#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM23	8745	genome.wustl.edu	37	2	207482334	207482334	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:207482334C>A	ENST00000264377.3	+	26	2810	c.2482C>A	c.(2482-2484)Cag>Aag	p.Q828K	ADAM23_ENST00000374416.1_Silent_p.L797L|ADAM23_ENST00000374415.3_Missense_Mutation_p.Q828K	NM_003812.2	NP_003803.1	O75077	ADA23_HUMAN	ADAM metallopeptidase domain 23	828					cell adhesion (GO:0007155)|central nervous system development (GO:0007417)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|endometrium(6)|kidney(3)|large_intestine(5)|liver(2)|lung(22)|ovary(2)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	51				LUSC - Lung squamous cell carcinoma(261;0.0961)|Lung(261;0.182)|Epithelial(149;0.205)		CGATCCTACTCAGCAAGGCCC	0.458																																					Melanoma(194;1127 2130 19620 24042 27855)	dbGAP											0													89.0	76.0	81.0					2																	207482334		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB009672	CCDS2369.1	2q33	2008-06-12	2005-08-18		ENSG00000114948	ENSG00000114948		"""ADAM metallopeptidase domain containing"""	202	protein-coding gene	gene with protein product		603710	"""a disintegrin and metalloproteinase domain 23"""			9693107	Standard	NM_003812		Approved	MDC3	uc002vbq.4	O75077	OTTHUMG00000132919	ENST00000264377.3:c.2482C>A	2.37:g.207482334C>A	ENSP00000264377:p.Gln828Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU59	Nonsense_Mutation	SNP	pfam_EGF_extracell,pfscan_EG-like_dom	p.S72*	ENST00000264377.3	37	c.215	CCDS2369.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.84|12.84	2.058368|2.058368	0.36277|0.36277	.|.	.|.	ENSG00000114948|ENSG00000114948	ENST00000264377;ENST00000374415|ENST00000431817;ENST00000444281	T;T|.	0.01804|.	4.64;4.63|.	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|.	.|.	.|.	.|.	T|.	0.62134|.	0.2403|.	L|L	0.54323|0.54323	1.7|1.7	0.80722|0.80722	D|D	1|1	P|.	0.41475|.	0.751|.	B|.	0.26693|.	0.072|.	T|.	0.56171|.	-0.8023|.	9|.	0.33940|0.05620	T|T	0.23|0.96	.|.	15.4266|15.4266	0.75055|0.75055	0.1395:0.8605:0.0:0.0|0.1395:0.8605:0.0:0.0	.|.	828|.	O75077|.	ADA23_HUMAN|.	K|X	828|667;72	ENSP00000264377:Q828K;ENSP00000363536:Q828K|.	ENSP00000264377:Q828K|ENSP00000415098:S667X	Q|S	+|+	1|2	0|0	ADAM23|ADAM23	207190579|207190579	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.699000|0.699000	0.40488|0.40488	3.605000|3.605000	0.54088|0.54088	2.691000|2.691000	0.91804|0.91804	0.655000|0.655000	0.94253|0.94253	CAG|TCA	ADAM23	-	NULL	ENSG00000114948		0.458	ADAM23-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAM23	HGNC	protein_coding	OTTHUMT00000256431.2	63	0.00	0	C	NM_003812		207482334	207482334	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444281	ensembl	human	known	69_37n	nonsense	46	34.29	24	SNP	0.992	A
ADGB	79747	genome.wustl.edu	37	6	147128561	147128561	+	Intron	SNP	G	G	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr6:147128561G>T	ENST00000397944.3	+	35	4894				ADGB_ENST00000367488.1_Intron|ADGB_ENST00000367493.3_Intron	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin						oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AAGCCCGACAGAAAATTTTCG	0.448																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4818+5414G>T	6.37:g.147128561G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	NULL	p.Q59H	ENST00000397944.3	37	c.177		6	.	.	.	.	.	.	.	.	.	.	G	13.13	2.146100	0.37923	.	.	ENSG00000118492	ENST00000367489	T	0.46451	0.87	3.62	-1.84	0.07809	.	.	.	.	.	T	0.11879	0.0289	.	.	.	0.18873	N	0.999984	.	.	.	.	.	.	T	0.32107	-0.9919	6	0.41790	T	0.15	.	1.2236	0.01929	0.1978:0.1376:0.3862:0.2784	.	.	.	.	H	59	ENSP00000356459:Q59H	ENSP00000356459:Q59H	Q	+	3	2	C6orf103	147170254	0.991000	0.36638	0.634000	0.29324	0.613000	0.37349	0.127000	0.15790	-0.055000	0.13244	0.462000	0.41574	CAG	ADGB	-	NULL	ENSG00000118492		0.448	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	26	0.00	0	G	NM_024694		147128561	147128561	+1	no_start_codon	ENST00000367489	ensembl	human	putative	69_37n	missense	13	27.78	5	SNP	0.007	T
AKT3	10000	genome.wustl.edu	37	1	243828108	243828108	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr1:243828108C>T	ENST00000366539.1	-	4	450	c.250G>A	c.(250-252)Gag>Aag	p.E84K	AKT3_ENST00000336199.5_Missense_Mutation_p.E84K|AKT3_ENST00000263826.5_Missense_Mutation_p.E84K|AKT3_ENST00000366540.1_Missense_Mutation_p.E84K			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3	84	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			AATGTTCTCTCTATAACAGTA	0.318																																						dbGAP											0													142.0	143.0	143.0					1																	243828108		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.250G>A	1.37:g.243828108C>T	ENSP00000355497:p.Glu84Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom	p.E84K	ENST00000366539.1	37	c.250	CCDS31077.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.931431	0.97116	.	.	ENSG00000117020	ENST00000336199;ENST00000366540;ENST00000366539;ENST00000263826;ENST00000552631	T;T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97;-0.97	6.08	6.08	0.98989	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	D	0.85208	0.5644	L	0.60012	1.86	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.984;0.973	D	0.84786	0.0776	10	0.72032	D	0.01	.	20.6647	0.99678	0.0:1.0:0.0:0.0	.	84;84	Q9Y243;Q9Y243-2	AKT3_HUMAN;.	K	84	ENSP00000336943:E84K;ENSP00000355498:E84K;ENSP00000355497:E84K;ENSP00000263826:E84K;ENSP00000447820:E84K	ENSP00000263826:E84K	E	-	1	0	AKT3	241894731	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.734000	0.84928	2.890000	0.99128	0.655000	0.94253	GAG	AKT3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000117020		0.318	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT3	HGNC	protein_coding	OTTHUMT00000096479.1	171	0.00	0	C	NM_181690		243828108	243828108	-1	no_errors	ENST00000263826	ensembl	human	known	69_37n	missense	94	14.55	16	SNP	1.000	T
ANO9	338440	genome.wustl.edu	37	11	418925	418925	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr11:418925C>T	ENST00000332826.6	-	21	2083	c.1999G>A	c.(1999-2001)Gat>Aat	p.D667N	SIGIRR_ENST00000397632.3_5'Flank|SIGIRR_ENST00000382520.2_5'Flank|SIGIRR_ENST00000332725.3_5'Flank	NM_001012302.2	NP_001012302	A1A5B4	ANO9_HUMAN	anoctamin 9	667					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|negative regulation of intracellular calcium activated chloride channel activity (GO:1902939)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)			central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|lung(5)|ovary(1)|prostate(4)|skin(4)	21						TCAATCCCATCAGGGTCCTGG	0.592																																						dbGAP											0													202.0	189.0	193.0					11																	418925		2203	4300	6503	-	-	-	SO:0001583	missense	0			U33271	CCDS31326.1	11p15.5	2014-04-09	2008-08-28	2008-08-28	ENSG00000185101	ENSG00000185101		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	20679	protein-coding gene	gene with protein product			"""tumor protein p53 inducible protein 5"", ""transmembrane protein 16J"""	TP53I5, TMEM16J		9305847, 24692353	Standard	NM_001012302		Approved	PIG5	uc001lpi.2	A1A5B4	OTTHUMG00000165446	ENST00000332826.6:c.1999G>A	11.37:g.418925C>T	ENSP00000332788:p.Asp667Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUC4|B4E134|Q8TEN4	Missense_Mutation	SNP	pfam_Anoctamin	p.D667N	ENST00000332826.6	37	c.1999	CCDS31326.1	11	.	.	.	.	.	.	.	.	.	.	c	8.545	0.874105	0.17395	.	.	ENSG00000185101	ENST00000332826	T	0.65178	-0.14	4.23	-3.21	0.05140	.	2.119430	0.02641	N	0.105342	T	0.37517	0.1006	N	0.11845	0.185	0.09310	N	1	B;B	0.20550	0.013;0.046	B;B	0.15484	0.003;0.013	T	0.18713	-1.0328	10	0.10377	T	0.69	.	5.5201	0.16927	0.0:0.2007:0.2802:0.519	.	368;667	A1A5B4-2;A1A5B4	.;ANO9_HUMAN	N	667	ENSP00000332788:D667N	ENSP00000332788:D667N	D	-	1	0	ANO9	408925	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.853000	0.01666	-0.216000	0.10048	0.478000	0.44815	GAT	ANO9	-	pfam_Anoctamin	ENSG00000185101		0.592	ANO9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO9	HGNC	protein_coding	OTTHUMT00000384116.1	77	0.00	0	C	NM_001012302		418925	418925	-1	no_errors	ENST00000332826	ensembl	human	known	69_37n	missense	54	18.18	12	SNP	0.000	T
AR	367	genome.wustl.edu	37	X	66863184	66863184	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:66863184C>T	ENST00000374690.3	+	2	2227	c.1703C>T	c.(1702-1704)tCt>tTt	p.S568F	AR_ENST00000513847.1_3'UTR|AR_ENST00000396044.3_Missense_Mutation_p.S568F|AR_ENST00000396043.2_Missense_Mutation_p.S36F|AR_ENST00000504326.1_Missense_Mutation_p.S568F	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	567	Interaction with LPXN.		G -> V (in a patient with isolated hypospadias). {ECO:0000269|PubMed:7673412}.|G -> W (in PAIS). {ECO:0000269|PubMed:7910529}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	GATGAAGCTTCTGGGTGTCAC	0.488									Androgen Insensitivity Syndrome																													dbGAP											0													120.0	97.0	105.0					X																	66863184		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.1703C>T	X.37:g.66863184C>T	ENSP00000363822:p.Ser568Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUN2|B1AKD7|Q9UD95	Missense_Mutation	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.S568F	ENST00000374690.3	37	c.1703	CCDS14387.1	X	.	.	.	.	.	.	.	.	.	.	C	24.7	4.565661	0.86439	.	.	ENSG00000169083	ENST00000544984;ENST00000374690;ENST00000504326;ENST00000396044;ENST00000396043	D;D;D;D	0.98090	-4.71;-4.71;-4.71;-4.71	5.37	5.37	0.77165	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.98557	0.9518	M	0.79475	2.455	0.80722	D	1	D;D;D;D	0.89917	0.999;0.999;1.0;1.0	D;D;D;D	0.97110	0.998;0.998;1.0;0.999	D	0.99804	1.1037	10	0.87932	D	0	.	15.4234	0.75031	0.0:1.0:0.0:0.0	.	568;568;36;567	E7EVX6;D3YPQ2;F1D8N5;P10275	.;.;.;ANDR_HUMAN	F	378;568;568;568;36	ENSP00000363822:S568F;ENSP00000421155:S568F;ENSP00000379359:S568F;ENSP00000379358:S36F	ENSP00000363822:S568F	S	+	2	0	AR	66779909	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.642000	0.83385	2.234000	0.73211	0.523000	0.50628	TCT	AR	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000169083		0.488	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	144	0.00	0	C	NM_000044		66863184	66863184	+1	no_errors	ENST00000374690	ensembl	human	known	69_37n	missense	77	21.43	21	SNP	1.000	T
ARHGAP42	143872	genome.wustl.edu	37	11	100665888	100665888	+	Missense_Mutation	SNP	G	G	T	rs61999341	byFrequency	TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr11:100665888G>T	ENST00000298815.8	+	3	306	c.303G>T	c.(301-303)agG>agT	p.R101S	AC015600.1_ENST00000577356.1_RNA|ARHGAP42_ENST00000534060.1_3'UTR|ARHGAP42_ENST00000524892.2_Missense_Mutation_p.R101S	NM_152432.2	NP_689645.2	A6NI28	RHG42_HUMAN	Rho GTPase activating protein 42	101	BAR.				signal transduction (GO:0007165)	intracellular (GO:0005622)	GTPase activator activity (GO:0005096)			endometrium(3)|skin(2)	5						AAGAAGAAAGGCGAAGACTGG	0.313																																						dbGAP											0													120.0	118.0	119.0					11																	100665888		692	1588	2280	-	-	-	SO:0001583	missense	0					11q22.1	2012-04-19			ENSG00000165895	ENSG00000165895		"""Rho GTPase activating proteins"""	26545	protein-coding gene	gene with protein product		615936				18954304	Standard	NM_152432		Approved	FLJ32810, GRAF3	uc001pge.2	A6NI28	OTTHUMG00000167530	ENST00000298815.8:c.303G>T	11.37:g.100665888G>T	ENSP00000298815:p.Arg101Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96M56	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.R101S	ENST00000298815.8	37	c.303		11	.	.	.	.	.	.	.	.	.	.	G	16.83	3.231771	0.58777	.	.	ENSG00000165895	ENST00000524892;ENST00000298815	T;T	0.05258	3.47;3.47	4.73	2.85	0.33270	IRSp53/MIM homology domain (IMD) (1);	0.109171	0.36002	U	0.002856	T	0.19208	0.0461	M	0.83603	2.65	0.58432	D	0.999998	D	0.60160	0.987	P	0.59115	0.852	T	0.00477	-1.1716	10	0.87932	D	0	.	7.5629	0.27862	0.2006:0.0:0.7994:0.0	.	101	A6NI28	RHG42_HUMAN	S	101	ENSP00000431776:R101S;ENSP00000298815:R101S	ENSP00000298815:R101S	R	+	3	2	ARHGAP42	100171098	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	0.262000	0.18460	0.686000	0.31488	0.655000	0.94253	AGG	ARHGAP42	-	NULL	ENSG00000165895		0.313	ARHGAP42-201	KNOWN	basic|appris_principal	protein_coding	ARHGAP42	HGNC	protein_coding		107	0.00	0	G	NM_152432		100665888	100665888	+1	no_errors	ENST00000298815	ensembl	human	known	69_37n	missense	79	19.39	19	SNP	1.000	T
ATP11C	286410	genome.wustl.edu	37	X	138880454	138880454	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:138880454G>A	ENST00000327569.3	-	10	942	c.844C>T	c.(844-846)Cag>Tag	p.Q282*	ATP11C_ENST00000361648.2_Nonsense_Mutation_p.Q282*|ATP11C_ENST00000370557.1_Nonsense_Mutation_p.Q279*|ATP11C_ENST00000460773.1_5'Flank|ATP11C_ENST00000370543.1_Nonsense_Mutation_p.Q282*|ATP11C_ENST00000359686.2_Nonsense_Mutation_p.Q282*	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	282					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					GAACGTTTCTGAGATTTCCCT	0.318																																						dbGAP											0													114.0	99.0	104.0					X																	138880454		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.844C>T	X.37:g.138880454G>A	ENSP00000332756:p.Gln282*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.Q282*	ENST00000327569.3	37	c.844	CCDS14668.1	X	.	.	.	.	.	.	.	.	.	.	G	39	7.469818	0.98302	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	.	.	.	5.68	5.68	0.88126	.	0.111603	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	17.6348	0.88119	0.0:0.0:1.0:0.0	.	.	.	.	X	279;282;282;282;282	.	ENSP00000332756:Q282X	Q	-	1	0	ATP11C	138708120	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.381000	0.81170	0.523000	0.50628	CAG	ATP11C	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000101974		0.318	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	150	0.00	0	G	NM_173694		138880454	138880454	-1	no_errors	ENST00000327569	ensembl	human	known	69_37n	nonsense	110	19.12	26	SNP	1.000	A
BAIAP3	8938	genome.wustl.edu	37	16	1392617	1392617	+	Silent	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr16:1392617C>G	ENST00000324385.5	+	12	1310	c.1152C>G	c.(1150-1152)ctC>ctG	p.L384L	BAIAP3_ENST00000426824.3_Silent_p.L349L|BAIAP3_ENST00000421665.2_Intron|BAIAP3_ENST00000397489.1_Silent_p.L366L|BAIAP3_ENST00000562208.1_Silent_p.L326L|BAIAP3_ENST00000568887.1_Silent_p.L321L|BAIAP3_ENST00000397488.2_Silent_p.L366L	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	384					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				ACCTGGTTCTCAAGCTGATCA	0.677																																						dbGAP											0													28.0	25.0	26.0					16																	1392617		2178	4286	6464	-	-	-	SO:0001819	synonymous_variant	0			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1152C>G	16.37:g.1392617C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Silent	SNP	pfam_C2_Ca-dep,pfam_Munc13_subgr_dom-2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L384	ENST00000324385.5	37	c.1152	CCDS10434.1	16																																																																																			BAIAP3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000007516		0.677	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	HGNC	protein_coding	OTTHUMT00000109056.3	23	0.00	0	C			1392617	1392617	+1	no_errors	ENST00000324385	ensembl	human	known	69_37n	silent	40	18.37	9	SNP	1.000	G
C11orf74	119710	genome.wustl.edu	37	11	36654963	36654963	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr11:36654963C>A	ENST00000334307.5	+	3	381	c.266C>A	c.(265-267)aCt>aAt	p.T89N	C11orf74_ENST00000446510.2_Missense_Mutation_p.T89N|C11orf74_ENST00000534635.1_Intron|C11orf74_ENST00000347206.4_Intron	NM_138787.2	NP_620142.2	Q86VG3	CK074_HUMAN	chromosome 11 open reading frame 74	89										breast(1)|kidney(1)|large_intestine(1)|lung(5)	8	all_lung(20;0.226)	all_hematologic(20;0.0118)				TTTCTTCGTACTTCATCACAA	0.318																																						dbGAP											0													69.0	66.0	67.0					11																	36654963		2201	4296	6497	-	-	-	SO:0001583	missense	0			AK095997, BC009561	CCDS7904.1, CCDS60762.1	11p12	2012-08-10			ENSG00000166352	ENSG00000166352			25142	protein-coding gene	gene with protein product						12477932	Standard	NM_001276722		Approved	FLJ38678, HEPIS	uc031pzr.1	Q86VG3	OTTHUMG00000166397	ENST00000334307.5:c.266C>A	11.37:g.36654963C>A	ENSP00000334848:p.Thr89Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR18|Q96DD6	Missense_Mutation	SNP	NULL	p.T89N	ENST00000334307.5	37	c.266	CCDS7904.1	11	.	.	.	.	.	.	.	.	.	.	C	12.12	1.842633	0.32606	.	.	ENSG00000166352	ENST00000334307;ENST00000531554;ENST00000446510;ENST00000532470	.	.	.	4.29	3.37	0.38596	.	0.666605	0.14462	N	0.318122	T	0.34483	0.0899	L	0.54323	1.7	0.09310	N	0.999999	P	0.48016	0.904	P	0.44394	0.448	T	0.09751	-1.0660	9	0.29301	T	0.29	-0.4156	8.6655	0.34118	0.0:0.8884:0.0:0.1116	.	89	Q86VG3	CK074_HUMAN	N	89	.	ENSP00000334848:T89N	T	+	2	0	C11orf74	36611539	0.000000	0.05858	0.346000	0.25655	0.242000	0.25591	-0.195000	0.09546	1.121000	0.41925	0.585000	0.79938	ACT	C11orf74	-	NULL	ENSG00000166352		0.318	C11orf74-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C11orf74	HGNC	protein_coding	OTTHUMT00000389567.1	60	0.00	0	C	NM_138787		36654963	36654963	+1	no_errors	ENST00000334307	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	0.257	A
C2orf47	79568	genome.wustl.edu	37	2	200826646	200826646	+	Silent	SNP	C	C	T	rs542762716	byFrequency	TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:200826646C>T	ENST00000392290.1	+	4	988	c.792C>T	c.(790-792)agC>agT	p.S264S	C2orf47_ENST00000295079.2_Silent_p.S264S|C2orf47_ENST00000469156.1_Intron			Q8WWC4	CB047_HUMAN	chromosome 2 open reading frame 47	264						mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|large_intestine(1)|lung(5)	9						TTAGTGCAAGCTATGAGTAAG	0.373													C|||	2	0.000399361	0.0	0.0029	5008	,	,		19520	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													104.0	99.0	100.0					2																	200826646		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017959	CCDS2329.1	2q33.1	2011-03-08			ENSG00000162972	ENSG00000162972			26198	protein-coding gene	gene with protein product						12477932	Standard	NM_024520		Approved	DKFZp666A212, FLJ22555	uc002uvm.3	Q8WWC4	OTTHUMG00000132771	ENST00000392290.1:c.792C>T	2.37:g.200826646C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q658V9|Q9H671	Silent	SNP	NULL	p.S264	ENST00000392290.1	37	c.792	CCDS2329.1	2																																																																																			C2orf47	-	NULL	ENSG00000162972		0.373	C2orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf47	HGNC	protein_coding	OTTHUMT00000256146.1	72	0.00	0	C	NM_024520		200826646	200826646	+1	no_errors	ENST00000295079	ensembl	human	known	69_37n	silent	51	28.17	20	SNP	0.916	T
CADM1	23705	genome.wustl.edu	37	11	115080312	115080314	+	In_Frame_Del	DEL	TGG	TGG	-	rs370430583		TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	TGG	TGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr11:115080312_115080314delTGG	ENST00000452722.3	-	8	1078_1080	c.1058_1060delCCA	c.(1057-1062)accatc>atc	p.T353del	CADM1_ENST00000331581.6_In_Frame_Del_p.T353del|CADM1_ENST00000536727.1_Intron|CADM1_ENST00000537140.1_Intron|CADM1_ENST00000537058.1_In_Frame_Del_p.T353del|CADM1_ENST00000542447.2_Intron	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		atggtaaggatggtggtggtggt	0.429																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.1058_1060delCCA	11.37:g.115080321_115080323delTGG	ENSP00000395359:p.Thr353del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like	p.T353in_frame_del	ENST00000452722.3	37	c.1060_1058	CCDS8373.1	11																																																																																			CADM1	-	NULL	ENSG00000182985		0.429	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CADM1	HGNC	protein_coding	OTTHUMT00000398753.2	50	0.00	0	TGG	NM_014333		115080312	115080314	-1	no_errors	ENST00000452722	ensembl	human	known	69_37n	in_frame_del	25	10.71	3	DEL	1.000:1.000:1.000	-
CDC42BPA	8476	genome.wustl.edu	37	1	227259959	227259959	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr1:227259959G>C	ENST00000366769.3	-	20	4068	c.2777C>G	c.(2776-2778)tCa>tGa	p.S926*	CDC42BPA_ENST00000535525.1_Nonsense_Mutation_p.S926*|CDC42BPA_ENST00000366765.3_Nonsense_Mutation_p.S926*|CDC42BPA_ENST00000488131.1_5'UTR|CDC42BPA_ENST00000366766.2_Nonsense_Mutation_p.S926*|CDC42BPA_ENST00000366764.2_Nonsense_Mutation_p.S926*|CDC42BPA_ENST00000334218.5_Nonsense_Mutation_p.S926*|CDC42BPA_ENST00000366767.3_Nonsense_Mutation_p.S845*	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				TTCGATTTCTGAGAGTAGTTC	0.353																																						dbGAP											0													175.0	163.0	167.0					1																	227259959		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2777C>G	1.37:g.227259959G>C	ENSP00000355731:p.Ser926*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.S926*	ENST00000366769.3	37	c.2777	CCDS1558.1	1	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753983	0.89843	.	.	ENSG00000143776	ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765	.	.	.	5.62	5.62	0.85841	.	0.188790	0.46145	D	0.000320	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	13.8882	0.63721	0.0726:0.0:0.9274:0.0	.	.	.	.	X	926;845;926;926;926;190;926;926	.	ENSP00000335341:S926X	S	-	2	0	CDC42BPA	225326582	1.000000	0.71417	0.976000	0.42696	0.939000	0.58152	3.854000	0.55949	2.662000	0.90505	0.591000	0.81541	TCA	CDC42BPA	-	pfam_Myotonic_dystrophy_kinase_coil	ENSG00000143776		0.353	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1	186	0.00	0	G	NM_014826		227259959	227259959	-1	no_errors	ENST00000334218	ensembl	human	known	69_37n	nonsense	142	14.46	24	SNP	0.982	C
CRAMP1L	57585	genome.wustl.edu	37	16	1719082	1719082	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr16:1719082C>T	ENST00000397412.3	+	19	3514	c.3415C>T	c.(3415-3417)Cag>Tag	p.Q1139*	CRAMP1L_ENST00000262317.4_Nonsense_Mutation_p.Q514*|CRAMP1L_ENST00000293925.5_Nonsense_Mutation_p.Q1139*|CRAMP1L_ENST00000436138.3_Nonsense_Mutation_p.Q1136*|LA16c-431H6.6_ENST00000454337.1_3'UTR			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	1139	Ser-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						CAGCAGCCCCCAGCCACACTG	0.602																																						dbGAP											0													35.0	44.0	41.0					16																	1719082		2053	4194	6247	-	-	-	SO:0001587	stop_gained	0			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.3415C>T	16.37:g.1719082C>T	ENSP00000380559:p.Gln1139*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Nonsense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.Q1139*	ENST00000397412.3	37	c.3415	CCDS10440.2	16	.	.	.	.	.	.	.	.	.	.	C	40	8.363297	0.98779	.	.	ENSG00000007545	ENST00000397412;ENST00000293925;ENST00000436138;ENST00000262317	.	.	.	5.73	5.73	0.89815	.	0.195749	0.46145	D	0.000317	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-28.9251	19.9025	0.96993	0.0:1.0:0.0:0.0	.	.	.	.	X	1139;1139;1136;514	.	ENSP00000262317:Q514X	Q	+	1	0	CRAMP1L	1659083	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	4.124000	0.57924	2.722000	0.93159	0.655000	0.94253	CAG	CRAMP1L	-	NULL	ENSG00000007545		0.602	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAMP1L	HGNC	protein_coding	OTTHUMT00000157297.4	49	0.00	0	C			1719082	1719082	+1	no_errors	ENST00000293925	ensembl	human	known	69_37n	nonsense	53	24.29	17	SNP	1.000	T
COG7	91949	genome.wustl.edu	37	16	23415115	23415115	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr16:23415115C>T	ENST00000307149.5	-	13	1888	c.1703G>A	c.(1702-1704)cGa>cAa	p.R568Q		NM_153603.3	NP_705831.1	P83436	COG7_HUMAN	component of oligomeric golgi complex 7	568					intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to Golgi apparatus (GO:0034067)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(7)|large_intestine(9)|liver(1)|lung(7)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.0401)		CAGCGCTGCTCGAGGTGCAGC	0.507																																						dbGAP											0													83.0	71.0	75.0					16																	23415115		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF070568	CCDS10610.1	16p12.2	2008-02-05			ENSG00000168434	ENSG00000168434		"""Components of oligomeric golgi complex"""	18622	protein-coding gene	gene with protein product		606978				11980916	Standard	NM_153603		Approved		uc002dlo.3	P83436	OTTHUMG00000094807	ENST00000307149.5:c.1703G>A	16.37:g.23415115C>T	ENSP00000305442:p.Arg568Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWU7	Missense_Mutation	SNP	pfam_COG_su7	p.R568Q	ENST00000307149.5	37	c.1703	CCDS10610.1	16	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242944	0.39697	.	.	ENSG00000168434	ENST00000307149	T	0.44482	0.92	4.43	3.47	0.39725	.	0.229487	0.38837	N	0.001549	T	0.44705	0.1306	L	0.39898	1.24	0.52099	D	0.999945	D	0.64830	0.994	P	0.55545	0.778	T	0.18618	-1.0331	10	0.24483	T	0.36	-6.0533	11.8078	0.52165	0.0:0.9138:0.0:0.0862	.	568	P83436	COG7_HUMAN	Q	568	ENSP00000305442:R568Q	ENSP00000305442:R568Q	R	-	2	0	COG7	23322616	1.000000	0.71417	0.019000	0.16419	0.019000	0.09904	4.921000	0.63397	0.990000	0.38787	0.650000	0.86243	CGA	COG7	-	pfam_COG_su7	ENSG00000168434		0.507	COG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG7	HGNC	protein_coding	OTTHUMT00000211625.1	52	0.00	0	C			23415115	23415115	-1	no_errors	ENST00000307149	ensembl	human	known	69_37n	missense	58	33.33	29	SNP	0.908	T
DCHS2	54798	genome.wustl.edu	37	4	155254228	155254228	+	Silent	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr4:155254228G>A	ENST00000357232.4	-	9	1634	c.1635C>T	c.(1633-1635)ggC>ggT	p.G545G	DCHS2_ENST00000507542.1_5'UTR|DCHS2_ENST00000339452.1_Silent_p.G1044G	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	545	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		CCCGCTGCTCGCCCGCGCCCA	0.657																																						dbGAP											0													27.0	31.0	30.0					4																	155254228		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.1635C>T	4.37:g.155254228G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G545	ENST00000357232.4	37	c.1635	CCDS3785.1	4																																																																																			DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.657	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	30	0.00	0	G	NM_001142552		155254228	155254228	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	silent	11	33.33	6	SNP	0.000	A
DIP2A	23181	genome.wustl.edu	37	21	47931393	47931393	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr21:47931393A>G	ENST00000417564.2	+	8	989	c.968A>G	c.(967-969)gAg>gGg	p.E323G	DIP2A_ENST00000466639.1_Missense_Mutation_p.E280G|DIP2A_ENST00000427143.2_Missense_Mutation_p.E259G|DIP2A_ENST00000435722.3_Missense_Mutation_p.E323G|DIP2A_ENST00000400274.1_Missense_Mutation_p.E319G|DIP2A_ENST00000318711.7_Missense_Mutation_p.E324G|DIP2A_ENST00000457905.3_Missense_Mutation_p.E323G			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	323					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CTGAGAGGGGAGCCTCTCACT	0.547																																						dbGAP											0													36.0	39.0	38.0					21																	47931393		1988	4155	6143	-	-	-	SO:0001583	missense	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.968A>G	21.37:g.47931393A>G	ENSP00000392066:p.Glu323Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.E324G	ENST00000417564.2	37	c.971	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	A	14.86	2.662394	0.47572	.	.	ENSG00000160305	ENST00000400274;ENST00000427143;ENST00000318711;ENST00000358985;ENST00000457905;ENST00000466639;ENST00000435722;ENST00000417564	T;T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8;0.8	5.44	5.44	0.79542	.	0.066865	0.64402	D	0.000017	T	0.65165	0.2665	M	0.75777	2.31	0.80722	D	1	P;B;D;P;P;B	0.55385	0.774;0.163;0.971;0.941;0.648;0.008	P;B;P;P;B;B	0.59487	0.493;0.25;0.705;0.858;0.351;0.014	T	0.68922	-0.5281	10	0.59425	D	0.04	-29.1525	14.6863	0.69052	1.0:0.0:0.0:0.0	.	324;259;280;323;323;323	E9PER1;E7EMA5;Q14689-3;Q14689;Q14689-4;Q14689-2	.;.;.;DIP2A_HUMAN;.;.	G	319;259;324;280;323;280;323;323	ENSP00000383133:E319G;ENSP00000400528:E259G;ENSP00000323633:E324G;ENSP00000393434:E323G;ENSP00000430249:E280G;ENSP00000415089:E323G;ENSP00000392066:E323G	ENSP00000323633:E324G	E	+	2	0	DIP2A	46755821	1.000000	0.71417	0.933000	0.37362	0.026000	0.11368	9.170000	0.94795	2.064000	0.61679	0.460000	0.39030	GAG	DIP2A	-	NULL	ENSG00000160305		0.547	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	32	0.00	0	A	NM_015151		47931393	47931393	+1	no_errors	ENST00000318711	ensembl	human	known	69_37n	missense	19	44.12	15	SNP	1.000	G
DOCK11	139818	genome.wustl.edu	37	X	117819732	117819732	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:117819732G>A	ENST00000276202.7	+	53	6247	c.6184G>A	c.(6184-6186)Gac>Aac	p.D2062N	DOCK11_ENST00000276204.6_Missense_Mutation_p.D2066N	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	2062					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TACATCAAGTGACCGAGGTTA	0.408																																						dbGAP											0													212.0	178.0	189.0					X																	117819732		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.6184G>A	X.37:g.117819732G>A	ENSP00000276202:p.Asp2062Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D2062N	ENST00000276202.7	37	c.6184	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	G	8.710	0.911890	0.17907	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.17854	2.25;2.25	6.17	5.3	0.74995	.	0.149691	0.47093	N	0.000243	T	0.09949	0.0244	N	0.22421	0.69	0.27210	N	0.959944	B;B	0.11235	0.004;0.003	B;B	0.08055	0.003;0.003	T	0.33929	-0.9849	10	0.09338	T	0.73	-5.1179	8.6941	0.34284	0.2421:0.0:0.7579:0.0	.	2066;2062	A6NIW2;Q5JSL3	.;DOC11_HUMAN	N	2066;2062	ENSP00000276204:D2066N;ENSP00000276202:D2062N	ENSP00000276202:D2062N	D	+	1	0	DOCK11	117703760	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.178000	0.50879	1.333000	0.45449	0.600000	0.82982	GAC	DOCK11	-	NULL	ENSG00000147251		0.408	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	113	0.00	0	G	NM_144658		117819732	117819732	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	89	11.88	12	SNP	0.999	A
DOCK3	1795	genome.wustl.edu	37	3	51101917	51101917	+	Silent	SNP	G	G	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr3:51101917G>T	ENST00000266037.9	+	6	377	c.354G>T	c.(352-354)gtG>gtT	p.V118V		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	118					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TACGCCATGTGATGAATGAAC	0.458																																						dbGAP											0													112.0	113.0	113.0					3																	51101917		1943	4129	6072	-	-	-	SO:0001819	synonymous_variant	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.354G>T	3.37:g.51101917G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15017	Silent	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.V118	ENST00000266037.9	37	c.354	CCDS46835.1	3																																																																																			DOCK3	-	NULL	ENSG00000088538		0.458	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	41	0.00	0	G	NM_004947		51101917	51101917	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	silent	27	15.62	5	SNP	1.000	T
DPP10	57628	genome.wustl.edu	37	2	116520181	116520181	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:116520181C>G	ENST00000410059.1	+	12	1588	c.1108C>G	c.(1108-1110)Cag>Gag	p.Q370E	DPP10_ENST00000310323.8_Missense_Mutation_p.Q363E|DPP10_ENST00000393147.2_Missense_Mutation_p.Q374E|DPP10_ENST00000409163.1_Missense_Mutation_p.Q320E	NM_001178037.1|NM_020868.3	NP_001171508.1|NP_065919	Q8N608	DPP10_HUMAN	dipeptidyl-peptidase 10 (non-functional)	370						integral component of membrane (GO:0016021)|membrane (GO:0016020)	serine-type peptidase activity (GO:0008236)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(24)|liver(2)|lung(48)|ovary(6)|prostate(1)|skin(5)|soft_tissue(1)	101						GTGGCTCTCTCAGCAGGTACA	0.348																																						dbGAP											0													194.0	182.0	186.0					2																	116520181		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY172661	CCDS33278.1, CCDS46400.1, CCDS54388.1, CCDS54389.1	2q14.1	2010-05-04	2010-05-04		ENSG00000175497	ENSG00000175497			20823	protein-coding gene	gene with protein product		608209	"""dipeptidylpeptidase 10"", ""dipeptidyl-peptidase 10"""			10819331, 12662155	Standard	NM_020868		Approved	DPRP3	uc002tle.3	Q8N608	OTTHUMG00000153294	ENST00000410059.1:c.1108C>G	2.37:g.116520181C>G	ENSP00000386565:p.Gln370Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Q2|J3KPP2|J3KQ46|Q0GLB8|Q53QT3|Q53S86|Q53SL8|Q53SS4|Q6TTV4|Q86YR9|Q9P236	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.Q374E	ENST00000410059.1	37	c.1120	CCDS46400.1	2	.	.	.	.	.	.	.	.	.	.	A	7.381	0.628798	0.14257	.	.	ENSG00000175497	ENST00000410059;ENST00000409163;ENST00000393147;ENST00000310323;ENST00000476155	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	4.99	4.99	0.66335	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.231705	0.43260	D	0.000590	T	0.15046	0.0363	N	0.02916	-0.46	0.09310	N	0.999996	B;B;B;B	0.11235	0.003;0.0;0.004;0.004	B;B;B;B	0.19946	0.016;0.0;0.003;0.027	T	0.18808	-1.0325	10	0.48119	T	0.1	-24.5489	11.4877	0.50363	0.8494:0.1506:0.0:0.0	.	363;374;366;370	Q8N608-2;Q0GLB8;Q0GLB9;Q8N608	.;.;.;DPP10_HUMAN	E	370;320;374;363;320	ENSP00000386565:Q370E;ENSP00000387038:Q320E;ENSP00000376855:Q374E;ENSP00000309066:Q363E	ENSP00000309066:Q363E	Q	+	1	0	DPP10	116236651	1.000000	0.71417	0.998000	0.56505	0.744000	0.42396	3.881000	0.56152	0.939000	0.37446	-0.375000	0.07067	CAG	DPP10	-	pfam_Peptidase_S9B	ENSG00000175497		0.348	DPP10-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DPP10	HGNC	protein_coding	OTTHUMT00000330580.4	159	0.00	0	C	NM_020868		116520181	116520181	+1	no_errors	ENST00000393147	ensembl	human	known	69_37n	missense	130	11.56	17	SNP	1.000	G
DSCAM	1826	genome.wustl.edu	37	21	41719621	41719621	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr21:41719621C>G	ENST00000400454.1	-	6	1663	c.1186G>C	c.(1186-1188)Gac>Cac	p.D396H		NM_001271534.1|NM_001389.3	NP_001258463.1|NP_001380.2	O60469	DSCAM_HUMAN	Down syndrome cell adhesion molecule	396	Ig-like C2-type 4.				cell adhesion (GO:0007155)|dendrite morphogenesis (GO:0048813)|dendrite self-avoidance (GO:0070593)|locomotory behavior (GO:0007626)|negative regulation of cell adhesion (GO:0007162)|nervous system development (GO:0007399)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)	axon (GO:0030424)|extracellular region (GO:0005576)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(22)|lung(47)|ovary(7)|pancreas(2)|prostate(3)|skin(14)|upper_aerodigestive_tract(6)|urinary_tract(4)	142		all_cancers(19;0.186)|Prostate(19;1.15e-05)|all_epithelial(19;0.0103)				TGCACATAGTCTTGAGCGGAC	0.507																																					Melanoma(134;970 1778 1785 21664 32388)	dbGAP											0													197.0	179.0	185.0					21																	41719621		1997	4169	6166	-	-	-	SO:0001583	missense	0			AF023449	CCDS42929.1	21q22.2-q22.3	2013-02-11			ENSG00000171587	ENSG00000171587		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	3039	protein-coding gene	gene with protein product		602523				9426258	Standard	NM_001271534		Approved	CHD2-42, CHD2-52	uc002yyq.1	O60469	OTTHUMG00000086732	ENST00000400454.1:c.1186G>C	21.37:g.41719621C>G	ENSP00000383303:p.Asp396His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60468	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub2,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D396H	ENST00000400454.1	37	c.1186	CCDS42929.1	21	.	.	.	.	.	.	.	.	.	.	C	25.3	4.620589	0.87460	.	.	ENSG00000171587	ENST00000400454;ENST00000404019	T;D	0.81499	0.25;-1.5	5.1	5.1	0.69264	Immunoglobulin-like (1);	0.000000	0.85682	D	0.000000	D	0.86289	0.5897	L	0.46614	1.455	0.58432	D	0.999999	D	0.76494	0.999	D	0.72982	0.979	D	0.84379	0.0548	10	0.30854	T	0.27	.	18.4949	0.90861	0.0:1.0:0.0:0.0	.	396	O60469	DSCAM_HUMAN	H	396;148	ENSP00000383303:D396H;ENSP00000385342:D148H	ENSP00000383303:D396H	D	-	1	0	DSCAM	40641491	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.718000	0.84743	2.344000	0.79699	0.655000	0.94253	GAC	DSCAM	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000171587		0.507	DSCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAM	HGNC	protein_coding	OTTHUMT00000195029.1	87	0.00	0	C	NM_001389		41719621	41719621	-1	no_errors	ENST00000400454	ensembl	human	known	69_37n	missense	39	39.06	25	SNP	1.000	G
ECEL1	9427	genome.wustl.edu	37	2	233349542	233349542	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:233349542G>A	ENST00000304546.1	-	5	1238	c.1028C>T	c.(1027-1029)aCg>aTg	p.T343M	ECEL1_ENST00000409941.1_Missense_Mutation_p.T343M	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	343					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CTGCCCCAGCGTCACCTTGTT	0.602																																						dbGAP											0													129.0	113.0	119.0					2																	233349542		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1028C>T	2.37:g.233349542G>A	ENSP00000302051:p.Thr343Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.T343M	ENST00000304546.1	37	c.1028	CCDS2493.1	2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.151219	0.78001	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	D;D	0.84370	-1.84;-1.84	5.07	5.07	0.68467	Peptidase M13 (1);	0.050546	0.85682	D	0.000000	D	0.91988	0.7462	M	0.72353	2.195	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.97;0.99	D	0.92769	0.6230	10	0.87932	D	0	-14.7002	18.8289	0.92130	0.0:0.0:1.0:0.0	.	343;343	O95672-2;O95672	.;ECEL1_HUMAN	M	343	ENSP00000302051:T343M;ENSP00000386333:T343M	ENSP00000302051:T343M	T	-	2	0	ECEL1	233057786	1.000000	0.71417	0.984000	0.44739	0.803000	0.45373	5.267000	0.65530	2.513000	0.84729	0.563000	0.77884	ACG	ECEL1	-	pfam_Peptidase_M13_N	ENSG00000171551		0.602	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECEL1	HGNC	protein_coding	OTTHUMT00000257039.2	58	0.00	0	G	NM_004826		233349542	233349542	-1	no_errors	ENST00000304546	ensembl	human	known	69_37n	missense	47	26.15	17	SNP	0.998	A
EFR3A	23167	genome.wustl.edu	37	8	133023110	133023110	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr8:133023110G>C	ENST00000254624.5	+	23	2659	c.2434G>C	c.(2434-2436)Gag>Cag	p.E812Q	EFR3A_ENST00000519656.1_Missense_Mutation_p.E776Q|EFR3A_ENST00000521940.1_3'UTR|EFR3A_ENST00000334503.4_Missense_Mutation_p.E812Q	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	812						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			CCCAGTCTATGAGATGAAGTT	0.433																																						dbGAP											0													148.0	121.0	130.0					8																	133023110		2203	4299	6502	-	-	-	SO:0001583	missense	0			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.2434G>C	8.37:g.133023110G>C	ENSP00000254624:p.Glu812Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E812Q	ENST00000254624.5	37	c.2434	CCDS34942.2	8	.	.	.	.	.	.	.	.	.	.	G	32	5.120801	0.94385	.	.	ENSG00000132294	ENST00000254624;ENST00000407309;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T	0.50548	0.75;0.75;0.74	6.02	6.02	0.97574	.	0.204184	0.50627	D	0.000119	T	0.71169	0.3308	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.72100	-0.4392	10	0.87932	D	0	-9.0619	19.5254	0.95203	0.0:0.0:1.0:0.0	.	812	Q14156	EFR3A_HUMAN	Q	812;191;768;812;776	ENSP00000254624:E812Q;ENSP00000334769:E812Q;ENSP00000428086:E776Q	ENSP00000254624:E812Q	E	+	1	0	EFR3A	133092292	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.209000	0.95087	2.857000	0.98124	0.650000	0.86243	GAG	EFR3A	-	NULL	ENSG00000132294		0.433	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	109	0.00	0	G	NM_015137		133023110	133023110	+1	no_errors	ENST00000254624	ensembl	human	known	69_37n	missense	114	15.56	21	SNP	1.000	C
EIF2S3	1968	genome.wustl.edu	37	X	24082437	24082437	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:24082437G>A	ENST00000253039.4	+	7	1010	c.757G>A	c.(757-759)Gag>Aag	p.E253K		NM_001415.3	NP_001406.1	P41091	IF2G_HUMAN	eukaryotic translation initiation factor 2, subunit 3 gamma, 52kDa	253					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|GTP catabolic process (GO:0006184)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(4)|ovary(1)	12						CTTTACTTCAGAGCCCCGGCT	0.363																																						dbGAP											0													116.0	121.0	120.0					X																	24082437		2202	4298	6500	-	-	-	SO:0001583	missense	0			L19161	CCDS14210.1	Xp22.2-p22.1	2008-07-31	2002-08-29		ENSG00000130741	ENSG00000130741			3267	protein-coding gene	gene with protein product	"""eukaryotic translation initiation factor 2G"""	300161	"""eukaryotic translation initiation factor 2, subunit 3 (gamma, 52kD)"""	EIF2G		8106381, 9736774	Standard	NM_001415		Approved	EIF2gamma, EIF2	uc004dbc.3	P41091	OTTHUMG00000021262	ENST00000253039.4:c.757G>A	X.37:g.24082437G>A	ENSP00000253039:p.Glu253Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BTZ4	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_TIF2_gsu_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Transl_elong_EF1A/Init_IF2_C,prints_ProtSyn_GTP-bd	p.E253K	ENST00000253039.4	37	c.757	CCDS14210.1	X	.	.	.	.	.	.	.	.	.	.	G	18.52	3.642552	0.67244	.	.	ENSG00000130741	ENST00000253039	T	0.61859	0.07	5.11	5.11	0.69529	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.52709	0.1751	L	0.45051	1.395	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.49153	-0.8969	10	0.45353	T	0.12	.	17.9593	0.89079	0.0:0.0:1.0:0.0	.	253	P41091	IF2G_HUMAN	K	253	ENSP00000253039:E253K	ENSP00000253039:E253K	E	+	1	0	EIF2S3	23992358	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.386000	0.97228	2.262000	0.75019	0.600000	0.82982	GAG	EIF2S3	-	superfamily_Transl_elong_init/rib_B-barrel	ENSG00000130741		0.363	EIF2S3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S3	HGNC	protein_coding	OTTHUMT00000056079.1	69	0.00	0	G	NM_001415		24082437	24082437	+1	no_errors	ENST00000253039	ensembl	human	known	69_37n	missense	37	46.38	32	SNP	1.000	A
ENKUR	219670	genome.wustl.edu	37	10	25288342	25288342	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr10:25288342delT	ENST00000331161.4	-	2	430	c.211delA	c.(211-213)actfs	p.T71fs	ENKUR_ENST00000376363.1_Frame_Shift_Del_p.T71fs	NM_145010.3	NP_659447.1	Q8TC29	ENKUR_HUMAN	enkurin, TRPC channel interacting protein	71						motile cilium (GO:0031514)				endometrium(2)|large_intestine(4)|lung(3)|skin(1)	10						GGTGGTAGAGTTTTTTCCTTT	0.308																																						dbGAP											0													86.0	76.0	79.0					10																	25288342		2201	4298	6499	-	-	-	SO:0001589	frameshift_variant	0			AK095021	CCDS7146.1, CCDS73075.1	10p12.31	2014-08-13	2009-04-28	2009-04-28	ENSG00000151023	ENSG00000151023			28388	protein-coding gene	gene with protein product		611025	"""chromosome 10 open reading frame 63"""	C10orf63		17217053, 15385169	Standard	NM_145010		Approved	MGC26778, enkurin, CFAP106	uc001isg.2	Q8TC29	OTTHUMG00000017827	ENST00000331161.4:c.211delA	10.37:g.25288342delT	ENSP00000331044:p.Thr71fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Y0|D3DRV2	Frame_Shift_Del	DEL	NULL	p.T71fs	ENST00000331161.4	37	c.211	CCDS7146.1	10																																																																																			ENKUR	-	NULL	ENSG00000151023		0.308	ENKUR-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENKUR	HGNC	protein_coding	OTTHUMT00000047239.2	130	0.00	0	T	NM_145010		25288342	25288342	-1	no_errors	ENST00000331161	ensembl	human	known	69_37n	frame_shift_del	73	17.98	16	DEL	0.000	-
ENTPD4	9583	genome.wustl.edu	37	8	23299120	23299120	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr8:23299120C>T	ENST00000358689.4	-	8	1079	c.844G>A	c.(844-846)Gaa>Aaa	p.E282K	ENTPD4_ENST00000417069.2_Missense_Mutation_p.E282K|ENTPD4_ENST00000356206.6_Missense_Mutation_p.E282K	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	282					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		TTGGGGACTTCGTACGCTATC	0.473																																						dbGAP											0													130.0	117.0	121.0					8																	23299120		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.844G>A	8.37:g.23299120C>T	ENSP00000351520:p.Glu282Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSS3|O15092	Missense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.E282K	ENST00000358689.4	37	c.844	CCDS6041.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.479245	0.96307	.	.	ENSG00000197217	ENST00000356206;ENST00000358689;ENST00000417069	T;T;T	0.12465	2.68;2.68;2.68	5.63	5.63	0.86233	.	0.149736	0.64402	D	0.000007	T	0.43233	0.1238	M	0.83953	2.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.76071	0.985;0.987;0.975	T	0.38286	-0.9668	10	0.66056	D	0.02	-22.513	18.2416	0.89969	0.0:1.0:0.0:0.0	.	282;282;282	Q8NE73;Q9Y227-2;Q9Y227	.;.;ENTP4_HUMAN	K	282	ENSP00000348536:E282K;ENSP00000351520:E282K;ENSP00000408573:E282K	ENSP00000348536:E282K	E	-	1	0	ENTPD4	23355065	1.000000	0.71417	0.979000	0.43373	0.987000	0.75469	7.729000	0.84864	2.663000	0.90544	0.655000	0.94253	GAA	ENTPD4	-	pfam_GDA1_CD39_NTPase	ENSG00000197217		0.473	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	HGNC	protein_coding	OTTHUMT00000215142.1	43	0.00	0	C	NM_004901		23299120	23299120	-1	no_errors	ENST00000358689	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	T
ETV7	51513	genome.wustl.edu	37	6	36343650	36343650	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr6:36343650G>C	ENST00000340181.4	-	3	546	c.305C>G	c.(304-306)tCa>tGa	p.S102*	ETV7_ENST00000339796.5_Nonsense_Mutation_p.S102*|ETV7_ENST00000538992.1_Intron|ETV7_ENST00000373738.1_Intron|ETV7_ENST00000373737.4_Nonsense_Mutation_p.S102*	NM_001207037.1|NM_001207040.1|NM_016135.3	NP_001193966.1|NP_001193969.1|NP_057219.1	Q9Y603	ETV7_HUMAN	ets variant 7	102	PNT. {ECO:0000255|PROSITE- ProRule:PRU00762}.				cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(4)	10						TCCCTGACCTGAGCTGGGCGC	0.657																																						dbGAP											0													110.0	104.0	106.0					6																	36343650		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF116508	CCDS4819.1, CCDS56422.1, CCDS56423.1, CCDS56424.1, CCDS56425.1, CCDS75440.1, CCDS75441.1	6p21	2008-09-12	2008-09-12		ENSG00000010030	ENSG00000010030			18160	protein-coding gene	gene with protein product	"""TEL2 oncogene"""	605255	"""ets variant gene 7 (TEL2 oncogene)"""			10828014, 11108721	Standard	NM_016135		Approved	TEL2, TEL-2	uc003omb.3	Q9Y603	OTTHUMG00000014594	ENST00000340181.4:c.305C>G	6.37:g.36343650G>C	ENSP00000341843:p.Ser102*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVC2|B4DVB6|B4E1G4|Q5R3L3|Q5R3L4|Q9NZ65|Q9NZ66|Q9NZ68|Q9NZR8|Q9UNJ7|Q9Y5K4|Q9Y604	Nonsense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.S102*	ENST00000340181.4	37	c.305	CCDS4819.1	6	.	.	.	.	.	.	.	.	.	.	G	36	5.959937	0.97145	.	.	ENSG00000010030	ENST00000339796;ENST00000340181;ENST00000373737	.	.	.	3.38	3.38	0.38709	.	0.178894	0.38897	U	0.001526	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	.	14.355	0.66730	0.0:0.0:1.0:0.0	.	.	.	.	X	102	.	ENSP00000342260:S102X	S	-	2	0	ETV7	36451628	1.000000	0.71417	0.709000	0.30452	0.124000	0.20399	8.840000	0.92125	1.449000	0.47699	0.585000	0.79938	TCA	ETV7	-	pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom	ENSG00000010030		0.657	ETV7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ETV7	HGNC	protein_coding	OTTHUMT00000040341.1	33	0.00	0	G	NM_016135		36343650	36343650	-1	no_errors	ENST00000340181	ensembl	human	known	69_37n	nonsense	36	12.20	5	SNP	1.000	C
FKBP15	23307	genome.wustl.edu	37	9	115932000	115932000	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr9:115932000G>A	ENST00000238256.3	-	26	3106	c.2989C>T	c.(2989-2991)Cag>Tag	p.Q997*		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	997					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						GTGAGGGCCTGAGGAGGCAAC	0.587																																						dbGAP											0													48.0	52.0	51.0					9																	115932000		2068	4201	6269	-	-	-	SO:0001587	stop_gained	0			AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.2989C>T	9.37:g.115932000G>A	ENSP00000238256:p.Gln997*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Nonsense_Mutation	SNP	pfam_PPIase_FKBP_dom,superfamily_Regulat_G_prot_signal_superfam,pfscan_PPIase_FKBP_dom	p.Q997*	ENST00000238256.3	37	c.2989	CCDS48007.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.878093	0.97055	.	.	ENSG00000119321	ENST00000446284;ENST00000238256	.	.	.	3.79	2.84	0.33178	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-1.3223	9.0456	0.36345	0.0:0.2257:0.7743:0.0	.	.	.	.	X	1022;997	.	ENSP00000238256:Q997X	Q	-	1	0	FKBP15	114971821	0.969000	0.33509	0.202000	0.23494	0.023000	0.10783	2.266000	0.43320	1.110000	0.41699	0.491000	0.48974	CAG	FKBP15	-	NULL	ENSG00000119321		0.587	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP15	HGNC	protein_coding		48	0.00	0	G	NM_015258		115932000	115932000	-1	no_errors	ENST00000238256	ensembl	human	known	69_37n	nonsense	54	10.00	6	SNP	0.122	A
FUCA2	2519	genome.wustl.edu	37	6	143828431	143828431	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr6:143828431C>T	ENST00000002165.6	-	2	410	c.355G>A	c.(355-357)Gat>Aat	p.D119N	RP1-20N2.6_ENST00000593175.1_RNA|RP1-20N2.6_ENST00000591892.1_RNA|RP1-20N2.6_ENST00000590703.1_RNA|RP1-20N2.6_ENST00000589489.1_RNA|FUCA2_ENST00000438118.2_Missense_Mutation_p.D119N|RP1-20N2.6_ENST00000593045.1_RNA|RP1-20N2.6_ENST00000591189.1_RNA|RP1-20N2.6_ENST00000415586.1_RNA|RP1-20N2.6_ENST00000589563.1_RNA|FUCA2_ENST00000367585.1_5'UTR	NM_032020.4	NP_114409.2	Q9BTY2	FUCO2_HUMAN	fucosidase, alpha-L- 2, plasma	119					fucose metabolic process (GO:0006004)|glycoside catabolic process (GO:0016139)|regulation of entry of bacterium into host cell (GO:2000535)|response to bacterium (GO:0009617)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-L-fucosidase activity (GO:0004560)|fucose binding (GO:0042806)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				OV - Ovarian serous cystadenocarcinoma(155;7.45e-06)|GBM - Glioblastoma multiforme(68;0.0142)		TGAAAAATATCTGCCCACTGG	0.358																																						dbGAP											0													83.0	93.0	90.0					6																	143828431		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC003060	CCDS5200.1	6q24	2012-10-02			ENSG00000001036	ENSG00000001036	3.2.1.51		4008	protein-coding gene	gene with protein product		136820				6590153	Standard	NM_032020		Approved	MGC1314, dJ20N2.5	uc003qjm.3	Q9BTY2	OTTHUMG00000015728	ENST00000002165.6:c.355G>A	6.37:g.143828431C>T	ENSP00000002165:p.Asp119Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PEB6|Q7Z6V1|Q7Z6Y2|Q8NBK4	Missense_Mutation	SNP	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub,prints_Glyco_hydro_29_sub	p.D119N	ENST00000002165.6	37	c.355	CCDS5200.1	6	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554586	0.65425	.	.	ENSG00000001036	ENST00000002165;ENST00000438118;ENST00000367585	T;T;T	0.58210	0.35;0.35;0.35	5.21	4.3	0.51218	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.096661	0.64402	D	0.000001	T	0.36193	0.0958	M	0.62088	1.915	0.54753	D	0.999987	B	0.31227	0.314	B	0.34242	0.178	T	0.35525	-0.9785	10	0.40728	T	0.16	-25.1427	9.545	0.39275	0.0:0.7823:0.143:0.0747	.	119	Q9BTY2	FUCO2_HUMAN	N	119	ENSP00000002165:D119N;ENSP00000394151:D119N;ENSP00000356557:D119N	ENSP00000002165:D119N	D	-	1	0	FUCA2	143870124	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.688000	0.54699	2.698000	0.92095	0.655000	0.94253	GAT	FUCA2	-	pfam_Glyco_hydro_29,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_29,pirsf_Glyco_hydro_29_sub	ENSG00000001036		0.358	FUCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUCA2	HGNC	protein_coding	OTTHUMT00000042521.2	81	0.00	0	C	NM_032020		143828431	143828431	-1	no_errors	ENST00000002165	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	1.000	T
GNB1L	54584	genome.wustl.edu	37	22	19794230	19794230	+	Silent	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr22:19794230C>G	ENST00000329517.6	-	6	704	c.468G>C	c.(466-468)ccG>ccC	p.P156P	GNB1L_ENST00000403325.1_Silent_p.P156P|GNB1L_ENST00000460402.1_5'UTR|GNB1L_ENST00000405009.1_Silent_p.P156P	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	156					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					CATCTGCCTTCGGCTTCAGGG	0.622																																						dbGAP											0													52.0	42.0	46.0					22																	19794230		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.468G>C	22.37:g.19794230C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H2S2|Q9H4M4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P156	ENST00000329517.6	37	c.468	CCDS13768.1	22																																																																																			GNB1L	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000185838		0.622	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB1L	HGNC	protein_coding	OTTHUMT00000075202.1	19	0.00	0	C			19794230	19794230	-1	no_errors	ENST00000329517	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.958	G
GNB2L1	10399	genome.wustl.edu	37	5	180666577	180666577	+	Silent	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr5:180666577C>T	ENST00000512805.1	-	4	843	c.435G>A	c.(433-435)gaG>gaA	p.E145E	GNB2L1_ENST00000376817.4_Silent_p.E101E|GNB2L1_ENST00000511900.1_Silent_p.E97E|GNB2L1_ENST00000514455.1_5'Flank|GNB2L1_ENST00000504726.1_Intron|GNB2L1_ENST00000511566.1_Silent_p.E145E|GNB2L1_ENST00000505461.1_5'Flank|SNORD96A_ENST00000606577.1_RNA	NM_006098.4	NP_006089.1	P63244	GBLP_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 2-like 1	145					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|cell cycle (GO:0007049)|gastrulation (GO:0007369)|negative regulation of cell growth (GO:0030308)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron death (GO:1903208)|negative regulation of phagocytosis (GO:0050765)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein tyrosine kinase activity (GO:0061099)|negative regulation of translation (GO:0017148)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cAMP catabolic process (GO:0030822)|positive regulation of cell migration (GO:0030335)|positive regulation of cyclic-nucleotide phosphodiesterase activity (GO:0051343)|positive regulation of gastrulation (GO:2000543)|positive regulation of GTPase activity (GO:0043547)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein phosphorylation (GO:0001934)|regulation of cell cycle (GO:0051726)|regulation of cell division (GO:0051302)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|regulation of protein localization (GO:0032880)|rhythmic process (GO:0048511)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|midbody (GO:0030496)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|phagocytic cup (GO:0001891)|small ribosomal subunit (GO:0015935)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|ion channel inhibitor activity (GO:0008200)|poly(A) RNA binding (GO:0044822)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase inhibitor activity (GO:0030292)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)			lung(3)|skin(2)	5	all_cancers(89;8.79e-06)|all_epithelial(37;1.13e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0654)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.101)|all cancers(165;0.11)		CTGAGTGGCTCTCATCCTACA	0.542																																						dbGAP											0													96.0	95.0	95.0					5																	180666577		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M24194	CCDS34324.1	5q35.3	2013-01-10				ENSG00000204628		"""WD repeat domain containing"""	4399	protein-coding gene	gene with protein product	"""Receptor for Activated C Kinase 1"""	176981				8302854, 2499885	Standard	NM_006098		Approved	Gnb2-rs1, RACK1, H12.3	uc003mni.1	P63244		ENST00000512805.1:c.435G>A	5.37:g.180666577C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTJ0|D3DWS0|P25388|P99049|Q53HU2|Q5J8M6|Q5VLR4|Q6FH47	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E52K	ENST00000512805.1	37	c.154	CCDS34324.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.838|9.838	1.190336|1.190336	0.21954|0.21954	.|.	.|.	ENSG00000204628|ENSG00000204628	ENST00000502905;ENST00000504128|ENST00000507756;ENST00000509535	T;T|.	0.59772|.	0.24;0.24|.	5.9|5.9	4.13|4.13	0.48395|0.48395	.|.	0.088222|.	0.85682|.	D|.	0.000000|.	T|T	0.58119|0.58119	0.2100|0.2100	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.53620|0.53620	-0.8413|-0.8413	7|4	0.11794|.	T|.	0.64|.	-34.7877|-34.7877	7.9518|7.9518	0.30019|0.30019	0.0:0.754:0.0:0.246|0.0:0.754:0.0:0.246	.|.	.|.	.|.	.|.	K|K	63;52|76;3	ENSP00000426960:E63K;ENSP00000427677:E52K|.	ENSP00000426960:E63K|.	E|R	-|-	1|2	0|0	GNB2L1|GNB2L1	180599183|180599183	0.970000|0.970000	0.33590|0.33590	1.000000|1.000000	0.80357|0.80357	0.960000|0.960000	0.62799|0.62799	0.146000|0.146000	0.16180|0.16180	0.839000|0.839000	0.34971|0.34971	0.591000|0.591000	0.81541|0.81541	GAG|AGA	GNB2L1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000204628		0.542	GNB2L1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	GNB2L1	HGNC	protein_coding	OTTHUMT00000372943.2	20	0.00	0	C	NM_006098		180666577	180666577	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000504128	ensembl	human	putative	69_37n	missense	28	22.22	8	SNP	1.000	T
GNS	2799	genome.wustl.edu	37	12	65122796	65122796	+	Silent	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr12:65122796G>A	ENST00000258145.3	-	10	1310	c.1140C>T	c.(1138-1140)gaC>gaT	p.D380D	GNS_ENST00000542058.1_Silent_p.D360D|GNS_ENST00000418919.2_Silent_p.D324D|GNS_ENST00000543646.1_Silent_p.D412D	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	380					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		AGCCAGCAATGTCCAAAATAG	0.453																																						dbGAP											0													170.0	134.0	147.0					12																	65122796		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.1140C>T	12.37:g.65122796G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYH8|Q53F05	Silent	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	p.D380	ENST00000258145.3	37	c.1140	CCDS8970.1	12																																																																																			GNS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	ENSG00000135677		0.453	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GNS	HGNC	protein_coding	OTTHUMT00000401195.2	89	0.00	0	G			65122796	65122796	-1	no_errors	ENST00000258145	ensembl	human	known	69_37n	silent	91	16.51	18	SNP	1.000	A
GUCY2F	2986	genome.wustl.edu	37	X	108652304	108652304	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:108652304C>T	ENST00000218006.2	-	9	2176	c.1885G>A	c.(1885-1887)Ggg>Agg	p.G629R		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	629	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TCTAGGCTCCCTCGGGAACAG	0.403																																						dbGAP											0													166.0	142.0	150.0					X																	108652304		2203	4300	6503	-	-	-	SO:0001583	missense	0			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.1885G>A	X.37:g.108652304C>T	ENSP00000218006:p.Gly629Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJF1	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Haem_no_assoc-bd,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.G629R	ENST00000218006.2	37	c.1885	CCDS14545.1	X	.	.	.	.	.	.	.	.	.	.	C	16.15	3.040579	0.55003	.	.	ENSG00000101890	ENST00000218006	D	0.89939	-2.59	5.05	0.27	0.15635	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.103263	0.64402	N	0.000003	D	0.92570	0.7640	M	0.93939	3.475	0.44061	D	0.9968	B	0.27316	0.175	B	0.43155	0.41	D	0.89171	0.3537	10	0.62326	D	0.03	.	8.1053	0.30881	0.0:0.5442:0.0:0.4558	.	629	P51841	GUC2F_HUMAN	R	629	ENSP00000218006:G629R	ENSP00000218006:G629R	G	-	1	0	GUCY2F	108538960	0.996000	0.38824	0.935000	0.37517	0.977000	0.68977	3.113000	0.50376	0.049000	0.15920	-0.340000	0.08031	GGG	GUCY2F	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000101890		0.403	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2F	HGNC	protein_coding	OTTHUMT00000057884.1	120	0.00	0	C	NM_001522		108652304	108652304	-1	no_errors	ENST00000218006	ensembl	human	known	69_37n	missense	68	18.07	15	SNP	1.000	T
HNRNPR	10236	genome.wustl.edu	37	1	23648158	23648158	+	Splice_Site	SNP	T	T	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr1:23648158T>C	ENST00000374612.1	-	7	799		c.e7-2		HNRNPR_ENST00000478691.1_Splice_Site|HNRNPR_ENST00000426846.2_Splice_Site|HNRNPR_ENST00000606561.1_Splice_Site|HNRNPR_ENST00000427764.2_Splice_Site|HNRNPR_ENST00000302271.6_Splice_Site|HNRNPR_ENST00000374616.3_Splice_Site	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R						gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		GCTGTCACACTGCAATAAGAA	0.413																																						dbGAP											0													93.0	98.0	96.0					1																	23648158		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.676-2A>G	1.37:g.23648158T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	Splice_Site	SNP	-	e6-2	ENST00000374612.1	37	c.676-2	CCDS232.1	1	.	.	.	.	.	.	.	.	.	.	T	21.2	4.117943	0.77323	.	.	ENSG00000125944	ENST00000374616;ENST00000374612;ENST00000302271;ENST00000427764;ENST00000426846	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5936	0.61975	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	HNRNPR	23520745	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.872000	0.87187	1.967000	0.57214	0.459000	0.35465	.	HNRNPR	-	-	ENSG00000125944		0.413	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	HGNC	protein_coding	OTTHUMT00000008889.1	81	0.00	0	T	NM_005826	Intron	23648158	23648158	-1	no_errors	ENST00000374616	ensembl	human	known	69_37n	splice_site	54	14.29	9	SNP	1.000	C
IQUB	154865	genome.wustl.edu	37	7	123097473	123097473	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr7:123097473C>A	ENST00000466202.1	-	12	2731	c.2155G>T	c.(2155-2157)Gaa>Taa	p.E719*	RNU6-296P_ENST00000384608.1_RNA|IQUB_ENST00000324698.6_Nonsense_Mutation_p.E719*|RP11-332K15.1_ENST00000419832.1_RNA	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	719					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						GCAGCTGCTTCATCTTTGGTA	0.403																																						dbGAP											0													104.0	107.0	106.0					7																	123097473		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.2155G>T	7.37:g.123097473C>A	ENSP00000417769:p.Glu719*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Nonsense_Mutation	SNP	pfam_Ubiquitin,pfscan_Ubiquitin_supergroup	p.E719*	ENST00000466202.1	37	c.2155	CCDS5787.1	7	.	.	.	.	.	.	.	.	.	.	C	41	8.930180	0.99006	.	.	ENSG00000164675	ENST00000466202;ENST00000324698	.	.	.	5.83	5.83	0.93111	.	0.044586	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.1127	0.97915	0.0:1.0:0.0:0.0	.	.	.	.	X	719	.	ENSP00000324882:E719X	E	-	1	0	IQUB	122884709	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.180000	0.77674	2.755000	0.94549	0.637000	0.83480	GAA	IQUB	-	NULL	ENSG00000164675		0.403	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IQUB	HGNC	protein_coding	OTTHUMT00000348529.1	75	0.00	0	C	NM_178827		123097473	123097473	-1	no_errors	ENST00000324698	ensembl	human	known	69_37n	nonsense	32	37.25	19	SNP	1.000	A
ITM2A	9452	genome.wustl.edu	37	X	78619023	78619023	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:78619023T>A	ENST00000373298.2	-	2	283	c.140A>T	c.(139-141)gAg>gTg	p.E47V	ITM2A_ENST00000434584.2_Intron|ITM2A_ENST00000469541.1_5'UTR	NM_004867.4	NP_004858.1	O43736	ITM2A_HUMAN	integral membrane protein 2A	47						integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	18						AGAGGAGCCCTCTTTTTCCTG	0.413																																						dbGAP											0													48.0	43.0	45.0					X																	78619023		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC034485	CCDS14444.1, CCDS55455.1	Xq13.3-q21.2	2012-10-10			ENSG00000078596	ENSG00000078596		"""BRICHOS domain containing"""	6173	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2A"""	300222				9892734, 8702637	Standard	NM_004867		Approved	BRICD2A, E25A	uc004edh.3	O43736	OTTHUMG00000021900	ENST00000373298.2:c.140A>T	X.37:g.78619023T>A	ENSP00000362395:p.Glu47Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7X5|B4E062|Q6IBC9	Missense_Mutation	SNP	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	p.E47V	ENST00000373298.2	37	c.140	CCDS14444.1	X	.	.	.	.	.	.	.	.	.	.	T	9.829	1.187829	0.21954	.	.	ENSG00000078596	ENST00000373298	T	0.25085	1.82	3.57	2.34	0.29019	.	0.115412	0.56097	D	0.000025	T	0.18676	0.0448	L	0.34521	1.04	0.80722	D	1	B	0.18741	0.03	B	0.19946	0.027	T	0.05194	-1.0900	10	0.72032	D	0.01	-17.6548	8.6047	0.33767	0.0:0.0:0.1922:0.8078	.	47	O43736	ITM2A_HUMAN	V	47	ENSP00000362395:E47V	ENSP00000362395:E47V	E	-	2	0	ITM2A	78505679	0.995000	0.38212	0.337000	0.25536	0.919000	0.55068	2.165000	0.42396	0.349000	0.23975	0.339000	0.21740	GAG	ITM2A	-	NULL	ENSG00000078596		0.413	ITM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITM2A	HGNC	protein_coding	OTTHUMT00000057329.1	43	0.00	0	T	NM_004867		78619023	78619023	-1	no_errors	ENST00000373298	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.822	A
KDM5B	10765	genome.wustl.edu	37	1	202736181	202736181	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr1:202736181T>C	ENST00000367265.3	-	5	1748	c.584A>G	c.(583-585)cAg>cGg	p.Q195R	KDM5B_ENST00000367264.2_Missense_Mutation_p.Q195R	NM_006618.3	NP_006609.3	Q9UGL1	KDM5B_HUMAN	lysine (K)-specific demethylase 5B	195					histone H3-K4 demethylation (GO:0034720)|histone H3-K4 demethylation, trimethyl-H3-K4-specific (GO:0034721)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-dimethyl-K4 specific) (GO:0034648)|histone demethylase activity (H3-trimethyl-K4 specific) (GO:0034647)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(2)|ovary(2)|skin(1)|urinary_tract(1)	6						GTTTGGCTTCTGCAAACACTA	0.443																																						dbGAP											0													150.0	140.0	143.0					1																	202736181		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ243706	CCDS30974.1	1q32.1	2014-06-12	2009-04-06	2009-04-06	ENSG00000117139	ENSG00000117139		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	18039	protein-coding gene	gene with protein product	"""cancer/testis antigen 31"", ""protein phosphatase 1, regulatory subunit 98"""	605393	"""Jumonji, AT rich interactive domain 1B (RBP2-like)"", ""jumonji, AT rich interactive domain 1B"""	JARID1B		11483573, 11478881	Standard	NM_006618		Approved	RBBP2H1A, PLU-1, CT31, PPP1R98	uc001gyf.3	Q9UGL1	OTTHUMG00000041401	ENST00000367265.3:c.584A>G	1.37:g.202736181T>C	ENSP00000356234:p.Gln195Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O95811|Q15752|Q9Y3Q5	Missense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.Q195R	ENST00000367265.3	37	c.584	CCDS30974.1	1	.	.	.	.	.	.	.	.	.	.	T	15.91	2.971725	0.53614	.	.	ENSG00000117139	ENST00000367265;ENST00000538292;ENST00000367264;ENST00000235790	D;D;D	0.85773	-1.91;-1.75;-2.03	5.65	5.65	0.86999	ARID/BRIGHT DNA-binding domain (1);	0.109140	0.64402	D	0.000006	T	0.81336	0.4801	L	0.38531	1.155	0.48901	D	0.999726	B;B	0.22541	0.071;0.002	B;B	0.27500	0.08;0.032	T	0.77861	-0.2430	10	0.51188	T	0.08	-21.9832	16.1778	0.81874	0.0:0.0:0.0:1.0	.	195;195	Q9UGL1-2;Q9UGL1	.;KDM5B_HUMAN	R	195;37;195;37	ENSP00000356234:Q195R;ENSP00000356233:Q195R;ENSP00000235790:Q37R	ENSP00000235790:Q37R	Q	-	2	0	KDM5B	201002804	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.986000	0.56937	2.279000	0.76181	0.533000	0.62120	CAG	KDM5B	-	superfamily_ARID/BRIGHT_DNA-bd	ENSG00000117139		0.443	KDM5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5B	HGNC	protein_coding	OTTHUMT00000099184.2	110	0.00	0	T	NM_006618		202736181	202736181	-1	no_errors	ENST00000367265	ensembl	human	known	69_37n	missense	111	24.49	36	SNP	1.000	C
GLTSCR1L	23506	genome.wustl.edu	37	6	42797254	42797254	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr6:42797254C>A	ENST00000314073.5	+	6	1359	c.1183C>A	c.(1183-1185)Cac>Aac	p.H395N	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.H395N			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	395																	GGGCCAACCTCACGCACCCCA	0.483																																						dbGAP											0													228.0	236.0	233.0					6																	42797254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1183C>A	6.37:g.42797254C>A	ENSP00000313933:p.His395Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	NULL	p.H395N	ENST00000314073.5	37	c.1183	CCDS34451.1	6	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890192	0.33348	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.34275	1.37;1.37	5.61	5.61	0.85477	.	0.000000	0.64402	D	0.000001	T	0.40448	0.1117	L	0.41236	1.265	0.48452	D	0.99965	D;B;B	0.61080	0.989;0.42;0.42	D;B;B	0.72982	0.979;0.255;0.255	T	0.03077	-1.1075	10	0.12766	T	0.61	-20.1172	20.0018	0.97417	0.0:1.0:0.0:0.0	.	395;395;395	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	N	395	ENSP00000313933:H395N;ENSP00000377723:H395N	ENSP00000313933:H395N	H	+	1	0	KIAA0240	42905232	1.000000	0.71417	0.997000	0.53966	0.835000	0.47333	5.006000	0.63978	2.793000	0.96121	0.655000	0.94253	CAC	KIAA0240	-	NULL	ENSG00000112624		0.483	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0240	HGNC	protein_coding	OTTHUMT00000040562.3	72	0.00	0	C	NM_015349		42797254	42797254	+1	no_errors	ENST00000314073	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	1.000	A
KNTC1	9735	genome.wustl.edu	37	12	123068876	123068876	+	Silent	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr12:123068876G>C	ENST00000333479.7	+	35	3492	c.3315G>C	c.(3313-3315)ctG>ctC	p.L1105L	KNTC1_ENST00000450485.2_Intron	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1105					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		TGCTATTTCTGACATGTCAGA	0.413																																						dbGAP											0													172.0	163.0	165.0					12																	123068876		1920	4134	6054	-	-	-	SO:0001819	synonymous_variant	0				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.3315G>C	12.37:g.123068876G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C4|B3KSG2	Silent	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.L1105	ENST00000333479.7	37	c.3315	CCDS45002.1	12																																																																																			KNTC1	-	NULL	ENSG00000184445		0.413	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	90	0.00	0	G			123068876	123068876	+1	no_errors	ENST00000333479	ensembl	human	known	69_37n	silent	50	38.27	31	SNP	0.023	C
LAMB2	3913	genome.wustl.edu	37	3	49163484	49163484	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr3:49163484G>T	ENST00000418109.1	-	18	2424	c.2260C>A	c.(2260-2262)Ctg>Atg	p.L754M	LAMB2_ENST00000464891.1_5'Flank|LAMB2_ENST00000305544.4_Missense_Mutation_p.L754M	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	754	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CTGGGCACCAGACCCTCCTCA	0.607																																						dbGAP											0													94.0	85.0	88.0					3																	49163484		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.2260C>A	3.37:g.49163484G>T	ENSP00000388325:p.Leu754Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16321	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.L754M	ENST00000418109.1	37	c.2260	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689137	0.29962	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	T;T	0.36520	1.25;1.25	5.67	2.82	0.32997	Laminin IV (1);	0.349614	0.28290	N	0.015898	T	0.24198	0.0586	L	0.28556	0.865	0.35661	D	0.812507	B	0.29805	0.257	B	0.28465	0.09	T	0.21348	-1.0248	10	0.33940	T	0.23	.	9.5906	0.39543	0.2337:0.0:0.7663:0.0	.	754	P55268	LAMB2_HUMAN	M	754	ENSP00000388325:L754M;ENSP00000307156:L754M	ENSP00000307156:L754M	L	-	1	2	LAMB2	49138488	0.099000	0.21834	0.694000	0.30210	0.823000	0.46562	0.576000	0.23744	0.711000	0.32018	0.655000	0.94253	CTG	LAMB2	-	pfscan_Laminin_IV	ENSG00000172037		0.607	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	61	0.00	0	G	NM_002292		49163484	49163484	-1	no_errors	ENST00000305544	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.926	T
LBX2	85474	genome.wustl.edu	37	2	74725249	74725249	+	Silent	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:74725249C>T	ENST00000377566.4	-	2	580	c.402G>A	c.(400-402)caG>caA	p.Q134Q	LBX2_ENST00000550249.1_5'UTR|AC005041.17_ENST00000479098.1_RNA|LBX2_ENST00000460508.3_Silent_p.Q130Q|LBX2_ENST00000341396.2_3'UTR	NM_001282430.1	NP_001269359.1	Q6XYB7	LBX2_HUMAN	ladybird homeobox 2	134					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)	4						CTCGCCGGTTCTGGAACCAAG	0.662																																						dbGAP											0													50.0	47.0	48.0					2																	74725249		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AC005041	CCDS33228.1, CCDS62938.1	2p13.1	2014-05-06	2007-02-15		ENSG00000179528	ENSG00000179528		"""Homeoboxes / ANTP class : NKL subclass"""	15525	protein-coding gene	gene with protein product		607164	"""ladybird homeobox homolog 2 (Drosophila)"""			11386758	Standard	NM_001282430		Approved		uc002slw.3	Q6XYB7	OTTHUMG00000170595	ENST00000377566.4:c.402G>A	2.37:g.74725249C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5Y8	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.Q134	ENST00000377566.4	37	c.402		2																																																																																			LBX2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000179528		0.662	LBX2-002	KNOWN	basic|appris_principal	protein_coding	LBX2	HGNC	protein_coding	OTTHUMT00000328490.1	12	0.00	0	C	NM_001009812		74725249	74725249	-1	no_errors	ENST00000377566	ensembl	human	known	69_37n	silent	14	26.32	5	SNP	1.000	T
LIFR	3977	genome.wustl.edu	37	5	38504178	38504178	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr5:38504178G>C	ENST00000263409.4	-	10	1499	c.1337C>G	c.(1336-1338)tCa>tGa	p.S446*	LIFR_ENST00000453190.2_Nonsense_Mutation_p.S446*|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	446	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)			NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AACAGCTGTTGAATTAATATC	0.284			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	0													55.0	60.0	58.0					5																	38504178		2202	4293	6495	-	-	-	SO:0001587	stop_gained	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.1337C>G	5.37:g.38504178G>C	ENSP00000263409:p.Ser446*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LCD9	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S446*	ENST00000263409.4	37	c.1337	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	G	39	7.340386	0.98221	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	.	.	.	5.65	5.65	0.86999	.	0.370903	0.26677	N	0.023064	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-16.044	18.2921	0.90134	0.0:0.0:1.0:0.0	.	.	.	.	X	446	.	ENSP00000263409:S446X	S	-	2	0	LIFR	38539935	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.952000	0.70282	2.649000	0.89929	0.650000	0.86243	TCA	LIFR	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000113594		0.284	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	42	0.00	0	G	NM_002310		38504178	38504178	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	nonsense	44	15.38	8	SNP	1.000	C
LILRB3	11025	genome.wustl.edu	37	19	54726628	54726628	+	Missense_Mutation	SNP	C	C	T	rs200758022	byFrequency	TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr19:54726628C>T	ENST00000391750.1	-	3	197	c.61G>A	c.(61-63)Gtg>Atg	p.V21M	LILRB3_ENST00000346401.6_Missense_Mutation_p.V21M|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000270464.5_Intron|LILRB3_ENST00000245620.9_Missense_Mutation_p.V21M|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRA6_ENST00000391735.3_Intron|LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000407860.2_Intron|LILRB3_ENST00000469273.1_5'Flank|LILRB3_ENST00000424807.1_Missense_Mutation_p.V21M			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	21			V -> M (in dbSNP:rs1132588).		cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		CCTGCCTGCACGCGGGTCCTG	0.657																																						dbGAP											0													2.0	2.0	2.0					19																	54726628		1163	2749	3912	-	-	-	SO:0001583	missense	0			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.61G>A	19.37:g.54726628C>T	ENSP00000375630:p.Val21Met	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V21M	ENST00000391750.1	37	c.61	CCDS33105.1	19	.	.	.	.	.	.	.	.	.	.	C	7.872	0.728256	0.15507	.	.	ENSG00000204577	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000445347	T;T;T;T;T	0.00522	7.06;7.06;7.02;7.05;6.84	2.9	0.662	0.17880	Immunoglobulin-like fold (1);	0.896200	0.09207	N	0.833786	T	0.00998	0.0033	M	0.71296	2.17	0.09310	N	1	D;P	0.67145	0.996;0.944	P;P	0.58620	0.842;0.606	T	0.50906	-0.8772	10	0.51188	T	0.08	.	4.0591	0.09831	0.0:0.6121:0.2464:0.1415	.	21;21	O75022;O75022-3	LIRB3_HUMAN;.	M	21	ENSP00000375630:V21M;ENSP00000412771:V21M;ENSP00000345184:V21M;ENSP00000245620:V21M;ENSP00000388199:V21M	ENSP00000245620:V21M	V	-	1	0	LILRB3	59418440	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.246000	0.08878	0.274000	0.22072	-0.241000	0.12123	GTG	LILRB3	-	NULL	ENSG00000204577		0.657	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB3	HGNC	protein_coding	OTTHUMT00000142844.5	42	0.00	0	C	NM_006864		54726628	54726628	-1	no_errors	ENST00000346401	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.000	T
LPAR4	2846	genome.wustl.edu	37	X	78010427	78010427	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:78010427A>T	ENST00000435339.3	+	2	447	c.61A>T	c.(61-63)Agg>Tgg	p.R21W		NM_005296.2	NP_005287.1	Q99677	LPAR4_HUMAN	lysophosphatidic acid receptor 4	21					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|lipid binding (GO:0008289)			breast(3)|endometrium(3)|kidney(4)|large_intestine(4)|lung(16)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	38						CCTCAGACCCAGGTTGGGCAA	0.433																																						dbGAP											0													171.0	147.0	155.0					X																	78010427		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90322	CCDS14441.1	Xq21.1	2012-08-08	2008-04-11	2008-04-11	ENSG00000147145	ENSG00000147145		"""GPCR / Class A : Lysophospholipid receptors : Lysophosphatidic acid"""	4478	protein-coding gene	gene with protein product		300086	"""G protein-coupled receptor 23"""	GPR23			Standard	NM_005296		Approved	P2Y9, P2Y5-LIKE, P2RY9, LPA4	uc010nme.3	Q99677	OTTHUMG00000021895	ENST00000435339.3:c.61A>T	X.37:g.78010427A>T	ENSP00000408205:p.Arg21Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAC7|O15132|Q502U9|Q6NSP5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2Y5_purnocptor,prints_P2_purnocptor	p.R21W	ENST00000435339.3	37	c.61	CCDS14441.1	X	.	.	.	.	.	.	.	.	.	.	A	11.85	1.763077	0.31228	.	.	ENSG00000147145	ENST00000435339;ENST00000373301	T;T	0.72051	-0.62;-0.62	4.32	1.86	0.25419	.	0.252388	0.27932	U	0.017267	T	0.36853	0.0982	N	0.08118	0	0.29259	N	0.871449	P	0.40834	0.73	B	0.25614	0.062	T	0.44467	-0.9326	10	0.66056	D	0.02	.	2.8864	0.05662	0.5887:0.263:0.1483:0.0	.	21	Q99677	LPAR4_HUMAN	W	21	ENSP00000408205:R21W;ENSP00000362398:R21W	ENSP00000362398:R21W	R	+	1	2	LPAR4	77897083	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.254000	0.43214	0.527000	0.28560	0.345000	0.21793	AGG	LPAR4	-	NULL	ENSG00000147145		0.433	LPAR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPAR4	HGNC	protein_coding	OTTHUMT00000057322.2	128	0.00	0	A	NM_005296		78010427	78010427	+1	no_errors	ENST00000373301	ensembl	human	known	69_37n	missense	77	31.25	35	SNP	0.998	T
LTK	4058	genome.wustl.edu	37	15	41804458	41804458	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr15:41804458G>A	ENST00000263800.6	-	4	461	c.365C>T	c.(364-366)tCa>tTa	p.S122L	LTK_ENST00000355166.5_Missense_Mutation_p.S122L|LTK_ENST00000453182.2_Missense_Mutation_p.S122L|LTK_ENST00000561619.1_Intron	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	122					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		TCCGTAGGCTGAGATCCTGCG	0.652										TSP Lung(18;0.14)																												dbGAP											0													23.0	29.0	27.0					15																	41804458		2203	4299	6502	-	-	-	SO:0001583	missense	0			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.365C>T	15.37:g.41804458G>A	ENSP00000263800:p.Ser122Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S122L	ENST00000263800.6	37	c.365	CCDS10077.1	15	.	.	.	.	.	.	.	.	.	.	G	34	5.352303	0.95830	.	.	ENSG00000062524	ENST00000360087;ENST00000355166;ENST00000263800;ENST00000453182	T;T;T	0.42900	0.96;0.96;0.96	4.18	4.18	0.49190	.	0.000000	0.30667	U	0.009139	T	0.61837	0.2379	M	0.68593	2.085	0.37850	D	0.929349	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.998;0.977	T	0.65524	-0.6147	10	0.35671	T	0.21	.	16.3122	0.82883	0.0:0.0:1.0:0.0	.	122;122;122	E9PFX4;P29376-4;P29376	.;.;LTK_HUMAN	L	122	ENSP00000347293:S122L;ENSP00000263800:S122L;ENSP00000392196:S122L	ENSP00000263800:S122L	S	-	2	0	LTK	39591750	1.000000	0.71417	0.999000	0.59377	0.958000	0.62258	5.707000	0.68370	2.160000	0.67779	0.561000	0.74099	TCA	LTK	-	NULL	ENSG00000062524		0.652	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2	20	0.00	0	G			41804458	41804458	-1	no_errors	ENST00000263800	ensembl	human	known	69_37n	missense	3	57.14	4	SNP	1.000	A
MAP1B	4131	genome.wustl.edu	37	5	71499538	71499538	+	Silent	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr5:71499538G>A	ENST00000296755.7	+	6	7459	c.7161G>A	c.(7159-7161)gtG>gtA	p.V2387V		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	2387	Mediates interaction with TMEM185A.				axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ACTACGTGGTGAGTGGGAATG	0.517																																					Melanoma(17;367 822 11631 31730 47712)	dbGAP											0													61.0	61.0	61.0					5																	71499538		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.7161G>A	5.37:g.71499538G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDK5	Silent	SNP	pfam_MAP1B_neuraxin	p.V2387	ENST00000296755.7	37	c.7161	CCDS4012.1	5																																																																																			MAP1B	-	NULL	ENSG00000131711		0.517	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	64	0.00	0	G	NM_005909		71499538	71499538	+1	no_errors	ENST00000296755	ensembl	human	known	69_37n	silent	58	12.12	8	SNP	1.000	A
MLX	6945	genome.wustl.edu	37	17	40722064	40722064	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr17:40722064G>C	ENST00000246912.4	+	7	756	c.703G>C	c.(703-705)Gac>Cac	p.D235H	MLX_ENST00000346833.4_Missense_Mutation_p.D151H|MLX_ENST00000435881.2_Missense_Mutation_p.D181H	NM_170607.2	NP_733752.1	Q9UH92	MLX_HUMAN	MLX, MAX dimerization protein	235					energy reserve metabolic process (GO:0006112)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|positive regulation of cellular metabolic process (GO:0031325)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(3)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	10		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		CCAGGTCTCTGACCAGGTCAA	0.552																																					GBM(121;657 1601 4665 24731 34640)	dbGAP											0													144.0	121.0	129.0					17																	40722064		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF213668	CCDS11430.1, CCDS42341.1, CCDS45687.1	17q21.1	2013-05-21	2012-11-15	2005-02-11		ENSG00000108788		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	11645	protein-coding gene	gene with protein product		602976	"""transcription factor-like 4"", ""MAX-like protein X"""	TCFL4		8973301	Standard	NM_170607		Approved	MAD7, MXD7, bHLHd13	uc002iag.3	Q9UH92		ENST00000246912.4:c.703G>C	17.37:g.40722064G>C	ENSP00000246912:p.Asp235His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2J3|B2RAV8|B2RD73|Q53XM6|Q96FL2|Q9H2V0|Q9H2V1|Q9H2V2|Q9NXN3	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D235H	ENST00000246912.4	37	c.703	CCDS11430.1	17	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036359	0.93630	.	.	ENSG00000108788	ENST00000346833;ENST00000246912;ENST00000435881	T;D;T	0.81659	-1.2;-1.52;-1.24	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.89466	0.6723	M	0.66378	2.025	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.99;0.996	D	0.89713	0.3913	10	0.87932	D	0	-21.6402	19.877	0.96880	0.0:0.0:1.0:0.0	.	151;235;181	Q9UH92-2;Q9UH92;Q9UH92-3	.;MLX_HUMAN;.	H	151;235;181	ENSP00000320913:D151H;ENSP00000246912:D235H;ENSP00000416627:D181H	ENSP00000246912:D235H	D	+	1	0	MLX	37975590	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	9.857000	0.99534	2.709000	0.92574	0.561000	0.74099	GAC	MLX	-	NULL	ENSG00000108788		0.552	MLX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLX	HGNC	protein_coding	OTTHUMT00000450415.1	64	0.00	0	G	NM_170607		40722064	40722064	+1	no_errors	ENST00000246912	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	1.000	C
MYCBP2	23077	genome.wustl.edu	37	13	77663147	77663147	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr13:77663147C>G	ENST00000544440.2	-	61	10448	c.10431G>C	c.(10429-10431)ttG>ttC	p.L3477F	MYCBP2_ENST00000407578.2_Missense_Mutation_p.L3515F|MYCBP2-AS1_ENST00000448470.2_RNA|MYCBP2_ENST00000357337.6_Missense_Mutation_p.L3477F|MYCBP2-AS1_ENST00000593933.1_RNA|MYCBP2-AS1_ENST00000422231.2_RNA|MYCBP2-AS1_ENST00000450627.2_RNA					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		ACGGATGTCTCAAAAGGGAAG	0.333																																						dbGAP											0													48.0	50.0	50.0					13																	77663147		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.10431G>C	13.37:g.77663147C>G	ENSP00000444596:p.Leu3477Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,prints_Reg_chr_condens,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens	p.L3515F	ENST00000544440.2	37	c.10545		13	.	.	.	.	.	.	.	.	.	.	C	16.78	3.216732	0.58452	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.36699	1.24;1.24;1.24	5.52	3.47	0.39725	.	0.000000	0.64402	D	0.000005	T	0.46600	0.1401	L	0.38175	1.15	0.58432	D	0.999991	D	0.65815	0.995	D	0.72982	0.979	T	0.45659	-0.9246	10	0.72032	D	0.01	.	10.7378	0.46135	0.0:0.7729:0.0:0.2271	.	3477	O75592	MYCB2_HUMAN	F	3477;3515;3477	ENSP00000349892:L3477F;ENSP00000384288:L3515F;ENSP00000444596:L3477F	ENSP00000349892:L3477F	L	-	3	2	MYCBP2	76561148	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	1.343000	0.33930	1.324000	0.45282	0.563000	0.77884	TTG	MYCBP2	-	superfamily_ARM-type_fold	ENSG00000005810		0.333	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	47	0.00	0	C	NM_015057		77663147	77663147	-1	no_errors	ENST00000407578	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.993	G
MYL5	4636	genome.wustl.edu	37	4	672772	672772	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr4:672772G>C	ENST00000400159.2	+	3	242	c.137G>C	c.(136-138)cGa>cCa	p.R46P	MYL5_ENST00000511290.1_Missense_Mutation_p.R5P|MYL5_ENST00000505477.1_Missense_Mutation_p.R5P|MYL5_ENST00000506838.1_Missense_Mutation_p.R5P	NM_002477.1	NP_002468.1	Q02045	MYL5_HUMAN	myosin, light chain 5, regulatory	46	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of muscle contraction (GO:0006937)	muscle myosin complex (GO:0005859)	calcium ion binding (GO:0005509)|structural constituent of muscle (GO:0008307)			endometrium(1)|kidney(1)|lung(1)	3						GATCAGAACCGAGATGGCTTC	0.622																																						dbGAP											0													109.0	117.0	114.0					4																	672772		2196	4299	6495	-	-	-	SO:0001583	missense	0				CCDS43197.1	4p16	2013-01-10	2006-09-29		ENSG00000215375	ENSG00000215375		"""Myosins / Light chain"", ""EF-hand domain containing"""	7586	protein-coding gene	gene with protein product		160782	"""myosin, light polypeptide 5, regulatory"""			1284596	Standard	NM_002477		Approved		uc003gav.3	Q02045	OTTHUMG00000159971	ENST00000400159.2:c.137G>C	4.37:g.672772G>C	ENSP00000383023:p.Arg46Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXL8	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.R46P	ENST00000400159.2	37	c.137	CCDS43197.1	4	.	.	.	.	.	.	.	.	.	.	G	20.0	3.931134	0.73327	.	.	ENSG00000215375	ENST00000506838;ENST00000505477;ENST00000511290;ENST00000400159;ENST00000507804	T;T;T;T;T	0.79247	-1.25;-1.25;-1.25;-0.45;-0.66	4.57	0.824	0.18818	EF-hand-like domain (1);	0.291860	0.17053	U	0.188848	D	0.86272	0.5893	M	0.89904	3.07	0.25897	N	0.983404	D	0.56287	0.975	P	0.60415	0.874	T	0.77840	-0.2438	10	0.66056	D	0.02	.	8.2564	0.31758	0.3476:0.0:0.6524:0.0	.	46	Q02045	MYL5_HUMAN	P	5;5;5;46;51	ENSP00000427153:R5P;ENSP00000423118:R5P;ENSP00000425162:R5P;ENSP00000383023:R46P;ENSP00000427317:R51P	ENSP00000383023:R46P	R	+	2	0	MYL5	662772	1.000000	0.71417	0.001000	0.08648	0.961000	0.63080	3.961000	0.56759	-0.190000	0.10465	0.591000	0.81541	CGA	MYL5	-	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000215375		0.622	MYL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYL5	HGNC	protein_coding	OTTHUMT00000358570.2	44	0.00	0	G	NM_002477		672772	672772	+1	no_errors	ENST00000400159	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.905	C
MYO18A	399687	genome.wustl.edu	37	17	27493080	27493080	+	Silent	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr17:27493080C>T	ENST00000527372.1	-	2	1059	c.879G>A	c.(877-879)gtG>gtA	p.V293V	MYO18A_ENST00000354329.4_Silent_p.V293V|MYO18A_ENST00000533112.1_Silent_p.V293V|MYO18A_ENST00000531253.1_Silent_p.V293V	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	293	Mediates nucleotide-independent binding to F-actin and interaction with GOLPH3.|PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GGATCATCTCCACAATCTCAT	0.627																																					Esophageal Squamous(182;472 2015 7001 15270 22562)	dbGAP											0													107.0	119.0	115.0					17																	27493080		2199	4296	6495	-	-	-	SO:0001819	synonymous_variant	0			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.879G>A	17.37:g.27493080C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.V293	ENST00000527372.1	37	c.879	CCDS45642.1	17																																																																																			MYO18A	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000196535		0.627	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000389396.1	17	0.00	0	C	NM_078471		27493080	27493080	-1	no_errors	ENST00000354329	ensembl	human	known	69_37n	silent	5	58.33	7	SNP	1.000	T
MYO1F	4542	genome.wustl.edu	37	19	8587599	8587599	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr19:8587599C>G	ENST00000338257.8	-	26	3236	c.2969G>C	c.(2968-2970)gGa>gCa	p.G990A		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	990				IMSGGGTHRPPRGPPSTSLG -> KFIWPRGHPQASPALRP HPWD (in Ref. 5; CAA67058). {ECO:0000305}.	defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)	p.G990E(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						TCTGCTGGCTCCCAGGGATGT	0.711																																						dbGAP											1	Substitution - Missense(1)	skin(1)											21.0	23.0	22.0					19																	8587599		1905	4114	6019	-	-	-	SO:0001583	missense	0			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.2969G>C	19.37:g.8587599C>G	ENSP00000344871:p.Gly990Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WWN7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain	p.G990A	ENST00000338257.8	37	c.2969	CCDS42494.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.37|10.37	1.331733|1.331733	0.24167|0.24167	.|.	.|.	ENSG00000142347|ENSG00000142347	ENST00000305795|ENST00000338257	.|D	.|0.86562	.|-2.14	5.27|5.27	5.27|5.27	0.74061|0.74061	.|.	1.370530|.	0.04860|.	N|.	0.443930|.	T|T	0.81678|0.81678	0.4873|0.4873	L|L	0.46157|0.46157	1.445|1.445	0.36941|0.36941	D|D	0.892362|0.892362	.|B	.|0.17038	.|0.02	.|B	.|0.11329	.|0.006	T|T	0.76669|0.76669	-0.2874|-0.2874	7|9	0.12766|0.06099	T|T	0.61|0.92	.|.	16.3738|16.3738	0.83378|0.83378	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|990	.|O00160	.|MYO1F_HUMAN	Q|A	1034|990	.|ENSP00000344871:G990A	ENSP00000304899:E1034Q|ENSP00000344871:G990A	E|G	-|-	1|2	0|0	MYO1F|MYO1F	8493599|8493599	0.013000|0.013000	0.17824|0.17824	0.713000|0.713000	0.30519|0.30519	0.347000|0.347000	0.29111|0.29111	1.351000|1.351000	0.34022|0.34022	2.468000|2.468000	0.83385|0.83385	0.455000|0.455000	0.32223|0.32223	GAG|GGA	MYO1F	-	NULL	ENSG00000142347		0.711	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	16	0.00	0	C			8587599	8587599	-1	no_errors	ENST00000338257	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.995	G
MYOM1	8736	genome.wustl.edu	37	18	3187502	3187502	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr18:3187502C>T	ENST00000356443.4	-	5	1238	c.905G>A	c.(904-906)gGc>gAc	p.G302D	MYOM1_ENST00000400569.3_Missense_Mutation_p.G302D|MYOM1_ENST00000261606.7_Missense_Mutation_p.G302D|RP13-270P17.2_ENST00000580139.1_RNA	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	302	Ig-like C2-type 1.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						TTCTGGCCAGCCTGCTATGGA	0.433																																						dbGAP											0													162.0	153.0	156.0					18																	3187502		1989	4153	6142	-	-	-	SO:0001583	missense	0			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.905G>A	18.37:g.3187502C>T	ENSP00000348821:p.Gly302Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G302D	ENST00000356443.4	37	c.905	CCDS45824.1	18	.	.	.	.	.	.	.	.	.	.	C	28.5	4.929923	0.92389	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.79554	-1.28;-1.28;-1.28	5.4	5.4	0.78164	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.94493	0.8227	H	0.98918	4.37	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96195	0.9141	10	0.62326	D	0.03	.	19.5338	0.95240	0.0:1.0:0.0:0.0	.	302;302	P52179-2;P52179	.;MYOM1_HUMAN	D	302	ENSP00000348821:G302D;ENSP00000383413:G302D;ENSP00000261606:G302D	ENSP00000261606:G302D	G	-	2	0	MYOM1	3177502	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	7.442000	0.80503	2.692000	0.91855	0.557000	0.71058	GGC	MYOM1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000101605		0.433	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	HGNC	protein_coding	OTTHUMT00000441037.2	65	0.00	0	C	NM_003803		3187502	3187502	-1	no_errors	ENST00000356443	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	1.000	T
NBEAL1	65065	genome.wustl.edu	37	2	204058611	204058611	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:204058611G>T	ENST00000449802.1	+	46	7261	c.6928G>T	c.(6928-6930)Gaa>Taa	p.E2310*		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2310										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ACACCTTCCTGAACTCAAGTC	0.338																																						dbGAP											0													137.0	135.0	136.0					2																	204058611		1846	4086	5932	-	-	-	SO:0001587	stop_gained	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.6928G>T	2.37:g.204058611G>T	ENSP00000399903:p.Glu2310*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E2310*	ENST00000449802.1	37	c.6928	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	G	49	15.703780	0.99842	.	.	ENSG00000144426	ENST00000449802;ENST00000414576	.	.	.	5.27	4.37	0.52481	.	0.229431	0.36034	U	0.002826	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	15.3599	0.74464	0.0:0.1404:0.8596:0.0	.	.	.	.	X	2310;325	.	ENSP00000388466:E325X	E	+	1	0	NBEAL1	203766856	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.515000	0.53429	1.175000	0.42826	0.650000	0.86243	GAA	NBEAL1	-	NULL	ENSG00000144426		0.338	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	103	0.00	0	G			204058611	204058611	+1	no_errors	ENST00000449802	ensembl	human	known	69_37n	nonsense	87	13.00	13	SNP	1.000	T
NBL1	4681	genome.wustl.edu	37	1	19983527	19983527	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr1:19983527C>T	ENST00000375136.3	+	4	754	c.451C>T	c.(451-453)Cac>Tac	p.H151Y	NBL1_ENST00000289749.2_Missense_Mutation_p.H186Y|MINOS1-NBL1_ENST00000602662.1_Missense_Mutation_p.H151Y|NBL1_ENST00000548815.1_Missense_Mutation_p.H150Y	NM_001204085.1|NM_001204089.1|NM_001278164.1|NM_001278166.1	NP_001191014.1|NP_001191018.1|NP_001265093.1|NP_001265095.1	P41271	NBL1_HUMAN	neuroblastoma 1, DAN family BMP antagonist	151	Pro-rich.				determination of dorsal identity (GO:0048263)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of monocyte chemotaxis (GO:0090027)|nervous system development (GO:0007399)|neuron projection morphogenesis (GO:0048812)|positive regulation of neuron differentiation (GO:0045666)|sequestering of BMP from receptor via BMP binding (GO:0038098)|sequestering of BMP in extracellular matrix (GO:0035582)	extracellular space (GO:0005615)	BMP binding (GO:0036122)|morphogen activity (GO:0016015)|protein homodimerization activity (GO:0042803)			lung(2)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	8		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Breast(348;0.00043)|Ovarian(437;0.00373)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|BRCA - Breast invasive adenocarcinoma(304;5.9e-05)|Kidney(64;0.000173)|GBM - Glioblastoma multiforme(114;0.0012)|KIRC - Kidney renal clear cell carcinoma(64;0.0026)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		CAcccaccctcacccccatcc	0.721																																						dbGAP											0													15.0	15.0	15.0					1																	19983527		2142	4181	6323	-	-	-	SO:0001583	missense	0				CCDS196.1, CCDS41278.1, CCDS196.2, CCDS72720.1	1p36.3-p36.2	2013-02-26	2013-02-26		ENSG00000158747	ENSG00000158747			7650	protein-coding gene	gene with protein product	"""neuroblastoma candidate region, suppression of tumorigenicity 1"", ""neuroblastoma suppressor of tumorigenicity 1"", ""differential screening-selected gene aberrant in neuroblastoma"""	600613	"""neuroblastoma, suppression of tumorigenicity 1"""			7633401	Standard	NM_182744		Approved	D1S1733E, NB, DAN, NO3, DAND1	uc001bcj.2	P41271	OTTHUMG00000002700	ENST00000375136.3:c.451C>T	1.37:g.19983527C>T	ENSP00000364278:p.His151Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFI7|Q5TGZ2|Q5U0N4|Q96L68	Missense_Mutation	SNP	pfam_DAN,pfam_Cys_knot,smart_Cys_knot_C	p.H186Y	ENST00000375136.3	37	c.556	CCDS196.2	1	.	.	.	.	.	.	.	.	.	.	C	14.54	2.565501	0.45694	.	.	ENSG00000158747	ENST00000289749;ENST00000375136;ENST00000548815;ENST00000427894	T;T;T;T	0.31247	1.5;1.51;1.51;1.5	2.28	2.28	0.28536	.	0.740166	0.12192	U	0.491066	T	0.26304	0.0642	N	0.08118	0	0.36970	D	0.893793	P;D	0.56968	0.813;0.978	B;P	0.55713	0.141;0.782	T	0.21861	-1.0233	9	.	.	.	-19.3216	12.1425	0.54007	0.0:1.0:0.0:0.0	.	150;186	P41271;P41271-2	NBL1_HUMAN;.	Y	186;151;150;150	ENSP00000289749:H186Y;ENSP00000364278:H151Y;ENSP00000449007:H150Y;ENSP00000394079:H150Y	.	H	+	1	0	NBL1	19856114	0.345000	0.24835	0.793000	0.32043	0.914000	0.54420	0.030000	0.13688	1.580000	0.49851	0.462000	0.41574	CAC	NBL1	-	NULL	ENSG00000158747		0.721	NBL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBL1	HGNC	protein_coding	OTTHUMT00000007681.4	12	0.00	0	C	NM_005380		19983527	19983527	+1	no_errors	ENST00000289749	ensembl	human	known	69_37n	missense	1	83.33	5	SNP	1.000	T
NR4A3	8013	genome.wustl.edu	37	9	102595783	102595783	+	Intron	SNP	A	A	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr9:102595783A>G	ENST00000395097.2	+	5	1983				NR4A3_ENST00000338488.4_Missense_Mutation_p.Y434C|NR4A3_ENST00000330847.1_Intron	NM_006981.3|NM_173200.2	NP_008912.2|NP_775292.1	Q92570	NR4A3_HUMAN	nuclear receptor subfamily 4, group A, member 3						gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|thyroid hormone receptor activity (GO:0004887)|zinc ion binding (GO:0008270)		TCF12/NR4A3(2)|TAF15/NR4A3(33)|EWSR1/NR4A3(146)|TFG/NR4A3(2)				Acute lymphoblastic leukemia(62;0.0559)|all_hematologic(171;0.189)				CAGGGTCTCTATTTATGGCTA	0.363			T	EWSR1	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		9	9q22	8013	"""nuclear receptor subfamily 4, group A, member 3 (NOR1)"""		M	0													92.0	96.0	94.0					9																	102595783		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U12767	CCDS6742.1, CCDS6743.1, CCDS6744.1	9q22	2013-01-16			ENSG00000119508	ENSG00000119508		"""Nuclear hormone receptors"""	7982	protein-coding gene	gene with protein product		600542				8614405	Standard	NM_006981		Approved	CSMF, CHN, NOR1, MINOR	uc004baf.1	Q92570	OTTHUMG00000021030	ENST00000395097.2:c.1254+47A>G	9.37:g.102595783A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3I7|Q12935|Q14979|Q16420|Q4VXA8|Q4VXA9|Q9UEK2|Q9UEK3	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_NOR1_rcpt,prints_Nuc_orph_rcpt,prints_Znf_hrmn_rcpt	p.Y434C	ENST00000395097.2	37	c.1301	CCDS6743.1	9	.	.	.	.	.	.	.	.	.	.	A	2.651	-0.282026	0.05642	.	.	ENSG00000119508	ENST00000338488;ENST00000395096	D	0.88586	-2.4	5.48	-8.9	0.00782	.	.	.	.	.	T	0.68054	0.2959	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.57093	-0.7870	8	.	.	.	.	3.6307	0.08130	0.2689:0.3169:0.3244:0.0899	.	434	Q92570-2	.	C	434;258	ENSP00000340301:Y434C	.	Y	+	2	0	NR4A3	101635604	0.000000	0.05858	0.000000	0.03702	0.266000	0.26442	-0.268000	0.08607	-1.424000	0.01999	-0.299000	0.09455	TAT	NR4A3	-	NULL	ENSG00000119508		0.363	NR4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR4A3	HGNC	protein_coding	OTTHUMT00000055482.1	96	0.00	0	A			102595783	102595783	+1	no_errors	ENST00000338488	ensembl	human	known	69_37n	missense	62	22.50	18	SNP	0.000	G
NRXN1	9378	genome.wustl.edu	37	2	50149372	50149372	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:50149372C>T	ENST00000406316.2	-	22	5620	c.4144G>A	c.(4144-4146)Ggc>Agc	p.G1382S	NRXN1_ENST00000401710.1_Missense_Mutation_p.G400S|NRXN1_ENST00000402717.3_Missense_Mutation_p.G1404S|NRXN1_ENST00000401669.2_Missense_Mutation_p.G1412S|NRXN1_ENST00000342183.5_Missense_Mutation_p.G347S|NRXN1_ENST00000404971.1_Missense_Mutation_p.G1452S|NRXN1_ENST00000405472.3_Missense_Mutation_p.G1404S|NRXN1_ENST00000406859.3_Missense_Mutation_p.G1382S	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	1382					adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)	p.G347S(1)|p.G1382S(1)|p.G1453S(1)		breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			TCTCTGCCGCCTGCTCGGGTT	0.502																																						dbGAP											3	Substitution - Missense(3)	lung(3)											33.0	30.0	31.0					2																	50149372		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4144G>A	2.37:g.50149372C>T	ENSP00000384311:p.Gly1382Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.G1404S	ENST00000406316.2	37	c.4210	CCDS54360.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.28|14.28	2.488499|2.488499	0.44249|0.44249	.|.	.|.	ENSG00000179915|ENSG00000179915	ENST00000342183;ENST00000536347;ENST00000401710;ENST00000404971;ENST00000406316;ENST00000405472;ENST00000401669;ENST00000536085;ENST00000402717;ENST00000406859|ENST00000378262	T;T;T;T;T;T;T;T|.	0.69685|.	1.05;2.26;0.29;0.25;-0.42;-0.31;-0.01;0.12|.	5.74|5.74	5.74|5.74	0.90152|0.90152	.|.	0.557137|.	0.12618|.	U|.	0.453259|.	T|T	0.53753|0.53753	0.1816|0.1816	L|L	0.55990|0.55990	1.75|1.75	0.28664|0.28664	N|N	0.906001|0.906001	B;B;B;B;B;B|.	0.34181|.	0.21;0.007;0.008;0.44;0.034;0.03|.	B;B;B;B;B;B|.	0.35240|.	0.028;0.007;0.024;0.198;0.017;0.037|.	T|T	0.51919|0.51919	-0.8644|-0.8644	10|5	0.38643|.	T|.	0.18|.	.|.	13.1584|13.1584	0.59531|0.59531	0.0:0.9272:0.0:0.0728|0.0:0.9272:0.0:0.0728	.|.	47;1452;347;1382;1401;44|.	B4DIT5;Q9ULB1-3;P58400;F8WB18;A7E294;Q5HYI0|.	.;.;NRX1B_HUMAN;.;.;.|.	S|K	347;301;400;1452;1382;1404;1412;1453;1404;1382|48	ENSP00000341184:G347S;ENSP00000385580:G400S;ENSP00000385142:G1452S;ENSP00000384311:G1382S;ENSP00000434015:G1404S;ENSP00000385017:G1412S;ENSP00000385434:G1404S;ENSP00000385681:G1382S|.	ENSP00000341184:G347S|.	G|R	-|-	1|2	0|0	NRXN1|NRXN1	50002876|50002876	1.000000|1.000000	0.71417|0.71417	0.994000|0.994000	0.49952|0.49952	0.954000|0.954000	0.61252|0.61252	3.728000|3.728000	0.54991|0.54991	2.707000|2.707000	0.92482|0.92482	0.563000|0.563000	0.77884|0.77884	GGC|AGG	NRXN1	-	NULL	ENSG00000179915		0.502	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	46	0.00	0	C			50149372	50149372	-1	no_errors	ENST00000402717	ensembl	human	known	69_37n	missense	50	19.35	12	SNP	1.000	T
NRP2	8828	genome.wustl.edu	37	2	206656994	206656994	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:206656994G>A	ENST00000357785.5	+	16	2492	c.2461G>A	c.(2461-2463)Gaa>Aaa	p.E821K	NRP2_ENST00000360409.3_Missense_Mutation_p.E826K|NRP2_ENST00000412873.2_Intron|NRP2_ENST00000540841.1_Intron|NRP2_ENST00000540178.1_Missense_Mutation_p.E821K			Q99435	NELL2_HUMAN	neuropilin 2	0						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(14)|lung(19)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	52						AGAAGGATATGAAGATGAAAT	0.333																																						dbGAP											0													174.0	178.0	177.0					2																	206656994		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016098	CCDS2364.1, CCDS2365.1, CCDS46496.1, CCDS46497.1, CCDS46498.1, CCDS46499.1	2q33.3	2008-05-23			ENSG00000118257	ENSG00000118257			8005	protein-coding gene	gene with protein product		602070				9529250, 9331348	Standard	NM_003872		Approved	VEGF165R2	uc002vaw.3	O60462	OTTHUMG00000132893	ENST00000357785.5:c.2461G>A	2.37:g.206656994G>A	ENSP00000350432:p.Glu821Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_CUB,superfamily_ConA-like_lec_gl,smart_CUB,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.E826K	ENST00000357785.5	37	c.2476	CCDS46496.1	2	.	.	.	.	.	.	.	.	.	.	G	10.40	1.338401	0.24253	.	.	ENSG00000118257	ENST00000360409;ENST00000540178;ENST00000357785	D;D;D	0.87334	-2.16;-2.18;-2.24	5.65	5.65	0.86999	.	0.381500	0.31624	N	0.007328	T	0.74764	0.3759	N	0.08118	0	0.80722	D	1	B;B	0.22211	0.066;0.023	B;B	0.18561	0.022;0.007	T	0.69584	-0.5106	10	0.14656	T	0.56	-1.8059	16.751	0.85485	0.0:0.0:1.0:0.0	.	821;826	O60462-3;O60462	.;NRP2_HUMAN	K	826;821;821	ENSP00000353582:E826K;ENSP00000439658:E821K;ENSP00000350432:E821K	ENSP00000350432:E821K	E	+	1	0	NRP2	206365239	1.000000	0.71417	0.995000	0.50966	0.265000	0.26407	5.274000	0.65569	2.941000	0.99782	0.655000	0.94253	GAA	NRP2	-	pirsf_Neuropilin	ENSG00000118257		0.333	NRP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRP2	HGNC	protein_coding	OTTHUMT00000336467.1	167	0.00	0	G			206656994	206656994	+1	no_errors	ENST00000360409	ensembl	human	known	69_37n	missense	129	14.00	21	SNP	1.000	A
OGDHL	55753	genome.wustl.edu	37	10	50944413	50944413	+	Missense_Mutation	SNP	C	C	T	rs554687335		TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr10:50944413C>T	ENST00000374103.4	-	21	2829	c.2744G>A	c.(2743-2745)cGc>cAc	p.R915H	OGDHL_ENST00000432695.1_Missense_Mutation_p.R706H|OGDHL_ENST00000419399.1_Missense_Mutation_p.R858H|OGDHL_ENST00000490844.1_5'UTR	NM_018245.2	NP_060715.2	Q9ULD0	OGDHL_HUMAN	oxoglutarate dehydrogenase-like	915					glycolytic process (GO:0006096)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)	61						CTGCTCCAGGCGCGTGATGGC	0.612													C|||	1	0.000199681	0.0	0.0	5008	,	,		20287	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													114.0	104.0	108.0					10																	50944413		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001713	CCDS7234.1, CCDS44390.1, CCDS44391.1	10q11.23	2013-09-20			ENSG00000197444	ENSG00000197444			25590	protein-coding gene	gene with protein product						10574462	Standard	NM_018245		Approved	FLJ10851	uc001jie.3	Q9ULD0	OTTHUMG00000018200	ENST00000374103.4:c.2744G>A	10.37:g.50944413C>T	ENSP00000363216:p.Arg915His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2G1|B4DKG2|B4E193|Q8TAN9|Q9NVA0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.R915H	ENST00000374103.4	37	c.2744	CCDS7234.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.225590	0.95173	.	.	ENSG00000197444	ENST00000374103;ENST00000419399;ENST00000432695	T;T;T	0.13778	2.56;2.56;2.56	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	T	0.57577	0.2063	H	0.98559	4.265	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.76772	-0.2836	10	0.87932	D	0	.	18.7031	0.91627	0.0:1.0:0.0:0.0	.	858;706;915	Q9ULD0-2;Q9ULD0-3;Q9ULD0	.;.;OGDHL_HUMAN	H	915;858;706	ENSP00000363216:R915H;ENSP00000401356:R858H;ENSP00000390240:R706H	ENSP00000363216:R915H	R	-	2	0	OGDHL	50614419	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	7.818000	0.86416	2.427000	0.82271	0.484000	0.47621	CGC	OGDHL	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000197444		0.612	OGDHL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGDHL	HGNC	protein_coding	OTTHUMT00000048007.1	42	0.00	0	C	NM_018245		50944413	50944413	-1	no_errors	ENST00000374103	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	1.000	T
OR2V1	26693	genome.wustl.edu	37	5	180551426	180551426	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr5:180551426C>G	ENST00000329365.2	-	1	878	c.879G>C	c.(877-879)ttG>ttC	p.L293F		NM_001258283.1	NP_001245212.1	Q8NHB1	OR2V1_HUMAN	olfactory receptor, family 2, subfamily V, member 1	293						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			lung(4)	4						CCCCATTCCTCAAGCTGTAAA	0.602																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB065465	CCDS58992.1	5q35.3	2012-08-09		2004-03-10	ENSG00000185372	ENSG00000185372		"""GPCR / Class A : Olfactory receptors"""	8280	protein-coding gene	gene with protein product				OR2V1P			Standard	NM_001258283		Approved	OST265	uc031smg.1	Q8NHB1	OTTHUMG00000162118	ENST00000329365.2:c.879G>C	5.37:g.180551426C>G	ENSP00000404102:p.Leu293Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L293F	ENST00000329365.2	37	c.879	CCDS58992.1	5	.	.	.	.	.	.	.	.	.	.	.	9.934	1.215554	0.22373	.	.	ENSG00000185372	ENST00000329365	T	0.39787	1.06	5.02	2.29	0.28610	.	.	.	.	.	T	0.40595	0.1123	.	.	.	0.30922	N	0.727911	.	.	.	.	.	.	T	0.47837	-0.9086	6	0.66056	D	0.02	.	4.5719	0.12214	0.0:0.5734:0.1608:0.2657	.	.	.	.	F	293	ENSP00000404102:L293F	ENSP00000404102:L293F	L	-	3	2	OR2V1	180484032	0.058000	0.20735	0.621000	0.29145	0.089000	0.18198	-0.571000	0.05889	0.306000	0.22856	-0.350000	0.07774	TTG	OR2V1	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000185372		0.602	OR2V1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2V1	HGNC	protein_coding	OTTHUMT00000367367.1	25	0.00	0	C			180551426	180551426	-1	no_errors	ENST00000329365	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.876	G
OR52I2	143502	genome.wustl.edu	37	11	4608668	4608668	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr11:4608668G>A	ENST00000312614.4	+	1	648	c.626G>A	c.(625-627)tGt>tAt	p.C209Y		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	209						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		CACTCCTACTGTGAGCACATA	0.517																																						dbGAP											0													187.0	178.0	181.0					11																	4608668		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.626G>A	11.37:g.4608668G>A	ENSP00000308764:p.Cys209Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ5|B9EKV8|Q6IFJ8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.C209Y	ENST00000312614.4	37	c.626	CCDS31355.1	11	.	.	.	.	.	.	.	.	.	.	G	19.58	3.854765	0.71719	.	.	ENSG00000226288	ENST00000312614	T	0.61980	0.06	4.18	4.18	0.49190	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000166	D	0.84642	0.5517	H	0.95328	3.655	0.58432	D	0.999994	D	0.89917	1.0	D	0.97110	1.0	D	0.89708	0.3910	10	0.87932	D	0	-11.7433	15.3687	0.74545	0.0:0.0:1.0:0.0	.	209	Q8NH67	O52I2_HUMAN	Y	209	ENSP00000308764:C209Y	ENSP00000308764:C209Y	C	+	2	0	OR52I2	4565244	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	6.371000	0.73119	2.187000	0.69744	0.644000	0.83932	TGT	OR52I2	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000226288		0.517	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52I2	HGNC	protein_coding	OTTHUMT00000385946.1	100	0.00	0	G	NM_001005170		4608668	4608668	+1	no_errors	ENST00000312614	ensembl	human	known	69_37n	missense	93	13.89	15	SNP	1.000	A
OR4S1	256148	genome.wustl.edu	37	11	48328481	48328481	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr11:48328481C>G	ENST00000319988.1	+	1	707	c.707C>G	c.(706-708)tCc>tGc	p.S236C		NM_001004725.1	NP_001004725.1	Q8NGB4	OR4S1_HUMAN	olfactory receptor, family 4, subfamily S, member 1	236						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(12)|ovary(1)|skin(3)	21						AAGGCTGTCTCCACATGTGGC	0.453																																						dbGAP											0													235.0	214.0	221.0					11																	48328481		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065908	CCDS31488.1	11p11.2	2012-08-09			ENSG00000176555	ENSG00000176555		"""GPCR / Class A : Olfactory receptors"""	14705	protein-coding gene	gene with protein product							Standard	NM_001004725		Approved		uc010rhu.2	Q8NGB4	OTTHUMG00000166578	ENST00000319988.1:c.707C>G	11.37:g.48328481C>G	ENSP00000321447:p.Ser236Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFB4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S236C	ENST00000319988.1	37	c.707	CCDS31488.1	11	.	.	.	.	.	.	.	.	.	.	C	11.82	1.753283	0.31046	.	.	ENSG00000176555	ENST00000319988	T	0.00314	8.14	5.02	5.02	0.67125	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01489	0.0048	H	0.98525	4.255	0.21604	N	0.999627	D	0.89917	1.0	D	0.97110	1.0	T	0.24693	-1.0153	9	0.87932	D	0	.	16.186	0.81950	0.0:1.0:0.0:0.0	.	236	Q8NGB4	OR4S1_HUMAN	C	236	ENSP00000321447:S236C	ENSP00000321447:S236C	S	+	2	0	OR4S1	48285057	0.928000	0.31464	0.853000	0.33588	0.041000	0.13682	3.058000	0.49939	2.497000	0.84241	0.655000	0.94253	TCC	OR4S1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000176555		0.453	OR4S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S1	HGNC	protein_coding	OTTHUMT00000390556.1	104	0.00	0	C	NM_001004725		48328481	48328481	+1	no_errors	ENST00000319988	ensembl	human	known	69_37n	missense	95	15.93	18	SNP	0.493	G
OTOA	146183	genome.wustl.edu	37	16	21726421	21726421	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr16:21726421C>G	ENST00000286149.4	+	13	1479	c.1478C>G	c.(1477-1479)tCc>tGc	p.S493C	OTOA_ENST00000388958.3_Missense_Mutation_p.S479C|OTOA_ENST00000388956.4_Missense_Mutation_p.S400C|OTOA_ENST00000388957.3_Missense_Mutation_p.S155C			Q7RTW8	OTOAN_HUMAN	otoancorin	493					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		AGTGCCGTCTCCCAGTATGTA	0.572																																						dbGAP											0													234.0	212.0	220.0					16																	21726421		2199	4300	6499	-	-	-	SO:0001583	missense	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.1478C>G	16.37:g.21726421C>G	ENSP00000286149:p.Ser493Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Missense_Mutation	SNP	NULL	p.S493C	ENST00000286149.4	37	c.1478		16	.	.	.	.	.	.	.	.	.	.	C	12.12	1.844093	0.32606	.	.	ENSG00000155719	ENST00000388958;ENST00000286149;ENST00000388956;ENST00000388957	T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32	5.66	3.71	0.42584	.	0.624732	0.16297	N	0.220627	D	0.86297	0.5899	M	0.62723	1.935	0.33252	D	0.558604	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.72982	0.979;0.979;0.965;0.979	D	0.87427	0.2386	10	0.72032	D	0.01	-4.3445	9.0064	0.36115	0.1482:0.7744:0.0:0.0775	.	493;400;155;479	Q7RTW8;B3KWU3;Q7RTW8-2;E9PF51	OTOAN_HUMAN;.;.;.	C	479;493;400;155	ENSP00000373610:S479C;ENSP00000286149:S493C;ENSP00000373608:S400C;ENSP00000373609:S155C	ENSP00000286149:S493C	S	+	2	0	OTOA	21633922	0.654000	0.27367	0.028000	0.17463	0.002000	0.02628	3.028000	0.49705	0.745000	0.32763	-0.122000	0.15005	TCC	OTOA	-	NULL	ENSG00000155719		0.572	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	69	0.00	0	C			21726421	21726421	+1	no_errors	ENST00000286149	ensembl	human	known	69_37n	missense	72	11.11	9	SNP	0.952	G
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	82	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	39	39.06	25	SNP	1.000	A
PIP4K2A	5305	genome.wustl.edu	37	10	22896829	22896829	+	Intron	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr10:22896829G>A	ENST00000376573.4	-	3	568				PIP4K2A_ENST00000422321.1_Intron|PIP4K2A_ENST00000545335.1_Intron	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha						megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						TTTCCTACTGGAAGCAAATGT	0.368																																						dbGAP											0													67.0	61.0	63.0					10																	22896829		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.339+26C>T	10.37:g.22896829G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Silent	SNP	NULL	p.F74	ENST00000376573.4	37	c.222	CCDS7141.1	10																																																																																			PIP4K2A	-	NULL	ENSG00000150867		0.368	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2A	HGNC	protein_coding	OTTHUMT00000047193.1	79	0.00	0	G	NM_005028		22896829	22896829	-1	no_start_codon	ENST00000432610	ensembl	human	known	69_37n	silent	39	22.00	11	SNP	0.010	A
PKD2	5311	genome.wustl.edu	37	4	88987028	88987028	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr4:88987028G>C	ENST00000508588.1	+	7	1004	c.609G>C	c.(607-609)gaG>gaC	p.E203D	PKD2_ENST00000237596.2_Missense_Mutation_p.E785D|PKD2_ENST00000502363.1_Missense_Mutation_p.E203D|PKD2_ENST00000511337.1_3'UTR			Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)	0					angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		TGGAGAAAGAGAGGGTGGGTC	0.443																																						dbGAP											0													171.0	147.0	155.0					4																	88987028		2203	4300	6503	-	-	-	SO:0001583	missense	0			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000508588.1:c.609G>C	4.37:g.88987028G>C	ENSP00000427131:p.Glu203Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_PKD1_2_channel,pfam_Ion_trans_dom,pfscan_EF_HAND_2,prints_PKD_2,prints_PKD_1	p.E785D	ENST00000508588.1	37	c.2355		4	.	.	.	.	.	.	.	.	.	.	G	24.4	4.522161	0.85600	.	.	ENSG00000118762	ENST00000237596;ENST00000508588;ENST00000502363	T;T;T	0.71579	-0.58;-0.58;-0.58	5.74	4.9	0.64082	.	0.165135	0.53938	D	0.000058	T	0.59715	0.2214	L	0.42245	1.32	0.58432	D	0.999995	P	0.43094	0.799	B	0.35931	0.214	T	0.64402	-0.6416	10	0.72032	D	0.01	-16.1932	10.8543	0.46789	0.1432:0.0:0.8568:0.0	.	785	Q13563	PKD2_HUMAN	D	785;203;203	ENSP00000237596:E785D;ENSP00000427131:E203D;ENSP00000425289:E203D	ENSP00000237596:E785D	E	+	3	2	PKD2	89206052	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	4.632000	0.61311	1.438000	0.47492	0.655000	0.94253	GAG	PKD2	-	pfscan_EF_HAND_2	ENSG00000118762		0.443	PKD2-002	PUTATIVE	basic|exp_conf	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000363253.2	85	0.00	0	G	NM_000297		88987028	88987028	+1	no_errors	ENST00000237596	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	1.000	C
PKNOX2	63876	genome.wustl.edu	37	11	125301095	125301095	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr11:125301095C>G	ENST00000298282.9	+	13	1497	c.1226C>G	c.(1225-1227)tCc>tGc	p.S409C	PKNOX2_ENST00000542175.1_Missense_Mutation_p.S345C|PKNOX2_ENST00000530517.1_3'UTR	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	409					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CAGTCCCTGTCCTCAGACAGT	0.567																																						dbGAP											0													48.0	50.0	50.0					11																	125301095		2151	4247	6398	-	-	-	SO:0001583	missense	0			AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.1226C>G	11.37:g.125301095C>G	ENSP00000298282:p.Ser409Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	pfam_Homeodomain,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.S409C	ENST00000298282.9	37	c.1226	CCDS41730.1	11	.	.	.	.	.	.	.	.	.	.	C	23.4	4.410354	0.83340	.	.	ENSG00000165495	ENST00000530517;ENST00000531116;ENST00000298282;ENST00000542175	D;D;D;D	0.85629	-2.01;-2.01;-2.01;-1.99	4.56	4.56	0.56223	.	0.000000	0.85682	D	0.000000	D	0.89729	0.6799	L	0.55481	1.735	0.80722	D	1	D;D;D	0.76494	0.997;0.999;0.994	P;P;P	0.62885	0.865;0.908;0.737	D	0.90333	0.4353	10	0.56958	D	0.05	-17.3878	17.8767	0.88827	0.0:1.0:0.0:0.0	.	345;380;409	F5GZ15;B7Z3G7;Q96KN3	.;.;PKNX2_HUMAN	C	380;380;409;345	ENSP00000434732:S380C;ENSP00000433971:S380C;ENSP00000298282:S409C;ENSP00000441470:S345C	ENSP00000298282:S409C	S	+	2	0	PKNOX2	124806305	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.275000	0.78548	2.517000	0.84864	0.655000	0.94253	TCC	PKNOX2	-	NULL	ENSG00000165495		0.567	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX2	HGNC	protein_coding	OTTHUMT00000386866.3	28	0.00	0	C			125301095	125301095	+1	no_errors	ENST00000298282	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	1.000	G
PRTFDC1	56952	genome.wustl.edu	37	10	25226277	25226277	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr10:25226277C>A	ENST00000320152.6	-	3	203	c.175G>T	c.(175-177)Gat>Tat	p.D59Y	PRTFDC1_ENST00000376376.3_Missense_Mutation_p.D59Y|PRTFDC1_ENST00000376378.1_Missense_Mutation_p.D59Y	NM_020200.5	NP_064585.1	Q9NRG1	PRDC1_HUMAN	phosphoribosyl transferase domain containing 1	59					nucleoside metabolic process (GO:0009116)	cytosol (GO:0005829)	magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	9						TTCATAATATCCTTGGCCAGC	0.363																																						dbGAP											0													80.0	80.0	80.0					10																	25226277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF226056	CCDS7145.1, CCDS60506.1	10p12.31	2003-11-10			ENSG00000099256	ENSG00000099256			23333	protein-coding gene	gene with protein product		610751					Standard	XM_005252537		Approved	HHGP	uc001ise.1	Q9NRG1	OTTHUMG00000017829	ENST00000320152.6:c.175G>T	10.37:g.25226277C>A	ENSP00000318602:p.Asp59Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1Z3|Q53HA7|Q59EL9|Q5VV18|Q5VV20	Missense_Mutation	SNP	pfam_PRibTrfase,tigrfam_Hxn_phspho_trans	p.D59Y	ENST00000320152.6	37	c.175	CCDS7145.1	10	.	.	.	.	.	.	.	.	.	.	C	16.16	3.044914	0.55110	.	.	ENSG00000099256	ENST00000320152;ENST00000358336;ENST00000376378;ENST00000376376	D;D;D	0.99745	-5.78;-5.78;-6.61	5.1	5.1	0.69264	Phosphoribosyltransferase (1);	0.047989	0.85682	D	0.000000	D	0.99554	0.9840	M	0.76838	2.35	0.58432	D	0.999995	D;P	0.53885	0.963;0.847	P;P	0.56088	0.555;0.791	D	0.98350	1.0543	10	0.66056	D	0.02	.	18.7444	0.91787	0.0:1.0:0.0:0.0	.	59;59	Q9NRG1-2;Q9NRG1	.;PRDC1_HUMAN	Y	59	ENSP00000318602:D59Y;ENSP00000365558:D59Y;ENSP00000365556:D59Y	ENSP00000318602:D59Y	D	-	1	0	PRTFDC1	25266283	0.885000	0.30320	1.000000	0.80357	0.998000	0.95712	1.502000	0.35704	2.652000	0.90054	0.655000	0.94253	GAT	PRTFDC1	-	pfam_PRibTrfase,tigrfam_Hxn_phspho_trans	ENSG00000099256		0.363	PRTFDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRTFDC1	HGNC	protein_coding	OTTHUMT00000047243.2	62	0.00	0	C	NM_020200		25226277	25226277	-1	no_errors	ENST00000320152	ensembl	human	known	69_37n	missense	45	19.64	11	SNP	1.000	A
PTPRC	5788	genome.wustl.edu	37	1	198668702	198668702	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr1:198668702C>T	ENST00000367376.2	+	5	473	c.302C>T	c.(301-303)tCa>tTa	p.S101L	PTPRC_ENST00000391970.3_3'UTR|PTPRC_ENST00000348564.6_Intron|PTPRC_ENST00000352140.3_Missense_Mutation_p.S101L|PTPRC_ENST00000442510.2_Missense_Mutation_p.S103L|PTPRC_ENST00000594404.1_Intron	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	101					axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						GGTGTTTCATCAGTACAGACG	0.493											OREG0014061	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													98.0	102.0	100.0					1																	198668702		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.302C>T	1.37:g.198668702C>T	ENSP00000356346:p.Ser101Leu	Somatic	2100	WXS	Illumina GAIIx	Phase_IV	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S103L	ENST00000367376.2	37	c.308		1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.959413	0.34565	.	.	ENSG00000081237	ENST00000367376;ENST00000367366;ENST00000352140;ENST00000535566;ENST00000271610;ENST00000530727;ENST00000442510;ENST00000367367;ENST00000418674	T	0.03004	4.08	5.09	2.2	0.27929	.	1.759330	0.03185	N	0.172635	T	0.05593	0.0147	L	0.53249	1.67	0.09310	N	1	B;B;B;B;B;B	0.30763	0.025;0.015;0.001;0.01;0.294;0.146	B;B;B;B;B;B	0.22152	0.012;0.009;0.003;0.019;0.038;0.038	T	0.38779	-0.9645	10	0.59425	D	0.04	.	6.2829	0.21017	0.0:0.6934:0.0:0.3065	.	37;37;37;142;101;101	F5GXZ3;B4DSZ5;Q5T9M4;Q6Q1P2;E9PC28;P08575	.;.;.;.;.;PTPRC_HUMAN	L	103;37;101;101;142;35;101;35;101	ENSP00000193532:S101L	ENSP00000271610:S142L	S	+	2	0	PTPRC	196935325	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.080000	0.14802	0.543000	0.28864	0.555000	0.69702	TCA	PTPRC	-	pirsf_Leukocyte_common_ag	ENSG00000081237		0.493	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		65	0.00	0	C			198668702	198668702	+1	no_errors	ENST00000367376	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	0.000	T
RGAG1	57529	genome.wustl.edu	37	X	109694516	109694516	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:109694516C>T	ENST00000465301.2	+	3	917	c.671C>T	c.(670-672)cCc>cTc	p.P224L	RGAG1_ENST00000540313.1_Missense_Mutation_p.P224L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	224										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GTGCCAGCTCCCAGCTCTGAG	0.473																																						dbGAP											0													110.0	102.0	105.0					X																	109694516		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.671C>T	X.37:g.109694516C>T	ENSP00000419786:p.Pro224Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.P224L	ENST00000465301.2	37	c.671	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	11.97	1.796870	0.31777	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.65732	-0.17;-0.17	4.02	2.19	0.27852	.	0.501626	0.15031	N	0.284476	T	0.54951	0.1890	N	0.19112	0.55	0.21933	N	0.999466	D	0.63046	0.992	P	0.59357	0.856	T	0.38993	-0.9635	9	.	.	.	-5.4727	3.8061	0.08777	0.2406:0.6302:0.0:0.1291	.	224	Q8NET4	RGAG1_HUMAN	L	224	ENSP00000419786:P224L;ENSP00000441452:P224L	.	P	+	2	0	RGAG1	109581172	0.169000	0.23002	0.023000	0.16930	0.424000	0.31475	2.626000	0.46460	0.442000	0.26555	0.600000	0.82982	CCC	RGAG1	-	NULL	ENSG00000243978		0.473	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	73	0.00	0	C	NM_020769		109694516	109694516	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	45	30.77	20	SNP	0.167	T
RHD	6007	genome.wustl.edu	37	1	25627521	25627521	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr1:25627521C>G	ENST00000328664.4	+	4	726	c.571C>G	c.(571-573)Cta>Gta	p.L191V	RHD_ENST00000423810.2_Missense_Mutation_p.L191V|RHD_ENST00000342055.5_Missense_Mutation_p.L191V|RHD_ENST00000454452.2_Missense_Mutation_p.L191V|RHD_ENST00000568195.1_Missense_Mutation_p.L191V|RHD_ENST00000417538.2_Missense_Mutation_p.L191V|RHD_ENST00000357542.4_Missense_Mutation_p.L191V|RHD_ENST00000423253.1_3'UTR	NM_001282867.1|NM_016124.3	NP_001269796.1|NP_057208	Q02161	RHD_HUMAN	Rh blood group, D antigen	191						integral component of plasma membrane (GO:0005887)	ammonium transmembrane transporter activity (GO:0008519)			breast(2)|large_intestine(4)|lung(7)|prostate(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.39e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000332)|BRCA - Breast invasive adenocarcinoma(304;0.000438)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000908)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		GCCAAAGCCTCTACCCGAGGG	0.527																																						dbGAP											0													218.0	149.0	174.0					1																	25627521		2120	3740	5860	-	-	-	SO:0001583	missense	0			AB012623	CCDS262.1, CCDS53285.1, CCDS60027.1, CCDS60028.1, CCDS60029.1, CCDS60030.1, CCDS60031.1	1p36.11	2014-07-19	2013-10-02		ENSG00000187010	ENSG00000187010		"""CD molecules"", ""Blood group antigens"""	10009	protein-coding gene	gene with protein product		111680	"""Rhesus blood group, D antigen"", ""Rh blood group, D antigen"""	RH		8220426	Standard	NM_016124		Approved	Rh30a, Rh4, RhPI, RhII, DIIIc, CD240D	uc001bjz.3	Q02161	OTTHUMG00000003476	ENST00000328664.4:c.571C>G	1.37:g.25627521C>G	ENSP00000331871:p.Leu191Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02162|Q07618|Q16147|Q16235|Q16355|Q5VSK0|Q5XLS9|Q5XLT1|Q5XLT2|Q9NPK0|Q9UQ20|Q9UQ21|Q9UQ22|Q9UQ23	Missense_Mutation	SNP	pfam_NH4_transpt_AmtB-like,superfamily_NH4_transpt_AmtB-like,prints_RhesusRHD	p.L191V	ENST00000328664.4	37	c.571	CCDS262.1	1	.	.	.	.	.	.	.	.	.	.	.	10.93	1.488795	0.26686	.	.	ENSG00000187010	ENST00000328664;ENST00000419831;ENST00000454452;ENST00000342055;ENST00000357542;ENST00000417538;ENST00000423810	T;T;T;T;T;T	0.23754	1.89;1.89;1.89;1.89;1.89;1.89	3.95	1.6	0.23607	Ammonium transporter AmtB-like (3);	0.781019	0.11820	N	0.526346	T	0.42539	0.1207	M	0.65975	2.015	0.09310	N	1	P;P;D;P;P;P;P;P	0.63046	0.866;0.866;0.992;0.741;0.464;0.818;0.908;0.908	P;P;D;P;B;B;P;P	0.76071	0.507;0.507;0.987;0.507;0.41;0.283;0.719;0.733	T	0.17501	-1.0367	10	0.30078	T	0.28	-1.4534	6.6882	0.23156	0.2192:0.6061:0.1747:0.0	.	191;191;191;191;191;191;191;191	B4DLT8;Q5XLT1;Q5XLS9;Q5XLT2;Q5XLT3;E7EVW1;Q5XLT0;Q02161	.;.;.;.;.;.;.;RHD_HUMAN	V	191	ENSP00000331871:L191V;ENSP00000413849:L191V;ENSP00000339577:L191V;ENSP00000350150:L191V;ENSP00000396420:L191V;ENSP00000399640:L191V	ENSP00000331871:L191V	L	+	1	2	RHD	25500108	0.000000	0.05858	0.010000	0.14722	0.002000	0.02628	0.115000	0.15540	0.697000	0.31718	0.393000	0.25936	CTA	RHD	-	pfam_NH4_transpt_AmtB-like,superfamily_NH4_transpt_AmtB-like	ENSG00000187010		0.527	RHD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHD	HGNC	protein_coding	OTTHUMT00000009660.5	77	0.00	0	C	NM_016124		25627521	25627521	+1	no_errors	ENST00000328664	ensembl	human	known	69_37n	missense	31	34.04	16	SNP	0.001	G
RPP40	10799	genome.wustl.edu	37	6	5002461	5002461	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr6:5002461C>G	ENST00000380051.2	-	2	186	c.142G>C	c.(142-144)Gaa>Caa	p.E48Q	RPP40_ENST00000464646.1_5'UTR|RPP40_ENST00000319533.5_Missense_Mutation_p.E48Q	NM_006638.2	NP_006629.2	O75818	RPP40_HUMAN	ribonuclease P/MRP 40kDa subunit	48					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			NS(1)|breast(1)|large_intestine(4)|lung(4)|ovary(1)|skin(2)|urinary_tract(1)	14	Ovarian(93;0.11)	all_hematologic(90;0.0895)				ATCCCACATTCAGGAATGAGA	0.358																																						dbGAP											0													70.0	68.0	68.0					6																	5002461		2203	4300	6503	-	-	-	SO:0001583	missense	0			U94317	CCDS34333.1, CCDS69040.1, CCDS75391.1	6p25.1	2012-05-21	2007-06-26	2004-03-19	ENSG00000124787	ENSG00000124787			20992	protein-coding gene	gene with protein product		606117	"""ribonuclease P1"", ""ribonuclease P 40kDa subunit"""	RNASEP1		9630247	Standard	NM_006638		Approved	bA428J1.3	uc003mwl.3	O75818	OTTHUMG00000014168	ENST00000380051.2:c.142G>C	6.37:g.5002461C>G	ENSP00000369391:p.Glu48Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VX97|Q8WVK8	Missense_Mutation	SNP	pfam_RNase_P_Rpp40	p.E48Q	ENST00000380051.2	37	c.142	CCDS34333.1	6	.	.	.	.	.	.	.	.	.	.	C	21.4	4.139794	0.77775	.	.	ENSG00000124787	ENST00000380051;ENST00000319533	T;T	0.49720	0.86;0.77	5.35	5.35	0.76521	.	0.172640	0.49916	D	0.000131	T	0.57080	0.2029	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.71656	0.974;0.963	T	0.53535	-0.8425	10	0.35671	T	0.21	-8.426	16.2479	0.82454	0.0:1.0:0.0:0.0	.	48;48	O75818-2;O75818	.;RPP40_HUMAN	Q	48	ENSP00000369391:E48Q;ENSP00000317998:E48Q	ENSP00000317998:E48Q	E	-	1	0	RPP40	4947460	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	5.523000	0.67099	2.503000	0.84419	0.655000	0.94253	GAA	RPP40	-	NULL	ENSG00000124787		0.358	RPP40-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	RPP40	HGNC	protein_coding	OTTHUMT00000039733.2	106	0.00	0	C	NM_006638		5002461	5002461	-1	no_errors	ENST00000380051	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	1.000	G
SCFD1	23256	genome.wustl.edu	37	14	31188583	31188583	+	Splice_Site	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr14:31188583G>C	ENST00000458591.2	+	21	1963	c.1736G>C	c.(1735-1737)aGc>aCc	p.S579T	SCFD1_ENST00000541123.1_Splice_Site_p.S394T|SCFD1_ENST00000396629.2_Splice_Site_p.S487T|SCFD1_ENST00000544052.2_Splice_Site_p.S512T|SCFD1_ENST00000421551.3_Splice_Site_p.S520T	NM_016106.3	NP_057190.2	Q8WVM8	SCFD1_HUMAN	sec1 family domain containing 1	579					post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|response to hypoxia (GO:0001666)|response to toxic substance (GO:0009636)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle docking involved in exocytosis (GO:0006904)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|Golgi transport complex (GO:0017119)|Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)	syntaxin binding (GO:0019905)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)	13	Hepatocellular(127;0.0877)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.0119)	GBM - Glioblastoma multiforme(265;0.0181)		GGCAATGACAGGTAAGCAGCT	0.318																																						dbGAP											0													110.0	123.0	118.0					14																	31188583		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF110646	CCDS9639.1, CCDS45092.1, CCDS58308.1	14q12	2006-04-04	2004-01-15	2004-01-16	ENSG00000092108	ENSG00000092108			20726	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 163"""	C14orf163			Standard	NM_016106		Approved	RA410, KIAA0917, STXBP1L2, SLY1	uc001wqm.2	Q8WVM8	OTTHUMG00000029420	ENST00000458591.2:c.1736+1G>C	14.37:g.31188583G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Z5|B7Z4U7|B7Z594|O60754|O94990|Q7Z529|Q9BZI3|Q9UNL3|Q9Y6A8	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.S579T	ENST00000458591.2	37	c.1736	CCDS9639.1	14	.	.	.	.	.	.	.	.	.	.	G	9.159	1.018305	0.19355	.	.	ENSG00000092108	ENST00000458591;ENST00000544052;ENST00000421551;ENST00000541123;ENST00000396629	T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.26304	0.0642	N	0.25426	0.745	0.54753	D	0.999987	B;B	0.30439	0.279;0.061	B;B	0.39027	0.288;0.056	T	0.02431	-1.1160	10	0.06099	T	0.92	-42.7406	17.5722	0.87937	0.0:0.0:1.0:0.0	.	520;579	B7Z738;Q8WVM8	.;SCFD1_HUMAN	T	579;512;520;394;487	ENSP00000390783:S579T;ENSP00000443010:S512T;ENSP00000388078:S520T;ENSP00000443537:S394T;ENSP00000379870:S487T	ENSP00000309417:S587T	S	+	2	0	SCFD1	30258334	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.149000	0.77396	2.422000	0.82143	0.491000	0.48974	AGC	SCFD1	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000092108		0.318	SCFD1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	SCFD1	HGNC	protein_coding	OTTHUMT00000276612.3	126	0.00	0	G	NM_182835	Missense_Mutation	31188583	31188583	+1	no_errors	ENST00000458591	ensembl	human	known	69_37n	missense	106	13.11	16	SNP	1.000	C
SCN10A	6336	genome.wustl.edu	37	3	38739417	38739417	+	Missense_Mutation	SNP	G	G	C	rs369137515		TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr3:38739417G>C	ENST00000449082.2	-	27	5293	c.5294C>G	c.(5293-5295)tCg>tGg	p.S1765W		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1765					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TGCAAAGTCCGAGAGAGCAGA	0.493																																						dbGAP											0													76.0	79.0	78.0					3																	38739417		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.5294C>G	3.37:g.38739417G>C	ENSP00000390600:p.Ser1765Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.S1765W	ENST00000449082.2	37	c.5294	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	15.28	2.787199	0.49997	.	.	ENSG00000185313	ENST00000449082	D	0.96168	-3.93	5.38	5.38	0.77491	.	0.076129	0.56097	D	0.000038	D	0.98419	0.9474	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99113	1.0847	10	0.87932	D	0	.	19.3209	0.94237	0.0:0.0:1.0:0.0	.	1765	Q9Y5Y9	SCNAA_HUMAN	W	1765	ENSP00000390600:S1765W	ENSP00000390600:S1765W	S	-	2	0	SCN10A	38714421	1.000000	0.71417	0.966000	0.40874	0.465000	0.32709	7.781000	0.85668	2.800000	0.96347	0.655000	0.94253	TCG	SCN10A	-	NULL	ENSG00000185313		0.493	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	54	0.00	0	G	NM_006514		38739417	38739417	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.999	C
SCN10A	6336	genome.wustl.edu	37	3	38755528	38755528	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr3:38755528T>A	ENST00000449082.2	-	21	3724	c.3725A>T	c.(3724-3726)gAa>gTa	p.E1242V		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	1242					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	GGGAGCCACTTCAGAATATTC	0.507																																						dbGAP											0													118.0	116.0	117.0					3																	38755528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.3725A>T	3.37:g.38755528T>A	ENSP00000390600:p.Glu1242Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.E1242V	ENST00000449082.2	37	c.3725	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	T	13.46	2.242739	0.39598	.	.	ENSG00000185313	ENST00000449082	D	0.97186	-4.28	4.23	3.03	0.35002	Ion transport (1);	0.238566	0.40144	N	0.001172	D	0.96109	0.8732	M	0.77313	2.365	0.19945	N	0.999946	B	0.28470	0.213	B	0.34536	0.185	D	0.92156	0.5732	10	0.87932	D	0	.	9.851	0.41057	0.0:0.0:0.1729:0.8271	.	1242	Q9Y5Y9	SCNAA_HUMAN	V	1242	ENSP00000390600:E1242V	ENSP00000390600:E1242V	E	-	2	0	SCN10A	38730532	1.000000	0.71417	0.011000	0.14972	0.329000	0.28539	7.406000	0.80017	0.628000	0.30357	0.338000	0.21704	GAA	SCN10A	-	pfam_Ion_trans_dom	ENSG00000185313		0.507	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	58	0.00	0	T	NM_006514		38755528	38755528	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	missense	41	38.81	26	SNP	0.293	A
SLC22A4	6583	genome.wustl.edu	37	5	131676322	131676322	+	Silent	SNP	C	C	A	rs201450794		TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr5:131676322C>A	ENST00000200652.3	+	9	1683	c.1509C>A	c.(1507-1509)ctC>ctA	p.L503L	AC034220.3_ENST00000417795.1_RNA|AC034220.3_ENST00000437091.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	503			L -> F (reduces the ability to transport carnitine; dbSNP:rs1050152). {ECO:0000269|PubMed:15107849, ECO:0000269|PubMed:9426230}.		body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	TTGGAATCCTCACCCTTTTTT	0.423																																						dbGAP											0													233.0	215.0	221.0					5																	131676322		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.1509C>A	5.37:g.131676322C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O14546	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L503	ENST00000200652.3	37	c.1509	CCDS4153.1	5																																																																																			SLC22A4	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000197208		0.423	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A4	HGNC	protein_coding	OTTHUMT00000132661.1	140	0.00	0	C	NM_003059		131676322	131676322	+1	no_errors	ENST00000200652	ensembl	human	known	69_37n	silent	107	13.01	16	SNP	0.648	A
SLC6A1	6529	genome.wustl.edu	37	3	11059539	11059539	+	Silent	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr3:11059539G>A	ENST00000287766.4	+	4	670	c.249G>A	c.(247-249)ctG>ctA	p.L83L	SLC6A1_ENST00000536032.1_Intron|SLC6A1-AS1_ENST00000414969.2_RNA|SLC6A1_ENST00000462473.1_3'UTR	NM_003042.3	NP_003033.3	P30531	SC6A1_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 1	83					gamma-aminobutyric acid import (GO:0051939)|learning (GO:0007612)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|neurotransmitter secretion (GO:0007269)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|protein homooligomerization (GO:0051260)|response to calcium ion (GO:0051592)|response to cocaine (GO:0042220)|response to estradiol (GO:0032355)|response to lead ion (GO:0010288)|response to purine-containing compound (GO:0014074)|response to sucrose (GO:0009744)|response to toxic substance (GO:0009636)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell surface (GO:0009986)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	gamma-aminobutyric acid:sodium symporter activity (GO:0005332)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	26		Ovarian(110;0.0392)		OV - Ovarian serous cystadenocarcinoma(96;0.00099)	Clobazam(DB00349)|Tiagabine(DB00906)	GAGCCTTCCTGATCCCCTATT	0.602																																						dbGAP											0													92.0	93.0	93.0					3																	11059539		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2603.1	3p25.3	2013-07-19	2013-07-19		ENSG00000157103	ENSG00000157103		"""Solute carriers"""	11042	protein-coding gene	gene with protein product	"""GABA transporter 1"""	137165	"""solute carrier family 6 (neurotransmitter transporter, GABA), member 1"""			8530094	Standard	NM_003042		Approved	GAT1, GABATR, GABATHG	uc010hdq.3	P30531	OTTHUMG00000044208	ENST00000287766.4:c.249G>A	3.37:g.11059539G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4K8	Silent	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_GABA_GAT1	p.L83	ENST00000287766.4	37	c.249	CCDS2603.1	3																																																																																			SLC6A1	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport	ENSG00000157103		0.602	SLC6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A1	HGNC	protein_coding	OTTHUMT00000102767.2	116	0.00	0	G	NM_003042		11059539	11059539	+1	no_errors	ENST00000287766	ensembl	human	known	69_37n	silent	76	11.63	10	SNP	0.999	A
SMC1A	8243	genome.wustl.edu	37	X	53436124	53436124	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chrX:53436124C>A	ENST00000322213.4	-	9	1541	c.1414G>T	c.(1414-1416)Gaa>Taa	p.E472*	SMC1A_ENST00000375340.6_Nonsense_Mutation_p.E238*	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	472					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						TTATTGATTTCATCAATACGC	0.567																																						dbGAP											0													87.0	59.0	69.0					X																	53436124		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.1414G>T	X.37:g.53436124C>A	ENSP00000323421:p.Glu472*	Somatic		WXS	Illumina GAIIx	Phase_IV	O14995|Q16351|Q2M228	Nonsense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge,prints_Tropomyosin	p.E472*	ENST00000322213.4	37	c.1414	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	C	40	8.254790	0.98727	.	.	ENSG00000072501	ENST00000322213;ENST00000375340	.	.	.	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	16.9938	0.86361	0.0:1.0:0.0:0.0	.	.	.	.	X	472;238	.	ENSP00000323421:E472X	E	-	1	0	SMC1A	53452849	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.937000	0.63513	2.362000	0.80069	0.600000	0.82982	GAA	SMC1A	-	pfam_RecF/RecN/SMC,prints_Tropomyosin	ENSG00000072501		0.567	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	HGNC	protein_coding	OTTHUMT00000056756.2	64	0.00	0	C	NM_006306		53436124	53436124	-1	no_errors	ENST00000322213	ensembl	human	known	69_37n	nonsense	54	11.48	7	SNP	1.000	A
SNUPN	10073	genome.wustl.edu	37	15	75897511	75897511	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr15:75897511C>T	ENST00000564644.1	-	8	1236	c.658G>A	c.(658-660)Gag>Aag	p.E220K	SNUPN_ENST00000564675.1_Missense_Mutation_p.E220K|SNUPN_ENST00000371091.5_Missense_Mutation_p.E262K|SNUPN_ENST00000567134.1_Missense_Mutation_p.E220K|SNUPN_ENST00000308588.5_Missense_Mutation_p.E220K			O95149	SPN1_HUMAN	snurportin 1	220	Necessary for binding to the m3G-cap structure.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein import into nucleus (GO:0006606)|RNA metabolic process (GO:0016070)|snRNA import into nucleus (GO:0061015)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nuclear pore (GO:0005643)	protein transporter activity (GO:0008565)|RNA cap binding (GO:0000339)			endometrium(2)|large_intestine(3)|lung(2)|pancreas(1)	8						TTGGTTTTCTCTCCCAGTCCT	0.403																																						dbGAP											0													159.0	148.0	152.0					15																	75897511		2197	4294	6491	-	-	-	SO:0001583	missense	0			AF039029	CCDS10281.1	15q24.2	2008-02-05	2006-07-14	2006-07-14	ENSG00000169371	ENSG00000169371			14245	protein-coding gene	gene with protein product		607902	"""RNA, U transporter 1"""	RNUT1		9670026	Standard	NM_005701		Approved	SNURPORTIN-1, Snurportin1	uc002bas.3	O95149	OTTHUMG00000142833	ENST00000564644.1:c.658G>A	15.37:g.75897511C>T	ENSP00000454852:p.Glu220Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE34|A8K0B0|D3DW76	Missense_Mutation	SNP	pfam_Snurportin-1_N,pirsf_Snurportin-1,pfscan_Importin-a_IBB	p.E262K	ENST00000564644.1	37	c.784	CCDS10281.1	15	.	.	.	.	.	.	.	.	.	.	-	21.1	4.090705	0.76756	.	.	ENSG00000169371	ENST00000308588;ENST00000371091	.	.	.	5.43	5.43	0.79202	.	0.051347	0.85682	D	0.000000	T	0.59293	0.2183	L	0.53780	1.695	0.80722	D	1	B;B	0.26400	0.027;0.148	B;B	0.24006	0.05;0.047	T	0.55095	-0.8194	9	0.28530	T	0.3	-34.1295	18.2991	0.90157	0.0:1.0:0.0:0.0	.	262;220	C9K0X5;O95149	.;SPN1_HUMAN	K	220;262	.	ENSP00000309831:E220K	E	-	1	0	SNUPN	73684566	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	4.155000	0.58131	2.567000	0.86603	0.531000	0.56144	GAG	SNUPN	-	pirsf_Snurportin-1	ENSG00000169371		0.403	SNUPN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNUPN	HGNC	protein_coding	OTTHUMT00000420332.1	185	0.00	0	C	NM_005701		75897511	75897511	-1	no_errors	ENST00000371091	ensembl	human	known	69_37n	missense	82	14.43	14	SNP	1.000	T
ST8SIA3	51046	genome.wustl.edu	37	18	55027376	55027376	+	Silent	SNP	T	T	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr18:55027376T>C	ENST00000324000.3	+	4	3045	c.1011T>C	c.(1009-1011)caT>caC	p.H337H		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	337					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		TTCCATACCATTACTATGACA	0.468																																						dbGAP											0													113.0	100.0	104.0					18																	55027376		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.1011T>C	18.37:g.55027376T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0F2|Q6B085|Q9NS41	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.H337	ENST00000324000.3	37	c.1011	CCDS32834.1	18																																																																																			ST8SIA3	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000177511		0.468	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ST8SIA3	HGNC	protein_coding	OTTHUMT00000449765.1	59	0.00	0	T	NM_015879		55027376	55027376	+1	no_errors	ENST00000324000	ensembl	human	known	69_37n	silent	71	18.39	16	SNP	1.000	C
SULF1	23213	genome.wustl.edu	37	8	70498615	70498615	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr8:70498615G>A	ENST00000260128.4	+	7	1153	c.436G>A	c.(436-438)Gaa>Aaa	p.E146K	SULF1_ENST00000402687.4_Missense_Mutation_p.E146K|SULF1_ENST00000458141.2_Missense_Mutation_p.E146K|SULF1_ENST00000419716.3_Missense_Mutation_p.E146K	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	146					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			ATACCTCAATGAATATAATGG	0.338																																						dbGAP											0													55.0	60.0	58.0					8																	70498615		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.436G>A	8.37:g.70498615G>A	ENSP00000260128:p.Glu146Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YV8|Q8NCA2|Q9UPS5	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.E146K	ENST00000260128.4	37	c.436	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.210378	0.95069	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716;ENST00000525999	D;D;D;D;D	0.96334	-3.98;-3.98;-3.98;-3.98;-3.98	5.65	5.65	0.86999	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.97343	0.9131	M	0.61703	1.905	0.80722	D	1	B	0.25486	0.127	P	0.47786	0.557	D	0.95356	0.8451	10	0.33141	T	0.24	.	19.717	0.96124	0.0:0.0:1.0:0.0	.	146	Q8IWU6	SULF1_HUMAN	K	146	ENSP00000403040:E146K;ENSP00000260128:E146K;ENSP00000385704:E146K;ENSP00000390315:E146K;ENSP00000431753:E146K	ENSP00000260128:E146K	E	+	1	0	SULF1	70661169	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.837000	0.99465	2.661000	0.90470	0.655000	0.94253	GAA	SULF1	-	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000137573		0.338	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	60	0.00	0	G	NM_015170		70498615	70498615	+1	no_errors	ENST00000260128	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	1.000	A
SVEP1	79987	genome.wustl.edu	37	9	113173528	113173528	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr9:113173528C>A	ENST00000401783.2	-	37	6799	c.6463G>T	c.(6463-6465)Ggc>Tgc	p.G2155C	SVEP1_ENST00000374469.1_Missense_Mutation_p.G2132C|SVEP1_ENST00000297826.5_Missense_Mutation_p.G81C	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2155	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CTTGCATAGCCATTCATGATG	0.512																																						dbGAP											0													109.0	113.0	112.0					9																	113173528		2011	4181	6192	-	-	-	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.6463G>T	9.37:g.113173528C>A	ENSP00000384917:p.Gly2155Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.G2155C	ENST00000401783.2	37	c.6463	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	C	26.9	4.779381	0.90195	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826	T;T;T	0.70399	-0.48;-0.48;0.44	5.84	5.84	0.93424	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	D	0.88596	0.6479	M	0.93106	3.38	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89432	0.3717	10	0.52906	T	0.07	.	20.1466	0.98079	0.0:1.0:0.0:0.0	.	2155	Q4LDE5	SVEP1_HUMAN	C	2155;2132;81	ENSP00000384917:G2155C;ENSP00000363593:G2132C;ENSP00000297826:G81C	ENSP00000297826:G81C	G	-	1	0	SVEP1	112213349	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	7.624000	0.83124	2.779000	0.95612	0.591000	0.81541	GGC	SVEP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000165124		0.512	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		73	0.00	0	C			113173528	113173528	-1	no_errors	ENST00000401783	ensembl	human	known	69_37n	missense	55	24.66	18	SNP	1.000	A
TCHP	84260	genome.wustl.edu	37	12	110341868	110341868	+	Silent	SNP	G	G	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr12:110341868G>C	ENST00000312777.5	+	3	529	c.315G>C	c.(313-315)ctG>ctC	p.L105L	TCHP_ENST00000405876.4_Silent_p.L105L	NM_032300.4	NP_115676.1			trichoplein, keratin filament binding											NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|ovary(1)|skin(2)	22						TGGAGGAGCTGAGGCTGAGCA	0.572																																						dbGAP											0													57.0	51.0	53.0					12																	110341868		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			AK092736	CCDS9137.1	12q24.11	2011-08-25	2006-01-27			ENSG00000139437			28135	protein-coding gene	gene with protein product	"""mitostatin"""	612654				15731013, 20930847	Standard	NM_032300		Approved	MGC10854, TpMs	uc001tpn.3	Q9BT92		ENST00000312777.5:c.315G>C	12.37:g.110341868G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L105	ENST00000312777.5	37	c.315	CCDS9137.1	12																																																																																			TCHP	-	NULL	ENSG00000139437		0.572	TCHP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TCHP	HGNC	protein_coding	OTTHUMT00000403289.1	50	0.00	0	G	NM_032300		110341868	110341868	+1	no_errors	ENST00000312777	ensembl	human	known	69_37n	silent	45	22.41	13	SNP	0.722	C
TET1	80312	genome.wustl.edu	37	10	70360776	70360776	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr10:70360776G>T	ENST00000373644.4	+	3	2162	c.1953G>T	c.(1951-1953)aaG>aaT	p.K651N		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	651	Sufficient for binding to genomic CpG islands.				chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						GGGAAAAGAAGCCCAAAGTTT	0.318																																						dbGAP											0													85.0	97.0	93.0					10																	70360776		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.1953G>T	10.37:g.70360776G>T	ENSP00000362748:p.Lys651Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Missense_Mutation	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.K651N	ENST00000373644.4	37	c.1953	CCDS7281.1	10	.	.	.	.	.	.	.	.	.	.	G	15.85	2.954628	0.53293	.	.	ENSG00000138336	ENST00000373644	T	0.09723	2.95	5.92	5.92	0.95590	.	0.178954	0.39341	N	0.001395	T	0.23289	0.0563	L	0.29908	0.895	0.38257	D	0.941775	D	0.89917	1.0	D	0.85130	0.997	T	0.01162	-1.1432	10	0.72032	D	0.01	.	15.8082	0.78531	0.0:0.0:1.0:0.0	.	651	Q8NFU7	TET1_HUMAN	N	651	ENSP00000362748:K651N	ENSP00000362748:K651N	K	+	3	2	TET1	70030782	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.737000	0.55060	2.795000	0.96236	0.655000	0.94253	AAG	TET1	-	NULL	ENSG00000138336		0.318	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	116	0.85	1	G	NM_030625		70360776	70360776	+1	no_errors	ENST00000373644	ensembl	human	known	69_37n	missense	93	12.26	13	SNP	1.000	T
TFAP2C	7022	genome.wustl.edu	37	20	55209300	55209300	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr20:55209300A>C	ENST00000201031.2	+	5	1141	c.898A>C	c.(898-900)Act>Cct	p.T300P	TFAP2C_ENST00000544508.1_Missense_Mutation_p.T131P	NM_003222.3	NP_003213.1	Q92754	AP2C_HUMAN	transcription factor AP-2 gamma (activating enhancer binding protein 2 gamma)	300	H-S-H (helix-span-helix), dimerization.				cell-cell signaling (GO:0007267)|cerebral cortex development (GO:0021987)|dichotomous subdivision of terminal units involved in mammary gland duct morphogenesis (GO:0060598)|epithelial cell proliferation involved in mammary gland duct elongation (GO:0060750)|forebrain neuron fate commitment (GO:0021877)|germ-line stem cell maintenance (GO:0030718)|hair follicle development (GO:0001942)|keratinocyte development (GO:0003334)|male gonad development (GO:0008584)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epidermis development (GO:0045682)|regulation of gene expression, epigenetic (GO:0040029)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sebaceous gland development (GO:0048733)|somatic stem cell maintenance (GO:0035019)|trophectodermal cell differentiation (GO:0001829)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			Colorectal(105;0.229)			CGCTCATGTGACTCTCCTGAC	0.458																																						dbGAP											0													66.0	64.0	65.0					20																	55209300		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13454.1	20q13.2	2008-07-17	2001-11-28		ENSG00000087510	ENSG00000087510			11744	protein-coding gene	gene with protein product	"""estrogen receptor factor 1"""	601602	"""transcription factor AP-2 gamma (activating enhancer-binding protein 2 gamma)"""			8661133	Standard	NM_003222		Approved	AP2-GAMMA, ERF1, TFAP2G, hAP-2g	uc002xya.3	Q92754	OTTHUMG00000032805	ENST00000201031.2:c.898A>C	20.37:g.55209300A>C	ENSP00000201031:p.Thr300Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWK3|O00685|O00730|Q86V30|Q8IVB6|Q9P1X2	Missense_Mutation	SNP	pfam_TF_AP2_C,prints_TF_AP2_C,prints_TF_AP2_gamma	p.T300P	ENST00000201031.2	37	c.898	CCDS13454.1	20	.	.	.	.	.	.	.	.	.	.	A	22.4	4.291631	0.80914	.	.	ENSG00000087510	ENST00000201031;ENST00000544508	D;D	0.97850	-4.57;-4.57	5.3	5.3	0.74995	Transcription factor AP-2, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.99017	0.9664	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99556	1.0967	10	0.87932	D	0	-9.2691	15.2576	0.73596	1.0:0.0:0.0:0.0	.	300	Q92754	AP2C_HUMAN	P	300;131	ENSP00000201031:T300P;ENSP00000442274:T131P	ENSP00000201031:T300P	T	+	1	0	TFAP2C	54642707	1.000000	0.71417	0.643000	0.29450	0.562000	0.35680	9.210000	0.95106	2.007000	0.58848	0.459000	0.35465	ACT	TFAP2C	-	pfam_TF_AP2_C,prints_TF_AP2_C	ENSG00000087510		0.458	TFAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP2C	HGNC	protein_coding	OTTHUMT00000079823.2	68	0.00	0	A	NM_003222		55209300	55209300	+1	no_errors	ENST00000201031	ensembl	human	known	69_37n	missense	39	40.00	26	SNP	1.000	C
TM6SF2	53345	genome.wustl.edu	37	19	19379481	19379481	+	Silent	SNP	G	G	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr19:19379481G>T	ENST00000389363.4	-	6	639	c.567C>A	c.(565-567)gtC>gtA	p.V189V	AC138430.4_ENST00000586064.2_RNA|TM6SF2_ENST00000586107.1_5'Flank	NM_001001524.2	NP_001001524.2	Q9BZW4	TM6S2_HUMAN	transmembrane 6 superfamily member 2	189						integral component of membrane (GO:0016021)				breast(2)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	14			Epithelial(12;0.0151)			GCTGGCTGAAGACCTTCATGC	0.597																																						dbGAP											0													66.0	68.0	67.0					19																	19379481		1976	4150	6126	-	-	-	SO:0001819	synonymous_variant	0			AF255923	CCDS42528.1	19p13.3-p12	2008-02-05							11861	protein-coding gene	gene with protein product		606563				11124529	Standard	NM_001001524		Approved	Lpr4	uc002nmd.1	Q9BZW4		ENST00000389363.4:c.567C>A	19.37:g.19379481G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0IJ64	Silent	SNP	pfam_Transmembrane_6/97	p.V189	ENST00000389363.4	37	c.567	CCDS42528.1	19																																																																																			TM6SF2	-	NULL	ENSG00000213996		0.597	TM6SF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM6SF2	HGNC	protein_coding	OTTHUMT00000460122.2	54	0.00	0	G	NM_203510		19379481	19379481	-1	no_errors	ENST00000389363	ensembl	human	known	69_37n	silent	44	13.46	7	SNP	0.996	T
TMPRSS5	80975	genome.wustl.edu	37	11	113569711	113569711	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr11:113569711C>T	ENST00000299882.5	-	4	392	c.244G>A	c.(244-246)Ggg>Agg	p.G82R	TMPRSS5_ENST00000536856.1_5'UTR|TMPRSS5_ENST00000538955.1_Missense_Mutation_p.G38R|TMPRSS5_ENST00000540540.1_5'UTR|TMPRSS5_ENST00000544634.1_Missense_Mutation_p.G82R|TMPRSS5_ENST00000544476.1_Missense_Mutation_p.G38R|TMPRSS5_ENST00000545579.1_Missense_Mutation_p.G73R	NM_030770.2	NP_110397.2	Q9H3S3	TMPS5_HUMAN	transmembrane protease, serine 5	82					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	peptidase activity (GO:0008233)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10		all_cancers(61;2.71e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.00014)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.75e-06)|Epithelial(105;6.34e-05)|all cancers(92;0.000502)		TGCAAGGTCCCGGAAATGGGC	0.532																																						dbGAP											0													40.0	43.0	42.0					11																	113569711		1990	4187	6177	-	-	-	SO:0001583	missense	0			AB028140	CCDS44735.1, CCDS73390.1, CCDS73391.1, CCDS73392.1, CCDS73393.1	11q	2010-04-13	2008-07-31		ENSG00000166682	ENSG00000166682		"""Serine peptidases / Transmembrane"""	14908	protein-coding gene	gene with protein product	"""spinesin"""	606751					Standard	NM_030770		Approved	MGC141886, MGC148044	uc001poc.4	Q9H3S3	OTTHUMG00000168186	ENST00000299882.5:c.244G>A	11.37:g.113569711C>T	ENSP00000299882:p.Gly82Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.G82R	ENST00000299882.5	37	c.244	CCDS44735.1	11	.	.	.	.	.	.	.	.	.	.	C	11.08	1.534528	0.27475	.	.	ENSG00000166682	ENST00000299882;ENST00000545579;ENST00000538955;ENST00000544634;ENST00000544476	D;D;D;D;D	0.89485	-2.46;-2.46;-2.4;-2.52;-2.46	3.38	1.45	0.22620	.	0.768239	0.11520	N	0.555752	T	0.78654	0.4317	N	0.22421	0.69	0.09310	N	1	B;B;B	0.24132	0.055;0.098;0.033	B;B;B	0.18871	0.01;0.023;0.007	T	0.60469	-0.7257	10	0.15066	T	0.55	.	9.5725	0.39436	0.0:0.5788:0.4212:0.0	.	82;73;82	F5GYA3;F5GX83;Q9H3S3	.;.;TMPS5_HUMAN	R	82;73;38;82;38	ENSP00000299882:G82R;ENSP00000441104:G73R;ENSP00000445528:G38R;ENSP00000440783:G82R;ENSP00000445930:G38R	ENSP00000299882:G82R	G	-	1	0	TMPRSS5	113074921	0.003000	0.15002	0.000000	0.03702	0.013000	0.08279	1.738000	0.38207	0.421000	0.25980	-0.178000	0.13098	GGG	TMPRSS5	-	NULL	ENSG00000166682		0.532	TMPRSS5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS5	HGNC	protein_coding	OTTHUMT00000398652.1	54	0.00	0	C	NM_030770		113569711	113569711	-1	no_errors	ENST00000299882	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.000	T
TRPV3	162514	genome.wustl.edu	37	17	3430193	3430193	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr17:3430193G>A	ENST00000576742.1	-	12	1853	c.1532C>T	c.(1531-1533)tCg>tTg	p.S511L	TRPV3_ENST00000301365.4_Missense_Mutation_p.S511L|TRPV3_ENST00000572519.1_Missense_Mutation_p.S511L	NM_001258205.1|NM_145068.3	NP_001245134.1|NP_659505.1	Q8NET8	TRPV3_HUMAN	transient receptor potential cation channel, subfamily V, member 3	511					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|negative regulation of hair cycle (GO:0042636)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium channel activity (GO:0005262)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(12)|ovary(5)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	35					Menthol(DB00825)	CTGCAGATCCGAGGGTCTCAG	0.567																																						dbGAP											0													135.0	88.0	104.0					17																	3430193		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF514998	CCDS11029.1, CCDS58500.1	17p13.3	2013-01-10			ENSG00000167723	ENSG00000167723		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18084	protein-coding gene	gene with protein product		607066				12016205, 12077606, 16382100	Standard	NM_001258205		Approved	VRL3	uc002fvr.3	Q8NET8	OTTHUMG00000090695	ENST00000576742.1:c.1532C>T	17.37:g.3430193G>A	ENSP00000461518:p.Ser511Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDW7|Q8NET9|Q8NFH2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel	p.S511L	ENST00000576742.1	37	c.1532	CCDS11029.1	17	.	.	.	.	.	.	.	.	.	.	g	15.86	2.958898	0.53400	.	.	ENSG00000167723	ENST00000381913;ENST00000301365;ENST00000430263	D	0.89415	-2.51	4.93	4.93	0.64822	.	0.000000	0.56097	D	0.000031	D	0.89015	0.6595	N	0.12182	0.205	0.45704	D	0.998612	D;B;B;D;B;D;D;D	0.89917	0.999;0.449;0.125;1.0;0.125;0.998;0.999;0.999	D;B;B;D;B;D;D;D	0.87578	0.927;0.119;0.058;0.998;0.058;0.986;0.994;0.99	D	0.89293	0.3620	10	0.35671	T	0.21	-5.2646	17.5751	0.87946	0.0:0.0:1.0:0.0	.	93;495;495;511;495;511;511;511	B4E3L1;E7EV24;B7ZKP9;Q2M3L1;B7ZKP6;Q8NET8-3;Q8NET8;Q8NET8-2	.;.;.;.;.;.;TRPV3_HUMAN;.	L	511;511;495	ENSP00000301365:S511L	ENSP00000301365:S511L	S	-	2	0	TRPV3	3376943	1.000000	0.71417	0.818000	0.32626	0.993000	0.82548	6.524000	0.73791	2.482000	0.83794	0.638000	0.83543	TCG	TRPV3	-	NULL	ENSG00000167723		0.567	TRPV3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPV3	HGNC	protein_coding	OTTHUMT00000207379.2	56	0.00	0	G	NM_145068		3430193	3430193	-1	no_errors	ENST00000301365	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.989	A
TSHZ3	57616	genome.wustl.edu	37	19	31767666	31767666	+	Silent	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr19:31767666G>A	ENST00000240587.4	-	2	3360	c.3033C>T	c.(3031-3033)acC>acT	p.T1011T		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	1011					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					TAATCTGTTCGGTGGACAGTT	0.502																																						dbGAP											0													146.0	125.0	132.0					19																	31767666		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.3033C>T	19.37:g.31767666G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.T1011	ENST00000240587.4	37	c.3033	CCDS12421.2	19																																																																																			TSHZ3	-	NULL	ENSG00000121297		0.502	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	125	0.79	1	G	NM_020856		31767666	31767666	-1	no_errors	ENST00000240587	ensembl	human	known	69_37n	silent	63	37.62	38	SNP	0.175	A
TTN	7273	genome.wustl.edu	37	2	179458942	179458942	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:179458942C>T	ENST00000591111.1	-	247	53479	c.53255G>A	c.(53254-53256)aGa>aAa	p.R17752K	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.R16825K|TTN-AS1_ENST00000590743.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R19393K|TTN_ENST00000359218.5_Missense_Mutation_p.R10453K|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.R10520K|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.R10328K|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000591332.1_RNA			Q8WZ42	TITIN_HUMAN	titin	17752	Ig-like 104.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAGCTTATCTCTGAAGTCGAG	0.408																																						dbGAP											0													65.0	62.0	63.0					2																	179458942		1894	4119	6013	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.53255G>A	2.37:g.179458942C>T	ENSP00000465570:p.Arg17752Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R16825K	ENST00000591111.1	37	c.50474		2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.985625	0.74589	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.63417	-0.04;0.2;0.19;0.17	6.17	6.17	0.99709	Immunoglobulin subtype (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.76463	0.3991	L	0.48218	1.51	0.58432	D	0.999997	D;D;D;D	0.69078	0.997;0.997;0.997;0.997	D;D;D;D	0.79108	0.992;0.992;0.992;0.992	T	0.75789	-0.3194	9	0.87932	D	0	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	10328;10453;10520;17752	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	16825;10328;10520;10453;10326	ENSP00000343764:R16825K;ENSP00000434586:R10328K;ENSP00000340554:R10520K;ENSP00000352154:R10453K	ENSP00000340554:R10520K	R	-	2	0	TTN	179167188	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.760000	0.85248	2.941000	0.99782	0.655000	0.94253	AGA	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	66	0.00	0	C	NM_133378		179458942	179458942	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179466175	179466175	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr2:179466175C>G	ENST00000591111.1	-	237	50850	c.50626G>C	c.(50626-50628)Gag>Cag	p.E16876Q	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E15949Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E18517Q|TTN_ENST00000359218.5_Missense_Mutation_p.E9577Q|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E9644Q|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E9452Q|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589234.1_RNA			Q8WZ42	TITIN_HUMAN	titin	16876	Fibronectin type-III 22. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCCTCTTCTCAATAACATAG	0.443																																						dbGAP											0													152.0	145.0	147.0					2																	179466175		1946	4128	6074	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.50626G>C	2.37:g.179466175C>G	ENSP00000465570:p.Glu16876Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E15949Q	ENST00000591111.1	37	c.47845		2	.	.	.	.	.	.	.	.	.	.	C	15.78	2.934140	0.52866	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57436	0.4;0.4;0.4;0.4	5.85	5.85	0.93711	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.70971	0.3285	L	0.53780	1.695	0.58432	D	0.999995	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.71397	-0.4605	9	0.87932	D	0	.	20.1588	0.98128	0.0:1.0:0.0:0.0	.	9452;9577;9644;16876	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	15949;9452;9644;9577;9452	ENSP00000343764:E15949Q;ENSP00000434586:E9452Q;ENSP00000340554:E9644Q;ENSP00000352154:E9577Q	ENSP00000340554:E9644Q	E	-	1	0	TTN	179174420	1.000000	0.71417	0.991000	0.47740	0.955000	0.61496	7.818000	0.86416	2.770000	0.95276	0.563000	0.77884	GAG	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.443	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	126	0.00	0	C	NM_133378		179466175	179466175	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	110	17.29	23	SNP	1.000	G
UBA52	7311	genome.wustl.edu	37	19	18685883	18685883	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr19:18685883C>T	ENST00000442744.2	+	5	368	c.310C>T	c.(310-312)Cac>Tac	p.H104Y	UBA52_ENST00000596304.1_Missense_Mutation_p.H104Y|CRLF1_ENST00000594325.1_Intron|UBA52_ENST00000430157.2_Missense_Mutation_p.H104Y|UBA52_ENST00000596273.1_Missense_Mutation_p.H104Y|UBA52_ENST00000597451.1_Missense_Mutation_p.H104Y|UBA52_ENST00000595683.1_Missense_Mutation_p.H104Y|UBA52_ENST00000599595.1_Missense_Mutation_p.H104Y|UBA52_ENST00000599551.1_Missense_Mutation_p.H104Y|UBA52_ENST00000598780.1_Missense_Mutation_p.H104Y|UBA52_ENST00000595158.1_Missense_Mutation_p.H104Y	NM_001033930.1	NP_001029102.1	P62987	RL40_HUMAN	ubiquitin A-52 residue ribosomal protein fusion product 1	104					activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|viral transcription (GO:0019083)|virion assembly (GO:0019068)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|ribosome (GO:0005840)	structural constituent of ribosome (GO:0003735)			endometrium(1)|large_intestine(2)	3						TGCTCGCCTTCACCCTCGTGC	0.582																																						dbGAP											0													110.0	93.0	99.0					19																	18685883		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12382.1	19p13.1-p12	2011-04-06			ENSG00000221983	ENSG00000221983		"""L ribosomal proteins"""	12458	protein-coding gene	gene with protein product	"""ribosomal protein L40"", ""ubiquitin-52 amino acid fusion protein"", ""ubiquitin carboxyl extension protein 52"", ""60S ribosomal protein L40"", ""ubiquitin-CEP52"""	191321				8188300	Standard	XM_005260051		Approved	RPL40, CEP52, HUBCEP52, MGC57125, MGC126879, MGC126881, L40	uc002njs.3	P62987		ENST00000442744.2:c.310C>T	19.37:g.18685883C>T	ENSP00000388107:p.His104Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	P02248|P02249|P02250|P14793|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Missense_Mutation	SNP	pfam_Ubiquitin,pfam_Ribosomal_L40e,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.H104Y	ENST00000442744.2	37	c.310	CCDS12382.1	19	.	.	.	.	.	.	.	.	.	.	C	23.6	4.431552	0.83776	.	.	ENSG00000221983	ENST00000442744;ENST00000430157	T;T	0.75477	-0.94;-0.94	4.73	4.73	0.59995	.	0.000000	0.85682	D	0.000000	T	0.78635	0.4314	M	0.72894	2.215	0.54753	D	0.999986	B	0.29301	0.241	B	0.40038	0.317	T	0.79757	-0.1669	10	0.56958	D	0.05	-4.6705	15.164	0.72807	0.0:1.0:0.0:0.0	.	104	P62987	RL40_HUMAN	Y	104	ENSP00000388107:H104Y;ENSP00000396910:H104Y	ENSP00000396910:H104Y	H	+	1	0	UBA52	18546883	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	7.357000	0.79456	2.165000	0.68154	0.462000	0.41574	CAC	UBA52	-	pfam_Ribosomal_L40e	ENSG00000221983		0.582	UBA52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA52	HGNC	protein_coding	OTTHUMT00000465117.2	55	0.00	0	C	NM_003333		18685883	18685883	+1	no_errors	ENST00000430157	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	T
UROC1	131669	genome.wustl.edu	37	3	126228489	126228489	+	Missense_Mutation	SNP	G	G	T	rs556450823	byFrequency	TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr3:126228489G>T	ENST00000290868.2	-	3	343	c.290C>A	c.(289-291)aCg>aAg	p.T97K	UROC1_ENST00000383579.3_Missense_Mutation_p.T97K	NM_144639.2	NP_653240.1	Q96N76	HUTU_HUMAN	urocanate hydratase 1	97					cellular nitrogen compound metabolic process (GO:0034641)|histidine catabolic process (GO:0006548)|histidine catabolic process to glutamate and formamide (GO:0019556)|histidine catabolic process to glutamate and formate (GO:0019557)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	urocanate hydratase activity (GO:0016153)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(1)|skin(1)	39				GBM - Glioblastoma multiforme(114;0.17)		AGCCACTTTCGTCTGGCAGGG	0.612																																						dbGAP											0													42.0	30.0	34.0					3																	126228489		2128	4118	6246	-	-	-	SO:0001583	missense	0			AK055862	CCDS3038.1, CCDS54636.1	3q21.2	2012-08-21	2012-08-21		ENSG00000159650	ENSG00000159650	4.2.1.49		26444	protein-coding gene	gene with protein product	"""urocanase 1"""	613012	"""urocanase domain containing 1"""			19304569	Standard	NM_144639		Approved	FLJ31300, HMFN0320	uc010hsi.2	Q96N76	OTTHUMG00000162753	ENST00000290868.2:c.290C>A	3.37:g.126228489G>T	ENSP00000290868:p.Thr97Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE13|Q14C64|Q68CJ7	Missense_Mutation	SNP	pfam_Urocanase_dom,superfamily_Urocanase_dom,pirsf_Urocanase	p.T97K	ENST00000290868.2	37	c.290	CCDS3038.1	3	.	.	.	.	.	.	.	.	.	.	G	13.74	2.328661	0.41197	.	.	ENSG00000159650	ENST00000290868;ENST00000383579	T;T	0.42131	0.98;0.98	5.13	2.36	0.29203	Urocanase domain (2);	0.216752	0.47093	D	0.000253	T	0.62962	0.2471	M	0.85299	2.745	0.49798	D	0.999824	D;P	0.89917	1.0;0.943	D;P	0.87578	0.998;0.82	T	0.63646	-0.6590	10	0.87932	D	0	-1.7954	7.8133	0.29243	0.2743:0.0:0.7257:0.0	.	97;97	E9PE13;Q96N76	.;HUTU_HUMAN	K	97	ENSP00000290868:T97K;ENSP00000373073:T97K	ENSP00000290868:T97K	T	-	2	0	UROC1	127711179	1.000000	0.71417	0.497000	0.27552	0.013000	0.08279	3.002000	0.49496	0.562000	0.29204	-0.339000	0.08088	ACG	UROC1	-	pfam_Urocanase_dom,superfamily_Urocanase_dom,pirsf_Urocanase	ENSG00000159650		0.612	UROC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROC1	HGNC	protein_coding	OTTHUMT00000370325.2	31	0.00	0	G	NM_144639		126228489	126228489	-1	no_errors	ENST00000290868	ensembl	human	known	69_37n	missense	14	50.00	14	SNP	0.936	T
VEGFC	7424	genome.wustl.edu	37	4	177650829	177650829	+	Silent	SNP	G	G	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr4:177650829G>T	ENST00000280193.2	-	2	634	c.219C>A	c.(217-219)ctC>ctA	p.L73L	VEGFC_ENST00000507638.1_5'Flank	NM_005429.2	NP_005420	P49767	VEGFC_HUMAN	vascular endothelial growth factor C	73					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|induction of positive chemotaxis (GO:0050930)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of blood pressure (GO:0045776)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of mast cell chemotaxis (GO:0060754)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of protein secretion (GO:0050714)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|response to drug (GO:0042493)|signal transduction (GO:0007165)|substrate-dependent cell migration (GO:0006929)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)	p.L73L(1)		biliary_tract(1)|cervix(1)|large_intestine(6)|lung(28)|pancreas(1)|prostate(2)|skin(2)	41		Breast(14;0.000223)|Renal(120;0.00988)|Prostate(90;0.00996)|Melanoma(52;0.0101)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;1.59e-18)|Epithelial(43;3.68e-16)|OV - Ovarian serous cystadenocarcinoma(60;8.52e-09)|GBM - Glioblastoma multiforme(59;0.000546)|STAD - Stomach adenocarcinoma(60;0.00308)|Colorectal(24;0.025)|COAD - Colon adenocarcinoma(29;0.0359)|LUSC - Lung squamous cell carcinoma(193;0.0397)		ATTCTGGGTAGAGTACAGTCA	0.438																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											115.0	104.0	107.0					4																	177650829		1924	4137	6061	-	-	-	SO:0001819	synonymous_variant	0			BC035212	CCDS43285.1	4q34.3	2013-02-18				ENSG00000150630			12682	protein-coding gene	gene with protein product	"""vascular endothelial growth factor-related protein"""	601528				8617204	Standard	NM_005429		Approved	VRP	uc003ius.1	P49767		ENST00000280193.2:c.219C>A	4.37:g.177650829G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Q8	Silent	SNP	pfam_PD_growth_factor,pfam_CXCXC_repeat,smart_PD_growth_factor,pfscan_PD_growth_factor	p.L73	ENST00000280193.2	37	c.219	CCDS43285.1	4																																																																																			VEGFC	-	NULL	ENSG00000150630		0.438	VEGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VEGFC	HGNC	protein_coding	OTTHUMT00000361991.1	128	0.78	1	G	NM_005429		177650829	177650829	-1	no_errors	ENST00000280193	ensembl	human	known	69_37n	silent	57	18.57	13	SNP	0.993	T
VPS33B	26276	genome.wustl.edu	37	15	91550259	91550259	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr15:91550259C>G	ENST00000333371.3	-	9	974	c.621G>C	c.(619-621)tgG>tgC	p.W207C	VPS33B_ENST00000535906.1_Missense_Mutation_p.W180C|VPS33B_ENST00000535843.1_Missense_Mutation_p.W116C	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	207					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					CCAGGTTCCTCCACAATTCAT	0.532																																						dbGAP											0													102.0	107.0	105.0					15																	91550259		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.621G>C	15.37:g.91550259C>G	ENSP00000327650:p.Trp207Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.W207C	ENST00000333371.3	37	c.621	CCDS10369.1	15	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428920	0.83667	.	.	ENSG00000184056	ENST00000333371;ENST00000535906;ENST00000535843;ENST00000537510	T;T;T	0.76060	-0.99;-0.99;-0.99	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.75874	0.3909	L	0.28274	0.84	0.80722	D	1	D;D	0.59357	0.981;0.985	P;P	0.55667	0.673;0.781	T	0.78897	-0.2023	10	0.72032	D	0.01	-2.5771	18.6538	0.91441	0.0:1.0:0.0:0.0	.	180;207	F5H008;Q9H267	.;VP33B_HUMAN	C	207;180;116;162	ENSP00000327650:W207C;ENSP00000444053:W180C;ENSP00000446267:W116C	ENSP00000327650:W207C	W	-	3	0	VPS33B	89351263	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	6.618000	0.74214	2.735000	0.93741	0.655000	0.94253	TGG	VPS33B	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000184056		0.532	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33B	HGNC	protein_coding	OTTHUMT00000313496.1	57	0.00	0	C	NM_018668		91550259	91550259	-1	no_errors	ENST00000333371	ensembl	human	known	69_37n	missense	48	21.31	13	SNP	1.000	G
WDR66	144406	genome.wustl.edu	37	12	122361793	122361793	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr12:122361793C>T	ENST00000288912.4	+	3	1498	c.644C>T	c.(643-645)tCc>tTc	p.S215F	WDR66_ENST00000397454.2_Missense_Mutation_p.S215F	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	215							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		AGGAGAGTATCCGACATCCAG	0.522																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													103.0	102.0	102.0					12																	122361793		1910	4124	6034	-	-	-	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.644C>T	12.37:g.122361793C>T	ENSP00000288912:p.Ser215Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.S215F	ENST00000288912.4	37	c.644	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	C	9.641	1.138903	0.21123	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.06068	3.35;3.36	2.94	2.01	0.26516	.	4.873430	0.01050	U	0.004441	T	0.05181	0.0138	N	0.22421	0.69	0.09310	N	1	P	0.38420	0.63	B	0.29353	0.101	T	0.34304	-0.9834	10	0.54805	T	0.06	.	6.8002	0.23746	0.0:0.8531:0.0:0.1469	.	215	Q8TBY9	WDR66_HUMAN	F	215	ENSP00000288912:S215F;ENSP00000380595:S215F	ENSP00000288912:S215F	S	+	2	0	WDR66	120846176	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	-0.823000	0.04443	0.513000	0.28278	0.460000	0.39030	TCC	WDR66	-	NULL	ENSG00000158023		0.522	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	53	0.00	0	C	NM_144668		122361793	122361793	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	0.009	T
WDR66	144406	genome.wustl.edu	37	12	122361879	122361880	+	Frame_Shift_Ins	INS	-	-	C			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr12:122361879_122361880insC	ENST00000288912.4	+	3	1584_1585	c.730_731insC	c.(730-732)accfs	p.T244fs	WDR66_ENST00000397454.2_Frame_Shift_Ins_p.T244fs	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	244							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		GGATAAAAGCACCCCGGTGTAT	0.475																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.734dupC	12.37:g.122361883_122361883dupC	ENSP00000288912:p.Thr244fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Frame_Shift_Ins	INS	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.V246fs	ENST00000288912.4	37	c.730_731	CCDS41853.1	12																																																																																			WDR66	-	NULL	ENSG00000158023		0.475	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	26	0.00	0	-	NM_144668		122361879	122361880	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	frame_shift_ins	20	16.67	4	INS	0.000:0.001	C
XPOT	11260	genome.wustl.edu	37	12	64815079	64815079	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr12:64815079T>A	ENST00000332707.5	+	9	1437	c.908T>A	c.(907-909)aTa>aAa	p.I303K		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	303	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		CAGTCATTGATAGTTAGTTGG	0.368																																						dbGAP											0													122.0	126.0	124.0					12																	64815079		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.908T>A	12.37:g.64815079T>A	ENSP00000327821:p.Ile303Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.I303K	ENST00000332707.5	37	c.908	CCDS31852.1	12	.	.	.	.	.	.	.	.	.	.	T	16.22	3.060970	0.55432	.	.	ENSG00000184575	ENST00000332707	T	0.25749	1.78	4.92	4.92	0.64577	Armadillo-type fold (1);	0.047201	0.85682	D	0.000000	T	0.24547	0.0595	L	0.50333	1.59	0.80722	D	1	P	0.49961	0.93	B	0.39299	0.296	T	0.03910	-1.0993	9	.	.	.	.	15.2733	0.73723	0.0:0.0:0.0:1.0	.	303	O43592	XPOT_HUMAN	K	303	ENSP00000327821:I303K	.	I	+	2	0	XPOT	63101346	1.000000	0.71417	0.996000	0.52242	0.076000	0.17211	6.078000	0.71282	2.152000	0.67230	0.533000	0.62120	ATA	XPOT	-	superfamily_ARM-type_fold	ENSG00000184575		0.368	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPOT	HGNC	protein_coding	OTTHUMT00000401122.1	109	0.00	0	T	NM_007235		64815079	64815079	+1	no_errors	ENST00000332707	ensembl	human	known	69_37n	missense	84	14.29	14	SNP	1.000	A
XPOT	11260	genome.wustl.edu	37	12	64815164	64815164	+	Silent	SNP	G	G	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr12:64815164G>A	ENST00000332707.5	+	9	1522	c.993G>A	c.(991-993)ctG>ctA	p.L331L		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	331	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		AAGTGGCACTGATGTTGCAGC	0.318																																						dbGAP											0													121.0	124.0	123.0					12																	64815164		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.993G>A	12.37:g.64815164G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH1|O43784|Q8WUG2|Q9BVS7	Silent	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.L331	ENST00000332707.5	37	c.993	CCDS31852.1	12																																																																																			XPOT	-	superfamily_ARM-type_fold	ENSG00000184575		0.318	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPOT	HGNC	protein_coding	OTTHUMT00000401122.1	122	0.00	0	G	NM_007235		64815164	64815164	+1	no_errors	ENST00000332707	ensembl	human	known	69_37n	silent	108	14.29	18	SNP	0.867	A
ZNF391	346157	genome.wustl.edu	37	6	27369106	27369106	+	Silent	SNP	C	C	A			TCGA-E9-A1R4-01A-21D-A14G-09	TCGA-E9-A1R4-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	15d9c916-a12e-48a0-8a0f-8c240c54bd37	769c4e3f-5ee1-4a17-840e-84cfdba07434	g.chr6:27369106C>A	ENST00000244576.4	+	3	1502	c.957C>A	c.(955-957)tcC>tcA	p.S319S	RP1-153G14.4_ENST00000607727.1_lincRNA	NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	319					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						GAAGCTCATCCCTTATTATTC	0.463																																						dbGAP											0													73.0	76.0	75.0					6																	27369106		2056	4240	6296	-	-	-	SO:0001819	synonymous_variant	0			BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.957C>A	6.37:g.27369106C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DH77	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S319	ENST00000244576.4	37	c.957	CCDS43429.1	6																																																																																			ZNF391	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000124613		0.463	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF391	HGNC	protein_coding	OTTHUMT00000040145.2	58	0.00	0	C	NM_001076781		27369106	27369106	+1	no_errors	ENST00000244576	ensembl	human	known	69_37n	silent	44	16.98	9	SNP	0.003	A
