mutation_p.V404I	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	632	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	GTTACCAAAACATTTCTGGCT	0.343		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																													dbGAP		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	0													151.0	153.0	152.0					10																	123247597		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.1894G>A	10.37:g.123247597C>T	ENSP00000351276:p.Val632Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V633I	ENST00000358487.5	37	c.1897	CCDS31298.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.272595	0.95429	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000369061;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000429361;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.88975	-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45;-2.45	5.37	5.37	0.77165	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.88321	0.6405	N	0.05124	-0.11	0.80722	D	1	P;D;D;D;D;P;D;D	0.69078	0.729;0.961;0.994;0.966;0.984;0.915;0.997;0.973	P;P;D;P;P;B;P;P	0.67382	0.627;0.807;0.951;0.682;0.879;0.345;0.872;0.787	D	0.91146	0.4949	10	0.62326	D	0.03	.	19.4731	0.94971	0.0:1.0:0.0:0.0	.	649;631;543;515;632;544;633;535	D3DRD5;P21802-18;P21802-21;P21802-20;P21802;P21802-22;P21802-17;D3DRD3	.;.;.;.;FGFR2_HUMAN;.;.;.	I	543;633;520;632;515;516;518;224;630;633;630;544;633;633;541	ENSP00000350166:V543I;ENSP00000358057:V520I;ENSP00000351276:V632I;ENSP00000348559:V515I;ENSP00000358056:V516I;ENSP00000358055:V518I;ENSP00000404219:V224I;ENSP00000263451:V630I;ENSP00000410294:V633I;ENSP00000309878:V630I;ENSP00000353262:V544I;ENSP00000358052:V633I;ENSP00000358054:V633I;ENSP00000337665:V541I	ENSP00000337665:V541I	V	-	1	0	FGFR2	123237587	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.656000	0.83736	2.659000	0.90383	0.655000	0.94253	GTT	FGFR2	-	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000066468		0.343	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	HGNC	protein_coding	OTTHUMT00000050715.1	72	0.00	0	C	NM_022976, NM_000141		123247597	123247597	-1	no_errors	ENST00000457416	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	1.000	T
FREM3	166752	genome.wustl.edu	37	4	144618543	144618543	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr4:144618543C>T	ENST00000329798.5	-	1	3285	c.3286G>A	c.(3286-3288)Gaa>Aaa	p.E1096K	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1096					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						TCCACATCTTCAACATGGAGA	0.488																																						dbGAP											0													85.0	72.0	76.0					4																	144618543		692	1591	2283	-	-	-	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.3286G>A	4.37:g.144618543C>T	ENSP00000332886:p.Glu1096Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.E1096K	ENST00000329798.5	37	c.3286	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	C	9.391	1.075433	0.20227	.	.	ENSG00000183090	ENST00000329798	T	0.62498	0.02	4.05	1.06	0.20224	.	0.310711	0.29028	N	0.013362	T	0.56630	0.1998	L	0.60455	1.87	0.39008	D	0.959485	.	.	.	.	.	.	T	0.49634	-0.8919	8	0.07990	T	0.79	-2.9591	9.0058	0.36111	0.0:0.6932:0.0:0.3068	.	.	.	.	K	1096	ENSP00000332886:E1096K	ENSP00000332886:E1096K	E	-	1	0	FREM3	144837993	0.996000	0.38824	0.688000	0.30117	0.884000	0.51177	3.394000	0.52551	0.364000	0.24374	-0.140000	0.14226	GAA	FREM3	-	NULL	ENSG00000183090		0.488	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	26	0.00	0	C	XM_094074		144618543	144618543	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	missense	19	29.63	8	SNP	0.936	T
GALNT9	50614	genome.wustl.edu	37	12	132685719	132685719	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr12:132685719T>G	ENST00000328957.8	-	8	1350	c.1351A>C	c.(1351-1353)Aac>Cac	p.N451H	GALNT9_ENST00000541995.1_Missense_Mutation_p.N85H|GALNT9_ENST00000535228.1_Missense_Mutation_p.N202H|GALNT9_ENST00000397325.2_Missense_Mutation_p.N85H	NM_001122636.1	NP_001116108.1	Q9HCQ5	GALT9_HUMAN	polypeptide N-acetylgalactosaminyltransferase 9	451					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(1)|endometrium(1)|large_intestine(2)|lung(5)	9	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.241)		OV - Ovarian serous cystadenocarcinoma(86;7.49e-08)|Epithelial(86;3.55e-07)|all cancers(50;2.09e-05)		GGGTACACGTTCTCCAGGTAC	0.627																																					Colon(186;2147 2752 13553 41466)	dbGAP											0													77.0	93.0	88.0					12																	132685719		2136	4245	6381	-	-	-	SO:0001583	missense	0			AB040672	CCDS41866.1	12q24.33	2014-03-13	2014-03-13		ENSG00000182870	ENSG00000182870	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4131	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 9"""	606251	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 9 (GalNAc-T9)"""			10978536, 12407114	Standard	NM_021808		Approved	GALNAC-T9	uc001ukc.4	Q9HCQ5	OTTHUMG00000168256	ENST00000328957.8:c.1351A>C	12.37:g.132685719T>G	ENSP00000329846:p.Asn451His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LR8|Q6NT54|Q8NFR1	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.N451H	ENST00000328957.8	37	c.1351		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	t|t	13.10|13.10	2.135777|2.135777	0.37728|0.37728	.|.	.|.	ENSG00000182870|ENSG00000182870	ENST00000411988|ENST00000397325;ENST00000328957;ENST00000535228;ENST00000541995;ENST00000538356	T|D;D;D;D;D	0.56611|0.82344	0.45|-1.6;-1.6;-1.6;-1.6;-1.6	4.39|4.39	4.39|4.39	0.52855|0.52855	.|.	.|0.090906	.|0.85682	.|D	.|0.000000	T|T	0.80706|0.80706	0.4674|0.4674	M|M	0.63428|0.63428	1.95|1.95	0.54753|0.54753	D|D	0.999986|0.999986	.|B;B;B	.|0.18741	.|0.03;0.001;0.003	.|B;B;B	.|0.18263	.|0.021;0.011;0.005	T|T	0.78375|0.78375	-0.2228|-0.2228	7|10	0.48119|0.49607	T|T	0.1|0.09	.|.	13.5816|13.5816	0.61907|0.61907	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|202;451;308	.|B3KNR7;Q9HCQ5;B3KP58	.|.;GALT9_HUMAN;.	A|H	223|85;451;202;85;85	ENSP00000394446:E223A|ENSP00000380488:N85H;ENSP00000329846:N451H;ENSP00000439745:N202H;ENSP00000440544:N85H;ENSP00000444709:N85H	ENSP00000394446:E223A|ENSP00000329846:N451H	E|N	-|-	2|1	0|0	GALNT9|GALNT9	131251672|131251672	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	4.038000|4.038000	0.57318|0.57318	1.599000|1.599000	0.50093|0.50093	0.379000|0.379000	0.24179|0.24179	GAA|AAC	GALNT9	-	NULL	ENSG00000182870		0.627	GALNT9-009	KNOWN	basic|appris_principal	protein_coding	GALNT9	HGNC	protein_coding	OTTHUMT00000402967.1	34	0.00	0	T	NM_001122636		132685719	132685719	-1	no_errors	ENST00000328957	ensembl	human	known	69_37n	missense	12	50.00	12	SNP	1.000	G
GATA3	2625	genome.wustl.edu	37	10	8111513	8111514	+	Frame_Shift_Ins	INS	-	-	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr10:8111513_8111514insG	ENST00000346208.3	+	5	1454_1455	c.999_1000insG	c.(1000-1002)gggfs	p.G334fs	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Frame_Shift_Ins_p.G335fs			P23771	GATA3_HUMAN	GATA binding protein 3	334					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.N334fs*19(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GGAATGCCAATGGGGACCCTGT	0.569			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Insertion - Frameshift(1)	NS(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1003dupG	10.37:g.8111517_8111517dupG	ENSP00000341619:p.Gly334fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.D335fs	ENST00000346208.3	37	c.1002_1003	CCDS7083.1	10																																																																																			GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA	ENSG00000107485		0.569	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	44	0.00	0	-	NM_001002295		8111513	8111514	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	31	18.42	7	INS	0.859:1.000	G
GPR112	139378	genome.wustl.edu	37	X	135441470	135441471	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chrX:135441470_135441471insT	ENST00000394143.1	+	11	7291_7292	c.7000_7001insT	c.(7000-7002)atafs	p.I2334fs	GPR112_ENST00000287534.4_Intron|GPR112_ENST00000394141.1_Frame_Shift_Ins_p.I2129fs|GPR112_ENST00000370652.1_Frame_Shift_Ins_p.I2334fs|GPR112_ENST00000412101.1_Frame_Shift_Ins_p.I2129fs	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	2334					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TCAGGTCATCATAAAAGCCAGC	0.371																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.7001dupT	X.37:g.135441471_135441471dupT	ENSP00000377699:p.Ile2334fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Frame_Shift_Ins	INS	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.A2336fs	ENST00000394143.1	37	c.7000_7001	CCDS35409.1	X																																																																																			GPR112	-	NULL	ENSG00000156920		0.371	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	57	0.00	0	-			135441470	135441471	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	frame_shift_ins	32	36.00	18	INS	0.952:0.996	T
GRIA3	2892	genome.wustl.edu	37	X	122387187	122387187	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chrX:122387187T>C	ENST00000371251.1	+	3	354	c.302T>C	c.(301-303)aTc>aCc	p.I101T	GRIA3_ENST00000371256.5_Missense_Mutation_p.I101T|GRIA3_ENST00000541091.1_Missense_Mutation_p.I85T|GRIA3_ENST00000542149.1_Missense_Mutation_p.I101T|GRIA3_ENST00000264357.5_Missense_Mutation_p.I101T|GRIA3_ENST00000479118.1_3'UTR			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	101					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	GTGTATGCCATCTTTGGATTC	0.488																																						dbGAP											0													183.0	139.0	154.0					X																	122387187		2203	4300	6503	-	-	-	SO:0001583	missense	0			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.302T>C	X.37:g.122387187T>C	ENSP00000360297:p.Ile101Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.I101T	ENST00000371251.1	37	c.302	CCDS14604.1	X	.	.	.	.	.	.	.	.	.	.	T	23.8	4.463995	0.84425	.	.	ENSG00000125675	ENST00000264357;ENST00000542149;ENST00000371256;ENST00000371251;ENST00000541091	D;D;D;D;D	0.86030	-2.06;-2.06;-2.06;-2.06;-2.06	5.63	5.63	0.86233	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91442	0.7299	M	0.69823	2.125	0.80722	D	1	D;D;D	0.89917	1.0;0.986;0.983	D;D;D	0.87578	0.998;0.987;0.977	D	0.92343	0.5883	10	0.87932	D	0	.	14.0973	0.65032	0.0:0.0:0.0:1.0	.	85;101;101	B7Z4C0;P42263;P42263-2	.;GRIA3_HUMAN;.	T	101;101;101;101;85	ENSP00000264357:I101T;ENSP00000446146:I101T;ENSP00000360302:I101T;ENSP00000360297:I101T;ENSP00000446440:I85T	ENSP00000264357:I101T	I	+	2	0	GRIA3	122214868	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.997000	0.88414	1.995000	0.58328	0.417000	0.27973	ATC	GRIA3	-	pfam_ANF_lig-bd_rcpt	ENSG00000125675		0.488	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	77	0.00	0	T	NM_000828		122387187	122387187	+1	no_errors	ENST00000264357	ensembl	human	known	69_37n	missense	42	28.81	17	SNP	1.000	C
GRIN3A	116443	genome.wustl.edu	37	9	104375772	104375772	+	Silent	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr9:104375772G>A	ENST00000361820.3	-	6	3252	c.2652C>T	c.(2650-2652)acC>acT	p.T884T	GRIN3A_ENST00000479772.1_5'UTR	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	884					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	ATATGTTGGCGGTCAATGGAG	0.463																																						dbGAP											0													185.0	151.0	163.0					9																	104375772		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2652C>T	9.37:g.104375772G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.T884	ENST00000361820.3	37	c.2652	CCDS6758.1	9																																																																																			GRIN3A	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000198785		0.463	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	44	0.00	0	G			104375772	104375772	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	0.999	A
HECW1	23072	genome.wustl.edu	37	7	43546786	43546786	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr7:43546786G>C	ENST00000395891.2	+	22	4287	c.3682G>C	c.(3682-3684)Gag>Cag	p.E1228Q	HECW1_ENST00000453890.1_Missense_Mutation_p.E1194Q|AC011738.4_ENST00000436105.1_RNA	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1228					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AAGAGACTTTGAGGCCAAGCT	0.493																																						dbGAP											0													92.0	96.0	95.0					7																	43546786		1840	4086	5926	-	-	-	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3682G>C	7.37:g.43546786G>C	ENSP00000379228:p.Glu1228Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.E1228Q	ENST00000395891.2	37	c.3682	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	G	32	5.192984	0.94960	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	D;D	0.87650	-2.28;-2.28	5.9	5.9	0.94986	HECT (1);	0.183866	0.56097	D	0.000026	D	0.92322	0.7564	L	0.56199	1.76	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.72625	0.956;0.978	D	0.92226	0.5788	10	0.72032	D	0.01	.	19.8784	0.96886	0.0:0.0:1.0:0.0	.	1194;1228	B4DH42;Q76N89	.;HECW1_HUMAN	Q	1228;1194;1228	ENSP00000379228:E1228Q;ENSP00000407774:E1194Q	ENSP00000265522:E1228Q	E	+	1	0	HECW1	43513311	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.825000	0.99386	2.802000	0.96397	0.542000	0.68232	GAG	HECW1	-	superfamily_HECT	ENSG00000002746		0.493	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	63	0.00	0	G	NM_015052		43546786	43546786	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	1.000	C
IGSF1	3547	genome.wustl.edu	37	X	130410058	130410058	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chrX:130410058C>T	ENST00000361420.3	-	15	2852	c.2773G>A	c.(2773-2775)Gct>Act	p.A925T	IGSF1_ENST00000370910.1_Missense_Mutation_p.A916T|IGSF1_ENST00000370904.1_Missense_Mutation_p.A916T|IGSF1_ENST00000370903.3_Missense_Mutation_p.A930T|IGSF1_ENST00000467244.1_5'UTR			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	925	Ig-like C2-type 9.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						AGGAAGTCAGCTGAGTTCCCT	0.522																																						dbGAP											0													100.0	78.0	85.0					X																	130410058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.2773G>A	X.37:g.130410058C>T	ENSP00000355010:p.Ala925Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.A930T	ENST00000361420.3	37	c.2788	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616072	0.46631	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.00932	5.53;5.53;5.53;5.53	5.38	5.38	0.77491	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.422095	0.22765	N	0.055901	T	0.02193	0.0068	M	0.71296	2.17	0.28735	N	0.902307	B;B;P	0.35493	0.115;0.284;0.505	B;B;B	0.38803	0.116;0.21;0.282	T	0.07770	-1.0755	10	0.66056	D	0.02	.	13.751	0.62908	0.0:1.0:0.0:0.0	.	916;369;925	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	T	916;925;916;930	ENSP00000359947:A916T;ENSP00000355010:A925T;ENSP00000359941:A916T;ENSP00000359940:A930T	ENSP00000355010:A925T	A	-	1	0	IGSF1	130237739	0.632000	0.27172	0.862000	0.33874	0.873000	0.50193	2.434000	0.44802	2.405000	0.81733	0.600000	0.82982	GCT	IGSF1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000147255		0.522	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	25	0.00	0	C			130410058	130410058	-1	no_errors	ENST00000370903	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.953	T
IQGAP2	10788	genome.wustl.edu	37	5	75757398	75757398	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr5:75757398T>A	ENST00000274364.6	+	2	347	c.50T>A	c.(49-51)aTt>aAt	p.I17N	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	17					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		TTTCTAGCTATTGTGGACGAT	0.403																																						dbGAP											0													110.0	98.0	102.0					5																	75757398		2203	4300	6503	-	-	-	SO:0001583	missense	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.50T>A	5.37:g.75757398T>A	ENSP00000274364:p.Ile17Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.I17N	ENST00000274364.6	37	c.50	CCDS34188.1	5	.	.	.	.	.	.	.	.	.	.	T	20.9	4.060124	0.76074	.	.	ENSG00000145703	ENST00000274364	T	0.02837	4.14	4.16	4.16	0.48862	.	0.000000	0.64402	D	0.000001	T	0.03390	0.0098	N	0.14661	0.345	0.80722	D	1	P	0.50443	0.935	P	0.48304	0.573	T	0.58836	-0.7566	10	0.66056	D	0.02	-11.4915	12.6177	0.56586	0.0:0.0:0.0:1.0	.	17	Q13576	IQGA2_HUMAN	N	17	ENSP00000274364:I17N	ENSP00000274364:I17N	I	+	2	0	IQGAP2	75793154	1.000000	0.71417	0.991000	0.47740	0.984000	0.73092	7.451000	0.80668	1.880000	0.54463	0.402000	0.26972	ATT	IQGAP2	-	NULL	ENSG00000145703		0.403	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	52	0.00	0	T	NM_006633		75757398	75757398	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.967	A
IQUB	154865	genome.wustl.edu	37	7	123150084	123150084	+	Missense_Mutation	SNP	C	C	G	rs368660926		TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr7:123150084C>G	ENST00000466202.1	-	3	979	c.403G>C	c.(403-405)Gtt>Ctt	p.V135L	IQUB_ENST00000324698.6_Missense_Mutation_p.V135L|IQUB_ENST00000434450.1_Missense_Mutation_p.V135L|IQUB_ENST00000488987.1_Intron	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	135	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)		p.V135F(1)		breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						ATAAGTACAACTTTTACTGTA	0.303																																						dbGAP											1	Substitution - Missense(1)	lung(1)											73.0	85.0	81.0					7																	123150084		2202	4291	6493	-	-	-	SO:0001583	missense	0			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.403G>C	7.37:g.123150084C>G	ENSP00000417769:p.Val135Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Missense_Mutation	SNP	pfam_Ubiquitin,pfscan_Ubiquitin_supergroup	p.V135L	ENST00000466202.1	37	c.403	CCDS5787.1	7	.	.	.	.	.	.	.	.	.	.	C	14.26	2.481891	0.44147	.	.	ENSG00000164675	ENST00000466202;ENST00000324698;ENST00000434450	T;T;T	0.60040	0.22;0.22;0.22	4.88	-0.189	0.13260	Ubiquitin supergroup (1);	0.646278	0.13809	N	0.361256	T	0.46112	0.1376	L	0.60455	1.87	0.24583	N	0.993865	B;B;B	0.27765	0.188;0.073;0.043	B;B;B	0.27608	0.081;0.071;0.032	T	0.34229	-0.9837	10	0.36615	T	0.2	.	4.0039	0.09592	0.1596:0.5024:0.0:0.3379	.	135;135;135	A1A4Z1;Q8NA54-2;Q8NA54	.;.;IQUB_HUMAN	L	135	ENSP00000417769:V135L;ENSP00000324882:V135L;ENSP00000388498:V135L	ENSP00000324882:V135L	V	-	1	0	IQUB	122937320	0.620000	0.27068	0.984000	0.44739	0.979000	0.70002	-0.860000	0.04272	-0.234000	0.09782	0.561000	0.74099	GTT	IQUB	-	pfscan_Ubiquitin_supergroup	ENSG00000164675		0.303	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IQUB	HGNC	protein_coding	OTTHUMT00000348529.1	26	0.00	0	C	NM_178827		123150084	123150084	-1	no_errors	ENST00000324698	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	0.993	G
ITPR3	3710	genome.wustl.edu	37	6	33647763	33647763	+	Silent	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr6:33647763C>T	ENST00000374316.5	+	32	5137	c.4077C>T	c.(4075-4077)caC>caT	p.H1359H	ITPR3_ENST00000605930.1_Silent_p.H1359H			Q14573	ITPR3_HUMAN	inositol 1,4,5-trisphosphate receptor, type 3	1359					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport into cytosol (GO:0060402)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|response to calcium ion (GO:0051592)|sensory perception of bitter taste (GO:0050913)|sensory perception of sweet taste (GO:0050916)|sensory perception of umami taste (GO:0050917)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	apical part of cell (GO:0045177)|brush border (GO:0005903)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nuclear outer membrane (GO:0005640)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)	inositol 1,3,4,5 tetrakisphosphate binding (GO:0043533)|inositol 1,4,5 trisphosphate binding (GO:0070679)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|inositol hexakisphosphate binding (GO:0000822)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(24)|ovary(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	85					Caffeine(DB00201)	TGGAGGACCACAGCCCCCTCA	0.607																																						dbGAP											0													81.0	57.0	65.0					6																	33647763		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D26351	CCDS4783.1	6p21.31	2011-11-24	2011-04-28		ENSG00000096433	ENSG00000096433		"""Ion channels / Inositol triphosphate receptors"""	6182	protein-coding gene	gene with protein product		147267	"""inositol 1,4,5-triphosphate receptor, type 3"""			8081734, 8288584	Standard	NM_002224		Approved	IP3R3	uc021ywr.1	Q14573	OTTHUMG00000014532	ENST00000374316.5:c.4077C>T	6.37:g.33647763C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14649|Q5TAQ2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,pfscan_MIR_motif,prints_InsP3_rcpt-bd	p.H1359	ENST00000374316.5	37	c.4077	CCDS4783.1	6																																																																																			ITPR3	-	NULL	ENSG00000096433		0.607	ITPR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR3	HGNC	protein_coding	OTTHUMT00000040204.2	18	0.00	0	C	NM_002224		33647763	33647763	+1	no_errors	ENST00000374316	ensembl	human	known	69_37n	silent	1	90.00	9	SNP	1.000	T
KDM2A	22992	genome.wustl.edu	37	11	67018032	67018032	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr11:67018032delC	ENST00000529006.2	+	17	2977	c.2531delC	c.(2530-2532)accfs	p.T844fs	KDM2A_ENST00000530342.1_Frame_Shift_Del_p.T405fs|KDM2A_ENST00000398645.2_Intron|KDM2A_ENST00000308783.5_Frame_Shift_Del_p.T302fs|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	844					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CCAGCCCGAACCCCCCAGCGT	0.662																																						dbGAP											0													21.0	24.0	23.0					11																	67018032		2010	4163	6173	-	-	-	SO:0001589	frameshift_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.2531delC	11.37:g.67018032delC	ENSP00000432786:p.Thr844fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Frame_Shift_Del	DEL	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.Q846fs	ENST00000529006.2	37	c.2531	CCDS44657.1	11																																																																																			KDM2A	-	NULL	ENSG00000173120		0.662	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	31	0.00	0	C	NM_012308		67018032	67018032	+1	no_errors	ENST00000529006	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	0.890	-
LAMA1	284217	genome.wustl.edu	37	18	6993719	6993719	+	Silent	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr18:6993719C>A	ENST00000389658.3	-	35	5022	c.4929G>T	c.(4927-4929)gtG>gtT	p.V1643V		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1643	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				TTGCCCTATTCACCTTTTGGG	0.428																																						dbGAP											0													197.0	178.0	184.0					18																	6993719		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.4929G>T	18.37:g.6993719C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.V1643	ENST00000389658.3	37	c.4929	CCDS32787.1	18																																																																																			LAMA1	-	pfam_Laminin_I	ENSG00000101680		0.428	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	65	0.00	0	C	NM_005559		6993719	6993719	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	silent	29	36.96	17	SNP	0.001	A
LRCH2	57631	genome.wustl.edu	37	X	114357648	114357648	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chrX:114357648G>A	ENST00000317135.8	-	18	1987	c.1957C>T	c.(1957-1959)Cgc>Tgc	p.R653C	LRCH2_ENST00000538422.1_Missense_Mutation_p.R636C	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	653	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.									breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						CTTACGTTGCGAAGTTGTCGT	0.413																																						dbGAP											0													149.0	125.0	133.0					X																	114357648		1907	4107	6014	-	-	-	SO:0001583	missense	0			AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.1957C>T	X.37:g.114357648G>A	ENSP00000325091:p.Arg653Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H2T1|Q08AD5|Q9HA88|Q9P233	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,superfamily_NA-bd_OB-fold-like,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.R653C	ENST00000317135.8	37	c.1957	CCDS48155.1	X	.	.	.	.	.	.	.	.	.	.	G	15.73	2.918617	0.52546	.	.	ENSG00000130224	ENST00000317135;ENST00000536655;ENST00000538422	T;T	0.01685	4.87;4.69	5.31	5.31	0.75309	Calponin homology domain (4);	0.000000	0.85682	D	0.000000	T	0.15565	0.0375	M	0.92219	3.285	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.971;0.999	T	0.00953	-1.1502	10	0.87932	D	0	-7.028	16.4513	0.83991	0.0:0.0:1.0:0.0	.	653;636	Q5VUJ6;F5H2T1	LRCH2_HUMAN;.	C	653;132;636	ENSP00000325091:R653C;ENSP00000439366:R636C	ENSP00000325091:R653C	R	-	1	0	LRCH2	114263904	1.000000	0.71417	1.000000	0.80357	0.570000	0.35934	5.843000	0.69424	2.453000	0.82957	0.544000	0.68410	CGC	LRCH2	-	superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000130224		0.413	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	HGNC	protein_coding	OTTHUMT00000057971.2	68	0.00	0	G	NM_020871		114357648	114357648	-1	no_errors	ENST00000317135	ensembl	human	known	69_37n	missense	50	32.43	24	SNP	1.000	A
MAGEE1	57692	genome.wustl.edu	37	X	75651135	75651135	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chrX:75651135G>A	ENST00000361470.2	+	1	3090	c.2812G>A	c.(2812-2814)Gaa>Aaa	p.E938K		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	938	Interaction with DTNA. {ECO:0000250}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						GGAGGCAATGGAAGATGAGGC	0.517																																						dbGAP											0													65.0	62.0	63.0					X																	75651135		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.2812G>A	X.37:g.75651135G>A	ENSP00000354912:p.Glu938Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.E938K	ENST00000361470.2	37	c.2812	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	.	15.79	2.936701	0.52972	.	.	ENSG00000198934	ENST00000361470	T	0.03801	3.8	2.2	2.2	0.27929	.	.	.	.	.	T	0.06735	0.0172	N	0.16233	0.39	0.26947	N	0.966112	D	0.57571	0.98	P	0.59288	0.855	T	0.39702	-0.9601	9	0.33940	T	0.23	.	7.1553	0.25635	0.0:0.0:1.0:0.0	.	938	Q9HCI5	MAGE1_HUMAN	K	938	ENSP00000354912:E938K	ENSP00000354912:E938K	E	+	1	0	MAGEE1	75567539	0.979000	0.34478	0.995000	0.50966	0.993000	0.82548	1.213000	0.32407	1.377000	0.46286	0.525000	0.51046	GAA	MAGEE1	-	NULL	ENSG00000198934		0.517	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	44	0.00	0	G	NM_020932		75651135	75651135	+1	no_errors	ENST00000361470	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.995	A
MAGEC1	9947	genome.wustl.edu	37	X	140995860	140995860	+	Silent	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chrX:140995860C>A	ENST00000285879.4	+	4	2956	c.2670C>A	c.(2668-2670)tcC>tcA	p.S890S	MAGEC1_ENST00000406005.2_Intron	NM_005462.4	NP_005453.2	O60732	MAGC1_HUMAN	melanoma antigen family C, 1	890										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(22)|lung(60)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(1)	127	Acute lymphoblastic leukemia(192;6.56e-05)					AGAGTGATTCCTTGACAGACA	0.483										HNSCC(15;0.026)																												dbGAP											0													162.0	165.0	164.0					X																	140995860		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF064589	CCDS35417.1	Xq26	2009-03-18			ENSG00000155495	ENSG00000155495			6812	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 1"""	300223				9485030, 9618514	Standard	NM_005462		Approved	MAGE-C1, CT7, MGC39366, CT7.1	uc004fbt.3	O60732	OTTHUMG00000022569	ENST00000285879.4:c.2670C>A	X.37:g.140995860C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK03|O75451|Q8TCV4	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.S890	ENST00000285879.4	37	c.2670	CCDS35417.1	X																																																																																			MAGEC1	-	NULL	ENSG00000155495		0.483	MAGEC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC1	HGNC	protein_coding	OTTHUMT00000058604.1	50	0.00	0	C	NM_005462		140995860	140995860	+1	no_errors	ENST00000285879	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	0.000	A
MED22	6837	genome.wustl.edu	37	9	136212104	136212104	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr9:136212104C>G	ENST00000491289.1	-	3	708	c.127G>C	c.(127-129)Gag>Cag	p.E43Q	MED22_ENST00000343730.5_Missense_Mutation_p.E43Q|RPL7A_ENST00000323345.6_5'Flank|MED22_ENST00000476080.1_Missense_Mutation_p.E43Q|MED22_ENST00000471524.1_5'UTR|MED22_ENST00000344469.5_Missense_Mutation_p.E43Q|MED22_ENST00000371999.1_Missense_Mutation_p.E43Q			Q15528	MED22_HUMAN	mediator complex subunit 22	43						cytoplasm (GO:0005737)|mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|large_intestine(1)|ovary(1)|urinary_tract(1)	4				OV - Ovarian serous cystadenocarcinoma(145;1.14e-06)|Epithelial(140;8.2e-06)|all cancers(34;6.94e-05)		GTCTCGTCCTCAATCTGGGGG	0.587																																						dbGAP											0													97.0	69.0	79.0					9																	136212104		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6963.1, CCDS6964.1	9q34.1	2008-02-05	2007-07-30	2007-07-30	ENSG00000148297	ENSG00000148297			11477	protein-coding gene	gene with protein product		185641	"""surfeit 5"""	SURF5		8499913, 15175163	Standard	NM_133640		Approved	Med24	uc004cdc.3	Q15528	OTTHUMG00000020869	ENST00000491289.1:c.127G>C	9.37:g.136212104C>G	ENSP00000420393:p.Glu43Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW83|B3KWX4|O76072|Q5T8U0	Missense_Mutation	SNP	NULL	p.E43Q	ENST00000491289.1	37	c.127	CCDS6963.1	9	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675441	0.88445	.	.	ENSG00000148297	ENST00000491289;ENST00000486395;ENST00000343730;ENST00000344469;ENST00000476080;ENST00000371999;ENST00000446777;ENST00000494177;ENST00000457204	.	.	.	4.0	4.0	0.46444	.	0.052003	0.85682	D	0.000000	T	0.79197	0.4405	M	0.84585	2.705	0.80722	D	1	P;D	0.57899	0.951;0.981	P;D	0.66497	0.809;0.944	T	0.82159	-0.0595	9	0.48119	T	0.1	-14.7287	14.6967	0.69126	0.0:1.0:0.0:0.0	.	43;43	Q15528-2;Q15528	.;MED22_HUMAN	Q	43	.	ENSP00000342343:E43Q	E	-	1	0	MED22	135201925	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.719000	0.84751	1.802000	0.52723	0.462000	0.41574	GAG	MED22	-	NULL	ENSG00000148297		0.587	MED22-007	KNOWN	basic|appris_principal|CCDS	protein_coding	MED22	HGNC	protein_coding	OTTHUMT00000054898.2	29	0.00	0	C	NM_133640		136212104	136212104	-1	no_errors	ENST00000343730	ensembl	human	known	69_37n	missense	5	58.33	7	SNP	1.000	G
MGAM	8972	genome.wustl.edu	37	7	141786092	141786092	+	Intron	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr7:141786092C>T	ENST00000549489.2	+	39	4713				MGAM_ENST00000475668.2_Silent_p.I2237I	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACGTCTTCATCAAGTACCCAA	0.502																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4619-8328C>T	7.37:g.141786092C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.I2238	ENST00000549489.2	37	c.6714	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.502	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	39	0.00	0	C			141786092	141786092	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	silent	17	32.00	8	SNP	1.000	T
MTMR6	9107	genome.wustl.edu	37	13	25831915	25831915	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr13:25831915delG	ENST00000381801.5	-	8	1689	c.928delC	c.(928-930)catfs	p.H310fs	MTMR6_ENST00000540661.1_Frame_Shift_Del_p.H310fs|MTMR6_ENST00000482345.1_5'Flank	NM_004685.3	NP_004676.3	Q9Y217	MTMR6_HUMAN	myotubularin related protein 6	310	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|potassium ion transmembrane transport (GO:0071805)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	calcium-activated potassium channel activity (GO:0015269)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(2)|endometrium(3)|kidney(3)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(5)|stomach(3)	36		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.00927)|Epithelial(112;0.0474)|OV - Ovarian serous cystadenocarcinoma(117;0.164)		GCTTTGATATGGCGAAGCCAT	0.388																																						dbGAP											0													71.0	74.0	73.0					13																	25831915		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AF072928	CCDS9313.1	13q12	2011-06-09			ENSG00000139505	ENSG00000139505		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7453	protein-coding gene	gene with protein product		603561				9736772	Standard	NM_004685		Approved		uc001uqf.4	Q9Y217	OTTHUMG00000016606	ENST00000381801.5:c.928delC	13.37:g.25831915delG	ENSP00000371221:p.His310fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBB5|B3KSB4|Q5JRG6|Q86TB7|Q86YH4|Q96P80	Frame_Shift_Del	DEL	pfam_Myotub-related,smart_Tyr_Pase_cat	p.H310fs	ENST00000381801.5	37	c.928	CCDS9313.1	13																																																																																			MTMR6	-	smart_Tyr_Pase_cat	ENSG00000139505		0.388	MTMR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR6	HGNC	protein_coding	OTTHUMT00000044225.1	64	0.00	0	G	NM_004685		25831915	25831915	-1	no_errors	ENST00000381801	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	1.000	-
MXRA5	25878	genome.wustl.edu	37	X	3241188	3241188	+	Silent	SNP	A	A	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chrX:3241188A>C	ENST00000217939.6	-	5	2692	c.2538T>G	c.(2536-2538)ccT>ccG	p.P846P		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	846						extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				CACCAAGTAGAGGTACATCTG	0.473																																						dbGAP											0													109.0	100.0	103.0					X																	3241188		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.2538T>G	X.37:g.3241188A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Silent	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P846	ENST00000217939.6	37	c.2538	CCDS14124.1	X																																																																																			MXRA5	-	NULL	ENSG00000101825		0.473	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	59	0.00	0	A	NM_015419		3241188	3241188	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	silent	26	35.00	14	SNP	0.000	C
LINC01317	104355287	genome.wustl.edu	37	2	33952584	33952584	+	lincRNA	SNP	C	C	T	rs75990996	byFrequency	TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr2:33952584C>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							TCAGTGATCTCGCCGGGCCGG	0.637													C|||	15	0.00299521	0.0015	0.0029	5008	,	,		17081	0.0		0.0109	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0																															2.37:g.33952584C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-	ENSG00000239649		0.637	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1	22	0.00	0	C			33952584	33952584	-1	no_errors	ENST00000474610	ensembl	human	known	69_37n	rna	5	54.55	6	SNP	0.999	T
MYO9A	4649	genome.wustl.edu	37	15	72320073	72320073	+	Splice_Site	SNP	G	G	A	rs202001851		TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr15:72320073G>A	ENST00000356056.5	-	4	1469	c.997C>T	c.(997-999)Cgg>Tgg	p.R333W	MYO9A_ENST00000564571.1_Splice_Site_p.R333W|MYO9A_ENST00000444904.1_Splice_Site_p.R333W|MYO9A_ENST00000424560.1_Splice_Site_p.R333W|MYO9A_ENST00000566885.1_De_novo_Start_OutOfFrame|RP11-390D11.1_ENST00000568391.1_RNA|MYO9A_ENST00000563542.1_5'UTR	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	333	Myosin motor.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						AATACGTACCGTTCATTATGC	0.308													G|||	1	0.000199681	0.0	0.0	5008	,	,		18344	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													117.0	109.0	112.0					15																	72320073		2199	4297	6496	-	-	-	SO:0001630	splice_region_variant	0			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.998+1C>T	15.37:g.72320073G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.R333W	ENST00000356056.5	37	c.997	CCDS10239.1	15	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	19.97	3.925572	0.73213	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904;ENST00000261864;ENST00000446448	D;D;D	0.94138	-3.36;-3.36;-3.36	4.68	4.68	0.58851	Myosin head, motor domain (2);	.	.	.	.	D	0.98058	0.9360	H	0.99415	4.555	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.81914	0.993;0.993;0.995	D	0.98100	1.0414	9	0.87932	D	0	.	10.6979	0.45909	0.0:0.0:0.6925:0.3075	.	333;333;333	B2RTY4-3;B7WP69;B2RTY4	.;.;MYO9A_HUMAN	W	333	ENSP00000348349:R333W;ENSP00000399162:R333W;ENSP00000398250:R333W	ENSP00000261864:R333W	R	-	1	2	MYO9A	70107127	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.355000	0.34068	2.273000	0.75805	0.462000	0.41574	CGG	MYO9A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000066933		0.308	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	51	0.00	0	G	NM_006901	Missense_Mutation	72320073	72320073	-1	no_errors	ENST00000424560	ensembl	human	known	69_37n	missense	39	42.65	29	SNP	1.000	A
MYOF	26509	genome.wustl.edu	37	10	95069836	95069836	+	Missense_Mutation	SNP	C	C	T	rs369733924		TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr10:95069836C>T	ENST00000359263.4	-	53	6087	c.6088G>A	c.(6088-6090)Ggc>Agc	p.G2030S	MYOF_ENST00000358334.5_Missense_Mutation_p.G2017S|MYOF_ENST00000371501.4_Missense_Mutation_p.G2030S|MYOF_ENST00000371502.4_Missense_Mutation_p.G2020S	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	2030					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						AACAGCAAGCCGATGATGACC	0.542																																						dbGAP											0													82.0	90.0	87.0					10																	95069836		2173	4286	6459	-	-	-	SO:0001583	missense	0			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.6088G>A	10.37:g.95069836C>T	ENSP00000352208:p.Gly2030Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.G2030S	ENST00000359263.4	37	c.6088	CCDS41551.1	10	.	.	.	.	.	.	.	.	.	.	C	16.44	3.124862	0.56613	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.74	4.84	4.84	0.62591	.	0.157759	0.56097	D	0.000026	D	0.85159	0.5633	M	0.80847	2.515	0.45477	D	0.998449	B;B	0.32338	0.185;0.365	B;B	0.34242	0.178;0.132	D	0.86139	0.1580	10	0.56958	D	0.05	-9.1626	18.1426	0.89644	0.0:1.0:0.0:0.0	.	2017;2030	Q9NZM1-6;Q9NZM1	.;MYOF_HUMAN	S	2017;2030;2030;2020	ENSP00000351094:G2017S;ENSP00000352208:G2030S;ENSP00000360556:G2030S;ENSP00000360557:G2020S	ENSP00000351094:G2017S	G	-	1	0	MYOF	95059826	0.040000	0.19996	0.993000	0.49108	0.621000	0.37620	1.993000	0.40747	2.485000	0.83878	0.561000	0.74099	GGC	MYOF	-	NULL	ENSG00000138119		0.542	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2	35	0.00	0	C	NM_013451		95069836	95069836	-1	no_errors	ENST00000359263	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	0.825	T
NAV3	89795	genome.wustl.edu	37	12	78530992	78530992	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr12:78530992G>C	ENST00000397909.2	+	19	4650	c.4477G>C	c.(4477-4479)Ggg>Cgg	p.G1493R	NAV3_ENST00000266692.7_Missense_Mutation_p.G1316R|NAV3_ENST00000228327.6_Missense_Mutation_p.G1493R|NAV3_ENST00000536525.2_Missense_Mutation_p.G1493R			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1493	Ser-rich.					membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						TAACCTTCCCGGGCCCAGCAT	0.463										HNSCC(70;0.22)																												dbGAP											0													104.0	104.0	104.0					12																	78530992		1882	4113	5995	-	-	-	SO:0001583	missense	0			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4477G>C	12.37:g.78530992G>C	ENSP00000381007:p.Gly1493Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.G1493R	ENST00000397909.2	37	c.4477		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.20|15.20	2.763992|2.763992	0.49574|0.49574	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788|ENST00000552895	T;T;T;T;T|.	0.29397|.	1.61;1.63;1.63;1.57;2.45|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.183165|.	0.25686|.	U|.	0.028980|.	T|T	0.65396|0.65396	0.2687|0.2687	L|L	0.34521|0.34521	1.04|1.04	0.80722|0.80722	D|D	1|1	P;B;P;B|.	0.41910|.	0.466;0.021;0.764;0.001|.	P;B;P;B|.	0.46796|.	0.527;0.027;0.458;0.004|.	T|T	0.59091|0.59091	-0.7519|-0.7519	10|5	0.42905|.	T|.	0.14|.	-7.9797|-7.9797	19.9607|19.9607	0.97248|0.97248	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1493;1316;1493;1493|.	E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2|.	.;.;NAV3_HUMAN;.|.	R|P	1493;1493;1493;1316;114;122|387	ENSP00000446132:G1493R;ENSP00000381007:G1493R;ENSP00000228327:G1493R;ENSP00000266692:G1316R;ENSP00000448303:G122R|.	ENSP00000228327:G1493R|.	G|R	+|+	1|2	0|0	NAV3|NAV3	77055123|77055123	1.000000|1.000000	0.71417|0.71417	0.990000|0.990000	0.47175|0.47175	0.537000|0.537000	0.34900|0.34900	5.437000|5.437000	0.66544|0.66544	2.713000|2.713000	0.92767|0.92767	0.585000|0.585000	0.79938|0.79938	GGG|CGG	NAV3	-	NULL	ENSG00000067798		0.463	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	89	0.00	0	G	NM_001024383		78530992	78530992	+1	no_errors	ENST00000397909	ensembl	human	known	69_37n	missense	51	27.14	19	SNP	1.000	C
NFKBIZ	64332	genome.wustl.edu	37	3	101572147	101572148	+	Frame_Shift_Ins	INS	-	-	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr3:101572147_101572148insG	ENST00000326172.5	+	5	892_893	c.777_778insG	c.(778-780)gggfs	p.G260fs	NFKBIZ_ENST00000394054.2_Frame_Shift_Ins_p.G160fs|NFKBIZ_ENST00000326151.5_Intron	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	260					inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						ACTTCCATGGAGGGCAGGTCTT	0.545																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.780dupG	3.37:g.101572150_101572150dupG	ENSP00000325663:p.Gly260fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.Q260fs	ENST00000326172.5	37	c.777_778	CCDS2946.1	3																																																																																			NFKBIZ	-	NULL	ENSG00000144802		0.545	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	41	0.00	0	-	NM_031419		101572147	101572148	+1	no_errors	ENST00000326172	ensembl	human	known	69_37n	frame_shift_ins	20	60.00	30	INS	0.906:0.909	G
NFKBIZ	64332	genome.wustl.edu	37	3	101573907	101573907	+	Splice_Site	SNP	G	G	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr3:101573907G>T	ENST00000326172.5	+	7	1560	c.1445G>T	c.(1444-1446)aGt>aTt	p.S482I	NFKBIZ_ENST00000394054.2_Splice_Site_p.S382I|NFKBIZ_ENST00000326151.5_Splice_Site_p.S360I	NM_031419.3	NP_113607.1	Q9BYH8	IKBZ_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta	482	Interaction with NFKB1/p50. {ECO:0000250}.				inflammatory response (GO:0006954)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24						TATCCACAGAGTGCCTTTCAG	0.438																																						dbGAP											0													65.0	66.0	66.0					3																	101573907		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF548362	CCDS2946.1, CCDS43123.1	3p12-q12	2013-01-10			ENSG00000144802	ENSG00000144802		"""Ankyrin repeat domain containing"""	29805	protein-coding gene	gene with protein product	"""IL-1 inducible nuclear ankyrin-repeat protein"""	608004				12565889, 16513645	Standard	NM_031419		Approved	MAIL, FLJ34463, INAP	uc003dvp.3	Q9BYH8	OTTHUMG00000159194	ENST00000326172.5:c.1444-1G>T	3.37:g.101573907G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNR2|D3DN54|Q8IUL4|Q8NAZ8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S482I	ENST00000326172.5	37	c.1445	CCDS2946.1	3	.	.	.	.	.	.	.	.	.	.	G	19.88	3.910007	0.72983	.	.	ENSG00000144802	ENST00000483180;ENST00000394054;ENST00000326151;ENST00000326172	T;T;T;T	0.39406	1.08;1.08;1.08;1.08	5.58	5.58	0.84498	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.62962	0.2471	L	0.55743	1.74	0.58432	D	0.999996	D;D	0.89917	0.999;1.0	D;D	0.85130	0.968;0.997	T	0.62196	-0.6905	10	0.62326	D	0.03	-14.1009	19.922	0.97089	0.0:0.0:1.0:0.0	.	360;482	Q9BYH8-3;Q9BYH8	.;IKBZ_HUMAN	I	382;382;360;482	ENSP00000419800:S382I;ENSP00000377618:S382I;ENSP00000325593:S360I;ENSP00000325663:S482I	ENSP00000325593:S360I	S	+	2	0	NFKBIZ	103056597	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.989000	0.70587	2.780000	0.95670	0.655000	0.94253	AGT	NFKBIZ	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000144802		0.438	NFKBIZ-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NFKBIZ	HGNC	protein_coding	OTTHUMT00000353793.1	20	0.00	0	G	NM_031419	Missense_Mutation	101573907	101573907	+1	no_errors	ENST00000326172	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	T
NID2	22795	genome.wustl.edu	37	14	52493941	52493941	+	Silent	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr14:52493941G>A	ENST00000216286.5	-	12	2651	c.2652C>T	c.(2650-2652)gcC>gcT	p.A884A	NID2_ENST00000541773.1_Intron	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	884	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)	p.A884A(1)		NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					GCCCATCGCCGGCATAACCAG	0.587																																						dbGAP											1	Substitution - coding silent(1)	pancreas(1)											37.0	33.0	34.0					14																	52493941		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.2652C>T	14.37:g.52493941G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6I7|B4DU19|O43710	Silent	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd,superfamily_Green_fluorescent_prot-like,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.A884	ENST00000216286.5	37	c.2652	CCDS9706.1	14																																																																																			NID2	-	smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000087303		0.587	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID2	HGNC	protein_coding	OTTHUMT00000276888.1	16	0.00	0	G			52493941	52493941	-1	no_errors	ENST00000216286	ensembl	human	known	69_37n	silent	8	33.33	4	SNP	0.000	A
NLRP4	147945	genome.wustl.edu	37	19	56372911	56372911	+	Silent	SNP	T	T	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:56372911T>G	ENST00000301295.6	+	4	2438	c.2016T>G	c.(2014-2016)ctT>ctG	p.L672L	NLRP4_ENST00000346986.5_Silent_p.L672L|NLRP4_ENST00000587891.1_Silent_p.L597L	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	672					inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		TTCAGAAGCTTGGGTGAGTTG	0.527																																						dbGAP											0													100.0	90.0	93.0					19																	56372911		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.2016T>G	19.37:g.56372911T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W87|Q96AY6	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L238W	ENST00000301295.6	37	c.713	CCDS12936.1	19																																																																																			NLRP4	-	NULL	ENSG00000160505		0.527	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	19	0.00	0	T	NM_134444		56372911	56372911	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000589437	ensembl	human	novel	69_37n	missense	20	37.50	12	SNP	0.000	G
NOP56	10528	genome.wustl.edu	37	20	2636061	2636061	+	Silent	SNP	A	A	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr20:2636061A>G	ENST00000329276.5	+	6	1176	c.660A>G	c.(658-660)cgA>cgG	p.R220R	SNORA51_ENST00000606420.1_RNA|MIR1292_ENST00000408135.1_RNA|SNORD57_ENST00000448188.1_RNA|SNORD56_ENST00000413522.1_RNA|SNORD110_ENST00000408189.1_RNA|SNORD86_ENST00000391196.1_RNA|IDH3B_ENST00000488299.1_5'Flank	NM_006392.3	NP_006383.2	O00567	NOP56_HUMAN	NOP56 ribonucleoprotein	220					cell death (GO:0008219)|rRNA processing (GO:0006364)	box C/D snoRNP complex (GO:0031428)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|snoRNA binding (GO:0030515)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25						TTGGAAACCGAAGGGAACTGA	0.532																																						dbGAP											0													128.0	122.0	124.0					20																	2636061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y12065	CCDS13030.1	20p13	2012-12-10	2012-12-10	2009-01-13	ENSG00000101361	ENSG00000101361			15911	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 36"""	614154	"""nucleolar protein 5A (56kD with KKE/D repeat)"", ""nucleolar protein 5A (56kDa with KKE/D repeat)"", ""NOP56 ribonucleoprotein homolog (yeast)"""	NOL5A		9372940, 21683323	Standard	NR_027700		Approved	SCA36	uc002wgh.3	O00567	OTTHUMG00000031703	ENST00000329276.5:c.660A>G	20.37:g.2636061A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3T6|Q9NQ05	Silent	SNP	pfam_SnoRNA-bd_dom,pfam_NOSIC,pfam_NOP5_N,smart_NOSIC	p.R220	ENST00000329276.5	37	c.660	CCDS13030.1	20																																																																																			NOP56	-	NULL	ENSG00000101361		0.532	NOP56-009	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP56	HGNC	protein_coding	OTTHUMT00000077631.2	50	0.00	0	A	NM_006392		2636061	2636061	+1	no_errors	ENST00000329276	ensembl	human	known	69_37n	silent	32	21.95	9	SNP	0.423	G
NRG3	10718	genome.wustl.edu	37	10	84711230	84711232	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr10:84711230_84711232delGAA	ENST00000404547.1	+	5	1060_1062	c.1060_1062delGAA	c.(1060-1062)gaadel	p.E355del	NRG3_ENST00000372141.2_In_Frame_Del_p.E355del|NRG3_ENST00000404576.2_In_Frame_Del_p.E159del|NRG3_ENST00000537893.1_In_Frame_Del_p.E5del|NRG3_ENST00000372142.2_In_Frame_Del_p.E134del|NRG3_ENST00000545131.1_In_Frame_Del_p.E5del|NRG3_ENST00000556918.1_In_Frame_Del_p.E185del			P56975	NRG3_HUMAN	neuregulin 3	355					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		CACAGAGAGTGAAGAAGTTTATC	0.404																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.1060_1062delGAA	10.37:g.84711233_84711235delGAA	ENSP00000384796:p.Glu355del	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D7U1|Q0PEH2|Q5VYH3	In_Frame_Del	DEL	pfscan_EG-like_dom	p.E355in_frame_del	ENST00000404547.1	37	c.1060_1062	CCDS31233.1	10																																																																																			NRG3	-	NULL	ENSG00000185737		0.404	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1	61	0.00	0	GAA	XM_166086		84711230	84711232	+1	no_errors	ENST00000404547	ensembl	human	known	69_37n	in_frame_del	51	13.56	8	DEL	1.000:1.000:1.000	-
OAS2	4939	genome.wustl.edu	37	12	113435403	113435403	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr12:113435403G>T	ENST00000342315.4	+	4	920	c.706G>T	c.(706-708)Ggg>Tgg	p.G236W	RP1-71H24.1_ENST00000552784.1_RNA|OAS2_ENST00000392583.2_Missense_Mutation_p.G236W	NM_016817.2	NP_058197.2	P29728	OAS2_HUMAN	2'-5'-oligoadenylate synthetase 2, 69/71kDa	236	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|nucleobase-containing compound metabolic process (GO:0006139)|protein glycosylation (GO:0006486)|protein myristoylation (GO:0018377)|purine nucleotide biosynthetic process (GO:0006164)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28						CTGGGAACAGGGGTGCAGAAA	0.488																																					Pancreas(199;709 2232 18410 33584 35052)	dbGAP											0													131.0	116.0	121.0					12																	113435403		2203	4300	6503	-	-	-	SO:0001583	missense	0			M87284	CCDS31906.1, CCDS41839.1, CCDS44982.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111335			8087	protein-coding gene	gene with protein product		603350	"""2'-5'-oligoadenylate synthetase 2 (69-71 kD)"""			9790745	Standard	NM_002535		Approved		uc001tuj.3	P29728	OTTHUMG00000169802	ENST00000342315.4:c.706G>T	12.37:g.113435403G>T	ENSP00000342278:p.Gly236Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9T1|Q6PJ33|Q86XX8	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.G236W	ENST00000342315.4	37	c.706	CCDS31906.1	12	.	.	.	.	.	.	.	.	.	.	G	14.07	2.424679	0.43020	.	.	ENSG00000111335	ENST00000342315;ENST00000392583;ENST00000552756	T;T;T	0.54071	0.59;0.59;0.59	4.06	4.06	0.47325	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	0.000000	0.37136	U	0.002231	T	0.76047	0.3933	M	0.91249	3.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.81378	-0.0960	10	0.87932	D	0	-3.8235	11.9132	0.52751	0.0:0.0:1.0:0.0	.	236;236	P29728;P29728-2	OAS2_HUMAN;.	W	236;236;161	ENSP00000342278:G236W;ENSP00000376362:G236W;ENSP00000446977:G161W	ENSP00000342278:G236W	G	+	1	0	OAS2	111919786	1.000000	0.71417	0.991000	0.47740	0.150000	0.21749	3.491000	0.53252	2.247000	0.74100	0.460000	0.39030	GGG	OAS2	-	pfam_2-5-oligoAdlate_synth_1_dom2/C	ENSG00000111335		0.488	OAS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OAS2	HGNC	protein_coding	OTTHUMT00000405937.1	42	0.00	0	G			113435403	113435403	+1	no_errors	ENST00000342315	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	0.909	T
OC90	729330	genome.wustl.edu	37	8	133058114	133058114	+	Silent	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr8:133058114G>A	ENST00000443356.2	-	3	149	c.63C>T	c.(61-63)gaC>gaT	p.D21D	OC90_ENST00000262283.5_Silent_p.D217D|OC90_ENST00000603859.1_Silent_p.D21D|OC90_ENST00000254627.3_Silent_p.D21D			Q02509	OC90_HUMAN	otoconin 90	21					lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(23)|ovary(2)|prostate(1)|skin(1)	37	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)			GATGTGGAGTGTCCAGAGGAT	0.458																																						dbGAP											0													157.0	144.0	148.0					8																	133058114		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			Z14310	CCDS47919.1	8q24.22	2011-03-01			ENSG00000253117	ENSG00000253117			8100	protein-coding gene	gene with protein product		601658		PLA2L		10329003, 9860971	Standard	NM_001080399		Approved		uc011lix.1	Q02509	OTTHUMG00000164672	ENST00000443356.2:c.63C>T	8.37:g.133058114G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNG8	Silent	SNP	pfam_PLipase_A2_euk,superfamily_PLipase_A2,smart_PLipase_A2,prints_PLipase_A2_euk	p.D21	ENST00000443356.2	37	c.63		8																																																																																			OC90	-	NULL	ENSG00000253117		0.458	OC90-201	KNOWN	basic	protein_coding	OC90	HGNC	protein_coding		88	0.00	0	G	NM_001080399		133058114	133058114	-1	no_errors	ENST00000443356	ensembl	human	known	69_37n	silent	50	26.47	18	SNP	1.000	A
OR2AT4	341152	genome.wustl.edu	37	11	74800231	74800231	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr11:74800231delA	ENST00000305159.3	-	1	568	c.528delT	c.(526-528)attfs	p.I176fs		NM_001005285.1	NP_001005285.1	A6NND4	O2AT4_HUMAN	olfactory receptor, family 2, subfamily AT, member 4	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(2)	12						AGATGTAGGCAATGCTGTTAT	0.577																																						dbGAP											0													96.0	85.0	89.0					11																	74800231		2200	4293	6493	-	-	-	SO:0001589	frameshift_variant	0			BK004820	CCDS31639.1	11q13.4	2012-08-09			ENSG00000171561	ENSG00000171561		"""GPCR / Class A : Olfactory receptors"""	19620	protein-coding gene	gene with protein product							Standard	NM_001005285		Approved		uc010rro.2	A6NND4	OTTHUMG00000165370	ENST00000305159.3:c.528delT	11.37:g.74800231delA	ENSP00000304846:p.Ile176fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGZ8	Frame_Shift_Del	DEL	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt	p.I176fs	ENST00000305159.3	37	c.528	CCDS31639.1	11																																																																																			OR2AT4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171561		0.577	OR2AT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AT4	HGNC	protein_coding	OTTHUMT00000383734.1	44	0.00	0	A	NM_001005285		74800231	74800231	-1	no_errors	ENST00000305159	ensembl	human	known	69_37n	frame_shift_del	59	16.67	12	DEL	0.000	-
OR4A5	81318	genome.wustl.edu	37	11	51412084	51412084	+	Silent	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr11:51412084G>A	ENST00000319760.6	-	1	364	c.312C>T	c.(310-312)ttC>ttT	p.F104F		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				CCCCACCAAAGAAATGGTCTA	0.448																																						dbGAP											0													66.0	67.0	67.0					11																	51412084		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.312C>T	11.37:g.51412084G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF84	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F104	ENST00000319760.6	37	c.312	CCDS31497.1	11																																																																																			OR4A5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000221840		0.448	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	43	0.00	0	G	NM_001005272		51412084	51412084	-1	no_errors	ENST00000319760	ensembl	human	known	69_37n	silent	28	28.21	11	SNP	0.000	A
OSR2	116039	genome.wustl.edu	37	8	99961516	99961516	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr8:99961516C>G	ENST00000297565.4	+	2	832	c.336C>G	c.(334-336)gaC>gaG	p.D112E	OSR2_ENST00000523368.1_Missense_Mutation_p.D112E|OSR2_ENST00000435298.2_Missense_Mutation_p.D112E|OSR2_ENST00000457907.2_Missense_Mutation_p.D233E|OSR2_ENST00000522510.1_Missense_Mutation_p.D112E	NM_001142462.1	NP_001135934.1	Q8N2R0	OSR2_HUMAN	odd-skipped related transciption factor 2	112					bone morphogenesis (GO:0060349)|cell differentiation (GO:0030154)|chondrocyte differentiation (GO:0002062)|embryo development (GO:0009790)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal joint development (GO:0072498)|embryonic skeletal joint morphogenesis (GO:0060272)|embryonic skeletal limb joint morphogenesis (GO:0036023)|embryonic skeletal system morphogenesis (GO:0048704)|eyelid development in camera-type eye (GO:0061029)|head development (GO:0060322)|mesonephros development (GO:0001823)|metanephros development (GO:0001656)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis (GO:0042476)|osteoblast proliferation (GO:0033687)|palate development (GO:0060021)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of gastrulation (GO:2000543)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephros development (GO:0048793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Breast(36;4.14e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.0136)			TGCACAAGGACCGGCCCCGTT	0.637																																						dbGAP											0													84.0	94.0	90.0					8																	99961516		1946	4140	6086	-	-	-	SO:0001583	missense	0			AY038072	CCDS47901.1, CCDS47902.1, CCDS69520.1	8q22.2	2013-10-17	2013-10-17			ENSG00000164920		"""Zinc fingers, C2H2-type"""	15830	protein-coding gene	gene with protein product		611297	"""odd-skipped related 2 (Drosophila)"""				Standard	XM_005250779		Approved	FLJ90037	uc003yir.3	Q8N2R0		ENST00000297565.4:c.336C>G	8.37:g.99961516C>G	ENSP00000297565:p.Asp112Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K626|B4E3B7|Q96AM6|Q96LB6|Q96LB7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D233E	ENST00000297565.4	37	c.699	CCDS47901.1	8	.	.	.	.	.	.	.	.	.	.	C	13.11	2.138713	0.37728	.	.	ENSG00000164920	ENST00000523368;ENST00000297565;ENST00000435298;ENST00000522510;ENST00000457907;ENST00000520951;ENST00000518199	T;T;T;T;T;T;T	0.07567	3.29;3.27;3.5;3.27;3.18;3.4;3.54	4.82	3.01	0.34805	.	0.097874	0.64402	D	0.000002	T	0.05318	0.0141	N	0.21448	0.665	0.46586	D	0.999112	B;B;B;B	0.20164	0.042;0.001;0.002;0.0	B;B;B;B	0.15484	0.013;0.002;0.002;0.001	T	0.40627	-0.9553	9	.	.	.	-19.3999	8.6278	0.33899	0.0:0.6695:0.1829:0.1476	.	233;112;112;112	B4E3B7;E5RH04;Q8N2R0;Q8N2R0-2	.;.;OSR2_HUMAN;.	E	112;112;112;112;233;165;112	ENSP00000430041:D112E;ENSP00000297565:D112E;ENSP00000402862:D112E;ENSP00000430780:D112E;ENSP00000414657:D233E;ENSP00000430074:D165E;ENSP00000429910:D112E	.	D	+	3	2	OSR2	100030692	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.637000	0.37155	0.718000	0.32166	0.655000	0.94253	GAC	OSR2	-	NULL	ENSG00000164920		0.637	OSR2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	OSR2	HGNC	protein_coding	OTTHUMT00000379505.1	28	0.00	0	C	NM_053001		99961516	99961516	+1	no_errors	ENST00000457907	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	1.000	G
PANX3	116337	genome.wustl.edu	37	11	124481538	124481538	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr11:124481538G>A	ENST00000284288.2	+	1	153	c.86G>A	c.(85-87)cGt>cAt	p.R29H		NM_052959.2	NP_443191.1	Q96QZ0	PANX3_HUMAN	pannexin 3	29					cell-cell signaling (GO:0007267)|ion transport (GO:0006811)|protein hexamerization (GO:0034214)|transmembrane transport (GO:0055085)	gap junction (GO:0005921)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gap junction hemi-channel activity (GO:0055077)			NS(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|urinary_tract(1)	26	all_hematologic(175;0.215)	Breast(109;0.00109)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0219)		AAAGGACTGCGTCTGGAACTG	0.587																																						dbGAP											0													88.0	88.0	88.0					11																	124481538		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF406650	CCDS8447.1	11q24.2	2011-12-02			ENSG00000154143	ENSG00000154143		"""Ion channels / Pannexins"""	20573	protein-coding gene	gene with protein product		608422					Standard	NM_052959		Approved	Px3	uc001qah.3	Q96QZ0	OTTHUMG00000165925	ENST00000284288.2:c.86G>A	11.37:g.124481538G>A	ENSP00000284288:p.Arg29His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Innexin,pfscan_Innexin	p.R29H	ENST00000284288.2	37	c.86	CCDS8447.1	11	.	.	.	.	.	.	.	.	.	.	G	13.92	2.382219	0.42207	.	.	ENSG00000154143	ENST00000284288	T	0.49139	0.79	4.78	-0.582	0.11709	.	0.287715	0.39274	N	0.001408	T	0.37348	0.1000	L	0.52573	1.65	0.32345	N	0.55928	B	0.09022	0.002	B	0.08055	0.003	T	0.38993	-0.9635	10	0.56958	D	0.05	-8.2962	9.4936	0.38976	0.3799:0.0:0.6201:0.0	.	29	Q96QZ0	PANX3_HUMAN	H	29	ENSP00000284288:R29H	ENSP00000284288:R29H	R	+	2	0	PANX3	123986748	0.997000	0.39634	0.941000	0.38009	0.884000	0.51177	1.822000	0.39052	-0.027000	0.13873	-0.119000	0.15052	CGT	PANX3	-	pfscan_Innexin	ENSG00000154143		0.587	PANX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANX3	HGNC	protein_coding	OTTHUMT00000387064.1	47	0.00	0	G			124481538	124481538	+1	no_errors	ENST00000284288	ensembl	human	known	69_37n	missense	8	72.41	21	SNP	0.966	A
PCDHAC1	56135	genome.wustl.edu	37	5	140307514	140307514	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr5:140307514C>T	ENST00000253807.2	+	1	1037	c.1037C>T	c.(1036-1038)tCg>tTg	p.S346L	PCDHA13_ENST00000289272.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.S346L|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA7_ENST00000525929.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	346					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGACTCTTTCGAACCCAGTA	0.517																																						dbGAP											0													142.0	133.0	136.0					5																	140307514		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1037C>T	5.37:g.140307514C>T	ENSP00000253807:p.Ser346Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S346L	ENST00000253807.2	37	c.1037	CCDS4241.1	5	.	.	.	.	.	.	.	.	.	.	C	0.019	-1.455577	0.01071	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.02085	4.46;4.46	5.91	-0.253	0.12996	Cadherin-like (1);	.	.	.	.	T	0.03220	0.0094	M	0.77712	2.385	0.09310	N	1	B;B	0.23442	0.085;0.021	B;B	0.22880	0.042;0.008	T	0.47736	-0.9094	9	0.14656	T	0.56	.	5.7647	0.18219	0.1055:0.6192:0.0965:0.1788	.	346;346	Q9H158;Q9H158-2	PCDC1_HUMAN;.	L	346	ENSP00000386356:S346L;ENSP00000253807:S346L	ENSP00000253807:S346L	S	+	2	0	PCDHAC1	140287698	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.144000	0.10280	-0.371000	0.08004	-1.569000	0.00873	TCG	PCDHAC1	-	superfamily_Cadherin-like	ENSG00000248383		0.517	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	38	0.00	0	C	NM_018898		140307514	140307514	+1	no_errors	ENST00000253807	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	0.001	T
PDE11A	50940	genome.wustl.edu	37	2	178681608	178681608	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr2:178681608A>G	ENST00000286063.6	-	9	2002	c.1685T>C	c.(1684-1686)aTt>aCt	p.I562T	PDE11A_ENST00000449286.2_Missense_Mutation_p.I204T|PDE11A_ENST00000358450.4_Missense_Mutation_p.I312T|PDE11A_ENST00000389683.3_Missense_Mutation_p.I118T|PDE11A_ENST00000497003.1_5'UTR|PDE11A_ENST00000409504.1_Missense_Mutation_p.I204T	NM_016953.3	NP_058649.3	Q9HCR9	PDE11_HUMAN	phosphodiesterase 11A	562					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|signal transduction (GO:0007165)	cytosol (GO:0005829)|perikaryon (GO:0043204)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(3)	58			OV - Ovarian serous cystadenocarcinoma(117;0.00121)|Epithelial(96;0.00455)|all cancers(119;0.02)		Caffeine(DB00201)|Tadalafil(DB00820)	ATCATACATAATTGTGTTGTT	0.388									Primary Pigmented Nodular Adrenocortical Disease, Familial																													dbGAP											0													135.0	124.0	128.0					2																	178681608		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	iPPNAD, PPNAD1, incl. familial micronodular adrenocortical hyperplasia, PPNAD2	AJ251509	CCDS33334.1, CCDS42785.1, CCDS42786.1, CCDS46459.1	2q31.3	2010-06-22			ENSG00000128655	ENSG00000128655	3.1.4.17	"""Phosphodiesterases"""	8773	protein-coding gene	gene with protein product		604961				10725373	Standard	NM_001077196		Approved		uc002ulq.3	Q9HCR9	OTTHUMG00000154188	ENST00000286063.6:c.1685T>C	2.37:g.178681608A>G	ENSP00000286063:p.Ile562Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CD1|Q53T16|Q96S76|Q9GZY7|Q9HB46|Q9NY45	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.I562T	ENST00000286063.6	37	c.1685	CCDS33334.1	2	.	.	.	.	.	.	.	.	.	.	A	16.59	3.165471	0.57476	.	.	ENSG00000128655	ENST00000286063;ENST00000358450;ENST00000409504;ENST00000389683;ENST00000449286	T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4	5.8	5.8	0.92144	GAF (1);	0.042293	0.85682	D	0.000000	T	0.65059	0.2655	L	0.36672	1.1	0.80722	D	1	P;P	0.52842	0.804;0.956	P;P	0.50754	0.568;0.649	T	0.61272	-0.7096	10	0.21540	T	0.41	.	15.1422	0.72620	1.0:0.0:0.0:0.0	.	312;562	Q9HCR9-2;Q9HCR9	.;PDE11_HUMAN	T	562;312;204;118;204	ENSP00000286063:I562T;ENSP00000351232:I312T;ENSP00000386539:I204T;ENSP00000374333:I118T;ENSP00000390599:I204T	ENSP00000286063:I562T	I	-	2	0	PDE11A	178389854	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.904000	0.92590	2.216000	0.71823	0.533000	0.62120	ATT	PDE11A	-	smart_GAF	ENSG00000128655		0.388	PDE11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE11A	HGNC	protein_coding	OTTHUMT00000334313.2	49	0.00	0	A			178681608	178681608	-1	no_errors	ENST00000286063	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	1.000	G
PDYN	5173	genome.wustl.edu	37	20	1961172	1961172	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr20:1961172C>G	ENST00000217305.2	-	4	787	c.562G>C	c.(562-564)Gag>Cag	p.E188Q	PDYN_ENST00000540134.1_Missense_Mutation_p.E188Q|RP4-684O24.5_ENST00000446562.1_RNA|PDYN_ENST00000539905.1_Missense_Mutation_p.E188Q	NM_001190892.1|NM_001190898.2|NM_024411.4	NP_001177821.1|NP_001177827.1|NP_077722.1	P01213	PDYN_HUMAN	prodynorphin	188					cell death (GO:0008219)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				endometrium(3)|kidney(1)|large_intestine(5)|lung(22)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCAGCCACCTCTGAGCTCCTC	0.592																																						dbGAP											0													88.0	97.0	94.0					20																	1961172		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13023.1	20p13	2014-09-17			ENSG00000101327	ENSG00000101327		"""Endogenous ligands"""	8820	protein-coding gene	gene with protein product	"""preproenkephalin B"", ""rimorphin"", ""beta-neoendorphin"", ""dynorphin"", ""leu-enkephalin"", ""leumorphin"", ""neoendorphin-dynorphin-enkephalin prepropeptide"""	131340	"""spinocerebellar ataxia 23"""	SCA23		21035104	Standard	NM_001190892		Approved	PENKB, ADCA	uc021vzs.1	P01213	OTTHUMG00000031683	ENST00000217305.2:c.562G>C	20.37:g.1961172C>G	ENSP00000217305:p.Glu188Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Q3	Missense_Mutation	SNP	pfam_Opioid_neupept,prints_Proenkphlin_B,prints_Opioid_neupept	p.E188Q	ENST00000217305.2	37	c.562	CCDS13023.1	20	.	.	.	.	.	.	.	.	.	.	C	19.45	3.829948	0.71258	.	.	ENSG00000101327	ENST00000539905;ENST00000540134;ENST00000217305	D;D;D	0.82167	-1.58;-1.58;-1.58	4.7	4.7	0.59300	.	0.272984	0.36972	N	0.002313	D	0.87026	0.6075	L	0.54908	1.71	0.32749	N	0.506705	D	0.71674	0.998	P	0.62184	0.899	D	0.87970	0.2736	10	0.33141	T	0.24	-28.0899	15.1657	0.72821	0.0:1.0:0.0:0.0	.	188	P01213	PDYN_HUMAN	Q	188	ENSP00000440185:E188Q;ENSP00000442259:E188Q;ENSP00000217305:E188Q	ENSP00000217305:E188Q	E	-	1	0	PDYN	1909172	0.752000	0.28338	0.999000	0.59377	0.842000	0.47809	1.716000	0.37981	2.445000	0.82738	0.313000	0.20887	GAG	PDYN	-	NULL	ENSG00000101327		0.592	PDYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDYN	HGNC	protein_coding	OTTHUMT00000077569.2	50	0.00	0	C			1961172	1961172	-1	no_errors	ENST00000217305	ensembl	human	known	69_37n	missense	24	40.00	16	SNP	0.998	G
PHF20L1	51105	genome.wustl.edu	37	8	133849986	133849986	+	Silent	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr8:133849986C>T	ENST00000395386.2	+	17	2420	c.2121C>T	c.(2119-2121)agC>agT	p.S707S	PHF20L1_ENST00000220847.7_Silent_p.S94S|AF230666.2_ENST00000429151.1_RNA|PHF20L1_ENST00000395390.2_Silent_p.S682S|AF230666.2_ENST00000608375.1_RNA	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	707							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			GGCAACACAGCGTGTGCATGG	0.512																																						dbGAP											0													121.0	123.0	122.0					8																	133849986		2122	4244	6366	-	-	-	SO:0001819	synonymous_variant	0			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2121C>T	8.37:g.133849986C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Silent	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD	p.S94	ENST00000395386.2	37	c.282	CCDS6367.2	8																																																																																			PHF20L1	-	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD	ENSG00000129292		0.512	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PHF20L1	HGNC	protein_coding	OTTHUMT00000308949.3	73	0.00	0	C	NM_016018		133849986	133849986	+1	no_errors	ENST00000220847	ensembl	human	known	69_37n	silent	39	38.10	24	SNP	0.652	T
POLD1	5424	genome.wustl.edu	37	19	50905959	50905959	+	Missense_Mutation	SNP	C	C	T	rs201010746		TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:50905959C>T	ENST00000440232.2	+	8	984	c.931C>T	c.(931-933)Cgc>Tgc	p.R311C	POLD1_ENST00000599857.1_Missense_Mutation_p.R311C|POLD1_ENST00000595904.1_Missense_Mutation_p.R311C	NM_001256849.1|NM_002691.3	NP_001243778.1|NP_002682.2	P28340	DPOD1_HUMAN	polymerase (DNA directed), delta 1, catalytic subunit	311					base-excision repair (GO:0006284)|base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA synthesis involved in DNA repair (GO:0000731)|fatty acid homeostasis (GO:0055089)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)|response to UV (GO:0009411)|small molecule metabolic process (GO:0044281)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|delta DNA polymerase complex (GO:0043625)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(6)|lung(8)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_neural(266;0.0571)		OV - Ovarian serous cystadenocarcinoma(262;0.00794)|GBM - Glioblastoma multiforme(134;0.0195)		TGCGCCCTTGCGCGTGCTCAG	0.667								DNA polymerases (catalytic subunits)					C|||	1	0.000199681	0.0	0.0014	5008	,	,		15948	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													27.0	26.0	26.0					19																	50905959		2202	4297	6499	-	-	-	SO:0001583	missense	0				CCDS12795.1	19q13.3	2014-09-17	2012-05-18		ENSG00000062822	ENSG00000062822		"""DNA polymerases"""	9175	protein-coding gene	gene with protein product	"""CDC2 homolog (S. cerevisiae)"""	174761	"""polymerase (DNA directed), delta 1, catalytic subunit (125kD)"""	POLD		1722322	Standard	NM_001256849		Approved	CDC2	uc002psc.5	P28340		ENST00000440232.2:c.931C>T	19.37:g.50905959C>T	ENSP00000406046:p.Arg311Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NER3|Q96H98	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.R311C	ENST00000440232.2	37	c.931	CCDS12795.1	19	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	16.45	3.126303	0.56721	.	.	ENSG00000062822	ENST00000440232;ENST00000376930	T	0.12879	2.64	4.69	3.57	0.40892	DNA-directed DNA polymerase, family B, exonuclease domain (1);Ribonuclease H-like (1);	0.068072	0.64402	D	0.000019	T	0.44664	0.1304	M	0.92268	3.29	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.73708	0.97;0.981	T	0.58521	-0.7622	10	0.87932	D	0	-11.8143	13.509	0.61499	0.0:0.8419:0.1581:0.0	.	311;311	E7EVW0;P28340	.;DPOD1_HUMAN	C	311;312	ENSP00000406046:R311C	ENSP00000366129:R312C	R	+	1	0	POLD1	55597771	1.000000	0.71417	0.996000	0.52242	0.214000	0.24535	0.934000	0.28910	2.329000	0.79093	0.491000	0.48974	CGC	POLD1	-	pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	ENSG00000062822		0.667	POLD1-002	KNOWN	alternative_5_UTR|NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	POLD1	HGNC	protein_coding	OTTHUMT00000464732.1	14	0.00	0	C			50905959	50905959	+1	no_errors	ENST00000440232	ensembl	human	known	69_37n	missense	3	57.14	4	SNP	1.000	T
PRKD3	23683	genome.wustl.edu	37	2	37501751	37501751	+	Silent	SNP	G	G	T	rs373013004		TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr2:37501751G>T	ENST00000379066.1	-	11	2226	c.1464C>A	c.(1462-1464)atC>atA	p.I488I	PRKD3_ENST00000234179.2_Silent_p.I488I			O94806	KPCD3_HUMAN	protein kinase D3	488	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				TATCAGTAATGATTTCAAAAC	0.408																																					Melanoma(80;621 1355 8613 11814 51767)	dbGAP											0													104.0	94.0	97.0					2																	37501751		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.1464C>A	2.37:g.37501751G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W587|Q53TR7|Q8NEL8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.I488	ENST00000379066.1	37	c.1464	CCDS1789.1	2																																																																																			PRKD3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000115825		0.408	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD3	HGNC	protein_coding	OTTHUMT00000218570.3	29	0.00	0	G	NM_005813		37501751	37501751	-1	no_errors	ENST00000234179	ensembl	human	known	69_37n	silent	11	54.17	13	SNP	1.000	T
RAET1G	353091	genome.wustl.edu	37	6	150239333	150239333	+	Silent	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr6:150239333C>G	ENST00000367360.2	-	4	886	c.819G>C	c.(817-819)ctG>ctC	p.L273L	RAET1E-AS1_ENST00000605899.1_RNA|RP11-244K5.8_ENST00000606915.1_RNA|RAET1E-AS1_ENST00000446954.2_RNA	NM_001001788.2	NP_001001788.2			retinoic acid early transcript 1G											NS(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|urinary_tract(1)	13		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.73e-12)		GGACTCTCCTCAGCAGCCAGG	0.587																																						dbGAP											0													104.0	110.0	108.0					6																	150239333		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY172579	CCDS43514.1	6q24.1-25.1	2009-04-29	2004-11-22		ENSG00000203722	ENSG00000203722			16795	protein-coding gene	gene with protein product		609244	"""retinoic acid early transcript 1G pseudogene"""			11827464, 15240696	Standard	NM_001001788		Approved	ULBP5	uc010kii.1	Q6H3X3	OTTHUMG00000015802	ENST00000367360.2:c.819G>C	6.37:g.150239333C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.L273	ENST00000367360.2	37	c.819	CCDS43514.1	6																																																																																			RAET1G	-	NULL	ENSG00000203722		0.587	RAET1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAET1G	HGNC	protein_coding	OTTHUMT00000042668.2	83	0.00	0	C			150239333	150239333	-1	no_errors	ENST00000367360	ensembl	human	known	69_37n	silent	153	22.61	45	SNP	0.000	G
RAX2	84839	genome.wustl.edu	37	19	3771698	3771698	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:3771698C>T	ENST00000555633.1	-	2	383	c.43G>A	c.(43-45)Ggt>Agt	p.G15S	RAX2_ENST00000555978.1_Missense_Mutation_p.G15S			Q96IS3	RAX2_HUMAN	retina and anterior neural fold homeobox 2	15					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			large_intestine(1)	1		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00463)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCCCCAGACCCCCACCCTCG	0.716																																						dbGAP											0													34.0	32.0	33.0					19																	3771698		2199	4297	6496	-	-	-	SO:0001583	missense	0			AY211277	CCDS12112.1	19p13.3	2013-06-06	2007-08-28	2007-08-28				"""Homeoboxes / PRD class"""	18286	protein-coding gene	gene with protein product		610362	"""retina and anterior neural fold homeobox like 1"""	RAXL1			Standard	NM_032753		Approved	MGC15631, ARMD6, CORD11	uc002lys.3	Q96IS3		ENST00000555633.1:c.43G>A	19.37:g.3771698C>T	ENSP00000450456:p.Gly15Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.G15S	ENST00000555633.1	37	c.43	CCDS12112.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.67|13.67	2.307296|2.307296	0.40795|0.40795	.|.	.|.	ENSG00000173976|ENSG00000173976	ENST00000555978|ENST00000555633;ENST00000395106	.|D	.|0.90732	.|-2.72	3.26|3.26	-3.16|-3.16	0.05217|0.05217	.|.	.|.	.|.	.|.	.|.	T|T	0.73361|0.73361	0.3577|0.3577	N|N	0.04508|0.04508	-0.205|-0.205	0.09310|0.09310	N|N	1|1	.|B;B	.|0.25312	.|0.002;0.123	.|B;B	.|0.16289	.|0.004;0.015	T|T	0.61436|0.61436	-0.7063|-0.7063	5|9	.|0.34782	.|T	.|0.22	.|.	4.9739|4.9739	0.14131|0.14131	0.0:0.3643:0.324:0.3117|0.0:0.3643:0.324:0.3117	.|.	.|15;61	.|Q96IS3;G3V243	.|RAX2_HUMAN;.	E|S	34|61;15	.|ENSP00000450456:G61S	.|ENSP00000378538:G15S	G|G	-|-	2|1	0|0	RAX2|RAX2	3722698|3722698	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.042000|0.042000	0.13812|0.13812	-0.115000|-0.115000	0.10741|0.10741	-0.370000|-0.370000	0.08016|0.08016	-1.579000|-1.579000	0.00862|0.00862	GGG|GGT	RAX2	-	NULL	ENSG00000173976		0.716	RAX2-001	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RAX2	HGNC	protein_coding	OTTHUMT00000411919.2	32	0.00	0	C	NM_032753		3771698	3771698	-1	no_errors	ENST00000555978	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.003	T
RIMS1	22999	genome.wustl.edu	37	6	72889545	72889545	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr6:72889545delC	ENST00000521978.1	+	5	739	c.739delC	c.(739-741)cccfs	p.P247fs	RIMS1_ENST00000520567.1_Frame_Shift_Del_p.P247fs|RIMS1_ENST00000348717.5_Frame_Shift_Del_p.P247fs|RIMS1_ENST00000517960.1_Frame_Shift_Del_p.P247fs|RIMS1_ENST00000518273.1_Frame_Shift_Del_p.P247fs|RIMS1_ENST00000522291.1_Frame_Shift_Del_p.P247fs|RIMS1_ENST00000491071.2_Frame_Shift_Del_p.P247fs|RIMS1_ENST00000264839.7_Frame_Shift_Del_p.P247fs	NM_014989.5	NP_055804.2	Q86UR5	RIMS1_HUMAN	regulating synaptic membrane exocytosis 1	247					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|glutamate secretion (GO:0014047)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|neurotransmitter secretion (GO:0007269)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|protein complex assembly (GO:0006461)|regulated secretory pathway (GO:0045055)|regulation of catalytic activity (GO:0050790)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of neurotransmitter secretion (GO:0046928)|response to stimulus (GO:0050896)|secretion (GO:0046903)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|visual perception (GO:0007601)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)|small GTPase regulator activity (GO:0005083)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(25)|liver(4)|lung(35)|ovary(9)|pancreas(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	102		all_epithelial(107;0.179)|all_hematologic(105;0.212)				AGGGGCTGAGCCCTCGCAGCA	0.577																																						dbGAP											0													36.0	40.0	38.0					6																	72889545		2076	4210	6286	-	-	-	SO:0001589	frameshift_variant	0			AB002338	CCDS47449.1, CCDS55029.1, CCDS55030.1, CCDS55031.1, CCDS55032.1, CCDS55033.1	6q12-q13	2008-10-16	2002-06-12	2002-06-14	ENSG00000079841	ENSG00000079841			17282	protein-coding gene	gene with protein product	"""Rab3-interacting molecule"""	606629	"""RAB3 interacting protein 2"""	RAB3IP2, CORD7		9205841, 11438518	Standard	NM_001168407		Approved	RIM, KIAA0340, RIM1	uc003pga.4	Q86UR5	OTTHUMG00000015009	ENST00000521978.1:c.739delC	6.37:g.72889545delC	ENSP00000428417:p.Pro247fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN6|B7Z2M0|B7Z2Q9|B7Z3S3|B7Z6S2|E7EX08|E9PCB7|E9PCZ1|E9PF48|E9PHF5|E9PHR1|O15048|Q5JY21|Q5JY25|Q5SZK1|Q8TDY9|Q8TDZ5|Q9HBA1|Q9HBA2|Q9HBA3|Q9HBA4|Q9HBA5|Q9HBA6	Frame_Shift_Del	DEL	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.S248fs	ENST00000521978.1	37	c.739	CCDS47449.1	6																																																																																			RIMS1	-	NULL	ENSG00000079841		0.577	RIMS1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS1	HGNC	protein_coding	OTTHUMT00000374968.1	20	0.00	0	C			72889545	72889545	+1	no_errors	ENST00000521978	ensembl	human	known	69_37n	frame_shift_del	5	28.57	2	DEL	0.000	-
SDE2	163859	genome.wustl.edu	37	1	226175683	226175683	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr1:226175683C>G	ENST00000272091.7	-	6	1066	c.1048G>C	c.(1048-1050)Gat>Cat	p.D350H		NM_152608.3	NP_689821.3	Q6IQ49	SDE2_HUMAN	SDE2 telomere maintenance homolog (S. pombe)	350																	CTTTCCCCATCAGTCCTTTCT	0.488																																						dbGAP											0													200.0	191.0	194.0					1																	226175683		1905	4105	6010	-	-	-	SO:0001583	missense	0			BC071563	CCDS41473.1	1q42.12	2012-06-26	2012-06-26	2012-06-26	ENSG00000143751	ENSG00000143751			26643	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 55"""	C1orf55		21333630	Standard	NM_152608		Approved	FLJ35382	uc001hpu.4	Q6IQ49	OTTHUMG00000037504	ENST00000272091.7:c.1048G>C	1.37:g.226175683C>G	ENSP00000272091:p.Asp350His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4P3|Q5TD36|Q6ZS26|Q8NAG7	Missense_Mutation	SNP	superfamily_Mopterin_synth/thiamin_S_b	p.D350H	ENST00000272091.7	37	c.1048	CCDS41473.1	1	.	.	.	.	.	.	.	.	.	.	C	17.89	3.500524	0.64298	.	.	ENSG00000143751	ENST00000272091;ENST00000366818;ENST00000366817	T;T	0.54866	0.65;0.55	5.65	4.72	0.59763	.	0.907619	0.09696	N	0.767756	T	0.52419	0.1733	L	0.54323	1.7	0.09310	N	1	B;B	0.24368	0.102;0.062	B;B	0.24155	0.051;0.023	T	0.49133	-0.8971	10	0.59425	D	0.04	-9.8364	13.832	0.63386	0.0:0.8472:0.1528:0.0	.	338;350	Q6IQ49-2;Q6IQ49	.;CA055_HUMAN	H	350;338;255	ENSP00000272091:D350H;ENSP00000355782:D255H	ENSP00000272091:D350H	D	-	1	0	C1orf55	224242306	0.000000	0.05858	0.100000	0.21137	0.189000	0.23516	0.205000	0.17356	1.347000	0.45714	0.650000	0.86243	GAT	SDE2	-	NULL	ENSG00000143751		0.488	SDE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDE2	HGNC	protein_coding	OTTHUMT00000091310.1	103	0.00	0	C	NM_152608		226175683	226175683	-1	no_errors	ENST00000272091	ensembl	human	known	69_37n	missense	108	24.48	35	SNP	0.042	G
SDK1	221935	genome.wustl.edu	37	7	4153064	4153064	+	Missense_Mutation	SNP	G	G	A	rs376638701		TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr7:4153064G>A	ENST00000404826.2	+	24	3717	c.3578G>A	c.(3577-3579)cGc>cAc	p.R1193H	SDK1_ENST00000389531.3_Missense_Mutation_p.R1193H	NM_152744.3	NP_689957.3	Q7Z5N4	SDK1_HUMAN	sidekick cell adhesion molecule 1	1193	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.R1193L(1)		NS(1)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(42)|lung(55)|ovary(4)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(4)	153		all_cancers(1;0.127)|Ovarian(82;0.0177)|Myeloproliferative disorder(862;0.194)		UCEC - Uterine corpus endometrioid carcinoma (126;0.121)|OV - Ovarian serous cystadenocarcinoma(56;9.65e-15)		CTGCGGCTTCGCTGGGTGGTG	0.637													G|||	1	0.000199681	0.0	0.0	5008	,	,		16115	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	lung(1)											70.0	75.0	73.0					7																	4153064		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074077	CCDS34590.1	7p22.3	2013-02-11	2011-12-09		ENSG00000146555	ENSG00000146555		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19307	protein-coding gene	gene with protein product		607216	"""sidekick homolog 1 (chicken)"", ""sidekick homolog 1, cell adhesion molecule (chicken)"""			12230981, 17307840, 15213259	Standard	NM_001079653		Approved	FLJ31425	uc003smx.3	Q7Z5N4	OTTHUMG00000151733	ENST00000404826.2:c.3578G>A	7.37:g.4153064G>A	ENSP00000385899:p.Arg1193His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEN9|Q8TEP5|Q96N44	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R1193H	ENST00000404826.2	37	c.3578	CCDS34590.1	7	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941637	0.92526	.	.	ENSG00000146555	ENST00000404826;ENST00000389531	T;T	0.58210	0.35;0.35	5.22	5.22	0.72569	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000004	T	0.75474	0.3854	M	0.82630	2.6	0.45899	D	0.99874	D;D	0.89917	1.0;1.0	D;D	0.70016	0.967;0.966	T	0.79792	-0.1654	10	0.87932	D	0	.	18.8007	0.92015	0.0:0.0:1.0:0.0	.	1193;1193	F8W6X9;Q7Z5N4	.;SDK1_HUMAN	H	1193	ENSP00000385899:R1193H;ENSP00000374182:R1193H	ENSP00000374182:R1193H	R	+	2	0	SDK1	4119590	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.485000	0.81204	2.437000	0.82529	0.655000	0.94253	CGC	SDK1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000146555		0.637	SDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK1	HGNC	protein_coding	OTTHUMT00000323702.1	20	0.00	0	G	NM_152744		4153064	4153064	+1	no_errors	ENST00000404826	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	1.000	A
SH3D19	152503	genome.wustl.edu	37	4	152043323	152043323	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr4:152043323C>A	ENST00000409252.2	-	20	3000	c.2293G>T	c.(2293-2295)Gat>Tat	p.D765Y	SH3D19_ENST00000455740.1_Missense_Mutation_p.D742Y|SH3D19_ENST00000304527.4_Missense_Mutation_p.D765Y|SH3D19_ENST00000409598.4_Missense_Mutation_p.D742Y|SH3D19_ENST00000427414.2_Missense_Mutation_p.D706Y|SH3D19_ENST00000424281.1_Missense_Mutation_p.D706Y|SH3D19_ENST00000514152.1_Missense_Mutation_p.D742Y			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	765	SH3 5. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				ATCCAGTCATCATCTACAGAT	0.388																																						dbGAP											0													125.0	121.0	122.0					4																	152043323		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.2293G>T	4.37:g.152043323C>A	ENSP00000386848:p.Asp765Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,prints_p67phox,prints_SH3_domain,pfscan_SH3_domain	p.D765Y	ENST00000409252.2	37	c.2293	CCDS34077.2	4	.	.	.	.	.	.	.	.	.	.	C	14.61	2.585633	0.46110	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.57273	0.41;0.41;0.41;0.41;0.41;0.41;0.41	5.53	4.68	0.58851	Src homology-3 domain (4);	0.886410	0.09692	N	0.768332	T	0.71358	0.3330	M	0.79805	2.47	0.43688	D	0.996137	P;P;P;P	0.52316	0.915;0.941;0.951;0.952	P;P;P;P	0.55999	0.764;0.555;0.789;0.697	T	0.69491	-0.5131	10	0.72032	D	0.01	-4.9536	14.9078	0.70733	0.0:0.7288:0.2711:0.0	.	765;742;706;520	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	Y	742;765;742;706;706;765;742	ENSP00000387030:D742Y;ENSP00000302913:D765Y;ENSP00000416708:D742Y;ENSP00000404542:D706Y;ENSP00000415694:D706Y;ENSP00000386848:D765Y;ENSP00000423449:D742Y	ENSP00000302913:D765Y	D	-	1	0	SH3D19	152262773	1.000000	0.71417	0.992000	0.48379	0.927000	0.56198	2.184000	0.42575	1.310000	0.45006	0.655000	0.94253	GAT	SH3D19	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000109686		0.388	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	SH3D19	HGNC	protein_coding	OTTHUMT00000335132.3	65	0.00	0	C	NM_001009555		152043323	152043323	-1	no_errors	ENST00000304527	ensembl	human	known	69_37n	missense	48	18.64	11	SNP	1.000	A
SLC17A6	57084	genome.wustl.edu	37	11	22397628	22397628	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr11:22397628T>A	ENST00000263160.3	+	10	1712	c.1275T>A	c.(1273-1275)ttT>ttA	p.F425L		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	425					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						TCAGTGGATTTGCTATATCTG	0.378																																						dbGAP											0													141.0	149.0	146.0					11																	22397628		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1275T>A	11.37:g.22397628T>A	ENSP00000263160:p.Phe425Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKS2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.F425L	ENST00000263160.3	37	c.1275	CCDS7856.1	11	.	.	.	.	.	.	.	.	.	.	T	26.1	4.706037	0.89018	.	.	ENSG00000091664	ENST00000263160;ENST00000546171	T	0.57595	0.39	6.17	6.17	0.99709	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.54822	0.1882	L	0.39467	1.215	0.80722	D	1	P	0.34522	0.455	P	0.49477	0.612	T	0.53215	-0.8470	10	0.25751	T	0.34	.	9.7634	0.40545	0.0:0.1321:0.0:0.8679	.	425	Q9P2U8	VGLU2_HUMAN	L	425;313	ENSP00000263160:F425L	ENSP00000263160:F425L	F	+	3	2	SLC17A6	22354204	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.135000	0.31454	2.371000	0.80710	0.533000	0.62120	TTT	SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.378	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	52	0.00	0	T	NM_020346		22397628	22397628	+1	no_errors	ENST00000263160	ensembl	human	known	69_37n	missense	14	51.72	15	SNP	1.000	A
SLC22A7	10864	genome.wustl.edu	37	6	43269378	43269378	+	Silent	SNP	C	C	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr6:43269378C>T	ENST00000372585.5	+	7	1104	c.1009C>T	c.(1009-1011)Ctg>Ttg	p.L337L	SLC22A7_ENST00000372589.3_Silent_p.L335L|SLC22A7_ENST00000487175.1_3'UTR|SLC22A7_ENST00000372574.3_Silent_p.L335L	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	337					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	ATACCTAGACCTGTTCCGCAC	0.602																																						dbGAP											0													90.0	68.0	75.0					6																	43269378		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.1009C>T	6.37:g.43269378C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L337	ENST00000372585.5	37	c.1009	CCDS4893.2	6																																																																																			SLC22A7	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000137204		0.602	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	SLC22A7	HGNC	protein_coding	OTTHUMT00000040588.1	15	0.00	0	C			43269378	43269378	+1	no_errors	ENST00000372585	ensembl	human	known	69_37n	silent	8	52.94	9	SNP	0.999	T
SLC39A6	25800	genome.wustl.edu	37	18	33691125	33691125	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr18:33691125C>A	ENST00000590986.1	-	9	2301	c.2012G>T	c.(2011-2013)gGa>gTa	p.G671V	SLC39A6_ENST00000269187.5_Missense_Mutation_p.G671V|SLC39A6_ENST00000440549.2_Missense_Mutation_p.G396V			Q13433	S39A6_HUMAN	solute carrier family 39 (zinc transporter), member 6	671					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|lamellipodium membrane (GO:0031258)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	41						TGTTGCCATTCCAAGATACGC	0.403																																						dbGAP											0													104.0	94.0	97.0					18																	33691125		1914	4141	6055	-	-	-	SO:0001583	missense	0			U41060	CCDS42428.1, CCDS45854.1	18q12.2	2013-05-22				ENSG00000141424		"""Solute carriers"""	18607	protein-coding gene	gene with protein product		608731	"""solute carrier family 39 (metal ion transporter), member 6"""			12659941, 12839489	Standard	NM_012319		Approved	LIV-1	uc010dmy.3	Q13433		ENST00000590986.1:c.2012G>T	18.37:g.33691125C>A	ENSP00000465915:p.Gly671Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR49|B4E224|Q8IXR3|Q96HP5	Missense_Mutation	SNP	pfam_ZIP	p.G671V	ENST00000590986.1	37	c.2012	CCDS42428.1	18	.	.	.	.	.	.	.	.	.	.	C	28.2	4.898291	0.91962	.	.	ENSG00000141424	ENST00000269187;ENST00000440549	T;T	0.75260	-0.92;-0.92	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.87849	0.6281	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.89255	0.3593	10	0.87932	D	0	-15.7972	17.2434	0.87021	0.0:1.0:0.0:0.0	.	671;396	Q13433;Q13433-2	S39A6_HUMAN;.	V	671;396	ENSP00000269187:G671V;ENSP00000401139:G396V	ENSP00000269187:G671V	G	-	2	0	SLC39A6	31945123	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.685000	0.91497	0.455000	0.32223	GGA	SLC39A6	-	pfam_ZIP	ENSG00000141424		0.403	SLC39A6-004	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	SLC39A6	HGNC	protein_coding	OTTHUMT00000444136.1	43	0.00	0	C			33691125	33691125	-1	no_errors	ENST00000269187	ensembl	human	known	69_37n	missense	105	11.76	14	SNP	1.000	A
SLC5A5	6528	genome.wustl.edu	37	19	18004631	18004631	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:18004631G>T	ENST00000222248.3	+	15	2224	c.1877G>T	c.(1876-1878)tGg>tTg	p.W626L		NM_000453.2	NP_000444.1	Q92911	SC5A5_HUMAN	solute carrier family 5 (sodium/iodide cotransporter), member 5	626					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|iodide transport (GO:0015705)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	iodide transmembrane transporter activity (GO:0015111)|sodium:iodide symporter activity (GO:0008507)			NS(2)|biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|skin(3)	31						GCTGGCTCTTGGACCCCCTGT	0.602																																					Melanoma(65;1008 1708 7910 46650)	dbGAP											0													29.0	28.0	28.0					19																	18004631		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12368.1	19p13.11	2013-07-19	2013-07-19		ENSG00000105641	ENSG00000105641		"""Solute carriers"""	11040	protein-coding gene	gene with protein product		601843	"""solute carrier family 5 (sodium iodide symporter), member 5"""			9231811	Standard	NM_000453		Approved	NIS	uc002nhr.4	Q92911		ENST00000222248.3:c.1877G>T	19.37:g.18004631G>T	ENSP00000222248:p.Trp626Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43702|Q2M335|Q9NYB6	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.W626L	ENST00000222248.3	37	c.1877	CCDS12368.1	19	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464423	0.26335	.	.	ENSG00000105641	ENST00000222248	D	0.85088	-1.94	3.89	1.71	0.24356	.	6.037150	0.00628	N	0.000479	T	0.77725	0.4173	L	0.36672	1.1	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.57573	-0.7788	10	0.10902	T	0.67	.	6.2595	0.20891	0.2385:0.0:0.7615:0.0	.	626	Q92911	SC5A5_HUMAN	L	626	ENSP00000222248:W626L	ENSP00000222248:W626L	W	+	2	0	SLC5A5	17865631	0.000000	0.05858	0.037000	0.18230	0.030000	0.12068	-0.019000	0.12546	0.427000	0.26145	0.485000	0.47835	TGG	SLC5A5	-	NULL	ENSG00000105641		0.602	SLC5A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A5	HGNC	protein_coding	OTTHUMT00000466690.1	42	0.00	0	G			18004631	18004631	+1	no_errors	ENST00000222248	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	0.079	T
SMARCC2	6601	genome.wustl.edu	37	12	56580003	56580003	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr12:56580003T>C	ENST00000267064.4	-	3	339	c.253A>G	c.(253-255)Aaa>Gaa	p.K85E	SMARCC2_ENST00000550164.1_Missense_Mutation_p.K85E|RP11-977G19.5_ENST00000553176.1_RNA|SMARCC2_ENST00000550859.1_5'UTR|SMARCC2_ENST00000394023.3_Missense_Mutation_p.K85E|SMARCC2_ENST00000347471.4_Missense_Mutation_p.K85E	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	85					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			CCTCCCGCTTTGAAATCTAGG	0.373																																						dbGAP											0													93.0	95.0	94.0					12																	56580003		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.253A>G	12.37:g.56580003T>C	ENSP00000267064:p.Lys85Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.K85E	ENST00000267064.4	37	c.253	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	T	27.9	4.869168	0.91587	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T	0.50277	0.79;0.8;0.75	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.57932	0.2087	L	0.34521	1.04	0.51767	D	0.999937	D;D;D;D	0.67145	0.996;0.993;0.993;0.996	D;D;D;D	0.76071	0.987;0.971;0.971;0.987	T	0.61217	-0.7107	10	0.72032	D	0.01	-14.676	14.5309	0.67926	0.0:0.0:0.0:1.0	.	85;90;85;85	F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;SMRC2_HUMAN;.	E	85	ENSP00000449396:K85E;ENSP00000302919:K85E;ENSP00000267064:K85E	ENSP00000267064:K85E	K	-	1	0	SMARCC2	54866270	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.649000	0.83500	2.333000	0.79357	0.533000	0.62120	AAA	SMARCC2	-	NULL	ENSG00000139613		0.373	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	43	0.00	0	T			56580003	56580003	-1	no_errors	ENST00000267064	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	C
SNX25	83891	genome.wustl.edu	37	4	186274707	186274707	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr4:186274707G>T	ENST00000504273.1	+	15	2337	c.2043G>T	c.(2041-2043)ttG>ttT	p.L681F	SNX25_ENST00000264694.8_Missense_Mutation_p.L681F|SNX25_ENST00000512853.1_3'UTR			Q9H3E2	SNX25_HUMAN	sorting nexin 25	681					negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein transport (GO:0015031)|receptor catabolic process (GO:0032801)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	endosome (GO:0005768)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			NS(1)|breast(4)|endometrium(2)|kidney(4)|large_intestine(8)|lung(13)|ovary(2)|pancreas(2)|prostate(2)|urinary_tract(2)	40		all_lung(41;1.03e-13)|Lung NSC(41;2.5e-13)|Hepatocellular(41;0.00826)|Colorectal(36;0.00886)|Renal(120;0.00988)|Prostate(90;0.0235)|all_hematologic(60;0.0592)|all_neural(102;0.243)		all cancers(43;2.13e-24)|Epithelial(43;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.6e-11)|BRCA - Breast invasive adenocarcinoma(30;0.00013)|Colorectal(24;0.000165)|GBM - Glioblastoma multiforme(59;0.000357)|COAD - Colon adenocarcinoma(29;0.000887)|STAD - Stomach adenocarcinoma(60;0.00118)|LUSC - Lung squamous cell carcinoma(40;0.0129)|READ - Rectum adenocarcinoma(43;0.228)		AAGACGCCTTGGCTGAACCAT	0.418																																						dbGAP											0													303.0	285.0	291.0					4																	186274707		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF113223	CCDS34116.1	4q35.1	2011-05-03			ENSG00000109762	ENSG00000109762		"""Sorting nexins"""	21883	protein-coding gene	gene with protein product						12461558	Standard	NM_031953		Approved	SBBI31	uc003ixh.3	Q9H3E2	OTTHUMG00000160475	ENST00000504273.1:c.2043G>T	4.37:g.186274707G>T	ENSP00000426255:p.Leu681Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZT30|Q8N6K3	Missense_Mutation	SNP	pfam_Phox_assoc,pfam_Sorting_nexin_C,pfam_Regulat_G_prot_signal,pfam_Phox,superfamily_Regulat_G_prot_signal_superfam,superfamily_Phox,smart_PX_assoc_Snx13,smart_Regulat_G_prot_signal,smart_Phox,pfscan_Phox,pfscan_Phox_assoc,pfscan_Regulat_G_prot_signal	p.L681F	ENST00000504273.1	37	c.2043	CCDS34116.1	4	.	.	.	.	.	.	.	.	.	.	G	19.11	3.764541	0.69878	.	.	ENSG00000109762	ENST00000504273;ENST00000264694;ENST00000264693	T;T	0.10288	2.89;2.89	5.74	3.98	0.46160	.	0.094593	0.45867	D	0.000337	T	0.11537	0.0281	L	0.44542	1.39	0.48087	D	0.999589	D;P;P	0.56035	0.974;0.905;0.945	P;B;P	0.53224	0.721;0.394;0.647	T	0.38929	-0.9638	10	0.06236	T	0.91	-11.5022	4.6476	0.12579	0.0802:0.1263:0.5981:0.1954	.	397;214;681	Q8N6K3;Q9H5Q8;Q9H3E2	.;.;SNX25_HUMAN	F	681;681;214	ENSP00000426255:L681F;ENSP00000264694:L681F	ENSP00000264693:L214F	L	+	3	2	SNX25	186511701	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.889000	0.39718	0.748000	0.32831	0.585000	0.79938	TTG	SNX25	-	NULL	ENSG00000109762		0.418	SNX25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX25	HGNC	protein_coding	OTTHUMT00000360756.1	100	0.00	0	G	NM_031953		186274707	186274707	+1	no_errors	ENST00000264694	ensembl	human	known	69_37n	missense	73	18.89	17	SNP	1.000	T
SSRP1	6749	genome.wustl.edu	37	11	57093910	57093910	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr11:57093910C>G	ENST00000278412.2	-	17	2367	c.2101G>C	c.(2101-2103)Gag>Cag	p.E701Q	TNKS1BP1_ENST00000358252.3_5'Flank|RP11-872D17.4_ENST00000534162.1_RNA|snoU13_ENST00000459327.1_RNA	NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1	701	Ser-rich.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						GCTGAGTCCTCTGAGCTGGGG	0.542																																					Colon(89;1000 1340 6884 23013 41819)	dbGAP											0													128.0	119.0	122.0					11																	57093910		2201	4296	6497	-	-	-	SO:0001583	missense	0			M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.2101G>C	11.37:g.57093910C>G	ENSP00000278412:p.Glu701Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BJG8	Missense_Mutation	SNP	pfam_SSRP1_dom,pfam_DUF1747,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily,prints_SSrcognition	p.E701Q	ENST00000278412.2	37	c.2101	CCDS7952.1	11	.	.	.	.	.	.	.	.	.	.	C	16.14	3.037629	0.54896	.	.	ENSG00000149136	ENST00000278412	D	0.92752	-3.1	5.71	4.79	0.61399	.	0.152168	0.42294	D	0.000727	D	0.87974	0.6313	L	0.39245	1.2	0.50171	D	0.999852	B	0.29432	0.244	B	0.28232	0.087	D	0.84812	0.0791	10	0.32370	T	0.25	.	14.2267	0.65863	0.1491:0.8509:0.0:0.0	.	701	Q08945	SSRP1_HUMAN	Q	701	ENSP00000278412:E701Q	ENSP00000278412:E701Q	E	-	1	0	SSRP1	56850486	0.997000	0.39634	1.000000	0.80357	0.771000	0.43674	2.916000	0.48813	1.392000	0.46585	0.467000	0.42956	GAG	SSRP1	-	NULL	ENSG00000149136		0.542	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSRP1	HGNC	protein_coding	OTTHUMT00000392460.1	44	0.00	0	C	NM_003146		57093910	57093910	-1	no_errors	ENST00000278412	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	1.000	G
STARD9	57519	genome.wustl.edu	37	15	42982291	42982291	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr15:42982291G>A	ENST00000290607.7	+	23	8572	c.8515G>A	c.(8515-8517)Gag>Aag	p.E2839K		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	2839					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						CCAATGCCCTGAGGCTTCTAC	0.498																																						dbGAP											0													50.0	49.0	50.0					15																	42982291		692	1590	2282	-	-	-	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.8515G>A	15.37:g.42982291G>A	ENSP00000290607:p.Glu2839Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E2839K	ENST00000290607.7	37	c.8515	CCDS53935.1	15	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667758	0.67814	.	.	ENSG00000159433	ENST00000290607	T	0.67171	-0.25	5.39	2.48	0.30137	.	0.821303	0.10977	N	0.613145	T	0.63177	0.2489	L	0.43152	1.355	0.09310	N	1	.	.	.	.	.	.	T	0.55425	-0.8143	8	0.72032	D	0.01	.	8.1127	0.30924	0.2582:0.0:0.7418:0.0	.	.	.	.	K	2839	ENSP00000290607:E2839K	ENSP00000290607:E2839K	E	+	1	0	STARD9	40769583	0.001000	0.12720	0.001000	0.08648	0.224000	0.24922	0.433000	0.21477	0.346000	0.23899	0.563000	0.77884	GAG	STARD9	-	NULL	ENSG00000159433		0.498	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	43	0.00	0	G			42982291	42982291	+1	no_errors	ENST00000290607	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	0.001	A
SV2A	9900	genome.wustl.edu	37	1	149880762	149880762	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr1:149880762C>A	ENST00000369146.3	-	8	1851	c.1361G>T	c.(1360-1362)tGg>tTg	p.W454L	SV2A_ENST00000369145.1_Missense_Mutation_p.W454L	NM_001278719.1|NM_014849.3	NP_001265648.1|NP_055664.3	Q7L0J3	SV2A_HUMAN	synaptic vesicle glycoprotein 2A	454					cellular calcium ion homeostasis (GO:0006874)|neurotransmitter transport (GO:0006836)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	protein kinase binding (GO:0019901)|receptor activity (GO:0004872)|transmembrane transporter activity (GO:0022857)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(6)|pancreas(1)|prostate(8)|skin(2)|urinary_tract(2)	55	Breast(34;0.00769)|all_hematologic(923;0.127)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)		Levetiracetam(DB01202)	CATGGTGAACCACACACCCAT	0.542																																						dbGAP											0													543.0	430.0	468.0					1																	149880762		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018279	CCDS940.1	1q21.2	2008-02-05			ENSG00000159164	ENSG00000159164			20566	protein-coding gene	gene with protein product		185860				7681585, 10611374	Standard	NM_014849		Approved	SV2, KIAA0736	uc001etg.3	Q7L0J3	OTTHUMG00000012209	ENST00000369146.3:c.1361G>T	1.37:g.149880762C>A	ENSP00000358142:p.Trp454Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUZ7|O94841|Q5QNX8|Q7Z3L6|Q8NBJ6|Q9BVZ9	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	p.W454L	ENST00000369146.3	37	c.1361	CCDS940.1	1	.	.	.	.	.	.	.	.	.	.	C	20.6	4.010184	0.75046	.	.	ENSG00000159164	ENST00000369146;ENST00000369145	T;T	0.57273	0.41;0.41	4.79	4.79	0.61399	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.276731	0.37577	N	0.002037	T	0.76285	0.3966	H	0.94698	3.57	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82416	-0.0468	10	0.59425	D	0.04	-9.9713	15.3729	0.74581	0.0:1.0:0.0:0.0	.	454	Q7L0J3	SV2A_HUMAN	L	454	ENSP00000358142:W454L;ENSP00000358141:W454L	ENSP00000358141:W454L	W	-	2	0	SV2A	148147386	1.000000	0.71417	0.996000	0.52242	0.672000	0.39443	7.281000	0.78621	2.492000	0.84095	0.491000	0.48974	TGG	SV2A	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_SV2_chordata	ENSG00000159164		0.542	SV2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SV2A	HGNC	protein_coding	OTTHUMT00000033754.1	109	0.00	0	C			149880762	149880762	-1	no_errors	ENST00000369146	ensembl	human	known	69_37n	missense	164	55.56	205	SNP	1.000	A
TDO2	6999	genome.wustl.edu	37	4	156825222	156825222	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr4:156825222A>G	ENST00000536354.2	+	2	152	c.88A>G	c.(88-90)Act>Gct	p.T30A		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase											breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		CAAATCACAAACTGGTGTGAA	0.408																																					Colon(57;928 1036 2595 6946 26094)	dbGAP											0													92.0	91.0	92.0					4																	156825222		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.88A>G	4.37:g.156825222A>G	ENSP00000444788:p.Thr30Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Trp_2_3_dOase	p.T30A	ENST00000536354.2	37	c.88	CCDS34086.1	4	.	.	.	.	.	.	.	.	.	.	A	3.577	-0.086490	0.07097	.	.	ENSG00000151790	ENST00000536354	.	.	.	5.59	-0.13	0.13498	.	0.862459	0.10635	N	0.651648	T	0.16214	0.0390	N	0.05441	-0.05	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31503	-0.9941	9	0.10111	T	0.7	1.3431	9.6581	0.39939	0.4278:0.0:0.5722:0.0	.	30	P48775	T23O_HUMAN	A	30	.	ENSP00000281525:T30A	T	+	1	0	TDO2	157044672	0.611000	0.26992	0.030000	0.17652	0.765000	0.43378	1.108000	0.31123	0.074000	0.16767	-0.417000	0.06048	ACT	TDO2	-	pfam_Trp_2_3_dOase	ENSG00000151790		0.408	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDO2	HGNC	protein_coding	OTTHUMT00000366209.3	57	0.00	0	A	NM_005651		156825222	156825222	+1	no_errors	ENST00000536354	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	0.108	G
TF	7018	genome.wustl.edu	37	3	133473400	133473400	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr3:133473400C>A	ENST00000402696.3	+	4	872	c.387C>A	c.(385-387)aaC>aaA	p.N129K	TFP1_ENST00000460564.1_RNA|TF_ENST00000475382.1_3'UTR|TF_ENST00000264998.3_Missense_Mutation_p.N2K	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	129	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	TCCAGATGAACCAGCTTCGAG	0.527																																						dbGAP											0													157.0	150.0	153.0					3																	133473400		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.387C>A	3.37:g.133473400C>A	ENSP00000385834:p.Asn129Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.N129K	ENST00000402696.3	37	c.387	CCDS3080.1	3	.	.	.	.	.	.	.	.	.	.	C	4.893	0.165945	0.09339	.	.	ENSG00000091513	ENST00000402696;ENST00000482271;ENST00000264998	T;T;T	0.34667	1.35;1.35;1.35	5.25	-4.44	0.03557	.	0.365437	0.37669	N	0.001983	T	0.21801	0.0525	L	0.45581	1.43	0.09310	N	1	B	0.21147	0.052	B	0.21151	0.033	T	0.11324	-1.0592	10	0.29301	T	0.29	-27.3287	5.1437	0.14973	0.1062:0.1784:0.1137:0.6016	.	129	P02787	TRFE_HUMAN	K	129;2;2	ENSP00000385834:N129K;ENSP00000419338:N2K;ENSP00000264998:N2K	ENSP00000264998:N2K	N	+	3	2	TF	134956090	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	-2.856000	0.00729	-0.716000	0.04962	-0.367000	0.07326	AAC	TF	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin	ENSG00000091513		0.527	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TF	HGNC	protein_coding	OTTHUMT00000317775.1	38	0.00	0	C	NM_001063		133473400	133473400	+1	no_errors	ENST00000402696	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	0.000	A
TSHZ1	10194	genome.wustl.edu	37	18	72998785	72998785	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr18:72998785C>G	ENST00000580243.1	+	2	1771	c.1423C>G	c.(1423-1425)Cac>Gac	p.H475D	TSHZ1_ENST00000322038.5_Missense_Mutation_p.H430D			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	475					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		GCCCACCACCCACACGCGGCT	0.597																																						dbGAP											0													41.0	52.0	48.0					18																	72998785		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.1423C>G	18.37:g.72998785C>G	ENSP00000464391:p.His475Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60534|Q4LE29|Q53EU4	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.H475D	ENST00000580243.1	37	c.1423		18	.	.	.	.	.	.	.	.	.	.	C	5.201	0.222597	0.09863	.	.	ENSG00000179981	ENST00000322038	T	0.10668	2.85	5.35	5.35	0.76521	.	0.243530	0.41712	D	0.000822	T	0.07999	0.0200	L	0.29908	0.895	0.28856	N	0.895784	P	0.49783	0.928	B	0.42062	0.374	T	0.08889	-1.0700	10	0.07482	T	0.82	-29.1531	12.4115	0.55469	0.0:0.9231:0.0:0.0769	.	475	Q6ZSZ6	TSH1_HUMAN	D	430	ENSP00000323584:H430D	ENSP00000323584:H430D	H	+	1	0	TSHZ1	71127773	1.000000	0.71417	0.993000	0.49108	0.586000	0.36452	5.280000	0.65603	2.030000	0.59900	0.459000	0.35465	CAC	TSHZ1	-	NULL	ENSG00000179981		0.597	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	HGNC	protein_coding	OTTHUMT00000444913.1	24	0.00	0	C	NM_005786		72998785	72998785	+1	no_errors	ENST00000580243	ensembl	human	known	69_37n	missense	10	47.37	9	SNP	0.879	G
TSKS	60385	genome.wustl.edu	37	19	50266424	50266424	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:50266424G>C	ENST00000246801.3	-	1	163	c.81C>G	c.(79-81)agC>agG	p.S27R	RNU6-841P_ENST00000383872.1_RNA	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	27					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		GCTGGGAGCAGCTCTCCACCC	0.647																																						dbGAP											0													66.0	71.0	69.0					19																	50266424		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.81C>G	19.37:g.50266424G>C	ENSP00000246801:p.Ser27Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WXJ0	Missense_Mutation	SNP	NULL	p.S27R	ENST00000246801.3	37	c.81	CCDS12780.1	19	.	.	.	.	.	.	.	.	.	.	G	6.240	0.412395	0.11812	.	.	ENSG00000126467	ENST00000246801	T	0.35973	1.28	4.93	1.41	0.22369	.	0.261621	0.27504	N	0.019079	T	0.20820	0.0501	N	0.24115	0.695	0.09310	N	1	B	0.11235	0.004	B	0.14578	0.011	T	0.16600	-1.0397	10	0.72032	D	0.01	-10.0408	4.9524	0.14021	0.2629:0.1536:0.5835:0.0	.	27	Q9UJT2	TSKS_HUMAN	R	27	ENSP00000246801:S27R	ENSP00000246801:S27R	S	-	3	2	TSKS	54958236	0.696000	0.27757	0.208000	0.23602	0.283000	0.27025	0.645000	0.24782	0.111000	0.17947	0.467000	0.42956	AGC	TSKS	-	NULL	ENSG00000126467		0.647	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	HGNC	protein_coding	OTTHUMT00000465795.1	22	0.00	0	G	NM_021733		50266424	50266424	-1	no_errors	ENST00000246801	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	0.012	C
WDR64	128025	genome.wustl.edu	37	1	241936093	241936093	+	Splice_Site	SNP	G	G	T			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr1:241936093G>T	ENST00000366552.2	+	19	2467		c.e19-1		WDR64_ENST00000437684.2_Intron	NM_144625.4	NP_653226.4	B1ANS9	WDR64_HUMAN	WD repeat domain 64											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(17)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	Ovarian(103;0.103)	all_cancers(173;0.0121)	OV - Ovarian serous cystadenocarcinoma(106;0.0116)			TTCTCGAATAGGTGAACAAAC	0.488																																						dbGAP											0													95.0	89.0	91.0					1																	241936093		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AK057540		1q43	2013-01-09			ENSG00000162843	ENSG00000162843		"""WD repeat domain containing"""	26570	protein-coding gene	gene with protein product							Standard	NM_144625		Approved	FLJ32978	uc001hzg.2	B1ANS9	OTTHUMG00000039705	ENST00000366552.2:c.2261-1G>T	1.37:g.241936093G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANT0|Q7Z573|Q96LY9	Splice_Site	SNP	-	e19-1	ENST00000366552.2	37	c.2261-1		1	.	.	.	.	.	.	.	.	.	.	G	13.18	2.161359	0.38119	.	.	ENSG00000162843	ENST00000366552;ENST00000425826	.	.	.	4.39	4.39	0.52855	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6464	0.56738	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WDR64	240002716	1.000000	0.71417	0.784000	0.31847	0.176000	0.22953	3.890000	0.56220	2.419000	0.82065	0.557000	0.71058	.	WDR64	-	-	ENSG00000162843		0.488	WDR64-201	KNOWN	basic|appris_principal	protein_coding	WDR64	HGNC	protein_coding		38	0.00	0	G	NM_144625	Intron	241936093	241936093	+1	no_errors	ENST00000366552	ensembl	human	known	69_37n	splice_site	24	40.00	16	SNP	0.731	T
XRCC4	7518	genome.wustl.edu	37	5	82500683	82500683	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr5:82500683G>A	ENST00000511817.1	+	6	768	c.688G>A	c.(688-690)Gat>Aat	p.D230N	XRCC4_ENST00000509268.1_3'UTR|XRCC4_ENST00000338635.6_Missense_Mutation_p.D230N|XRCC4_ENST00000396027.4_Missense_Mutation_p.D230N|XRCC4_ENST00000282268.3_Missense_Mutation_p.D230N			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	230					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		TCCAGTCTATGATGAGAGTAC	0.403								Non-homologous end-joining																														dbGAP											0													122.0	125.0	124.0					5																	82500683		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.688G>A	5.37:g.82500683G>A	ENSP00000421491:p.Asp230Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3X4|Q9BS72|Q9UP94	Missense_Mutation	SNP	pfam_DNA_ds_break_repair_XRCC4,superfamily_XRCC4_N	p.D230N	ENST00000511817.1	37	c.688	CCDS4059.1	5	.	.	.	.	.	.	.	.	.	.	G	14.16	2.451114	0.43531	.	.	ENSG00000152422	ENST00000282268;ENST00000338635;ENST00000396027;ENST00000511817	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.43	2.69	0.31865	.	0.429307	0.26638	N	0.023276	T	0.34832	0.0911	M	0.71581	2.175	0.32052	N	0.596806	P;D;P	0.53462	0.898;0.96;0.95	B;P;P	0.50659	0.429;0.647;0.592	T	0.45804	-0.9236	10	0.46703	T	0.11	-19.1027	8.9317	0.35675	0.2339:0.0:0.7661:0.0	.	230;230;230	Q13426-2;Q13426;Q13426-3	.;XRCC4_HUMAN;.	N	230	ENSP00000282268:D230N;ENSP00000342011:D230N;ENSP00000379344:D230N;ENSP00000421491:D230N	ENSP00000282268:D230N	D	+	1	0	XRCC4	82536439	1.000000	0.71417	0.959000	0.39883	0.367000	0.29736	2.388000	0.44398	0.352000	0.24053	0.591000	0.81541	GAT	XRCC4	-	pfam_DNA_ds_break_repair_XRCC4	ENSG00000152422		0.403	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	XRCC4	HGNC	protein_coding	OTTHUMT00000369624.1	41	0.00	0	G	NM_022550		82500683	82500683	+1	no_errors	ENST00000338635	ensembl	human	known	69_37n	missense	27	35.71	15	SNP	1.000	A
ZBTB38	253461	genome.wustl.edu	37	3	141162010	141162010	+	Silent	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr3:141162010G>A	ENST00000514251.1	+	4	1059	c.780G>A	c.(778-780)ccG>ccA	p.P260P	ZBTB38_ENST00000321464.5_Silent_p.P261P|ZBTB38_ENST00000441582.2_Silent_p.P260P					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						CAGCGAAACCGAAAACATGCC	0.473																																						dbGAP											0													65.0	66.0	66.0					3																	141162010		1978	4168	6146	-	-	-	SO:0001819	synonymous_variant	0			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.780G>A	3.37:g.141162010G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P261	ENST00000514251.1	37	c.783	CCDS43157.1	3																																																																																			ZBTB38	-	NULL	ENSG00000177311		0.473	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB38	HGNC	protein_coding	OTTHUMT00000359329.2	39	0.00	0	G			141162010	141162010	+1	no_errors	ENST00000321464	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.000	A
ZIC2	7546	genome.wustl.edu	37	13	100635008	100635010	+	In_Frame_Del	DEL	CCA	CCA	-	rs375069774		TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr13:100635008_100635010delCCA	ENST00000376335.3	+	1	983_985	c.690_692delCCA	c.(688-693)gcccac>gcc	p.H239del		NM_007129.3	NP_009060.2	O95409	ZIC2_HUMAN	Zic family member 2	239	Necessary for interaction with MDFIC and transcriptional activation or repression. {ECO:0000250}.|Poly-His.		H -> HH. {ECO:0000269|PubMed:15221788}.|Missing. {ECO:0000269|PubMed:15221788}.		brain development (GO:0007420)|developmental pigmentation (GO:0048066)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|retinal ganglion cell axon guidance (GO:0031290)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(2)|liver(2)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CAGCCGCGGCccaccaccaccac	0.621																																					Pancreas(97;119 1522 31925 44771 48764)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF104902	CCDS9495.1	13q32	2013-01-08	2011-05-19		ENSG00000043355	ENSG00000043355		"""Zinc fingers, C2H2-type"""	12873	protein-coding gene	gene with protein product	"""Zinc finger protein of the cerebellum 2"""	603073	"""Zic family member 2 (odd-paired Drosophila homolog)"", ""Zic family member 2 (odd-paired homolog, Drosophila)"""			9771712	Standard	NM_007129		Approved	HPE5	uc001von.3	O95409	OTTHUMG00000017279	ENST00000376335.3:c.690_692delCCA	13.37:g.100635017_100635019delCCA	ENSP00000365514:p.His239del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYA9|Q9H309	In_Frame_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H234in_frame_del	ENST00000376335.3	37	c.690_692	CCDS9495.1	13																																																																																			ZIC2	-	NULL	ENSG00000043355		0.621	ZIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC2	HGNC	protein_coding	OTTHUMT00000045618.2	13	0.00	0	CCA	NM_007129		100635008	100635010	+1	no_errors	ENST00000376335	ensembl	human	known	69_37n	in_frame_del	8	20.00	2	DEL	0.990:0.999:1.000	-
ZNF418	147686	genome.wustl.edu	37	19	58437604	58437604	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:58437604delA	ENST00000396147.1	-	4	2236	c.1945delT	c.(1945-1947)tgcfs	p.C649fs	ZNF418_ENST00000425570.3_Frame_Shift_Del_p.C670fs|ZNF418_ENST00000599852.1_Frame_Shift_Del_p.C564fs|ZNF418_ENST00000600989.1_Intron|ZNF418_ENST00000599086.1_5'Flank|ZNF418_ENST00000595830.1_Frame_Shift_Del_p.C649fs	NM_133460.1	NP_597717.1	Q8TF45	ZN418_HUMAN	zinc finger protein 418	649					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	31		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0158)		CATTCACTGCACTCATAAGGC	0.433																																						dbGAP											0													122.0	123.0	123.0					19																	58437604		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB075836, AY695825	CCDS42642.1	19q13.43	2013-01-08				ENSG00000196724		"""Zinc fingers, C2H2-type"", ""-"""	20647	protein-coding gene	gene with protein product						11853319	Standard	NM_133460		Approved	KIAA1956, FLJ31551	uc002qqs.1	Q8TF45		ENST00000396147.1:c.1945delT	19.37:g.58437604delA	ENSP00000379451:p.Cys649fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1S2|Q670L5|Q96N18	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C670fs	ENST00000396147.1	37	c.2008	CCDS42642.1	19																																																																																			ZNF418	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196724		0.433	ZNF418-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZNF418	HGNC	protein_coding	OTTHUMT00000466693.1	66	0.00	0	A	NM_133460		58437604	58437604	-1	no_errors	ENST00000425570	ensembl	human	known	69_37n	frame_shift_del	44	20.00	11	DEL	0.254	-
ZNF718	255403	genome.wustl.edu	37	4	155300	155300	+	lincRNA	SNP	A	A	C			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr4:155300A>C	ENST00000510175.1	+	0	735							Q3SXZ3	ZN718_HUMAN	zinc finger protein 718						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)						all_cancers(4;0.0738)|all_epithelial(65;0.139)		Lung(54;0.0681)|Epithelial(2;0.0838)|all cancers(2;0.135)|LUSC - Lung squamous cell carcinoma(95;0.18)		TACATAAGAGAATTCATTCTG	0.338																																						dbGAP											0													41.0	46.0	44.0					4																	155300		2067	4226	6293	-	-	-			0			AK096662	CCDS75078.1, CCDS75079.1	4p16.3	2011-05-24			ENSG00000250312	ENSG00000250312		"""Zinc fingers, C2H2-type"""	26889	protein-coding gene	gene with protein product							Standard	XM_005278364		Approved	FLJ90036	uc003fzt.4	Q3SXZ3	OTTHUMG00000159873		4.37:g.155300A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXZ4|Q3SXZ5	RNA	SNP	-	NULL	ENST00000510175.1	37	NULL		4																																																																																			ZNF718	-	-	ENSG00000250312		0.338	ZNF718-002	KNOWN	basic	lincRNA	ZNF718	HGNC	lincRNA	OTTHUMT00000357865.3	34	0.00	0	A	NM_001039127		155300	155300	+1	no_errors	ENST00000400172	ensembl	human	known	69_37n	rna	27	18.18	6	SNP	0.991	C
ZSWIM4	65249	genome.wustl.edu	37	19	13934173	13934173	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:13934173G>A	ENST00000254323.2	+	10	1912	c.1723G>A	c.(1723-1725)Gag>Aag	p.E575K	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.E409K	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	575							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			GCCCATACTGGAGACAGCATT	0.612																																						dbGAP											0													57.0	45.0	49.0					19																	13934173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1723G>A	19.37:g.13934173G>A	ENSP00000254323:p.Glu575Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfscan_Znf_SWIM	p.E575K	ENST00000254323.2	37	c.1723	CCDS32924.1	19	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656972	0.67586	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.47869	0.83;0.83	4.55	4.55	0.56014	.	0.000000	0.51477	D	0.000091	T	0.65048	0.2654	M	0.69358	2.11	0.47819	D	0.999528	D;D	0.89917	0.982;1.0	P;D	0.72982	0.831;0.979	T	0.64820	-0.6317	10	0.40728	T	0.16	-22.3974	14.8308	0.70146	0.0:0.0:1.0:0.0	.	409;575	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	K	575;409	ENSP00000254323:E575K;ENSP00000405278:E409K	ENSP00000254323:E575K	E	+	1	0	ZSWIM4	13795173	1.000000	0.71417	0.909000	0.35828	0.240000	0.25518	8.746000	0.91604	2.351000	0.79841	0.591000	0.81541	GAG	ZSWIM4	-	NULL	ENSG00000132003		0.612	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	25	0.00	0	G	XM_031342		13934173	13934173	+1	no_errors	ENST00000254323	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	A
ZNF829	374899	genome.wustl.edu	37	19	37398926	37398926	+	Splice_Site	SNP	C	C	G			TCGA-E9-A1NA-01A-11D-A142-09	TCGA-E9-A1NA-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a3d223eb-20e6-40b9-9f07-e5f865bd2439	6c9a17cd-a638-47f4-ba5d-3ec57d96b56e	g.chr19:37398926C>G	ENST00000391711.3	-	5	588	c.224G>C	c.(223-225)gGa>gCa	p.G75A	ZNF829_ENST00000520965.1_Splice_Site_p.G156A|ZNF345_ENST00000432005.2_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	75	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATTGGAAAGTCCTGTTCACAA	0.468																																						dbGAP											0													86.0	87.0	87.0					19																	37398926		2175	4287	6462	-	-	-	SO:0001630	splice_region_variant	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.224-1G>C	19.37:g.37398926C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G156A	ENST00000391711.3	37	c.467	CCDS42557.1	19	.	.	.	.	.	.	.	.	.	.	C	17.60	3.429625	0.62844	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.02787	4.16	4.54	3.49	0.39957	Krueppel-associated box (4);	.	.	.	.	T	0.08268	0.0206	M	0.83012	2.62	0.23396	N	0.997766	B	0.20780	0.048	B	0.33960	0.173	T	0.08229	-1.0732	9	0.62326	D	0.03	.	10.6506	0.45647	0.0:0.8054:0.1946:0.0	.	75	Q3KNS6	ZN829_HUMAN	A	75	ENSP00000429266:G75A	ENSP00000429266:G75A	G	-	2	0	ZNF829	42090766	0.993000	0.37304	1.000000	0.80357	0.995000	0.86356	2.101000	0.41787	1.244000	0.43870	0.585000	0.79938	GGA	ZNF829	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000185869		0.468	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	70	0.00	0	C	NM_001037232	Missense_Mutation	37398926	37398926	-1	no_errors	ENST00000520965	ensembl	human	known	69_37n	missense	41	28.07	16	SNP	1.000	G
