#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2M	2	genome.wustl.edu	37	12	9242989	9242989	+	Silent	SNP	C	C	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr12:9242989C>T	ENST00000318602.7	-	20	2866	c.2559G>A	c.(2557-2559)cgG>cgA	p.R853R		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	853					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	ACACAGTTTGCCGCCCGTTTG	0.507																																						dbGAP											0													153.0	155.0	155.0					12																	9242989		2057	4214	6271	-	-	-	SO:0001819	synonymous_variant	0			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.2559G>A	12.37:g.9242989C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Missense_Mutation	SNP	pfam_Macroglobln_a2,pfam_SV_autoAg	p.G101D	ENST00000318602.7	37	c.302	CCDS44827.1	12	.	.	.	.	.	.	.	.	.	.	C	8.502	0.864468	0.17250	.	.	ENSG00000175899	ENST00000543436	.	.	.	5.23	-0.562	0.11781	.	.	.	.	.	T	0.19287	0.0463	.	.	.	0.25578	N	0.986828	.	.	.	.	.	.	T	0.23655	-1.0182	4	.	.	.	.	1.1757	0.01835	0.245:0.3981:0.1204:0.2364	.	.	.	.	D	101	.	.	G	-	2	0	A2M	9134256	0.001000	0.12720	0.979000	0.43373	0.835000	0.47333	-2.239000	0.01198	0.207000	0.20607	0.655000	0.94253	GGC	A2M	-	pfam_SV_autoAg	ENSG00000175899		0.507	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	HGNC	protein_coding	OTTHUMT00000317233.2	105	0.00	0	C	NM_000014		9242989	9242989	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000543436	ensembl	human	putative	69_37n	missense	54	14.29	9	SNP	0.385	T
AGBL1	123624	genome.wustl.edu	37	15	86940618	86940618	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr15:86940618T>C	ENST00000441037.2	+	17	2353	c.2258T>C	c.(2257-2259)aTc>aCc	p.I753T	AGBL1_ENST00000389298.3_Missense_Mutation_p.I484T|AGBL1_ENST00000421325.2_Missense_Mutation_p.I753T	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	753					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TATCAGGTGATCACTGCTCGA	0.423																																						dbGAP											0													110.0	105.0	107.0					15																	86940618		1937	4137	6074	-	-	-	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2258T>C	15.37:g.86940618T>C	ENSP00000413001:p.Ile753Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.I753T	ENST00000441037.2	37	c.2258	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	T	22.8	4.341741	0.81911	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.13538	2.58;2.58	5.49	5.49	0.81192	Peptidase M14, carboxypeptidase A (1);	0.083318	0.47093	D	0.000248	T	0.32406	0.0828	M	0.65498	2.005	0.38994	D	0.959212	D	0.62365	0.991	P	0.59825	0.864	T	0.11518	-1.0584	10	0.87932	D	0	-17.3909	15.0701	0.72030	0.0:0.0:0.0:1.0	.	753	Q96MI9	CBPC4_HUMAN	T	782;753;484	ENSP00000397173:I753T;ENSP00000373949:I484T	ENSP00000373949:I484T	I	+	2	0	AGBL1	84741622	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.897000	0.87356	2.207000	0.71202	0.533000	0.62120	ATC	AGBL1	-	pfam_Peptidase_M14	ENSG00000166748		0.423	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	72	0.00	0	T	NM_152336		86940618	86940618	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	1.000	C
AKAP4	8852	genome.wustl.edu	37	X	49957994	49957994	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chrX:49957994T>A	ENST00000376056.2	-	5	1493	c.1343A>T	c.(1342-1344)gAt>gTt	p.D448V	AKAP4_ENST00000376064.3_Missense_Mutation_p.D448V|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000358526.2_Missense_Mutation_p.D457V					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					GCATTTGGGATCATGGGACCC	0.463																																						dbGAP											0													109.0	102.0	104.0					X																	49957994		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1343A>T	X.37:g.49957994T>A	ENSP00000365224:p.Asp448Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.D457V	ENST00000376056.2	37	c.1370	CCDS14330.1	X	.	.	.	.	.	.	.	.	.	.	T	9.259	1.042668	0.19748	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.15603	2.41;2.41;2.41	4.6	4.6	0.57074	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.50627	D	0.000109	T	0.39809	0.1092	M	0.77820	2.39	0.44432	D	0.997355	D	0.89917	1.0	D	0.91635	0.999	T	0.22243	-1.0222	9	.	.	.	-17.6179	9.5416	0.39255	0.0:0.0:0.0:1.0	.	457	Q5JQC9	AKAP4_HUMAN	V	448;457;448	ENSP00000365224:D448V;ENSP00000351327:D457V;ENSP00000365232:D448V	.	D	-	2	0	AKAP4	49844734	0.488000	0.25996	0.013000	0.15412	0.216000	0.24613	2.836000	0.48183	1.512000	0.48834	0.381000	0.24937	GAT	AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.463	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	98	0.00	0	T	NM_003886		49957994	49957994	-1	no_errors	ENST00000358526	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	0.070	A
ANKRD18B	441459	genome.wustl.edu	37	9	33555770	33555770	+	Missense_Mutation	SNP	C	C	T	rs190336871		TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr9:33555770C>T	ENST00000290943.6	+	11	2192	c.2096C>T	c.(2095-2097)gCg>gTg	p.A699V		NM_001244752.1	NP_001231681.1	A2A2Z9	AN18B_HUMAN	ankyrin repeat domain 18B	699										NS(1)|breast(1)|endometrium(2)|lung(1)|prostate(1)|stomach(1)	7						AACTATACTGCGGATCAAATA	0.264													c|||	1	0.000199681	0.0	0.0	5008	,	,		16046	0.001		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0					9p13.3	2013-01-10			ENSG00000230453	ENSG00000230453		"""Ankyrin repeat domain containing"""	23644	protein-coding gene	gene with protein product							Standard	NM_001244752		Approved	bA255A11.3	uc010mjw.2	A2A2Z9	OTTHUMG00000019776	ENST00000290943.6:c.2096C>T	9.37:g.33555770C>T	ENSP00000290943:p.Ala699Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A699V	ENST00000290943.6	37	c.2096		9	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	c	1.767	-0.485295	0.04352	.	.	ENSG00000230453	ENST00000290943;ENST00000357927	T;T	0.26957	1.7;3.14	1.48	0.277	0.15668	.	.	.	.	.	T	0.07413	0.0187	.	.	.	0.22127	N	0.99935	.	.	.	.	.	.	T	0.40515	-0.9559	5	0.02654	T	1	.	3.3514	0.07154	0.0:0.2406:0.0:0.7594	.	.	.	.	V	699;80	ENSP00000290943:A699V;ENSP00000350607:A80V	ENSP00000290943:A699V	A	+	2	0	ANKRD18B	33545770	0.977000	0.34250	0.017000	0.16124	0.019000	0.09904	1.983000	0.40648	0.060000	0.16281	-0.856000	0.03024	GCG	ANKRD18B	-	NULL	ENSG00000230453		0.264	ANKRD18B-002	KNOWN	basic|appris_principal	protein_coding	ANKRD18B	HGNC	protein_coding	OTTHUMT00000313729.2	116	0.00	0	C	XM_001718334		33555770	33555770	+1	no_errors	ENST00000290943	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	0.034	T
ASXL1	171023	genome.wustl.edu	37	20	31021612	31021612	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr20:31021612A>T	ENST00000375687.4	+	12	2035	c.1611A>T	c.(1609-1611)gaA>gaT	p.E537D	ASXL1_ENST00000306058.5_Missense_Mutation_p.E532D	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	537	Interaction with NCOA1. {ECO:0000250}.				bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CCTTTCCCGAAAAGAAGCCCC	0.517			"""F, N, Mis"""		"""MDS, CMML"""																																	dbGAP		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0													96.0	106.0	102.0					20																	31021612		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.1611A>T	20.37:g.31021612A>T	ENSP00000364839:p.Glu537Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Missense_Mutation	SNP	NULL	p.E537D	ENST00000375687.4	37	c.1611	CCDS13201.1	20	.	.	.	.	.	.	.	.	.	.	A	19.18	3.777484	0.70107	.	.	ENSG00000171456	ENST00000358956;ENST00000375687;ENST00000421155;ENST00000412498;ENST00000306058	T;T	0.59083	0.29;0.29	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.70561	0.3238	M	0.72894	2.215	0.50467	D	0.99987	D;D	0.76494	0.999;0.997	D;D	0.80764	0.994;0.965	T	0.71761	-0.4495	10	0.49607	T	0.09	-10.3959	7.8136	0.29245	0.8452:0.0:0.1548:0.0	.	532;537	A6NIZ6;Q8IXJ9	.;ASXL1_HUMAN	D	537;537;537;476;532	ENSP00000364839:E537D;ENSP00000305119:E532D	ENSP00000305119:E532D	E	+	3	2	ASXL1	30485273	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.844000	0.39269	2.243000	0.73865	0.533000	0.62120	GAA	ASXL1	-	NULL	ENSG00000171456		0.517	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	15	0.00	0	A	NM_015338		31021612	31021612	+1	no_errors	ENST00000375687	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	1.000	T
ATF1	466	genome.wustl.edu	37	12	51207889	51207889	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr12:51207889C>T	ENST00000262053.3	+	5	447	c.425C>T	c.(424-426)aCt>aTt	p.T142I	ATF1_ENST00000539132.1_Missense_Mutation_p.T7I	NM_005171.4	NP_005162.1	P18846	ATF1_HUMAN	activating transcription factor 1	142					cellular protein complex assembly (GO:0043623)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to cobalt ion (GO:0032025)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/ATF1(347)|FUS/ATF1(4)	breast(1)|large_intestine(1)|ovary(2)	4					Pseudoephedrine(DB00852)	TCAGGCAGTACTCAGCAAGGT	0.463			T	"""EWSR1, FUS"""	"""malignant melanoma of soft parts , angiomatoid fibrous histiocytoma """																																	dbGAP		Dom	yes		12	12q13	466	activating transcription factor 1		"""E, M"""	0													109.0	98.0	101.0					12																	51207889		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029619	CCDS8803.1	12q13	2014-05-13			ENSG00000123268	ENSG00000123268		"""basic leucine zipper proteins"""	783	protein-coding gene	gene with protein product		123803				8401579	Standard	NM_005171		Approved	TREB36	uc001rww.4	P18846		ENST00000262053.3:c.425C>T	12.37:g.51207889C>T	ENSP00000262053:p.Thr142Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRF9|P25168|Q9H4A8	Missense_Mutation	SNP	pfam_bZIP_1,pfam_Coactivator_CBP_pKID,pfam_bZIP_2,smart_bZIP,pfscan_Coactivator_CBP_pKID,pfscan_bZIP,prints_Leuzip_CREB	p.T142I	ENST00000262053.3	37	c.425	CCDS8803.1	12	.	.	.	.	.	.	.	.	.	.	C	13.05	2.120634	0.37436	.	.	ENSG00000123268	ENST00000552510;ENST00000262053;ENST00000539132;ENST00000552487	T;T;T;T	0.78126	-1.15;0.42;0.51;0.43	4.93	4.03	0.46877	.	0.567606	0.21195	N	0.078569	T	0.68997	0.3062	L	0.34521	1.04	0.32927	D	0.516601	B	0.23735	0.09	B	0.20577	0.03	T	0.73433	-0.3984	10	0.54805	T	0.06	-19.3561	14.6897	0.69076	0.0:0.854:0.146:0.0	.	142	P18846	ATF1_HUMAN	I	142;142;7;142	ENSP00000448592:T142I;ENSP00000262053:T142I;ENSP00000438403:T7I;ENSP00000448921:T142I	ENSP00000262053:T142I	T	+	2	0	ATF1	49494156	0.000000	0.05858	1.000000	0.80357	0.891000	0.51852	0.687000	0.25407	1.205000	0.43262	0.561000	0.74099	ACT	ATF1	-	NULL	ENSG00000123268		0.463	ATF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF1	HGNC	protein_coding	OTTHUMT00000404285.1	38	0.00	0	C	NM_005171		51207889	51207889	+1	no_errors	ENST00000262053	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	0.927	T
TRAPPC3L	100128327	genome.wustl.edu	37	6	116861558	116861558	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr6:116861558T>C	ENST00000368602.3	-	3	303	c.208A>G	c.(208-210)Agt>Ggt	p.S70G	FAM26D_ENST00000416171.2_Intron|FAM26D_ENST00000405399.1_Intron|FAM26D_ENST00000368597.2_Intron	NM_001139444.2	NP_001132916.1	Q5T215	TPC3L_HUMAN	trafficking protein particle complex 3-like	70					vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)											TCTGAATAACTATGGCATCTT	0.403																																						dbGAP											0													71.0	64.0	66.0					6																	116861558		692	1591	2283	-	-	-	SO:0001583	missense	0			AK002042	CCDS47468.1	6q22.31	2013-05-01	2013-05-01	2013-05-01	ENSG00000173626	ENSG00000173626			21090	protein-coding gene	gene with protein product		614137	"""BET3 like (S. cerevisiae)"""	BET3L		21525244	Standard	NM_001139444		Approved	bA259P20.2, FLJ11180		Q5T215	OTTHUMG00000015440	ENST00000368602.3:c.208A>G	6.37:g.116861558T>C	ENSP00000357591:p.Ser70Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T213|Q5T214	Missense_Mutation	SNP	pfam_TRAPP_component,superfamily_NO_sig/Golgi_transp_ligand-bd,pirsf_TRAPP_I_complex_Bet3	p.S70G	ENST00000368602.3	37	c.208	CCDS47468.1	6	.	.	.	.	.	.	.	.	.	.	T	16.59	3.165409	0.57476	.	.	ENSG00000173626	ENST00000437098;ENST00000368602	T;T	0.43688	0.94;0.94	5.67	5.67	0.87782	NO signalling/Golgi transport  ligand-binding domain (1);	0.065515	0.64402	D	0.000004	T	0.33177	0.0854	M	0.65975	2.015	0.80722	D	1	B	0.23650	0.089	B	0.28638	0.092	T	0.29882	-0.9997	10	0.62326	D	0.03	-3.788	15.1873	0.73012	0.0:0.0:0.0:1.0	.	70	Q5T215	TPC3L_HUMAN	G	56;70	ENSP00000395769:S56G;ENSP00000357591:S70G	ENSP00000357591:S70G	S	-	1	0	BET3L	116968251	1.000000	0.71417	0.994000	0.49952	0.992000	0.81027	3.885000	0.56182	2.286000	0.76751	0.455000	0.32223	AGT	BET3L	-	pfam_TRAPP_component,superfamily_NO_sig/Golgi_transp_ligand-bd,pirsf_TRAPP_I_complex_Bet3	ENSG00000173626		0.403	TRAPPC3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BET3L	HGNC	protein_coding	OTTHUMT00000101701.1	36	0.00	0	T	XM_166322		116861558	116861558	-1	no_errors	ENST00000368602	ensembl	human	known	69_37n	missense	25	26.47	9	SNP	0.994	C
CATSPERB	79820	genome.wustl.edu	37	14	92047329	92047329	+	Silent	SNP	C	C	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr14:92047329C>T	ENST00000256343.3	-	27	3411	c.3255G>A	c.(3253-3255)ccG>ccA	p.P1085P		NM_024764.2	NP_079040.2	Q9H7T0	CTSRB_HUMAN	catsper channel auxiliary subunit beta	1085					cell differentiation (GO:0030154)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|cilium (GO:0005929)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|kidney(3)|large_intestine(15)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(2)	54		all_cancers(154;0.0663)|all_epithelial(191;0.236)				ATGTCCTCCACGGATGGATGC	0.433																																						dbGAP											0													128.0	118.0	121.0					14																	92047329		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024360	CCDS32142.1	14q32.12	2012-02-22	2012-02-22	2007-10-18	ENSG00000133962	ENSG00000133962			20500	protein-coding gene	gene with protein product		611169	"""chromosome 14 open reading frame 161"", ""cation channel, sperm-associated, beta"""	C14orf161		17478420	Standard	NM_024764		Approved	FLJ14298	uc001xzs.1	Q9H7T0	OTTHUMG00000171118	ENST00000256343.3:c.3255G>A	14.37:g.92047329C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV51	Silent	SNP	superfamily_Neuraminidase	p.P1085	ENST00000256343.3	37	c.3255	CCDS32142.1	14																																																																																			CATSPERB	-	NULL	ENSG00000133962		0.433	CATSPERB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CATSPERB	HGNC	protein_coding	OTTHUMT00000411769.1	109	0.00	0	C	NM_024764		92047329	92047329	-1	no_errors	ENST00000256343	ensembl	human	known	69_37n	silent	38	41.54	27	SNP	0.000	T
CD109	135228	genome.wustl.edu	37	6	74466405	74466405	+	Splice_Site	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr6:74466405G>A	ENST00000287097.5	+	6	785	c.673G>A	c.(673-675)Gta>Ata	p.V225I	CD109_ENST00000422508.2_Splice_Site_p.V148I|CD109_ENST00000437994.2_Splice_Site_p.V225I			Q6YHK3	CD109_HUMAN	CD109 molecule	225					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						TTCAGAATATGGTAAGAGTTC	0.303																																						dbGAP											0													77.0	78.0	78.0					6																	74466405		2203	4294	6497	-	-	-	SO:0001630	splice_region_variant	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.673+1G>A	6.37:g.74466405G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.V225I	ENST00000287097.5	37	c.673	CCDS4982.1	6	.	.	.	.	.	.	.	.	.	.	G	16.61	3.170281	0.57584	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.38887	1.15;1.2;1.11	4.71	3.84	0.44239	.	0.067378	0.64402	D	0.000015	T	0.42854	0.1221	L	0.56340	1.77	0.80722	D	1	D;P;D;P	0.56521	0.971;0.825;0.976;0.826	P;B;P;P	0.61800	0.713;0.371;0.894;0.502	T	0.40905	-0.9538	10	0.87932	D	0	.	8.1098	0.30907	0.1066:0.0:0.8934:0.0	.	148;225;225;225	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	I	225;148;225	ENSP00000388062:V225I;ENSP00000404475:V148I;ENSP00000287097:V225I	ENSP00000287097:V225I	V	+	1	0	CD109	74523126	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.067000	0.64357	2.612000	0.88384	0.585000	0.79938	GTA	CD109	-	NULL	ENSG00000156535		0.303	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	83	0.00	0	G	NM_133493	Missense_Mutation	74466405	74466405	+1	no_errors	ENST00000287097	ensembl	human	known	69_37n	missense	48	29.41	20	SNP	1.000	A
CELF4	56853	genome.wustl.edu	37	18	35145386	35145386	+	Silent	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr18:35145386G>A	ENST00000591282.1	-	1	218	c.219C>T	c.(217-219)ctC>ctT	p.L73L	CELF4_ENST00000361795.5_Silent_p.L73L|CELF4_ENST00000591287.1_Silent_p.L73L|CELF4_ENST00000334919.5_Silent_p.L73L|CELF4_ENST00000420428.2_Silent_p.L73L|CELF4_ENST00000603232.1_Silent_p.L73L|CELF4_ENST00000601019.1_Silent_p.L73L|CELF4_ENST00000412753.1_Silent_p.L73L|CELF4_ENST00000588597.1_Silent_p.L73L			Q9BZC1	CELF4_HUMAN	CUGBP, Elav-like family member 4	73	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.|Sufficient for RNA-binding and MSE- dependent splicing activity.				alternative mRNA splicing, via spliceosome (GO:0000380)|embryo development (GO:0009790)|germ cell development (GO:0007281)|mRNA splice site selection (GO:0006376)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of translation (GO:0017148)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	BRE binding (GO:0042835)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|translation repressor activity, nucleic acid binding (GO:0000900)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(18)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	44						ACTCCTCGAAGAGGGGCTTGA	0.552																																						dbGAP											0													126.0	116.0	119.0					18																	35145386		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF248651	CCDS32818.1, CCDS45857.1, CCDS45858.1	18q12	2013-02-12	2010-02-19	2010-02-19				"""RNA binding motif (RRM) containing"""	14015	protein-coding gene	gene with protein product		612679	"""Bruno (Drosophila) -like 4, RNA binding protein"", ""bruno-like 4, RNA binding protein (Drosophila)"""	BRUNOL4		10893231	Standard	NM_020180		Approved		uc002lae.2	Q9BZC1		ENST00000591282.1:c.219C>T	18.37:g.35145386G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q59EN7|Q86XB9|Q8N2M6|Q9BQ96|Q9NR84|Q9NR85	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L73	ENST00000591282.1	37	c.219	CCDS32818.1	18																																																																																			CELF4	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000101489		0.552	CELF4-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF4	HGNC	protein_coding	OTTHUMT00000440892.1	72	0.00	0	G	NM_020180		35145386	35145386	-1	no_errors	ENST00000361795	ensembl	human	known	69_37n	silent	31	18.42	7	SNP	1.000	A
CHD1L	9557	genome.wustl.edu	37	1	146758174	146758174	+	Missense_Mutation	SNP	G	G	C	rs142193146		TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr1:146758174G>C	ENST00000369258.4	+	18	2238	c.2218G>C	c.(2218-2220)Gta>Cta	p.V740L	CHD1L_ENST00000361293.5_Missense_Mutation_p.V459L|CHD1L_ENST00000369259.3_Missense_Mutation_p.V536L|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000431239.1_Missense_Mutation_p.V646L	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	740	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					TGTGCACTGCGTAGGTACGAG	0.592																																						dbGAP											0													127.0	117.0	120.0					1																	146758174		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.2218G>C	1.37:g.146758174G>C	ENSP00000358262:p.Val740Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_A1pp,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V740L	ENST00000369258.4	37	c.2218	CCDS927.1	1	.	.	.	.	.	.	.	.	.	.	G	16.47	3.132779	0.56828	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.95	3.05	0.35203	Appr-1-p processing (1);	0.178133	0.49305	D	0.000158	T	0.23688	0.0573	L	0.52364	1.645	0.47862	D	0.999532	P;B;P	0.41546	0.754;0.443;0.501	B;B;B	0.38056	0.264;0.158;0.104	T	0.05007	-1.0912	10	0.51188	T	0.08	.	8.3757	0.32442	0.2499:0.0:0.7501:0.0	.	646;536;740	Q86WJ1-2;Q86WJ1-3;Q86WJ1	.;.;CHD1L_HUMAN	L	646;536;740;459	ENSP00000389031:V646L;ENSP00000358263:V536L;ENSP00000358262:V740L;ENSP00000355100:V459L	ENSP00000355100:V459L	V	+	1	0	CHD1L	145224798	0.982000	0.34865	0.991000	0.47740	0.895000	0.52256	1.150000	0.31639	0.854000	0.35336	0.655000	0.94253	GTA	CHD1L	-	pfscan_A1pp	ENSG00000131778		0.592	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	84	0.00	0	G	NM_004284		146758174	146758174	+1	no_errors	ENST00000369258	ensembl	human	known	69_37n	missense	21	46.15	18	SNP	0.998	C
CHRM2	1129	genome.wustl.edu	37	7	136700646	136700646	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr7:136700646A>G	ENST00000445907.2	+	3	1562	c.1034A>G	c.(1033-1035)gAg>gGg	p.E345G	CHRM2_ENST00000401861.1_Missense_Mutation_p.E345G|CHRM2_ENST00000397608.3_Missense_Mutation_p.E345G|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.E345G|CHRM2_ENST00000453373.1_Missense_Mutation_p.E345G|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|CHRM2_ENST00000320658.5_Missense_Mutation_p.E345G|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000586239.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	345					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	ACCACCGTGGAGGTAGTGGGG	0.463																																						dbGAP											0													84.0	85.0	85.0					7																	136700646		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.1034A>G	7.37:g.136700646A>G	ENSP00000399745:p.Glu345Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_M2_rcpt,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	p.E345G	ENST00000445907.2	37	c.1034	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	A	12.64	1.998175	0.35226	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13;-0.13	5.4	5.4	0.78164	GPCR, rhodopsin-like superfamily (1);	0.435209	0.21850	N	0.068192	T	0.62258	0.2413	M	0.71581	2.175	0.58432	D	0.999997	B	0.15141	0.012	B	0.21360	0.034	T	0.58607	-0.7607	10	0.22706	T	0.39	-14.2489	15.427	0.75061	1.0:0.0:0.0:0.0	.	345	P08172	ACM2_HUMAN	G	345	ENSP00000399745:E345G;ENSP00000415386:E345G;ENSP00000319984:E345G;ENSP00000380733:E345G;ENSP00000384937:E345G;ENSP00000384401:E345G	ENSP00000319984:E345G	E	+	2	0	CHRM2	136351186	1.000000	0.71417	0.951000	0.38953	0.958000	0.62258	6.189000	0.72051	2.055000	0.61198	0.533000	0.62120	GAG	CHRM2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_M2_rcpt	ENSG00000181072		0.463	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	38	0.00	0	A			136700646	136700646	+1	no_errors	ENST00000320658	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	1.000	G
CHST15	51363	genome.wustl.edu	37	10	125771954	125771954	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr10:125771954A>T	ENST00000346248.5	-	7	2032	c.1390T>A	c.(1390-1392)Tgg>Agg	p.W464R	CHST15_ENST00000435907.1_Missense_Mutation_p.W464R	NM_015892.4	NP_056976.2	Q7LFX5	CHSTF_HUMAN	carbohydrate (N-acetylgalactosamine 4-sulfate 6-O) sulfotransferase 15	464					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|hexose biosynthetic process (GO:0019319)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	3'-phosphoadenosine 5'-phosphosulfate binding (GO:0050656)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			endometrium(4)|kidney(1)|large_intestine(11)|lung(6)|ovary(3)|stomach(1)	26						ACGCTGAGCCAGTCCAGAAGG	0.498																																						dbGAP											0													127.0	102.0	111.0					10																	125771954		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011170	CCDS7638.1	10q26	2009-07-09			ENSG00000182022	ENSG00000182022	2.8.2.33	"""Sulfotransferases, membrane-bound"""	18137	protein-coding gene	gene with protein product	"""B cell RAG associated protein"", ""N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase"""	608277				9628581, 9754571, 11572857	Standard	NM_014863		Approved	GALNAC4S-6ST, BRAG, KIAA0598	uc001lhm.4	Q7LFX5	OTTHUMG00000019208	ENST00000346248.5:c.1390T>A	10.37:g.125771954A>T	ENSP00000333947:p.Trp464Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O60338|O60474|Q86VM4	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.W464R	ENST00000346248.5	37	c.1390	CCDS7638.1	10	.	.	.	.	.	.	.	.	.	.	A	24.4	4.528442	0.85706	.	.	ENSG00000182022	ENST00000346248;ENST00000435907	T;T	0.62639	0.01;0.01	4.86	4.86	0.63082	Sulfotransferase domain (1);	0.000000	0.85682	D	0.000000	D	0.82342	0.5016	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86558	0.1839	10	0.87932	D	0	-16.9444	14.7455	0.69488	1.0:0.0:0.0:0.0	.	464	Q7LFX5	CHSTF_HUMAN	R	464	ENSP00000333947:W464R;ENSP00000402394:W464R	ENSP00000333947:W464R	W	-	1	0	CHST15	125761944	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	9.279000	0.95777	1.946000	0.56461	0.533000	0.62120	TGG	CHST15	-	pfam_Sulfotransferase_dom	ENSG00000182022		0.498	CHST15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST15	HGNC	protein_coding	OTTHUMT00000050856.1	84	0.00	0	A	NM_015892		125771954	125771954	-1	no_errors	ENST00000346248	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	1.000	T
DARS2	55157	genome.wustl.edu	37	1	173826805	173826805	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr1:173826805T>A	ENST00000361951.4	+	17	2627	c.1900T>A	c.(1900-1902)Tcc>Acc	p.S634T	DARS2_ENST00000471476.1_3'UTR|DARS2_ENST00000239457.5_Missense_Mutation_p.S179T	NM_018122.4	NP_060592.2	Q6PI48	SYDM_HUMAN	aspartyl-tRNA synthetase 2, mitochondrial	634					gene expression (GO:0010467)|mitochondrial asparaginyl-tRNA aminoacylation (GO:0070145)|tRNA aminoacylation (GO:0043039)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	aspartate-tRNA ligase activity (GO:0004815)|aspartate-tRNA(Asn) ligase activity (GO:0050560)|ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(4)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(10)|ovary(1)|pancreas(1)|urinary_tract(1)	30					L-Aspartic Acid(DB00128)	TATCCGAGTCTCCAAGCCAAC	0.483																																						dbGAP											0													104.0	94.0	97.0					1																	173826805		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022754	CCDS1311.1	1q25.1	2011-07-01	2007-02-23		ENSG00000117593	ENSG00000117593	6.1.1.12	"""Aminoacyl tRNA synthetases / Class II"""	25538	protein-coding gene	gene with protein product	"""aspartate tRNA ligase 2, mitochondrial"""	610956				15779907	Standard	NM_018122		Approved	FLJ10514	uc001gjh.2	Q6PI48	OTTHUMG00000034803	ENST00000361951.4:c.1900T>A	1.37:g.173826805T>A	ENSP00000355086:p.Ser634Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_aa-tRNA-synt_II,pfam_GAD_dom,pfam_NA-bd_OB_tRNA-helicase,superfamily_GAD_dom,superfamily_NA-bd_OB-fold-like,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,prints_Lys-tRNA-synth_II_C,tigrfam_Asp-tRNA-synth_IIb_bac/mt	p.S634T	ENST00000361951.4	37	c.1900	CCDS1311.1	1	.	.	.	.	.	.	.	.	.	.	T	7.473	0.647083	0.14516	.	.	ENSG00000117593	ENST00000361951;ENST00000239457	D;D	0.91407	-1.64;-2.84	5.65	1.79	0.24919	.	0.787127	0.12211	N	0.489349	T	0.68705	0.3030	L	0.45285	1.41	0.18873	N	0.999984	B	0.29341	0.242	B	0.29077	0.098	T	0.56269	-0.8007	10	0.12430	T	0.62	-9.4702	2.3984	0.04395	0.2262:0.0815:0.1226:0.5698	.	634	Q6PI48	SYDM_HUMAN	T	634;179	ENSP00000355086:S634T;ENSP00000239457:S179T	ENSP00000239457:S179T	S	+	1	0	DARS2	172093428	0.768000	0.28519	1.000000	0.80357	0.568000	0.35870	1.187000	0.32090	0.945000	0.37605	0.454000	0.30748	TCC	DARS2	-	tigrfam_Asp-tRNA-synth_IIb_bac/mt	ENSG00000117593		0.483	DARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARS2	HGNC	protein_coding	OTTHUMT00000084220.1	33	0.00	0	T	NM_018122		173826805	173826805	+1	no_errors	ENST00000361951	ensembl	human	known	69_37n	missense	42	14.00	7	SNP	0.397	A
DEFB129	140881	genome.wustl.edu	37	20	210186	210186	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr20:210186G>A	ENST00000246105.4	+	2	357	c.326G>A	c.(325-327)aGc>aAc	p.S109N		NM_080831.3	NP_543021.1	Q9H1M3	DB129_HUMAN	defensin, beta 129	109					defense response to bacterium (GO:0042742)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(1)|ovary(1)|stomach(1)	9		all_cancers(10;7.65e-05)|Lung NSC(37;0.0417)|all_epithelial(17;0.0676)|all_lung(30;0.0713)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.122)			AAAAGCACTAGCTTTTTTGCT	0.408																																						dbGAP											0													98.0	97.0	97.0					20																	210186		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358186	CCDS12992.1	20p13	2010-03-30	2002-05-09	2002-05-10	ENSG00000125903	ENSG00000125903		"""Defensins, beta"""	16218	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 87"""	C20orf87		11854508	Standard	NM_080831		Approved	bA530N10.3, DEFB-29	uc002wda.3	Q9H1M3	OTTHUMG00000031618	ENST00000246105.4:c.326G>A	20.37:g.210186G>A	ENSP00000246105:p.Ser109Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NES7	Missense_Mutation	SNP	NULL	p.S109N	ENST00000246105.4	37	c.326	CCDS12992.1	20	.	.	.	.	.	.	.	.	.	.	G	0.306	-0.970572	0.02232	.	.	ENSG00000125903	ENST00000246105	T	0.40476	1.03	3.95	-6.5	0.01884	.	2.642980	0.00948	N	0.002929	T	0.20210	0.0486	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.17471	-1.0368	10	0.09843	T	0.71	1.6538	5.1627	0.15070	0.546:0.0:0.2024:0.2516	.	109	Q9H1M3	DB129_HUMAN	N	109	ENSP00000246105:S109N	ENSP00000246105:S109N	S	+	2	0	DEFB129	158186	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	-1.183000	0.03079	-1.498000	0.01824	-0.217000	0.12591	AGC	DEFB129	-	NULL	ENSG00000125903		0.408	DEFB129-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEFB129	HGNC	protein_coding	OTTHUMT00000077430.2	108	0.00	0	G	NM_080831		210186	210186	+1	no_errors	ENST00000246105	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	0.000	A
DGKD	8527	genome.wustl.edu	37	2	234359581	234359581	+	Silent	SNP	G	G	A	rs370757617		TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr2:234359581G>A	ENST00000264057.2	+	17	2064	c.2052G>A	c.(2050-2052)ccG>ccA	p.P684P	DGKD_ENST00000409813.3_Silent_p.P640P	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	684					blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	CGAAATCTCCGTGTGAAAAGC	0.567																																						dbGAP											0													164.0	152.0	156.0					2																	234359581		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.2052G>A	2.37:g.234359581G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14158|Q6PK55|Q8NG53	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.R345H	ENST00000264057.2	37	c.1034	CCDS2504.1	2																																																																																			DGKD	-	NULL	ENSG00000077044		0.567	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	HGNC	protein_coding	OTTHUMT00000257072.2	45	0.00	0	G	NM_003648		234359581	234359581	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430834	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	0.003	A
DIAPH3	81624	genome.wustl.edu	37	13	60407364	60407364	+	Silent	SNP	C	C	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr13:60407364C>T	ENST00000400324.4	-	24	3124	c.2904G>A	c.(2902-2904)tcG>tcA	p.S968S	DIAPH3_ENST00000400319.1_Silent_p.S898S|DIAPH3_ENST00000267215.4_Silent_p.S968S|DIAPH3_ENST00000465066.1_5'UTR|DIAPH3_ENST00000400320.1_Silent_p.S922S|DIAPH3_ENST00000400330.1_Silent_p.S968S|DIAPH3_ENST00000377908.2_Silent_p.S957S	NM_001042517.1|NM_001258366.1	NP_001035982.1|NP_001245295.1	Q9NSV4	DIAP3_HUMAN	diaphanous-related formin 3	968	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin cytoskeleton organization (GO:0030036)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|liver(1)|lung(20)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46		Breast(118;0.052)|Prostate(109;0.103)|Hepatocellular(98;0.132)		GBM - Glioblastoma multiforme(99;2.77e-05)		CGTGTAACTTCGAAAGTGTCT	0.363																																						dbGAP											0													129.0	116.0	120.0					13																	60407364		1837	4085	5922	-	-	-	SO:0001819	synonymous_variant	0			AL137718	CCDS41898.1, CCDS58294.1, CCDS58295.1, CCDS58296.1, CCDS58297.1, CCDS73579.1, CCDS73580.1	13q21.2	2013-05-24	2013-05-24		ENSG00000139734	ENSG00000139734			15480	protein-coding gene	gene with protein product		614567	"""diaphanous (Drosophila, homolog) 3"", ""auditory neuropathy, autosomal dominant 1"", ""diaphanous homolog 3 (Drosophila)"""	AUNA1		14767582, 20624953	Standard	NM_030932		Approved	DRF3, FLJ34705, AN, NSDAN	uc001vht.4	Q9NSV4	OTTHUMG00000017004	ENST00000400324.4:c.2904G>A	13.37:g.60407364C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3B8|A2A3B9|A2A3C0|Q18P99|Q18PA0|Q18PA1|Q2KPB6|Q3ZK23|Q5JTP8|Q5T2S7|Q5XKF6|Q6MZF0|Q6NUP0|Q86VS4|Q8NAV4	Silent	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Drf_DAD,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.S968	ENST00000400324.4	37	c.2904	CCDS41898.1	13																																																																																			DIAPH3	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000139734		0.363	DIAPH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIAPH3	HGNC	protein_coding	OTTHUMT00000045166.3	83	0.00	0	C	NM_001042517		60407364	60407364	-1	no_errors	ENST00000400324	ensembl	human	known	69_37n	silent	48	17.24	10	SNP	0.000	T
FASTK	10922	genome.wustl.edu	37	7	150774317	150774317	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr7:150774317A>T	ENST00000297532.6	-	8	1375	c.1298T>A	c.(1297-1299)cTg>cAg	p.L433Q	RP11-148K1.12_ENST00000485974.1_RNA|FASTK_ENST00000353841.2_Missense_Mutation_p.L292Q|FASTK_ENST00000540185.1_3'UTR|FASTK_ENST00000489884.1_5'UTR|FASTK_ENST00000482571.1_Missense_Mutation_p.L406Q	NM_006712.4	NP_006703.1	Q14296	FASTK_HUMAN	Fas-activated serine/threonine kinase	433					apoptotic signaling pathway (GO:0097190)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|Fas-activated serine/threonine kinase activity (GO:0033867)|protein serine/threonine kinase activity (GO:0004674)			lung(4)|stomach(2)	6			OV - Ovarian serous cystadenocarcinoma(82;0.00989)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)|LUSC - Lung squamous cell carcinoma(290;0.0718)|Lung(243;0.138)		GGCGCACAGCAGGAAGTCTGG	0.692																																						dbGAP											0													34.0	40.0	38.0					7																	150774317		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS5918.1, CCDS5919.1, CCDS59088.1	7q35	2006-07-06			ENSG00000164896	ENSG00000164896			24676	protein-coding gene	gene with protein product		606965				7544399, 15572676	Standard	NM_006712		Approved	FAST	uc003wix.2	Q14296	OTTHUMG00000158694	ENST00000297532.6:c.1298T>A	7.37:g.150774317A>T	ENSP00000297532:p.Leu433Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K867|F8VTW9|Q59EM8|Q8IVA0	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.L433Q	ENST00000297532.6	37	c.1298	CCDS5918.1	7	.	.	.	.	.	.	.	.	.	.	A	15.59	2.879170	0.51801	.	.	ENSG00000164896	ENST00000483105;ENST00000297530;ENST00000353841;ENST00000297532;ENST00000482571	T;T;T	0.46819	0.86;0.86;0.86	4.91	3.78	0.43462	FAST kinase-like protein, subdomain 2 (1);	0.121554	0.33110	N	0.005265	T	0.48277	0.1491	N	0.19112	0.55	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.79108	0.992;0.977;0.977	T	0.43458	-0.9390	10	0.41790	T	0.15	-20.5718	8.3942	0.32546	0.9099:0.0:0.0901:0.0	.	406;292;433	F8VTW9;Q8IVA0;Q14296	.;.;FASTK_HUMAN	Q	433;433;292;433;406	ENSP00000324817:L292Q;ENSP00000297532:L433Q;ENSP00000418516:L406Q	ENSP00000297530:L433Q	L	-	2	0	FASTK	150405250	0.999000	0.42202	1.000000	0.80357	0.924000	0.55760	2.196000	0.42686	2.144000	0.66660	0.459000	0.35465	CTG	FASTK	-	pfam_FAST_2	ENSG00000164896		0.692	FASTK-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTK	HGNC	protein_coding	OTTHUMT00000351832.2	10	0.00	0	A	NM_006712		150774317	150774317	-1	no_errors	ENST00000297532	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.993	T
FBXW10	10517	genome.wustl.edu	37	17	18670066	18670066	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr17:18670066G>C	ENST00000395665.4	+	9	1816	c.1595G>C	c.(1594-1596)aGa>aCa	p.R532T	FBXW10_ENST00000395667.1_Missense_Mutation_p.R532T|FBXW10_ENST00000308799.4_Missense_Mutation_p.R561T|FBXW10_ENST00000301938.4_Missense_Mutation_p.R532T			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	532										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						AAGACGTTTAGACACAAAGAC	0.522																																						dbGAP											0													67.0	64.0	65.0					17																	18670066		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1595G>C	17.37:g.18670066G>C	ENSP00000379025:p.Arg532Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R561T	ENST00000395665.4	37	c.1682	CCDS11199.3	17	.	.	.	.	.	.	.	.	.	.	G	9.116	1.007894	0.19199	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.17854	2.25;2.25;2.25;2.25	3.09	2.0	0.26442	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.199682	0.41823	U	0.000815	T	0.08403	0.0209	N	0.12663	0.25	0.27949	N	0.937203	B;B;B;B	0.32467	0.372;0.372;0.255;0.372	B;B;B;B	0.32677	0.15;0.15;0.071;0.15	T	0.17531	-1.0366	10	0.49607	T	0.09	.	5.9654	0.19322	0.8626:0.0:0.1374:0.0	.	532;561;532;532	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	T	532;561;532;532	ENSP00000379026:R532T;ENSP00000310382:R561T;ENSP00000306937:R532T;ENSP00000379025:R532T	ENSP00000306937:R532T	R	+	2	0	FBXW10	18610791	1.000000	0.71417	0.979000	0.43373	0.393000	0.30537	2.670000	0.46833	0.316000	0.23135	0.186000	0.17326	AGA	FBXW10	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000171931		0.522	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	HGNC	protein_coding	OTTHUMT00000313531.2	129	0.00	0	G	NM_031456		18670066	18670066	+1	no_errors	ENST00000308799	ensembl	human	known	69_37n	missense	77	18.09	17	SNP	1.000	C
GOLGA6L17P	642402	genome.wustl.edu	37	15	85053254	85053254	+	RNA	SNP	T	T	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr15:85053254T>C	ENST00000414190.2	-	0	198					NR_003246.2																						TACCAACAGCTTCTCCACTCA	0.577																																						dbGAP											0																																										-	-	-			0																															15.37:g.85053254T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000414190.2	37	NULL		15																																																																																			GOLGA6L5	-	-	ENSG00000230373		0.577	GOLGA6L5-003	KNOWN	mRNA_end_NF|basic	processed_transcript	GOLGA6L5	HGNC	pseudogene	OTTHUMT00000418579.1	20	0.00	0	T			85053254	85053254	-1	no_errors	ENST00000414190	ensembl	human	known	69_37n	rna	10	23.08	3	SNP	0.973	C
GOLIM4	27333	genome.wustl.edu	37	3	167750551	167750551	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr3:167750551C>G	ENST00000470487.1	-	9	1622	c.933G>C	c.(931-933)gaG>gaC	p.E311D	GOLIM4_ENST00000309027.4_Missense_Mutation_p.E283D	NM_014498.3	NP_055313.1	O00461	GOLI4_HUMAN	golgi integral membrane protein 4	311	Glu-rich.				transport (GO:0006810)	cis-Golgi network (GO:0005801)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(5)|endometrium(2)|large_intestine(8)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GAAATTCTGCCTCCTTATGGG	0.522																																						dbGAP											0													123.0	124.0	123.0					3																	167750551		2203	4300	6503	-	-	-	SO:0001583	missense	0			U55853	CCDS3204.1	3q26	2007-07-30	2007-07-30	2007-07-30	ENSG00000173905	ENSG00000173905			15448	protein-coding gene	gene with protein product		606805	"""golgi phosphoprotein 4"""	GOLPH4		9201717, 15004235	Standard	NM_014498		Approved	GPP130, GIMPC, P138	uc003ffe.2	O00461	OTTHUMG00000158554	ENST00000470487.1:c.933G>C	3.37:g.167750551C>G	ENSP00000417354:p.Glu311Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E311D	ENST00000470487.1	37	c.933	CCDS3204.1	3	.	.	.	.	.	.	.	.	.	.	C	10.22	1.290147	0.23478	.	.	ENSG00000173905	ENST00000470487;ENST00000309027	.	.	.	5.1	-2.51	0.06365	.	0.431488	0.26331	N	0.024987	T	0.24509	0.0594	L	0.40543	1.245	0.09310	N	1	B;B	0.13594	0.008;0.004	B;B	0.12837	0.008;0.006	T	0.07424	-1.0773	9	0.39692	T	0.17	-2.6027	2.7898	0.05384	0.1338:0.2004:0.1319:0.5339	.	283;311	F8W785;O00461	.;GOLI4_HUMAN	D	311;283	.	ENSP00000309893:E283D	E	-	3	2	GOLIM4	169233245	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.224000	0.09164	-0.655000	0.05387	0.549000	0.68633	GAG	GOLIM4	-	NULL	ENSG00000173905		0.522	GOLIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLIM4	HGNC	protein_coding	OTTHUMT00000351278.2	87	0.00	0	C			167750551	167750551	-1	no_errors	ENST00000470487	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	0.001	G
GRINA	2907	genome.wustl.edu	37	8	145066211	145066211	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr8:145066211T>G	ENST00000313269.5	+	4	936	c.658T>G	c.(658-660)Ttc>Gtc	p.F220V	GRINA_ENST00000395068.4_Missense_Mutation_p.F220V	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	220						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			TTGTGGGGACTTCCGGCGAAA	0.577																																						dbGAP											0													202.0	190.0	194.0					8																	145066211		2203	4300	6503	-	-	-	SO:0001583	missense	0			NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.658T>G	8.37:g.145066211T>G	ENSP00000314380:p.Phe220Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXM7|O43836|Q8IVW7	Missense_Mutation	SNP	pfam_Bax_inhibitor_1-related	p.F220V	ENST00000313269.5	37	c.658	CCDS34961.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.118|8.118	0.780225|0.780225	0.16120|0.16120	.|.	.|.	ENSG00000178719|ENSG00000178719	ENST00000313269;ENST00000529301;ENST00000395068;ENST00000537637|ENST00000534791	T;T;T|.	0.58358|.	0.34;0.34;0.34|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	0.055894|.	0.64402|.	D|.	0.000001|.	T|T	0.26085|0.26085	0.0636|0.0636	N|N	0.03154|0.03154	-0.405|-0.405	0.36278|0.36278	D|D	0.85557|0.85557	B|.	0.16802|.	0.019|.	B|.	0.20955|.	0.032|.	T|T	0.32428|0.32428	-0.9907|-0.9907	10|5	0.16420|.	T|.	0.52|.	-34.4068|-34.4068	10.806|10.806	0.46518|0.46518	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	220|.	Q7Z429|.	GRINA_HUMAN|.	V|R	220;220;220;201|143	ENSP00000314380:F220V;ENSP00000432706:F220V;ENSP00000378507:F220V|.	ENSP00000314380:F220V|.	F|L	+|+	1|2	0|0	GRINA|GRINA	145138199|145138199	0.986000|0.986000	0.35501|0.35501	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	2.826000|2.826000	0.48104|0.48104	2.052000|2.052000	0.61016|0.61016	0.529000|0.529000	0.55759|0.55759	TTC|CTT	GRINA	-	pfam_Bax_inhibitor_1-related	ENSG00000178719		0.577	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GRINA	HGNC	protein_coding	OTTHUMT00000384048.1	40	0.00	0	T	NM_001009184		145066211	145066211	+1	no_errors	ENST00000313269	ensembl	human	known	69_37n	missense	50	10.71	6	SNP	1.000	G
HHLA2	11148	genome.wustl.edu	37	3	108094632	108094632	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr3:108094632G>T	ENST00000357759.5	+	8	1558	c.1144G>T	c.(1144-1146)Gat>Tat	p.D382Y	HHLA2_ENST00000467761.1_Missense_Mutation_p.D382Y|HHLA2_ENST00000491820.1_Intron|HHLA2_ENST00000467562.1_Missense_Mutation_p.D318Y|HHLA2_ENST00000489514.2_Missense_Mutation_p.D382Y	NM_007072.2	NP_009003.1	Q9UM44	HHLA2_HUMAN	HERV-H LTR-associating 2	382					positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(14)|ovary(1)	18						acaccctgctgatggagccca	0.493																																						dbGAP											0													60.0	67.0	65.0					3																	108094632		1929	4135	6064	-	-	-	SO:0001583	missense	0			AF126162	CCDS46883.1, CCDS63713.1, CCDS74975.1	3q13.13	2013-01-11			ENSG00000114455	ENSG00000114455		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C1-set domain containing"""	4905	protein-coding gene	gene with protein product		604371				10444326	Standard	NM_007072		Approved	B7H7	uc003dwz.3	Q9UM44	OTTHUMG00000159224	ENST00000357759.5:c.1144G>T	3.37:g.108094632G>T	ENSP00000350402:p.Asp382Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKN2|D3DN60|Q9NWQ6	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.D382Y	ENST00000357759.5	37	c.1144	CCDS46883.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.809|7.809	0.715248|0.715248	0.15306|0.15306	.|.	.|.	ENSG00000114455|ENSG00000114455	ENST00000467562;ENST00000357759;ENST00000467761;ENST00000489514|ENST00000482099	T;T;T;T|.	0.15372|.	2.43;4.64;4.64;4.64|.	3.3|3.3	-4.32|-4.32	0.03688|0.03688	.|.	.|.	.|.	.|.	.|.	T|.	0.09598|.	0.0236|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.18461|.	0.028;0.028|.	B;B|.	0.11329|.	0.006;0.006|.	T|.	0.25117|.	-1.0141|.	9|.	0.87932|.	D|.	0|.	0.22|0.22	0.2964|0.2964	0.00266|0.00266	0.2745:0.1439:0.2915:0.2901|0.2745:0.1439:0.2915:0.2901	.|.	318;382|.	B4DKN2;Q9UM44|.	.;HHLA2_HUMAN|.	Y|L	318;382;382;382|284	ENSP00000418345:D318Y;ENSP00000350402:D382Y;ENSP00000419207:D382Y;ENSP00000417856:D382Y|.	ENSP00000350402:D382Y|.	D|X	+|+	1|2	0|2	HHLA2|HHLA2	109577322|109577322	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.139000|0.139000	0.21198|0.21198	-0.317000|-0.317000	0.08060|0.08060	-1.080000|-1.080000	0.03109|0.03109	0.561000|0.561000	0.74099|0.74099	GAT|TGA	HHLA2	-	NULL	ENSG00000114455		0.493	HHLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HHLA2	HGNC	protein_coding	OTTHUMT00000353924.1	79	0.00	0	G	NM_007072		108094632	108094632	+1	no_errors	ENST00000357759	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	0.000	T
IL1RAPL1	11141	genome.wustl.edu	37	X	29301321	29301321	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chrX:29301321G>A	ENST00000378993.1	+	3	1022	c.349G>A	c.(349-351)Gcc>Acc	p.A117T	IL1RAPL1_ENST00000302196.4_Missense_Mutation_p.A117T	NM_014271.3	NP_055086.1	Q9NZN1	IRPL1_HUMAN	interleukin 1 receptor accessory protein-like 1	117	Ig-like C2-type 1.				calcium ion transmembrane transport (GO:0070588)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of exocytosis (GO:0045920)|neuron differentiation (GO:0030182)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor binding (GO:0005102)|voltage-gated calcium channel activity (GO:0005245)			biliary_tract(1)|breast(1)|endometrium(5)|large_intestine(9)|lung(38)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62						TGGTCTCTACGCCTGTGTCAT	0.433																																						dbGAP											0													82.0	72.0	76.0					X																	29301321		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ243874	CCDS14218.1	Xp22.1-p21.3	2013-01-29	2004-02-13		ENSG00000169306	ENSG00000169306		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5996	protein-coding gene	gene with protein product		300206	"""mental retardation, X-linked 34"", ""mental retardation, X-linked 21"", ""mental retardation, X-linked 10"""	IL1RAPL, MRX34, MRX21, MRX10		10471494, 10757639	Standard	NM_014271		Approved	OPHN4, TIGIRR-2, IL1R8	uc004dby.2	Q9NZN1	OTTHUMG00000021317	ENST00000378993.1:c.349G>A	X.37:g.29301321G>A	ENSP00000368278:p.Ala117Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVG4|Q9UJ53	Missense_Mutation	SNP	pfam_TIR_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_TIR_dom,smart_Ig_sub,smart_Ig_sub2,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom,pfscan_Ig-like	p.A117T	ENST00000378993.1	37	c.349	CCDS14218.1	X	.	.	.	.	.	.	.	.	.	.	G	2.989	-0.208551	0.06140	.	.	ENSG00000169306	ENST00000378993;ENST00000302196	T;T	0.73789	-0.78;-0.78	5.81	5.81	0.92471	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.119478	0.64402	D	0.000019	T	0.37679	0.1012	N	0.00224	-1.81	0.37230	D	0.905634	B	0.18741	0.03	B	0.13407	0.009	T	0.57289	-0.7837	10	0.02654	T	1	.	17.9294	0.88992	0.0:0.0:1.0:0.0	.	117	Q9NZN1	IRPL1_HUMAN	T	117	ENSP00000368278:A117T;ENSP00000305200:A117T	ENSP00000305200:A117T	A	+	1	0	IL1RAPL1	29211242	1.000000	0.71417	0.950000	0.38849	0.740000	0.42216	6.993000	0.76245	2.454000	0.82982	0.600000	0.82982	GCC	IL1RAPL1	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000169306		0.433	IL1RAPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL1	HGNC	protein_coding	OTTHUMT00000056155.1	40	0.00	0	G	NM_014271		29301321	29301321	+1	no_errors	ENST00000302196	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	0.985	A
KCNJ2	3759	genome.wustl.edu	37	17	68171571	68171571	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr17:68171571G>A	ENST00000243457.3	+	2	774	c.391G>A	c.(391-393)Gct>Act	p.A131T	KCNJ2_ENST00000535240.1_Missense_Mutation_p.A131T	NM_000891.2	NP_000882.1	P63252	KCNJ2_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 2	131					cardiac muscle cell action potential involved in contraction (GO:0086002)|cellular potassium ion homeostasis (GO:0030007)|cellular response to mechanical stimulus (GO:0071260)|magnesium ion transport (GO:0015693)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion import (GO:0010107)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of resting membrane potential (GO:0060075)|regulation of skeletal muscle contraction via regulation of action potential (GO:0014861)|relaxation of cardiac muscle (GO:0055119)|relaxation of skeletal muscle (GO:0090076)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of membrane (GO:0031224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(13)|skin(1)|urinary_tract(1)	25	Breast(10;1.64e-08)					CAGCTTCACGGCTGCCTTCCT	0.498																																						dbGAP											0													160.0	160.0	160.0					17																	68171571		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF011904	CCDS11688.1	17q24.3	2014-09-17				ENSG00000123700		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6263	protein-coding gene	gene with protein product		600681				7696590, 11240146, 16382105	Standard	NM_000891		Approved	Kir2.1, IRK1, LQT7	uc002jir.3	P63252		ENST00000243457.3:c.391G>A	17.37:g.68171571G>A	ENSP00000243457:p.Ala131Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15110|P48049	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,pfam_K_chnl_inward-rec_Kir_N,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir2.1	p.A131T	ENST00000243457.3	37	c.391	CCDS11688.1	17	.	.	.	.	.	.	.	.	.	.	G	17.30	3.353499	0.61293	.	.	ENSG00000123700	ENST00000535240;ENST00000243457	D;D	0.95724	-3.79;-3.79	5.92	5.92	0.95590	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.000000	0.85682	D	0.000000	D	0.94282	0.8163	L	0.39085	1.19	0.80722	D	1	B	0.33103	0.397	B	0.41917	0.37	D	0.91702	0.5374	9	.	.	.	.	20.3242	0.98691	0.0:0.0:1.0:0.0	.	131	P63252	IRK2_HUMAN	T	131	ENSP00000441848:A131T;ENSP00000243457:A131T	.	A	+	1	0	KCNJ2	65683166	1.000000	0.71417	0.802000	0.32245	0.956000	0.61745	9.869000	0.99810	2.811000	0.96726	0.555000	0.69702	GCT	KCNJ2	-	pfam_K_chnl_inward-rec_Kir_Cr2,pirsf_K_chnl_inward-rec_Kir	ENSG00000123700		0.498	KCNJ2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNJ2	HGNC	protein_coding	OTTHUMT00000450889.1	59	0.00	0	G	NM_000891		68171571	68171571	+1	no_errors	ENST00000243457	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	0.999	A
KCNT2	343450	genome.wustl.edu	37	1	196251440	196251440	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr1:196251440C>A	ENST00000294725.9	-	24	3659	c.2744G>T	c.(2743-2745)gGa>gTa	p.G915V	KCNT2_ENST00000609185.1_Missense_Mutation_p.G841V|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000367433.5_Missense_Mutation_p.G891V|KCNT2_ENST00000451324.2_3'UTR|KCNT2_ENST00000367431.4_Missense_Mutation_p.G841V			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	915					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						AGTGTCCAGTCCCAACAGAAG	0.308																																						dbGAP											0													71.0	83.0	79.0					1																	196251440		2203	4299	6502	-	-	-	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.2744G>T	1.37:g.196251440C>A	ENSP00000294725:p.Gly915Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.G915V	ENST00000294725.9	37	c.2744	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	C	27.3	4.819351	0.90873	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000294725	T;T;T	0.77098	-1.07;-1.07;-1.07	6.16	6.16	0.99307	.	0.000000	0.64402	D	0.000009	D	0.90270	0.6957	M	0.87547	2.89	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;1.0;0.999;1.0	D	0.90519	0.4487	10	0.72032	D	0.01	-20.6404	19.6313	0.95704	0.0:1.0:0.0:0.0	.	915;873;891;841;915	A9LNM6;Q6UVM3-4;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;.;KCNT2_HUMAN	V	891;841;915	ENSP00000356403:G891V;ENSP00000356401:G841V;ENSP00000294725:G915V	ENSP00000294725:G915V	G	-	2	0	KCNT2	194518063	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.201000	0.77847	2.937000	0.99478	0.650000	0.86243	GGA	KCNT2	-	NULL	ENSG00000162687		0.308	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	74	0.00	0	C	NM_198503		196251440	196251440	-1	no_errors	ENST00000294725	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	1.000	A
CCAR2	57805	genome.wustl.edu	37	8	22470552	22470552	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr8:22470552C>T	ENST00000308511.4	+	8	856	c.607C>T	c.(607-609)Cgc>Tgc	p.R203C	CCAR2_ENST00000520861.1_5'UTR|CCAR2_ENST00000389279.3_Missense_Mutation_p.R203C|RP11-582J16.5_ENST00000521025.1_RNA			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	203					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)	p.R203C(1)									CTCCAAGAAACGCAAACAGCG	0.488																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											112.0	93.0	100.0					8																	22470552		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.607C>T	8.37:g.22470552C>T	ENSP00000310670:p.Arg203Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.R203C	ENST00000308511.4	37	c.607	CCDS34863.1	8	.	.	.	.	.	.	.	.	.	.	C	26.9	4.781627	0.90282	.	.	ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000522599	T;T;T	0.56444	1.27;1.27;0.46	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	T	0.64316	0.2587	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	T	0.65100	-0.6250	10	0.87932	D	0	-18.089	17.4969	0.87720	0.0:1.0:0.0:0.0	.	203	Q8N163	K1967_HUMAN	C	203;203;21	ENSP00000310670:R203C;ENSP00000373930:R203C;ENSP00000429739:R21C	ENSP00000310670:R203C	R	+	1	0	KIAA1967	22526497	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.102000	0.57776	2.941000	0.99782	0.655000	0.94253	CGC	KIAA1967	-	NULL	ENSG00000158941		0.488	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1967	HGNC	protein_coding	OTTHUMT00000375865.1	27	0.00	0	C	NM_021174		22470552	22470552	+1	no_errors	ENST00000308511	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	T
L1CAM	3897	genome.wustl.edu	37	X	153129922	153129922	+	Silent	SNP	A	A	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chrX:153129922A>G	ENST00000370060.1	-	25	3366	c.3177T>C	c.(3175-3177)ggT>ggC	p.G1059G	L1CAM_ENST00000370055.1_Silent_p.G1054G|L1CAM_ENST00000543994.1_Silent_p.G1061G|L1CAM_ENST00000370057.3_Silent_p.G1059G|L1CAM_ENST00000538883.1_Silent_p.G1061G|L1CAM_ENST00000361699.4_Silent_p.G1059G|L1CAM_ENST00000361981.3_Silent_p.G1054G	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	1059	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGGAAGCCCCACCCTTCTCTT	0.617																																						dbGAP											0													100.0	89.0	93.0					X																	153129922		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.3177T>C	X.37:g.153129922A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G1061	ENST00000370060.1	37	c.3183	CCDS14733.1	X																																																																																			L1CAM	-	superfamily_Fibronectin_type3	ENSG00000198910		0.617	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	24	0.00	0	A	NM_024003		153129922	153129922	-1	no_errors	ENST00000543994	ensembl	human	known	69_37n	silent	26	15.62	5	SNP	0.000	G
LONP2	83752	genome.wustl.edu	37	16	48304031	48304031	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr16:48304031A>G	ENST00000285737.4	+	7	1180	c.1087A>G	c.(1087-1089)Aaa>Gaa	p.K363E	LONP2_ENST00000535754.1_Missense_Mutation_p.K319E	NM_031490.2	NP_113678.2			lon peptidase 2, peroxisomal											breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31						CAGACAGCTCAAAAATAACCT	0.468																																						dbGAP											0													89.0	84.0	86.0					16																	48304031		2200	4300	6500	-	-	-	SO:0001583	missense	0			AJ548761	CCDS10734.1, CCDS73880.1	16q12.1	2010-04-21			ENSG00000102910	ENSG00000102910		"""ATPases / AAA-type"""	20598	protein-coding gene	gene with protein product						14561759	Standard	XM_005256191		Approved	MGC4840, LONP, LONPL	uc002efi.1	Q86WA8	OTTHUMG00000133144	ENST00000285737.4:c.1087A>G	16.37:g.48304031A>G	ENSP00000285737:p.Lys363Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Pept_S16_C,pfam_Pept_S16_N,pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_PUA-like_domain,smart_Pept_S16_N,smart_AAA+_ATPase,tigrfam_Pept_S16_lon	p.K363E	ENST00000285737.4	37	c.1087	CCDS10734.1	16	.	.	.	.	.	.	.	.	.	.	A	23.6	4.438480	0.83885	.	.	ENSG00000102910	ENST00000285737;ENST00000544734;ENST00000535754;ENST00000416006	T;T;T	0.39406	1.08;1.08;1.08	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.71626	0.3362	M	0.93763	3.455	0.50171	D	0.999853	D;D	0.69078	0.996;0.997	P;D	0.65010	0.907;0.931	T	0.78866	-0.2035	10	0.49607	T	0.09	-26.2087	15.8713	0.79122	1.0:0.0:0.0:0.0	.	319;363	B7ZKL7;Q86WA8	.;LONP2_HUMAN	E	363;92;319;319	ENSP00000285737:K363E;ENSP00000445426:K319E;ENSP00000415983:K319E	ENSP00000285737:K363E	K	+	1	0	LONP2	46861532	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	7.278000	0.78587	2.144000	0.66660	0.533000	0.62120	AAA	LONP2	-	tigrfam_Pept_S16_lon	ENSG00000102910		0.468	LONP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONP2	HGNC	protein_coding	OTTHUMT00000256839.2	59	0.00	0	A	NM_031490		48304031	48304031	+1	no_errors	ENST00000285737	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	1.000	G
LRCH2	57631	genome.wustl.edu	37	X	114414224	114414224	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chrX:114414224G>T	ENST00000317135.8	-	4	742	c.712C>A	c.(712-714)Cat>Aat	p.H238N	LRCH2_ENST00000538422.1_Missense_Mutation_p.H238N	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	238										breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						GGCAAAACATGAAGATTATTT	0.303																																						dbGAP											0													49.0	44.0	45.0					X																	114414224		1805	4042	5847	-	-	-	SO:0001583	missense	0			AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.712C>A	X.37:g.114414224G>T	ENSP00000325091:p.His238Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H2T1|Q08AD5|Q9HA88|Q9P233	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,superfamily_NA-bd_OB-fold-like,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.H238N	ENST00000317135.8	37	c.712	CCDS48155.1	X	.	.	.	.	.	.	.	.	.	.	G	9.882	1.201783	0.22121	.	.	ENSG00000130224	ENST00000317135;ENST00000538422	T;T	0.23754	1.89;2.27	5.11	5.11	0.69529	.	0.360786	0.31589	N	0.007387	T	0.17323	0.0416	N	0.16166	0.38	0.45490	D	0.998453	B;P	0.38195	0.009;0.622	B;B	0.38500	0.02;0.275	T	0.08289	-1.0729	10	0.18276	T	0.48	-5.1984	16.3096	0.82864	0.0:0.0:1.0:0.0	.	238;238	Q5VUJ6;F5H2T1	LRCH2_HUMAN;.	N	238	ENSP00000325091:H238N;ENSP00000439366:H238N	ENSP00000325091:H238N	H	-	1	0	LRCH2	114320480	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	8.767000	0.91732	2.243000	0.73865	0.538000	0.68166	CAT	LRCH2	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000130224		0.303	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	HGNC	protein_coding	OTTHUMT00000057971.2	45	0.00	0	G	NM_020871		114414224	114414224	-1	no_errors	ENST00000317135	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	1.000	T
LYRM5	144363	genome.wustl.edu	37	12	25356905	25356908	+	Frame_Shift_Del	DEL	TTCT	TTCT	-			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	TTCT	TTCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr12:25356905_25356908delTTCT	ENST00000381356.4	+	2	174_177	c.15_18delTTCT	c.(13-18)aattctfs	p.NS5fs	LYRM5_ENST00000556885.1_Frame_Shift_Del_p.NS3fs|LYRM5_ENST00000554266.1_Frame_Shift_Del_p.NS3fs|LYRM5_ENST00000553788.1_Frame_Shift_Del_p.NS3fs|LYRM5_ENST00000556927.1_Frame_Shift_Del_p.NS3fs|LYRM5_ENST00000556402.1_Frame_Shift_Del_p.NS3fs|LYRM5_ENST00000556351.1_Frame_Shift_Del_p.NS3fs|LYRM5_ENST00000555711.1_Frame_Shift_Del_p.NS3fs|LYRM5_ENST00000557540.2_Frame_Shift_Del_p.NS3fs	NM_001001660.2	NP_001001660.2	Q6IPR1	LYRM5_HUMAN	LYR motif containing 5	5						mitochondrion (GO:0005739)		p.S6Y(1)		large_intestine(3)	3	all_cancers(2;4.75e-35)|all_epithelial(2;1.91e-37)|all_lung(3;1.07e-23)|Lung NSC(3;5.49e-23)|Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.0016)|Melanoma(3;0.0301)|Colorectal(261;0.11)|Ovarian(17;0.12)		OV - Ovarian serous cystadenocarcinoma(3;2.21e-21)|Epithelial(3;8.04e-19)|all cancers(3;2.26e-16)|STAD - Stomach adenocarcinoma(2;0.00138)			AAATGGCCAATTCTTTAAGAGGAG	0.235																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK057730	CCDS53764.1	12p12.1	2006-09-19				ENSG00000205707		"""LYR motif containing"""	27052	protein-coding gene	gene with protein product							Standard	NM_001001660		Approved		uc001rgn.3	Q6IPR1		ENST00000381356.4:c.15_18delTTCT	12.37:g.25356905_25356908delTTCT	ENSP00000370761:p.Asn5fs	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KPI7	Frame_Shift_Del	DEL	pfam_Complex1_LYR	p.S6fs	ENST00000381356.4	37	c.15_18	CCDS53764.1	12																																																																																			LYRM5	-	NULL	ENSG00000205707		0.235	LYRM5-201	KNOWN	basic|CCDS	protein_coding	LYRM5	HGNC	protein_coding		61	0.00	0	TTCT	NM_001001660		25356905	25356908	+1	no_errors	ENST00000381356	ensembl	human	known	69_37n	frame_shift_del	33	15.38	6	DEL	1.000:1.000:1.000:0.992	-
MT1M	4499	genome.wustl.edu	37	16	56666647	56666647	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr16:56666647G>A	ENST00000379818.3	+	1	503	c.4G>A	c.(4-6)Gac>Aac	p.D2N	AC026461.1_ENST00000600389.1_5'Flank	NM_176870.2	NP_789846.1	Q8N339	MT1M_HUMAN	metallothionein 1M	2	Beta.				cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	5						GCTCGAAATGGACCCCAACTG	0.622																																						dbGAP											0													67.0	72.0	71.0					16																	56666647		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF136177	CCDS42166.1	16q13	2008-02-05				ENSG00000205364		"""Metallothioneins"""	14296	protein-coding gene	gene with protein product		156357	"""metallothionein 1K"""	MT1, MT1K		2286373, 8049263	Standard	NM_176870		Approved		uc002ejn.3	Q8N339		ENST00000379818.3:c.4G>A	16.37:g.56666647G>A	ENSP00000369146:p.Asp2Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDN3	Missense_Mutation	SNP	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom,prints_Metalthion_vert	p.D2N	ENST00000379818.3	37	c.4	CCDS42166.1	16	.	.	.	.	.	.	.	.	.	.	G	18.92	3.725088	0.68959	.	.	ENSG00000205364	ENST00000379818	T	0.14391	2.51	2.61	2.61	0.31194	Metallothionein domain, vertebrate (1);Metallothionein domain (1);	0.000000	0.64402	U	0.000014	T	0.26122	0.0637	.	.	.	0.35635	D	0.81055	D	0.55172	0.97	P	0.58013	0.831	T	0.30736	-0.9968	9	0.62326	D	0.03	.	8.7876	0.34830	0.0:0.0:1.0:0.0	.	2	Q8N339	MT1M_HUMAN	N	2	ENSP00000369146:D2N	ENSP00000369146:D2N	D	+	1	0	MT1M	55224148	1.000000	0.71417	0.844000	0.33320	0.103000	0.19146	3.999000	0.57031	1.466000	0.48025	0.306000	0.20318	GAC	MT1M	-	pfam_Metalthion_sfam_euk,superfamily_Metalthion_dom	ENSG00000205364		0.622	MT1M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1M	HGNC	protein_coding	OTTHUMT00000434359.1	49	0.00	0	G	NM_176870		56666647	56666647	+1	no_errors	ENST00000379818	ensembl	human	known	69_37n	missense	14	41.67	10	SNP	0.967	A
MUC17	140453	genome.wustl.edu	37	7	100681604	100681604	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr7:100681604C>A	ENST00000306151.4	+	3	6971	c.6907C>A	c.(6907-6909)Cct>Act	p.P2303T		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2303	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCAACAACTCCTGTTGACTC	0.483																																						dbGAP											0													225.0	227.0	226.0					7																	100681604		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.6907C>A	7.37:g.100681604C>A	ENSP00000302716:p.Pro2303Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.P2303T	ENST00000306151.4	37	c.6907	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	2.040	-0.420280	0.04734	.	.	ENSG00000169876	ENST00000306151	T	0.03212	4.01	0.997	-0.136	0.13473	.	.	.	.	.	T	0.01454	0.0047	N	0.24115	0.695	0.09310	N	0.999998	P	0.47604	0.898	B	0.28849	0.095	T	0.30909	-0.9962	9	0.05721	T	0.95	.	5.0035	0.14277	0.0:0.7273:0.0:0.2727	.	2303	Q685J3	MUC17_HUMAN	T	2303	ENSP00000302716:P2303T	ENSP00000302716:P2303T	P	+	1	0	MUC17	100468324	0.000000	0.05858	0.102000	0.21198	0.056000	0.15407	-4.813000	0.00182	0.494000	0.27859	0.134000	0.15878	CCT	MUC17	-	NULL	ENSG00000169876		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	40	0.00	0	C	NM_001040105		100681604	100681604	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	90	10.89	11	SNP	0.596	A
MUC20	200958	genome.wustl.edu	37	3	195452814	195452814	+	Missense_Mutation	SNP	C	C	T	rs199753483		TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr3:195452814C>T	ENST00000447234.2	+	2	1466	c.1340C>T	c.(1339-1341)aCg>aTg	p.T447M	MUC20_ENST00000436408.1_Missense_Mutation_p.T447M|MUC20_ENST00000445522.2_Missense_Mutation_p.T412M|MUC20_ENST00000320736.6_Missense_Mutation_p.T276M	NM_001282506.1	NP_001269435.1	Q8N307	MUC20_HUMAN	mucin 20, cell surface associated	447					activation of MAPK activity (GO:0000187)|cellular protein metabolic process (GO:0044267)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein homooligomerization (GO:0051260)	basal plasma membrane (GO:0009925)|cell projection (GO:0042995)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)				NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(1)	23	all_cancers(143;1.8e-08)|Ovarian(172;0.0634)	Lung NSC(153;0.191)	Epithelial(36;1e-21)|all cancers(36;9.02e-20)|OV - Ovarian serous cystadenocarcinoma(49;1.6e-18)|Lung(62;0.000104)|LUSC - Lung squamous cell carcinoma(58;0.000128)	GBM - Glioblastoma multiforme(46;1.66e-05)		CTCATCCCCACGGAAGGGGTG	0.537																																						dbGAP											0													35.0	31.0	32.0					3																	195452814		2053	4183	6236	-	-	-	SO:0001583	missense	0			AB037780	CCDS63877.1	3q29	2008-08-07	2006-03-14		ENSG00000176945	ENSG00000176945		"""Mucins"""	23282	protein-coding gene	gene with protein product		610360				14565953	Standard	NM_001282506		Approved	FLJ14408, KIAA1359	uc010hzo.3	Q8N307	OTTHUMG00000155823	ENST00000447234.2:c.1340C>T	3.37:g.195452814C>T	ENSP00000414350:p.Thr447Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX97|Q76I83|Q76I85|Q86ST8|Q8NBY6|Q96KA1|Q9P2I8	Missense_Mutation	SNP	NULL	p.T447M	ENST00000447234.2	37	c.1340		3	.	.	.	.	.	.	.	.	.	.	C	14.09	2.432260	0.43122	.	.	ENSG00000176945	ENST00000447234;ENST00000320736;ENST00000436408;ENST00000445522	T;T;T;T	0.18016	2.67;2.72;2.84;2.24	4.38	3.51	0.40186	.	1.054240	0.07475	N	0.902873	T	0.29093	0.0723	L	0.34521	1.04	0.09310	N	1	D	0.89917	1.0	D	0.66196	0.942	T	0.20174	-1.0283	10	0.62326	D	0.03	0.7157	8.4723	0.32993	0.0:0.8925:0.0:0.1075	.	276	E9PH32	.	M	447;276;447;412	ENSP00000414350:T447M;ENSP00000325431:T276M;ENSP00000396774:T447M;ENSP00000405629:T412M	ENSP00000325431:T276M	T	+	2	0	MUC20	196938485	0.000000	0.05858	0.002000	0.10522	0.014000	0.08584	-0.101000	0.10973	1.198000	0.43158	0.514000	0.50259	ACG	MUC20	-	NULL	ENSG00000176945		0.537	MUC20-001	KNOWN	basic|appris_candidate	protein_coding	MUC20	HGNC	protein_coding	OTTHUMT00000341835.1	29	0.00	0	C	NM_152673		195452814	195452814	+1	no_errors	ENST00000447234	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	0.002	T
MUC5B	727897	genome.wustl.edu	37	11	1266156	1266156	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr11:1266156G>C	ENST00000529681.1	+	31	8104	c.8046G>C	c.(8044-8046)caG>caC	p.Q2682H	MUC5B_ENST00000447027.1_Missense_Mutation_p.Q2685H|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2682	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CTAGCACACAGACCAGTGGTA	0.622																																						dbGAP											0													31.0	41.0	38.0					11																	1266156		1835	3998	5833	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8046G>C	11.37:g.1266156G>C	ENSP00000436812:p.Gln2682His	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.Q2685H	ENST00000529681.1	37	c.8055	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	g	2.494	-0.316713	0.05386	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.19938	2.11;2.3	1.96	1.96	0.26148	.	.	.	.	.	T	0.13543	0.0328	L	0.53249	1.67	0.09310	N	1	P;P	0.47034	0.889;0.889	B;B	0.28385	0.089;0.089	T	0.30387	-0.9980	9	0.87932	D	0	.	4.5025	0.11870	0.2059:0.0:0.7941:0.0	.	3320;2685	A7Y9J9;E9PBJ0	.;.	H	2682;2685;2654;2697	ENSP00000436812:Q2682H;ENSP00000415793:Q2685H	ENSP00000343037:Q2654H	Q	+	3	2	MUC5B	1222732	0.068000	0.21057	0.001000	0.08648	0.039000	0.13416	0.923000	0.28757	1.059000	0.40554	0.205000	0.17691	CAG	MUC5B	-	NULL	ENSG00000117983		0.622	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	30	0.00	0	G	XM_001126093		1266156	1266156	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	0.001	C
MYO5B	4645	genome.wustl.edu	37	18	47518741	47518741	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr18:47518741G>T	ENST00000285039.7	-	6	972	c.673C>A	c.(673-675)Cag>Aag	p.Q225K		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	225	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AAGCCAATCTGGATGTACTTG	0.488																																						dbGAP											0													237.0	222.0	227.0					18																	47518741		1969	4159	6128	-	-	-	SO:0001583	missense	0			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.673C>A	18.37:g.47518741G>T	ENSP00000285039:p.Gln225Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q225K	ENST00000285039.7	37	c.673	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121208	0.56613	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.95069	-3.6	5.65	4.76	0.60689	Myosin head, motor domain (3);	0.123668	0.56097	D	0.000033	D	0.92264	0.7546	L	0.43598	1.365	0.80722	D	1	B;B	0.18461	0.028;0.003	B;B	0.25614	0.062;0.01	D	0.89445	0.3726	10	0.59425	D	0.04	.	16.2204	0.82255	0.0:0.1379:0.8621:0.0	.	224;225	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	K	225;224	ENSP00000285039:Q225K	ENSP00000285039:Q225K	Q	-	1	0	MYO5B	45772739	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.584000	0.46102	1.485000	0.48380	0.655000	0.94253	CAG	MYO5B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000167306		0.488	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	163	0.00	0	G			47518741	47518741	-1	no_errors	ENST00000285039	ensembl	human	known	69_37n	missense	52	24.64	17	SNP	1.000	T
OMA1	115209	genome.wustl.edu	37	1	58999654	58999654	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr1:58999654C>T	ENST00000371226.3	-	5	1095	c.982G>A	c.(982-984)Gaa>Aaa	p.E328K	OMA1_ENST00000467063.1_5'Flank|DAB1_ENST00000485760.1_Intron|OMA1_ENST00000358603.2_Missense_Mutation_p.E328K	NM_145243.3	NP_660286.1	Q96E52	OMA1_HUMAN	OMA1 zinc metallopeptidase	328					cristae formation (GO:0042407)|diet induced thermogenesis (GO:0002024)|energy homeostasis (GO:0097009)|glucose metabolic process (GO:0006006)|lipid metabolic process (GO:0006629)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrial protein processing (GO:0034982)|negative regulation of mitochondrial fusion (GO:0010637)|response to stress (GO:0006950)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(1)|large_intestine(6)|liver(2)|lung(6)|prostate(1)|skin(1)	18	all_cancers(7;6.54e-05)					TGTGCTATTTCATGGCCCAGA	0.338																																						dbGAP											0													103.0	103.0	103.0					1																	58999654		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091101	CCDS608.1	1p32.2-p32.1	2013-05-03	2013-05-03		ENSG00000162600	ENSG00000162600			29661	protein-coding gene	gene with protein product	"""overlapping activity with M-AAA protease"", ""zinc metallopeptidase OMA1"""		"""OMA1 zinc metallopeptidase homolog (S. cerevisiae)"""			12477932	Standard	NM_145243		Approved	MPRP-1, YKR087C, ZMPOMA1, FLJ33782	uc001cyy.3	Q96E52	OTTHUMG00000010068	ENST00000371226.3:c.982G>A	1.37:g.58999654C>T	ENSP00000360270:p.Glu328Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ54|Q5T3G6|Q5T3G7|Q5T3G8|Q5T3G9|Q5T3H0|Q8NBB3	Missense_Mutation	SNP	pfam_Peptidase_M48	p.E328K	ENST00000371226.3	37	c.982	CCDS608.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.068617	0.93950	.	.	ENSG00000162600	ENST00000358603;ENST00000371226	D;D	0.96459	-4.02;-4.02	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.98795	0.9594	H	0.95884	3.735	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99640	1.0988	10	0.87932	D	0	-20.3287	18.1343	0.89612	0.0:1.0:0.0:0.0	.	328;328	Q96E52;Q96E52-2	OMA1_HUMAN;.	K	328	ENSP00000351417:E328K;ENSP00000360270:E328K	ENSP00000351417:E328K	E	-	1	0	OMA1	58772242	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.860000	0.75473	2.521000	0.84997	0.563000	0.77884	GAA	OMA1	-	pfam_Peptidase_M48	ENSG00000162600		0.338	OMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OMA1	HGNC	protein_coding	OTTHUMT00000027819.1	59	0.00	0	C	NM_145243		58999654	58999654	-1	no_errors	ENST00000371226	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	1.000	T
NLRP3	114548	genome.wustl.edu	37	1	247582310	247582310	+	Missense_Mutation	SNP	G	G	A	rs117287351	byFrequency	TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr1:247582310G>A	ENST00000336119.3	+	1	960	c.214G>A	c.(214-216)Gtg>Atg	p.V72M	NLRP3_ENST00000391827.2_Missense_Mutation_p.V72M|NLRP3_ENST00000366497.2_Missense_Mutation_p.V72M|NLRP3_ENST00000366496.2_Missense_Mutation_p.V72M|NLRP3_ENST00000391828.3_Missense_Mutation_p.V72M|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000348069.2_Missense_Mutation_p.V72M	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	72	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GGCCATGGCCGTGTGGATCTT	0.512													G|||	11	0.00219649	0.0	0.0	5008	,	,		13380	0.0109		0.0	False		,,,				2504	0.0					dbGAP											0													72.0	64.0	67.0					1																	247582310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.214G>A	1.37:g.247582310G>A	ENSP00000337383:p.Val72Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.V72M	ENST00000336119.3	37	c.214	CCDS1632.1	1	10	0.004578754578754579	0	0.0	0	0.0	10	0.017482517482517484	0	0.0	G	16.49	3.137600	0.56936	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59	4.49	-4.64	0.03349	Pyrin (2);DEATH-like (2);	1.479250	0.04102	N	0.313016	T	0.40546	0.1121	L	0.53249	1.67	0.09310	N	1	D;D;D;D;D	0.69078	0.99;0.985;0.997;0.993;0.989	P;B;P;P;P	0.55713	0.447;0.413;0.782;0.499;0.663	T	0.56673	-0.7940	10	0.72032	D	0.01	.	6.1796	0.20463	0.3905:0.4254:0.1841:0.0	.	72;72;72;72;72	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	M	72	ENSP00000375704:V72M;ENSP00000355453:V72M;ENSP00000337383:V72M;ENSP00000294752:V72M;ENSP00000355452:V72M;ENSP00000375703:V72M	ENSP00000337383:V72M	V	+	1	0	NLRP3	245648933	0.000000	0.05858	0.000000	0.03702	0.972000	0.66771	-0.306000	0.08178	-0.624000	0.05611	-0.291000	0.09656	GTG	NLRP3	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000162711		0.512	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1	40	0.00	0	G	NM_004895		247582310	247582310	+1	no_errors	ENST00000336119	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.000	A
OPHN1	4983	genome.wustl.edu	37	X	67417078	67417078	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chrX:67417078A>G	ENST00000355520.5	-	12	1695	c.1054T>C	c.(1054-1056)Tca>Cca	p.S352P	OPHN1_ENST00000540071.1_Missense_Mutation_p.S352P	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	352	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						TTAGCTTCTGAAAGGGCCTGC	0.468																																						dbGAP											0													119.0	95.0	103.0					X																	67417078		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.1054T>C	X.37:g.67417078A>G	ENSP00000347710:p.Ser352Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.S352P	ENST00000355520.5	37	c.1054	CCDS14388.1	X	.	.	.	.	.	.	.	.	.	.	A	20.4	3.977832	0.74360	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.55413	0.52;0.52	4.79	4.79	0.61399	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.139939	0.49916	D	0.000133	T	0.70657	0.3249	M	0.87758	2.905	0.58432	D	0.99999	D;D	0.64830	0.987;0.994	P;P	0.59288	0.696;0.855	T	0.76650	-0.2881	10	0.87932	D	0	.	11.3478	0.49571	1.0:0.0:0.0:0.0	.	352;352	F5H2E3;O60890	.;OPHN1_HUMAN	P	352	ENSP00000347710:S352P;ENSP00000438617:S352P	ENSP00000347710:S352P	S	-	1	0	OPHN1	67333803	1.000000	0.71417	0.989000	0.46669	0.997000	0.91878	7.105000	0.77031	1.881000	0.54492	0.486000	0.48141	TCA	OPHN1	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000079482		0.468	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	HGNC	protein_coding	OTTHUMT00000057011.1	108	0.00	0	A	NM_002547		67417078	67417078	-1	no_errors	ENST00000355520	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	0.997	G
PCLO	27445	genome.wustl.edu	37	7	82784526	82784526	+	Silent	SNP	T	T	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr7:82784526T>C	ENST00000333891.9	-	2	1768	c.1431A>G	c.(1429-1431)gcA>gcG	p.A477A	PCLO_ENST00000423517.2_Silent_p.A477A	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GTGGGGGCTTTGCTGGGCCAG	0.607																																						dbGAP											0													64.0	72.0	69.0					7																	82784526		1975	4142	6117	-	-	-	SO:0001819	synonymous_variant	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.1431A>G	7.37:g.82784526T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.A477	ENST00000333891.9	37	c.1431	CCDS47630.1	7																																																																																			PCLO	-	NULL	ENSG00000186472		0.607	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	37	0.00	0	T	NM_014510		82784526	82784526	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	silent	66	12.00	9	SNP	0.010	C
PDCD6IP	10015	genome.wustl.edu	37	3	33905540	33905540	+	Silent	SNP	A	A	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr3:33905540A>G	ENST00000307296.3	+	16	2540	c.2163A>G	c.(2161-2163)tcA>tcG	p.S721S	PDCD6IP_ENST00000457054.2_Silent_p.S726S			Q8WUM4	PDC6I_HUMAN	programmed cell death 6 interacting protein	721	Interaction with EIAV p9.|Pro-rich.|Self-association.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cell division (GO:0051301)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium-dependent protein binding (GO:0048306)|protein homodimerization activity (GO:0042803)			central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(6)|ovary(2)|skin(1)|stomach(1)	23						GTGCTCCTTCAATTCCTACAC	0.423																																						dbGAP											0													87.0	83.0	85.0					3																	33905540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC020066	CCDS2660.1, CCDS54561.1	3p22.3	2012-08-30	2001-11-29		ENSG00000170248	ENSG00000170248			8766	protein-coding gene	gene with protein product	"""ALG-2 interacting protein X"""	608074	"""programmed cell death 6-interacting protein"""			9880530	Standard	NM_001162429		Approved	Alix, AIP1, Hp95	uc003cfy.4	Q8WUM4	OTTHUMG00000130751	ENST00000307296.3:c.2163A>G	3.37:g.33905540A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C5MQH7|E9PFU1|Q6NUS1|Q9BX86|Q9NUN0|Q9P2H2|Q9UKL5	Silent	SNP	pfam_BRO1_dom,pfscan_BRO1_dom	p.S726	ENST00000307296.3	37	c.2178	CCDS2660.1	3																																																																																			PDCD6IP	-	NULL	ENSG00000170248		0.423	PDCD6IP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDCD6IP	HGNC	protein_coding	OTTHUMT00000253251.2	58	0.00	0	A			33905540	33905540	+1	no_errors	ENST00000457054	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.196	G
PGR	5241	genome.wustl.edu	37	11	100922227	100922227	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr11:100922227C>A	ENST00000325455.5	-	5	3738	c.2285G>T	c.(2284-2286)gGt>gTt	p.G762V	PGR_ENST00000534013.1_Missense_Mutation_p.G168V|PGR_ENST00000263463.5_Missense_Mutation_p.G660V	NM_000926.4|NM_001202474.1|NM_001271162.1	NP_000917.3|NP_001189403.1|NP_001258091.1	P06401	PRGR_HUMAN	progesterone receptor	762	Steroid-binding.				cell-cell signaling (GO:0007267)|epithelial cell maturation (GO:0002070)|gene expression (GO:0010467)|negative regulation of gene expression (GO:0010629)|ovulation from ovarian follicle (GO:0001542)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|progesterone receptor signaling pathway (GO:0050847)|regulation of epithelial cell proliferation (GO:0050678)|signal transduction (GO:0007165)|tertiary branching involved in mammary gland duct morphogenesis (GO:0060748)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mitochondrial outer membrane (GO:0005741)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|liver(1)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	36		Acute lymphoblastic leukemia(157;0.000885)|all_hematologic(158;0.014)		LUSC - Lung squamous cell carcinoma(1;0.0387)|BRCA - Breast invasive adenocarcinoma(274;0.124)|OV - Ovarian serous cystadenocarcinoma(223;0.148)|Lung(307;0.164)	Allylestrenol(DB01431)|Danazol(DB01406)|Desogestrel(DB00304)|Drospirenone(DB01395)|Dydrogesterone(DB00378)|Ethynodiol(DB00823)|Etonogestrel(DB00294)|Fluticasone Propionate(DB00588)|Levonorgestrel(DB00367)|Medroxyprogesterone Acetate(DB00603)|Megestrol acetate(DB00351)|Mifepristone(DB00834)|Norelgestromin(DB06713)|Norethindrone(DB00717)|Norgestimate(DB00957)|Progesterone(DB00396)|Spironolactone(DB00421)	CCATCCTAGACCAAACACCAT	0.343																																					Pancreas(124;2271 2354 21954 22882)	dbGAP											0													120.0	117.0	118.0					11																	100922227		2203	4300	6503	-	-	-	SO:0001583	missense	0			M15716	CCDS8310.1, CCDS59229.1	11q22-q23	2013-01-16			ENSG00000082175	ENSG00000082175		"""Nuclear hormone receptors"""	8910	protein-coding gene	gene with protein product		607311					Standard	NM_000926		Approved	PR, NR3C3	uc001pgh.2	P06401	OTTHUMG00000167531	ENST00000325455.5:c.2285G>T	11.37:g.100922227C>A	ENSP00000325120:p.Gly762Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7LQ08|A7X8B0|B4E3T0|Q8TDS3|Q9UPF7	Missense_Mutation	SNP	pfam_Progest_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Progest_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.G762V	ENST00000325455.5	37	c.2285	CCDS8310.1	11	.	.	.	.	.	.	.	.	.	.	C	16.94	3.260850	0.59431	.	.	ENSG00000082175	ENST00000325455;ENST00000534013;ENST00000263463;ENST00000537623	D;D;D	0.96745	-4.11;-4.11;-4.11	5.24	3.31	0.37934	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.119765	0.56097	D	0.000031	D	0.98077	0.9366	M	0.84773	2.715	0.42872	D	0.994146	D;D;D	0.89917	1.0;0.999;0.972	D;D;P	0.76071	0.959;0.987;0.804	D	0.98372	1.0554	10	0.62326	D	0.03	.	16.1846	0.81942	0.0:0.4176:0.5824:0.0	.	660;762;143	Q8TDS3;P06401;A7LQ08	.;PRGR_HUMAN;.	V	762;168;660;660	ENSP00000325120:G762V;ENSP00000436561:G168V;ENSP00000263463:G660V	ENSP00000263463:G660V	G	-	2	0	PGR	100427437	1.000000	0.71417	0.993000	0.49108	0.820000	0.46376	4.972000	0.63756	0.549000	0.28973	0.650000	0.86243	GGT	PGR	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000082175		0.343	PGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGR	HGNC	protein_coding	OTTHUMT00000394934.1	60	0.00	0	C			100922227	100922227	-1	no_errors	ENST00000325455	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	0.995	A
PKP2	5318	genome.wustl.edu	37	12	32949226	32949226	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr12:32949226T>C	ENST00000070846.6	-	12	2330	c.2306A>G	c.(2305-2307)gAa>gGa	p.E769G	PKP2_ENST00000340811.4_Missense_Mutation_p.E725G	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	769					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AGGGAGAGTTTCTTTGGCTAC	0.353																																						dbGAP											0													69.0	62.0	64.0					12																	32949226		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.2306A>G	12.37:g.32949226T>C	ENSP00000070846:p.Glu769Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.E769G	ENST00000070846.6	37	c.2306	CCDS8731.1	12	.	.	.	.	.	.	.	.	.	.	T	14.26	2.483749	0.44147	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	T;T	0.42900	0.96;0.96	5.2	4.03	0.46877	Armadillo-like helical (1);Armadillo-type fold (1);	0.263731	0.38605	N	0.001631	T	0.37945	0.1022	L	0.55103	1.725	0.44168	D	0.996977	B;B;B	0.17268	0.004;0.002;0.021	B;B;B	0.08055	0.002;0.001;0.003	T	0.20538	-1.0272	10	0.54805	T	0.06	-0.0042	11.1783	0.48612	0.138:0.0:0.0:0.862	.	725;725;769	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	G	725;769;769	ENSP00000342800:E725G;ENSP00000070846:E769G	ENSP00000070846:E769G	E	-	2	0	PKP2	32840493	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	4.901000	0.63259	0.888000	0.36160	0.528000	0.53228	GAA	PKP2	-	superfamily_ARM-type_fold	ENSG00000057294		0.353	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	HGNC	protein_coding	OTTHUMT00000404449.1	37	0.00	0	T	NM_004572		32949226	32949226	-1	no_errors	ENST00000070846	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	1.000	C
PMS1	5378	genome.wustl.edu	37	2	190682787	190682787	+	Nonsense_Mutation	SNP	A	A	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr2:190682787A>T	ENST00000441310.2	+	5	696	c.463A>T	c.(463-465)Aga>Tga	p.R155*	PMS1_ENST00000409823.3_Nonsense_Mutation_p.R155*|PMS1_ENST00000421722.1_3'UTR|PMS1_ENST00000418224.3_5'UTR|PMS1_ENST00000432292.3_5'UTR|PMS1_ENST00000447232.2_Nonsense_Mutation_p.R155*	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	155					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TCTACCTGTAAGAAAGCAGTT	0.343			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														dbGAP	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0													44.0	44.0	44.0					2																	190682787		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.463A>T	2.37:g.190682787A>T	ENSP00000406490:p.Arg155*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Nonsense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_HMG_superfamily,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily,tigrfam_DNA_mismatch_repair_N	p.R155*	ENST00000441310.2	37	c.463	CCDS2302.1	2	.	.	.	.	.	.	.	.	.	.	A	28.4	4.915845	0.92178	.	.	ENSG00000064933	ENST00000441310;ENST00000409823;ENST00000424766;ENST00000447232;ENST00000424307	.	.	.	5.36	2.73	0.32206	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.8109	11.9604	0.53005	0.7261:0.2738:0.0:0.0	.	.	.	.	X	155;155;155;155;94	.	ENSP00000387125:R155X	R	+	1	2	PMS1	190391032	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.436000	0.52856	0.939000	0.37446	0.477000	0.44152	AGA	PMS1	-	superfamily_ATPase-like_ATP-bd,tigrfam_DNA_mismatch_repair_N	ENSG00000064933		0.343	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	32	0.00	0	A			190682787	190682787	+1	no_errors	ENST00000441310	ensembl	human	known	69_37n	nonsense	27	25.00	9	SNP	1.000	T
POM121	9883	genome.wustl.edu	37	7	72418986	72418986	+	IGR	SNP	T	T	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr7:72418986T>A	ENST00000434423.2	+	0	3750				POM121_ENST00000446813.1_Missense_Mutation_p.S993T|NSUN5P2_ENST00000388955.4_RNA|POM121_ENST00000395270.1_Missense_Mutation_p.S993T			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				ACAGGCATCTTCCTTTCCCAC	0.577																																						dbGAP											0													80.0	92.0	88.0					7																	72418986		2198	4300	6498	-	-	-	SO:0001628	intergenic_variant	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527		7.37:g.72418986T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.S993T	ENST00000434423.2	37	c.2977		7	.	.	.	.	.	.	.	.	.	.	T	7.245	0.602146	0.13939	.	.	ENSG00000196313	ENST00000446813;ENST00000395270	T;T	0.06218	3.33;3.33	2.23	-2.24	0.06909	.	.	.	.	.	T	0.03959	0.0111	.	.	.	0.09310	N	0.999999	P	0.34684	0.463	B	0.21360	0.034	T	0.30880	-0.9963	8	0.87932	D	0	.	6.0366	0.19710	0.0:0.415:0.0:0.585	.	993	A8MXF9	.	T	993	ENSP00000393020:S993T;ENSP00000378687:S993T	ENSP00000378687:S993T	S	+	1	0	POM121	72056922	0.000000	0.05858	0.000000	0.03702	0.084000	0.17831	-0.818000	0.04467	-0.695000	0.05105	0.136000	0.15936	TCC	POM121	-	NULL	ENSG00000196313		0.577	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	89	0.00	0	T			72418986	72418986	+1	no_errors	ENST00000395270	ensembl	human	known	69_37n	missense	61	20.78	16	SNP	0.000	A
RELN	5649	genome.wustl.edu	37	7	103214716	103214716	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr7:103214716G>A	ENST00000428762.1	-	30	4493	c.4334C>T	c.(4333-4335)cCc>cTc	p.P1445L	RELN_ENST00000424685.2_Missense_Mutation_p.P1445L|RELN_ENST00000343529.5_Missense_Mutation_p.P1445L	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	1445					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)			NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		ATTGTGATTGGGGACATTTGA	0.448																																					NSCLC(146;835 1944 15585 22231 52158)	dbGAP											0													100.0	82.0	88.0					7																	103214716		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.4334C>T	7.37:g.103214716G>A	ENSP00000392423:p.Pro1445Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom,pfscan_Reeler_dom	p.P1445L	ENST00000428762.1	37	c.4334	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	G	19.07	3.756116	0.69648	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.23147	1.92;1.92;1.92	5.51	5.51	0.81932	.	0.115146	0.64402	D	0.000009	T	0.30479	0.0766	L	0.43152	1.355	0.80722	D	1	B;B	0.29590	0.014;0.25	B;B	0.34180	0.06;0.177	T	0.07790	-1.0754	10	0.72032	D	0.01	.	19.7654	0.96337	0.0:0.0:1.0:0.0	.	1445;1445	P78509-2;P78509	.;RELN_HUMAN	L	1445	ENSP00000392423:P1445L;ENSP00000345694:P1445L;ENSP00000388446:P1445L	ENSP00000345694:P1445L	P	-	2	0	RELN	103001952	1.000000	0.71417	0.738000	0.30950	0.960000	0.62799	6.354000	0.73036	2.750000	0.94351	0.655000	0.94253	CCC	RELN	-	superfamily_Growth_fac_rcpt	ENSG00000189056		0.448	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	65	0.00	0	G	NM_005045		103214716	103214716	-1	no_errors	ENST00000424685	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	0.998	A
RPRD1A	55197	genome.wustl.edu	37	18	33606996	33606996	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr18:33606996G>A	ENST00000399022.4	-	6	827	c.656C>T	c.(655-657)gCg>gTg	p.A219V	RPRD1A_ENST00000357384.4_Missense_Mutation_p.A219V|RPRD1A_ENST00000319040.6_Missense_Mutation_p.A219V|RPRD1A_ENST00000590898.1_Missense_Mutation_p.A183V|RPRD1A_ENST00000337059.5_Missense_Mutation_p.A183V|RPRD1A_ENST00000588737.1_Missense_Mutation_p.A183V	NM_018170.3	NP_060640.2	Q96P16	RPR1A_HUMAN	regulation of nuclear pre-mRNA domain containing 1A	219					dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|urinary_tract(2)	12						CAACATACACGCATCCTCTAC	0.368																																						dbGAP											0													89.0	85.0	86.0					18																	33606996		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF419845	CCDS11917.1	18q12.2	2012-02-09	2008-08-15		ENSG00000141425	ENSG00000141425			25560	protein-coding gene	gene with protein product	"""cyclin-dependent kinase 2B-inhibitor-related protein"", ""Cyclin-dependent kinase inhibitor 2B-related protein (p15INK4B-related protein)"""	610347				12470661, 22231121	Standard	NM_018170		Approved	P15RS, FLJ10656, HsT3101	uc002kzg.3	Q96P16	OTTHUMG00000132591	ENST00000399022.4:c.656C>T	18.37:g.33606996G>A	ENSP00000381984:p.Ala219Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA42|B2RBA3|Q7Z5G8|Q96FY9|Q9NVL4	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.A219V	ENST00000399022.4	37	c.656	CCDS11917.1	18	.	.	.	.	.	.	.	.	.	.	G	32	5.125173	0.94429	.	.	ENSG00000141425	ENST00000399022;ENST00000357384;ENST00000337059;ENST00000319040	.	.	.	5.22	5.22	0.72569	.	0.000000	0.85682	D	0.000000	T	0.80407	0.4617	M	0.80183	2.485	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.992;0.998	T	0.83025	-0.0165	9	0.87932	D	0	-13.6392	16.6336	0.85040	0.0:0.0:1.0:0.0	.	219;219;183	Q96P16-2;Q96P16;Q96P16-3	.;RPR1A_HUMAN;.	V	219;219;183;219	.	ENSP00000314602:A219V	A	-	2	0	RPRD1A	31860994	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.759000	0.98931	2.583000	0.87209	0.650000	0.86243	GCG	RPRD1A	-	NULL	ENSG00000141425		0.368	RPRD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRD1A	HGNC	protein_coding	OTTHUMT00000255802.1	81	0.00	0	G	NM_018170		33606996	33606996	-1	no_errors	ENST00000357384	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	A
RPTOR	57521	genome.wustl.edu	37	17	78897383	78897383	+	Silent	SNP	G	G	A	rs199647030	byFrequency	TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr17:78897383G>A	ENST00000306801.3	+	23	3080	c.2718G>A	c.(2716-2718)ccG>ccA	p.P906P	RPTOR_ENST00000575542.1_3'UTR|RPTOR_ENST00000544334.2_Silent_p.P748P	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	906					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						CTGGCCGGCCGGGCACCACAG	0.687													G|||	3	0.000599042	0.0	0.0043	5008	,	,		15974	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													32.0	32.0	32.0					17																	78897383		2197	4299	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.2718G>A	17.37:g.78897383G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.P906	ENST00000306801.3	37	c.2718	CCDS11773.1	17																																																																																			RPTOR	-	NULL	ENSG00000141564		0.687	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	8	0.00	0	G	NM_020761		78897383	78897383	+1	no_errors	ENST00000306801	ensembl	human	known	69_37n	silent	14	62.16	23	SNP	0.028	A
RYR2	6262	genome.wustl.edu	37	1	237948029	237948029	+	Silent	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr1:237948029G>A	ENST00000366574.2	+	90	13334	c.13017G>A	c.(13015-13017)caG>caA	p.Q4339Q	RYR2_ENST00000542537.1_Silent_p.Q4323Q|RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000360064.6_Silent_p.Q4345Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4339					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ACCCCACTCAGGATGAGGTTA	0.552																																						dbGAP											0													63.0	62.0	62.0					1																	237948029		1924	4131	6055	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13017G>A	1.37:g.237948029G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.Q4345	ENST00000366574.2	37	c.13035	CCDS55691.1	1																																																																																			RYR2	-	pfam_Ryanrecept_TM4-6	ENSG00000198626		0.552	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	59	0.00	0	G	NM_001035		237948029	237948029	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	16	40.74	11	SNP	1.000	A
SEMA5B	54437	genome.wustl.edu	37	3	122630348	122630348	+	Silent	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr3:122630348G>A	ENST00000357599.3	-	21	3467	c.3081C>T	c.(3079-3081)acC>acT	p.T1027T	SEMA5B_ENST00000451055.2_Silent_p.T1081T|SEMA5B_ENST00000195173.4_Silent_p.T1025T	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	1027					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		CTGCACAGTCGGTGGCCTCCT	0.632																																						dbGAP											0													55.0	49.0	51.0					3																	122630348		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.3081C>T	3.37:g.122630348G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.P73L	ENST00000357599.3	37	c.218	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	G	0.771	-0.765752	0.02996	.	.	ENSG00000082684	ENST00000451541	.	.	.	5.02	1.23	0.21249	.	.	.	.	.	T	0.43077	0.1231	.	.	.	0.45914	D	0.998757	.	.	.	.	.	.	T	0.20405	-1.0276	4	.	.	.	.	2.2187	0.03967	0.2955:0.1202:0.4612:0.1231	.	.	.	.	L	73	.	.	P	-	2	0	SEMA5B	124113038	0.000000	0.05858	0.122000	0.21767	0.134000	0.20937	-1.037000	0.03557	0.045000	0.15804	0.655000	0.94253	CCG	SEMA5B	-	NULL	ENSG00000082684		0.632	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	50	0.00	0	G	NM_001031702		122630348	122630348	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451541	ensembl	human	putative	69_37n	missense	14	33.33	7	SNP	0.489	A
SEMG2	6407	genome.wustl.edu	37	20	43851246	43851246	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr20:43851246A>C	ENST00000372769.3	+	2	1063	c.973A>C	c.(973-975)Aag>Cag	p.K325Q		NM_003008.2	NP_002999.1	Q02383	SEMG2_HUMAN	semenogelin II	325	4 X 60 AA tandem repeats, type I.|Repeat-rich region.				sexual reproduction (GO:0019953)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|secretory granule (GO:0030141)	structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(3)|endometrium(6)|kidney(2)|large_intestine(6)|lung(9)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	36		Myeloproliferative disorder(115;0.0122)				AATACATGGCAAGTCTCAAAA	0.363																																						dbGAP											0													82.0	78.0	79.0					20																	43851246		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS13346.1	20q12-q13.1	2008-07-02			ENSG00000124157	ENSG00000124157			10743	protein-coding gene	gene with protein product	"""Semenogelin 2"""	182141				1517240, 9523691	Standard	NM_003008		Approved	SGII	uc002xnk.3	Q02383	OTTHUMG00000032566	ENST00000372769.3:c.973A>C	20.37:g.43851246A>C	ENSP00000361855:p.Lys325Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53ZU2|Q6X2M5|Q6X2M6	Missense_Mutation	SNP	pfam_Semenogelin	p.K325Q	ENST00000372769.3	37	c.973	CCDS13346.1	20	.	.	.	.	.	.	.	.	.	.	A	11.51	1.658974	0.29515	.	.	ENSG00000124157	ENST00000372769	T	0.11604	2.76	1.2	1.2	0.21068	.	.	.	.	.	T	0.23054	0.0557	M	0.62154	1.92	0.09310	N	1	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.91635	0.994;0.999;0.999	T	0.08554	-1.0716	9	0.37606	T	0.19	.	4.5711	0.12210	1.0:0.0:0.0:0.0	.	325;325;325	A8K6Z6;Q6IRW3;Q02383	.;.;SEMG2_HUMAN	Q	325	ENSP00000361855:K325Q	ENSP00000361855:K325Q	K	+	1	0	SEMG2	43284660	0.001000	0.12720	0.002000	0.10522	0.009000	0.06853	0.328000	0.19681	0.799000	0.34018	0.338000	0.21704	AAG	SEMG2	-	pfam_Semenogelin	ENSG00000124157		0.363	SEMG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMG2	HGNC	protein_coding	OTTHUMT00000079417.1	41	0.00	0	A	NM_003008		43851246	43851246	+1	no_errors	ENST00000372769	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	0.002	C
SLC25A11	8402	genome.wustl.edu	37	17	4841331	4841331	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr17:4841331T>C	ENST00000225665.7	-	7	1116	c.776A>G	c.(775-777)tAc>tGc	p.Y259C	RNF167_ENST00000262482.6_5'Flank|RNF167_ENST00000572430.1_5'Flank|SLC25A11_ENST00000544061.2_Missense_Mutation_p.Y208C|RNF167_ENST00000575111.1_5'Flank|RNF167_ENST00000571816.1_5'Flank|RNF167_ENST00000576229.1_5'Flank	NM_001165417.1|NM_003562.4	NP_001158889.1|NP_003553.2	Q02978	M2OM_HUMAN	solute carrier family 25 (mitochondrial carrier; oxoglutarate carrier), member 11	259					alpha-ketoglutarate transport (GO:0015742)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxoglutarate:malate antiporter activity (GO:0015367)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(5)	10						CCCGTTCTTGTATTCCGGCTT	0.627																																					Esophageal Squamous(144;1178 2388 18010 48797)	dbGAP											0													139.0	145.0	143.0					17																	4841331		2203	4300	6503	-	-	-	SO:0001583	missense	0			X66114	CCDS11059.1, CCDS54069.1	17p13.3	2013-05-22			ENSG00000108528	ENSG00000108528		"""Solute carriers"""	10981	protein-coding gene	gene with protein product		604165		SLC20A4		10072597, 1457818	Standard	NM_003562		Approved	OGC	uc002fzo.2	Q02978	OTTHUMG00000099395	ENST00000225665.7:c.776A>G	17.37:g.4841331T>C	ENSP00000225665:p.Tyr259Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	F5GY65|O75537|Q969P7	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.Y259C	ENST00000225665.7	37	c.776	CCDS11059.1	17	.	.	.	.	.	.	.	.	.	.	T	17.41	3.383424	0.61845	.	.	ENSG00000108528	ENST00000225665;ENST00000544061	D;D	0.82081	-1.57;-1.57	5.08	5.08	0.68730	Mitochondrial carrier domain (2);	0.216101	0.41194	D	0.000926	D	0.94162	0.8127	H	0.98525	4.255	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.95358	0.8453	10	0.87932	D	0	-15.4187	11.1551	0.48482	0.0:0.0:0.0:1.0	.	259;259	Q6IBH0;Q02978	.;M2OM_HUMAN	C	259;208	ENSP00000225665:Y259C;ENSP00000440804:Y208C	ENSP00000225665:Y259C	Y	-	2	0	SLC25A11	4782076	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.034000	0.76511	2.130000	0.65690	0.533000	0.62120	TAC	SLC25A11	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000108528		0.627	SLC25A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A11	HGNC	protein_coding	OTTHUMT00000216852.4	49	0.00	0	T	NM_003562		4841331	4841331	-1	no_errors	ENST00000225665	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	1.000	C
SPPL3	121665	genome.wustl.edu	37	12	121222339	121222339	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr12:121222339G>C	ENST00000353487.2	-	4	751	c.248C>G	c.(247-249)tCt>tGt	p.S83C		NM_139015.4	NP_620584.2	Q8TCT6	SPPL3_HUMAN	signal peptide peptidase like 3	84						Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|rough endoplasmic reticulum (GO:0005791)	aspartic endopeptidase activity, intramembrane cleaving (GO:0042500)|protein homodimerization activity (GO:0042803)					all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					TACTAAAAGAGAGACAGATGC	0.353																																						dbGAP											0													84.0	81.0	82.0					12																	121222339		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9208.1	12q24.31	2012-02-21			ENSG00000157837	ENSG00000157837			30424	protein-coding gene	gene with protein product	"""intramembrane protease 2"", ""presenilin-like protein 4"""	608240				12139484	Standard	NM_139015		Approved	IMP2, PSL4, MGC90402, MGC126674, MGC126676, DKFZP586C1324	uc001tzd.3	Q8TCT6	OTTHUMG00000169232	ENST00000353487.2:c.248C>G	12.37:g.121222339G>C	ENSP00000288680:p.Ser83Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MJ04|Q8TAU4|Q96DD9	Missense_Mutation	SNP	pfam_Peptidase_A22B_SPP,smart_Peptidase_A22	p.S83C	ENST00000353487.2	37	c.248	CCDS9208.1	12	.	.	.	.	.	.	.	.	.	.	G	27.9	4.873676	0.91664	.	.	ENSG00000157837	ENST00000353487;ENST00000405631;ENST00000536996;ENST00000543608;ENST00000543181;ENST00000540091	T;T;T;D;T	0.91686	2.22;2.22;2.22;-2.89;2.22	5.86	5.86	0.93980	.	0.054000	0.85682	D	0.000000	D	0.96349	0.8809	M	0.82323	2.585	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.989	D	0.95133	0.8257	10	0.38643	T	0.18	-25.7243	19.7774	0.96400	0.0:0.0:1.0:0.0	.	84;83	Q8TCT6;Q3MJ04	PSL4_HUMAN;.	C	83;82;46;46;46;46	ENSP00000288680:S83C;ENSP00000442484:S46C;ENSP00000437603:S46C;ENSP00000446088:S46C;ENSP00000444821:S46C	ENSP00000288680:S83C	S	-	2	0	AC069214.1	119706722	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	9.161000	0.94739	2.771000	0.95319	0.650000	0.86243	TCT	SPPL3	-	pfam_Peptidase_A22B_SPP,smart_Peptidase_A22	ENSG00000157837		0.353	SPPL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL3	HGNC	protein_coding	OTTHUMT00000402980.2	61	0.00	0	G	NM_139015		121222339	121222339	-1	no_errors	ENST00000353487	ensembl	human	known	69_37n	missense	14	51.72	15	SNP	1.000	C
ST3GAL2	6483	genome.wustl.edu	37	16	70432295	70432295	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr16:70432295G>A	ENST00000393640.4	-	1	2246	c.139C>T	c.(139-141)Cgg>Tgg	p.R47W	RP11-529K1.4_ENST00000566960.1_RNA|ST3GAL2_ENST00000566097.1_5'Flank|ST3GAL2_ENST00000342907.2_Missense_Mutation_p.R47W			Q16842	SIA4B_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 2	47					amino sugar metabolic process (GO:0006040)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	beta-galactoside (CMP) alpha-2,3-sialyltransferase activity (GO:0003836)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)	11		Ovarian(137;0.0694)				AGCTTCACCCGGTGCGTCCCA	0.662																																						dbGAP											0													58.0	55.0	56.0					16																	70432295		2198	4300	6498	-	-	-	SO:0001583	missense	0			U63090	CCDS10890.1	16q22.3	2013-03-01	2003-01-14	2005-02-07	ENSG00000157350	ENSG00000157350	2.4.99.4	"""Sialyltransferases"""	10863	protein-coding gene	gene with protein product		607188	"""sialyltransferase 4B (beta-galactosidase alpha-2,3-sialytransferase)"""	SIAT4B		9266697, 8920913	Standard	NM_006927		Approved	ST3GALII, ST3GalA.2	uc002eyx.2	Q16842	OTTHUMG00000137580	ENST00000393640.4:c.139C>T	16.37:g.70432295G>A	ENSP00000377257:p.Arg47Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O00654	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.R47W	ENST00000393640.4	37	c.139	CCDS10890.1	16	.	.	.	.	.	.	.	.	.	.	G	14.63	2.593711	0.46214	.	.	ENSG00000157350	ENST00000342907;ENST00000393640	T;T	0.19806	2.12;2.12	5.13	4.11	0.48088	.	0.115496	0.56097	D	0.000022	T	0.29458	0.0734	L	0.34521	1.04	0.47374	D	0.999404	D	0.76494	0.999	P	0.59424	0.857	T	0.01652	-1.1303	10	0.51188	T	0.08	0.3406	12.9555	0.58425	0.0:0.0:0.7319:0.268	.	47	Q16842	SIA4B_HUMAN	W	47	ENSP00000345477:R47W;ENSP00000377257:R47W	ENSP00000345477:R47W	R	-	1	2	ST3GAL2	68989796	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	3.625000	0.54238	2.391000	0.81399	0.561000	0.74099	CGG	ST3GAL2	-	pirsf_Sialyl_trans	ENSG00000157350		0.662	ST3GAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST3GAL2	HGNC	protein_coding	OTTHUMT00000268968.1	15	0.00	0	G	NM_006927		70432295	70432295	-1	no_errors	ENST00000342907	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	1.000	A
STK35	140901	genome.wustl.edu	37	20	2097914	2097914	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr20:2097914T>G	ENST00000381482.3	+	3	1766	c.1495T>G	c.(1495-1497)Tct>Gct	p.S499A	STK35_ENST00000246032.3_Missense_Mutation_p.S366A|STK35_ENST00000400064.3_Intron			Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	499	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(2)|liver(2)|lung(6)|ovary(1)|prostate(2)	13						GACTTCCATGTCTGAGGGGAT	0.502																																						dbGAP											0													82.0	79.0	80.0					20																	2097914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL359916	CCDS13024.1, CCDS13024.2	20p13	2008-07-02			ENSG00000125834	ENSG00000125834			16254	protein-coding gene	gene with protein product	"""CLP-36 interacting kinase"""	609370				11973348	Standard	NM_080836		Approved	bA550O8.2, CLIK1	uc002wfw.4	Q8TDR2	OTTHUMG00000031688	ENST00000381482.3:c.1495T>G	20.37:g.2097914T>G	ENSP00000370891:p.Ser499Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBM3|C7ENV8|Q2NKW6|Q5T3R1|Q5T3R2|Q96AB4|Q9BZ06	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S499A	ENST00000381482.3	37	c.1495	CCDS13024.2	20	.	.	.	.	.	.	.	.	.	.	T	15.36	2.811272	0.50527	.	.	ENSG00000125834	ENST00000381482;ENST00000246032	D;D	0.94457	-3.43;-3.43	5.5	5.5	0.81552	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92590	0.7646	L	0.53617	1.68	0.80722	D	1	B	0.32968	0.392	B	0.34346	0.18	D	0.92325	0.5869	10	0.72032	D	0.01	-8.1355	13.6097	0.62071	0.0:0.0:0.0:1.0	.	499	Q8TDR2	STK35_HUMAN	A	499;366	ENSP00000370891:S499A;ENSP00000246032:S366A	ENSP00000246032:S366A	S	+	1	0	STK35	2045914	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.802000	0.62539	2.308000	0.77769	0.533000	0.62120	TCT	STK35	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000125834		0.502	STK35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK35	HGNC	protein_coding	OTTHUMT00000077574.3	21	0.00	0	T	NM_080836		2097914	2097914	+1	no_errors	ENST00000381482	ensembl	human	known	69_37n	missense	13	48.00	12	SNP	1.000	G
TNN	63923	genome.wustl.edu	37	1	175052955	175052955	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr1:175052955A>C	ENST00000239462.4	+	5	1231	c.1118A>C	c.(1117-1119)aAc>aCc	p.N373T		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	373	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		GAGTGGGAAAACCCCTCAACT	0.572																																						dbGAP											0													118.0	99.0	106.0					1																	175052955		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.1118A>C	1.37:g.175052955A>C	ENSP00000239462:p.Asn373Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGP3|Q5R360	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.N373T	ENST00000239462.4	37	c.1118	CCDS30943.1	1	.	.	.	.	.	.	.	.	.	.	A	19.79	3.893306	0.72524	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	T	0.56275	0.47	5.52	5.52	0.82312	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.090866	0.85682	D	0.000000	T	0.64227	0.2579	L	0.45698	1.435	0.46564	D	0.999103	P;P	0.46578	0.837;0.88	P;P	0.60886	0.597;0.88	T	0.63014	-0.6731	10	0.42905	T	0.14	.	15.3039	0.73976	1.0:0.0:0.0:0.0	.	373;373	B3KXB6;Q9UQP3	.;TENN_HUMAN	T	373	ENSP00000239462:N373T	ENSP00000239462:N373T	N	+	2	0	TNN	173319578	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	8.038000	0.88943	2.080000	0.62538	0.482000	0.46254	AAC	TNN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000120332		0.572	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	45	0.00	0	A	XM_040527		175052955	175052955	+1	no_errors	ENST00000239462	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578190	7578190	+	Missense_Mutation	SNP	T	T	C	rs121912666		TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr17:7578190T>C	ENST00000269305.4	-	6	848	c.659A>G	c.(658-660)tAt>tGt	p.Y220C	TP53_ENST00000574684.1_Intron|TP53_ENST00000445888.2_Missense_Mutation_p.Y220C|TP53_ENST00000359597.4_Missense_Mutation_p.Y220C|TP53_ENST00000455263.2_Missense_Mutation_p.Y220C|TP53_ENST00000413465.2_Missense_Mutation_p.Y220C|TP53_ENST00000420246.2_Missense_Mutation_p.Y220C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	220	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Y -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:9450901}.|Y -> D (in sporadic cancers; somatic mutation).|Y -> F (in a sporadic cancer; somatic mutation).|Y -> H (in sporadic cancers; somatic mutation).|Y -> N (in sporadic cancers; somatic mutation).|Y -> S (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Y220C(278)|p.Y127C(24)|p.Y220S(12)|p.?(11)|p.0?(8)|p.D208fs*1(1)|p.Y220_P223delYEPP(1)|p.V218_E224delVPYEPPE(1)|p.V218_E221delVPYE(1)|p.Y127S(1)|p.V218_Y220delVPY(1)|p.Y220fs*25(1)|p.V216_Y220delVVVPY(1)|p.Y220fs*2(1)|p.V218fs*26(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGGCGGCTCATAGGGCACCAC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	343	Substitution - Missense(315)|Unknown(11)|Whole gene deletion(8)|Deletion - In frame(5)|Deletion - Frameshift(3)|Insertion - Frameshift(1)	ovary(55)|breast(54)|lung(37)|upper_aerodigestive_tract(35)|urinary_tract(19)|oesophagus(19)|large_intestine(17)|liver(17)|central_nervous_system(16)|stomach(15)|haematopoietic_and_lymphoid_tissue(15)|endometrium(14)|soft_tissue(8)|biliary_tract(6)|bone(5)|pancreas(4)|prostate(4)|peritoneum(2)|small_intestine(1)	GRCh37	CM015378|CM951227	TP53	M	rs121912666						102.0	94.0	97.0					17																	7578190		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.659A>G	17.37:g.7578190T>C	ENSP00000269305:p.Tyr220Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Y220C	ENST00000269305.4	37	c.659	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	T	22.1	4.248510	0.80024	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99840	-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08;-7.08	5.28	5.28	0.74379	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99822	0.9921	M	0.89287	3.02	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.998;0.996;1.0;0.999;0.998;1.0	D	0.96735	0.9542	10	0.87932	D	0	-1.87	13.4753	0.61306	0.0:0.0:0.0:1.0	.	181;220;220;127;220;220;220	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	220;220;220;220;220;220;209;127;88;127	ENSP00000410739:Y220C;ENSP00000352610:Y220C;ENSP00000269305:Y220C;ENSP00000398846:Y220C;ENSP00000391127:Y220C;ENSP00000391478:Y220C;ENSP00000425104:Y88C;ENSP00000423862:Y127C	ENSP00000269305:Y220C	Y	-	2	0	TP53	7518915	1.000000	0.71417	0.585000	0.28666	0.993000	0.82548	6.232000	0.72313	2.128000	0.65567	0.460000	0.39030	TAT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	163	0.00	0	T	NM_000546		7578190	7578190	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	36	29.41	15	SNP	0.998	C
TRIP12	9320	genome.wustl.edu	37	2	230661314	230661315	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr2:230661314_230661315insA	ENST00000283943.5	-	24	3761_3762	c.3583_3584insT	c.(3583-3585)tctfs	p.S1195fs	TRIP12_ENST00000389045.3_Frame_Shift_Ins_p.S925fs|TRIP12_ENST00000389044.4_Frame_Shift_Ins_p.S1243fs	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1195					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		TACTGGAGAAGAAAAAAATACA	0.342																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3584dupT	2.37:g.230661321_230661321dupA	ENSP00000283943:p.Ser1195fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Frame_Shift_Ins	INS	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.S1195fs	ENST00000283943.5	37	c.3584_3583	CCDS33391.1	2																																																																																			TRIP12	-	NULL	ENSG00000153827		0.342	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	74	0.00	0	-	NM_004238		230661314	230661315	-1	no_errors	ENST00000283943	ensembl	human	known	69_37n	frame_shift_ins	40	18.37	9	INS	1.000:1.000	A
TRIT1	54802	genome.wustl.edu	37	1	40307439	40307439	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr1:40307439G>C	ENST00000316891.5	-	11	1395	c.1381C>G	c.(1381-1383)Caa>Gaa	p.Q461E	TRIT1_ENST00000372818.1_Missense_Mutation_p.Q435E|TRIT1_ENST00000491865.1_5'UTR|TRIT1_ENST00000537440.1_Missense_Mutation_p.Q157E|TRIT1_ENST00000441669.2_Missense_Mutation_p.Q379E|TRIT1_ENST00000541099.1_Missense_Mutation_p.Q79E|TRIT1_ENST00000537223.1_Missense_Mutation_p.Q157E|TRIT1_ENST00000545233.1_Missense_Mutation_p.Q215E	NM_017646.4	NP_060116.2	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1	461					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|tRNA dimethylallyltransferase activity (GO:0052381)			breast(1)|large_intestine(5)|liver(1)|lung(3)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(1)	15	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			TTCAGCTCTTGATCATTCTGC	0.488																																						dbGAP											0													329.0	313.0	318.0					1																	40307439		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074918	CCDS30681.1	1p34.2	2012-10-05			ENSG00000043514	ENSG00000043514	2.5.1.8		20286	protein-coding gene	gene with protein product						11111046, 15870694	Standard	NM_017646		Approved	FLJ20061, IPT	uc021olz.1	Q9H3H1	OTTHUMG00000009245	ENST00000316891.5:c.1381C>G	1.37:g.40307439G>C	ENSP00000321810:p.Gln461Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X7|Q3T7B5|Q5QPK5|Q5QPK6|Q6IAC9|Q96FJ3|Q96L45|Q9NXT7	Missense_Mutation	SNP	pfam_IPPT,pfam_Isopentenyl_transferase,pfam_Znf_C2H2_jaz,smart_Znf_U1,tigrfam_tRNA_delta_PyrP_Trfase	p.Q461E	ENST00000316891.5	37	c.1381	CCDS30681.1	1	.	.	.	.	.	.	.	.	.	.	G	3.558	-0.090318	0.07053	.	.	ENSG00000043514	ENST00000046894;ENST00000372825;ENST00000441669;ENST00000316891;ENST00000372818;ENST00000534869;ENST00000545233;ENST00000537440;ENST00000537223;ENST00000541099	T;T	0.42131	1.01;0.98	5.93	-0.709	0.11237	.	1.142550	0.06500	N	0.736074	T	0.23766	0.0575	N	0.19112	0.55	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.22626	-1.0211	10	0.12103	T	0.63	1.2129	6.0812	0.19942	0.0727:0.5063:0.212:0.2089	.	461;435;379;157	Q9H3H1;Q9H3H1-4;Q9H3H1-5;Q3T7B5	MOD5_HUMAN;.;.;.	E	435;379;373;461;435;354;215;157;157;79	ENSP00000321810:Q461E;ENSP00000361905:Q435E	ENSP00000046894:Q435E	Q	-	1	0	TRIT1	40080026	0.176000	0.23096	0.005000	0.12908	0.014000	0.08584	0.477000	0.22196	-0.378000	0.07918	0.655000	0.94253	CAA	TRIT1	-	NULL	ENSG00000043514		0.488	TRIT1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TRIT1	HGNC	protein_coding	OTTHUMT00000025627.2	124	0.00	0	G	NM_017646		40307439	40307439	-1	no_errors	ENST00000316891	ensembl	human	known	69_37n	missense	84	16.83	17	SNP	0.000	C
TRRAP	8295	genome.wustl.edu	37	7	98528347	98528347	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr7:98528347T>C	ENST00000359863.4	+	25	3694	c.3485T>C	c.(3484-3486)gTg>gCg	p.V1162A	TRRAP_ENST00000355540.3_Missense_Mutation_p.V1162A|TRRAP_ENST00000446306.3_Missense_Mutation_p.V1161A	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1162					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GGGGGTGTGGTGTCTATTAAG	0.517																																						dbGAP											0													136.0	137.0	137.0					7																	98528347		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3485T>C	7.37:g.98528347T>C	ENSP00000352925:p.Val1162Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.V1162A	ENST00000359863.4	37	c.3485	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.48|18.48	3.632590|3.632590	0.67015|0.67015	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.63580	.|-0.05;-0.05	5.43|5.43	5.43|5.43	0.79202|0.79202	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.47040|0.47040	0.1424|0.1424	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.31026	.|0.304;0.138;0.244	.|B;B;B	.|0.26517	.|0.07;0.026;0.044	T|T	0.42050|0.42050	-0.9474|-0.9474	5|10	.|0.20519	.|T	.|0.43	.|.	15.7663|15.7663	0.78128|0.78128	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1162;876;1162	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	R|A	877|1162;1162;1160	.|ENSP00000352925:V1162A;ENSP00000347733:V1162A	.|ENSP00000347733:V1162A	C|V	+|+	1|2	0|0	TRRAP|TRRAP	98366283|98366283	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.988000|7.988000	0.88194|0.88194	2.180000|2.180000	0.69256|0.69256	0.482000|0.482000	0.46254|0.46254	TGT|GTG	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.517	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	110	0.00	0	T	NM_003496		98528347	98528347	+1	no_errors	ENST00000359863	ensembl	human	known	69_37n	missense	72	20.88	19	SNP	1.000	C
UBA6	55236	genome.wustl.edu	37	4	68494810	68494810	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr4:68494810C>G	ENST00000322244.5	-	27	2438	c.2379G>C	c.(2377-2379)caG>caC	p.Q793H		NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6	793					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						GCTTGAATTCCTGAATCTTTA	0.318																																						dbGAP											0													91.0	94.0	93.0					4																	68494810		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.2379G>C	4.37:g.68494810C>G	ENSP00000313454:p.Gln793His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.Q793H	ENST00000322244.5	37	c.2379	CCDS3516.1	4	.	.	.	.	.	.	.	.	.	.	C	13.07	2.126774	0.37533	.	.	ENSG00000033178	ENST00000322244	T	0.42900	0.96	5.5	2.83	0.33086	Molybdenum cofactor biosynthesis, MoeB (1);Ubiquitin-like 1 activating enzyme, catalytic cysteine domain (1);	0.583655	0.19399	N	0.115233	T	0.26412	0.0645	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.06516	-1.0822	10	0.62326	D	0.03	-20.3426	8.1102	0.30909	0.0:0.5747:0.0:0.4253	.	793	A0AVT1	UBA6_HUMAN	H	793	ENSP00000313454:Q793H	ENSP00000313454:Q793H	Q	-	3	2	UBA6	68177405	0.998000	0.40836	1.000000	0.80357	0.987000	0.75469	0.327000	0.19663	0.698000	0.31739	0.650000	0.86243	CAG	UBA6	-	superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000033178		0.318	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6	HGNC	protein_coding	OTTHUMT00000251429.2	57	0.00	0	C	NM_018227		68494810	68494810	-1	no_errors	ENST00000322244	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	0.991	G
WBP11P1	441818	genome.wustl.edu	37	18	30092243	30092243	+	RNA	SNP	C	C	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr18:30092243C>G	ENST00000567636.1	+	0	618					NR_003558.1				WW domain binding protein 11 pseudogene 1																		CCAGATATGCCACATGCTTCT	0.463																																						dbGAP											0																																										-	-	-			0			BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30092243C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			WBP11P1	-	-	ENSG00000260389		0.463	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	HGNC	pseudogene	OTTHUMT00000435119.1	65	0.00	0	C			30092243	30092243	+1	no_errors	ENST00000567636	ensembl	human	known	69_37n	rna	27	18.18	6	SNP	1.000	G
WDR17	116966	genome.wustl.edu	37	4	177072997	177072997	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr4:177072997C>G	ENST00000280190.4	+	18	2567	c.2411C>G	c.(2410-2412)tCt>tGt	p.S804C	WDR17_ENST00000507824.2_Missense_Mutation_p.S787C|WDR17_ENST00000393643.2_Missense_Mutation_p.S780C|WDR17_ENST00000508596.1_Missense_Mutation_p.S780C			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	804										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GTCAAGATGTCTAAATTTGGT	0.333																																						dbGAP											0													109.0	110.0	110.0					4																	177072997		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.2411C>G	4.37:g.177072997C>G	ENSP00000280190:p.Ser804Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.S804C	ENST00000280190.4	37	c.2411	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	C	14.94	2.685412	0.47991	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.60040	0.24;0.28;0.22	5.55	4.7	0.59300	.	0.058748	0.64402	N	0.000001	T	0.60314	0.2259	M	0.73598	2.24	0.80722	D	1	B;B;B	0.16396	0.017;0.009;0.009	B;B;B	0.15870	0.014;0.005;0.005	T	0.60469	-0.7257	10	0.54805	T	0.06	-14.8436	16.4872	0.84188	0.0:0.8687:0.1313:0.0	.	780;780;804	E7EP77;E7EQX0;Q8IZU2	.;.;WDR17_HUMAN	C	780;780;804;787	ENSP00000422763:S780C;ENSP00000377258:S780C;ENSP00000280190:S804C	ENSP00000280190:S804C	S	+	2	0	WDR17	177309991	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.691000	0.68249	1.351000	0.45789	0.549000	0.68633	TCT	WDR17	-	NULL	ENSG00000150627		0.333	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	78	0.00	0	C			177072997	177072997	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	missense	56	26.32	20	SNP	1.000	G
ZFC3H1	196441	genome.wustl.edu	37	12	72009006	72009006	+	Silent	SNP	A	A	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr12:72009006A>C	ENST00000378743.3	-	28	5593	c.5235T>G	c.(5233-5235)ccT>ccG	p.P1745P		NM_144982.4	NP_659419.3	O60293	ZC3H1_HUMAN	zinc finger, C3H1-type containing	1745					RNA processing (GO:0006396)	extracellular space (GO:0005615)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(31)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						GCCACAAATAAGGAACTTGGT	0.348																																						dbGAP											0													99.0	92.0	94.0					12																	72009006		1870	4099	5969	-	-	-	SO:0001819	synonymous_variant	0			AB011118	CCDS41813.1	12q21.1	2013-01-25	2008-10-01	2008-10-01		ENSG00000133858		"""Zinc finger, C3H1-type containing"""	28328	protein-coding gene	gene with protein product			"""proline/serine-rich coiled-coil 2"", ""coiled-coil domain containing 131"""	PSRC2, CCDC131		9628581	Standard	NM_144982		Approved	MGC23401, KIAA0546	uc001swo.2	O60293	OTTHUMG00000169545	ENST00000378743.3:c.5235T>G	12.37:g.72009006A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GMU1|Q6P2S9|Q6ZV36|Q96BE7	Silent	SNP	pfam_Putative_zinc-finger_domain,smart_HAT,pfscan_TPR-contain_dom	p.P1745	ENST00000378743.3	37	c.5235	CCDS41813.1	12																																																																																			ZFC3H1	-	NULL	ENSG00000133858		0.348	ZFC3H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFC3H1	HGNC	protein_coding	OTTHUMT00000404751.1	65	0.00	0	A	NM_144982		72009006	72009006	-1	no_errors	ENST00000378743	ensembl	human	known	69_37n	silent	28	42.86	21	SNP	0.999	C
ZNF121	7675	genome.wustl.edu	37	19	9677328	9677328	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr19:9677328C>T	ENST00000586602.1	-	6	877	c.461G>A	c.(460-462)aGa>aAa	p.R154K	ZNF121_ENST00000320451.6_Missense_Mutation_p.R154K			P58317	ZN121_HUMAN	zinc finger protein 121	154					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|kidney(4)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)	24						TGAAGAATATCTAAAGAATTT	0.388																																						dbGAP											0													78.0	76.0	76.0					19																	9677328		2203	4300	6503	-	-	-	SO:0001583	missense	0			M99593	CCDS32902.1	19p13.2	2013-01-08	2006-08-22			ENSG00000197961		"""Zinc fingers, C2H2-type"""	12904	protein-coding gene	gene with protein product		194628	"""zinc finger protein 121 (clone ZHC32)"""	D19S204		8468057	Standard	NM_001008727		Approved	ZHC32, ZNF20	uc010xkp.1	P58317		ENST00000586602.1:c.461G>A	19.37:g.9677328C>T	ENSP00000468643:p.Arg154Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R154K	ENST00000586602.1	37	c.461		19	.	.	.	.	.	.	.	.	.	.	C	9.484	1.098918	0.20552	.	.	ENSG00000197961	ENST00000538300;ENST00000320451	T	0.07114	3.22	1.3	-1.4	0.08968	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04815	0.0130	N	0.16016	0.355	0.09310	N	1	B	0.20988	0.05	B	0.32393	0.145	T	0.45469	-0.9259	9	0.38643	T	0.18	.	2.5884	0.04836	0.0:0.4547:0.315:0.2302	.	154	P58317	ZN121_HUMAN	K	154	ENSP00000326967:R154K	ENSP00000326967:R154K	R	-	2	0	ZNF121	9538328	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-8.094000	0.00025	-0.312000	0.08741	0.491000	0.48974	AGA	ZNF121	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197961		0.388	ZNF121-003	KNOWN	basic|appris_principal	protein_coding	ZNF121	HGNC	protein_coding	OTTHUMT00000449910.1	45	0.00	0	C	NM_001008727		9677328	9677328	-1	no_errors	ENST00000320451	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	0.001	T
ZNF274	10782	genome.wustl.edu	37	19	58698334	58698334	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr19:58698334G>C	ENST00000326804.4	+	4	640	c.181G>C	c.(181-183)Gat>Cat	p.D61H	ZNF274_ENST00000597818.1_3'UTR|ZNF274_ENST00000345813.3_Intron|ZNF274_ENST00000424679.2_Intron	NM_001278734.1|NM_133502.1	NP_001265663.1|NP_598009.1	Q96GC6	ZN274_HUMAN	zinc finger protein 274	61	KRAB 1. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(13)|ovary(1)|prostate(1)|skin(1)	21		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)|Lung(386;0.215)		TTCCAAACCAGATGTGGTATC	0.502																																						dbGAP											0													49.0	47.0	48.0					19																	58698334		1932	4148	6080	-	-	-	SO:0001583	missense	0			AB029149	CCDS74473.1, CCDS74474.1, CCDS74475.1, CCDS74476.1	19q13.43	2013-01-09				ENSG00000171606		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13068	protein-coding gene	gene with protein product		605467				10777669	Standard	NM_133502		Approved	ZKSCAN19, ZSCAN51	uc002qrs.1	Q96GC6		ENST00000326804.4:c.181G>C	19.37:g.58698334G>C	ENSP00000321209:p.Asp61His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XU4|Q6MZG1|Q8WY37|Q8WY38|Q92969|Q9UII0|Q9UII1	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.D61H	ENST00000326804.4	37	c.181		19	.	.	.	.	.	.	.	.	.	.	G	17.05	3.290925	0.59976	.	.	ENSG00000171606	ENST00000326804	T	0.00949	5.51	4.37	0.956	0.19608	Krueppel-associated box (3);	0.206156	0.24236	N	0.040311	T	0.00608	0.0020	N	0.17345	0.48	0.80722	D	1	P	0.38148	0.62	B	0.32211	0.142	T	0.73646	-0.3917	10	0.54805	T	0.06	-10.2977	4.3089	0.10960	0.2123:0.1884:0.5993:0.0	.	61	Q96GC6	ZN274_HUMAN	H	61	ENSP00000321209:D61H	ENSP00000321209:D61H	D	+	1	0	ZNF274	63390146	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	0.753000	0.26376	0.315000	0.23110	0.563000	0.77884	GAT	ZNF274	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000171606		0.502	ZNF274-201	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF274	HGNC	protein_coding		21	0.00	0	G	NM_133502		58698334	58698334	+1	no_errors	ENST00000326804	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	1.000	C
ZNF335	63925	genome.wustl.edu	37	20	44598176	44598176	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr20:44598176A>G	ENST00000322927.2	-	3	456	c.356T>C	c.(355-357)gTg>gCg	p.V119A	ZNF335_ENST00000426788.1_Intron|ZNF335_ENST00000494955.1_5'Flank	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	119					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				GCAGTCGGACACCAGCATGTT	0.612											OREG0025987	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													63.0	59.0	60.0					20																	44598176		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.356T>C	20.37:g.44598176A>G	ENSP00000325326:p.Val119Ala	Somatic	925	WXS	Illumina GAIIx	Phase_IV	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V119A	ENST00000322927.2	37	c.356	CCDS13389.1	20	.	.	.	.	.	.	.	.	.	.	A	15.51	2.854493	0.51376	.	.	ENSG00000198026	ENST00000322927	T	0.15372	2.43	4.87	2.57	0.30868	.	0.159286	0.40728	N	0.001026	T	0.09905	0.0243	N	0.24115	0.695	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.18871	-1.0323	10	0.32370	T	0.25	-12.2036	6.5665	0.22515	0.7915:0.0:0.2085:0.0	.	119	Q9H4Z2	ZN335_HUMAN	A	119	ENSP00000325326:V119A	ENSP00000325326:V119A	V	-	2	0	ZNF335	44031583	1.000000	0.71417	0.982000	0.44146	0.988000	0.76386	5.238000	0.65366	0.345000	0.23873	0.460000	0.39030	GTG	ZNF335	-	NULL	ENSG00000198026		0.612	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	HGNC	protein_coding	OTTHUMT00000079553.1	14	0.00	0	A	NM_022095		44598176	44598176	-1	no_errors	ENST00000322927	ensembl	human	known	69_37n	missense	9	43.75	7	SNP	1.000	G
ZNF804A	91752	genome.wustl.edu	37	2	185803708	185803708	+	Silent	SNP	G	G	T			TCGA-E9-A1ND-01A-11D-A142-09	TCGA-E9-A1ND-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e72652d-3b99-47b2-87fe-04b96b243722	c2ad1535-c9a1-410e-9684-a1d0422a02bf	g.chr2:185803708G>T	ENST00000302277.6	+	4	4179	c.3585G>T	c.(3583-3585)ctG>ctT	p.L1195L		NM_194250.1	NP_919226.1	Q7Z570	Z804A_HUMAN	zinc finger protein 804A	1195							metal ion binding (GO:0046872)			NS(5)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(22)|liver(2)|lung(79)|ovary(7)|pancreas(1)|prostate(2)|skin(12)|urinary_tract(1)	146						TTCCTTCACTGCTTTCCCCAC	0.443																																						dbGAP											0													287.0	254.0	265.0					2																	185803708		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF052145	CCDS2291.1	2q32.1	2012-10-05	2006-10-27	2006-10-27	ENSG00000170396	ENSG00000170396			21711	protein-coding gene	gene with protein product		612282		C2orf10		12970790	Standard	NM_194250		Approved		uc002uph.3	Q7Z570	OTTHUMG00000132625	ENST00000302277.6:c.3585G>T	2.37:g.185803708G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E253|Q6ZN26	Silent	SNP	pfam_Znf_C2H2_jaz	p.L1195	ENST00000302277.6	37	c.3585	CCDS2291.1	2																																																																																			ZNF804A	-	NULL	ENSG00000170396		0.443	ZNF804A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804A	HGNC	protein_coding	OTTHUMT00000255871.1	154	0.00	0	G	NM_194250		185803708	185803708	+1	no_errors	ENST00000302277	ensembl	human	known	69_37n	silent	119	10.53	14	SNP	1.000	T
