#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ATG2A	23130	genome.wustl.edu	37	11	64674264	64674264	+	Silent	SNP	C	C	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr11:64674264C>T	ENST00000377264.3	-	20	2968	c.2856G>A	c.(2854-2856)gaG>gaA	p.E952E	ATG2A_ENST00000421419.2_Silent_p.E952E	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	952					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CGTGCACAGCCTCCAGCCGCT	0.632																																						dbGAP											0													64.0	55.0	58.0					11																	64674264		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.2856G>A	11.37:g.64674264C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.G754S	ENST00000377264.3	37	c.2260	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	C	1.431	-0.570354	0.03910	.	.	ENSG00000110046	ENST00000418259	.	.	.	5.39	2.37	0.29283	.	.	.	.	.	T	0.51924	0.1703	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42310	-0.9459	4	.	.	.	.	4.9819	0.14170	0.3048:0.5272:0.0:0.168	.	.	.	.	S	754	.	.	G	-	1	0	ATG2A	64430840	0.031000	0.19500	0.749000	0.31150	0.189000	0.23516	0.025000	0.13577	0.712000	0.32039	0.655000	0.94253	GGC	ATG2A	-	NULL	ENSG00000110046		0.632	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1	47	0.00	0	C	NM_015104		64674264	64674264	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418259	ensembl	human	novel	69_37n	missense	57	10.94	7	SNP	0.802	T
ATG2A	23130	genome.wustl.edu	37	11	64674996	64674996	+	Splice_Site	SNP	C	C	G			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr11:64674996C>G	ENST00000377264.3	-	18	2760		c.e18+1		ATG2A_ENST00000421419.2_Splice_Site	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A						autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						ACCTCTCATACCCAGCTTGAA	0.642																																						dbGAP											0													41.0	38.0	39.0					11																	64674996		2198	4296	6494	-	-	-	SO:0001630	splice_region_variant	0				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.2647+1G>C	11.37:g.64674996C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Splice_Site	SNP	-	e18+1	ENST00000377264.3	37	c.2647+1	CCDS31602.1	11	.	.	.	.	.	.	.	.	.	.	C	18.90	3.722299	0.68959	.	.	ENSG00000110046	ENST00000421419;ENST00000418259;ENST00000377264	.	.	.	4.19	4.19	0.49359	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.437	0.67287	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATG2A	64431572	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	6.475000	0.73582	2.350000	0.79820	0.655000	0.94253	.	ATG2A	-	-	ENSG00000110046		0.642	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1	49	0.00	0	C	NM_015104	Intron	64674996	64674996	-1	no_errors	ENST00000421419	ensembl	human	known	69_37n	splice_site	46	16.36	9	SNP	1.000	G
ATP10B	23120	genome.wustl.edu	37	5	160034008	160034008	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr5:160034008C>T	ENST00000327245.5	-	19	3770	c.2924G>A	c.(2923-2925)gGa>gAa	p.G975E		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	975					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TAAGCGGAATCCAAAGAGCTT	0.463																																						dbGAP											0													115.0	109.0	111.0					5																	160034008		1948	4129	6077	-	-	-	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2924G>A	5.37:g.160034008C>T	ENSP00000313600:p.Gly975Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.G975E	ENST00000327245.5	37	c.2924	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	C	8.897	0.955358	0.18507	.	.	ENSG00000118322	ENST00000327245	T	0.05649	3.41	5.05	3.15	0.36227	HAD-like domain (1);	0.555584	0.17567	N	0.169616	T	0.04907	0.0132	L	0.31752	0.955	0.51233	D	0.999912	B	0.26120	0.142	B	0.29598	0.104	T	0.41858	-0.9485	9	.	.	.	.	5.9384	0.19179	0.0:0.6741:0.1582:0.1677	.	975	O94823	AT10B_HUMAN	E	975	ENSP00000313600:G975E	.	G	-	2	0	ATP10B	159966586	0.588000	0.26799	0.522000	0.27862	0.178000	0.23041	1.155000	0.31700	1.130000	0.42092	0.563000	0.77884	GGA	ATP10B	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000118322		0.463	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	96	0.00	0	C	NM_025153		160034008	160034008	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	missense	87	17.14	18	SNP	0.664	T
CAMK1G	57172	genome.wustl.edu	37	1	209784824	209784824	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr1:209784824C>G	ENST00000009105.1	+	10	1087	c.842C>G	c.(841-843)aCa>aGa	p.T281R	CAMK1G_ENST00000494990.1_3'UTR|CAMK1G_ENST00000361322.2_Missense_Mutation_p.T281R			Q96NX5	KCC1G_HUMAN	calcium/calmodulin-dependent protein kinase IG	281	Autoinhibitory domain. {ECO:0000250}.					calcium- and calmodulin-dependent protein kinase complex (GO:0005954)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			breast(2)|central_nervous_system(1)|large_intestine(8)|lung(8)|stomach(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.0475)		GACGGAAACACAGCCCTCCAC	0.567																																					Ovarian(163;530 1939 9680 28669 48710)	dbGAP											0													111.0	90.0	97.0					1																	209784824		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1486.1	1q32.2	2012-09-20			ENSG00000008118	ENSG00000008118			14585	protein-coding gene	gene with protein product		614994				12637513	Standard	NM_020439		Approved	VWS1, CLICKIII, dJ272L16.1	uc001hhd.3	Q96NX5	OTTHUMG00000036361	ENST00000009105.1:c.842C>G	1.37:g.209784824C>G	ENSP00000009105:p.Thr281Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UH5|Q9Y3J7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T281R	ENST00000009105.1	37	c.842	CCDS1486.1	1	.	.	.	.	.	.	.	.	.	.	C	18.22	3.576099	0.65878	.	.	ENSG00000008118	ENST00000009105;ENST00000361322	T;T	0.38560	1.13;1.13	5.31	5.31	0.75309	Protein kinase-like domain (1);	0.000000	0.52532	D	0.000073	T	0.52338	0.1728	L	0.49571	1.57	0.80722	D	1	P;B	0.52842	0.956;0.292	P;P	0.51918	0.684;0.486	T	0.56013	-0.8049	10	0.87932	D	0	.	19.0077	0.92859	0.0:1.0:0.0:0.0	.	281;281	Q96NX5-2;Q96NX5	.;KCC1G_HUMAN	R	281	ENSP00000009105:T281R;ENSP00000354861:T281R	ENSP00000009105:T281R	T	+	2	0	CAMK1G	207851447	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.207000	0.77899	2.481000	0.83766	0.561000	0.74099	ACA	CAMK1G	-	superfamily_Kinase-like_dom	ENSG00000008118		0.567	CAMK1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK1G	HGNC	protein_coding	OTTHUMT00000088526.1	81	0.00	0	C	NM_020439		209784824	209784824	+1	no_errors	ENST00000009105	ensembl	human	known	69_37n	missense	82	11.83	11	SNP	1.000	G
CELF2	10659	genome.wustl.edu	37	10	11330504	11330504	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr10:11330504T>A	ENST00000379261.4	+	9	1036	c.944T>A	c.(943-945)cTc>cAc	p.L315H	CELF2_ENST00000399850.3_Missense_Mutation_p.L291H|CELF2_ENST00000315874.4_Missense_Mutation_p.L291H|CELF2_ENST00000542579.1_Missense_Mutation_p.L322H|CELF2_ENST00000354440.2_Missense_Mutation_p.L291H|CELF2_ENST00000354897.3_Missense_Mutation_p.L291H|CELF2_ENST00000608830.1_Missense_Mutation_p.L291H|CELF2_ENST00000416382.2_Missense_Mutation_p.L315H|CELF2_ENST00000450189.1_Missense_Mutation_p.L322H|CELF2_ENST00000609692.1_Missense_Mutation_p.L291H|CELF2_ENST00000537122.1_Missense_Mutation_p.L204H|CELF2_ENST00000417956.2_Missense_Mutation_p.L291H|CELF2_ENST00000427450.1_Missense_Mutation_p.L291H	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2	315	Ala-rich.				mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						CTGGGAGCCCTCACGAGTCCC	0.652																																						dbGAP											0													28.0	31.0	30.0					10																	11330504		2049	4194	6243	-	-	-	SO:0001583	missense	0			U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.944T>A	10.37:g.11330504T>A	ENSP00000368563:p.Leu315His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA	p.L322H	ENST00000379261.4	37	c.965	CCDS44354.1	10	.	.	.	.	.	.	.	.	.	.	T	24.2	4.510363	0.85389	.	.	ENSG00000048740	ENST00000379261;ENST00000416382;ENST00000450189;ENST00000542579;ENST00000399850;ENST00000417956;ENST00000315874;ENST00000354440;ENST00000354897;ENST00000427450;ENST00000537122;ENST00000538632	T;T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	4.86	4.86	0.63082	.	0.000000	0.64402	D	0.000001	T	0.63651	0.2529	L	0.60845	1.875	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.995;1.0;1.0	D;D;D;P;D;D;D	0.79784	0.956;0.968;0.993;0.907;0.971;0.991;0.956	T	0.63220	-0.6686	10	0.39692	T	0.17	-7.6575	14.4841	0.67603	0.0:0.0:0.0:1.0	.	299;315;87;310;322;310;315	B4DDE7;B4DS31;B4DMB0;B2RA86;E9PC62;O95319-3;O95319	.;.;.;.;.;.;CELF2_HUMAN	H	315;315;322;322;291;291;291;291;291;291;204;121	ENSP00000368563:L315H;ENSP00000406451:L315H;ENSP00000389951:L322H;ENSP00000443926:L322H;ENSP00000382743:L291H;ENSP00000404834:L291H;ENSP00000315328:L291H;ENSP00000346426:L291H;ENSP00000388530:L291H;ENSP00000438884:L204H	ENSP00000315328:L291H	L	+	2	0	CELF2	11370510	1.000000	0.71417	1.000000	0.80357	0.879000	0.50718	7.189000	0.77747	1.840000	0.53500	0.377000	0.23210	CTC	CELF2	-	NULL	ENSG00000048740		0.652	CELF2-201	KNOWN	basic|CCDS	protein_coding	CELF2	HGNC	protein_coding		47	0.00	0	T			11330504	11330504	+1	no_errors	ENST00000450189	ensembl	human	known	69_37n	missense	60	23.08	18	SNP	1.000	A
CLEC10A	10462	genome.wustl.edu	37	17	6980307	6980307	+	Splice_Site	SNP	C	C	A			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr17:6980307C>A	ENST00000254868.4	-	4	513		c.e4-1		CLEC10A_ENST00000416562.2_Splice_Site|CLEC10A_ENST00000576617.1_Splice_Site|CLEC10A_ENST00000571664.1_Splice_Site	NM_182906.2	NP_878910.1	Q8IUN9	CLC10_HUMAN	C-type lectin domain family 10, member A						endocytosis (GO:0006897)|innate immune response (GO:0045087)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10						AATTTGGAATCTAAACAGGTG	0.527																																						dbGAP											0													71.0	71.0	71.0					17																	6980307		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D50532	CCDS11087.1, CCDS45597.1	17p13.2	2014-05-20	2005-02-09	2005-02-11		ENSG00000132514		"""C-type lectin domain containing"", ""CD molecules"""	16916	protein-coding gene	gene with protein product	"""macrophage lectin 2 (calcium dependent)"""	605999	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 14 (macrophage-derived)"""	CLECSF13, CLECSF14		8598452	Standard	XM_005256411		Approved	HML2, HML, CD301	uc002gej.3	Q8IUN9		ENST00000254868.4:c.185-1G>T	17.37:g.6980307C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8J8|Q14538|Q6PIW3	Splice_Site	SNP	-	e3-1	ENST00000254868.4	37	c.185-1	CCDS11087.1	17	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697988	0.48307	.	.	ENSG00000132514	ENST00000254868;ENST00000416562	.	.	.	4.86	4.86	0.63082	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999988	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.8389	0.46704	0.1883:0.8117:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CLEC10A	6921031	0.195000	0.23338	0.321000	0.25320	0.574000	0.36063	1.939000	0.40213	2.673000	0.90976	0.650000	0.86243	.	CLEC10A	-	-	ENSG00000132514		0.527	CLEC10A-001	KNOWN	basic|CCDS	protein_coding	CLEC10A	HGNC	protein_coding	OTTHUMT00000439837.2	67	0.00	0	C	NM_006344	Intron	6980307	6980307	-1	no_errors	ENST00000254868	ensembl	human	known	69_37n	splice_site	91	12.50	13	SNP	0.402	A
DACT1	51339	genome.wustl.edu	37	14	59112414	59112414	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr14:59112414C>T	ENST00000335867.4	+	4	1097	c.1073C>T	c.(1072-1074)cCa>cTa	p.P358L	DACT1_ENST00000395153.3_Missense_Mutation_p.P321L|DACT1_ENST00000541264.2_Missense_Mutation_p.P77L|DACT1_ENST00000556859.1_Missense_Mutation_p.P77L			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	358					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						ACCAACAAACCAAGAACCAGC	0.537																																						dbGAP											0													63.0	61.0	62.0					14																	59112414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1073C>T	14.37:g.59112414C>T	ENSP00000337439:p.Pro358Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYJ2|Q86TY0	Missense_Mutation	SNP	NULL	p.P358L	ENST00000335867.4	37	c.1073	CCDS9736.1	14	.	.	.	.	.	.	.	.	.	.	C	7.642	0.681030	0.14907	.	.	ENSG00000165617	ENST00000556859;ENST00000421793;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T;T	0.47177	0.85;0.85;0.85;0.85;0.85;0.85	5.46	4.37	0.52481	.	0.052395	0.85682	D	0.000000	T	0.40473	0.1118	L	0.38838	1.175	0.80722	D	1	B;B	0.29232	0.238;0.238	B;B	0.33196	0.159;0.092	T	0.22626	-1.0211	10	0.28530	T	0.3	-11.6836	15.107	0.72329	0.0:0.9201:0.0:0.0799	.	321;358	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	L	77;77;77;321;358;77	ENSP00000451598:P77L;ENSP00000404297:P77L;ENSP00000378581:P77L;ENSP00000378582:P321L;ENSP00000337439:P358L;ENSP00000442850:P77L	ENSP00000337439:P358L	P	+	2	0	DACT1	58182167	0.989000	0.36119	0.981000	0.43875	0.990000	0.78478	2.852000	0.48310	2.577000	0.86979	0.563000	0.77884	CCA	DACT1	-	NULL	ENSG00000165617		0.537	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	HGNC	protein_coding	OTTHUMT00000325515.1	44	0.00	0	C	NM_016651		59112414	59112414	+1	no_errors	ENST00000335867	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.991	T
DCHS2	54798	genome.wustl.edu	37	4	155241643	155241643	+	Silent	SNP	G	G	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr4:155241643G>C	ENST00000357232.4	-	14	3542	c.3543C>G	c.(3541-3543)tcC>tcG	p.S1181S		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1181	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GGTGGACCAAGGAGCCCACTG	0.438																																						dbGAP											0													232.0	212.0	219.0					4																	155241643		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.3543C>G	4.37:g.155241643G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S1181	ENST00000357232.4	37	c.3543	CCDS3785.1	4																																																																																			DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000197410		0.438	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	181	0.00	0	G	NM_001142552		155241643	155241643	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	silent	244	10.62	29	SNP	0.361	C
DUOXA2	405753	genome.wustl.edu	37	15	45406842	45406842	+	Silent	SNP	G	G	A			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr15:45406842G>A	ENST00000323030.5	+	1	324	c.39G>A	c.(37-39)caG>caA	p.Q13Q	DUOX2_ENST00000389039.6_5'Flank|DUOX2_ENST00000603300.1_5'Flank	NM_207581.3	NP_997464.2	Q1HG44	DOXA2_HUMAN	dual oxidase maturation factor 2	13					hydrogen peroxide metabolic process (GO:0042743)|protein transport (GO:0015031)|regulation of inflammatory response (GO:0050727)|regulation of thyroid hormone generation (GO:2000609)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)							all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;2.88e-18)|GBM - Glioblastoma multiforme(94;3.95e-07)|COAD - Colon adenocarcinoma(120;0.0652)|Colorectal(133;0.0659)		TTTACCCCCAGCCCCGGCATG	0.622																																						dbGAP											0													88.0	74.0	79.0					15																	45406842		2197	4298	6495	-	-	-	SO:0001819	synonymous_variant	0			BX537581	CCDS10118.2	15q21.1	2008-10-30		2006-07-25	ENSG00000140274	ENSG00000140274			32698	protein-coding gene	gene with protein product		612772				16651268	Standard	NM_207581		Approved		uc001zuo.3	Q1HG44	OTTHUMG00000131354	ENST00000323030.5:c.39G>A	15.37:g.45406842G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPI9|H0YNQ6	Silent	SNP	pfam_Dual_oxidase_maturation_fac	p.Q13	ENST00000323030.5	37	c.39	CCDS10118.2	15																																																																																			DUOXA2	-	pfam_Dual_oxidase_maturation_fac	ENSG00000140274		0.622	DUOXA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUOXA2	HGNC	protein_coding	OTTHUMT00000254142.1	112	0.00	0	G	NM_207581		45406842	45406842	+1	no_errors	ENST00000323030	ensembl	human	known	69_37n	silent	132	14.74	23	SNP	0.004	A
EFCAB6	64800	genome.wustl.edu	37	22	44079628	44079628	+	Splice_Site	SNP	G	G	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr22:44079628G>C	ENST00000262726.7	-	12	1503	c.1250C>G	c.(1249-1251)aCt>aGt	p.T417S	EFCAB6_ENST00000396231.2_Splice_Site_p.T265S|EFCAB6_ENST00000358439.4_Intron	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	417	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				AAATCTTACAGTGTTGATTAT	0.343																																						dbGAP											0													240.0	212.0	221.0					22																	44079628		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.1251+1C>G	22.37:g.44079628G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	pfam_EF_hand_Ca-bd_contain_6,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.T417S	ENST00000262726.7	37	c.1250	CCDS14049.1	22	.	.	.	.	.	.	.	.	.	.	G	3.635	-0.074681	0.07184	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.08282	3.11;3.11	4.9	-2.38	0.06622	EF-hand-like domain (1);	1.850010	0.02461	N	0.086609	T	0.05273	0.0140	N	0.25144	0.715	0.20638	N	0.999873	B;B	0.10296	0.003;0.001	B;B	0.08055	0.003;0.002	T	0.34775	-0.9815	10	0.19147	T	0.46	0.0363	2.8075	0.05431	0.0873:0.2583:0.2249:0.4295	.	417;417	Q5THR3-6;Q5THR3	.;EFCB6_HUMAN	S	265;417	ENSP00000379533:T265S;ENSP00000262726:T417S	ENSP00000262726:T417S	T	-	2	0	EFCAB6	42410961	0.000000	0.05858	0.000000	0.03702	0.105000	0.19272	-0.518000	0.06267	-0.179000	0.10654	0.655000	0.94253	ACT	EFCAB6	-	NULL	ENSG00000186976		0.343	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB6	HGNC	protein_coding	OTTHUMT00000353176.1	264	0.00	0	G	NM_022785	Missense_Mutation	44079628	44079628	-1	no_errors	ENST00000262726	ensembl	human	known	69_37n	missense	279	11.15	35	SNP	0.000	C
EPPIN	57119	genome.wustl.edu	37	20	44171491	44171491	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr20:44171491G>T	ENST00000354280.4	-	3	305	c.239C>A	c.(238-240)cCa>cAa	p.P80Q	EPPIN_ENST00000336443.3_Missense_Mutation_p.P64Q|EPPIN_ENST00000555685.1_Missense_Mutation_p.P80Q|EPPIN_ENST00000409554.1_Intron|EPPIN-WFDC6_ENST00000504988.1_Missense_Mutation_p.P80Q	NM_020398.3	NP_065131.1	O95925	EPPI_HUMAN	epididymal peptidase inhibitor	80	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.				defense response to bacterium (GO:0042742)|negative regulation of peptidase activity (GO:0010466)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										AGTTTCTTTTGGCATTTCGCA	0.438																																						dbGAP											0													84.0	85.0	85.0					20																	44171491		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF286370	CCDS13359.1	20q13.12	2014-01-21	2012-08-22	2012-08-22	ENSG00000101448	ENSG00000101448		"""WAP four-disulfide core domain containing"""	15932	protein-coding gene	gene with protein product	"""epididymal protease inhibitor"", ""cancer/testis antigen 72"""	609031	"""serine protease inhibitor-like, with Kunitz and WAP domains 1 (eppin)"", ""serine peptidase inhibitor-like, with Kunitz and WAP domains 1 (eppin)"""	SPINLW1		11404006, 12206714	Standard	NM_020398		Approved	EPPIN1, EPPIN2, EPPIN3, dJ461P17.2, WAP7, WFDC7, CT71		O95925	OTTHUMG00000032588	ENST00000354280.4:c.239C>A	20.37:g.44171491G>T	ENSP00000361746:p.Pro80Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVD6|Q86TP9|Q96SD7|Q9HD30	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,pfam_Whey_acidic_protein_4-diS_core,superfamily_Prot_inh_Kunz-m,superfamily_Whey_acidic_protein_4-diS_core,smart_Whey_acidic_protein_4-diS_core,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.P80Q	ENST00000354280.4	37	c.239	CCDS13359.1	20	.	.	.	.	.	.	.	.	.	.	G	13.20	2.164919	0.38217	.	.	ENSG00000101448;ENSG00000101448;ENSG00000101448;ENSG00000249139	ENST00000555685;ENST00000354280;ENST00000336443;ENST00000504988	T;T;T;T	0.61742	0.08;0.08;0.08;0.08	4.41	3.45	0.39498	Proteinase inhibitor I2, Kunitz metazoa (6);	0.110203	0.41396	N	0.000897	T	0.75989	0.3925	M	0.86420	2.815	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.995;0.999	T	0.66948	-0.5794	10	0.72032	D	0.01	.	9.7825	0.40656	0.0:0.0:0.7939:0.2061	.	80;80;64	A6PVD6;O95925;O95925-2	.;EPPI_HUMAN;.	Q	80;80;64;80	ENSP00000452085:P80Q;ENSP00000361746:P80Q;ENSP00000338114:P64Q;ENSP00000424176:P80Q	ENSP00000338114:P64Q	P	-	2	0	SPINLW1;SPINLW1-WFDC6	43604905	0.969000	0.33509	0.111000	0.21465	0.003000	0.03518	3.439000	0.52878	1.195000	0.43115	-0.309000	0.09137	CCA	EPPIN	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	ENSG00000101448		0.438	EPPIN-001	KNOWN	basic|CCDS	protein_coding	EPPIN	HGNC	protein_coding	OTTHUMT00000079467.4	117	0.00	0	G			44171491	44171491	-1	no_errors	ENST00000555685	ensembl	human	known	69_37n	missense	92	19.30	22	SNP	0.007	T
FAM171A2	284069	genome.wustl.edu	37	17	42433630	42433630	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr17:42433630G>C	ENST00000293443.7	-	5	849	c.689C>G	c.(688-690)cCc>cGc	p.P230R		NM_198475.2	NP_940877.2	A8MVW0	F1712_HUMAN	family with sequence similarity 171, member A2	230						integral component of membrane (GO:0016021)											CAGGTGAATGGGGCCTGAGAG	0.627																																						dbGAP											0													49.0	60.0	57.0					17																	42433630		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45701.1	17q21.31	2008-06-16			ENSG00000161682	ENSG00000161682			30480	protein-coding gene	gene with protein product						12477932	Standard	NM_198475		Approved	MGC34829	uc002igs.2	A8MVW0	OTTHUMG00000132421	ENST00000293443.7:c.689C>G	17.37:g.42433630G>C	ENSP00000293443:p.Pro230Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQB4	Missense_Mutation	SNP	pfam_Uncharacterised_FAM171,superfamily_Collagen-bd_Cna_B-typ_dom	p.P230R	ENST00000293443.7	37	c.689	CCDS45701.1	17	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761663	0.89932	.	.	ENSG00000161682	ENST00000293443	T	0.40225	1.04	5.63	5.63	0.86233	.	0.000000	0.64402	U	0.000003	T	0.64034	0.2562	M	0.66297	2.02	0.58432	D	0.999995	D	0.76494	0.999	D	0.69479	0.964	T	0.66015	-0.6028	10	0.87932	D	0	-21.0756	18.457	0.90724	0.0:0.0:1.0:0.0	.	230	A8MVW0	F1712_HUMAN	R	230	ENSP00000293443:P230R	ENSP00000293443:P230R	P	-	2	0	FAM171A2	39789156	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.760000	0.91671	2.637000	0.89404	0.561000	0.74099	CCC	FAM171A2	-	pfam_Uncharacterised_FAM171	ENSG00000161682		0.627	FAM171A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A2	HGNC	protein_coding	OTTHUMT00000255559.2	31	0.00	0	G	NM_198475		42433630	42433630	-1	no_errors	ENST00000293443	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	1.000	C
IGHV1-2	28474	genome.wustl.edu	37	14	106452815	106452815	+	RNA	SNP	C	C	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr14:106452815C>T	ENST00000390594.2	-	0	270									immunoglobulin heavy variable 1-2																		TAGGGTTGATCCATCCCATCC	0.552																																						dbGAP											0													151.0	147.0	148.0					14																	106452815		2000	4165	6165	-	-	-			0			X07448		14q32.33	2012-02-08			ENSG00000211934	ENSG00000211934		"""Immunoglobulins / IGH locus"""	5550	other	immunoglobulin gene							Standard	NG_001019		Approved	V35			OTTHUMG00000152320		14.37:g.106452815C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.W69*	ENST00000390594.2	37	c.207		14																																																																																			IGHV1-2	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211934		0.552	IGHV1-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV1-2	HGNC	IG_V_gene	OTTHUMT00000325882.1	200	0.00	0	C	NG_001019		106452815	106452815	-1	no_stop_codon	ENST00000390594	ensembl	human	known	69_37n	nonsense	225	16.04	43	SNP	0.000	T
KDM7A	80853	genome.wustl.edu	37	7	139824558	139824558	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr7:139824558delT	ENST00000397560.2	-	7	1011	c.914delA	c.(913-915)aagfs	p.K305fs	JHDM1D_ENST00000006967.5_Frame_Shift_Del_p.K305fs	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		305	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					ATCTGTTGGCTTTATTAAATA	0.348																																						dbGAP											0													64.0	59.0	60.0					7																	139824558		1826	4081	5907	-	-	-	SO:0001589	frameshift_variant	0																														ENST00000397560.2:c.914delA	7.37:g.139824558delT	ENSP00000380692:p.Lys305fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Frame_Shift_Del	DEL	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.K305fs	ENST00000397560.2	37	c.914	CCDS43658.1	7																																																																																			JHDM1D	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000006459		0.348	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JHDM1D	HGNC	protein_coding	OTTHUMT00000348460.1	86	0.00	0	T			139824558	139824558	-1	no_errors	ENST00000397560	ensembl	human	known	69_37n	frame_shift_del	107	12.30	15	DEL	1.000	-
KCNA5	3741	genome.wustl.edu	37	12	5155008	5155008	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr12:5155008G>C	ENST00000252321.3	+	1	1924	c.1695G>C	c.(1693-1695)aaG>aaC	p.K565N		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	565					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	CCTTCTGCAAGGCTGGGGGGA	0.637																																						dbGAP											0													32.0	37.0	35.0					12																	5155008		2203	4300	6503	-	-	-	SO:0001583	missense	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1695G>C	12.37:g.5155008G>C	ENSP00000252321:p.Lys565Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.K565N	ENST00000252321.3	37	c.1695	CCDS8536.1	12	.	.	.	.	.	.	.	.	.	.	G	5.299	0.240621	0.10023	.	.	ENSG00000130037	ENST00000252321	D	0.97870	-4.58	5.1	-2.92	0.05615	.	4.037270	0.00918	U	0.002544	D	0.95683	0.8596	M	0.78049	2.395	0.22827	N	0.998685	P	0.42941	0.794	B	0.30495	0.116	D	0.89190	0.3550	10	0.62326	D	0.03	.	6.4646	0.21975	0.5519:0.0:0.322:0.1261	.	565	P22460	KCNA5_HUMAN	N	565	ENSP00000252321:K565N	ENSP00000252321:K565N	K	+	3	2	KCNA5	5025269	0.003000	0.15002	0.020000	0.16555	0.202000	0.24057	-0.102000	0.10956	-0.440000	0.07211	0.561000	0.74099	AAG	KCNA5	-	NULL	ENSG00000130037		0.637	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	40	0.00	0	G	NM_002234		5155008	5155008	+1	no_errors	ENST00000252321	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.016	C
KCNB1	3745	genome.wustl.edu	37	20	48098719	48098719	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr20:48098719C>T	ENST00000371741.4	-	1	465	c.299G>A	c.(298-300)cGc>cAc	p.R100H		NM_004975.2	NP_004966.1	Q14721	KCNB1_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 1	100					energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|dendrite membrane (GO:0032590)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(22)|pancreas(2)|prostate(7)|skin(4)|stomach(1)|urinary_tract(1)	53			BRCA - Breast invasive adenocarcinoma(12;0.000405)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Dalfampridine(DB06637)	TCGCCCAGTGCGGTAGAAGTT	0.597																																						dbGAP											0													58.0	46.0	50.0					20																	48098719		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026005	CCDS13418.1	20q13.2	2012-07-05			ENSG00000158445	ENSG00000158445		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6231	protein-coding gene	gene with protein product		600397				7774931, 16382104	Standard	NM_004975		Approved	Kv2.1	uc002xur.1	Q14721	OTTHUMG00000033051	ENST00000371741.4:c.299G>A	20.37:g.48098719C>T	ENSP00000360806:p.Arg100His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14193	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.1,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.R100H	ENST00000371741.4	37	c.299	CCDS13418.1	20	.	.	.	.	.	.	.	.	.	.	C	27.7	4.858571	0.91433	.	.	ENSG00000158445	ENST00000371741;ENST00000538812	T	0.80480	-1.38	5.37	5.37	0.77165	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.91233	0.7237	M	0.87038	2.855	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.91619	0.5309	10	0.56958	D	0.05	.	18.9149	0.92501	0.0:1.0:0.0:0.0	.	100	Q14721	KCNB1_HUMAN	H	100;55	ENSP00000360806:R100H	ENSP00000360806:R100H	R	-	2	0	KCNB1	47532126	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.651000	0.83577	2.793000	0.96121	0.563000	0.77884	CGC	KCNB1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	ENSG00000158445		0.597	KCNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB1	HGNC	protein_coding	OTTHUMT00000080374.3	37	0.00	0	C	NM_004975		48098719	48098719	-1	no_errors	ENST00000371741	ensembl	human	known	69_37n	missense	53	20.59	14	SNP	1.000	T
KIAA1468	57614	genome.wustl.edu	37	18	59888293	59888293	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr18:59888293G>T	ENST00000398130.2	+	3	872	c.640G>T	c.(640-642)Gcc>Tcc	p.A214S	KIAA1468_ENST00000256858.6_Missense_Mutation_p.A214S	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	214										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				ACTACGGAAAGCCAAGGAGAC	0.418																																						dbGAP											0													120.0	119.0	120.0					18																	59888293		1851	4093	5944	-	-	-	SO:0001583	missense	0			BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.640G>T	18.37:g.59888293G>T	ENSP00000381198:p.Ala214Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_HEAT_type_2,pfscan_LisH_dimerisation	p.A214S	ENST00000398130.2	37	c.640	CCDS11979.2	18	.	.	.	.	.	.	.	.	.	.	G	21.1	4.096058	0.76870	.	.	ENSG00000134444	ENST00000398130;ENST00000256858	T;T	0.43294	0.95;0.95	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.63698	0.2533	L	0.58302	1.8	0.80722	D	1	D;D	0.89917	0.965;1.0	P;D	0.85130	0.698;0.997	T	0.57359	-0.7825	9	.	.	.	-7.9797	20.394	0.98981	0.0:0.0:1.0:0.0	.	214;214	Q9P260-2;Q9P260	.;K1468_HUMAN	S	214	ENSP00000381198:A214S;ENSP00000256858:A214S	.	A	+	1	0	KIAA1468	58039273	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.864000	0.99589	2.830000	0.97506	0.585000	0.79938	GCC	KIAA1468	-	NULL	ENSG00000134444		0.418	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1468	HGNC	protein_coding	OTTHUMT00000256187.1	144	0.00	0	G	NM_020854		59888293	59888293	+1	no_errors	ENST00000256858	ensembl	human	known	69_37n	missense	127	14.77	22	SNP	1.000	T
KIF7	374654	genome.wustl.edu	37	15	90173555	90173555	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr15:90173555G>A	ENST00000394412.3	-	16	3357	c.3281C>T	c.(3280-3282)tCa>tTa	p.S1094L	KIF7_ENST00000558928.1_5'Flank	NM_198525.2	NP_940927.2	Q2M1P5	KIF7_HUMAN	kinesin family member 7	1094					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|smoothened signaling pathway (GO:0007224)|ventricular system development (GO:0021591)	cilium (GO:0005929)|kinesin complex (GO:0005871)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	25	Lung NSC(78;0.0237)|all_lung(78;0.0478)		BRCA - Breast invasive adenocarcinoma(143;0.128)			TCTGGTCTCTGAGGATGAGAG	0.622																																						dbGAP											0													70.0	63.0	66.0					15																	90173555		2200	4299	6499	-	-	-	SO:0001583	missense	0			AY358384	CCDS32325.2	15q26.1	2011-06-02			ENSG00000166813	ENSG00000166813		"""Kinesins"""	30497	protein-coding gene	gene with protein product		611254				11416179, 15547730	Standard	NM_198525		Approved	JBTS12	uc002bof.2	Q2M1P5	OTTHUMG00000157177	ENST00000394412.3:c.3281C>T	15.37:g.90173555G>A	ENSP00000377934:p.Ser1094Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SXY0|Q6UXE9|Q8IW72	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1094L	ENST00000394412.3	37	c.3281	CCDS32325.2	15	.	.	.	.	.	.	.	.	.	.	G	26.8	4.771593	0.90108	.	.	ENSG00000166813	ENST00000394412	T	0.71817	-0.6	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.82195	0.4984	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.85130	0.997;0.994	T	0.79487	-0.1783	10	0.33940	T	0.23	.	19.3929	0.94592	0.0:0.0:1.0:0.0	.	580;1094	B7ZKY4;Q2M1P5	.;KIF7_HUMAN	L	1094	ENSP00000377934:S1094L	ENSP00000377934:S1094L	S	-	2	0	KIF7	87974559	1.000000	0.71417	0.953000	0.39169	0.946000	0.59487	7.701000	0.84566	2.572000	0.86782	0.462000	0.41574	TCA	KIF7	-	NULL	ENSG00000166813		0.622	KIF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF7	HGNC	protein_coding	OTTHUMT00000347782.1	61	0.00	0	G	NM_198525		90173555	90173555	-1	no_errors	ENST00000394412	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	1.000	A
MSTN	2660	genome.wustl.edu	37	2	190924879	190924879	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr2:190924879G>A	ENST00000260950.4	-	2	788	c.656C>T	c.(655-657)cCt>cTt	p.P219L	C2orf88_ENST00000478197.1_Intron	NM_005259.2	NP_005250.1	O14793	GDF8_HUMAN	myostatin	219					cellular response to dexamethasone stimulus (GO:0071549)|muscle organ development (GO:0007517)|negative regulation of muscle hypertrophy (GO:0014741)|negative regulation of skeletal muscle tissue growth (GO:0048632)|ovulation cycle process (GO:0022602)|positive regulation of transcription, DNA-templated (GO:0045893)|response to electrical stimulus (GO:0051602)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gravity (GO:0009629)|response to heat (GO:0009408)|response to muscle activity (GO:0014850)|response to testosterone (GO:0033574)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue regeneration (GO:0043403)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|skin(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.000742)|Epithelial(96;0.0121)|all cancers(119;0.0395)			GTTGGATTCAGGTTGTTTGAG	0.428																																						dbGAP											0													196.0	184.0	188.0					2																	190924879		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019627	CCDS2303.1	2q32.1	2014-09-17	2007-06-21	2007-06-21	ENSG00000138379	ENSG00000138379			4223	protein-coding gene	gene with protein product		601788	"""growth differentiation factor 8"""	GDF8		9288100, 10610713, 17003236	Standard	NM_005259		Approved		uc002urp.3	O14793	OTTHUMG00000132663	ENST00000260950.4:c.656C>T	2.37:g.190924879G>A	ENSP00000260950:p.Pro219Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1C2J7|A1C2K0|Q6B0H2	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.P219L	ENST00000260950.4	37	c.656	CCDS2303.1	2	.	.	.	.	.	.	.	.	.	.	G	24.2	4.501218	0.85176	.	.	ENSG00000138379	ENST00000260950	T	0.68765	-0.35	5.24	5.24	0.73138	Transforming growth factor-beta, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81758	0.4890	M	0.70595	2.14	0.80722	D	1	D	0.69078	0.997	D	0.75484	0.986	T	0.83287	-0.0035	10	0.87932	D	0	-9.7436	18.9984	0.92822	0.0:0.0:1.0:0.0	.	219	O14793	GDF8_HUMAN	L	219	ENSP00000260950:P219L	ENSP00000260950:P219L	P	-	2	0	MSTN	190633124	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.657000	0.98554	2.718000	0.92993	0.650000	0.86243	CCT	MSTN	-	pfam_TGF-b_N	ENSG00000138379		0.428	MSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSTN	HGNC	protein_coding	OTTHUMT00000255917.2	160	0.00	0	G	NM_005259		190924879	190924879	-1	no_errors	ENST00000260950	ensembl	human	known	69_37n	missense	157	14.21	26	SNP	1.000	A
NAP1L4	4676	genome.wustl.edu	37	11	2975878	2975878	+	Splice_Site	SNP	T	T	A			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr11:2975878T>A	ENST00000380542.4	-	12	1056		c.e12-2		NAP1L4_ENST00000526115.1_Splice_Site	NM_005969.3	NP_005960.1	Q99733	NP1L4_HUMAN	nucleosome assembly protein 1-like 4						nucleosome assembly (GO:0006334)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(2)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)	13		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00301)|LUSC - Lung squamous cell carcinoma(625;0.211)		ATCTTCATCCTGAGGAGGAAA	0.438																																						dbGAP											0													57.0	56.0	57.0					11																	2975878		1878	4110	5988	-	-	-	SO:0001630	splice_region_variant	0			AA573896, BC022090, U77456	CCDS41599.1	11p15.5	2007-12-06			ENSG00000205531	ENSG00000205531			7640	protein-coding gene	gene with protein product		601651				8923002	Standard	NM_005969		Approved	NAP2	uc001lxc.3	Q99733	OTTHUMG00000011009	ENST00000380542.4:c.916-2A>T	11.37:g.2975878T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6J4|F5HFY4	Splice_Site	SNP	-	e11-2	ENST00000380542.4	37	c.916-2	CCDS41599.1	11	.	.	.	.	.	.	.	.	.	.	T	15.17	2.753119	0.49362	.	.	ENSG00000205531	ENST00000399624;ENST00000380542;ENST00000526115	.	.	.	4.51	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.9873	0.64343	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	NAP1L4	2932454	1.000000	0.71417	0.993000	0.49108	0.456000	0.32438	7.329000	0.79170	1.880000	0.54463	0.455000	0.32223	.	NAP1L4	-	-	ENSG00000205531		0.438	NAP1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L4	HGNC	protein_coding	OTTHUMT00000030273.3	65	0.00	0	T	NM_005969	Intron	2975878	2975878	-1	no_errors	ENST00000380542	ensembl	human	known	69_37n	splice_site	62	20.51	16	SNP	1.000	A
NUP133	55746	genome.wustl.edu	37	1	229633915	229633915	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr1:229633915A>G	ENST00000261396.3	-	6	878	c.787T>C	c.(787-789)Ttt>Ctt	p.F263L	NUP133_ENST00000537506.1_Missense_Mutation_p.F247L	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	263					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				AAAATTCCAAAAAGAGAAGAA	0.353																																						dbGAP											0													55.0	57.0	56.0					1																	229633915		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.787T>C	1.37:g.229633915A>G	ENSP00000261396:p.Phe263Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	pfam_Nucleoporin_Nup133/Nup155_C,pfam_Nucleoporin_Nup133/Nup155_N	p.F263L	ENST00000261396.3	37	c.787	CCDS1579.1	1	.	.	.	.	.	.	.	.	.	.	A	9.198	1.027760	0.19512	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.15017	2.46;2.46;2.46	5.71	-1.94	0.07571	WD40/YVTN repeat-like-containing domain (1);Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.110338	0.64402	N	0.000006	T	0.07773	0.0195	N	0.13098	0.295	0.29636	N	0.845114	B	0.12630	0.006	B	0.14023	0.01	T	0.39663	-0.9603	10	0.09843	T	0.71	-8.1567	12.236	0.54516	0.4613:0.0:0.5387:0.0	.	263	Q8WUM0	NU133_HUMAN	L	263;263;263;247	ENSP00000261396:F263L;ENSP00000355640:F263L;ENSP00000443496:F247L	ENSP00000261396:F263L	F	-	1	0	NUP133	227700538	0.960000	0.32886	0.531000	0.27976	0.695000	0.40330	1.249000	0.32839	-0.358000	0.08162	0.528000	0.53228	TTT	NUP133	-	pfam_Nucleoporin_Nup133/Nup155_N	ENSG00000069248		0.353	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP133	HGNC	protein_coding	OTTHUMT00000095224.1	53	0.00	0	A	NM_018230		229633915	229633915	-1	no_errors	ENST00000261396	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	0.156	G
PTPRH	5794	genome.wustl.edu	37	19	55708703	55708703	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr19:55708703G>C	ENST00000376350.3	-	9	1794	c.1772C>G	c.(1771-1773)cCc>cGc	p.P591R	PTPRH_ENST00000263434.5_Missense_Mutation_p.P413R|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	591	Fibronectin type-III 7. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CTGAGAGTGGGGGTCTCCAGG	0.557																																						dbGAP											0													70.0	73.0	72.0					19																	55708703		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.1772C>G	19.37:g.55708703G>C	ENSP00000365528:p.Pro591Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P591R	ENST00000376350.3	37	c.1772	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892264	0.33442	.	.	ENSG00000080031	ENST00000376350;ENST00000263434	T;T	0.56776	0.44;0.44	5.18	1.9	0.25705	Fibronectin, type III (4);Immunoglobulin-like fold (1);	1.700790	0.03954	N	0.288972	T	0.67887	0.2941	M	0.69823	2.125	0.18873	N	0.999982	D;D;P	0.65815	0.993;0.995;0.872	D;D;P	0.69654	0.962;0.965;0.688	T	0.48456	-0.9034	10	0.16420	T	0.52	.	7.2325	0.26051	0.2805:0.0:0.7195:0.0	.	413;413;591	C9JCH2;Q9HD43-2;Q9HD43	.;.;PTPRH_HUMAN	R	591;413	ENSP00000365528:P591R;ENSP00000263434:P413R	ENSP00000263434:P413R	P	-	2	0	PTPRH	60400515	0.079000	0.21365	0.043000	0.18650	0.004000	0.04260	0.472000	0.22116	0.301000	0.22738	0.655000	0.94253	CCC	PTPRH	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000080031		0.557	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	67	0.00	0	G			55708703	55708703	-1	no_errors	ENST00000376350	ensembl	human	known	69_37n	missense	71	18.39	16	SNP	0.274	C
LRRC23	10233	genome.wustl.edu	37	12	6993151	6993151	+	Intron	SNP	G	G	T	rs2269358	byFrequency	TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr12:6993151G>T	ENST00000433346.1	+	2	429				RPL13P5_ENST00000412023.1_RNA|DSTNP2_ENST00000602547.1_RNA|LRRC23_ENST00000449039.1_Intron|SPSB2_ENST00000437851.1_Intron			Q53EV4	LRC23_HUMAN	leucine rich repeat containing 23											NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)|stomach(1)	13						CCCTGGGCTGGAGGGAGGCAG	0.642													T|||	2345	0.468251	0.8079	0.2853	5008	,	,		-128	0.4444		0.3042	False		,,,				2504	0.3323					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC014450	CCDS8568.1, CCDS8569.1	12p13	2006-02-02			ENSG00000010626	ENSG00000010626			19138	protein-coding gene	gene with protein product						11830501, 11826754	Standard	NM_201650		Approved	B7, LRPB7	uc001qrp.3	Q53EV4	OTTHUMG00000156668	ENST00000433346.1:c.-50+68G>T	12.37:g.6993151G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8C6|D3DUT1|Q8N6K6|Q92977|Q99620	RNA	SNP	-	NULL	ENST00000433346.1	37	NULL		12																																																																																			RPL13P5	-	-	ENSG00000240370		0.642	LRRC23-011	PUTATIVE	basic	protein_coding	RPL13P5	HGNC	protein_coding	OTTHUMT00000345224.1	8	0.00	0	G	NM_006992		6993151	6993151	+1	no_errors	ENST00000412023	ensembl	human	known	69_37n	rna	2	62.50	5	SNP	0.858	T
SLC16A4	9122	genome.wustl.edu	37	1	110921957	110921957	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr1:110921957G>C	ENST00000369779.4	-	6	797	c.548C>G	c.(547-549)gCt>gGt	p.A183G	SLC16A4_ENST00000437429.2_Missense_Mutation_p.A73G|SLC16A4_ENST00000497687.1_5'UTR|SLC16A4_ENST00000472422.2_Missense_Mutation_p.A135G|SLC16A4_ENST00000541986.1_Missense_Mutation_p.A121G|SLC16A4_ENST00000369781.4_Intron	NM_001201547.1|NM_004696.2	NP_001188476.1|NP_004687.1	O15374	MOT5_HUMAN	solute carrier family 16, member 4	183					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)			breast(1)|endometrium(1)|kidney(4)|large_intestine(2)|lung(2)|ovary(3)|prostate(1)|stomach(2)	16		all_cancers(81;0.000476)|all_epithelial(167;0.000401)|all_lung(203;0.00277)|Lung NSC(277;0.0043)		Lung(183;0.0251)|all cancers(265;0.0766)|Epithelial(280;0.0807)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.14)	Pyruvic acid(DB00119)	CAATGCGATAGCTCCAAATAA	0.378																																						dbGAP											0													52.0	51.0	51.0					1																	110921957		2203	4300	6503	-	-	-	SO:0001583	missense	0			U59185	CCDS823.1, CCDS55621.1, CCDS55622.1, CCDS55623.1, CCDS55624.1	1p13.3	2013-07-18	2013-07-18		ENSG00000168679	ENSG00000168679		"""Solute carriers"""	10925	protein-coding gene	gene with protein product		603878	"""solute carrier family 16 (monocarboxylic acid transporters), member 4"", ""solute carrier family 16, member 4 (monocarboxylic acid transporter 5)"""			9425115	Standard	NM_004696		Approved	MCT4, MCT5	uc001dzo.2	O15374	OTTHUMG00000011285	ENST00000369779.4:c.548C>G	1.37:g.110921957G>C	ENSP00000358794:p.Ala183Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3V5|B2R9C9|B4DJ67|B4DPX7|E7EPY8|G3V175|Q5T612|Q8WU09	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A183G	ENST00000369779.4	37	c.548	CCDS823.1	1	.	.	.	.	.	.	.	.	.	.	g	0.243	-1.012279	0.02095	.	.	ENSG00000168679	ENST00000369779;ENST00000472422;ENST00000437429;ENST00000541986	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.89	0.214	0.15249	Major facilitator superfamily domain, general substrate transporter (1);	0.210971	0.48286	N	0.000191	T	0.07773	0.0195	N	0.03194	-0.395	0.24979	N	0.991612	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.0;0.0	T	0.44003	-0.9356	10	0.02654	T	1	.	12.9536	0.58415	0.0:0.5296:0.3691:0.1014	.	73;121;135;183	E7EPY8;B4DJ67;G3V175;O15374	.;.;.;MOT5_HUMAN	G	183;135;73;121	ENSP00000358794:A183G;ENSP00000432495:A135G;ENSP00000394790:A73G;ENSP00000446087:A121G	ENSP00000358794:A183G	A	-	2	0	SLC16A4	110723480	0.975000	0.34042	0.356000	0.25785	0.346000	0.29079	1.430000	0.34914	0.373000	0.24621	-0.155000	0.13514	GCT	SLC16A4	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000168679		0.378	SLC16A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A4	HGNC	protein_coding	OTTHUMT00000031115.3	72	0.00	0	G	NM_004696		110921957	110921957	-1	no_errors	ENST00000369779	ensembl	human	known	69_37n	missense	71	11.25	9	SNP	0.541	C
SNX10	29887	genome.wustl.edu	37	7	26412143	26412143	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr7:26412143A>G	ENST00000338523.4	+	7	744	c.557A>G	c.(556-558)gAc>gGc	p.D186G	SNX10_ENST00000446848.2_Missense_Mutation_p.D212G|SNX10_ENST00000396376.1_Missense_Mutation_p.D186G|AC004540.4_ENST00000451264.1_RNA|AC004540.4_ENST00000451368.1_RNA|SNX10_ENST00000409838.1_Missense_Mutation_p.D102G|SNX10_ENST00000462993.1_3'UTR|SNX10_ENST00000409367.1_Missense_Mutation_p.D146G	NM_001199835.1|NM_013322.2	NP_001186764.1|NP_037454.2	Q9Y5X0	SNX10_HUMAN	sorting nexin 10	186					cilium assembly (GO:0042384)|endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|osteoclast differentiation (GO:0030316)|protein localization to centrosome (GO:0071539)|protein localization to cilium (GO:0061512)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extrinsic component of endosome membrane (GO:0031313)|nucleus (GO:0005634)	1-phosphatidylinositol binding (GO:0005545)|ATPase binding (GO:0051117)			endometrium(1)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	6						AGTAGTGATGACAGCAGTTCA	0.383																																						dbGAP											0													168.0	178.0	174.0					7																	26412143		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF121860	CCDS5399.1, CCDS56470.1	7p15.2	2008-05-22			ENSG00000086300	ENSG00000086300		"""Sorting nexins"""	14974	protein-coding gene	gene with protein product		614780				17012226	Standard	NM_013322		Approved		uc010kuu.3	Q9Y5X0	OTTHUMG00000023650	ENST00000338523.4:c.557A>G	7.37:g.26412143A>G	ENSP00000343709:p.Asp186Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PFH5|Q8IYT5	Missense_Mutation	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.D212G	ENST00000338523.4	37	c.635	CCDS5399.1	7	.	.	.	.	.	.	.	.	.	.	A	15.07	2.724045	0.48728	.	.	ENSG00000086300	ENST00000338523;ENST00000446848;ENST00000396376;ENST00000409367;ENST00000409838	T;T;T;T;T	0.65178	0.44;0.39;0.44;-0.14;0.72	5.33	5.33	0.75918	.	0.322034	0.35615	N	0.003096	T	0.65616	0.2708	L	0.34521	1.04	0.42041	D	0.991078	D;B	0.63880	0.993;0.002	D;B	0.72338	0.977;0.002	T	0.62334	-0.6876	10	0.22109	T	0.4	.	9.7761	0.40621	0.9229:0.0:0.0771:0.0	.	212;186	B4DJM0;Q9Y5X0	.;SNX10_HUMAN	G	186;212;186;146;102	ENSP00000343709:D186G;ENSP00000395474:D212G;ENSP00000379661:D186G;ENSP00000387274:D146G;ENSP00000386540:D102G	ENSP00000343709:D186G	D	+	2	0	SNX10	26378668	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.108000	0.64609	1.999000	0.58509	0.528000	0.53228	GAC	SNX10	-	NULL	ENSG00000086300		0.383	SNX10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX10	HGNC	protein_coding	OTTHUMT00000214120.1	132	0.00	0	A			26412143	26412143	+1	no_errors	ENST00000446848	ensembl	human	known	69_37n	missense	182	14.95	32	SNP	1.000	G
STAP1	26228	genome.wustl.edu	37	4	68424566	68424566	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr4:68424566G>C	ENST00000265404.2	+	1	121	c.39G>C	c.(37-39)agG>agC	p.R13S	STAP1_ENST00000396225.1_Missense_Mutation_p.R13S	NM_012108.2	NP_036240.1	Q9ULZ2	STAP1_HUMAN	signal transducing adaptor family member 1	13					intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)				NS(1)|large_intestine(1)|liver(1)|lung(7)|skin(1)|urinary_tract(1)	12						CCCCTCGCAGGATCTTCCAGG	0.428																																						dbGAP											0													105.0	111.0	109.0					4																	68424566		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023483	CCDS3515.1	4q13.2	2013-02-14	2007-08-09		ENSG00000035720	ENSG00000035720		"""SH2 domain containing"""	24133	protein-coding gene	gene with protein product	"""BCR downstream signaling 1"""	604298				10518561, 10679268	Standard	NM_012108		Approved	STAP-1, BRDG1	uc003hde.4	Q9ULZ2	OTTHUMG00000129304	ENST00000265404.2:c.39G>C	4.37:g.68424566G>C	ENSP00000265404:p.Arg13Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R980	Missense_Mutation	SNP	pfam_SH2,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_SH2	p.R13S	ENST00000265404.2	37	c.39	CCDS3515.1	4	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293286	0.60086	.	.	ENSG00000035720	ENST00000265404;ENST00000396225	T;T	0.52983	0.64;0.64	5.02	2.93	0.34026	.	0.328640	0.28914	N	0.013733	T	0.59321	0.2185	L	0.57536	1.79	0.31274	N	0.691428	D	0.71674	0.998	D	0.76071	0.987	T	0.61983	-0.6950	10	0.62326	D	0.03	-7.4599	7.7634	0.28965	0.225:0.0:0.775:0.0	.	13	Q9ULZ2	STAP1_HUMAN	S	13	ENSP00000265404:R13S;ENSP00000379527:R13S	ENSP00000265404:R13S	R	+	3	2	STAP1	68107161	0.993000	0.37304	1.000000	0.80357	0.998000	0.95712	0.397000	0.20883	1.120000	0.41904	0.655000	0.94253	AGG	STAP1	-	NULL	ENSG00000035720		0.428	STAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAP1	HGNC	protein_coding	OTTHUMT00000251434.1	78	0.00	0	G	NM_012108		68424566	68424566	+1	no_errors	ENST00000265404	ensembl	human	known	69_37n	missense	83	13.54	13	SNP	0.959	C
SYT14	255928	genome.wustl.edu	37	1	210273640	210273640	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr1:210273640T>C	ENST00000472886.1	+	6	1012	c.998T>C	c.(997-999)gTt>gCt	p.V333A	SYT14_ENST00000367019.1_Missense_Mutation_p.V333A|SYT14_ENST00000422431.1_Missense_Mutation_p.V378A|SYT14_ENST00000271745.7_Intron|SYT14_ENST00000367015.1_Missense_Mutation_p.V295A|SYT14_ENST00000537238.1_Missense_Mutation_p.V295A|SYT14_ENST00000534859.1_Missense_Mutation_p.V333A|SYT14_ENST00000399639.2_Missense_Mutation_p.V333A			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	333	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		TTTAATCATGTTGAATCTGAG	0.358																																						dbGAP											0													65.0	62.0	63.0					1																	210273640		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.998T>C	1.37:g.210273640T>C	ENSP00000418901:p.Val333Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.V378A	ENST00000472886.1	37	c.1133	CCDS31014.1	1	.	.	.	.	.	.	.	.	.	.	T	16.25	3.069474	0.55539	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000399639;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T;T	0.10192	2.9;2.9;2.9;2.9;2.9;2.9;2.9	5.97	4.83	0.62350	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.124366	0.53938	D	0.000046	T	0.22898	0.0553	M	0.75884	2.315	0.40983	D	0.984795	P;P;P;P	0.43412	0.776;0.806;0.525;0.735	P;P;B;B	0.48921	0.595;0.472;0.111;0.209	T	0.01345	-1.1379	10	0.72032	D	0.01	-12.7531	12.5249	0.56081	0.1251:0.0:0.0:0.8749	.	361;333;333;378	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	A	378;333;333;295;333;333;295	ENSP00000389039:V378A;ENSP00000442891:V333A;ENSP00000445837:V333A;ENSP00000437423:V295A;ENSP00000355986:V333A;ENSP00000418901:V333A;ENSP00000355982:V295A	ENSP00000355982:V295A	V	+	2	0	SYT14	208340263	1.000000	0.71417	0.993000	0.49108	0.999000	0.98932	7.317000	0.79018	1.051000	0.40369	0.528000	0.53228	GTT	SYT14	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000143469		0.358	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT14	HGNC	protein_coding	OTTHUMT00000089124.1	72	0.00	0	T	NM_153262		210273640	210273640	+1	no_errors	ENST00000422431	ensembl	human	known	69_37n	missense	87	22.32	25	SNP	0.992	C
TLE1	7088	genome.wustl.edu	37	9	84202727	84202727	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr9:84202727T>C	ENST00000376499.3	-	17	2910	c.1846A>G	c.(1846-1848)Aca>Gca	p.T616A		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	616					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						GCTCCGTCTGTGTGGCCCTGG	0.502																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	dbGAP											0													77.0	76.0	77.0					9																	84202727		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1846A>G	9.37:g.84202727T>C	ENSP00000365682:p.Thr616Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.T616A	ENST00000376499.3	37	c.1846	CCDS6661.1	9	.	.	.	.	.	.	.	.	.	.	t	25.2	4.611688	0.87258	.	.	ENSG00000196781	ENST00000376499	T	0.64618	-0.11	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75087	0.3802	M	0.63208	1.945	0.80722	D	1	P;B	0.39443	0.674;0.303	P;P	0.55161	0.77;0.621	T	0.76884	-0.2794	10	0.87932	D	0	-14.4828	16.0796	0.80995	0.0:0.0:0.0:1.0	.	601;616	B4DEF9;Q04724	.;TLE1_HUMAN	A	616	ENSP00000365682:T616A	ENSP00000365682:T616A	T	-	1	0	TLE1	83392547	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.040000	0.89188	2.206000	0.71126	0.533000	0.62120	ACA	TLE1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196781		0.502	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE1	HGNC	protein_coding	OTTHUMT00000055407.1	95	0.00	0	T	NM_005077		84202727	84202727	-1	no_errors	ENST00000376499	ensembl	human	known	69_37n	missense	108	14.17	18	SNP	1.000	C
TRPC5	7224	genome.wustl.edu	37	X	111024400	111024400	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chrX:111024400T>A	ENST00000262839.2	-	9	3053	c.2135A>T	c.(2134-2136)cAt>cTt	p.H712L		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	712					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						TACCTGATAATGTTGATTTTG	0.458																																						dbGAP											0													219.0	173.0	188.0					X																	111024400		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.2135A>T	X.37:g.111024400T>A	ENSP00000262839:p.His712Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.H712L	ENST00000262839.2	37	c.2135	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	T	18.36	3.607710	0.66558	.	.	ENSG00000072315	ENST00000262839	T	0.80033	-1.33	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.72811	0.3507	L	0.38838	1.175	0.58432	D	0.999999	B;B	0.20550	0.023;0.046	B;B	0.20384	0.029;0.028	T	0.67413	-0.5677	10	0.22706	T	0.39	-16.5173	14.897	0.70651	0.0:0.0:0.0:1.0	.	713;712	Q59G51;Q9UL62	.;TRPC5_HUMAN	L	712	ENSP00000262839:H712L	ENSP00000262839:H712L	H	-	2	0	TRPC5	110911056	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.350000	0.79385	1.901000	0.55032	0.446000	0.29264	CAT	TRPC5	-	tigrfam_TRP_channel	ENSG00000072315		0.458	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	216	0.00	0	T	NM_012471		111024400	111024400	-1	no_errors	ENST00000262839	ensembl	human	known	69_37n	missense	283	10.16	32	SNP	1.000	A
UPF2	26019	genome.wustl.edu	37	10	12077114	12077114	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr10:12077114C>A	ENST00000356352.2	-	1	782	c.309G>T	c.(307-309)aaG>aaT	p.K103N	UPF2_ENST00000397053.2_Missense_Mutation_p.K103N|UPF2_ENST00000357604.5_Missense_Mutation_p.K103N|UPF2_ENST00000460569.1_5'UTR			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	103	Glu/Lys-rich.|Sufficient for interaction with UPF1.				gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CTTCTTGCttctttctctctt	0.403																																						dbGAP											0													209.0	193.0	199.0					10																	12077114		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.309G>T	10.37:g.12077114C>A	ENSP00000348708:p.Lys103Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.K103N	ENST00000356352.2	37	c.309	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	C	12.73	2.025889	0.35701	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000379172;ENST00000397053;ENST00000313977	T;T;T	0.52295	0.67;0.67;0.67	5.44	3.43	0.39272	.	0.163459	0.51477	D	0.000093	T	0.38904	0.1058	L	0.47716	1.5	0.34266	D	0.680485	B;B	0.25609	0.13;0.079	B;B	0.29598	0.104;0.048	T	0.45702	-0.9243	10	0.42905	T	0.14	.	7.2612	0.26203	0.0:0.7493:0.0:0.2507	.	73;103	Q9HAU5-2;Q9HAU5	.;RENT2_HUMAN	N	103;103;73;103;73	ENSP00000348708:K103N;ENSP00000350221:K103N;ENSP00000380244:K103N	ENSP00000313617:K73N	K	-	3	2	UPF2	12117120	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.577000	0.36515	0.619000	0.30197	0.591000	0.81541	AAG	UPF2	-	NULL	ENSG00000151461		0.403	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	443	0.00	0	C			12077114	12077114	-1	no_errors	ENST00000356352	ensembl	human	known	69_37n	missense	549	19.56	134	SNP	1.000	A
WNT2B	7482	genome.wustl.edu	37	1	113059026	113059026	+	Missense_Mutation	SNP	G	G	A	rs180824040		TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr1:113059026G>A	ENST00000369684.4	+	3	1153	c.668G>A	c.(667-669)cGc>cAc	p.R223H	WNT2B_ENST00000256640.5_Missense_Mutation_p.R131H|WNT2B_ENST00000478360.1_3'UTR|RP4-671G15.2_ENST00000608357.1_RNA|WNT2B_ENST00000369686.5_Missense_Mutation_p.R204H	NM_024494.2	NP_078613.1	Q93097	WNT2B_HUMAN	wingless-type MMTV integration site family, member 2B	223					canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular response to starvation (GO:0009267)|chondrocyte differentiation (GO:0002062)|cornea development in camera-type eye (GO:0061303)|forebrain regionalization (GO:0021871)|hematopoietic stem cell proliferation (GO:0071425)|iris morphogenesis (GO:0061072)|lens development in camera-type eye (GO:0002088)|lung induction (GO:0060492)|male gonad development (GO:0008584)|mesenchymal-epithelial cell signaling (GO:0060638)|neuron differentiation (GO:0030182)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(4)|ovary(2)|skin(1)|stomach(1)	18	Lung SC(450;0.246)	all_cancers(81;7.31e-07)|all_epithelial(167;4.59e-06)|all_lung(203;2.56e-05)|Lung NSC(69;4.38e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATAATAACCGCTGTGGTCGC	0.498																																						dbGAP											0													96.0	84.0	88.0					1																	113059026		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB045116	CCDS847.1, CCDS846.1	1p13	2008-07-18			ENSG00000134245	ENSG00000134245		"""Wingless-type MMTV integration sites"""	12781	protein-coding gene	gene with protein product	"""XWNT2, Xenopus, homolog of"", ""wingless-type MMTV integration site family, member 13"""	601968		WNT13		8761309, 10944466	Standard	NM_024494		Approved	XWNT2	uc001ecb.3	Q93097	OTTHUMG00000011157	ENST00000369684.4:c.668G>A	1.37:g.113059026G>A	ENSP00000358698:p.Arg223His	Somatic		WXS	Illumina GAIIx	Phase_IV	O14903|Q5TEH9|Q5TEI2|Q9HDC1|Q9HDC2	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt2	p.R223H	ENST00000369684.4	37	c.668	CCDS847.1	1	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783286	0.90282	.	.	ENSG00000134245	ENST00000256640;ENST00000369686;ENST00000369684	T;T;T	0.76448	-1.02;-1.02;-1.02	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.76608	0.4011	M	0.71871	2.18	0.80722	D	1	P;D	0.52996	0.94;0.957	P;P	0.45449	0.46;0.481	T	0.80656	-0.1285	10	0.66056	D	0.02	.	19.2806	0.94051	0.0:0.0:1.0:0.0	.	223;204	Q93097;Q93097-2	WNT2B_HUMAN;.	H	131;204;223	ENSP00000256640:R131H;ENSP00000358700:R204H;ENSP00000358698:R223H	ENSP00000256640:R131H	R	+	2	0	WNT2B	112860549	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.960000	0.87893	2.637000	0.89404	0.561000	0.74099	CGC	WNT2B	-	pfam_Wnt,smart_Wnt	ENSG00000134245		0.498	WNT2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT2B	HGNC	protein_coding	OTTHUMT00000030692.1	61	0.00	0	G	NM_004185		113059026	113059026	+1	no_errors	ENST00000369684	ensembl	human	known	69_37n	missense	76	15.56	14	SNP	1.000	A
YPEL1	29799	genome.wustl.edu	37	22	22064966	22064966	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr22:22064966C>T	ENST00000339468.3	-	2	451	c.68G>A	c.(67-69)tGt>tAt	p.C23Y	YPEL1_ENST00000403503.1_Missense_Mutation_p.C23Y	NM_013313.3	NP_037445.1	O60688	YPEL1_HUMAN	yippee-like 1 (Drosophila)	23						nucleus (GO:0005634)				breast(1)|large_intestine(1)|lung(1)	3	Colorectal(54;0.105)					GCAGTGGATACAGCTGTACGT	0.483																																						dbGAP											0													361.0	305.0	324.0					22																	22064966		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF060862	CCDS13794.1	22q11.2	2008-02-04	2001-11-28		ENSG00000100027	ENSG00000100027			12845	protein-coding gene	gene with protein product		608082	"""yippee (Drosophila) homolog-like 1"""			11473580	Standard	NM_013313		Approved		uc002zvl.3	O60688	OTTHUMG00000150830	ENST00000339468.3:c.68G>A	22.37:g.22064966C>T	ENSP00000342832:p.Cys23Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q65ZA1|Q6GLI6	Missense_Mutation	SNP	pfam_Yippee	p.C23Y	ENST00000339468.3	37	c.68	CCDS13794.1	22	.	.	.	.	.	.	.	.	.	.	C	18.41	3.618731	0.66787	.	.	ENSG00000100027	ENST00000339468;ENST00000403503	.	.	.	4.86	4.86	0.63082	.	0.000000	0.85682	D	0.000000	D	0.82976	0.5154	H	0.97291	3.975	0.80722	D	1	B	0.14805	0.011	B	0.21708	0.036	D	0.84545	0.0641	9	0.87932	D	0	.	18.5625	0.91105	0.0:1.0:0.0:0.0	.	23	O60688	YPEL1_HUMAN	Y	23	.	ENSP00000342832:C23Y	C	-	2	0	YPEL1	20394966	1.000000	0.71417	0.994000	0.49952	0.964000	0.63967	7.564000	0.82326	2.704000	0.92352	0.561000	0.74099	TGT	YPEL1	-	pfam_Yippee	ENSG00000100027		0.483	YPEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YPEL1	HGNC	protein_coding	OTTHUMT00000320245.1	300	0.00	0	C	NM_013313		22064966	22064966	-1	no_errors	ENST00000339468	ensembl	human	known	69_37n	missense	387	11.75	53	SNP	1.000	T
ZNF354C	30832	genome.wustl.edu	37	5	178505799	178505799	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr5:178505799T>G	ENST00000315475.6	+	5	672	c.366T>G	c.(364-366)atT>atG	p.I122M		NM_014594.1	NP_055409.1	Q86Y25	Z354C_HUMAN	zinc finger protein 354C	122					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|urinary_tract(3)	30	all_cancers(89;0.00065)|all_epithelial(37;0.000153)|Renal(175;0.000159)|Lung NSC(126;0.00175)|all_lung(126;0.00309)	all_cancers(40;0.19)|all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.247)		ACTGGGACATTAACTTTGAAG	0.383																																						dbGAP											0													87.0	91.0	90.0					5																	178505799		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4443.1	5q35	2013-01-08			ENSG00000177932	ENSG00000177932		"""Zinc fingers, C2H2-type"", ""-"""	16736	protein-coding gene	gene with protein product						10786630	Standard	NM_014594		Approved	KID3	uc003mju.3	Q86Y25	OTTHUMG00000130888	ENST00000315475.6:c.366T>G	5.37:g.178505799T>G	ENSP00000324064:p.Ile122Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4P9|Q8NFX1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I122M	ENST00000315475.6	37	c.366	CCDS4443.1	5	.	.	.	.	.	.	.	.	.	.	T	6.362	0.434822	0.12045	.	.	ENSG00000177932	ENST00000315475	T	0.05382	3.45	4.09	0.0516	0.14298	.	.	.	.	.	T	0.03959	0.0111	N	0.22421	0.69	0.09310	N	1	B	0.15930	0.015	B	0.17098	0.017	T	0.43798	-0.9369	9	0.33940	T	0.23	-0.9112	3.4528	0.07505	0.0:0.4428:0.1993:0.3579	.	122	Q86Y25	Z354C_HUMAN	M	122	ENSP00000324064:I122M	ENSP00000324064:I122M	I	+	3	3	ZNF354C	178438405	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.074000	0.11450	0.092000	0.17331	-0.462000	0.05337	ATT	ZNF354C	-	NULL	ENSG00000177932		0.383	ZNF354C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF354C	HGNC	protein_coding	OTTHUMT00000253473.2	62	0.00	0	T			178505799	178505799	+1	no_errors	ENST00000315475	ensembl	human	known	69_37n	missense	54	18.18	12	SNP	0.000	G
ZNF684	127396	genome.wustl.edu	37	1	41012838	41012838	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NE-01A-21D-A14K-09	TCGA-E9-A1NE-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	dbd34322-ac40-41f0-acc7-7bfd06afdf67	992642bc-6b17-456e-acf5-e2ec2a1f2a08	g.chr1:41012838G>T	ENST00000372699.3	+	5	1094	c.843G>T	c.(841-843)agG>agT	p.R281S	ZNF684_ENST00000493756.1_3'UTR	NM_152373.3	NP_689586.3	Q5T5D7	ZN684_HUMAN	zinc finger protein 684	281					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(2)|lung(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			AAACCTTCAGGTATAGTTCAT	0.393																																						dbGAP											0													76.0	80.0	79.0					1																	41012838		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS454.1	1p34.2	2013-01-08			ENSG00000117010	ENSG00000117010		"""Zinc fingers, C2H2-type"", ""-"""	28418	protein-coding gene	gene with protein product	"""hypothetical protein MGC27466"""					12477932	Standard	NM_152373		Approved	MGC27466	uc001cft.2	Q5T5D7	OTTHUMG00000007359	ENST00000372699.3:c.843G>T	1.37:g.41012838G>T	ENSP00000361784:p.Arg281Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKY4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R281S	ENST00000372699.3	37	c.843	CCDS454.1	1	.	.	.	.	.	.	.	.	.	.	G	0.112	-1.137490	0.01742	.	.	ENSG00000117010	ENST00000372699	T	0.07567	3.18	4.38	-1.26	0.09376	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.305956	0.20387	N	0.093327	T	0.01695	0.0054	N	0.01535	-0.81	0.09310	N	1	B	0.16603	0.018	B	0.23018	0.043	T	0.40136	-0.9579	10	0.02654	T	1	.	0.9585	0.01390	0.3707:0.1522:0.3211:0.156	.	281	Q5T5D7	ZN684_HUMAN	S	281	ENSP00000361784:R281S	ENSP00000361784:R281S	R	+	3	2	ZNF684	40785425	0.000000	0.05858	0.732000	0.30844	0.985000	0.73830	-1.981000	0.01490	-0.027000	0.13873	-0.749000	0.03505	AGG	ZNF684	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000117010		0.393	ZNF684-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF684	HGNC	protein_coding	OTTHUMT00000019260.3	51	0.00	0	G	NM_152373		41012838	41012838	+1	no_errors	ENST00000372699	ensembl	human	known	69_37n	missense	66	12.00	9	SNP	0.000	T
