#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADGB	79747	genome.wustl.edu	37	6	147049874	147049874	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr6:147049874C>A	ENST00000397944.3	+	20	2593	c.2517C>A	c.(2515-2517)ttC>ttA	p.F839L	ADGB_ENST00000367493.3_Missense_Mutation_p.F258L	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	839					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						CACAGCACTTCAGGGTAAGCT	0.413																																						dbGAP											0													94.0	80.0	84.0					6																	147049874		692	1591	2283	-	-	-	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.2517C>A	6.37:g.147049874C>A	ENSP00000381036:p.Phe839Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T402|Q5T904|Q5T905	Nonsense_Mutation	SNP	superfamily_Globin-like,pfscan_IQ_motif_EF-hand-BS	p.S259*	ENST00000397944.3	37	c.776		6	.	.	.	.	.	.	.	.	.	.	C	21.3	4.128657	0.77549	.	.	ENSG00000118492	ENST00000397944;ENST00000367493	T	0.32272	1.46	5.59	3.77	0.43336	Globin, structural domain (1);	.	.	.	.	T	0.13457	0.0326	M	0.64997	1.995	0.27109	N	0.962415	P	0.43788	0.817	B	0.36092	0.217	T	0.06844	-1.0804	9	0.59425	D	0.04	.	8.5439	0.33410	0.0:0.763:0.1544:0.0826	.	839	Q8N7X0	CAN7L_HUMAN	L	839;258	ENSP00000381036:F839L	ENSP00000356463:F258L	F	+	3	2	C6orf103	147091567	0.986000	0.35501	0.992000	0.48379	0.978000	0.69477	0.669000	0.25142	0.704000	0.31869	0.591000	0.81541	TTC	ADGB	-	superfamily_Globin-like	ENSG00000118492		0.413	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	85	0.00	0	C	NM_024694		147049874	147049874	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000480328	ensembl	human	known	69_37n	nonsense	87	17.92	19	SNP	0.999	A
ARHGAP35	2909	genome.wustl.edu	37	19	47503802	47503802	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr19:47503802delT	ENST00000404338.3	+	6	4357	c.4357delT	c.(4357-4359)tctfs	p.S1453fs		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	1453	Pro-rich.			PS -> RN (in Ref. 6; AAA58618). {ECO:0000305}.	axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										CAGCTCCCCCTCTGCCGTGGC	0.632																																						dbGAP											0													64.0	70.0	68.0					19																	47503802		2031	4158	6189	-	-	-	SO:0001589	frameshift_variant	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.4357delT	19.37:g.47503802delT	ENSP00000385720:p.Ser1453fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2A4|Q14452|Q9C0E1	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S1453fs	ENST00000404338.3	37	c.4357	CCDS46127.1	19																																																																																			ARHGAP35	-	NULL	ENSG00000160007		0.632	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	55	0.00	0	T	NM_004491		47503802	47503802	+1	no_errors	ENST00000404338	ensembl	human	known	69_37n	frame_shift_del	25	21.21	7	DEL	0.950	-
ARHGEF10L	55160	genome.wustl.edu	37	1	17975064	17975064	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:17975064C>G	ENST00000361221.3	+	22	2447	c.2288C>G	c.(2287-2289)cCa>cGa	p.P763R	ARHGEF10L_ENST00000375408.3_Missense_Mutation_p.P536R|ARHGEF10L_ENST00000167825.4_Missense_Mutation_p.P466R|ARHGEF10L_ENST00000375415.1_Missense_Mutation_p.P724R|ARHGEF10L_ENST00000452522.1_Missense_Mutation_p.P724R|ARHGEF10L_ENST00000434513.1_Missense_Mutation_p.P758R|ARHGEF10L_ENST00000469726.1_3'UTR	NM_018125.3	NP_060595	Q9HCE6	ARGAL_HUMAN	Rho guanine nucleotide exchange factor (GEF) 10-like	763						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	43		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00598)|COAD - Colon adenocarcinoma(227;1.62e-05)|BRCA - Breast invasive adenocarcinoma(304;1.68e-05)|Kidney(64;0.000269)|KIRC - Kidney renal clear cell carcinoma(64;0.00361)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0718)|Lung(427;0.204)		GAGAACCAGCCAGGCTGGCTA	0.627																																						dbGAP											0													63.0	63.0	63.0					1																	17975064		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046846	CCDS182.1, CCDS30617.1	1p36.13	2011-11-16			ENSG00000074964	ENSG00000074964		"""Rho guanine nucleotide exchange factors"""	25540	protein-coding gene	gene with protein product	"""GrinchGEF"""	612494				10997877, 16112081	Standard	XM_005245923		Approved	FLJ10521, KIAA1626	uc001ban.3	Q9HCE6	OTTHUMG00000002514	ENST00000361221.3:c.2288C>G	1.37:g.17975064C>G	ENSP00000355060:p.Pro763Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS1|Q17RW1|Q3YFJ4|Q5VXI5|Q5VXI6|Q66K51|Q6P0L7|Q8NAV5|Q9NVT3	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_WD40_repeat_dom,smart_DH-domain,pfscan_DH-domain	p.P763R	ENST00000361221.3	37	c.2288	CCDS182.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.002214	0.74932	.	.	ENSG00000074964	ENST00000361221;ENST00000452522;ENST00000434513;ENST00000375415;ENST00000375408;ENST00000457829;ENST00000167825	T;T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16;2.16	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	M	0.75264	2.295	0.58432	D	0.999995	D;D;D;D;D;D;D	0.89917	0.992;0.991;1.0;0.996;0.996;1.0;1.0	D;D;D;D;D;D;D	0.87578	0.938;0.952;0.996;0.957;0.972;0.998;0.994	T	0.43114	-0.9411	10	0.49607	T	0.09	-21.1446	14.8497	0.70286	0.0:1.0:0.0:0.0	.	536;758;466;524;719;724;763	Q5VXI4;Q9HCE6-5;Q9HCE6-4;B3KX74;Q9HCE6-3;Q9HCE6-2;Q9HCE6	.;.;.;.;.;.;ARGAL_HUMAN	R	763;724;758;724;536;536;466	ENSP00000355060:P763R;ENSP00000399401:P724R;ENSP00000394621:P758R;ENSP00000364564:P724R;ENSP00000364557:P536R;ENSP00000167825:P466R	ENSP00000167825:P466R	P	+	2	0	ARHGEF10L	17847651	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	6.241000	0.72369	2.340000	0.79590	0.591000	0.81541	CCA	ARHGEF10L	-	NULL	ENSG00000074964		0.627	ARHGEF10L-001	KNOWN	basic|CCDS	protein_coding	ARHGEF10L	HGNC	protein_coding	OTTHUMT00000007147.1	87	0.00	0	C	NM_018125		17975064	17975064	+1	no_errors	ENST00000361221	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	0.998	G
ATG5	9474	genome.wustl.edu	37	6	106649944	106649944	+	Silent	SNP	G	G	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr6:106649944G>A	ENST00000369076.3	-	7	917	c.594C>T	c.(592-594)ttC>ttT	p.F198F	ATG5_ENST00000360666.4_Missense_Mutation_p.S75L|ATG5_ENST00000343245.3_Silent_p.F198F|ATG5_ENST00000369070.1_Silent_p.F120F|ATG5_ENST00000475645.1_5'UTR	NM_004849.2	NP_004840.1	Q9H1Y0	ATG5_HUMAN	autophagy related 5	198					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|blood vessel remodeling (GO:0001974)|heart contraction (GO:0060047)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of type I interferon production (GO:0032480)|negative stranded viral RNA replication (GO:0039689)|otolith development (GO:0048840)|post-translational protein modification (GO:0043687)|regulation of cilium assembly (GO:1902017)|regulation of cytokine secretion involved in immune response (GO:0002739)|response to drug (GO:0042493)|response to fungus (GO:0009620)|vasodilation (GO:0042311)|ventricular cardiac muscle cell development (GO:0055015)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|membrane (GO:0016020)|pre-autophagosomal structure membrane (GO:0034045)				endometrium(1)|large_intestine(5)|lung(1)|prostate(1)	8	Breast(9;0.0296)	all_cancers(87;0.000301)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|all_epithelial(87;0.0612)|Lung NSC(302;0.216)	BRCA - Breast invasive adenocarcinoma(8;0.00802)	OV - Ovarian serous cystadenocarcinoma(136;0.128)|Epithelial(106;0.159)|all cancers(137;0.18)		GCTTCTGAATGAAAGGTCTTT	0.368																																						dbGAP											0													98.0	91.0	93.0					6																	106649944		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y11588	CCDS5055.1, CCDS69159.1, CCDS75498.1	6q21	2014-02-12	2012-06-06	2005-09-11	ENSG00000057663	ENSG00000057663			589	protein-coding gene	gene with protein product		604261	"""APG5 (autophagy 5, S. cerevisiae)-like"", ""APG5 autophagy 5-like (S. cerevisiae)"", ""ATG5 autophagy related 5 homolog (S. cerevisiae)"""	APG5L		9563500, 11349150, 15778222	Standard	NM_001286111		Approved	ASP, APG5, hAPG5	uc003prf.3	Q9H1Y0	OTTHUMG00000016193	ENST00000369076.3:c.594C>T	6.37:g.106649944G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60875|Q5JVR2|Q68DI4|Q9H2B8|Q9HCZ7	Missense_Mutation	SNP	NULL	p.S75L	ENST00000369076.3	37	c.224	CCDS5055.1	6	.	.	.	.	.	.	.	.	.	.	G	15.37	2.812419	0.50527	.	.	ENSG00000057663	ENST00000360666	.	.	.	5.09	4.22	0.49857	.	.	.	.	.	T	0.15392	0.0371	.	.	.	0.22226	N	0.999272	B	0.06786	0.001	B	0.09377	0.004	T	0.23261	-1.0193	7	0.87932	D	0	-21.0135	7.2006	0.25879	0.2618:0.0:0.7381:0.0	.	75	Q7Z3H3	.	L	75	.	ENSP00000353884:S75L	S	-	2	0	ATG5	106756637	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.622000	0.46427	1.141000	0.42275	0.561000	0.74099	TCA	ATG5	-	NULL	ENSG00000057663		0.368	ATG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG5	HGNC	protein_coding	OTTHUMT00000043476.1	83	0.00	0	G	NM_004849		106649944	106649944	-1	no_errors	ENST00000360666	ensembl	human	known	69_37n	missense	80	10.11	9	SNP	1.000	A
ATP1B1	481	genome.wustl.edu	37	1	169094132	169094132	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:169094132G>T	ENST00000367816.1	+	4	766	c.237G>T	c.(235-237)caG>caT	p.Q79H	ATP1B1_ENST00000367815.4_Missense_Mutation_p.Q79H|ATP1B1_ENST00000367813.3_Missense_Mutation_p.Q71H|ATP1B1_ENST00000499679.3_Missense_Mutation_p.Q23H			P05026	AT1B1_HUMAN	ATPase, Na+/K+ transporting, beta 1 polypeptide	79					blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular potassium ion homeostasis (GO:0030007)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|leukocyte migration (GO:0050900)|membrane repolarization (GO:0086009)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|positive regulation of ATP catabolic process (GO:1903291)|positive regulation of ATPase activity (GO:0032781)|positive regulation of calcium:sodium antiporter activity (GO:1903281)|positive regulation of potassium ion import (GO:1903288)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of sodium ion export from cell (GO:1903278)|potassium ion import (GO:0010107)|protein localization to plasma membrane (GO:0072659)|protein stabilization (GO:0050821)|protein transport into plasma membrane raft (GO:0044861)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of gene expression (GO:0010468)|relaxation of cardiac muscle (GO:0055119)|response to hypoxia (GO:0001666)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sodium:potassium-exchanging ATPase complex (GO:0005890)|vesicle (GO:0031982)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|MHC class II protein complex binding (GO:0023026)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	14	all_hematologic(923;0.208)					GATTAACACAGATTCCTCAGA	0.388																																						dbGAP											0													108.0	105.0	106.0					1																	169094132		2203	4300	6503	-	-	-	SO:0001583	missense	0			U16799	CCDS1276.1	1q24.2	2012-10-22			ENSG00000143153	ENSG00000143153		"""ATPases / P-type"""	804	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit beta-1"", ""sodium pump subunit beta-1"", ""sodium-potassium ATPase subunit beta 1 (non-catalytic)"""	182330		ATP1B			Standard	NM_001677		Approved		uc001gfr.1	P05026	OTTHUMG00000034590	ENST00000367816.1:c.237G>T	1.37:g.169094132G>T	ENSP00000356790:p.Gln79His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGZ3	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	p.Q79H	ENST00000367816.1	37	c.237	CCDS1276.1	1	.	.	.	.	.	.	.	.	.	.	G	10.58	1.391405	0.25118	.	.	ENSG00000143153	ENST00000367816;ENST00000367815;ENST00000499679;ENST00000367813	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.57	4.65	0.58169	.	0.051143	0.85682	D	0.000000	T	0.05868	0.0153	N	0.16066	0.365	0.37110	D	0.900321	B	0.14012	0.009	B	0.17979	0.02	T	0.30179	-0.9987	9	0.17832	T	0.49	-16.8289	5.0616	0.14560	0.2029:0.0:0.6329:0.1642	.	79	P05026	AT1B1_HUMAN	H	79;79;23;71	ENSP00000356790:Q79H;ENSP00000356789:Q79H;ENSP00000423450:Q23H;ENSP00000356787:Q71H	ENSP00000356787:Q71H	Q	+	3	2	ATP1B1	167360756	0.840000	0.29493	0.995000	0.50966	0.995000	0.86356	1.242000	0.32755	2.614000	0.88457	0.655000	0.94253	CAG	ATP1B1	-	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	ENSG00000143153		0.388	ATP1B1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP1B1	HGNC	protein_coding	OTTHUMT00000083696.1	86	0.00	0	G			169094132	169094132	+1	no_errors	ENST00000367815	ensembl	human	known	69_37n	missense	70	10.26	8	SNP	0.334	T
OSER1	51526	genome.wustl.edu	37	20	42831600	42831600	+	Splice_Site	SNP	C	C	A	rs3177803		TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr20:42831600C>A	ENST00000372970.2	-	5	372		c.e5+1		OSER1_ENST00000255174.2_Splice_Site			Q9NX31	OSER1_HUMAN	oxidative stress responsive serine-rich 1						cellular response to hydrogen peroxide (GO:0070301)												GAAGCTCTTACCCGTGCCAAC	0.388																																						dbGAP											0													163.0	127.0	139.0					20																	42831600		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AL035447	CCDS13327.1	20q13.11	2013-05-17	2013-05-17	2013-05-17	ENSG00000132823	ENSG00000132823			16105	protein-coding gene	gene with protein product	"""peroxide-inducible transcript 1"", ""oxidative stress-responsive 1"""		"""chromosome 20 open reading frame 111"""	C20orf111		17148688	Standard	NM_016470		Approved	dJ1183I21.1, HSPC207, Perit1, Osr1		Q9NX31	OTTHUMG00000032518	ENST00000372970.2:c.191+1G>T	20.37:g.42831600C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCK4|O95912|Q9NZ84|Q9P0R8	Splice_Site	SNP	-	e2+1	ENST00000372970.2	37	c.191+1	CCDS13327.1	20	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933772	0.73442	.	.	ENSG00000132823	ENST00000255174;ENST00000372970	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9478	0.92628	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	C20orf111	42265014	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	5.141000	0.64814	2.726000	0.93360	0.655000	0.94253	.	C20orf111	-	-	ENSG00000132823		0.388	OSER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf111	HGNC	protein_coding	OTTHUMT00000079334.2	125	0.00	0	C	NM_016470	Intron	42831600	42831600	-1	no_errors	ENST00000255174	ensembl	human	known	69_37n	splice_site	104	21.80	29	SNP	1.000	A
CALR3	125972	genome.wustl.edu	37	19	16606648	16606648	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr19:16606648C>T	ENST00000269881.3	-	2	169	c.107G>A	c.(106-108)cGa>cAa	p.R36Q	C19orf44_ENST00000594035.1_5'Flank|CTD-3222D19.2_ENST00000409035.1_3'UTR|C19orf44_ENST00000221671.3_5'Flank	NM_145046.4	NP_659483.2	Q96L12	CALR3_HUMAN	calreticulin 3	36	N-domain.				cell differentiation (GO:0030154)|protein folding (GO:0006457)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|prostate(1)|skin(1)	15						CTGCAACCATCGGTTTCTCCA	0.458																																						dbGAP											0													75.0	70.0	72.0					19																	16606648		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058084	CCDS12344.1	19p13.11	2014-09-17				ENSG00000269058			20407	protein-coding gene	gene with protein product	"""cancer/testis antigen 93"", ""calsperin"""	611414				12384296	Standard	NM_145046		Approved	CRT2, FLJ25355, MGC26577, CT93	uc002ned.3	Q96L12		ENST00000269881.3:c.107G>A	19.37:g.16606648C>T	ENSP00000269881:p.Arg36Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D9N574|Q96LN3	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,superfamily_Calreticulin/calnexin_P,pirsf_Calreticulin,prints_Calret/calnex	p.R36Q	ENST00000269881.3	37	c.107	CCDS12344.1	19	.	.	.	.	.	.	.	.	.	.	c	37	6.222319	0.97390	.	.	ENSG00000141979	ENST00000269881	T	0.52526	0.66	5.39	5.39	0.77823	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.73877	0.3643	M	0.87038	2.855	0.45883	D	0.99873	D	0.89917	1.0	D	0.85130	0.997	T	0.78966	-0.1995	10	0.87932	D	0	-19.4158	17.7054	0.88308	0.0:1.0:0.0:0.0	.	36	Q96L12	CALR3_HUMAN	Q	36	ENSP00000269881:R36Q	ENSP00000269881:R36Q	R	-	2	0	CALR3	16467648	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.371000	0.79600	2.524000	0.85096	0.543000	0.68304	CGA	CALR3	-	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,pirsf_Calreticulin	ENSG00000141979		0.458	CALR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALR3	HGNC	protein_coding	OTTHUMT00000461089.1	77	0.00	0	C	NM_145046		16606648	16606648	-1	no_errors	ENST00000269881	ensembl	human	known	69_37n	missense	59	18.92	14	SNP	1.000	T
CD1B	910	genome.wustl.edu	37	1	158298045	158298045	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:158298045G>A	ENST00000368168.3	-	6	1090	c.983C>T	c.(982-984)tCa>tTa	p.S328L		NM_001764.2	NP_001755.1	P29016	CD1B_HUMAN	CD1b molecule	328					antigen processing and presentation (GO:0019882)|immune response (GO:0006955)	cell surface (GO:0009986)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)				breast(2)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	30	all_hematologic(112;0.0378)					ATTCTGATATGACCTGTTAAA	0.363																																						dbGAP											0													144.0	134.0	138.0					1																	158298045		2203	4300	6503	-	-	-	SO:0001583	missense	0			M28826	CCDS1176.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158485	ENSG00000158485		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1635	protein-coding gene	gene with protein product		188360	"""CD1B antigen, b polypeptide"", ""CD1b antigen"""	CD1		2447586	Standard	NM_001764		Approved		uc001frx.3	P29016	OTTHUMG00000017513	ENST00000368168.3:c.983C>T	1.37:g.158298045G>A	ENSP00000357150:p.Ser328Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDK9|Q5TDL0|Q9UMM2	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.S328L	ENST00000368168.3	37	c.983	CCDS1176.1	1	.	.	.	.	.	.	.	.	.	.	G	13.98	2.397924	0.42512	.	.	ENSG00000158485	ENST00000368168	T	0.01388	4.95	3.65	2.73	0.32206	.	0.278394	0.19488	N	0.113047	T	0.02807	0.0084	M	0.85041	2.73	0.09310	N	1	D;B	0.69078	0.997;0.019	P;B	0.62560	0.904;0.01	T	0.31916	-0.9926	10	0.62326	D	0.03	-0.3105	7.1577	0.25647	0.1228:0.0:0.8772:0.0	.	328;273	P29016;P29016-2	CD1B_HUMAN;.	L	328	ENSP00000357150:S328L	ENSP00000357150:S328L	S	-	2	0	CD1B	156564669	0.992000	0.36948	0.037000	0.18230	0.007000	0.05969	2.744000	0.47450	1.109000	0.41680	-0.140000	0.14226	TCA	CD1B	-	NULL	ENSG00000158485		0.363	CD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1B	HGNC	protein_coding	OTTHUMT00000046350.2	196	0.00	0	G	NM_001764		158298045	158298045	-1	no_errors	ENST00000368168	ensembl	human	known	69_37n	missense	127	20.13	32	SNP	0.062	A
CEP19	84984	genome.wustl.edu	37	3	196434456	196434456	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr3:196434456C>A	ENST00000399942.4	-	2	647	c.353G>T	c.(352-354)tGt>tTt	p.C118F	CEP19_ENST00000409690.3_Missense_Mutation_p.C157F|RNU6-646P_ENST00000364571.1_RNA			Q96LK0	CEP19_HUMAN	centrosomal protein 19kDa	153						centriole (GO:0005814)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	10						GTCCCAGCCACAGGACTGCAG	0.408																																						dbGAP											0													99.0	94.0	95.0					3																	196434456		1934	4153	6087	-	-	-	SO:0001583	missense	0			BC007827	CCDS43193.2	3q29	2014-02-20	2011-05-06	2011-05-06	ENSG00000174007	ENSG00000174007			28209	protein-coding gene	gene with protein product		615586	"""chromosome 3 open reading frame 34"""	C3orf34		21399614	Standard	XM_005269370		Approved	MGC14126	uc011btw.2	Q96LK0	OTTHUMG00000153933	ENST00000399942.4:c.353G>T	3.37:g.196434456C>A	ENSP00000382823:p.Cys118Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA74|Q96I48	Missense_Mutation	SNP	NULL	p.C157F	ENST00000399942.4	37	c.470		3	.	.	.	.	.	.	.	.	.	.	C	19.07	3.755600	0.69648	.	.	ENSG00000174007	ENST00000409690;ENST00000399942	.	.	.	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.82843	0.5125	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.83465	0.0056	9	0.72032	D	0.01	-9.7234	20.1253	0.97977	0.0:1.0:0.0:0.0	.	153	Q96LK0	CEP19_HUMAN	F	157;118	.	ENSP00000382823:C118F	C	-	2	0	CEP19	197918853	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.202000	0.77856	2.832000	0.97577	0.655000	0.94253	TGT	CEP19	-	NULL	ENSG00000174007		0.408	CEP19-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CEP19	HGNC	protein_coding	OTTHUMT00000333081.1	124	0.00	0	C	NM_032898		196434456	196434456	-1	no_errors	ENST00000409690	ensembl	human	known	69_37n	missense	98	14.66	17	SNP	1.000	A
COL5A3	50509	genome.wustl.edu	37	19	10097049	10097049	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr19:10097049G>A	ENST00000264828.3	-	30	2379	c.2294C>T	c.(2293-2295)cCg>cTg	p.P765L		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	765	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			CTGCCCCTTCGGCCCCTCAGG	0.602																																						dbGAP											0													20.0	25.0	23.0					19																	10097049		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.2294C>T	19.37:g.10097049G>A	ENSP00000264828:p.Pro765Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.P765L	ENST00000264828.3	37	c.2294	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758108	0.31137	.	.	ENSG00000080573	ENST00000264828	D	0.92495	-3.05	4.32	-3.66	0.04489	.	0.506434	0.18244	N	0.147152	D	0.83317	0.5228	L	0.33710	1.025	0.21064	N	0.999796	B	0.02656	0.0	B	0.01281	0.0	T	0.68420	-0.5413	10	0.39692	T	0.17	.	7.9715	0.30130	0.2588:0.0:0.5913:0.1499	.	765	P25940	CO5A3_HUMAN	L	765	ENSP00000264828:P765L	ENSP00000264828:P765L	P	-	2	0	COL5A3	9958049	0.033000	0.19621	0.021000	0.16686	0.509000	0.34042	0.250000	0.18235	-0.882000	0.03987	-1.587000	0.00848	CCG	COL5A3	-	NULL	ENSG00000080573		0.602	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	30	0.00	0	G	NM_015719		10097049	10097049	-1	no_errors	ENST00000264828	ensembl	human	known	69_37n	missense	11	54.17	13	SNP	0.074	A
EFCAB7	84455	genome.wustl.edu	37	1	63999242	63999242	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:63999242G>A	ENST00000371088.4	+	5	850	c.604G>A	c.(604-606)Gaa>Aaa	p.E202K		NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	202							calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						AGGGTCCCCTGAAAGGGACCC	0.393																																						dbGAP											0													112.0	120.0	118.0					1																	63999242		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.604G>A	1.37:g.63999242G>A	ENSP00000360129:p.Glu202Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658P0|Q96B95|Q96JM6	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E202K	ENST00000371088.4	37	c.604	CCDS30737.1	1	.	.	.	.	.	.	.	.	.	.	G	9.506	1.104450	0.20632	.	.	ENSG00000203965	ENST00000371088	T	0.59224	0.28	5.69	5.69	0.88448	.	0.291833	0.43260	D	0.000589	T	0.43233	0.1238	L	0.50333	1.59	0.80722	D	1	B	0.18741	0.03	B	0.13407	0.009	T	0.29088	-1.0023	10	0.37606	T	0.19	-16.715	19.8113	0.96547	0.0:0.0:1.0:0.0	.	202	A8K855	EFCB7_HUMAN	K	202	ENSP00000360129:E202K	ENSP00000360129:E202K	E	+	1	0	EFCAB7	63771830	0.999000	0.42202	0.997000	0.53966	0.465000	0.32709	2.997000	0.49457	2.690000	0.91761	0.655000	0.94253	GAA	EFCAB7	-	NULL	ENSG00000203965		0.393	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB7	HGNC	protein_coding	OTTHUMT00000024910.1	63	0.00	0	G	NM_032437		63999242	63999242	+1	no_errors	ENST00000371088	ensembl	human	known	69_37n	missense	28	44.00	22	SNP	0.998	A
EFCAB7	84455	genome.wustl.edu	37	1	64011686	64011686	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:64011686G>C	ENST00000371088.4	+	7	1150	c.904G>C	c.(904-906)Gtt>Ctt	p.V302L	DLEU2L_ENST00000340052.3_5'Flank|DLEU2L_ENST00000371086.2_5'Flank	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	302							calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						GAGGTCCATGGTTTATCTAAC	0.353																																						dbGAP											0													105.0	105.0	105.0					1																	64011686		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.904G>C	1.37:g.64011686G>C	ENSP00000360129:p.Val302Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658P0|Q96B95|Q96JM6	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.V302L	ENST00000371088.4	37	c.904	CCDS30737.1	1	.	.	.	.	.	.	.	.	.	.	G	11.92	1.782277	0.31502	.	.	ENSG00000203965	ENST00000371088	T	0.49432	0.78	5.61	3.71	0.42584	.	0.108239	0.64402	N	0.000007	T	0.17534	0.0421	L	0.37507	1.11	0.80722	D	1	B	0.13594	0.008	B	0.15052	0.012	T	0.05869	-1.0859	10	0.16896	T	0.51	-8.8748	10.8219	0.46610	0.0685:0.2529:0.6786:0.0	.	302	A8K855	EFCB7_HUMAN	L	302	ENSP00000360129:V302L	ENSP00000360129:V302L	V	+	1	0	EFCAB7	63784274	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.392000	0.52537	0.712000	0.32039	0.591000	0.81541	GTT	EFCAB7	-	NULL	ENSG00000203965		0.353	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB7	HGNC	protein_coding	OTTHUMT00000024910.1	77	0.00	0	G	NM_032437		64011686	64011686	+1	no_errors	ENST00000371088	ensembl	human	known	69_37n	missense	77	14.44	13	SNP	0.997	C
EPB41L5	57669	genome.wustl.edu	37	2	120903830	120903830	+	Silent	SNP	T	T	C			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr2:120903830T>C	ENST00000263713.5	+	20	1972	c.1758T>C	c.(1756-1758)caT>caC	p.H586H	EPB41L5_ENST00000452780.1_Silent_p.H586H|EPB41L5_ENST00000443902.2_Silent_p.H586H	NM_020909.3	NP_065960.2	Q9HCM4	E41L5_HUMAN	erythrocyte membrane protein band 4.1 like 5	586					actomyosin structure organization (GO:0031032)|apical constriction (GO:0003383)|axial mesoderm morphogenesis (GO:0048319)|cellular response to transforming growth factor beta stimulus (GO:0071560)|ectoderm development (GO:0007398)|embryonic foregut morphogenesis (GO:0048617)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|in utero embryonic development (GO:0001701)|left/right axis specification (GO:0070986)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of protein binding (GO:0032091)|neural plate morphogenesis (GO:0001839)|paraxial mesoderm development (GO:0048339)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein binding (GO:0032092)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of establishment of protein localization (GO:0070201)|somite rostral/caudal axis specification (GO:0032525)|substrate-dependent cell migration, cell attachment to substrate (GO:0006931)|unidimensional cell growth (GO:0009826)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(5)|lung(12)|ovary(1)	26						TATTAAGTCATAAAAATGCCA	0.284																																						dbGAP											0													52.0	53.0	53.0					2																	120903830		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK023019	CCDS2130.1, CCDS54392.1, CCDS54393.1	2q14.2	2009-07-28			ENSG00000115109	ENSG00000115109			19819	protein-coding gene	gene with protein product		611730					Standard	NM_001184937		Approved	KIAA1548, FLJ12957, BE37, YMO1	uc002tmg.3	Q9HCM4	OTTHUMG00000131433	ENST00000263713.5:c.1758T>C	2.37:g.120903830T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5S1|Q8IZ12|Q9H975	Silent	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.H586	ENST00000263713.5	37	c.1758	CCDS2130.1	2																																																																																			EPB41L5	-	NULL	ENSG00000115109		0.284	EPB41L5-001	KNOWN	basic|CCDS	protein_coding	EPB41L5	HGNC	protein_coding	OTTHUMT00000254230.2	71	0.00	0	T	NM_020909		120903830	120903830	+1	no_errors	ENST00000263713	ensembl	human	known	69_37n	silent	45	26.23	16	SNP	1.000	C
FAM217A	222826	genome.wustl.edu	37	6	4069649	4069649	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr6:4069649C>T	ENST00000274673.3	-	7	1211	c.808G>A	c.(808-810)Gac>Aac	p.D270N	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	270																	TTCCAATTGTCAGATTTGGAG	0.413																																						dbGAP											0													82.0	83.0	83.0					6																	4069649		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.808G>A	6.37:g.4069649C>T	ENSP00000274673:p.Asp270Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYK1	Missense_Mutation	SNP	NULL	p.D270N	ENST00000274673.3	37	c.808	CCDS4489.1	6	.	.	.	.	.	.	.	.	.	.	C	17.31	3.357948	0.61403	.	.	ENSG00000145975	ENST00000274673;ENST00000538080;ENST00000470599	T	0.23147	1.92	5.43	4.53	0.55603	.	0.194029	0.42172	D	0.000751	T	0.11623	0.0283	L	0.40543	1.245	0.23483	N	0.997589	P	0.35272	0.493	B	0.36845	0.234	T	0.04915	-1.0918	10	0.51188	T	0.08	-8.9879	11.6189	0.51106	0.1761:0.8239:0.0:0.0	.	270	Q8IXS0	CF146_HUMAN	N	270;117;398	ENSP00000274673:D270N	ENSP00000274673:D270N	D	-	1	0	C6orf146	4014648	1.000000	0.71417	0.967000	0.41034	0.959000	0.62525	2.838000	0.48199	2.827000	0.97445	0.650000	0.86243	GAC	FAM217A	-	NULL	ENSG00000145975		0.413	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217A	HGNC	protein_coding	OTTHUMT00000352577.2	147	0.00	0	C	NM_173563		4069649	4069649	-1	no_errors	ENST00000274673	ensembl	human	known	69_37n	missense	46	45.88	39	SNP	0.949	T
FASTKD2	22868	genome.wustl.edu	37	2	207638973	207638973	+	Missense_Mutation	SNP	G	G	A	rs200972487		TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr2:207638973G>A	ENST00000236980.6	+	7	1627	c.1279G>A	c.(1279-1281)Gaa>Aaa	p.E427K	FASTKD2_ENST00000402774.3_Missense_Mutation_p.E427K|FASTKD2_ENST00000403094.3_Missense_Mutation_p.E427K	NM_014929.3	NP_055744.2	Q9NYY8	FAKD2_HUMAN	FAST kinase domains 2	427					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|skin(2)	21				LUSC - Lung squamous cell carcinoma(261;0.0718)|Epithelial(149;0.119)|Lung(261;0.138)		CATTTTATTTGAAAACCTTGG	0.294																																						dbGAP											0													69.0	68.0	69.0					2																	207638973		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC001544	CCDS2371.1	2q33.3	2008-02-05	2006-07-07	2006-07-07	ENSG00000118246	ENSG00000118246			29160	protein-coding gene	gene with protein product		612322	"""KIAA0971"""	KIAA0971			Standard	NM_014929		Approved		uc002vbx.3	Q9NYY8	OTTHUMG00000132917	ENST00000236980.6:c.1279G>A	2.37:g.207638973G>A	ENSP00000236980:p.Glu427Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NVX6|Q9Y2H7	Missense_Mutation	SNP	pfam_FAST_Leu-rich,pfam_FAST_2,pfam_RAP,smart_RAP	p.E427K	ENST00000236980.6	37	c.1279	CCDS2371.1	2	.	.	.	.	.	.	.	.	.	.	G	19.56	3.850866	0.71719	.	.	ENSG00000118246	ENST00000236980;ENST00000402774;ENST00000403094	T;T;T	0.16196	2.36;2.36;2.36	5.74	4.84	0.62591	.	0.122627	0.52532	D	0.000071	T	0.37265	0.0997	M	0.72894	2.215	0.52099	D	0.99994	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	T	0.11446	-1.0587	10	0.08837	T	0.75	-6.5642	15.7955	0.78407	0.0:0.1359:0.8641:0.0	.	427;427	Q9NYY8-2;Q9NYY8	.;FAKD2_HUMAN	K	427	ENSP00000236980:E427K;ENSP00000385990:E427K;ENSP00000384929:E427K	ENSP00000236980:E427K	E	+	1	0	FASTKD2	207347218	1.000000	0.71417	1.000000	0.80357	0.395000	0.30598	5.346000	0.65992	2.703000	0.92315	0.655000	0.94253	GAA	FASTKD2	-	NULL	ENSG00000118246		0.294	FASTKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD2	HGNC	protein_coding	OTTHUMT00000256428.2	148	0.67	1	G	NM_014929		207638973	207638973	+1	no_errors	ENST00000236980	ensembl	human	known	69_37n	missense	46	66.19	92	SNP	1.000	A
FMN2	56776	genome.wustl.edu	37	1	240370352	240370352	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:240370352C>T	ENST00000319653.9	+	5	2470	c.2240C>T	c.(2239-2241)tCc>tTc	p.S747F		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	747					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			ATACAGACTTCCCCCACGGAA	0.572																																						dbGAP											0													47.0	47.0	47.0					1																	240370352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2240C>T	1.37:g.240370352C>T	ENSP00000318884:p.Ser747Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.S747F	ENST00000319653.9	37	c.2240	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	10.69	1.420442	0.25639	.	.	ENSG00000155816	ENST00000447095;ENST00000319653	T	0.52295	0.67	5.59	4.68	0.58851	.	0.000000	0.64402	D	0.000011	T	0.51736	0.1692	M	0.72894	2.215	0.80722	D	1	P	0.47106	0.89	B	0.43623	0.425	T	0.60078	-0.7333	10	0.87932	D	0	.	14.3165	0.66454	0.0:0.9286:0.0:0.0714	.	747	Q9NZ56	FMN2_HUMAN	F	184;747	ENSP00000318884:S747F	ENSP00000318884:S747F	S	+	2	0	FMN2	238436975	1.000000	0.71417	0.975000	0.42487	0.088000	0.18126	6.848000	0.75409	1.368000	0.46115	0.655000	0.94253	TCC	FMN2	-	NULL	ENSG00000155816		0.572	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	47	0.00	0	C	XM_371352		240370352	240370352	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	22	43.59	17	SNP	0.999	T
FMN2	56776	genome.wustl.edu	37	1	240370552	240370552	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:240370552C>T	ENST00000319653.9	+	5	2670	c.2440C>T	c.(2440-2442)Cca>Tca	p.P814S		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	814	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCCACCACCTCCATCCCTTCT	0.532																																						dbGAP											0													71.0	66.0	68.0					1																	240370552		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2440C>T	1.37:g.240370552C>T	ENSP00000318884:p.Pro814Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.P814S	ENST00000319653.9	37	c.2440	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	C	2.797	-0.249981	0.05867	.	.	ENSG00000155816	ENST00000319653	T	0.27720	1.65	4.22	-0.0828	0.13697	Actin-binding FH2/DRF autoregulatory (1);	0.846232	0.10193	N	0.704437	T	0.22859	0.0552	L	0.60455	1.87	0.45415	D	0.998393	B	0.19706	0.038	B	0.11329	0.006	T	0.20940	-1.0260	9	.	.	.	.	0.8776	0.01227	0.1473:0.2374:0.2897:0.3256	.	814	Q9NZ56	FMN2_HUMAN	S	814	ENSP00000318884:P814S	.	P	+	1	0	FMN2	238437175	0.000000	0.05858	0.007000	0.13788	0.118000	0.20060	-0.422000	0.07043	-0.099000	0.12263	-0.266000	0.10368	CCA	FMN2	-	smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.532	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	55	0.00	0	C	XM_371352		240370552	240370552	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	missense	23	42.50	17	SNP	0.626	T
GCNT4	51301	genome.wustl.edu	37	5	74325091	74325091	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr5:74325091G>A	ENST00000322348.4	-	1	1633	c.772C>T	c.(772-774)Cca>Tca	p.P258S		NM_016591.2	NP_057675.1	Q9P109	GCNT4_HUMAN	glucosaminyl (N-acetyl) transferase 4, core 2	258					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|homeostasis of number of cells (GO:0048872)|inter-male aggressive behavior (GO:0002121)|kidney morphogenesis (GO:0060993)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation (GO:0006493)|thyroid hormone metabolic process (GO:0042403)|tissue morphogenesis (GO:0048729)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase activity (GO:0003829)|N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|skin(1)|stomach(2)	19		all_lung(232;0.0131)|Lung NSC(167;0.0282)|Ovarian(174;0.0798)		OV - Ovarian serous cystadenocarcinoma(47;8.44e-57)		TTACTGTTTGGGGGTTTCACC	0.403																																						dbGAP											0													86.0	90.0	88.0					5																	74325091		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132035	CCDS4026.1	5q12	2013-02-25	2010-03-16		ENSG00000176928	ENSG00000176928	2.4.1.102	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	17973	protein-coding gene	gene with protein product	"""core 2 beta-1,6-N-acetylglucosaminyltransferase 3"", ""beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,6-N-acetylglucosaminyltransferase 4"""		"""glucosaminyl (N-acetyl) transferase 4, core 2 (beta-1,6-N-acetylglucosaminyltransferase)"""			10753916	Standard	NM_016591		Approved	C2GNT3	uc003kdn.3	Q9P109	OTTHUMG00000131272	ENST00000322348.4:c.772C>T	5.37:g.74325091G>A	ENSP00000317027:p.Pro258Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Glyco_trans_14	p.P258S	ENST00000322348.4	37	c.772	CCDS4026.1	5	.	.	.	.	.	.	.	.	.	.	.	6.193	0.403737	0.11754	.	.	ENSG00000176928	ENST00000322348	T	0.12039	2.72	5.96	4.0	0.46444	.	0.427108	0.27778	N	0.017886	T	0.07503	0.0189	N	0.16567	0.415	0.26448	N	0.97566	B	0.19073	0.033	B	0.15052	0.012	T	0.28902	-1.0029	10	0.24483	T	0.36	-15.5194	7.213	0.25945	0.0846:0.0:0.453:0.4624	.	258	Q9P109	GCNT4_HUMAN	S	258	ENSP00000317027:P258S	ENSP00000317027:P258S	P	-	1	0	GCNT4	74360847	0.998000	0.40836	0.996000	0.52242	0.953000	0.61014	2.530000	0.45641	1.506000	0.48736	0.650000	0.86243	CCA	GCNT4	-	pfam_Glyco_trans_14	ENSG00000176928		0.403	GCNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCNT4	HGNC	protein_coding	OTTHUMT00000254040.1	60	0.00	0	G	NM_016591		74325091	74325091	-1	no_errors	ENST00000322348	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	0.877	A
GOLGA6L6	727832	genome.wustl.edu	37	15	20740459	20740461	+	In_Frame_Del	DEL	TCG	TCG	-			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	TCG	TCG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr15:20740459_20740461delTCG	ENST00000427390.2	-	8	1379_1381	c.1289_1291delCGA	c.(1288-1293)gcgaag>gag	p.430_431AK>E		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	430	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ctccacatcttcgcctcctgctc	0.552																																						dbGAP											0										16,452		5,6,223							0.0			1	60,546		25,10,268	no	coding	GOLGA6L6	NM_001145004.1		30,16,491	A1A1,A1R,RR		9.901,3.4188,7.0764				76,998				-	-	-	SO:0001651	inframe_deletion	0			AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1289_1291delCGA	15.37:g.20740459_20740461delTCG	ENSP00000398615:p.Ala430_Lys431delinsGlu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3YTC0	In_Frame_Del	DEL	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.AK430in_frame_delE	ENST00000427390.2	37	c.1291_1289	CCDS45184.1	15																																																																																			GOLGA6L6	-	NULL	ENSG00000215405		0.552	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	HGNC	protein_coding	OTTHUMT00000414660.3	17	0.00	0	TCG	NM_001145004		20740459	20740461	-1	no_errors	ENST00000427390	ensembl	human	known	69_37n	in_frame_del	8	50.00	8	DEL	0.966:0.963:0.960	-
GPATCH4	54865	genome.wustl.edu	37	1	156568029	156568030	+	In_Frame_Ins	INS	-	-	CCA			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:156568029_156568030insCCA	ENST00000438976.2	-	4	280_281	c.250_251insTGG	c.(250-252)gaa>gTGGaa	p.83_84insV	GPATCH4_ENST00000497287.1_5'UTR|GPATCH4_ENST00000334588.7_In_Frame_Ins_p.32_33insV|GPATCH4_ENST00000368232.4_In_Frame_Ins_p.78_79insV			Q5T3I0	GPTC4_HUMAN	G patch domain containing 4	78							poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(3)|stomach(1)	17	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTGCCCAGTTTCCACTACCAAG	0.51																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			BC056904	CCDS1146.1, CCDS44245.1	1q22	2013-01-28		2006-12-13	ENSG00000160818	ENSG00000160818		"""G patch domain containing"""	25982	protein-coding gene	gene with protein product				GPATC4		12477932	Standard	NM_015590		Approved	FLJ20249, DKFZP434F1735	uc001fpl.3	Q5T3I0	OTTHUMG00000033203	ENST00000438976.2:c.248_250dupTGG	1.37:g.156568030_156568032dupCCA	ENSP00000396441:p.Val83_Val83dup	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3I1|Q6ZUE7|Q8IWG8|Q9NXH4	In_Frame_Ins	INS	pfam_G_patch_dom,smart_G_patch_dom,pfscan_G_patch_dom	p.84in_frame_insV	ENST00000438976.2	37	c.251_250	CCDS44245.1	1																																																																																			GPATCH4	-	NULL	ENSG00000160818		0.510	GPATCH4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPATCH4	HGNC	protein_coding	OTTHUMT00000386947.1	183	0.00	0	-	NM_017725		156568029	156568030	-1	no_errors	ENST00000438976	ensembl	human	known	69_37n	in_frame_ins	118	16.90	24	INS	0.994:0.999	CCA
HPSE2	60495	genome.wustl.edu	37	10	100219345	100219346	+	Frame_Shift_Ins	INS	-	-	G			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr10:100219345_100219346insG	ENST00000370552.3	-	12	1823_1824	c.1764_1765insC	c.(1762-1767)gcctgcfs	p.C589fs	HPSE2_ENST00000404542.1_Frame_Shift_Ins_p.C477fs|HPSE2_ENST00000370549.1_Frame_Shift_Ins_p.C531fs|HPSE2_ENST00000370546.1_3'UTR	NM_021828.4	NP_068600.4	Q8WWQ2	HPSE2_HUMAN	heparanase 2 (inactive)	589					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	intracellular (GO:0005622)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	heparan sulfate proteoglycan binding (GO:0043395)|heparanase activity (GO:0030305)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(15)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	40				Epithelial(162;1.8e-09)|all cancers(201;4.72e-07)		CGGTAGCGGCAGGCCAAAGCAT	0.564																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF282885	CCDS7477.1, CCDS53567.1, CCDS53568.1	10q23-q24	2014-05-09	2014-05-09		ENSG00000172987	ENSG00000172987			18374	protein-coding gene	gene with protein product		613469	"""urofacial syndrome"", ""heparanase 2"""	UFS		11027606, 20605132, 9199567, 20576607	Standard	NM_021828		Approved	HPA2, HPR2	uc001kpn.2	Q8WWQ2	OTTHUMG00000018880	ENST00000370552.3:c.1765dupC	10.37:g.100219347_100219347dupG	ENSP00000359583:p.Cys589fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUH4|Q5VUH5|Q5VUH6|Q8WWQ1|Q9HB37|Q9HB38|Q9HB39	Frame_Shift_Ins	INS	pfam_Glyco_hydro_79,superfamily_Glycoside_hydrolase_SF	p.C588fs	ENST00000370552.3	37	c.1765_1764	CCDS7477.1	10																																																																																			HPSE2	-	NULL	ENSG00000172987		0.564	HPSE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HPSE2	HGNC	protein_coding	OTTHUMT00000049789.1	30	0.00	0	-	NM_021828		100219345	100219346	-1	no_errors	ENST00000370552	ensembl	human	known	69_37n	frame_shift_ins	9	18.18	2	INS	1.000:1.000	G
INTS4L1	285905	genome.wustl.edu	37	7	64649422	64649422	+	RNA	SNP	C	C	T	rs138221668	byFrequency	TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr7:64649422C>T	ENST00000587624.1	+	0	1203							Q96LV5	IN4L1_HUMAN	integrator complex subunit 4-like 1																		GAGGATCCTTCGCAGCAGCTC	0.507													C|||	21	0.00419329	0.0159	0.0	5008	,	,		20391	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0					7q11.21	2013-03-26			ENSG00000164669	ENSG00000164669			21925	other	unknown							Standard	XR_426205		Approved	FLJ25037		Q96LV5	OTTHUMG00000156510		7.37:g.64649422C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000587624.1	37	NULL		7																																																																																			INTS4L1	-	-	ENSG00000164669		0.507	INTS4L1-002	KNOWN	non_canonical_conserved|basic	processed_transcript	INTS4L1	HGNC	pseudogene	OTTHUMT00000460821.1	43	0.00	0	C	XR_041315		64649422	64649422	+1	no_errors	ENST00000587624	ensembl	human	known	69_37n	rna	28	24.32	9	SNP	1.000	T
LIG4	3981	genome.wustl.edu	37	13	108862458	108862458	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr13:108862458C>T	ENST00000356922.4	-	2	1431	c.1159G>A	c.(1159-1161)Gag>Aag	p.E387K	LIG4_ENST00000442234.1_Missense_Mutation_p.E387K|LIG4_ENST00000405925.1_Missense_Mutation_p.E387K	NM_002312.3|NM_206937.1	NP_002303.2|NP_996820.1	P49917	DNLI4_HUMAN	ligase IV, DNA, ATP-dependent	387					cell cycle (GO:0007049)|cell division (GO:0051301)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|chromosome organization (GO:0051276)|DNA biosynthetic process (GO:0071897)|DNA ligation (GO:0006266)|DNA ligation involved in DNA recombination (GO:0051102)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|lagging strand elongation (GO:0006273)|negative regulation of neuron apoptotic process (GO:0043524)|neuron apoptotic process (GO:0051402)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|single strand break repair (GO:0000012)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|focal adhesion (GO:0005925)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|ligase activity (GO:0016874)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(22)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42	all_lung(23;0.000238)|all_neural(89;0.00256)|Lung NSC(43;0.0056)|Medulloblastoma(90;0.00596)|Lung SC(71;0.104)					CTAAGAATCTCATACCTCTTT	0.328								Non-homologous end-joining																														dbGAP											0													88.0	93.0	91.0					13																	108862458		2203	4298	6501	-	-	-	SO:0001583	missense	0			X83441	CCDS9508.1	13q33-q34	2014-09-17			ENSG00000174405	ENSG00000174405	6.5.1.1		6601	protein-coding gene	gene with protein product	"""polydeoxyribonucleotide synthase [ATP] 4"", ""polynucleotide ligase"", ""sealase"", ""DNA repair enzyme"", ""DNA joinase"""	601837				7760816	Standard	NM_001098268		Approved		uc001vqo.3	P49917	OTTHUMG00000017328	ENST00000356922.4:c.1159G>A	13.37:g.108862458C>T	ENSP00000349393:p.Glu387Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IY66|Q8TEU5	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_IV,pfam_BRCT_dom,pfam_DNA_ligase_ATP-dep_C,superfamily_NA-bd_OB-fold-like,superfamily_BRCT_dom,superfamily_DNA_ligase_ATP-dep_N,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.E387K	ENST00000356922.4	37	c.1159	CCDS9508.1	13	.	.	.	.	.	.	.	.	.	.	C	3.416	-0.119228	0.06838	.	.	ENSG00000174405	ENST00000405925;ENST00000442234;ENST00000356922	T;T;T	0.80738	-1.41;-1.41;-1.41	5.49	5.49	0.81192	DNA ligase, ATP-dependent, central (2);	0.154228	0.56097	D	0.000028	T	0.63710	0.2534	N	0.11724	0.165	0.58432	D	0.999999	B	0.02656	0.0	B	0.09377	0.004	T	0.59478	-0.7447	10	0.11485	T	0.65	.	13.7164	0.62700	0.0:0.9236:0.0:0.0764	.	387	P49917	DNLI4_HUMAN	K	387	ENSP00000385955:E387K;ENSP00000402030:E387K;ENSP00000349393:E387K	ENSP00000349393:E387K	E	-	1	0	LIG4	107660459	1.000000	0.71417	1.000000	0.80357	0.680000	0.39746	5.997000	0.70646	2.572000	0.86782	0.643000	0.83706	GAG	LIG4	-	pfam_DNA_ligase_ATP-dep_cent,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	ENSG00000174405		0.328	LIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG4	HGNC	protein_coding	OTTHUMT00000045738.4	85	0.00	0	C	NM_002312		108862458	108862458	-1	no_errors	ENST00000356922	ensembl	human	known	69_37n	missense	84	16.83	17	SNP	1.000	T
MASP1	5648	genome.wustl.edu	37	3	186970996	186970996	+	Silent	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr3:186970996C>T	ENST00000337774.5	-	6	1241	c.852G>A	c.(850-852)tcG>tcA	p.S284S	MASP1_ENST00000392470.2_Silent_p.S258S|MASP1_ENST00000296280.6_Silent_p.S284S|MASP1_ENST00000392472.2_Silent_p.S171S|MASP1_ENST00000169293.6_Silent_p.S284S|MASP1_ENST00000495249.1_Intron	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)	284	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)	p.S284S(3)		NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		GGTTCTCTCCCGAGTTGTCAC	0.572																																						dbGAP											3	Substitution - coding silent(3)	lung(3)											183.0	184.0	184.0					3																	186970996		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.852G>A	3.37:g.186970996C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Silent	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.S284	ENST00000337774.5	37	c.852	CCDS33907.1	3																																																																																			MASP1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000127241		0.572	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	82	0.00	0	C	NM_001879		186970996	186970996	-1	no_errors	ENST00000296280	ensembl	human	known	69_37n	silent	77	17.20	16	SNP	0.000	T
MED25	81857	genome.wustl.edu	37	19	50335258	50335258	+	Silent	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr19:50335258C>T	ENST00000312865.6	+	11	1349	c.1296C>T	c.(1294-1296)taC>taT	p.Y432Y	MED25_ENST00000538643.1_Silent_p.Y219Y	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	432	Interaction with CREBBP.|Interaction with VP16.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		GCCAGGTCTACGTGAATCATG	0.607																																					GBM(51;894 1657 37868)	dbGAP											0													90.0	78.0	82.0					19																	50335258		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1296C>T	19.37:g.50335258C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Silent	SNP	pfam_Mediator_Med25_VWA,pfam_Mediator_Med25,pfam_Mediator_Med25_SD1,pfam_Mediator_Med25_NR-box	p.Y432	ENST00000312865.6	37	c.1296	CCDS33075.1	19																																																																																			MED25	-	pfam_Mediator_Med25	ENSG00000104973		0.607	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	HGNC	protein_coding	OTTHUMT00000465316.1	110	0.00	0	C	NM_030973		50335258	50335258	+1	no_errors	ENST00000312865	ensembl	human	known	69_37n	silent	68	10.53	8	SNP	0.703	T
NCOA6	23054	genome.wustl.edu	37	20	33370003	33370003	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr20:33370003G>C	ENST00000374796.2	-	4	2726	c.156C>G	c.(154-156)ttC>ttG	p.F52L	NCOA6_ENST00000359003.2_Missense_Mutation_p.F52L			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	52	CREBBP-binding region.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TATTTCCTTTGAAGGCCACAA	0.328																																						dbGAP											0													51.0	48.0	49.0					20																	33370003		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.156C>G	20.37:g.33370003G>C	ENSP00000363929:p.Phe52Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Missense_Mutation	SNP	NULL	p.F52L	ENST00000374796.2	37	c.156	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	G	22.1	4.251145	0.80135	.	.	ENSG00000198646	ENST00000374796;ENST00000359003;ENST00000397675	T;T	0.29397	1.57;1.57	5.84	3.85	0.44370	.	0.000000	0.64402	D	0.000003	T	0.47060	0.1425	L	0.56769	1.78	0.43841	D	0.996427	D;P	0.67145	0.996;0.92	D;P	0.73380	0.98;0.89	T	0.39840	-0.9594	10	0.66056	D	0.02	-7.5807	8.5127	0.33226	0.3029:0.0:0.6971:0.0	.	52;52	F6M2K2;Q14686	.;NCOA6_HUMAN	L	52	ENSP00000363929:F52L;ENSP00000351894:F52L	ENSP00000351894:F52L	F	-	3	2	NCOA6	32833664	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.478000	0.45189	0.762000	0.33152	0.591000	0.81541	TTC	NCOA6	-	NULL	ENSG00000198646		0.328	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	69	0.00	0	G	NM_014071		33370003	33370003	-1	no_errors	ENST00000359003	ensembl	human	known	69_37n	missense	65	34.34	34	SNP	1.000	C
NCOR1	9611	genome.wustl.edu	37	17	16029456	16029457	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr17:16029456_16029457insT	ENST00000268712.3	-	15	1830_1831	c.1573_1574insA	c.(1573-1575)acafs	p.T525fs	NCOR1_ENST00000395848.1_Frame_Shift_Ins_p.T416fs|NCOR1_ENST00000395851.1_Frame_Shift_Ins_p.T525fs	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	525					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ttttttttctgttttttctgct	0.297																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.1574dupA	17.37:g.16029462_16029462dupT	ENSP00000268712:p.Thr525fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Frame_Shift_Ins	INS	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.T525fs	ENST00000268712.3	37	c.1574_1573	CCDS11175.1	17																																																																																			NCOR1	-	NULL	ENSG00000141027		0.297	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	103	0.00	0	-	NM_006311		16029456	16029457	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	frame_shift_ins	44	38.89	28	INS	1.000:1.000	T
NUMB	8650	genome.wustl.edu	37	14	73753872	73753872	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr14:73753872T>A	ENST00000355058.3	-	9	879	c.601A>T	c.(601-603)Act>Tct	p.T201S	NUMB_ENST00000559312.1_Missense_Mutation_p.T201S|NUMB_ENST00000359560.3_Missense_Mutation_p.T190S|NUMB_ENST00000535282.1_Missense_Mutation_p.T190S|NUMB_ENST00000555738.2_Missense_Mutation_p.T190S|NUMB_ENST00000555394.1_Missense_Mutation_p.T201S|NUMB_ENST00000554546.1_Missense_Mutation_p.T190S|NUMB_ENST00000560335.1_Missense_Mutation_p.T201S|NUMB_ENST00000555238.1_Missense_Mutation_p.T201S|NUMB_ENST00000356296.4_Missense_Mutation_p.T201S|NUMB_ENST00000554521.2_Missense_Mutation_p.T190S|NUMB_ENST00000454166.4_Missense_Mutation_p.T201S|NUMB_ENST00000557597.1_Missense_Mutation_p.T190S|NUMB_ENST00000556772.1_Missense_Mutation_p.T57S|NUMB_ENST00000544991.3_Missense_Mutation_p.T201S			P49757	NUMB_HUMAN	numb homolog (Drosophila)	201					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		GCTTGTTCAGTGGCTGTTGTG	0.443																																						dbGAP											0													238.0	199.0	212.0					14																	73753872		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.601A>T	14.37:g.73753872T>A	ENSP00000347169:p.Thr201Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	pfam_Numb_domain,pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom	p.T201S	ENST00000355058.3	37	c.601	CCDS32116.1	14	.	.	.	.	.	.	.	.	.	.	T	21.7	4.188448	0.78789	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000544991;ENST00000454166;ENST00000555738;ENST00000554521;ENST00000535282;ENST00000326018;ENST00000555859;ENST00000555307;ENST00000554394	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.64991	0.51;0.5;0.84;0.84;1.47;0.84;0.84;0.5;0.46;0.52;0.51;0.47;0.84;-0.13;-0.13	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.71187	0.3310	L	0.38953	1.18	0.80722	D	1	B;D;B;P;B;B;P;D;D;D;P	0.76494	0.392;0.999;0.402;0.684;0.065;0.085;0.952;0.999;0.998;0.999;0.952	B;D;B;B;B;B;P;D;D;D;P	0.85130	0.262;0.996;0.186;0.344;0.049;0.066;0.54;0.997;0.974;0.993;0.692	T	0.70963	-0.4729	10	0.42905	T	0.14	-16.0262	15.7759	0.78214	0.0:0.0:0.0:1.0	.	190;201;190;201;201;190;190;190;201;190;201	B1P2N6;B1P2N5;B1P2N8;B1P2N7;G3V3R1;Q86SW5;B2RCI6;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;.;.;.;.;.;NUMB_HUMAN	S	190;201;190;201;57;201;190;201;201;201;190;190;190;165;165;201;201	ENSP00000452416:T190S;ENSP00000348644:T201S;ENSP00000451117:T190S;ENSP00000451300:T201S;ENSP00000451513:T57S;ENSP00000347169:T201S;ENSP00000352563:T190S;ENSP00000451625:T201S;ENSP00000446001:T201S;ENSP00000394025:T201S;ENSP00000452069:T190S;ENSP00000450817:T190S;ENSP00000441258:T190S;ENSP00000452357:T201S;ENSP00000451374:T201S	ENSP00000315193:T165S	T	-	1	0	NUMB	72823625	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.308000	0.77769	0.533000	0.62120	ACT	NUMB	-	pirsf_Numb/numb-like	ENSG00000133961		0.443	NUMB-201	KNOWN	basic|CCDS	protein_coding	NUMB	HGNC	protein_coding	OTTHUMT00000414416.1	200	0.00	0	T			73753872	73753872	-1	no_errors	ENST00000355058	ensembl	human	known	69_37n	missense	105	35.98	59	SNP	1.000	A
NUP133	55746	genome.wustl.edu	37	1	229622242	229622242	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr1:229622242C>G	ENST00000261396.3	-	11	1467	c.1376G>C	c.(1375-1377)gGt>gCt	p.G459A	NUP133_ENST00000537506.1_Missense_Mutation_p.G443A	NM_018230.2	NP_060700.2	Q8WUM0	NU133_HUMAN	nucleoporin 133kDa	459					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore organization (GO:0006999)|paraxial mesoderm development (GO:0048339)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)	nucleocytoplasmic transporter activity (GO:0005487)			NS(1)|breast(7)|endometrium(1)|kidney(6)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(4)	56	Breast(184;0.104)|Ovarian(103;0.249)	Prostate(94;0.167)				GATAGGAACACCACCACAGGC	0.378																																						dbGAP											0													89.0	89.0	89.0					1																	229622242		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1579.1	1q42.13	2008-02-05	2002-08-29		ENSG00000069248	ENSG00000069248			18016	protein-coding gene	gene with protein product		607613	"""nucleoporin 133kD"""			11684705	Standard	NM_018230		Approved	FLJ10814	uc001htn.3	Q8WUM0	OTTHUMG00000039462	ENST00000261396.3:c.1376G>C	1.37:g.229622242C>G	ENSP00000261396:p.Gly459Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAZ8|Q5T8N0|Q9H9W2|Q9NV71|Q9NVC4	Missense_Mutation	SNP	pfam_Nucleoporin_Nup133/Nup155_C,pfam_Nucleoporin_Nup133/Nup155_N	p.G459A	ENST00000261396.3	37	c.1376	CCDS1579.1	1	.	.	.	.	.	.	.	.	.	.	C	14.37	2.514064	0.44763	.	.	ENSG00000069248	ENST00000366681;ENST00000261396;ENST00000366679;ENST00000537506	T;T;T	0.24350	1.86;1.86;1.86	5.21	5.21	0.72293	WD40/YVTN repeat-like-containing domain (1);	0.298472	0.41605	D	0.000855	T	0.20861	0.0502	L	0.38531	1.155	0.39598	D	0.969688	P	0.36683	0.565	B	0.29942	0.109	T	0.05178	-1.0901	10	0.21540	T	0.41	-11.0523	19.1227	0.93369	0.0:1.0:0.0:0.0	.	459	Q8WUM0	NU133_HUMAN	A	459;459;459;443	ENSP00000261396:G459A;ENSP00000355640:G459A;ENSP00000443496:G443A	ENSP00000261396:G459A	G	-	2	0	NUP133	227688865	0.605000	0.26941	0.885000	0.34714	0.989000	0.77384	4.888000	0.63164	2.590000	0.87494	0.467000	0.42956	GGT	NUP133	-	NULL	ENSG00000069248		0.378	NUP133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP133	HGNC	protein_coding	OTTHUMT00000095224.1	99	0.00	0	C	NM_018230		229622242	229622242	-1	no_errors	ENST00000261396	ensembl	human	known	69_37n	missense	29	49.12	28	SNP	0.948	G
PLA2G7	7941	genome.wustl.edu	37	6	46672386	46672386	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr6:46672386C>T	ENST00000274793.7	-	12	1433	c.1237G>A	c.(1237-1239)Gat>Aat	p.D413N	PLA2G7_ENST00000537365.1_Missense_Mutation_p.D413N	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	413					cellular protein metabolic process (GO:0044267)|lipid catabolic process (GO:0016042)|lipid oxidation (GO:0034440)|low-density lipoprotein particle remodeling (GO:0034374)|plasma lipoprotein particle oxidation (GO:0034441)|positive regulation of inflammatory response (GO:0050729)|positive regulation of monocyte chemotaxis (GO:0090026)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|low-density lipoprotein particle (GO:0034362)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)			AGATTCTCATCATCTCCTTCA	0.313																																						dbGAP											0													118.0	107.0	111.0					6																	46672386		2201	4300	6501	-	-	-	SO:0001583	missense	0			U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070	3.1.1.4		9040	protein-coding gene	gene with protein product		601690				7700381, 8624782	Standard	NM_005084		Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.1237G>A	6.37:g.46672386C>T	ENSP00000274793:p.Asp413Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5HTT5|Q15692|Q5VTT1|Q8IVA2	Missense_Mutation	SNP	pfam_PAF_acetylhydro,pirsf_Ac_Ohase_PAF	p.D413N	ENST00000274793.7	37	c.1237	CCDS4917.1	6	.	.	.	.	.	.	.	.	.	.	C	6.035	0.374744	0.11409	.	.	ENSG00000146070	ENST00000274793;ENST00000537365	T;T	0.55760	0.5;0.5	5.5	3.71	0.42584	.	0.176499	0.49916	N	0.000134	T	0.24624	0.0597	L	0.43701	1.375	0.80722	D	1	B	0.19583	0.037	B	0.21708	0.036	T	0.06338	-1.0832	10	0.20519	T	0.43	.	10.8308	0.46659	0.0:0.8494:0.0:0.1506	.	413	Q13093	PAFA_HUMAN	N	413	ENSP00000274793:D413N;ENSP00000445666:D413N	ENSP00000274793:D413N	D	-	1	0	PLA2G7	46780345	0.961000	0.32948	0.028000	0.17463	0.045000	0.14185	2.179000	0.42528	0.794000	0.33899	-0.258000	0.10820	GAT	PLA2G7	-	pfam_PAF_acetylhydro,pirsf_Ac_Ohase_PAF	ENSG00000146070		0.313	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G7	HGNC	protein_coding	OTTHUMT00000040802.1	130	0.00	0	C			46672386	46672386	-1	no_errors	ENST00000274793	ensembl	human	known	69_37n	missense	106	23.74	33	SNP	0.670	T
PLA2G7	7941	genome.wustl.edu	37	6	46678354	46678354	+	Silent	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr6:46678354C>T	ENST00000274793.7	-	8	901	c.705G>A	c.(703-705)ctG>ctA	p.L235L	PLA2G7_ENST00000537365.1_Silent_p.L235L|PLA2G7_ENST00000538237.1_Silent_p.L190L|PLA2G7_ENST00000541026.1_Silent_p.L108L	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	235					cellular protein metabolic process (GO:0044267)|lipid catabolic process (GO:0016042)|lipid oxidation (GO:0034440)|low-density lipoprotein particle remodeling (GO:0034374)|plasma lipoprotein particle oxidation (GO:0034441)|positive regulation of inflammatory response (GO:0050729)|positive regulation of monocyte chemotaxis (GO:0090026)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|low-density lipoprotein particle (GO:0034362)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)			TGTCAAGAATCAGACTGAGAG	0.303																																						dbGAP											0													115.0	113.0	114.0					6																	46678354		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070	3.1.1.4		9040	protein-coding gene	gene with protein product		601690				7700381, 8624782	Standard	NM_005084		Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.705G>A	6.37:g.46678354C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5HTT5|Q15692|Q5VTT1|Q8IVA2	Silent	SNP	pfam_PAF_acetylhydro,pirsf_Ac_Ohase_PAF	p.L235	ENST00000274793.7	37	c.705	CCDS4917.1	6																																																																																			PLA2G7	-	pfam_PAF_acetylhydro,pirsf_Ac_Ohase_PAF	ENSG00000146070		0.303	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G7	HGNC	protein_coding	OTTHUMT00000040802.1	98	0.00	0	C			46678354	46678354	-1	no_errors	ENST00000274793	ensembl	human	known	69_37n	silent	53	36.14	30	SNP	0.135	T
RAB19	401409	genome.wustl.edu	37	7	140107556	140107556	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr7:140107556T>G	ENST00000356407.3	+	1	178	c.110T>G	c.(109-111)tTc>tGc	p.F37C	RAB19_ENST00000275874.5_Missense_Mutation_p.F37C|RAB19_ENST00000537763.1_Missense_Mutation_p.F37C			A4D1S5	RAB19_HUMAN	RAB19, member RAS oncogene family	37					protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)			breast(3)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	9	Melanoma(164;0.0142)					GTGCAGCATTTCAAGTCTGGA	0.483																																						dbGAP											0													172.0	145.0	154.0					7																	140107556		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34762.1, CCDS34762.2	7q34	2014-05-09			ENSG00000146955	ENSG00000146955		"""RAB, member RAS oncogene"""	19982	protein-coding gene	gene with protein product							Standard	NM_001008749		Approved	RAB19B	uc010lni.2	A4D1S5	OTTHUMG00000157410	ENST00000356407.3:c.110T>G	7.37:g.140107556T>G	ENSP00000348778:p.Phe37Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1S6|B2RTS6|B5MDR2|Q9UL27	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F37C	ENST00000356407.3	37	c.110	CCDS34762.2	7	.	.	.	.	.	.	.	.	.	.	T	24.3	4.513333	0.85389	.	.	ENSG00000146955	ENST00000495590;ENST00000275874;ENST00000537763;ENST00000356407	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	6.06	6.06	0.98353	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.94178	0.8132	H	0.96333	3.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95772	0.8809	10	0.87932	D	0	.	16.6154	0.84909	0.0:0.0:0.0:1.0	.	37	A4D1S5	RAB19_HUMAN	C	37	ENSP00000420782:F37C;ENSP00000275874:F37C;ENSP00000440167:F37C;ENSP00000348778:F37C	ENSP00000275874:F37C	F	+	2	0	RAB19	139754025	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	7.942000	0.87708	2.315000	0.78130	0.533000	0.62120	TTC	RAB19	-	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000146955		0.483	RAB19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB19	HGNC	protein_coding	OTTHUMT00000348740.1	110	0.00	0	T			140107556	140107556	+1	no_errors	ENST00000275874	ensembl	human	known	69_37n	missense	84	17.65	18	SNP	1.000	G
RANBP2	5903	genome.wustl.edu	37	2	109347330	109347330	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr2:109347330G>A	ENST00000283195.6	+	3	367	c.241G>A	c.(241-243)Gaa>Aaa	p.E81K		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	81					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						CAAAGCCGTTGAATGTTACAG	0.348																																						dbGAP											0													105.0	126.0	118.0					2																	109347330		1475	2563	4038	-	-	-	SO:0001583	missense	0			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.241G>A	2.37:g.109347330G>A	ENSP00000283195:p.Glu81Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_Znf_RanBP2,pfam_IR1-M,pfam_Cyclophilin-like_PPIase_dom,pfam_TPR-1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,smart_Ran_bind_dom,smart_Znf_RanBP2,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RanBP2,pfscan_Cyclophilin-like_PPIase_dom,pfscan_Ran_bind_dom,prints_Cyclophilin-like_PPIase_dom	p.E81K	ENST00000283195.6	37	c.241	CCDS2079.1	2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312868	0.81358	.	.	ENSG00000153201	ENST00000409491;ENST00000283195;ENST00000456637	T	0.65916	-0.18	4.24	4.24	0.50183	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.	.	.	.	T	0.60248	0.2254	L	0.35854	1.095	0.39950	D	0.974526	P	0.43231	0.801	P	0.46419	0.516	T	0.62599	-0.6820	9	0.36615	T	0.2	-28.0259	17.1647	0.86812	0.0:0.0:1.0:0.0	.	81	P49792	RBP2_HUMAN	K	81;81;55	ENSP00000283195:E81K	ENSP00000283195:E81K	E	+	1	0	RANBP2	108713762	1.000000	0.71417	0.998000	0.56505	0.823000	0.46562	8.675000	0.91195	2.351000	0.79841	0.585000	0.79938	GAA	RANBP2	-	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000153201		0.348	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	HGNC	protein_coding	OTTHUMT00000253594.1	178	0.00	0	G	NM_006267		109347330	109347330	+1	no_errors	ENST00000283195	ensembl	human	known	69_37n	missense	126	29.21	52	SNP	1.000	A
RECQL	5965	genome.wustl.edu	37	12	21630747	21630747	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr12:21630747A>T	ENST00000444129.2	-	7	1325	c.857T>A	c.(856-858)cTa>cAa	p.L286Q	RECQL_ENST00000421138.2_Missense_Mutation_p.L286Q	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	286					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						CTCATAATATAGATTTGGCCT	0.328								Other identified genes with known or suspected DNA repair function																														dbGAP											0													42.0	42.0	42.0					12																	21630747		2203	4300	6503	-	-	-	SO:0001583	missense	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.857T>A	12.37:g.21630747A>T	ENSP00000416739:p.Leu286Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G2	Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.L286Q	ENST00000444129.2	37	c.857	CCDS31756.1	12	.	.	.	.	.	.	.	.	.	.	A	22.2	4.260847	0.80246	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.79033	-1.23;-1.23	4.7	4.7	0.59300	DEAD-like helicase (1);	0.061993	0.64402	D	0.000003	D	0.92034	0.7476	H	0.97682	4.055	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.94682	0.7866	10	0.87932	D	0	-7.0194	14.6278	0.68635	1.0:0.0:0.0:0.0	.	286	P46063	RECQ1_HUMAN	Q	286	ENSP00000416739:L286Q;ENSP00000395449:L286Q	ENSP00000395449:L286Q	L	-	2	0	RECQL	21522014	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	8.794000	0.91867	2.098000	0.63641	0.528000	0.53228	CTA	RECQL	-	smart_Helicase_ATP-bd,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.328	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	66	0.00	0	A	NM_002907		21630747	21630747	-1	no_errors	ENST00000421138	ensembl	human	known	69_37n	missense	34	52.11	37	SNP	1.000	T
SALL1	6299	genome.wustl.edu	37	16	51174727	51174727	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr16:51174727C>T	ENST00000251020.4	-	2	1439	c.1406G>A	c.(1405-1407)cGt>cAt	p.R469H	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.R372H|SALL1_ENST00000566102.1_Intron	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	469					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			GGTATGGGAACGCAAGTGGAT	0.502																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													100.0	94.0	96.0					16																	51174727		2198	4300	6498	-	-	-	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.1406G>A	16.37:g.51174727C>T	ENSP00000251020:p.Arg469His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R469H	ENST00000251020.4	37	c.1406	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	C	21.0	4.075542	0.76415	.	.	ENSG00000103449	ENST00000251020;ENST00000440970;ENST00000457559	T;T	0.25749	1.78;1.78	5.18	5.18	0.71444	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.53899	0.1825	M	0.74881	2.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.58730	-0.7585	10	0.87932	D	0	.	18.685	0.91560	0.0:1.0:0.0:0.0	.	469	Q9NSC2	SALL1_HUMAN	H	469;372;433	ENSP00000251020:R469H;ENSP00000407914:R372H	ENSP00000251020:R469H	R	-	2	0	SALL1	49732228	1.000000	0.71417	0.998000	0.56505	0.917000	0.54804	7.814000	0.86154	2.386000	0.81285	0.563000	0.77884	CGT	SALL1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000103449		0.502	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	61	0.00	0	C	NM_002968		51174727	51174727	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	1.000	T
SLCO2A1	6578	genome.wustl.edu	37	3	133664056	133664056	+	Silent	SNP	G	G	A			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr3:133664056G>A	ENST00000310926.4	-	10	1617	c.1344C>T	c.(1342-1344)tgC>tgT	p.C448C	SLCO2A1_ENST00000493729.1_Silent_p.C372C	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	448	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	CTGGGCACGAGCAGTCCCTGC	0.522																																						dbGAP											0													152.0	161.0	158.0					3																	133664056		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.1344C>T	3.37:g.133664056G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86V98|Q8IUN2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,tigrfam_OA_transporter	p.A385V	ENST00000310926.4	37	c.1154	CCDS3084.1	3																																																																																			SLCO2A1	-	NULL	ENSG00000174640		0.522	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO2A1	HGNC	protein_coding	OTTHUMT00000357131.1	75	0.00	0	G	NM_005630		133664056	133664056	-1	no_errors	ENST00000481359	ensembl	human	known	69_37n	missense	36	36.21	21	SNP	1.000	A
SPRED2	200734	genome.wustl.edu	37	2	65571979	65571979	+	Silent	SNP	G	G	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr2:65571979G>T	ENST00000356388.4	-	2	267	c.78C>A	c.(76-78)tcC>tcA	p.S26S	SPRED2_ENST00000443619.2_Silent_p.S23S|SPRED2_ENST00000474228.1_5'UTR	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2	26	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						ATCCCCCGCTGGAGTCATCTC	0.542																																						dbGAP											0													82.0	67.0	72.0					2																	65571979		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.78C>A	2.37:g.65571979G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Silent	SNP	pfam_Sprouty,pfam_EVH1,smart_EVH1,pfscan_EVH1	p.S26	ENST00000356388.4	37	c.78	CCDS33211.1	2																																																																																			SPRED2	-	pfam_EVH1,smart_EVH1,pfscan_EVH1	ENSG00000198369		0.542	SPRED2-001	KNOWN	basic|CCDS	protein_coding	SPRED2	HGNC	protein_coding	OTTHUMT00000327632.1	47	0.00	0	G			65571979	65571979	-1	no_errors	ENST00000356388	ensembl	human	known	69_37n	silent	41	12.77	6	SNP	1.000	T
STK35	140901	genome.wustl.edu	37	20	2097463	2097463	+	Silent	SNP	T	T	C			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr20:2097463T>C	ENST00000381482.3	+	3	1315	c.1044T>C	c.(1042-1044)atT>atC	p.I348I	STK35_ENST00000400064.3_Intron|STK35_ENST00000246032.3_Silent_p.I215I			Q8TDR2	STK35_HUMAN	serine/threonine kinase 35	348	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(2)|liver(2)|lung(6)|ovary(1)|prostate(2)	13						CGAGCGCCATTGCCTTCCTGC	0.542																																						dbGAP											0													111.0	108.0	109.0					20																	2097463		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL359916	CCDS13024.1, CCDS13024.2	20p13	2008-07-02			ENSG00000125834	ENSG00000125834			16254	protein-coding gene	gene with protein product	"""CLP-36 interacting kinase"""	609370				11973348	Standard	NM_080836		Approved	bA550O8.2, CLIK1	uc002wfw.4	Q8TDR2	OTTHUMG00000031688	ENST00000381482.3:c.1044T>C	20.37:g.2097463T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBM3|C7ENV8|Q2NKW6|Q5T3R1|Q5T3R2|Q96AB4|Q9BZ06	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I348	ENST00000381482.3	37	c.1044	CCDS13024.2	20																																																																																			STK35	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000125834		0.542	STK35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK35	HGNC	protein_coding	OTTHUMT00000077574.3	100	0.00	0	T	NM_080836		2097463	2097463	+1	no_errors	ENST00000381482	ensembl	human	known	69_37n	silent	44	39.73	29	SNP	0.998	C
TMPRSS9	360200	genome.wustl.edu	37	19	2416579	2416579	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr19:2416579C>T	ENST00000332578.3	+	11	1687	c.1687C>T	c.(1687-1689)Ctc>Ttc	p.L563F		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	563	Peptidase S1 2. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACTGCGTCCCTCCTGGGCCT	0.672																																						dbGAP											0													38.0	38.0	38.0					19																	2416579		2203	4296	6499	-	-	-	SO:0001583	missense	0			AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.1687C>T	19.37:g.2416579C>T	ENSP00000330264:p.Leu563Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZND6|Q7Z411	Missense_Mutation	SNP	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6	p.L563F	ENST00000332578.3	37	c.1687	CCDS12088.1	19	.	.	.	.	.	.	.	.	.	.	C	19.14	3.770047	0.69992	.	.	ENSG00000178297	ENST00000332578	D	0.89810	-2.57	5.17	5.17	0.71159	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.48767	D	0.000167	D	0.93818	0.8023	M	0.74258	2.255	0.31614	N	0.651136	D	0.76494	0.999	D	0.74348	0.983	D	0.93129	0.6531	10	0.39692	T	0.17	.	17.1959	0.86892	0.0:1.0:0.0:0.0	.	563	Q7Z410	TMPS9_HUMAN	F	563	ENSP00000330264:L563F	ENSP00000330264:L563F	L	+	1	0	TMPRSS9	2367579	0.068000	0.21057	0.959000	0.39883	0.807000	0.45602	0.749000	0.26320	2.415000	0.81967	0.484000	0.47621	CTC	TMPRSS9	-	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000178297		0.672	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS9	HGNC	protein_coding	OTTHUMT00000451330.3	28	0.00	0	C	NM_182973		2416579	2416579	+1	no_errors	ENST00000332578	ensembl	human	known	69_37n	missense	18	37.93	11	SNP	0.452	T
TMEM143	55260	genome.wustl.edu	37	19	48836505	48836505	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr19:48836505G>T	ENST00000293261.3	-	8	1667	c.1351C>A	c.(1351-1353)Caa>Aaa	p.Q451K	TMEM143_ENST00000436660.2_Missense_Mutation_p.Q386K|TMEM143_ENST00000377431.2_Missense_Mutation_p.Q351K|TMEM143_ENST00000541566.1_Missense_Mutation_p.Q341K|TMEM143_ENST00000435956.3_Missense_Mutation_p.Q416K	NM_018273.2	NP_060743.2	Q96AN5	TM143_HUMAN	transmembrane protein 143	451					hematopoietic progenitor cell differentiation (GO:0002244)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				endometrium(2)|kidney(1)|large_intestine(2)|lung(9)	14		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000149)|all cancers(93;0.000198)|Epithelial(262;0.0151)|GBM - Glioblastoma multiforme(486;0.0157)		GGCGTGGCTTGCGGGGGCTCG	0.622																																						dbGAP											0													35.0	39.0	38.0					19																	48836505		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129801	CCDS12716.1	19q13.32	2008-02-05				ENSG00000161558			25603	protein-coding gene	gene with protein product						12975309	Standard	NM_018273		Approved	FLJ10922	uc002pix.1	Q96AN5		ENST00000293261.3:c.1351C>A	19.37:g.48836505G>T	ENSP00000293261:p.Gln451Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K656|Q6UXY4|Q9NV49	Missense_Mutation	SNP	pfam_DUF3754	p.Q451K	ENST00000293261.3	37	c.1351	CCDS12716.1	19	.	.	.	.	.	.	.	.	.	.	G	15.04	2.716484	0.48622	.	.	ENSG00000161558	ENST00000293261;ENST00000377431;ENST00000435956;ENST00000436660;ENST00000541566	T;T;T	0.43294	0.95;0.97;0.95	3.05	3.05	0.35203	.	0.446120	0.16777	N	0.199954	T	0.34135	0.0887	N	0.14661	0.345	0.09310	N	1	P;B;B;B	0.40332	0.713;0.049;0.0;0.001	P;B;B;B	0.51742	0.678;0.011;0.001;0.002	T	0.14896	-1.0456	10	0.14656	T	0.56	-7.4549	9.8262	0.40914	0.0:0.0:1.0:0.0	.	386;351;416;451	B4DPF8;Q96AN5-2;B4DMT0;Q96AN5	.;.;.;TM143_HUMAN	K	451;351;416;386;341	ENSP00000293261:Q451K;ENSP00000397038:Q416K;ENSP00000444275:Q341K	ENSP00000293261:Q451K	Q	-	1	0	TMEM143	53528317	0.027000	0.19231	0.096000	0.21009	0.011000	0.07611	2.246000	0.43142	2.016000	0.59253	0.462000	0.41574	CAA	TMEM143	-	NULL	ENSG00000161558		0.622	TMEM143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM143	HGNC	protein_coding	OTTHUMT00000465622.1	43	0.00	0	G	NM_018273		48836505	48836505	-1	no_errors	ENST00000293261	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.193	T
TP53	7157	genome.wustl.edu	37	17	7579349	7579349	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr17:7579349A>C	ENST00000269305.4	-	4	527	c.338T>G	c.(337-339)tTc>tGc	p.F113C	TP53_ENST00000359597.4_Missense_Mutation_p.F113C|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Missense_Mutation_p.F113C|TP53_ENST00000420246.2_Missense_Mutation_p.F113C|TP53_ENST00000455263.2_Missense_Mutation_p.F113C|TP53_ENST00000445888.2_Missense_Mutation_p.F113C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	113	Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		F -> C (in sporadic cancers; somatic mutation).|F -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|F -> I (in a sporadic cancer; somatic mutation).|F -> L (in sporadic cancers; somatic mutation).|F -> S (in sporadic cancers; somatic mutation).|F -> V (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.F113C(11)|p.0?(8)|p.F113S(4)|p.G59fs*23(3)|p.V73fs*9(1)|p.G105_T125del21(1)|p.G112_V122delGFLHSGTAKSV(1)|p.G112fs*9(1)|p.F113del(1)|p.Y107fs*44(1)|p.G112_S116delGFLHS(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AGAATGCAAGAAGCCCAGACG	0.607		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	35	Substitution - Missense(15)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(4)	upper_aerodigestive_tract(6)|lung(5)|large_intestine(4)|bone(4)|central_nervous_system(3)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|breast(2)|stomach(1)|liver(1)|oesophagus(1)|autonomic_ganglia(1)											65.0	61.0	62.0					17																	7579349		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.338T>G	17.37:g.7579349A>C	ENSP00000269305:p.Phe113Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.F113C	ENST00000269305.4	37	c.338	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	18.70	3.680367	0.68042	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000508793;ENST00000503591	D;D;D;D;D;D;D;D	0.99867	-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31;-7.31	4.75	4.75	0.60458	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99854	0.9932	M	0.89414	3.03	0.52099	D	0.999945	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;0.995;1.0;1.0;1.0	D	0.96472	0.9349	10	0.87932	D	0	-31.6488	12.5363	0.56144	1.0:0.0:0.0:0.0	.	74;113;113;113;113;113;113	B4E095;E7EMR6;P04637-2;P04637-3;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	C	113	ENSP00000410739:F113C;ENSP00000352610:F113C;ENSP00000269305:F113C;ENSP00000398846:F113C;ENSP00000391127:F113C;ENSP00000391478:F113C;ENSP00000424104:F113C;ENSP00000426252:F113C	ENSP00000269305:F113C	F	-	2	0	TP53	7520074	1.000000	0.71417	0.986000	0.45419	0.960000	0.62799	5.450000	0.66626	2.125000	0.65367	0.533000	0.62120	TTC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.607	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	38	0.00	0	A	NM_000546		7579349	7579349	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	1.000	C
TSPAN3	10099	genome.wustl.edu	37	15	77346562	77346562	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr15:77346562G>T	ENST00000267970.4	-	4	663	c.390C>A	c.(388-390)aaC>aaA	p.N130K	TSPAN3_ENST00000558394.1_5'UTR|TSPAN3_ENST00000558745.1_5'UTR|TSPAN3_ENST00000559494.1_Missense_Mutation_p.N41K|TSPAN3_ENST00000561277.1_5'UTR|TSPAN3_ENST00000346495.2_Missense_Mutation_p.N105K|TSPAN3_ENST00000424443.3_Missense_Mutation_p.N66K	NM_001168412.1|NM_005724.5|NM_198902.2	NP_001161884.1|NP_005715.1|NP_944492.1	O60637	TSN3_HUMAN	tetraspanin 3	130						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				kidney(1)|large_intestine(2)|lung(6)|urinary_tract(1)	10				all cancers(203;1.14e-19)		CAGCATCAGGGTTGGTTCCAT	0.418																																						dbGAP											0													166.0	142.0	150.0					15																	77346562		2196	4294	6490	-	-	-	SO:0001583	missense	0				CCDS10292.1, CCDS10293.1, CCDS53963.1	15q23	2013-02-14	2005-03-21	2005-03-21	ENSG00000140391	ENSG00000140391		"""Tetraspanins"""	17752	protein-coding gene	gene with protein product		613134	"""transmembrane 4 superfamily member 8"""	TM4SF8			Standard	NM_005724		Approved	TM4-A, TSPAN-3	uc002bcj.3	O60637	OTTHUMG00000143728	ENST00000267970.4:c.390C>A	15.37:g.77346562G>T	ENSP00000267970:p.Asn130Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEH4|B3KQQ2|B4DP19|Q9BW22|Q9NVX9	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.N130K	ENST00000267970.4	37	c.390	CCDS10292.1	15	.	.	.	.	.	.	.	.	.	.	G	15.15	2.749220	0.49257	.	.	ENSG00000140391	ENST00000267970;ENST00000424443;ENST00000423920;ENST00000346495	D;D;D	0.86562	-2.14;-2.14;-2.14	6.17	4.11	0.48088	Tetraspanin, EC2 domain (1);	0.481200	0.25660	N	0.029154	T	0.82167	0.4978	L	0.41236	1.265	0.80722	D	1	B;B;B;B	0.25351	0.124;0.069;0.01;0.01	B;B;B;B	0.34093	0.158;0.175;0.064;0.142	T	0.77408	-0.2599	10	0.32370	T	0.25	.	9.6653	0.39981	0.2363:0.0:0.7637:0.0	.	66;92;105;130	B4DP19;B4DEK8;A6NEH4;O60637	.;.;.;TSN3_HUMAN	K	130;66;92;105	ENSP00000267970:N130K;ENSP00000407243:N66K;ENSP00000341329:N105K	ENSP00000267970:N130K	N	-	3	2	TSPAN3	75133617	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.119000	0.31258	1.630000	0.50440	0.655000	0.94253	AAC	TSPAN3	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000140391		0.418	TSPAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN3	HGNC	protein_coding	OTTHUMT00000289792.3	147	0.00	0	G	NM_005724		77346562	77346562	-1	no_errors	ENST00000267970	ensembl	human	known	69_37n	missense	49	48.98	48	SNP	1.000	T
VCAN	1462	genome.wustl.edu	37	5	82834037	82834037	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr5:82834037G>T	ENST00000265077.3	+	8	5780	c.5215G>T	c.(5215-5217)Gag>Tag	p.E1739*	VCAN_ENST00000343200.5_Nonsense_Mutation_p.E752*|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000502527.2_Intron|VCAN_ENST00000512590.2_Intron	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1739	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	TTCTACATTTGAGGTATATTC	0.398																																						dbGAP											0													77.0	81.0	80.0					5																	82834037		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.5215G>T	5.37:g.82834037G>T	ENSP00000265077:p.Glu1739*	Somatic		WXS	Illumina GAIIx	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Nonsense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.E1739*	ENST00000265077.3	37	c.5215	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	G	47	13.141625	0.99723	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	.	.	.	5.82	2.68	0.31781	.	0.425742	0.22187	N	0.063439	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	8.2944	0.31976	0.1105:0.6051:0.2843:0.0	.	.	.	.	X	1739;752;752	.	ENSP00000265077:E1739X	E	+	1	0	VCAN	82869793	0.848000	0.29623	0.072000	0.20136	0.003000	0.03518	0.850000	0.27737	0.799000	0.34018	-0.175000	0.13238	GAG	VCAN	-	NULL	ENSG00000038427		0.398	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	49	0.00	0	G	NM_004385		82834037	82834037	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	nonsense	21	34.38	11	SNP	0.001	T
VPS13C	54832	genome.wustl.edu	37	15	62277090	62277090	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr15:62277090G>C	ENST00000261517.5	-	19	1760	c.1687C>G	c.(1687-1689)Caa>Gaa	p.Q563E	VPS13C_ENST00000249837.3_Missense_Mutation_p.Q520E|VPS13C_ENST00000395896.4_Missense_Mutation_p.Q563E|VPS13C_ENST00000395898.3_Missense_Mutation_p.Q520E	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TGAGATACTTGAGTGCCCAGG	0.328																																						dbGAP											0													72.0	69.0	70.0					15																	62277090		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.1687C>G	15.37:g.62277090G>C	ENSP00000261517:p.Gln563Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.Q563E	ENST00000261517.5	37	c.1687	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	11.21	1.570225	0.28003	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.40756	1.02;1.02;1.02	5.78	4.86	0.63082	.	0.273886	0.35677	N	0.003050	T	0.34571	0.0902	L	0.36672	1.1	0.09310	N	0.999999	B;B;B;B	0.10296	0.001;0.003;0.001;0.0	B;B;B;B	0.19666	0.001;0.026;0.001;0.003	T	0.20240	-1.0281	10	0.34782	T	0.22	.	13.14	0.59430	0.0:0.0:0.5631:0.4369	.	520;563;520;563	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	E	520;563;563;563	ENSP00000249837:Q520E;ENSP00000261517:Q563E;ENSP00000379233:Q563E	ENSP00000249837:Q520E	Q	-	1	0	VPS13C	60064382	0.904000	0.30761	0.879000	0.34478	0.995000	0.86356	2.563000	0.45922	1.426000	0.47256	0.563000	0.77884	CAA	VPS13C	-	NULL	ENSG00000129003		0.328	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	109	0.00	0	G	NM_017684		62277090	62277090	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	83	15.31	15	SNP	0.354	C
WDR17	116966	genome.wustl.edu	37	4	177050008	177050008	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1NF-01A-11D-A14G-09	TCGA-E9-A1NF-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	cd428bec-fc31-4d2d-9e6c-c8f30608d797	edffc09c-201a-44d1-b758-5d9d64f5f6a6	g.chr4:177050008A>G	ENST00000280190.4	+	7	1138	c.982A>G	c.(982-984)Aag>Gag	p.K328E	WDR17_ENST00000508596.1_Missense_Mutation_p.K304E|WDR17_ENST00000507824.2_Missense_Mutation_p.K311E|WDR17_ENST00000393643.2_Missense_Mutation_p.K304E			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	328										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		TCCAAGAAAAAAGTGTAAGTA	0.254																																						dbGAP											0													26.0	27.0	26.0					4																	177050008		2194	4281	6475	-	-	-	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.982A>G	4.37:g.177050008A>G	ENSP00000280190:p.Lys328Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.K328E	ENST00000280190.4	37	c.982	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	A	25.0	4.595935	0.86953	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.58652	0.35;0.38;0.32	5.36	5.36	0.76844	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.51126	0.1656	N	0.24115	0.695	0.43172	D	0.994973	P;D	0.56035	0.954;0.974	P;P	0.48571	0.582;0.582	T	0.51521	-0.8695	10	0.33940	T	0.23	-20.3028	15.3459	0.74337	1.0:0.0:0.0:0.0	.	304;328	E7EQX0;Q8IZU2	.;WDR17_HUMAN	E	304;304;328;311	ENSP00000422763:K304E;ENSP00000377258:K304E;ENSP00000280190:K328E	ENSP00000280190:K328E	K	+	1	0	WDR17	177287002	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	8.193000	0.89719	2.028000	0.59812	0.477000	0.44152	AAG	WDR17	-	superfamily_WD40_repeat_dom	ENSG00000150627		0.254	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	50	0.00	0	A			177050008	177050008	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	1.000	G
