#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABR	29	genome.wustl.edu	37	17	1028559	1028559	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr17:1028559delC	ENST00000302538.5	-	2	351	c.205delG	c.(205-207)gatfs	p.D69fs	ABR_ENST00000574437.1_Frame_Shift_Del_p.D23fs|ABR_ENST00000544583.2_Frame_Shift_Del_p.D23fs	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	69					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		GAGACGCCATCCCCCCCGCCC	0.677																																					Esophageal Squamous(197;2016 2115 4129 29033 46447)	dbGAP											0													66.0	66.0	66.0					17																	1028559		2202	4300	6502	-	-	-	SO:0001589	frameshift_variant	0			L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.205delG	17.37:g.1028559delC	ENSP00000303909:p.Asp69fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RhoGAP_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.D69fs	ENST00000302538.5	37	c.205	CCDS10999.1	17																																																																																			ABR	-	superfamily_DH-domain	ENSG00000159842		0.677	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	HGNC	protein_coding	OTTHUMT00000206675.4	17	0.00	0	C			1028559	1028559	-1	no_errors	ENST00000302538	ensembl	human	known	69_37n	frame_shift_del	15	16.67	3	DEL	1.000	-
ACAN	176	genome.wustl.edu	37	15	89388987	89388987	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr15:89388987G>T	ENST00000561243.1	+	6	1303	c.1303G>T	c.(1303-1305)Gag>Tag	p.E435*	ACAN_ENST00000352105.7_Nonsense_Mutation_p.E435*|ACAN_ENST00000558207.1_Nonsense_Mutation_p.E435*|ACAN_ENST00000439576.2_Nonsense_Mutation_p.E435*|ACAN_ENST00000559004.1_Nonsense_Mutation_p.E435*			P16112	PGCA_HUMAN	aggrecan	435					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GGTTGAGAATGAGACTGGAGA	0.632																																						dbGAP											0													31.0	37.0	35.0					15																	89388987		2038	4185	6223	-	-	-	SO:0001587	stop_gained	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.1303G>T	15.37:g.89388987G>T	ENSP00000453342:p.Glu435*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Nonsense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EGF-like,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.E435*	ENST00000561243.1	37	c.1303	CCDS53970.1	15	.	.	.	.	.	.	.	.	.	.	G	14.74	2.626144	0.46840	.	.	ENSG00000157766	ENST00000439576;ENST00000352105;ENST00000268134	.	.	.	4.96	-5.37	0.02681	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	0.5678	8.2971	0.31993	0.6557:0.1282:0.2161:0.0	.	.	.	.	X	435	.	ENSP00000268134:E435X	E	+	1	0	ACAN	87189991	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.269000	0.08596	-1.068000	0.03156	-0.218000	0.12543	GAG	ACAN	-	NULL	ENSG00000157766		0.632	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	13	0.00	0	G	NM_001135		89388987	89388987	+1	no_errors	ENST00000439576	ensembl	human	known	69_37n	nonsense	13	43.48	10	SNP	0.000	T
AGPAT6	137964	genome.wustl.edu	37	8	41467297	41467297	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr8:41467297G>A	ENST00000396987.3	+	4	1286	c.359G>A	c.(358-360)cGg>cAg	p.R120Q	RP11-360L9.8_ENST00000581909.1_RNA	NM_178819.3	NP_848934.1	Q86UL3	GPAT4_HUMAN	1-acylglycerol-3-phosphate O-acyltransferase 6	120					acyl-CoA metabolic process (GO:0006637)|CDP-diacylglycerol biosynthetic process (GO:0016024)|cellular lipid metabolic process (GO:0044255)|diacylglycerol metabolic process (GO:0046339)|fatty acid metabolic process (GO:0006631)|glandular epithelial cell maturation (GO:0002071)|glycerophospholipid biosynthetic process (GO:0046474)|lactation (GO:0007595)|lipid biosynthetic process (GO:0008610)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)			endometrium(3)|kidney(2)|large_intestine(3)|lung(6)	14	Ovarian(28;0.00769)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.0131)|Lung NSC(58;0.0363)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	OV - Ovarian serous cystadenocarcinoma(14;0.00126)|Colorectal(10;0.0014)|Lung(22;0.00177)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0147)			TACTTTTGCCGGAAAGGAATG	0.443																																						dbGAP											0													105.0	99.0	101.0					8																	41467297		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF406612	CCDS6117.1	8p11.21	2013-02-05	2013-02-05			ENSG00000158669	2.3.1.15	"""1-acylglycerol-3-phosphate O-acyltransferases"""	20880	protein-coding gene	gene with protein product	"""lysophosphatidic acid acyltransferase, zeta"""	608143	"""1-acylglycerol-3-phosphate O-acyltransferase 6 (lysophosphatidic acid acyltransferase, zeta)"""			12938015	Standard	NM_178819		Approved	DKFZp586M1819, LPAAT-zeta	uc003xnz.2	Q86UL3		ENST00000396987.3:c.359G>A	8.37:g.41467297G>A	ENSP00000380184:p.Arg120Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86V89	Missense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.R120Q	ENST00000396987.3	37	c.359	CCDS6117.1	8	.	.	.	.	.	.	.	.	.	.	G	28.8	4.947472	0.92593	.	.	ENSG00000158669	ENST00000396987;ENST00000519853	T	0.45276	0.9	4.82	4.82	0.62117	.	0.000000	0.85682	D	0.000000	T	0.36413	0.0966	L	0.38531	1.155	0.80722	D	1	B	0.29432	0.244	B	0.26310	0.068	T	0.28235	-1.0050	10	0.59425	D	0.04	.	17.4163	0.87500	0.0:0.0:1.0:0.0	.	120	Q86UL3	GPAT4_HUMAN	Q	120;74	ENSP00000380184:R120Q	ENSP00000380184:R120Q	R	+	2	0	AGPAT6	41586454	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.597000	0.98273	2.643000	0.89663	0.563000	0.77884	CGG	AGPAT6	-	NULL	ENSG00000158669		0.443	AGPAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGPAT6	HGNC	protein_coding	OTTHUMT00000377158.1	45	0.00	0	G	NM_178819		41467297	41467297	+1	no_errors	ENST00000396987	ensembl	human	known	69_37n	missense	7	53.33	8	SNP	1.000	A
AHCTF1	25909	genome.wustl.edu	37	1	247007193	247007193	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:247007193T>G	ENST00000391829.2	-	34	6552	c.6429A>C	c.(6427-6429)ttA>ttC	p.L2143F	AHCTF1_ENST00000326225.3_Missense_Mutation_p.L2152F|AHCTF1_ENST00000366508.1_Missense_Mutation_p.L2178F|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	2143	Disordered. {ECO:0000250}.|Necessary for nuclear localization. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			AATCCGAAACTAATTCTTTCA	0.318																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											0													72.0	70.0	71.0					1																	247007193		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.6429A>C	1.37:g.247007193T>G	ENSP00000375705:p.Leu2143Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.L2152F	ENST00000391829.2	37	c.6456		1	.	.	.	.	.	.	.	.	.	.	T	15.21	2.766535	0.49574	.	.	ENSG00000153207	ENST00000366508;ENST00000326225;ENST00000391829	T;T;T	0.55588	0.51;0.52;0.52	5.03	-2.25	0.06888	.	0.253497	0.27604	N	0.018631	T	0.60907	0.2305	M	0.66939	2.045	0.32287	N	0.566793	D;D	0.89917	1.0;0.999	D;D	0.77004	0.989;0.942	T	0.62695	-0.6800	10	0.54805	T	0.06	-4.7351	5.6475	0.17598	0.0:0.334:0.1384:0.5275	.	2178;2143	Q8WYP5-2;Q8WYP5	.;ELYS_HUMAN	F	2178;2152;2143	ENSP00000355464:L2178F;ENSP00000355465:L2152F;ENSP00000375705:L2143F	ENSP00000355465:L2152F	L	-	3	2	AHCTF1	245073816	0.882000	0.30256	0.977000	0.42913	0.466000	0.32739	-0.341000	0.07811	-0.605000	0.05753	-0.435000	0.05868	TTA	AHCTF1	-	NULL	ENSG00000153207		0.318	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		84	0.00	0	T	NM_015446		247007193	247007193	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	missense	119	26.09	42	SNP	0.993	G
ANO4	121601	genome.wustl.edu	37	12	101490420	101490420	+	Silent	SNP	C	C	T	rs572173243		TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr12:101490420C>T	ENST00000392977.3	+	19	2055	c.1845C>T	c.(1843-1845)ctC>ctT	p.L615L	ANO4_ENST00000550015.1_Silent_p.L135L|ANO4_ENST00000392979.3_Silent_p.L580L|ANO4_ENST00000299222.9_Silent_p.L135L			Q32M45	ANO4_HUMAN	anoctamin 4	615					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						CATTCTTCCTCGGAAGGTAAG	0.502										HNSCC(74;0.22)			C|||	1	0.000199681	0.0	0.0	5008	,	,		21263	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													98.0	89.0	92.0					12																	101490420		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.1845C>T	12.37:g.101490420C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAJ0|Q8NB39|Q8NB53	Silent	SNP	pfam_Anoctamin	p.L615	ENST00000392977.3	37	c.1845		12																																																																																			ANO4	-	pfam_Anoctamin	ENSG00000151572		0.502	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	44	0.00	0	C	NM_178826		101490420	101490420	+1	no_errors	ENST00000392977	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	0.269	T
ATP2B4	493	genome.wustl.edu	37	1	203680228	203680228	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:203680228C>T	ENST00000357681.5	+	12	3146	c.2023C>T	c.(2023-2025)Cgc>Tgc	p.R675C	ATP2B4_ENST00000367218.3_Missense_Mutation_p.R675C|ATP2B4_ENST00000341360.2_Missense_Mutation_p.R675C|ATP2B4_ENST00000367219.3_Missense_Mutation_p.R663C|ATP2B4_ENST00000391954.2_Missense_Mutation_p.R675C	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	675					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			GGACCCTGTGCGCCCAGAGGT	0.567																																						dbGAP											0													72.0	66.0	68.0					1																	203680228		2203	4300	6503	-	-	-	SO:0001583	missense	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.2023C>T	1.37:g.203680228C>T	ENSP00000350310:p.Arg675Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.R675C	ENST00000357681.5	37	c.2023	CCDS1440.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.291056	0.80914	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82	5.35	5.35	0.76521	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.53938	D	0.000060	D	0.96309	0.8796	H	0.99525	4.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.998	D	0.98134	1.0432	10	0.87932	D	0	-18.0262	19.0388	0.92989	0.0:1.0:0.0:0.0	.	675;675;675	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	C	675;675;663;675;675	ENSP00000350310:R675C;ENSP00000356187:R675C;ENSP00000356188:R663C;ENSP00000375816:R675C;ENSP00000340930:R675C	ENSP00000340930:R675C	R	+	1	0	ATP2B4	201946851	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.052000	0.49893	2.655000	0.90218	0.655000	0.94253	CGC	ATP2B4	-	pfam_Dehalogen-like_hydro,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA	ENSG00000058668		0.567	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	27	0.00	0	C	NM_001001396		203680228	203680228	+1	no_errors	ENST00000357681	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	1.000	T
CATSPER2	117155	genome.wustl.edu	37	15	43927354	43927354	+	Intron	DEL	T	T	-	rs565591354		TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr15:43927354delT	ENST00000321596.5	-	10	1378				CATSPER2_ENST00000354127.4_Intron|STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000381761.1_Intron|CATSPER2_ENST00000396879.1_Intron|RNU6-610P_ENST00000384264.1_RNA|CATSPER2_ENST00000355438.2_Intron			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2						calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		acttaggatcttttttttttt	0.393											OREG0003957	type=REGULATORY REGION|Gene=AK093318|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.1178+203A>-	15.37:g.43927354delT		Somatic	920	WXS	Illumina GAIIx	Phase_IV	Q8NHT9|Q96P54|Q96P55	Splice_Site	DEL	-	e2-2	ENST00000321596.5	37	c.34-2	CCDS10099.1	15																																																																																			CATSPER2	-	-	ENSG00000166762		0.393	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	13	0.00	0	T	NM_054020		43927354	43927354	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000419262	ensembl	human	known	69_37n	splice_site_del	13	13.33	2	DEL	0.002	-
CASC4	113201	genome.wustl.edu	37	15	44615184	44615184	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr15:44615184T>A	ENST00000345795.2	+	2	619	c.349T>A	c.(349-351)Tcg>Acg	p.S117T	CASC4_ENST00000360824.3_Missense_Mutation_p.S117T|CASC4_ENST00000299957.6_Missense_Mutation_p.S117T	NM_177974.2	NP_816929.1	Q6P4E1	CASC4_HUMAN	cancer susceptibility candidate 4	117						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(7)|ovary(1)|urinary_tract(2)	17		all_cancers(109;1.69e-13)|all_epithelial(112;3.94e-11)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.027)		all cancers(107;2.91e-20)|GBM - Glioblastoma multiforme(94;1.57e-06)|COAD - Colon adenocarcinoma(120;0.217)|Colorectal(105;0.237)		GAACAACATATCGTATCAGAT	0.284																																						dbGAP											0													93.0	95.0	94.0					15																	44615184		2198	4290	6488	-	-	-	SO:0001583	missense	0			AF103804	CCDS10108.1, CCDS10109.1	15q15.1	2010-11-24			ENSG00000166734	ENSG00000166734			24892	protein-coding gene	gene with protein product						10497265	Standard	NM_138423		Approved	H63, DKFZp459F1927	uc001ztp.3	Q6P4E1	OTTHUMG00000131133	ENST00000345795.2:c.349T>A	15.37:g.44615184T>A	ENSP00000335063:p.Ser117Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPZ6|G5E934|Q6UY45|Q96EM1	Missense_Mutation	SNP	NULL	p.S117T	ENST00000345795.2	37	c.349	CCDS10109.1	15	.	.	.	.	.	.	.	.	.	.	T	18.66	3.671208	0.67814	.	.	ENSG00000166734	ENST00000299957;ENST00000345795;ENST00000360824;ENST00000416522	D;D	0.83673	-1.75;-1.75	6.08	6.08	0.98989	.	0.062212	0.64402	D	0.000002	D	0.85204	0.5643	L	0.33189	0.99	0.49582	D	0.999808	D;D;D	0.76494	0.998;0.982;0.999	D;D;D	0.85130	0.994;0.961;0.997	T	0.80728	-0.1253	10	0.10377	T	0.69	.	15.6338	0.76933	0.0:0.0:0.0:1.0	.	117;117;117	Q6P4E1-2;G5E934;Q6P4E1	.;.;CASC4_HUMAN	T	117;117;117;96	ENSP00000299957:S117T;ENSP00000335063:S117T	ENSP00000299957:S117T	S	+	1	0	CASC4	42402476	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.140000	0.64807	2.333000	0.79357	0.482000	0.46254	TCG	CASC4	-	NULL	ENSG00000166734		0.284	CASC4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CASC4	HGNC	protein_coding	OTTHUMT00000253816.1	55	0.00	0	T	NM_138423		44615184	44615184	+1	no_errors	ENST00000299957	ensembl	human	known	69_37n	missense	24	35.14	13	SNP	1.000	A
CEP112	201134	genome.wustl.edu	37	17	63898300	63898300	+	Silent	SNP	T	T	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr17:63898300T>C	ENST00000392769.2	-	20	2351	c.2133A>G	c.(2131-2133)caA>caG	p.Q711Q	CEP112_ENST00000541355.1_Silent_p.Q346Q|CEP112_ENST00000537949.1_Silent_p.Q669Q|CEP112_ENST00000535342.2_Silent_p.Q711Q	NM_145036.3	NP_659473.2	Q8N8E3	CE112_HUMAN	centrosomal protein 112kDa	711					receptor localization to synapse (GO:0097120)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(8)|lung(11)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	28						ACTCCTGAATTTGATTTTCGT	0.383																																						dbGAP											0													131.0	112.0	118.0					17																	63898300		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF458591	CCDS32710.1, CCDS32711.1	17q24.2	2014-02-20	2011-05-06	2011-05-06	ENSG00000154240	ENSG00000154240			28514	protein-coding gene	gene with protein product			"""coiled-coil domain containing 46"""	CCDC46		21399614	Standard	NM_145036		Approved	MGC33887	uc002jfl.3	Q8N8E3		ENST00000392769.2:c.2133A>G	17.37:g.63898300T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIB5|Q8NCR4|Q8NFR4	Silent	SNP	superfamily_t-SNARE	p.Q711	ENST00000392769.2	37	c.2133	CCDS32710.1	17																																																																																			CEP112	-	superfamily_t-SNARE	ENSG00000154240		0.383	CEP112-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP112	HGNC	protein_coding	OTTHUMT00000446582.1	103	0.00	0	T	NM_145036		63898300	63898300	-1	no_errors	ENST00000392769	ensembl	human	known	69_37n	silent	85	31.45	39	SNP	1.000	C
EXT2	2132	genome.wustl.edu	37	11	44219400	44219400	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr11:44219400C>T	ENST00000343631.3	+	9	1456	c.1327C>T	c.(1327-1329)Cca>Tca	p.P443S	EXT2_ENST00000395673.3_Missense_Mutation_p.P476S|EXT2_ENST00000358681.4_Missense_Mutation_p.P453S|EXT2_ENST00000533608.1_Missense_Mutation_p.P443S			Q93063	EXT2_HUMAN	exostosin glycosyltransferase 2	443					carbohydrate metabolic process (GO:0005975)|cell differentiation (GO:0030154)|cellular polysaccharide biosynthetic process (GO:0033692)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0015014)|mesoderm formation (GO:0001707)|ossification (GO:0001503)|protein glycosylation (GO:0006486)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)	glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0050508)|glucuronosyltransferase activity (GO:0015020)|heparan sulfate N-acetylglucosaminyltransferase activity (GO:0042328)|N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase activity (GO:0050509)|protein heterodimerization activity (GO:0046982)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|lung(17)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)	32						CGTGAGCAATCCACTCTTCCT	0.522			"""Mis, N, F, S"""			"""exostoses, osteosarcoma"""			Hereditary Multiple Exostoses																													dbGAP	yes	Rec		Multiple Exostoses Type 2	11	11p12-p11	2132	multiple exostoses type 2 gene		M	0													100.0	97.0	98.0					11																	44219400		2203	4299	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HME, Hereditary Exostoses, Multiple Osteochondromatosis, Multiple Cartilaginous Exostoses		CCDS7908.1, CCDS53618.1, CCDS53619.1	11p12-p11	2014-09-17	2013-03-01		ENSG00000151348	ENSG00000151348	2.4.1.224, 2.4.1.225	"""Exostosin glycosyltransferase family"""	3513	protein-coding gene	gene with protein product	"""Glucuronosyl-N-acetylglucosaminyl-proteoglycan 4-alpha-N- acetylglucosaminyltransferase"", ""N-acetylglucosaminyl-proteoglycan 4-beta-glucuronosyltransferase"""	608210	"""exostoses (multiple) 2"", ""exostosin 2"""			8162019, 9576285	Standard	NM_000401		Approved	SOTV	uc001mya.3	Q93063	OTTHUMG00000166498	ENST00000343631.3:c.1327C>T	11.37:g.44219400C>T	ENSP00000342656:p.Pro443Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Z6|C9JU51|J3KPT2|O15288	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.P476S	ENST00000343631.3	37	c.1426	CCDS7908.1	11	.	.	.	.	.	.	.	.	.	.	C	24.1	4.491699	0.84962	.	.	ENSG00000151348	ENST00000533608;ENST00000358681;ENST00000395673;ENST00000343631	D;D;D;D	0.95103	-3.59;-3.58;-3.61;-3.59	6.1	6.1	0.99115	.	0.102825	0.64402	D	0.000002	D	0.94830	0.8330	L	0.41356	1.27	0.80722	D	1	P;P;P;P;P	0.42248	0.546;0.651;0.763;0.657;0.774	B;B;P;B;B	0.52424	0.115;0.433;0.698;0.433;0.433	D	0.92459	0.5976	10	0.27082	T	0.32	-9.4706	20.7146	0.99709	0.0:1.0:0.0:0.0	.	443;453;453;443;456	Q6NUL1;C9JU51;Q93063-2;Q93063;D3DR24	.;.;.;EXT2_HUMAN;.	S	443;453;476;443	ENSP00000431173:P443S;ENSP00000351509:P453S;ENSP00000379032:P476S;ENSP00000342656:P443S	ENSP00000342656:P443S	P	+	1	0	EXT2	44175976	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.710000	0.84655	2.902000	0.99343	0.650000	0.86243	CCA	EXT2	-	NULL	ENSG00000151348		0.522	EXT2-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EXT2	HGNC	protein_coding	OTTHUMT00000390074.1	28	0.00	0	C	NM_000401		44219400	44219400	+1	no_errors	ENST00000395673	ensembl	human	known	69_37n	missense	16	52.94	18	SNP	1.000	T
GATA3	2625	genome.wustl.edu	37	10	8115941	8115942	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr10:8115941_8115942insT	ENST00000346208.3	+	6	1742_1743	c.1287_1288insT	c.(1288-1290)tttfs	p.F430fs	GATA3_ENST00000379328.3_Frame_Shift_Ins_p.F431fs|GATA3_ENST00000461472.1_3'UTR			P23771	GATA3_HUMAN	GATA binding protein 3	430					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.F431fs*>14(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						CCAGCCTGTCCTTTGGACCACA	0.639			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1290dupT	10.37:g.8115944_8115944dupT	ENSP00000341619:p.Phe430fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.G431fs	ENST00000346208.3	37	c.1290_1291	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.639	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	24	0.00	0	-	NM_001002295		8115941	8115942	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	26	29.73	11	INS	1.000:1.000	T
GSK3A	2931	genome.wustl.edu	37	19	42738739	42738739	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr19:42738739T>C	ENST00000222330.3	-	5	885	c.758A>G	c.(757-759)gAc>gGc	p.D253G	GSK3A_ENST00000398249.4_Missense_Mutation_p.D171G|AC006486.9_ENST00000594664.1_Missense_Mutation_p.D166G	NM_019884.2	NP_063937.2	P49840	GSK3A_HUMAN	glycogen synthase kinase 3 alpha	253	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cardiac left ventricle morphogenesis (GO:0003214)|cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|cellular response to interleukin-3 (GO:0036016)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|endoplasmic reticulum unfolded protein response (GO:0030968)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell growth involved in cardiac muscle cell development (GO:0061052)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of TOR signaling (GO:0032007)|negative regulation of transferase activity (GO:0051348)|negative regulation of type B pancreatic cell development (GO:2000077)|negative regulation of UDP-glucose catabolic process (GO:0010905)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of glycogen (starch) synthase activity (GO:2000467)|positive regulation of heart contraction (GO:0045823)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein phosphorylation (GO:0006468)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of systemic arterial blood pressure (GO:0003073)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cytosol (GO:0005829)	ATP binding (GO:0005524)|protein kinase A catalytic subunit binding (GO:0034236)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(3)|large_intestine(3)|lung(6)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	19		Prostate(69;0.00682)				AGTGTCAGGGTCCACCAGCAG	0.632																																						dbGAP											0													90.0	78.0	82.0					19																	42738739		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS12599.1	19q13	2008-02-15			ENSG00000105723	ENSG00000105723			4616	protein-coding gene	gene with protein product		606784				9809441	Standard	NM_019884		Approved		uc002otb.1	P49840	OTTHUMG00000150722	ENST00000222330.3:c.758A>G	19.37:g.42738739T>C	ENSP00000222330:p.Asp253Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O14959	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D253G	ENST00000222330.3	37	c.758	CCDS12599.1	19	.	.	.	.	.	.	.	.	.	.	T	24.0	4.481673	0.84747	.	.	ENSG00000105723	ENST00000222330;ENST00000398249;ENST00000544315	T;T	0.52057	0.68;0.68	4.84	4.84	0.62591	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62319	0.2418	L	0.52823	1.66	0.80722	D	1	D;D	0.67145	0.996;0.99	D;D	0.68192	0.956;0.953	T	0.66097	-0.6008	10	0.87932	D	0	-9.3148	13.7244	0.62750	0.0:0.0:0.0:1.0	.	253;171	P49840;A8MT37	GSK3A_HUMAN;.	G	253;171;198	ENSP00000222330:D253G;ENSP00000381301:D171G	ENSP00000222330:D253G	D	-	2	0	GSK3A	47430579	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.350000	0.79385	1.945000	0.56424	0.402000	0.26972	GAC	GSK3A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000105723		0.632	GSK3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSK3A	HGNC	protein_coding	OTTHUMT00000319782.1	31	0.00	0	T			42738739	42738739	-1	no_errors	ENST00000222330	ensembl	human	known	69_37n	missense	10	61.54	16	SNP	1.000	C
HIST1H2AH	85235	genome.wustl.edu	37	6	27115041	27115041	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr6:27115041G>A	ENST00000377459.1	+	1	181	c.134G>A	c.(133-135)gGa>gAa	p.G45E	MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000356950.1_5'Flank|HIST1H2BK_ENST00000396891.4_5'Flank	NM_080596.1	NP_542163.1	Q96KK5	H2A1H_HUMAN	histone cluster 1, H2ah	45						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)|prostate(1)|skin(1)	12						GAGCGGGTTGGAGCCGGCGCG	0.667																																						dbGAP											0													43.0	47.0	46.0					6																	27115041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY131988	CCDS4622.1	6p22.1	2011-01-27	2006-10-11			ENSG00000274997		"""Histones / Replication-dependent"""	13671	protein-coding gene	gene with protein product		615013	"""histone 1, H2ah"""			12408966	Standard	NM_080596		Approved	H2AFALii, dJ86C11.1, H2A/S	uc003niz.4	Q96KK5		ENST00000377459.1:c.134G>A	6.37:g.27115041G>A	ENSP00000366679:p.Gly45Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.G45E	ENST00000377459.1	37	c.134	CCDS4622.1	6	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354141	0.41700	.	.	ENSG00000184825	ENST00000377459	T	0.68624	-0.34	3.95	3.95	0.45737	Histone-fold (2);Histone core (1);Histone H2A (2);	0.000000	0.41712	D	0.000836	D	0.84624	0.5513	H	0.96175	3.78	0.45066	D	0.998082	D	0.89917	1.0	D	0.80764	0.994	D	0.89402	0.3696	10	0.87932	D	0	.	14.3093	0.66405	0.0:0.0:1.0:0.0	.	45	Q96KK5	H2A1H_HUMAN	E	45	ENSP00000366679:G45E	ENSP00000366679:G45E	G	+	2	0	HIST1H2AH	27223020	1.000000	0.71417	0.982000	0.44146	0.026000	0.11368	8.845000	0.92153	2.142000	0.66516	0.655000	0.94253	GGA	HIST1H2AH	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000184825		0.667	HIST1H2AH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AH	HGNC	protein_coding	OTTHUMT00000040136.1	43	0.00	0	G	NM_080596		27115041	27115041	+1	no_errors	ENST00000377459	ensembl	human	known	69_37n	missense	29	32.56	14	SNP	1.000	A
IL7R	3575	genome.wustl.edu	37	5	35874629	35874629	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr5:35874629T>C	ENST00000303115.3	+	6	914	c.785T>C	c.(784-786)gTg>gCg	p.V262A	IL7R_ENST00000506850.1_Intron|IL7R_ENST00000343305.4_Intron	NM_002185.3	NP_002176.2	P16871	IL7RA_HUMAN	interleukin 7 receptor	262					B cell proliferation (GO:0042100)|cell growth (GO:0016049)|cell morphogenesis (GO:0000902)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|immune response (GO:0006955)|immunoglobulin production (GO:0002377)|interleukin-7-mediated signaling pathway (GO:0038111)|lymph node development (GO:0048535)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|positive regulation of gene expression (GO:0010628)|positive regulation of T cell differentiation in thymus (GO:0033089)|regulation of cell size (GO:0008361)|regulation of DNA recombination (GO:0000018)|signal transduction (GO:0007165)|T cell differentiation (GO:0030217)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)|interleukin-7 receptor activity (GO:0004917)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(78)|kidney(2)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|skin(5)|stomach(3)	126	all_lung(31;0.00015)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.187)|Colorectal(62;0.202)			TTGGCCTGTGTGTTATGGAAA	0.418			"""Mis, O"""		"""ALL, ETP ALL"""		Severe combined immune deficiency																															dbGAP		Dom	yes		5	5p13	146661	interleukin 7 receptor	yes	L	0													193.0	169.0	177.0					5																	35874629		2203	4300	6503	-	-	-	SO:0001583	missense	0			M29696	CCDS3911.1	5p13	2014-09-17			ENSG00000168685	ENSG00000168685		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6024	protein-coding gene	gene with protein product		146661				2317865	Standard	NM_002185		Approved	CD127	uc003jjs.4	P16871	OTTHUMG00000090791	ENST00000303115.3:c.785T>C	5.37:g.35874629T>C	ENSP00000306157:p.Val262Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCS6|B4DVT1|Q05CU8|Q6NSP4|Q6NWM0|Q6NWM1|Q6NWM2|Q6NWM3|Q6SV45|Q9UPC1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3	p.V262A	ENST00000303115.3	37	c.785	CCDS3911.1	5	.	.	.	.	.	.	.	.	.	.	T	11.07	1.530693	0.27387	.	.	ENSG00000168685	ENST00000303115	D	0.96136	-3.92	5.97	3.59	0.41128	.	0.739384	0.12885	N	0.431081	D	0.90164	0.6926	L	0.31926	0.97	0.20074	N	0.999936	B	0.12630	0.006	B	0.09377	0.004	T	0.77469	-0.2576	10	0.18276	T	0.48	-15.8785	7.0918	0.25287	0.0:0.1841:0.0:0.8159	.	262	P16871	IL7RA_HUMAN	A	262	ENSP00000306157:V262A	ENSP00000306157:V262A	V	+	2	0	IL7R	35910386	0.602000	0.26916	0.095000	0.20976	0.953000	0.61014	1.077000	0.30741	0.507000	0.28148	0.533000	0.62120	GTG	IL7R	-	NULL	ENSG00000168685		0.418	IL7R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL7R	HGNC	protein_coding	OTTHUMT00000207577.2	82	0.00	0	T			35874629	35874629	+1	no_errors	ENST00000303115	ensembl	human	known	69_37n	missense	68	42.37	50	SNP	0.142	C
INO80D	54891	genome.wustl.edu	37	2	206869432	206869432	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr2:206869432G>T	ENST00000403263.1	-	11	3148	c.2744C>A	c.(2743-2745)tCc>tAc	p.S915Y		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	738					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						TAGGGAAGTGGAAAGAAGATG	0.582																																						dbGAP											0													119.0	131.0	127.0					2																	206869432		2110	4215	6325	-	-	-	SO:0001583	missense	0				CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.2744C>A	2.37:g.206869432G>T	ENSP00000384198:p.Ser915Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	NULL	p.S915Y	ENST00000403263.1	37	c.2744	CCDS46500.1	2	.	.	.	.	.	.	.	.	.	.	G	20.2	3.955882	0.73902	.	.	ENSG00000114933	ENST00000403263	T	0.49720	0.77	5.84	5.84	0.93424	.	.	.	.	.	T	0.59115	0.2170	N	0.24115	0.695	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	T	0.62572	-0.6826	9	0.87932	D	0	.	20.1533	0.98095	0.0:0.0:1.0:0.0	.	915	Q53TQ3-2	.	Y	915	ENSP00000384198:S915Y	ENSP00000384198:S915Y	S	-	2	0	INO80D	206577677	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	9.230000	0.95299	2.758000	0.94735	0.655000	0.94253	TCC	INO80D	-	NULL	ENSG00000114933		0.582	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80D	HGNC	protein_coding	OTTHUMT00000336459.1	70	0.00	0	G	NM_017759		206869432	206869432	-1	no_errors	ENST00000403263	ensembl	human	known	69_37n	missense	64	29.67	27	SNP	1.000	T
IQCA1	79781	genome.wustl.edu	37	2	237240002	237240002	+	Splice_Site	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr2:237240002C>T	ENST00000409907.3	-	18	2647	c.2373G>A	c.(2371-2373)aaG>aaA	p.K791K	IQCA1_ENST00000309507.5_Splice_Site_p.K788K|IQCA1_ENST00000431676.2_Splice_Site_p.K750K	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	791							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						GTTCATTTACCTTAAAGCTCT	0.488																																						dbGAP											0													130.0	131.0	130.0					2																	237240002		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.2373+1G>A	2.37:g.237240002C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Silent	SNP	pfam_ATPase_AAA_core,pfscan_IQ_motif_EF-hand-BS	p.K791	ENST00000409907.3	37	c.2373	CCDS46549.1	2																																																																																			IQCA1	-	NULL	ENSG00000132321		0.488	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	HGNC	protein_coding	OTTHUMT00000329266.1	73	0.00	0	C	NM_024726	Silent	237240002	237240002	-1	no_errors	ENST00000409907	ensembl	human	known	69_37n	silent	50	28.57	20	SNP	1.000	T
ITGAL	3683	genome.wustl.edu	37	16	30515580	30515580	+	Silent	SNP	A	A	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr16:30515580A>C	ENST00000356798.6	+	18	2410	c.2230A>C	c.(2230-2232)Agg>Cgg	p.R744R	ITGAL_ENST00000433423.2_Intron|MIR4518_ENST00000580665.1_RNA|ITGAL_ENST00000358164.5_Silent_p.R661R	NM_002209.2	NP_002200.2	P20701	ITAL_HUMAN	integrin, alpha L (antigen CD11A (p180), lymphocyte function-associated antigen 1; alpha polypeptide)	744					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|cellular component movement (GO:0006928)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell proliferation (GO:0042102)|receptor clustering (GO:0043113)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)	cell surface (GO:0009986)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(10)|kidney(4)|large_intestine(12)|lung(32)|ovary(3)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	76					Antithymocyte globulin(DB00098)|Efalizumab(DB00095)|Lovastatin(DB00227)	GAGGGACCAAAGGGCGGTAAG	0.512																																					NSCLC(110;1462 1641 3311 33990 49495)	dbGAP											0													122.0	126.0	125.0					16																	30515580		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS32433.1, CCDS45461.1	16p13.1-p11	2010-03-23				ENSG00000005844		"""CD molecules"", ""Integrins"""	6148	protein-coding gene	gene with protein product		153370		CD11A		3284962	Standard	NM_002209		Approved	LFA-1	uc002dyi.4	P20701		ENST00000356798.6:c.2230A>C	16.37:g.30515580A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O43746|Q45H73|Q96HB1|Q9UBC8	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.R744	ENST00000356798.6	37	c.2230	CCDS32433.1	16																																																																																			ITGAL	-	pfam_Integrin_alpha-2	ENSG00000005844		0.512	ITGAL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAL	HGNC	protein_coding	OTTHUMT00000434508.2	79	0.00	0	A			30515580	30515580	+1	no_errors	ENST00000356798	ensembl	human	known	69_37n	silent	72	15.29	13	SNP	0.000	C
JAK1	3716	genome.wustl.edu	37	1	65335075	65335075	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:65335075C>T	ENST00000342505.4	-	6	814	c.566G>A	c.(565-567)tGt>tAt	p.C189Y		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	189	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	CATCCCTAGACACTCGTTCTC	0.517			Mis		ALL																																	dbGAP		Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0													145.0	139.0	141.0					1																	65335075		2017	4192	6209	-	-	-	SO:0001583	missense	0			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.566G>A	1.37:g.65335075C>T	ENSP00000343204:p.Cys189Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GQ2|Q9UD26	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.C189Y	ENST00000342505.4	37	c.566	CCDS41346.1	1	.	.	.	.	.	.	.	.	.	.	C	25.9	4.681478	0.88542	.	.	ENSG00000162434	ENST00000342505	T	0.75821	-0.97	5.33	5.33	0.75918	FERM central domain (1);Band 4.1 domain (1);FERM domain (1);	.	.	.	.	D	0.86285	0.5896	M	0.83118	2.625	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	D	0.87423	0.2383	9	0.72032	D	0.01	.	19.4006	0.94627	0.0:1.0:0.0:0.0	.	189	P23458	JAK1_HUMAN	Y	189	ENSP00000343204:C189Y	ENSP00000343204:C189Y	C	-	2	0	JAK1	65107663	1.000000	0.71417	1.000000	0.80357	0.896000	0.52359	7.466000	0.80914	2.663000	0.90544	0.655000	0.94253	TGT	JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000162434		0.517	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	59	0.00	0	C	NM_002227		65335075	65335075	-1	no_errors	ENST00000342505	ensembl	human	known	69_37n	missense	26	46.94	23	SNP	1.000	T
KCTD3	51133	genome.wustl.edu	37	1	215768802	215768802	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:215768802C>T	ENST00000259154.4	+	10	1216	c.922C>T	c.(922-924)Cag>Tag	p.Q308*		NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	308					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		TGCTGTCACTCAGCACTGGCA	0.403																																						dbGAP											0													161.0	156.0	158.0					1																	215768802		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.922C>T	1.37:g.215768802C>T	ENSP00000259154:p.Gln308*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Nonsense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.Q308*	ENST00000259154.4	37	c.922	CCDS1515.1	1	.	.	.	.	.	.	.	.	.	.	C	41	8.744332	0.98937	.	.	ENSG00000136636	ENST00000259154	.	.	.	5.83	5.83	0.93111	.	0.101006	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-21.1277	19.122	0.93367	0.0:1.0:0.0:0.0	.	.	.	.	X	308	.	ENSP00000259154:Q308X	Q	+	1	0	KCTD3	213835425	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.567000	0.60850	2.770000	0.95276	0.655000	0.94253	CAG	KCTD3	-	superfamily_WD40_repeat_dom	ENSG00000136636		0.403	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	70	0.00	0	C	NM_016121		215768802	215768802	+1	no_errors	ENST00000259154	ensembl	human	known	69_37n	nonsense	131	25.99	46	SNP	1.000	T
MARC2	54996	genome.wustl.edu	37	1	220953546	220953546	+	Silent	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:220953546C>T	ENST00000366913.3	+	6	1047	c.849C>T	c.(847-849)gtC>gtT	p.V283V	MARC2_ENST00000359316.2_Intron|MARC2_ENST00000472447.1_3'UTR	NM_017898.3	NP_060368.2	Q969Z3	MARC2_HUMAN	mitochondrial amidoxime reducing component 2	283	MOSC. {ECO:0000255|PROSITE- ProRule:PRU00670}.				detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										ACACTGGAGTCATAGACAGGA	0.468																																						dbGAP											0													155.0	161.0	159.0					1																	220953546		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1525.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000117791	ENSG00000117791			26064	protein-coding gene	gene with protein product		614127	"""MOCO sulphurase C-terminal domain containing 2"""	MOSC2		11886751	Standard	NM_017898		Approved	FLJ20605	uc001hmq.3	Q969Z3	OTTHUMG00000037354	ENST00000366913.3:c.849C>T	1.37:g.220953546C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2D0R5|D3DTB3|Q0JSK7|Q5VT67|Q5VXC7|Q7L317|Q9H066|Q9NWU0	Silent	SNP	pfam_MOSC_N,pfam_MoCF_Sase_C,superfamily_Pyrv_Knase-like_insert_dom	p.V283	ENST00000366913.3	37	c.849	CCDS1525.1	1																																																																																			MARC2	-	pfam_MoCF_Sase_C,superfamily_Pyrv_Knase-like_insert_dom	ENSG00000117791		0.468	MARC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARC2	HGNC	protein_coding	OTTHUMT00000090911.1	51	0.00	0	C	NM_017898		220953546	220953546	+1	no_errors	ENST00000366913	ensembl	human	known	69_37n	silent	125	12.59	18	SNP	0.805	T
JMJD4	65094	genome.wustl.edu	37	1	227921282	227921282	+	Silent	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:227921282G>A	ENST00000366758.3	-	4	792	c.793C>T	c.(793-795)Ctg>Ttg	p.L265L	SNAP47_ENST00000480897.1_3'UTR|SNAP47_ENST00000366760.1_Intron|SNAP47_ENST00000366759.4_5'Flank|JMJD4_ENST00000438896.2_Silent_p.L265L|JMJD4_ENST00000485807.1_5'UTR|SNAP47_ENST00000315781.5_5'Flank	NM_023007.2	NP_075383.2	Q9H9V9	JMJD4_HUMAN	jumonji domain containing 4	265	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.									endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	9		Prostate(94;0.0885)				CGGTCCCGCAGGGCCTCTTCC	0.637																																						dbGAP											0													53.0	49.0	50.0					1																	227921282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022579	CCDS1561.1, CCDS59203.1	1q42.13	2008-02-05			ENSG00000081692	ENSG00000081692			25724	protein-coding gene	gene with protein product						12477932	Standard	NM_023007		Approved	FLJ12517	uc001hrb.3	Q9H9V9	OTTHUMG00000037698	ENST00000366758.3:c.793C>T	1.37:g.227921282G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBZ1|Q5TBZ6|Q9H970	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.L265	ENST00000366758.3	37	c.793	CCDS1561.1	1																																																																																			JMJD4	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000081692		0.637	JMJD4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD4	HGNC	protein_coding	OTTHUMT00000091970.1	8	0.00	0	G	NM_023007		227921282	227921282	-1	no_errors	ENST00000366758	ensembl	human	known	69_37n	silent	49	20.97	13	SNP	0.996	A
MASP1	5648	genome.wustl.edu	37	3	186953750	186953750	+	Intron	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr3:186953750G>A	ENST00000337774.5	-	10	1693				MASP1_ENST00000495249.1_5'UTR|MASP1_ENST00000392472.2_Missense_Mutation_p.R524C|MASP1_ENST00000296280.6_Missense_Mutation_p.R637C	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		TTGCCCGAGCGGGACTCATAG	0.547																																						dbGAP											0													105.0	85.0	92.0					3																	186953750		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+5518C>T	3.37:g.186953750G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.R637C	ENST00000337774.5	37	c.1909	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384881	0.82792	.	.	ENSG00000127241	ENST00000296280;ENST00000392472	D;D	0.89343	-2.5;-2.5	5.87	5.87	0.94306	.	0.160360	0.56097	D	0.000034	D	0.93135	0.7814	M	0.62088	1.915	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.61275	0.886;0.886	D	0.92770	0.6231	10	0.62326	D	0.03	.	19.5705	0.95413	0.0:0.0:1.0:0.0	.	524;637	P48740-4;P48740-2	.;.	C	637;524	ENSP00000296280:R637C;ENSP00000376264:R524C	ENSP00000296280:R637C	R	-	1	0	MASP1	188436444	1.000000	0.71417	0.997000	0.53966	0.973000	0.67179	6.363000	0.73082	2.941000	0.99782	0.655000	0.94253	CGC	MASP1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000127241		0.547	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	28	0.00	0	G	NM_001879		186953750	186953750	-1	no_errors	ENST00000296280	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	1.000	A
MKRN3	7681	genome.wustl.edu	37	15	23811660	23811660	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr15:23811660G>A	ENST00000314520.3	+	1	1207	c.731G>A	c.(730-732)tGc>tAc	p.C244Y	RP11-73C9.1_ENST00000563044.1_RNA|MKRN3_ENST00000568252.1_Intron|MKRN3_ENST00000568945.1_3'UTR|MKRN3_ENST00000564592.1_Intron	NM_005664.3	NP_005655.1	Q13064	MKRN3_HUMAN	makorin ring finger protein 3	244					protein ubiquitination (GO:0016567)	ribonucleoprotein complex (GO:0030529)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(33)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		all_cancers(20;8.44e-25)|all_epithelial(15;3.69e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000353)|Colorectal(260;0.14)		all cancers(64;3.02e-06)|Epithelial(43;1.94e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0012)		TTGCGGTTTTGCTATTATGCT	0.582																																						dbGAP											0													95.0	101.0	99.0					15																	23811660		2203	4300	6503	-	-	-	SO:0001583	missense	0			U19107	CCDS10013.1	15q11-q13	2013-01-09	2008-08-13		ENSG00000179455	ENSG00000179455		"""RING-type (C3HC4) zinc fingers"""	7114	protein-coding gene	gene with protein product	"""zinc finger protein 127"""	603856		ZNF127, D15S9		10196367	Standard	NM_005664		Approved	RNF63, ZFP127, MGC88288	uc001ywh.4	Q13064	OTTHUMG00000129160	ENST00000314520.3:c.731G>A	15.37:g.23811660G>A	ENSP00000313881:p.Cys244Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.C244Y	ENST00000314520.3	37	c.731	CCDS10013.1	15	.	.	.	.	.	.	.	.	.	.	G	14.59	2.580454	0.46006	.	.	ENSG00000179455	ENST00000314520	T	0.72725	-0.68	4.07	4.07	0.47477	Zinc finger, CCCH-type (2);	0.110230	0.64402	D	0.000007	D	0.87313	0.6146	M	0.93507	3.425	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.90227	0.4276	10	0.72032	D	0.01	-11.1965	14.5895	0.68354	0.0:0.0:1.0:0.0	.	244	Q13064	MKRN3_HUMAN	Y	244	ENSP00000313881:C244Y	ENSP00000313881:C244Y	C	+	2	0	MKRN3	21362753	1.000000	0.71417	0.529000	0.27951	0.009000	0.06853	8.986000	0.93492	2.567000	0.86603	0.655000	0.94253	TGC	MKRN3	-	smart_Znf_CCCH	ENSG00000179455		0.582	MKRN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN3	HGNC	protein_coding	OTTHUMT00000251225.1	66	0.00	0	G	NM_005664		23811660	23811660	+1	no_errors	ENST00000314520	ensembl	human	known	69_37n	missense	29	34.78	16	SNP	1.000	A
MUC5B	727897	genome.wustl.edu	37	11	1266479	1266479	+	Missense_Mutation	SNP	G	G	T	rs202133597	byFrequency	TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr11:1266479G>T	ENST00000529681.1	+	31	8427	c.8369G>T	c.(8368-8370)gGg>gTg	p.G2790V	MUC5B_ENST00000447027.1_Missense_Mutation_p.G2793V|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2790	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTTCCACGGGGACTTCCCAC	0.667																																						dbGAP											0													19.0	24.0	22.0					11																	1266479		1776	3932	5708	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.8369G>T	11.37:g.1266479G>T	ENSP00000436812:p.Gly2790Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.G2793V	ENST00000529681.1	37	c.8378	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	-	2.799	-0.249517	0.05867	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.24723	1.84;2.02	1.58	-1.18	0.09617	.	.	.	.	.	T	0.06050	0.0157	N	0.00436	-1.5	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.31447	-0.9943	9	0.87932	D	0	.	3.1646	0.06531	0.0:0.421:0.2369:0.3421	.	3373;2793	A7Y9J9;E9PBJ0	.;.	V	2790;2793;2762;2750	ENSP00000436812:G2790V;ENSP00000415793:G2793V	ENSP00000343037:G2762V	G	+	2	0	MUC5B	1223055	0.000000	0.05858	0.000000	0.03702	0.058000	0.15608	-4.009000	0.00314	-0.877000	0.04012	-1.241000	0.01538	GGG	MUC5B	-	NULL	ENSG00000117983		0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	14	0.00	0	G	XM_001126093		1266479	1266479	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	34	22.73	10	SNP	0.000	T
MYH8	4626	genome.wustl.edu	37	17	10298758	10298758	+	Splice_Site	SNP	C	C	G			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr17:10298758C>G	ENST00000403437.2	-	34	4748	c.4654G>C	c.(4654-4656)Gca>Cca	p.A1552P	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1552					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCAAGAGATGCCTTAACAAAA	0.368									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													dbGAP											0													56.0	51.0	53.0					17																	10298758		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.4654-1G>C	17.37:g.10298758C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1552P	ENST00000403437.2	37	c.4654	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695668	0.88830	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.80304	-1.36	4.45	4.45	0.53987	Myosin tail (1);	0.000000	0.41396	U	0.000885	D	0.88507	0.6455	M	0.89214	3.015	0.80722	D	1	P	0.40107	0.703	P	0.49387	0.609	D	0.91121	0.4930	10	0.87932	D	0	.	17.2699	0.87098	0.0:1.0:0.0:0.0	.	1552	P13535	MYH8_HUMAN	P	1552	ENSP00000384330:A1552P	ENSP00000252173:A1552P	A	-	1	0	MYH8	10239483	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.463000	0.66712	2.303000	0.77524	0.650000	0.86243	GCA	MYH8	-	pfam_Myosin_tail,superfamily_t-SNARE	ENSG00000133020		0.368	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	53	0.00	0	C	NM_002472	Missense_Mutation	10298758	10298758	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	missense	20	44.44	16	SNP	1.000	G
NFATC4	4776	genome.wustl.edu	37	14	24836347	24836347	+	5'Flank	SNP	A	A	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr14:24836347A>C	ENST00000250373.4	+	0	0				NFATC4_ENST00000554591.1_Silent_p.S29S|NFATC4_ENST00000413692.2_Silent_p.S29S|NFATC4_ENST00000554661.1_5'Flank|NFATC4_ENST00000557451.1_5'Flank|NFATC4_ENST00000556279.1_5'Flank|NFATC4_ENST00000553469.1_5'Flank|NFATC4_ENST00000554050.1_5'Flank|NFATC4_ENST00000554966.1_5'Flank|NFATC4_ENST00000553879.1_5'Flank|NFATC4_ENST00000556169.1_5'Flank|NFATC4_ENST00000554344.1_5'Flank|NFATC4_ENST00000539237.2_5'Flank|NFATC4_ENST00000440487.2_3'UTR|NFATC4_ENST00000555453.1_5'Flank|NFATC4_ENST00000422617.3_5'Flank|NFATC4_ENST00000555590.1_5'Flank|NFATC4_ENST00000553708.1_5'Flank|NFATC4_ENST00000424781.2_5'Flank	NM_004554.4	NP_004545.2	Q14934	NFAC4_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 4						cellular respiration (GO:0045333)|cellular response to lithium ion (GO:0071285)|cellular response to UV (GO:0034644)|heart development (GO:0007507)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|muscle cell development (GO:0055001)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of synaptic plasticity (GO:0048167)|smooth muscle cell differentiation (GO:0051145)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|transcription coactivator activity (GO:0003713)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(7)|liver(4)|lung(12)|ovary(1)|skin(2)	34				GBM - Glioblastoma multiforme(265;0.018)		ACTCCCTCTCACACAACCCAG	0.587																																						dbGAP											0													134.0	133.0	133.0					14																	24836347		1568	3582	5150	-	-	-	SO:0001631	upstream_gene_variant	0			BC053855	CCDS9629.1, CCDS45089.1, CCDS55909.1, CCDS55910.1, CCDS55911.1, CCDS73625.1	14q11.2	2009-11-24			ENSG00000100968	ENSG00000100968		"""Nuclear factor of activated T-cells"""	7778	protein-coding gene	gene with protein product		602699				7749981	Standard	NM_004554		Approved	NFAT3	uc010tok.2	Q14934	OTTHUMG00000029351		14.37:g.24836347A>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDG5|B4DY55|B5B2U7|B5B2U8|B5B2U9|B5B2V0|B5B2V1|B5B2V2|B5B2V3|B5B2V4|B5B2V5|B5B2V7|B5B2V8|B5B2V9|B5B2W0|B5B2W1|B5B2W2|B5B2W3|B5B2W4|B5B2W5|B5B2W6|B5B2W7|B5B2W8|B5B2W9|B5B2X0|Q7Z598|Q96H68	Silent	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.S29	ENST00000250373.4	37	c.87	CCDS9629.1	14																																																																																			NFATC4	-	NULL	ENSG00000100968		0.587	NFATC4-001	KNOWN	basic|CCDS	protein_coding	NFATC4	HGNC	protein_coding	OTTHUMT00000073206.6	50	0.00	0	A	NM_004554		24836347	24836347	+1	no_errors	ENST00000413692	ensembl	human	known	69_37n	silent	55	23.61	17	SNP	0.000	C
NRP1	8829	genome.wustl.edu	37	10	33469188	33469188	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr10:33469188G>A	ENST00000265371.4	-	18	3113	c.2588C>T	c.(2587-2589)gCc>gTc	p.A863V	NRP1_ENST00000374867.2_Missense_Mutation_p.A863V|NRP1_ENST00000395995.1_Missense_Mutation_p.A846V|NRP1_ENST00000374875.1_Missense_Mutation_p.A675V			O14786	NRP1_HUMAN	neuropilin 1	863					angiogenesis (GO:0001525)|angiogenesis involved in coronary vascular morphogenesis (GO:0060978)|artery morphogenesis (GO:0048844)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|cell-cell signaling (GO:0007267)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|commissural neuron axon guidance (GO:0071679)|coronary artery morphogenesis (GO:0060982)|dendrite development (GO:0016358)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|endothelial cell chemotaxis (GO:0035767)|endothelial tip cell fate specification (GO:0097102)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|patterning of blood vessels (GO:0001569)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of cytokine activity (GO:0060301)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of retinal ganglion cell axon guidance (GO:1902336)|positive regulation of smooth muscle cell migration (GO:0014911)|protein localization to early endosome (GO:1902946)|regulation of retinal ganglion cell axon guidance (GO:0090259)|regulation of vesicle-mediated transport (GO:0060627)|renal artery morphogenesis (GO:0061441)|response to wounding (GO:0009611)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal ganglion cell axon guidance (GO:0031290)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|sympathetic ganglion development (GO:0061549)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|VEGF-activated neuropilin signaling pathway (GO:0038190)|VEGF-activated neuropilin signaling pathway involved in axon guidance (GO:1902378)	axon (GO:0030424)|cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|neurofilament (GO:0005883)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|semaphorin receptor complex (GO:0002116)|sorting endosome (GO:0097443)	coreceptor activity (GO:0015026)|cytokine binding (GO:0019955)|growth factor binding (GO:0019838)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)|semaphorin receptor activity (GO:0017154)|vascular endothelial growth factor binding (GO:0038085)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(16)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(2)	48					Palifermin(DB00039)|Pegaptanib(DB04895)	GGCACTCATGGCTATGATGGT	0.542																																					Melanoma(104;886 1489 44640 45944 51153)	dbGAP											0													207.0	191.0	197.0					10																	33469188		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016050	CCDS7177.1, CCDS31179.1, CCDS31180.1	10p12	2006-02-23			ENSG00000099250	ENSG00000099250		"""CD molecules"""	8004	protein-coding gene	gene with protein product		602069				9529250, 9331348	Standard	NM_003873		Approved	NRP, VEGF165R, CD304	uc001iwx.4	O14786	OTTHUMG00000019343	ENST00000265371.4:c.2588C>T	10.37:g.33469188G>A	ENSP00000265371:p.Ala863Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPG9|O60461|Q5T7F1|Q5T7F2|Q5T7F3|Q86T59|Q96I90|Q96IH5	Missense_Mutation	SNP	pirsf_Neuropilin,pfam_CUB,pfam_Coagulation_fac_5/8-C_type_dom,pfam_MAM_dom,pfam_Neuropilin1_C,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_CUB,smart_CUB,smart_Coagulation_fac_5/8-C_type_dom,smart_MAM_dom,prints_MAM_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_MAM_dom	p.A863V	ENST00000265371.4	37	c.2588	CCDS7177.1	10	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693349	0.68386	.	.	ENSG00000099250	ENST00000265371;ENST00000374875;ENST00000374867;ENST00000413802;ENST00000395995	D;D;D;D	0.94280	-2.19;-3.39;-2.19;-2.3	5.84	5.84	0.93424	Neuropilin-1, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92364	0.7577	N	0.12182	0.205	0.80722	D	1	P;P;P;P;P	0.49307	0.922;0.775;0.922;0.922;0.846	P;B;P;P;B	0.58577	0.841;0.306;0.841;0.841;0.395	D	0.91590	0.5286	10	0.31617	T	0.26	-28.4079	20.1551	0.98106	0.0:0.0:1.0:0.0	.	857;863;863;675;846	A8K9V7;Q68DN3;O14786;Q5JWQ6;E9PEP6	.;.;NRP1_HUMAN;.;.	V	863;675;863;45;846	ENSP00000265371:A863V;ENSP00000364009:A675V;ENSP00000364001:A863V;ENSP00000379317:A846V	ENSP00000265371:A863V	A	-	2	0	NRP1	33509194	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	7.660000	0.83776	2.760000	0.94817	0.655000	0.94253	GCC	NRP1	-	pirsf_Neuropilin,pfam_Neuropilin1_C	ENSG00000099250		0.542	NRP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NRP1	HGNC	protein_coding	OTTHUMT00000051203.2	77	0.00	0	G			33469188	33469188	-1	no_errors	ENST00000265371	ensembl	human	known	69_37n	missense	54	30.77	24	SNP	1.000	A
OR2AG1	144125	genome.wustl.edu	37	11	6806874	6806874	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr11:6806874G>A	ENST00000307401.4	+	1	627	c.606G>A	c.(604-606)atG>atA	p.M202I		NM_001004489.2	NP_001004489.1	Q9H205	O2AG1_HUMAN	olfactory receptor, family 2, subfamily AG, member 1	202						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(13)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	26		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)		Epithelial(150;2.19e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TATATGTGATGGGTGTGACCT	0.502																																						dbGAP											0													238.0	199.0	212.0					11																	6806874		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065823	CCDS31414.1	11p15.4	2012-08-09			ENSG00000170803	ENSG00000170803		"""GPCR / Class A : Olfactory receptors"""	15142	protein-coding gene	gene with protein product				OR2AG3			Standard	NM_001004489		Approved		uc001mer.2	Q9H205	OTTHUMG00000165735	ENST00000307401.4:c.606G>A	11.37:g.6806874G>A	ENSP00000307447:p.Met202Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EKV7|Q6IFG7|Q96R26	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.M202I	ENST00000307401.4	37	c.606	CCDS31414.1	11	.	.	.	.	.	.	.	.	.	.	G	12.15	1.852348	0.32699	.	.	ENSG00000170803	ENST00000307401	T	0.00042	8.84	4.23	2.35	0.29111	GPCR, rhodopsin-like superfamily (1);	0.987105	0.08242	N	0.975991	T	0.00109	0.0003	N	0.16066	0.365	0.27143	N	0.961608	B	0.14805	0.011	B	0.19666	0.026	T	0.22765	-1.0207	10	0.72032	D	0.01	.	3.907	0.09186	0.2025:0.0:0.6092:0.1883	.	202	Q9H205	O2AG1_HUMAN	I	202	ENSP00000307447:M202I	ENSP00000307447:M202I	M	+	3	0	OR2AG1	6763450	0.000000	0.05858	0.999000	0.59377	0.940000	0.58332	-2.291000	0.01147	0.553000	0.29044	0.591000	0.81541	ATG	OR2AG1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000170803		0.502	OR2AG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AG1	HGNC	protein_coding	OTTHUMT00000385980.1	96	0.00	0	G	NM_001004489		6806874	6806874	+1	no_errors	ENST00000307401	ensembl	human	known	69_37n	missense	95	29.10	39	SNP	0.722	A
PEX1	5189	genome.wustl.edu	37	7	92119083	92119083	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr7:92119083T>C	ENST00000248633.4	-	22	3676	c.3581A>G	c.(3580-3582)gAt>gGt	p.D1194G	PEX1_ENST00000438045.1_Missense_Mutation_p.D872G|PEX1_ENST00000428214.1_Missense_Mutation_p.D1137G|AC007566.10_ENST00000441539.1_RNA|AC007566.10_ENST00000427458.1_RNA	NM_000466.2	NP_000457.1	O43933	PEX1_HUMAN	peroxisomal biogenesis factor 1	1194					ATP catabolic process (GO:0006200)|microtubule-based peroxisome localization (GO:0060152)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix (GO:0016558)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41	all_cancers(62;9.35e-11)|all_epithelial(64;4.59e-10)|Breast(17;0.00201)|all_lung(186;0.0438)|Lung NSC(181;0.0592)	Breast(660;0.000932)|all_neural(109;0.00391)|Myeloproliferative disorder(862;0.0122)|Ovarian(593;0.023)|Medulloblastoma(109;0.123)	GBM - Glioblastoma multiforme(5;4.06e-06)|STAD - Stomach adenocarcinoma(4;4.51e-05)|all cancers(6;5.32e-05)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			CCTCAGTTGATCTCTTTGTTC	0.423																																						dbGAP											0													159.0	139.0	146.0					7																	92119083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026086	CCDS5627.1, CCDS64710.1	7q21.2	2010-04-21	2008-08-26		ENSG00000127980	ENSG00000127980		"""ATPases / AAA-type"""	8850	protein-coding gene	gene with protein product		602136	"""peroxisome biogenesis factor 1"", ""Zellweger syndrome 1"", ""Zellweger syndrome"""	ZWS1, ZWS		9398848	Standard	NM_001282677		Approved		uc003uly.3	O43933	OTTHUMG00000023926	ENST00000248633.4:c.3581A>G	7.37:g.92119083T>C	ENSP00000248633:p.Asp1194Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1G3|A8KA90|B4DIM7|E9PE75|Q96S71|Q96S72|Q96S73|Q99994	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Peroxisome_synth_fac_1_a/b,pfam_PEX-1N,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase	p.D1194G	ENST00000248633.4	37	c.3581	CCDS5627.1	7	.	.	.	.	.	.	.	.	.	.	T	16.98	3.270274	0.59540	.	.	ENSG00000127980	ENST00000438045;ENST00000248633;ENST00000428214	D;D;D	0.94966	-3.52;-3.55;-3.57	6.07	6.07	0.98685	.	0.275219	0.39909	N	0.001231	D	0.91280	0.7251	L	0.29908	0.895	0.80722	D	1	P;P;P	0.40909	0.732;0.546;0.546	B;B;B	0.40444	0.329;0.307;0.133	D	0.92170	0.5743	10	0.72032	D	0.01	-8.3655	15.2117	0.73230	0.0:0.0:0.0:1.0	.	872;986;1194	E9PE75;B4DER6;O43933	.;.;PEX1_HUMAN	G	872;1194;1137	ENSP00000410438:D872G;ENSP00000248633:D1194G;ENSP00000394413:D1137G	ENSP00000248633:D1194G	D	-	2	0	PEX1	91957019	1.000000	0.71417	0.991000	0.47740	0.846000	0.48090	6.120000	0.71596	2.326000	0.78906	0.533000	0.62120	GAT	PEX1	-	NULL	ENSG00000127980		0.423	PEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX1	HGNC	protein_coding	OTTHUMT00000254066.3	100	0.00	0	T	NM_000466		92119083	92119083	-1	no_errors	ENST00000248633	ensembl	human	known	69_37n	missense	73	25.51	25	SNP	0.993	C
PHLPP1	23239	genome.wustl.edu	37	18	60563042	60563042	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr18:60563042T>G	ENST00000262719.5	+	6	2476	c.2242T>G	c.(2242-2244)Ttt>Gtt	p.F748V	PHLPP1_ENST00000400316.4_Missense_Mutation_p.F236V			O60346	PHLP1_HUMAN	PH domain and leucine rich repeat protein phosphatase 1	748					apoptotic process (GO:0006915)|entrainment of circadian clock (GO:0009649)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(2)|kidney(2)|lung(13)	17						GGATGGAAACTTTCTCCAATC	0.333																																						dbGAP											0													152.0	144.0	146.0					18																	60563042		1829	4073	5902	-	-	-	SO:0001583	missense	0			AB011178	CCDS45881.1, CCDS45881.2	18q21.32	2013-01-11	2009-05-26	2009-05-26	ENSG00000081913	ENSG00000081913		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	20610	protein-coding gene	gene with protein product		609396	"""pleckstrin homology domain containing, family E (with leucine rich repeats) member 1"", ""PH domain and leucine rich repeat protein phosphatase"""	PLEKHE1, PHLPP		10570941, 15808505	Standard	NM_194449		Approved	KIAA0606, SCOP	uc021ule.1	O60346	OTTHUMG00000150629	ENST00000262719.5:c.2242T>G	18.37:g.60563042T>G	ENSP00000262719:p.Phe748Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4F5|Q641Q7|Q6P4C4|Q6PJI6|Q86TN6|Q96FK2|Q9NUY1	Missense_Mutation	SNP	pfam_PP2C-like,pfam_Leu-rich_rpt,superfamily_PP2C-like,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like,pfscan_Pleckstrin_homology	p.F748V	ENST00000262719.5	37	c.2242	CCDS45881.2	18	.	.	.	.	.	.	.	.	.	.	T	10.20	1.283801	0.23392	.	.	ENSG00000081913	ENST00000400316;ENST00000262719	T;T	0.56941	0.43;0.43	4.98	3.81	0.43845	.	.	.	.	.	T	0.35595	0.0937	N	0.21240	0.645	0.35547	D	0.80357	B	0.32101	0.356	B	0.30716	0.119	T	0.36407	-0.9749	9	0.17369	T	0.5	-6.4344	12.0254	0.53367	0.0:0.0:0.1445:0.8555	.	748	O60346	PHLP1_HUMAN	V	236;748	ENSP00000383170:F236V;ENSP00000262719:F748V	ENSP00000262719:F748V	F	+	1	0	PHLPP1	58714022	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	1.544000	0.36158	0.918000	0.36919	0.482000	0.46254	TTT	PHLPP1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000081913		0.333	PHLPP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PHLPP1	HGNC	protein_coding	OTTHUMT00000319249.2	74	0.00	0	T	NM_194449		60563042	60563042	+1	no_errors	ENST00000262719	ensembl	human	known	69_37n	missense	48	34.25	25	SNP	0.998	G
PHRF1	57661	genome.wustl.edu	37	11	605238	605238	+	Silent	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr11:605238G>A	ENST00000264555.5	+	11	1400	c.1272G>A	c.(1270-1272)gcG>gcA	p.A424A	PHRF1_ENST00000533464.1_Silent_p.A420A|PHRF1_ENST00000416188.2_Silent_p.A424A|PHRF1_ENST00000413872.2_Silent_p.A423A	NM_020901.2	NP_065952.2	Q9P1Y6	PHRF1_HUMAN	PHD and ring finger domains 1	424					mRNA processing (GO:0006397)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)	RNA polymerase binding (GO:0070063)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|urinary_tract(2)	28						TGCTGAGAGCGGATATTGGAG	0.602																																						dbGAP											0													68.0	76.0	73.0					11																	605238		2034	4190	6224	-	-	-	SO:0001819	synonymous_variant	0			BC004950	CCDS44507.1, CCDS65987.1, CCDS65988.1, CCDS65989.1	11p15.5	2014-06-13			ENSG00000070047	ENSG00000070047		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	24351	protein-coding gene	gene with protein product	"""CTD binding SR like protein rA9"", ""protein phosphatase 1, regulatory subunit 125"""	611780		RNF221			Standard	XM_005253027		Approved	KIAA1542, PPP1R125	uc010qwc.2	Q9P1Y6	OTTHUMG00000165141	ENST00000264555.5:c.1272G>A	11.37:g.605238G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W1|B7ZM64|B9EGP0|C9JS82|Q6PJP2|Q8IVY2|Q8N2Y7|Q9BSM2	Silent	SNP	pfam_Znf_PHD-finger,pfam_Znf_C3HC4_RING-type,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.A424	ENST00000264555.5	37	c.1272		11																																																																																			PHRF1	-	NULL	ENSG00000070047		0.602	PHRF1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHRF1	HGNC	protein_coding	OTTHUMT00000382133.1	26	0.00	0	G	NM_020901		605238	605238	+1	no_errors	ENST00000264555	ensembl	human	known	69_37n	silent	31	46.55	27	SNP	0.962	A
PJA2	9867	genome.wustl.edu	37	5	108714080	108714080	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr5:108714080C>T	ENST00000361189.2	-	4	1347	c.1108G>A	c.(1108-1110)Gag>Aag	p.E370K	PJA2_ENST00000361557.3_Missense_Mutation_p.E370K|PJA2_ENST00000511624.1_5'Flank	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	370					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		CAGTCATGCTCTCCATCATAT	0.408																																						dbGAP											0													206.0	198.0	201.0					5																	108714080		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.1108G>A	5.37:g.108714080C>T	ENSP00000354775:p.Glu370Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.E370K	ENST00000361189.2	37	c.1108	CCDS4099.1	5	.	.	.	.	.	.	.	.	.	.	C	14.20	2.464832	0.43839	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.05786	3.39;3.39	4.35	4.35	0.52113	.	0.126941	0.36200	N	0.002721	T	0.07098	0.0180	L	0.59436	1.845	0.23537	N	0.997466	B	0.18968	0.032	B	0.18263	0.021	T	0.20874	-1.0262	10	0.62326	D	0.03	-6.9889	4.3009	0.10923	0.2151:0.6444:0.0:0.1404	.	370	O43164	PJA2_HUMAN	K	370	ENSP00000354775:E370K;ENSP00000355284:E370K	ENSP00000354775:E370K	E	-	1	0	PJA2	108741979	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.251000	0.32862	2.721000	0.93114	0.655000	0.94253	GAG	PJA2	-	NULL	ENSG00000198961		0.408	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PJA2	HGNC	protein_coding	OTTHUMT00000250663.1	96	0.00	0	C	NM_014819		108714080	108714080	-1	no_errors	ENST00000361189	ensembl	human	known	69_37n	missense	61	28.24	24	SNP	0.984	T
PRKCB	5579	genome.wustl.edu	37	16	24135281	24135281	+	Silent	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr16:24135281G>A	ENST00000321728.7	+	9	1219	c.1044G>A	c.(1042-1044)ctG>ctA	p.L348L	PRKCB_ENST00000303531.7_Silent_p.L348L	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	348	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	TAATGGTGCTGGGGAAAGGCA	0.473																																						dbGAP											0													196.0	186.0	189.0					16																	24135281		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.1044G>A	16.37:g.24135281G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.L348	ENST00000321728.7	37	c.1044	CCDS10618.1	16																																																																																			PRKCB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000166501		0.473	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	52	0.00	0	G	NM_212535		24135281	24135281	+1	no_errors	ENST00000303531	ensembl	human	known	69_37n	silent	27	41.30	19	SNP	1.000	A
PRSS3	5646	genome.wustl.edu	37	9	33797959	33797959	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr9:33797959C>G	ENST00000361005.5	+	3	504	c.504C>G	c.(502-504)atC>atG	p.I168M	PRSS3_ENST00000379405.3_Missense_Mutation_p.I111M|RP11-133O22.6_ENST00000454429.2_RNA|PRSS3_ENST00000429677.3_Missense_Mutation_p.I104M|PRSS3_ENST00000342836.4_Missense_Mutation_p.I125M	NM_007343.3	NP_031369	P35030	TRY3_HUMAN	protease, serine, 3	168	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cobalamin metabolic process (GO:0009235)|digestion (GO:0007586)|endothelial cell migration (GO:0043542)|innate immune response (GO:0045087)|proteolysis (GO:0006508)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	13			LUSC - Lung squamous cell carcinoma(29;0.0176)			TCATGCTGATCAAACTCTCCT	0.562																																						dbGAP											0													267.0	203.0	225.0					9																	33797959		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6545.1, CCDS47958.1, CCDS56570.1, CCDS56571.1	9p13	2010-05-07	2008-03-11		ENSG00000010438	ENSG00000010438	3.4.21.4	"""Serine peptidases / Serine peptidases"""	9486	protein-coding gene	gene with protein product	"""mesotrypsin"""	613578	"""protease, serine, 4 (trypsin 4, brain)"", ""protease, serine, 3 (mesotrypsin)"""	PRSS4		2326201, 8294000	Standard	NM_002771		Approved	TRY3, TRY4	uc003ztj.4	P35030	OTTHUMG00000019798	ENST00000361005.5:c.504C>G	9.37:g.33797959C>G	ENSP00000354280:p.Ile168Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8CED1|A8CED3|A9Z1Y4|E7ES07|F8W7P3|P15951|Q15665|Q5VXV0|Q6ISJ4|Q9UQV3	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.I168M	ENST00000361005.5	37	c.504	CCDS47958.1	9	.	.	.	.	.	.	.	.	.	.	C	11.25	1.582219	0.28180	.	.	ENSG00000010438	ENST00000361005;ENST00000457896;ENST00000342836;ENST00000429677;ENST00000379405	T;T;D;T;D	0.94457	-0.02;-0.1;-3.43;-0.02;-3.43	3.62	0.558	0.17266	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.043864	0.85682	D	0.000000	D	0.95557	0.8556	M	0.70787	2.145	0.44352	D	0.997242	D;D;D	0.61080	0.96;0.989;0.96	P;D;D	0.71870	0.885;0.975;0.916	D	0.93337	0.6706	10	0.56958	D	0.05	.	7.9189	0.29835	0.0:0.6743:0.0:0.3257	.	111;168;125	P35030-3;P35030;P35030-4	.;TRY3_HUMAN;.	M	168;123;125;104;111	ENSP00000354280:I168M;ENSP00000401249:I123M;ENSP00000340889:I125M;ENSP00000401828:I104M;ENSP00000368715:I111M	ENSP00000340889:I125M	I	+	3	3	PRSS3	33787959	1.000000	0.71417	0.879000	0.34478	0.046000	0.14306	5.212000	0.65225	0.173000	0.19788	0.313000	0.20887	ATC	PRSS3	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000010438		0.562	PRSS3-003	KNOWN	basic|CCDS	protein_coding	PRSS3	HGNC	protein_coding	OTTHUMT00000052121.1	76	0.00	0	C	NM_002771		33797959	33797959	+1	no_errors	ENST00000361005	ensembl	human	known	69_37n	missense	43	38.57	27	SNP	1.000	G
PVRL4	81607	genome.wustl.edu	37	1	161059016	161059016	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:161059016G>A	ENST00000368012.3	-	1	373	c.71C>T	c.(70-72)tCa>tTa	p.S24L	RP11-544M22.8_ENST00000447167.1_RNA	NM_030916.2	NP_112178.2	Q96NY8	PVRL4_HUMAN	poliovirus receptor-related 4	24					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|urinary_tract(1)	20	all_cancers(52;8.9e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			ACCTGTAAATGATGCCAGCAG	0.577																																					NSCLC(76;1160 1387 14476 16172 29359)	dbGAP											0													127.0	124.0	125.0					1																	161059016		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF426163	CCDS1216.1	1q22-q23.2	2013-01-14			ENSG00000143217	ENSG00000143217		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	19688	protein-coding gene	gene with protein product		609607				11544254	Standard	NM_030916		Approved	nectin-4, PRR4, LNIR	uc001fxo.2	Q96NY8	OTTHUMG00000031475	ENST00000368012.3:c.71C>T	1.37:g.161059016G>A	ENSP00000356991:p.Ser24Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQW3|Q96K15	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S24L	ENST00000368012.3	37	c.71	CCDS1216.1	1	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223402	0.39300	.	.	ENSG00000143217	ENST00000368012	T	0.37235	1.21	4.17	4.17	0.49024	.	0.000000	0.32314	N	0.006269	T	0.20373	0.0490	N	0.14661	0.345	0.80722	D	1	D	0.54601	0.967	P	0.60789	0.879	T	0.02519	-1.1147	10	0.09338	T	0.73	.	12.1795	0.54204	0.0:0.0:1.0:0.0	.	24	Q96NY8	PVRL4_HUMAN	L	24	ENSP00000356991:S24L	ENSP00000356991:S24L	S	-	2	0	PVRL4	159325640	0.989000	0.36119	0.738000	0.30950	0.710000	0.40934	2.635000	0.46537	2.311000	0.77944	0.462000	0.41574	TCA	PVRL4	-	NULL	ENSG00000143217		0.577	PVRL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PVRL4	HGNC	protein_coding	OTTHUMT00000077074.1	11	0.00	0	G	NM_030916		161059016	161059016	-1	no_errors	ENST00000368012	ensembl	human	known	69_37n	missense	43	47.56	39	SNP	0.554	A
RGS3	5998	genome.wustl.edu	37	9	116224016	116224016	+	Missense_Mutation	SNP	A	A	G	rs201175305		TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr9:116224016A>G	ENST00000374140.2	+	3	319	c.110A>G	c.(109-111)aAt>aGt	p.N37S	RGS3_ENST00000317613.6_5'Flank|RGS3_ENST00000350696.5_Missense_Mutation_p.N37S	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	37					inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						CCTTTGCCCAATTTTCTTTCT	0.517																																						dbGAP											0													116.0	116.0	116.0					9																	116224016		1986	4151	6137	-	-	-	SO:0001583	missense	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.110A>G	9.37:g.116224016A>G	ENSP00000363255:p.Asn37Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_C2_Ca-dep,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,smart_C2_Ca-dep,smart_PDZ,smart_Regulat_G_prot_signal,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.N37S	ENST00000374140.2	37	c.110	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	A	2.436	-0.329840	0.05314	.	.	ENSG00000138835	ENST00000374140;ENST00000350696	T;T	0.45276	0.9;0.9	3.34	-2.03	0.07365	.	.	.	.	.	T	0.19366	0.0465	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.17592	-1.0364	9	0.87932	D	0	.	4.3735	0.11260	0.3202:0.0:0.5212:0.1585	.	37	P49796	RGS3_HUMAN	S	37	ENSP00000363255:N37S;ENSP00000259406:N37S	ENSP00000259406:N37S	N	+	2	0	RGS3	115263837	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.288000	0.08377	-0.474000	0.06862	-1.944000	0.00493	AAT	RGS3	-	NULL	ENSG00000138835		0.517	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	44	0.00	0	A	NM_017790		116224016	116224016	+1	no_errors	ENST00000350696	ensembl	human	known	69_37n	missense	17	54.05	20	SNP	0.000	G
RNF145	153830	genome.wustl.edu	37	5	158630630	158630630	+	5'UTR	DEL	T	T	-	rs76451527		TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr5:158630630delT	ENST00000424310.2	-	0	355				RNF145_ENST00000274542.2_Frame_Shift_Del_p.N28fs|RNF145_ENST00000520638.1_Frame_Shift_Del_p.N14fs|RNF145_ENST00000518802.1_Frame_Shift_Del_p.N30fs|RNF145_ENST00000519865.1_5'UTR|RNF145_ENST00000521606.2_Frame_Shift_Del_p.N17fs	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AGCCATGTTGttttttttttt	0.378																																						dbGAP											0													47.0	49.0	48.0					5																	158630630		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.-5A>-	5.37:g.158630630delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z903|B7Z949|E7EVI7|Q8IVP7	Frame_Shift_Del	DEL	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.N27fs	ENST00000424310.2	37	c.80	CCDS56390.1	5																																																																																			RNF145	-	NULL	ENSG00000145860		0.378	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF145	HGNC	protein_coding	OTTHUMT00000374048.1	34	0.00	0	T	NM_144726		158630630	158630630	-1	no_errors	ENST00000274542	ensembl	human	known	69_37n	frame_shift_del	17	10.53	2	DEL	0.002	-
RP1	6101	genome.wustl.edu	37	8	55540310	55540310	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr8:55540310C>T	ENST00000220676.1	+	4	4016	c.3868C>T	c.(3868-3870)Cag>Tag	p.Q1290*		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	1290					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			TGGTGTGGATCAGACTTCTAT	0.408																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													153.0	151.0	152.0					8																	55540310		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.3868C>T	8.37:g.55540310C>T	ENSP00000220676:p.Gln1290*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.Q1290*	ENST00000220676.1	37	c.3868	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	38	7.202381	0.98132	.	.	ENSG00000104237	ENST00000220676	.	.	.	5.57	2.51	0.30379	.	0.553758	0.16583	N	0.208139	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.3265	7.6955	0.28592	0.3342:0.5038:0.162:0.0	.	.	.	.	X	1290	.	ENSP00000220676:Q1290X	Q	+	1	0	RP1	55702863	0.948000	0.32251	0.771000	0.31576	0.120000	0.20174	0.432000	0.21461	0.647000	0.30713	0.655000	0.94253	CAG	RP1	-	NULL	ENSG00000104237		0.408	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	33	0.00	0	C	NM_006269		55540310	55540310	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	nonsense	24	14.29	4	SNP	0.962	T
RPTOR	57521	genome.wustl.edu	37	17	78704422	78704422	+	Silent	SNP	G	G	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr17:78704422G>T	ENST00000306801.3	+	5	932	c.570G>T	c.(568-570)tcG>tcT	p.S190S	RPTOR_ENST00000544334.2_Silent_p.S190S|RPTOR_ENST00000570891.1_Silent_p.S190S|RPTOR_ENST00000537330.1_Silent_p.S5S	NM_020761.2	NP_065812.1	Q8N122	RPTOR_HUMAN	regulatory associated protein of MTOR, complex 1	190					cell cycle arrest (GO:0007050)|cell growth (GO:0016049)|cellular response to amino acid stimulus (GO:0071230)|cellular response to nutrient levels (GO:0031669)|insulin receptor signaling pathway (GO:0008286)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of TOR signaling (GO:0032008)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|regulation of cell size (GO:0008361)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|TORC1 complex (GO:0031931)	14-3-3 protein binding (GO:0071889)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)			breast(1)|endometrium(4)|kidney(1)|large_intestine(12)|lung(17)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(3)	44						GCAGCCCGTCGATCTTCGTCT	0.547																																						dbGAP											0													139.0	99.0	113.0					17																	78704422		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11773.1, CCDS54175.1	17q25.3	2013-01-10				ENSG00000141564		"""WD repeat domain containing"""	30287	protein-coding gene	gene with protein product	"""regulatory associated protein of mTOR"""	607130				10718198, 12150926	Standard	NM_001163034		Approved	KOG1, Mip1, KIAA1303, raptor	uc002jyt.1	Q8N122		ENST00000306801.3:c.570G>T	17.37:g.78704422G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN36|C6KEF2|F5H7J5|Q8N4V9|Q8TB32|Q9P2P3	Silent	SNP	pfam_HEAT,pfam_WD40_repeat,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom,prints_Raptor	p.S190	ENST00000306801.3	37	c.570	CCDS11773.1	17																																																																																			RPTOR	-	prints_Raptor	ENSG00000141564		0.547	RPTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTOR	HGNC	protein_coding	OTTHUMT00000438125.1	37	0.00	0	G	NM_020761		78704422	78704422	+1	no_errors	ENST00000306801	ensembl	human	known	69_37n	silent	38	24.00	12	SNP	0.962	T
SALL1	6299	genome.wustl.edu	37	16	51175500	51175500	+	Silent	SNP	G	G	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr16:51175500G>T	ENST00000251020.4	-	2	666	c.633C>A	c.(631-633)tcC>tcA	p.S211S	SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Silent_p.S114S|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000562674.1_5'Flank	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	211					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			TCGCTTCCTGGGAGAACTGGG	0.617																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													78.0	81.0	80.0					16																	51175500		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.633C>A	16.37:g.51175500G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q99881|Q9NSC3|Q9P1R0	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S211	ENST00000251020.4	37	c.633	CCDS10747.1	16																																																																																			SALL1	-	NULL	ENSG00000103449		0.617	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	22	0.00	0	G	NM_002968		51175500	51175500	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	silent	10	58.33	14	SNP	1.000	T
SDC2	6383	genome.wustl.edu	37	8	97605791	97605791	+	Missense_Mutation	SNP	C	C	A	rs137986371	byFrequency	TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr8:97605791C>A	ENST00000302190.4	+	2	1065	c.144C>A	c.(142-144)gaC>gaA	p.D48E	SDC2_ENST00000519914.1_Missense_Mutation_p.D19E|SDC2_ENST00000522911.1_Missense_Mutation_p.D19E|SDC2_ENST00000518385.1_Intron	NM_002998.3	NP_002989.2	P34741	SDC2_HUMAN	syndecan 2	48					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|dendrite morphogenesis (GO:0048813)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|regulation of dendrite morphogenesis (GO:0048814)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|large_intestine(5)|lung(4)|ovary(2)|prostate(1)|stomach(2)	16	Breast(36;3.41e-05)				Sargramostim(DB00020)	CTATTGATGACGATGACTACG	0.473																																						dbGAP											0													147.0	113.0	125.0					8																	97605791		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030133	CCDS6272.1	8q22-q23	2011-08-11	2007-02-15		ENSG00000169439	ENSG00000169439		"""Proteoglycans / Cell Surface : Syndecans"", ""CD molecules"""	10659	protein-coding gene	gene with protein product	"""syndecan proteoglycan 2"""	142460	"""heparan sulfate proteoglycan 1, cell surface-associated"""	HSPG, HSPG1		8187643	Standard	NM_002998		Approved	fibroglycan, SYND2, CD362	uc003yhv.1	P34741	OTTHUMG00000164689	ENST00000302190.4:c.144C>A	8.37:g.97605791C>A	ENSP00000307046:p.Asp48Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQA3|Q6PIS6|Q9H6V1	Missense_Mutation	SNP	pfam_Syndecan,smart_Neurexin-like	p.D48E	ENST00000302190.4	37	c.144	CCDS6272.1	8	.	.	.	.	.	.	.	.	.	.	C	12.01	1.811041	0.32053	.	.	ENSG00000169439	ENST00000302190;ENST00000545117;ENST00000546193;ENST00000522911;ENST00000519914;ENST00000521590;ENST00000523877	T;T;T;T	0.53206	0.63;0.63;0.63;0.63	5.75	-10.5	0.00291	.	0.000000	0.85682	D	0.000000	T	0.56978	0.2022	M	0.71581	2.175	0.42896	D	0.994218	D	0.89917	1.0	D	0.91635	0.999	T	0.82643	-0.0356	10	0.24483	T	0.36	-23.4427	16.5125	0.84289	0.0:0.5281:0.0:0.4719	.	48	P34741	SDC2_HUMAN	E	48;48;38;19;19;19;19	ENSP00000307046:D48E;ENSP00000427784:D19E;ENSP00000428256:D19E;ENSP00000429121:D19E	ENSP00000307046:D48E	D	+	3	2	SDC2	97674967	0.174000	0.23070	0.041000	0.18516	0.519000	0.34347	-1.286000	0.02788	-2.315000	0.00646	-0.312000	0.09012	GAC	SDC2	-	pfam_Syndecan	ENSG00000169439		0.473	SDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDC2	HGNC	protein_coding	OTTHUMT00000379750.1	35	0.00	0	C	NM_002998		97605791	97605791	+1	no_errors	ENST00000302190	ensembl	human	known	69_37n	missense	37	30.19	16	SNP	0.402	A
SDHAP1	255812	genome.wustl.edu	37	3	195702639	195702639	+	RNA	SNP	C	C	T	rs201406351	byFrequency	TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr3:195702639C>T	ENST00000427841.1	-	0	1323					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		GGACAGGGATCGGCTCCTTCG	0.592																																					Ovarian(67;1158 1227 12109 20189 43170)	dbGAP											0																																										-	-	-			0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195702639C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.592	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	11	0.00	0	C			195702639	195702639	-1	no_errors	ENST00000427841	ensembl	human	known	69_37n	rna	12	33.33	6	SNP	0.965	T
SIGLEC1	6614	genome.wustl.edu	37	20	3682202	3682202	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr20:3682202G>T	ENST00000344754.4	-	6	1314	c.1315C>A	c.(1315-1317)Ccc>Acc	p.P439T	SIGLEC1_ENST00000202578.4_Missense_Mutation_p.P439T	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	439	Ig-like C2-type 4.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						GTGGCCAGGGGCTCACTGACC	0.617																																						dbGAP											0													75.0	60.0	65.0					20																	3682202		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.1315C>A	20.37:g.3682202G>T	ENSP00000341141:p.Pro439Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P439T	ENST00000344754.4	37	c.1315	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230665	0.79688	.	.	ENSG00000088827	ENST00000344754;ENST00000202578	T;T	0.74315	-0.83;-0.83	5.68	5.68	0.88126	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.41294	D	0.000901	D	0.89901	0.6849	M	0.94063	3.49	0.50813	D	0.999895	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.91975	0.5590	10	0.72032	D	0.01	.	17.2787	0.87122	0.0:0.0:1.0:0.0	.	439;439	Q9BZZ2;Q9BZZ2-3	SN_HUMAN;.	T	439	ENSP00000341141:P439T;ENSP00000202578:P439T	ENSP00000202578:P439T	P	-	1	0	SIGLEC1	3630202	1.000000	0.71417	0.997000	0.53966	0.942000	0.58702	5.980000	0.70516	2.671000	0.90904	0.650000	0.86243	CCC	SIGLEC1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000088827		0.617	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	30	0.00	0	G	NM_023068		3682202	3682202	-1	no_errors	ENST00000344754	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	T
SLC35B3	51000	genome.wustl.edu	37	6	8417217	8417217	+	Silent	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr6:8417217C>T	ENST00000379660.4	-	9	1334	c.885G>A	c.(883-885)cgG>cgA	p.R295R		NM_001142540.1|NM_001142541.1|NM_015948.3	NP_001136012.1|NP_001136013.1|NP_057032.2	Q9H1N7	S35B3_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B3	295					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(1)|prostate(1)	15	Ovarian(93;0.0569)					AACCATAGGTCCGAACTGGAT	0.328																																					Melanoma(83;700 1353 9357 11478 30548)	dbGAP											0													63.0	68.0	66.0					6																	8417217		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF132953	CCDS4508.1	6p24.3	2013-07-17	2013-07-17	2003-09-10	ENSG00000124786	ENSG00000124786		"""Solute carriers"""	21601	protein-coding gene	gene with protein product	"""3' phosphoadenosine 5' phosphosulfate transporter 2"""	610845	"""chromosome 6 open reading frame 196"", ""solute carrier family 35, member B3"""	C6orf196		10810093	Standard	XM_005249156		Approved	CGI-19, dJ453H5.1, PAPST2	uc010joe.3	Q9H1N7	OTTHUMG00000014224	ENST00000379660.4:c.885G>A	6.37:g.8417217C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKX9|Q1XH11|Q6MZJ0|Q7Z662|Q9Y308	Silent	SNP	pfam_UAA	p.R295	ENST00000379660.4	37	c.885	CCDS4508.1	6																																																																																			SLC35B3	-	pfam_UAA	ENSG00000124786		0.328	SLC35B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B3	HGNC	protein_coding	OTTHUMT00000039802.1	43	0.00	0	C	NM_015948		8417217	8417217	-1	no_errors	ENST00000379660	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	1.000	T
STAT3	6774	genome.wustl.edu	37	17	40497585	40497585	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr17:40497585C>T	ENST00000264657.5	-	4	676	c.364G>A	c.(364-366)Gcg>Acg	p.A122T	STAT3_ENST00000585517.1_Missense_Mutation_p.A122T|STAT3_ENST00000404395.3_Missense_Mutation_p.A122T|STAT3_ENST00000389272.3_Missense_Mutation_p.A24T|STAT3_ENST00000588969.1_Missense_Mutation_p.A122T	NM_003150.3|NM_139276.2	NP_003141.2|NP_644805.1	P40763	STAT3_HUMAN	signal transducer and activator of transcription 3 (acute-phase response factor)	122					acute-phase response (GO:0006953)|astrocyte differentiation (GO:0048708)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular response to hormone stimulus (GO:0032870)|cytokine-mediated signaling pathway (GO:0019221)|eating behavior (GO:0042755)|eye photoreceptor cell differentiation (GO:0001754)|glucose homeostasis (GO:0042593)|growth hormone receptor signaling pathway (GO:0060396)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular receptor signaling pathway (GO:0030522)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of cell death (GO:0060548)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron migration (GO:2001223)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|radial glial cell differentiation (GO:0060019)|regulation of multicellular organism growth (GO:0040014)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|sexual reproduction (GO:0019953)|signal transduction (GO:0007165)|stem cell maintenance (GO:0019827)|temperature homeostasis (GO:0001659)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(3)|lung(12)|ovary(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		all_cancers(22;1.39e-06)|all_epithelial(22;2.95e-05)|Breast(137;0.000135)		BRCA - Breast invasive adenocarcinoma(366;0.139)		ACCTGGGCCGCAGTGGCTGCA	0.453									Hyperimmunoglobulin E Recurrent Infection Syndrome																													dbGAP											0													30.0	28.0	29.0					17																	40497585		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HIES, Hyper IgE syndrome, autosomal dominant (Job syndrome) / recessive	BC014482	CCDS32656.1, CCDS32657.1, CCDS59288.1	17q21	2014-09-17			ENSG00000168610	ENSG00000168610		"""SH2 domain containing"""	11364	protein-coding gene	gene with protein product		102582				7512451	Standard	NM_139276		Approved	APRF	uc002hzl.1	P40763	OTTHUMG00000150645	ENST00000264657.5:c.364G>A	17.37:g.40497585C>T	ENSP00000264657:p.Ala122Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7B8|K7ENL3|O14916|Q9BW54	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,pfscan_SH2	p.A122T	ENST00000264657.5	37	c.364	CCDS32656.1	17	.	.	.	.	.	.	.	.	.	.	C	16.38	3.108005	0.56291	.	.	ENSG00000168610	ENST00000264657;ENST00000389272;ENST00000404395	D;D;D	0.90324	-2.38;-2.65;-2.38	5.26	5.26	0.73747	STAT transcription factor, protein interaction (2);	0.061001	0.64402	D	0.000005	D	0.85600	0.5734	L	0.29908	0.895	0.53688	D	0.999979	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.11329	0.002;0.006;0.006	T	0.80377	-0.1408	10	0.17832	T	0.49	-35.1537	18.8349	0.92157	0.0:1.0:0.0:0.0	.	122;122;122	P40763-2;P40763;B5BTZ6	.;STAT3_HUMAN;.	T	122;24;122	ENSP00000264657:A122T;ENSP00000373923:A24T;ENSP00000384943:A122T	ENSP00000264657:A122T	A	-	1	0	STAT3	37751111	0.999000	0.42202	1.000000	0.80357	0.992000	0.81027	4.141000	0.58038	2.441000	0.82636	0.591000	0.81541	GCG	STAT3	-	superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction	ENSG00000168610		0.453	STAT3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT3	HGNC	protein_coding	OTTHUMT00000319353.3	43	0.00	0	C	NM_139276, NM_003150		40497585	40497585	-1	no_errors	ENST00000264657	ensembl	human	known	69_37n	missense	64	18.99	15	SNP	0.992	T
STXBP5L	9515	genome.wustl.edu	37	3	121137241	121137241	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr3:121137241C>T	ENST00000273666.6	+	27	3627	c.3356C>T	c.(3355-3357)cCa>cTa	p.P1119L	STXBP5L_ENST00000471454.1_Missense_Mutation_p.P1095L	NM_014980.2	NP_055795.1	Q9Y2K9	STB5L_HUMAN	syntaxin binding protein 5-like	1119					exocytosis (GO:0006887)|glucose homeostasis (GO:0042593)|negative regulation of insulin secretion (GO:0046676)|positive regulation of protein secretion (GO:0050714)|protein transport (GO:0015031)|regulation of exocytosis (GO:0017157)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(3)|endometrium(3)|kidney(3)|large_intestine(12)|lung(28)|ovary(7)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	68				GBM - Glioblastoma multiforme(114;0.0694)		ATTCCTGGACCAGGTAGTATA	0.498																																						dbGAP											0													48.0	54.0	52.0					3																	121137241		1992	4177	6169	-	-	-	SO:0001583	missense	0			AB023223	CCDS43137.1	3q13.33-q21.1	2013-01-10			ENSG00000145087	ENSG00000145087		"""WD repeat domain containing"""	30757	protein-coding gene	gene with protein product		609381				10231032, 14767561	Standard	NM_014980		Approved	KIAA1006, LLGL4	uc003eec.4	Q9Y2K9	OTTHUMG00000159426	ENST00000273666.6:c.3356C>T	3.37:g.121137241C>T	ENSP00000273666:p.Pro1119Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G1B4|Q6PIC3	Missense_Mutation	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Lethal2_giant,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin	p.P1119L	ENST00000273666.6	37	c.3356	CCDS43137.1	3	.	.	.	.	.	.	.	.	.	.	C	14.10	2.436127	0.43224	.	.	ENSG00000145087	ENST00000273666;ENST00000471454;ENST00000471262	T;T;T	0.26518	1.73;1.74;1.76	5.35	5.35	0.76521	.	0.201833	0.44483	D	0.000446	T	0.32704	0.0838	M	0.73217	2.22	0.80722	D	1	B;B	0.28128	0.201;0.094	B;B	0.19148	0.024;0.016	T	0.18335	-1.0340	10	0.87932	D	0	-12.2344	19.0738	0.93151	0.0:1.0:0.0:0.0	.	1095;1119	E9PFI2;Q9Y2K9	.;STB5L_HUMAN	L	1119;1095;1062	ENSP00000273666:P1119L;ENSP00000420019:P1095L;ENSP00000420167:P1062L	ENSP00000273666:P1119L	P	+	2	0	STXBP5L	122619931	0.942000	0.31987	1.000000	0.80357	0.634000	0.38068	3.790000	0.55461	2.512000	0.84698	0.655000	0.94253	CCA	STXBP5L	-	NULL	ENSG00000145087		0.498	STXBP5L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP5L	HGNC	protein_coding	OTTHUMT00000355256.3	47	0.00	0	C			121137241	121137241	+1	no_errors	ENST00000273666	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	T
TAF13	6884	genome.wustl.edu	37	1	109617632	109617632	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:109617632C>A	ENST00000338366.5	-	2	137	c.83G>T	c.(82-84)aGa>aTa	p.R28I		NM_005645.3	NP_005636.1	Q15543	TAF13_HUMAN	TAF13 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 18kDa	28					DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(1)|lung(1)	3		all_epithelial(167;0.000102)|all_lung(203;0.000321)|Lung NSC(277;0.000626)		Colorectal(144;0.0138)|Lung(183;0.0425)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.166)|all cancers(265;0.191)|LUSC - Lung squamous cell carcinoma(189;0.228)		AAGTCTCTTTCTTTTACCCTG	0.313																																						dbGAP											0													234.0	255.0	248.0					1																	109617632		2203	4296	6499	-	-	-	SO:0001583	missense	0			XM_496381	CCDS30788.1	1p13.3	2010-04-22	2002-08-29	2001-12-07	ENSG00000197780	ENSG00000197780			11546	protein-coding gene	gene with protein product		600774	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, K, 18kD"""	TAF2K		7729427	Standard	NM_005645		Approved	TAFII18	uc001dwm.1	Q15543	OTTHUMG00000042363	ENST00000338366.5:c.83G>T	1.37:g.109617632C>A	ENSP00000355051:p.Arg28Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5E5|Q5TYV6	Missense_Mutation	SNP	pfam_TFIID-18,superfamily_Histone-fold	p.R28I	ENST00000338366.5	37	c.83	CCDS30788.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.392662	0.83011	.	.	ENSG00000197780	ENST00000338366	.	.	.	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.74959	0.3785	M	0.79475	2.455	0.80722	D	1	D	0.71674	0.998	D	0.68943	0.961	T	0.77755	-0.2469	9	0.87932	D	0	.	16.1548	0.81649	0.0:1.0:0.0:0.0	.	28	Q15543	TAF13_HUMAN	I	28	.	ENSP00000355051:R28I	R	-	2	0	TAF13	109419155	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.633000	0.61318	2.756000	0.94617	0.561000	0.74099	AGA	TAF13	-	NULL	ENSG00000197780		0.313	TAF13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF13	HGNC	protein_coding	OTTHUMT00000100609.2	157	0.00	0	C	NM_005645		109617632	109617632	-1	no_errors	ENST00000338366	ensembl	human	known	69_37n	missense	37	50.00	37	SNP	1.000	A
TEP1	7011	genome.wustl.edu	37	14	20876196	20876196	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr14:20876196G>C	ENST00000262715.5	-	2	443	c.403C>G	c.(403-405)Cac>Gac	p.H135D	TEP1_ENST00000556935.1_Missense_Mutation_p.H135D	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	135					RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TGCGTCATGTGAGATATCTGT	0.527																																						dbGAP											0													135.0	132.0	133.0					14																	20876196		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.403C>G	14.37:g.20876196G>C	ENSP00000262715:p.His135Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUV9	Missense_Mutation	SNP	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H135D	ENST00000262715.5	37	c.403	CCDS9548.1	14	.	.	.	.	.	.	.	.	.	.	G	6.976	0.550101	0.13374	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935;ENST00000556549	T;T;T	0.50813	0.9;0.73;1.42	4.86	2.04	0.26737	.	0.738886	0.12532	N	0.460739	T	0.30135	0.0755	L	0.27053	0.805	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.18304	-1.0341	10	0.31617	T	0.26	0.508	5.199	0.15254	0.1876:0.1815:0.6308:0.0	.	135;135	G3V5X7;Q99973	.;TEP1_HUMAN	D	135	ENSP00000262715:H135D;ENSP00000452574:H135D;ENSP00000452240:H135D	ENSP00000262715:H135D	H	-	1	0	TEP1	19946036	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	0.783000	0.26802	0.339000	0.23719	-0.143000	0.13931	CAC	TEP1	-	NULL	ENSG00000129566		0.527	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	HGNC	protein_coding	OTTHUMT00000073563.2	45	0.00	0	G	NM_007110		20876196	20876196	-1	no_errors	ENST00000262715	ensembl	human	known	69_37n	missense	29	36.96	17	SNP	0.000	C
TPRKB	51002	genome.wustl.edu	37	2	73957812	73957812	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr2:73957812G>C	ENST00000272424.5	-	4	422	c.316C>G	c.(316-318)Cta>Gta	p.L106V	TPRKB_ENST00000318190.7_Missense_Mutation_p.L145V|TPRKB_ENST00000485758.1_5'UTR|TPRKB_ENST00000409716.2_Missense_Mutation_p.L145V	NM_016058.2	NP_057142.1	Q9Y3C4	TPRKB_HUMAN	TP53RK binding protein	106					tRNA processing (GO:0008033)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)			lung(2)|ovary(1)|skin(1)	4						TAAACAATTAGAATTGAAGTG	0.289																																						dbGAP											0													82.0	81.0	81.0					2																	73957812		2202	4295	6497	-	-	-	SO:0001583	missense	0			AY157986	CCDS1927.1	2p24.3-p24.1	2008-02-05			ENSG00000144034	ENSG00000144034			24259	protein-coding gene	gene with protein product		608680				10810093, 12659830	Standard	NM_016058		Approved	CGI-121	uc002sjn.2	Q9Y3C4	OTTHUMG00000129815	ENST00000272424.5:c.316C>G	2.37:g.73957812G>C	ENSP00000272424:p.Leu106Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5H6|Q8IWR6|Q8IWR7|Q9H3K4	Missense_Mutation	SNP	pfam_Kinase-bd_CGI-121	p.L106V	ENST00000272424.5	37	c.316	CCDS1927.1	2	.	.	.	.	.	.	.	.	.	.	G	14.65	2.598666	0.46318	.	.	ENSG00000144034	ENST00000272424;ENST00000409716;ENST00000318190	T;T	0.47869	0.83;0.83	5.23	3.05	0.35203	.	0.214949	0.39341	N	0.001395	T	0.44201	0.1282	M	0.68728	2.09	0.41902	D	0.990423	P;B;P;P	0.43607	0.711;0.132;0.812;0.778	B;B;P;B	0.45474	0.378;0.087;0.482;0.28	T	0.39313	-0.9620	10	0.09590	T	0.72	.	8.0935	0.30813	0.2368:0.0:0.7632:0.0	.	73;106;145;73	B4DHS0;Q9Y3C4;Q9Y3C4-3;Q9Y3C4-2	.;TPRKB_HUMAN;.;.	V	106;145;145	ENSP00000386936:L145V;ENSP00000325398:L145V	ENSP00000272424:L106V	L	-	1	2	TPRKB	73811320	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.281000	0.51685	1.361000	0.45981	0.655000	0.94253	CTA	TPRKB	-	pfam_Kinase-bd_CGI-121	ENSG00000144034		0.289	TPRKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPRKB	HGNC	protein_coding	OTTHUMT00000252046.2	83	0.00	0	G	NM_016058		73957812	73957812	-1	no_errors	ENST00000272424	ensembl	human	known	69_37n	missense	21	52.27	23	SNP	1.000	C
TMEM131	23505	genome.wustl.edu	37	2	98422132	98422132	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr2:98422132T>C	ENST00000186436.5	-	20	2318	c.2090A>G	c.(2089-2091)aAt>aGt	p.N697S		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	697						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						TGAGAAGGAATTCATAATATT	0.323																																						dbGAP											0													88.0	90.0	89.0					2																	98422132		1810	4077	5887	-	-	-	SO:0001583	missense	0			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.2090A>G	2.37:g.98422132T>C	ENSP00000186436:p.Asn697Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.N697S	ENST00000186436.5	37	c.2090	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	T	4.356	0.065501	0.08388	.	.	ENSG00000075568	ENST00000186436	T	0.23552	1.9	5.81	4.68	0.58851	.	0.221621	0.53938	D	0.000058	T	0.06188	0.0160	N	0.00760	-1.21	0.80722	D	1	B	0.14012	0.009	B	0.15052	0.012	T	0.28522	-1.0041	10	0.06236	T	0.91	-23.5183	6.2328	0.20744	0.0:0.2388:0.0:0.7612	.	697	Q92545	TM131_HUMAN	S	697	ENSP00000186436:N697S	ENSP00000186436:N697S	N	-	2	0	TMEM131	97788564	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.098000	0.50259	2.210000	0.71456	0.533000	0.62120	AAT	TMEM131	-	pfam_DUF3651_TMEM131	ENSG00000075568		0.323	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	46	0.00	0	T	XM_371542		98422132	98422132	-1	no_errors	ENST00000186436	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	C
TXLNB	167838	genome.wustl.edu	37	6	139576544	139576544	+	Intron	SNP	G	G	A	rs41289819	byFrequency	TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr6:139576544G>A	ENST00000358430.3	-	7	1310					NM_153235.3	NP_694967.3	Q8N3L3	TXLNB_HUMAN	taxilin beta							cytoplasm (GO:0005737)				breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	37				OV - Ovarian serous cystadenocarcinoma(155;0.000185)|GBM - Glioblastoma multiforme(68;0.000235)		ATTTTTACTTGAAAATATGAA	0.423													A|||	1062	0.212061	0.5499	0.1311	5008	,	,		17764	0.0317		0.1511	False		,,,				2504	0.0613					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS34545.1	6q23.3	2008-02-05	2005-07-29	2005-07-29	ENSG00000164440	ENSG00000164440			21617	protein-coding gene	gene with protein product		611438	"""chromosome 6 open reading frame 198"""	C6orf198		15184072	Standard	NM_153235		Approved	DKFZp451A175, MDP77, dJ522B19.2	uc021zfy.1	Q8N3L3	OTTHUMG00000015688	ENST00000358430.3:c.1077+156C>T	6.37:g.139576544G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTF3|Q76L25|Q86T52|Q8N3S2	Missense_Mutation	SNP	pfam_Taxilin	p.S124L	ENST00000358430.3	37	c.371	CCDS34545.1	6	447	0.20467032967032966	261	0.5304878048780488	51	0.1408839779005525	14	0.024475524475524476	121	0.15963060686015831	A	8.836	0.940969	0.18281	.	.	ENSG00000164440	ENST00000367652	.	.	.	3.43	2.24	0.28232	.	.	.	.	.	T	0.15132	0.0365	.	.	.	0.33096	P	0.46140000000000003	.	.	.	.	.	.	T	0.16070	-1.0415	3	.	.	.	.	4.1346	0.10164	0.7006:0.0:0.1073:0.1921	rs41289819;rs58899415	.	.	.	L	124	.	.	S	-	2	0	TXLNB	139618237	0.001000	0.12720	0.367000	0.25926	0.120000	0.20174	-0.085000	0.11250	0.202000	0.20498	-0.254000	0.11334	TCA	TXLNB	-	NULL	ENSG00000164440		0.423	TXLNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNB	HGNC	protein_coding	OTTHUMT00000042458.1	12	0.00	0	G	NM_153235		139576544	139576544	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000367652	ensembl	human	known	69_37n	missense	3	76.92	10	SNP	0.526	A
UBR4	23352	genome.wustl.edu	37	1	19439335	19439335	+	Silent	SNP	C	C	T			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr1:19439335C>T	ENST00000375254.3	-	78	11511	c.11484G>A	c.(11482-11484)ttG>ttA	p.L3828L	UBR4_ENST00000375267.2_Silent_p.L3828L|UBR4_ENST00000375226.2_Silent_p.L3804L|UBR4_ENST00000375217.2_Silent_p.L3821L|UBR4_ENST00000375218.3_3'UTR	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	3828					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CATATTCCAACAACTCTTTGC	0.433																																						dbGAP											0													169.0	169.0	169.0					1																	19439335		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.11484G>A	1.37:g.19439335C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Silent	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.L3828	ENST00000375254.3	37	c.11484	CCDS189.1	1																																																																																			UBR4	-	NULL	ENSG00000127481		0.433	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	36	0.00	0	C	NM_020765		19439335	19439335	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	silent	41	31.67	19	SNP	0.998	T
UNC80	285175	genome.wustl.edu	37	2	210841715	210841715	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr2:210841715A>G	ENST00000439458.1	+	57	8733	c.8653A>G	c.(8653-8655)Ata>Gta	p.I2885V	UNC80_ENST00000539183.1_Missense_Mutation_p.I331V|UNC80_ENST00000272845.6_Missense_Mutation_p.I2880V	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	2885					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						GCGGCGCTTCATACCACGCCC	0.498																																						dbGAP											0													76.0	67.0	70.0					2																	210841715		692	1591	2283	-	-	-	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.8653A>G	2.37:g.210841715A>G	ENSP00000391088:p.Ile2885Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.I2885V	ENST00000439458.1	37	c.8653	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	A	19.44	3.828654	0.71258	.	.	ENSG00000144406	ENST00000439458;ENST00000272845;ENST00000333907;ENST00000539183	T;T	0.30981	1.51;1.51	5.39	5.39	0.77823	.	.	.	.	.	T	0.33818	0.0876	N	0.08118	0	0.42114	D	0.991393	P;P	0.46327	0.876;0.65	D;P	0.64595	0.927;0.743	T	0.32348	-0.9910	9	0.26408	T	0.33	.	15.4111	0.74923	1.0:0.0:0.0:0.0	.	2880;2885	C9J1U3;Q8N2C7	.;UNC80_HUMAN	V	2885;2880;411;331	ENSP00000391088:I2885V;ENSP00000272845:I2880V	ENSP00000272845:I2880V	I	+	1	0	UNC80	210549960	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.339000	0.96797	2.039000	0.60335	0.533000	0.62120	ATA	UNC80	-	NULL	ENSG00000144406		0.498	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		29	0.00	0	A	NM_182587		210841715	210841715	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	1.000	G
WWC1	23286	genome.wustl.edu	37	5	167798457	167798457	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr5:167798457T>A	ENST00000265293.4	+	2	650	c.148T>A	c.(148-150)Tgc>Agc	p.C50S	WWC1_ENST00000521089.1_Missense_Mutation_p.C50S	NM_001161661.1|NM_001161662.1|NM_015238.2	NP_001155133.1|NP_001155134.1|NP_056053.1	Q8IX03	KIBRA_HUMAN	WW and C2 domain containing 1	50					cell migration (GO:0016477)|establishment of cell polarity (GO:0030010)|hippo signaling (GO:0035329)|negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of MAPK cascade (GO:0043410)|regulation of hippo signaling (GO:0035330)|regulation of intracellular transport (GO:0032386)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(2)|prostate(1)|skin(4)	43	Renal(175;0.000212)|Lung NSC(126;0.0875)|all_lung(126;0.166)	Medulloblastoma(196;0.0399)|all_neural(177;0.0577)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0364)|Epithelial(171;0.0765)|OV - Ovarian serous cystadenocarcinoma(192;0.0918)		CTTTGCTGACTGCATTAGTGA	0.527																																						dbGAP											0													201.0	141.0	161.0					5																	167798457		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF506799	CCDS4366.1, CCDS54945.1	5q34	2014-06-13	2006-11-09		ENSG00000113645	ENSG00000113645		"""WW, C2 and coiled-coil domain containing"""	29435	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 168"""	610533	"""WW, C2 and coiled-coil domain containing 1"""			10048485, 12559952	Standard	NM_001161661		Approved	KIBRA, KIAA0869, PPP1R168	uc011den.2	Q8IX03	OTTHUMG00000130408	ENST00000265293.4:c.148T>A	5.37:g.167798457T>A	ENSP00000265293:p.Cys50Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK05|O94946|Q6MZX4|Q6Y2F8|Q7Z4G8|Q8WVM4|Q9BT29	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.C50S	ENST00000265293.4	37	c.148	CCDS4366.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	28.3|28.3	4.908891|4.908891	0.92107|0.92107	.|.	.|.	ENSG00000113645|ENSG00000113645	ENST00000265293;ENST00000521089|ENST00000393895	T;T|.	0.05382|.	3.45;3.45|.	5.63|5.63	5.63|5.63	0.86233|0.86233	WW/Rsp5/WWP (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.70552|0.70552	0.3237|0.3237	L|L	0.60012|0.60012	1.86|1.86	0.80722|0.80722	D|D	1|1	D;P|.	0.69078|.	0.997;0.89|.	D;P|.	0.78314|.	0.991;0.803|.	T|T	0.69228|0.69228	-0.5200|-0.5200	10|5	0.72032|.	D|.	0.01|.	.|.	15.5113|15.5113	0.75786|0.75786	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	50;50|.	Q8IX03-2;Q8IX03|.	.;KIBRA_HUMAN|.	S|Q	50|11	ENSP00000265293:C50S;ENSP00000427772:C50S|.	ENSP00000265293:C50S|.	C|L	+|+	1|2	0|0	WWC1|WWC1	167731035|167731035	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.992000|0.992000	0.81027|0.81027	7.740000|7.740000	0.84986|0.84986	2.144000|2.144000	0.66660|0.66660	0.459000|0.459000	0.35465|0.35465	TGC|CTG	WWC1	-	superfamily_WW_Rsp5_WWP	ENSG00000113645		0.527	WWC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	WWC1	HGNC	protein_coding	OTTHUMT00000252791.2	53	0.00	0	T	NM_015238		167798457	167798457	+1	no_errors	ENST00000265293	ensembl	human	known	69_37n	missense	59	15.71	11	SNP	1.000	A
ZNF330	27309	genome.wustl.edu	37	4	142150807	142150807	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1R7-01A-11D-A14K-09	TCGA-E9-A1R7-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b3991854-6634-4428-bef7-a7d9ad9cca30	dbd03fe1-1392-455f-a634-69b59d0ef3aa	g.chr4:142150807C>A	ENST00000262990.4	+	6	602	c.374C>A	c.(373-375)aCc>aAc	p.T125N	ZNF330_ENST00000421169.2_Missense_Mutation_p.T65N	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330	125						chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					TGCCCTCTTACCGATGCTGAG	0.453																																						dbGAP											0													326.0	278.0	294.0					4																	142150807		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.374C>A	4.37:g.142150807C>A	ENSP00000262990:p.Thr125Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDA3	Missense_Mutation	SNP	pfam_NOA36	p.T125N	ENST00000262990.4	37	c.374	CCDS3754.1	4	.	.	.	.	.	.	.	.	.	.	C	17.65	3.443011	0.63067	.	.	ENSG00000109445	ENST00000262990;ENST00000512809;ENST00000503649;ENST00000512738;ENST00000421169	T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52	5.93	5.93	0.95920	.	0.134805	0.64402	D	0.000002	T	0.37128	0.0992	L	0.50333	1.59	0.58432	D	0.999995	B;B	0.26708	0.157;0.077	B;B	0.36608	0.229;0.062	T	0.09207	-1.0685	10	0.17369	T	0.5	-16.8027	20.3437	0.98782	0.0:1.0:0.0:0.0	.	65;125	E9PDK6;Q9Y3S2	.;ZN330_HUMAN	N	125;125;125;125;65	ENSP00000262990:T125N;ENSP00000422599:T125N;ENSP00000422966:T125N;ENSP00000422251:T125N;ENSP00000397397:T65N	ENSP00000262990:T125N	T	+	2	0	ZNF330	142370257	1.000000	0.71417	0.520000	0.27837	0.968000	0.65278	7.814000	0.86154	2.802000	0.96397	0.563000	0.77884	ACC	ZNF330	-	pfam_NOA36	ENSG00000109445		0.453	ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF330	HGNC	protein_coding	OTTHUMT00000257271.2	95	0.00	0	C	NM_014487		142150807	142150807	+1	no_errors	ENST00000262990	ensembl	human	known	69_37n	missense	58	38.95	37	SNP	0.998	A
