#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS19	171019	genome.wustl.edu	37	5	129030517	129030517	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr5:129030517C>T	ENST00000274487.4	+	19	3050	c.2905C>T	c.(2905-2907)Cga>Tga	p.R969*	ADAMTS19_ENST00000509467.1_3'UTR|CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	969	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R969*(2)		NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		GCCACAGATTCGAAAGTGCAA	0.393																																						dbGAP											2	Substitution - Nonsense(2)	large_intestine(1)|skin(1)											161.0	149.0	153.0					5																	129030517		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2905C>T	5.37:g.129030517C>T	ENSP00000274487:p.Arg969*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R969*	ENST00000274487.4	37	c.2905	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	C	42	9.563879	0.99205	.	.	ENSG00000145808	ENST00000274487	.	.	.	4.08	4.08	0.47627	.	0.000000	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.596	0.88012	0.0:1.0:0.0:0.0	.	.	.	.	X	969	.	.	R	+	1	2	ADAMTS19	129058416	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.216000	0.42871	2.566000	0.86566	0.555000	0.69702	CGA	ADAMTS19	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000145808		0.393	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	60	0.00	0	C	NM_133638		129030517	129030517	+1	no_errors	ENST00000274487	ensembl	human	known	69_37n	nonsense	59	28.05	23	SNP	1.000	T
ADRA1A	148	genome.wustl.edu	37	8	26722154	26722154	+	Silent	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr8:26722154G>A	ENST00000519229.1	-	1	339	c.333C>T	c.(331-333)acC>acT	p.T111T	ADRA1A_ENST00000354550.4_Silent_p.T111T|ADRA1A_ENST00000380573.3_Silent_p.T111T|ADRA1A_ENST00000380581.2_Silent_p.T111T|ADRA1A_ENST00000276393.4_Silent_p.T111T|ADRA1A_ENST00000380582.3_Silent_p.T111T|ADRA1A_ENST00000380587.1_Silent_p.T111T|ADRA1A_ENST00000380586.1_Silent_p.T111T|ADRA1A_ENST00000380572.3_Silent_p.T111T|ADRA1A_ENST00000358857.5_Silent_p.T111T			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	181					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TGATGGACGCGGTGCAGCACA	0.627																																						dbGAP											0													104.0	95.0	98.0					8																	26722154		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.333C>T	8.37:g.26722154G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPY0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adrene_rcpt_A1Cs,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.T111	ENST00000519229.1	37	c.333		8																																																																																			ADRA1A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000120907		0.627	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	38	0.00	0	G	NM_033303		26722154	26722154	-1	no_errors	ENST00000380586	ensembl	human	known	69_37n	silent	7	78.79	26	SNP	0.521	A
AKAP8L	26993	genome.wustl.edu	37	19	15512077	15512077	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr19:15512077delG	ENST00000397410.5	-	5	830	c.700delC	c.(700-702)cagfs	p.Q234fs	AKAP8L_ENST00000595465.2_Frame_Shift_Del_p.Q173fs|AKAP8L_ENST00000595879.1_5'UTR	NM_014371.2	NP_055186.2	Q9ULX6	AKP8L_HUMAN	A kinase (PRKA) anchor protein 8-like	234						cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(4)|kidney(2)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	11						CGCATGCCCTGGAACATGCCG	0.652																																						dbGAP											0													75.0	86.0	83.0					19																	15512077		1941	4145	6086	-	-	-	SO:0001589	frameshift_variant	0			BC000713	CCDS46005.1	19p13.12	2013-10-16			ENSG00000011243	ENSG00000011243			29857	protein-coding gene	gene with protein product	"""neighbor of A kinase anchoring protein 95"""	609475				10748171, 10761695	Standard	XM_005259854		Approved	NAKAP95, HAP95	uc002naw.1	Q9ULX6	OTTHUMG00000182446	ENST00000397410.5:c.700delC	19.37:g.15512077delG	ENSP00000380557:p.Gln234fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ74|B5BU90|O94792|Q96J58|Q9NRQ0|Q9UGM0	Frame_Shift_Del	DEL	pfam_AKAP95	p.Q234fs	ENST00000397410.5	37	c.700	CCDS46005.1	19																																																																																			AKAP8L	-	NULL	ENSG00000011243		0.652	AKAP8L-004	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP8L	HGNC	protein_coding	OTTHUMT00000461301.2	28	0.00	0	G	NM_014371		15512077	15512077	-1	no_errors	ENST00000397410	ensembl	human	known	69_37n	frame_shift_del	17	15.00	3	DEL	1.000	-
AQP7	364	genome.wustl.edu	37	9	33395134	33395135	+	Frame_Shift_Ins	INS	-	-	CC	rs373384368|rs192851993|rs2381005		TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr9:33395134_33395135insCC	ENST00000539936.1	-	3	323_324	c.85_86insGG	c.(85-87)ctgfs	p.L29fs	AQP7_ENST00000377425.4_Intron|AQP7_ENST00000537089.1_5'UTR|AQP7_ENST00000541274.1_5'UTR			O14520	AQP7_HUMAN	aquaporin 7	29					excretion (GO:0007588)|generation of precursor metabolites and energy (GO:0006091)|glycerol transport (GO:0015793)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glycerol channel activity (GO:0015254)|water channel activity (GO:0015250)			NS(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(4)|skin(2)|stomach(1)	17			LUSC - Lung squamous cell carcinoma(29;0.00788)	GBM - Glioblastoma multiforme(74;0.191)		CTTCCTCTGCAGTATTTCCTGG	0.564																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB006190	CCDS6541.1	9p13	2008-02-05			ENSG00000165269	ENSG00000165269		"""Ion channels / Aquaporins"""	640	protein-coding gene	gene with protein product		602974		AQP7L		9252401	Standard	NM_001170		Approved	AQP9, AQPap	uc003zst.3	O14520	OTTHUMG00000019773	ENST00000539936.1:c.85_86insGG	9.37:g.33395134_33395135insCC	ENSP00000439534:p.Leu29fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08E94|Q5T5L9|Q8NHM3	Frame_Shift_Ins	INS	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,prints_Aquaporin_3,tigrfam_Aquaporin	p.L29fs	ENST00000539936.1	37	c.86_85		9																																																																																			AQP7	-	NULL	ENSG00000165269		0.564	AQP7-203	KNOWN	basic	protein_coding	AQP7	HGNC	protein_coding		89	0.00	0	-	NM_001170		33395134	33395135	-1	no_errors	ENST00000297988	ensembl	human	known	69_37n	frame_shift_ins	66	14.29	11	INS	0.007:0.000	CC
ATP10B	23120	genome.wustl.edu	37	5	160033805	160033805	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr5:160033805G>A	ENST00000327245.5	-	19	3973	c.3127C>T	c.(3127-3129)Cga>Tga	p.R1043*		NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	1043					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			AACTTGTCTCGCACCAGCTTG	0.522																																						dbGAP											0													94.0	96.0	95.0					5																	160033805		2103	4245	6348	-	-	-	SO:0001587	stop_gained	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.3127C>T	5.37:g.160033805G>A	ENSP00000313600:p.Arg1043*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Nonsense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.R1043*	ENST00000327245.5	37	c.3127	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	G	49	15.693278	0.99842	.	.	ENSG00000118322	ENST00000327245	.	.	.	4.98	4.98	0.66077	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2717	0.87104	0.0:0.0:1.0:0.0	.	.	.	.	X	1043	.	.	R	-	1	2	ATP10B	159966383	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	3.680000	0.54641	2.309000	0.77851	0.563000	0.77884	CGA	ATP10B	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000118322		0.522	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	56	0.00	0	G	NM_025153		160033805	160033805	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	nonsense	42	25.86	15	SNP	1.000	A
BOC	91653	genome.wustl.edu	37	3	112969456	112969456	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr3:112969456G>A	ENST00000495514.1	+	4	856	c.152G>A	c.(151-153)gGc>gAc	p.G51D	BOC_ENST00000485230.1_Missense_Mutation_p.G51D|BOC_ENST00000273395.4_Missense_Mutation_p.G51D|BOC_ENST00000484034.1_Missense_Mutation_p.G51D|BOC_ENST00000355385.3_Missense_Mutation_p.G51D			Q9BWV1	BOC_HUMAN	BOC cell adhesion associated, oncogene regulated	51	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of myoblast differentiation (GO:0045663)|smoothened signaling pathway (GO:0007224)	axonal growth cone (GO:0044295)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	68			Epithelial(53;0.227)			AAGCCCGGAGGCACTGTGATC	0.582																																						dbGAP											0													129.0	122.0	124.0					3																	112969456		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY027658	CCDS2971.1	3q13.2	2013-02-11	2012-12-07		ENSG00000144857	ENSG00000144857		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17173	protein-coding gene	gene with protein product	"""brother of CDO"", ""brother of CDON"", ""cell adhesion associated, oncogene regulated 2"""	608708	"""Boc homolog (mouse)"""			11782431	Standard	NM_033254		Approved	CDON2	uc003dzy.3	Q9BWV1	OTTHUMG00000159305	ENST00000495514.1:c.152G>A	3.37:g.112969456G>A	ENSP00000418663:p.Gly51Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ30|B2RMS8|D3DN70|Q6UXJ5|Q8N2P7|Q8NF26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G51D	ENST00000495514.1	37	c.152	CCDS2971.1	3	.	.	.	.	.	.	.	.	.	.	g	29.3	4.996443	0.93167	.	.	ENSG00000144857	ENST00000464546;ENST00000495514;ENST00000485230;ENST00000273395;ENST00000355385;ENST00000484034	T;T;T;T;T;T	0.75704	-0.96;1.08;1.08;1.08;1.08;1.08	5.78	5.78	0.91487	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.81983	0.4938	L	0.42581	1.335	0.80722	D	1	D;P;D;P	0.89917	1.0;0.925;0.97;0.767	D;P;P;P	0.97110	1.0;0.734;0.868;0.698	T	0.75855	-0.3170	10	0.18710	T	0.47	.	20.025	0.97521	0.0:0.0:1.0:0.0	.	51;51;51;51	C9J2L7;Q9BWV1-3;Q9BWV1;Q96DN7	.;.;BOC_HUMAN;.	D	51	ENSP00000417362:G51D;ENSP00000418663:G51D;ENSP00000420154:G51D;ENSP00000273395:G51D;ENSP00000347546:G51D;ENSP00000417337:G51D	ENSP00000273395:G51D	G	+	2	0	BOC	114452146	1.000000	0.71417	0.931000	0.37212	0.921000	0.55340	9.331000	0.96430	2.730000	0.93505	0.651000	0.88453	GGC	BOC	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000144857		0.582	BOC-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BOC	HGNC	protein_coding	OTTHUMT00000354485.3	53	0.00	0	G	NM_033254		112969456	112969456	+1	no_errors	ENST00000273395	ensembl	human	known	69_37n	missense	67	19.28	16	SNP	0.997	A
C1orf35	79169	genome.wustl.edu	37	1	228289842	228289843	+	Frame_Shift_Ins	INS	-	-	C	rs1128456	byFrequency	TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr1:228289842_228289843insC	ENST00000272139.4	-	6	705_706	c.471_472insG	c.(469-474)gggcccfs	p.P158fs	C1orf35_ENST00000472617.1_5'UTR	NM_024319.2	NP_077295.1	Q9BU76	MMTA2_HUMAN	chromosome 1 open reading frame 35	158							poly(A) RNA binding (GO:0044822)			large_intestine(1)|lung(1)|skin(1)	3		Prostate(94;0.0488)				GAGGTCCCGGGCCCGCCGCTCT	0.743																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY137773	CCDS1566.1	1q42.13	2012-06-25			ENSG00000143793	ENSG00000143793			19032	protein-coding gene	gene with protein product	"""multiple myeloma tumor-associated protein 2"""					12545221	Standard	NM_024319		Approved	MGC4174, MMTAG2	uc001hrx.3	Q9BU76	OTTHUMG00000037793	ENST00000272139.4:c.472dupG	1.37:g.228289845_228289845dupC	ENSP00000272139:p.Pro158fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P5Y0|Q6ZTZ6|Q6ZWA6|Q8IZH3	Frame_Shift_Ins	INS	pfam_Kinase_phosphorylation_domain	p.P157fs	ENST00000272139.4	37	c.472_471	CCDS1566.1	1																																																																																			C1orf35	-	NULL	ENSG00000143793		0.743	C1orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf35	HGNC	protein_coding	OTTHUMT00000092245.1	8	0.00	0	-	NM_024319		228289842	228289843	-1	no_errors	ENST00000272139	ensembl	human	known	69_37n	frame_shift_ins	4	33.33	2	INS	0.000:0.000	C
CROCCP2	84809	genome.wustl.edu	37	1	16946535	16946535	+	lincRNA	SNP	T	T	C	rs437905	byFrequency	TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr1:16946535T>C	ENST00000412962.1	-	0	1000				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GGGCCAGGACTGGACGCGTGT	0.682																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946535T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	Splice_Site	SNP	-	NULL	ENST00000412962.1	37	c.NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.682	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	16	0.00	0	T	NR_026752.1		16946535	16946535	-1	no_errors	ENST00000540383	ensembl	human	known	69_37n	splice_site	10	33.33	5	SNP	0.000	C
CTTNBP2	83992	genome.wustl.edu	37	7	117375356	117375356	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr7:117375356G>A	ENST00000160373.3	-	15	3746	c.3655C>T	c.(3655-3657)Cgc>Tgc	p.R1219C		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	1219					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)				breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		TCAGTGCTGCGATTTTCAAGA	0.383																																						dbGAP											0													67.0	73.0	71.0					7																	117375356		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.3655C>T	7.37:g.117375356G>A	ENSP00000160373:p.Arg1219Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43389|Q7LG11|Q9C0A5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R1219C	ENST00000160373.3	37	c.3655	CCDS5774.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.0|26.0	4.698348|4.698348	0.88830|0.88830	.|.	.|.	ENSG00000077063|ENSG00000077063	ENST00000160373|ENST00000446636	T|.	0.49720|.	0.77|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.045615|.	0.85682|.	D|.	0.000000|.	D|D	0.84074|0.84074	0.5392|0.5392	M|M	0.86502|0.86502	2.82|2.82	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	P|.	0.59761|.	0.863|.	D|D	0.85190|0.85190	0.1009|0.1009	10|5	0.87932|.	D|.	0|.	4.1994|4.1994	19.8125|19.8125	0.96553|0.96553	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	1219|.	Q8WZ74|.	CTTB2_HUMAN|.	C|L	1219|706	ENSP00000160373:R1219C|.	ENSP00000160373:R1219C|.	R|S	-|-	1|2	0|0	CTTNBP2|CTTNBP2	117162592|117162592	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.975000|0.975000	0.68041|0.68041	5.042000|5.042000	0.64202|0.64202	2.745000|2.745000	0.94114|0.94114	0.655000|0.655000	0.94253|0.94253	CGC|TCG	CTTNBP2	-	NULL	ENSG00000077063		0.383	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4	38	0.00	0	G	NM_033427		117375356	117375356	-1	no_errors	ENST00000160373	ensembl	human	known	69_37n	missense	49	30.99	22	SNP	1.000	A
CYB5R1	51706	genome.wustl.edu	37	1	202936357	202936357	+	5'UTR	SNP	A	A	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr1:202936357A>C	ENST00000367249.4	-	0	51				CYB5R1_ENST00000497655.1_5'Flank	NM_016243.2	NP_057327.2	Q9UHQ9	NB5R1_HUMAN	cytochrome b5 reductase 1						sterol biosynthetic process (GO:0016126)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)			breast(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(75;0.141)		Flavin adenine dinucleotide(DB03147)	TTCCTCCACCACCTGACAAGC	0.692																																						dbGAP											0													28.0	24.0	25.0					1																	202936357		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF169481	CCDS1431.1	1q32.1	2011-04-08		2005-07-13	ENSG00000159348	ENSG00000159348	1.6.2.2		13397	protein-coding gene	gene with protein product		608341	"""NAD(P)H:quinone oxidoreductase type 3, polypeptide A2"""	NQO3A2		12975309, 10611283	Standard	NM_016243		Approved	humb5R2	uc001gyt.2	Q9UHQ9	OTTHUMG00000041387	ENST00000367249.4:c.-24T>G	1.37:g.202936357A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK21|B2R8E0|O95329|Q53F73|Q8NCL5|Q9UHJ1	RNA	SNP	-	NULL	ENST00000367249.4	37	NULL	CCDS1431.1	1																																																																																			CYB5R1	-	-	ENSG00000159348		0.692	CYB5R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R1	HGNC	protein_coding	OTTHUMT00000099155.1	13	0.00	0	A	NM_016243		202936357	202936357	-1	no_errors	ENST00000473599	ensembl	human	known	69_37n	rna	5	54.55	6	SNP	0.000	C
DMD	1756	genome.wustl.edu	37	X	32366618	32366618	+	Missense_Mutation	SNP	G	G	T	rs398123990		TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chrX:32366618G>T	ENST00000357033.4	-	38	5559	c.5353C>A	c.(5353-5355)Cag>Aag	p.Q1785K	DMD_ENST00000378677.2_Missense_Mutation_p.Q1781K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1785	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GAGTTAAACTGCTCCAATTCC	0.323																																						dbGAP											0													78.0	70.0	73.0					X																	32366618		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5353C>A	X.37:g.32366618G>T	ENSP00000354923:p.Gln1785Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q1785K	ENST00000357033.4	37	c.5353	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	12.09	1.833076	0.32421	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000493412	T;T;T	0.62232	0.04;0.05;1.48	5.49	5.49	0.81192	.	0.000000	0.35320	U	0.003281	T	0.60907	0.2305	N	0.08118	0	0.80722	D	1	P;P;P;P;P	0.52842	0.954;0.956;0.924;0.787;0.787	D;B;P;B;B	0.67900	0.954;0.275;0.9;0.219;0.219	T	0.59820	-0.7382	10	0.14656	T	0.56	.	18.4768	0.90795	0.0:0.0:1.0:0.0	.	1777;1785;1781;444;441	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	K	1777;444;441;1781;1785;1785;1662;4	ENSP00000367948:Q1781K;ENSP00000354923:Q1785K;ENSP00000417725:Q4K	ENSP00000354923:Q1785K	Q	-	1	0	DMD	32276539	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.908000	0.69916	2.306000	0.77630	0.462000	0.41574	CAG	DMD	-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.323	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	111	0.00	0	G	NM_004006		32366618	32366618	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	133	14.19	22	SNP	1.000	T
TMEM255A	55026	genome.wustl.edu	37	X	119421019	119421019	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chrX:119421019T>C	ENST00000309720.5	-	5	536	c.413A>G	c.(412-414)gAa>gGa	p.E138G	TMEM255A_ENST00000371352.1_5'Flank|TMEM255A_ENST00000371369.4_Missense_Mutation_p.E138G|TMEM255A_ENST00000440464.1_Missense_Mutation_p.E138G	NM_017938.3	NP_060408.3	Q5JRV8	T255A_HUMAN	transmembrane protein 255A	138						integral component of membrane (GO:0016021)											CTCCTCAGCTTCCTTCTGTGA	0.478																																						dbGAP											0													259.0	230.0	240.0					X																	119421019		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047054	CCDS14597.1, CCDS43986.1, CCDS48157.1	Xq24	2012-11-30	2012-11-30	2012-11-30	ENSG00000125355	ENSG00000125355			26086	protein-coding gene	gene with protein product			"""family with sequence similarity 70, member A"""	FAM70A		12477932	Standard	NM_017938		Approved	FLJ20716	uc004eso.4	Q5JRV8	OTTHUMG00000022298	ENST00000309720.5:c.413A>G	X.37:g.119421019T>C	ENSP00000310110:p.Glu138Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0W9|B1APR4|B3KPI6|E9PAR3|Q86Y72|Q9NWN8	Missense_Mutation	SNP	NULL	p.E138G	ENST00000309720.5	37	c.413	CCDS14597.1	X	.	.	.	.	.	.	.	.	.	.	t	11.93	1.785899	0.31593	.	.	ENSG00000125355	ENST00000309720;ENST00000371369;ENST00000440464;ENST00000519908	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	5.27	5.27	0.74061	.	0.237463	0.42821	D	0.000653	T	0.22666	0.0547	N	0.08118	0	0.37631	D	0.921682	P;P;P	0.44816	0.844;0.844;0.646	B;B;B	0.38616	0.277;0.277;0.196	T	0.17167	-1.0378	10	0.30078	T	0.28	-9.6774	12.2565	0.54627	0.0:0.0:0.0:1.0	.	138;138;138	E9PAR3;B1APR4;Q5JRV8	.;.;FA70A_HUMAN	G	138	ENSP00000310110:E138G;ENSP00000360420:E138G;ENSP00000405781:E138G;ENSP00000428013:E138G	ENSP00000310110:E138G	E	-	2	0	FAM70A	119305047	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	1.802000	0.38853	1.868000	0.54150	0.414000	0.27820	GAA	FAM70A	-	NULL	ENSG00000125355		0.478	TMEM255A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM70A	HGNC	protein_coding	OTTHUMT00000058091.1	82	0.00	0	T	NM_017938		119421019	119421019	-1	no_errors	ENST00000309720	ensembl	human	known	69_37n	missense	53	30.26	23	SNP	1.000	C
SPATA31D1	389763	genome.wustl.edu	37	9	84607812	84607812	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr9:84607812G>T	ENST00000344803.2	+	4	2474	c.2427G>T	c.(2425-2427)atG>atT	p.M809I		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	809					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AAACTCATATGATGCATCTGT	0.458																																						dbGAP											0													70.0	68.0	69.0					9																	84607812		1867	4086	5953	-	-	-	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.2427G>T	9.37:g.84607812G>T	ENSP00000341988:p.Met809Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.M809I	ENST00000344803.2	37	c.2427	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	G	2.572	-0.299441	0.05532	.	.	ENSG00000214929	ENST00000344803	T	0.06528	3.29	2.37	-4.75	0.03239	.	10.548800	0.00397	N	0.000052	T	0.06050	0.0157	L	0.29908	0.895	0.09310	N	1	B	0.32324	0.364	B	0.42245	0.381	T	0.35871	-0.9771	10	0.06494	T	0.89	16.9706	5.3619	0.16093	0.0:0.4336:0.2765:0.2899	.	809	Q6ZQQ2	F75D1_HUMAN	I	809	ENSP00000341988:M809I	ENSP00000341988:M809I	M	+	3	0	FAM75D1	83797632	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.342000	0.02645	-0.998000	0.03446	0.462000	0.41574	ATG	FAM75D1	-	NULL	ENSG00000214929		0.458	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75D1	HGNC	protein_coding	OTTHUMT00000402325.1	37	0.00	0	G	NM_001001670		84607812	84607812	+1	no_errors	ENST00000344803	ensembl	human	known	69_37n	missense	98	11.71	13	SNP	0.000	T
FARS2	10667	genome.wustl.edu	37	6	5545516	5545516	+	Silent	SNP	C	C	T	rs145770549		TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr6:5545516C>T	ENST00000324331.6	+	5	1344	c.1008C>T	c.(1006-1008)gaC>gaT	p.D336D	FARS2_ENST00000274680.4_Silent_p.D336D			O95363	SYFM_HUMAN	phenylalanyl-tRNA synthetase 2, mitochondrial	336					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)|tRNA processing (GO:0008033)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|phenylalanine-tRNA ligase activity (GO:0004826)|tRNA binding (GO:0000049)			endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|prostate(1)|stomach(2)	15	Ovarian(93;0.11)	all_hematologic(90;0.0104)			L-Phenylalanine(DB00120)	GGTGTGAGGACGAGCGCTTCC	0.448													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15997	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													197.0	190.0	192.0					6																	5545516		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF097441	CCDS4494.1	6p25.1	2011-07-01	2007-02-23	2004-12-03	ENSG00000145982	ENSG00000145982	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	21062	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 2, mitochondrial"""	611592	"""phenylalanine-tRNA synthetase 1 (mitochondrial)"""	FARS1		10329163	Standard	NM_006567		Approved	dJ236A3.1	uc003mwr.2	O95363	OTTHUMG00000014178	ENST00000324331.6:c.1008C>T	6.37:g.5545516C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R664|Q53F66|Q5TCS3|Q6FG29|Q9NPY7|Q9P062	Silent	SNP	pfam_Phenylalanyl-tRNA_Synthase,pfam_PheS_beta_Fdx_antiC-bd,superfamily_PheS_beta_Fdx_antiC-bd,smart_PheS_beta_Fdx_antiC-bd,pfscan_aa-tRNA-synth_II,tigrfam_Phe-tRNA-synth_IIc_mito	p.D336	ENST00000324331.6	37	c.1008	CCDS4494.1	6																																																																																			FARS2	-	pfam_Phenylalanyl-tRNA_Synthase,pfscan_aa-tRNA-synth_II,tigrfam_Phe-tRNA-synth_IIc_mito	ENSG00000145982		0.448	FARS2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FARS2	HGNC	protein_coding	OTTHUMT00000467790.1	63	0.00	0	C	NM_006567		5545516	5545516	+1	no_errors	ENST00000274680	ensembl	human	known	69_37n	silent	57	30.49	25	SNP	0.986	T
FBN2	2201	genome.wustl.edu	37	5	127685051	127685051	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr5:127685051G>C	ENST00000508053.1	-	29	3951	c.2977C>G	c.(2977-2979)Cgt>Ggt	p.R993G	FBN2_ENST00000508989.1_Missense_Mutation_p.R960G|FBN2_ENST00000262464.4_Missense_Mutation_p.R993G			P35556	FBN2_HUMAN	fibrillin 2	993	EGF-like 14; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.R993G(2)		NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		AAACATACACGGCCAGTCCCA	0.458																																						dbGAP											2	Substitution - Missense(2)	endometrium(2)											110.0	93.0	99.0					5																	127685051		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2977C>G	5.37:g.127685051G>C	ENSP00000424571:p.Arg993Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R993G	ENST00000508053.1	37	c.2977	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	G	14.06	2.422169	0.43020	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.91843	-2.92;-2.92;-2.92	3.97	3.11	0.35812	Matrix fibril-associated (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.108017	0.38005	N	0.001850	D	0.93552	0.7942	L	0.59912	1.85	0.48830	D	0.999717	D;D	0.71674	0.988;0.998	D;D	0.83275	0.92;0.996	D	0.92342	0.5882	10	0.59425	D	0.04	.	6.8865	0.24206	0.086:0.0:0.6313:0.2827	.	960;993	D6RJI3;P35556	.;FBN2_HUMAN	G	993;993;960	ENSP00000262464:R993G;ENSP00000424571:R993G;ENSP00000425596:R960G	ENSP00000262464:R993G	R	-	1	0	FBN2	127712950	0.812000	0.29077	1.000000	0.80357	0.651000	0.38670	1.157000	0.31724	1.281000	0.44480	0.655000	0.94253	CGT	FBN2	-	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,superfamily_TB_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000138829		0.458	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	29	0.00	0	G	NM_001999		127685051	127685051	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	1.000	C
GNL3L	54552	genome.wustl.edu	37	X	54569444	54569444	+	Silent	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chrX:54569444G>A	ENST00000336470.4	+	6	502	c.363G>A	c.(361-363)agG>agA	p.R121R	GNL3L_ENST00000360845.2_Silent_p.R121R|GNL3L_ENST00000489691.1_3'UTR	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	121					GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						AGGCCACGAGGAAGGCTTATT	0.478																																						dbGAP											0													79.0	75.0	76.0					X																	54569444		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.363G>A	X.37:g.54569444G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,prints_GTP_binding_domain	p.R121	ENST00000336470.4	37	c.363	CCDS14360.1	X																																																																																			GNL3L	-	NULL	ENSG00000130119		0.478	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	HGNC	protein_coding	OTTHUMT00000056805.1	56	0.00	0	G	NM_019067		54569444	54569444	+1	no_errors	ENST00000336470	ensembl	human	known	69_37n	silent	77	34.19	40	SNP	0.997	A
GRASP	160622	genome.wustl.edu	37	12	52407973	52407973	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr12:52407973C>T	ENST00000293662.4	+	7	750	c.670C>T	c.(670-672)Cgg>Tgg	p.R224W	GRASP_ENST00000552963.1_3'UTR|GRASP_ENST00000380039.2_Missense_Mutation_p.R81W|GRASP_ENST00000552049.1_Missense_Mutation_p.R81W	NM_181711.2	NP_859062.1	Q7Z6J2	GRASP_HUMAN	GRP1 (general receptor for phosphoinositides 1)-associated scaffold protein	224	Interaction with PSCD3. {ECO:0000250}.				protein localization (GO:0008104)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				central_nervous_system(1)|large_intestine(1)|lung(1)|skin(2)	5				BRCA - Breast invasive adenocarcinoma(357;0.0967)		GCAGGAGCAGCGGCTGGTGCA	0.577																																						dbGAP											0													72.0	64.0	67.0					12																	52407973		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC019244	CCDS8817.1, CCDS61124.1	12q13.13	2011-09-02			ENSG00000161835	ENSG00000161835			18707	protein-coding gene	gene with protein product		612027				10828067	Standard	NM_001271856		Approved		uc001rzo.2	Q7Z6J2	OTTHUMG00000169595	ENST00000293662.4:c.670C>T	12.37:g.52407973C>T	ENSP00000293662:p.Arg224Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIF8|Q7Z741	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R224W	ENST00000293662.4	37	c.670	CCDS8817.1	12	.	.	.	.	.	.	.	.	.	.	C	22.3	4.268920	0.80469	.	.	ENSG00000161835	ENST00000293662;ENST00000552049;ENST00000546756;ENST00000380039	T;T	0.61158	0.13;0.52	4.07	4.07	0.47477	.	0.000000	0.85682	D	0.000000	T	0.71929	0.3398	M	0.61703	1.905	0.58432	D	0.999996	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.75465	-0.3308	10	0.87932	D	0	5.5226	13.6227	0.62146	0.0:1.0:0.0:0.0	.	81;224	Q7Z6J2-2;Q7Z6J2	.;GRASP_HUMAN	W	224;81;94;81	ENSP00000293662:R224W;ENSP00000448476:R94W	ENSP00000293662:R224W	R	+	1	2	GRASP	50694240	0.997000	0.39634	1.000000	0.80357	0.985000	0.73830	0.328000	0.19681	2.280000	0.76307	0.460000	0.39030	CGG	GRASP	-	NULL	ENSG00000161835		0.577	GRASP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRASP	HGNC	protein_coding	OTTHUMT00000404972.1	64	0.00	0	C			52407973	52407973	+1	no_errors	ENST00000293662	ensembl	human	known	69_37n	missense	65	30.85	29	SNP	1.000	T
GRIN2C	2905	genome.wustl.edu	37	17	72846369	72846369	+	Silent	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr17:72846369G>A	ENST00000293190.5	-	6	1613	c.1467C>T	c.(1465-1467)ggC>ggT	p.G489G	GRIN2C_ENST00000578159.1_5'Flank|GRIN2C_ENST00000347612.4_Silent_p.G489G	NM_000835.3	NP_000826.2	Q14957	NMDE3_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2C	489					directional locomotion (GO:0033058)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of protein catabolic process (GO:0042177)|neuromuscular process controlling balance (GO:0050885)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	33	all_lung(278;0.172)|Lung NSC(278;0.207)				Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGTTCCATACGCCGCGCACCC	0.617																																						dbGAP											0													105.0	86.0	92.0					17																	72846369		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32724.1, CCDS62330.1	17q25.1	2012-08-29			ENSG00000161509	ENSG00000161509		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4587	protein-coding gene	gene with protein product		138254		NMDAR2C		9480759	Standard	NM_001278553		Approved	GluN2C	uc002jlt.1	Q14957	OTTHUMG00000044524	ENST00000293190.5:c.1467C>T	17.37:g.72846369G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT1	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,pfam_NMDAR2_C,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.G489	ENST00000293190.5	37	c.1467	CCDS32724.1	17																																																																																			GRIN2C	-	pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	ENSG00000161509		0.617	GRIN2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2C	HGNC	protein_coding	OTTHUMT00000103824.1	24	0.00	0	G			72846369	72846369	-1	no_errors	ENST00000293190	ensembl	human	known	69_37n	silent	13	31.58	6	SNP	0.856	A
H2BFM	286436	genome.wustl.edu	37	X	103294608	103294608	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chrX:103294608T>C	ENST00000355016.3	+	1	93	c.65T>C	c.(64-66)aTc>aCc	p.I22T	H2BFM_ENST00000243297.5_Missense_Mutation_p.I125T	NM_001164416.1	NP_001157888.1	P0C1H6	H2BFM_HUMAN	H2B histone family, member M	22						nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|lung(1)|ovary(1)	3						GGCCAGAGCATCCAGGAGCCC	0.637																																						dbGAP											0													17.0	20.0	19.0					X																	103294608		692	1591	2283	-	-	-	SO:0001583	missense	0			AK093522	CCDS55468.1	Xq22.2	2011-01-27			ENSG00000101812	ENSG00000101812		"""Histones / Replication-independent"""	27867	protein-coding gene	gene with protein product							Standard	NM_001164416		Approved		uc004els.2	P0C1H6	OTTHUMG00000022122	ENST00000355016.3:c.65T>C	X.37:g.103294608T>C	ENSP00000347119:p.Ile22Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP82	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.I125T	ENST00000355016.3	37	c.374	CCDS55468.1	X	.	.	.	.	.	.	.	.	.	.	.	0.570	-0.841395	0.02692	.	.	ENSG00000101812	ENST00000243297;ENST00000355016	T;T	0.22945	1.93;1.93	1.36	-1.04	0.10068	.	.	.	.	.	T	0.06735	0.0172	N	0.02539	-0.55	0.09310	N	1	B	0.14438	0.01	B	0.04013	0.001	T	0.36114	-0.9761	9	0.02654	T	1	.	4.0314	0.09711	0.0:0.5124:0.0:0.4876	.	125	P0C1H6	H2BFM_HUMAN	T	125;22	ENSP00000243297:I125T;ENSP00000347119:I22T	ENSP00000243297:I125T	I	+	2	0	H2BFM	103181264	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.171000	0.09883	-0.295000	0.08960	-0.416000	0.06073	ATC	H2BFM	-	NULL	ENSG00000101812		0.637	H2BFM-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	H2BFM	HGNC	protein_coding	OTTHUMT00000057758.2	14	0.00	0	T	XM_210048		103294608	103294608	+1	no_errors	ENST00000243297	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	0.000	C
HS3ST4	9951	genome.wustl.edu	37	16	26147331	26147331	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr16:26147331A>C	ENST00000331351.5	+	2	1525	c.1133A>C	c.(1132-1134)aAa>aCa	p.K378T	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	378					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)			breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		CTAGGCCTCAAACGTGTTGTG	0.512																																						dbGAP											0													73.0	71.0	71.0					16																	26147331		1568	3582	5150	-	-	-	SO:0001583	missense	0			AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.1133A>C	16.37:g.26147331A>C	ENSP00000330606:p.Lys378Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QI42|Q8NDC2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.K378T	ENST00000331351.5	37	c.1133	CCDS53995.1	16	.	.	.	.	.	.	.	.	.	.	A	16.83	3.230780	0.58777	.	.	ENSG00000182601	ENST00000331351	T	0.54071	0.59	5.56	3.3	0.37823	Sulfotransferase domain (1);	0.070048	0.53938	U	0.000053	T	0.59088	0.2168	L	0.49699	1.58	0.52501	D	0.999956	D	0.61697	0.99	D	0.71870	0.975	T	0.56456	-0.7976	10	0.39692	T	0.17	.	4.9889	0.14203	0.6867:0.1606:0.1527:0.0	.	378	Q9Y661	HS3S4_HUMAN	T	378	ENSP00000330606:K378T	ENSP00000330606:K378T	K	+	2	0	HS3ST4	26054832	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.788000	0.55446	0.899000	0.36444	0.533000	0.62120	AAA	HS3ST4	-	pfam_Sulfotransferase_dom	ENSG00000182601		0.512	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST4	HGNC	protein_coding	OTTHUMT00000133286.2	29	0.00	0	A	NM_006040		26147331	26147331	+1	no_errors	ENST00000331351	ensembl	human	known	69_37n	missense	50	18.03	11	SNP	1.000	C
IL17RE	132014	genome.wustl.edu	37	3	9956194	9956194	+	Intron	SNP	T	T	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr3:9956194T>C	ENST00000383814.3	+	14	1401				IL17RC_ENST00000413608.1_5'Flank|IL17RC_ENST00000403601.3_5'Flank|IL17RC_ENST00000383812.4_5'Flank|IL17RE_ENST00000454190.2_Silent_p.D444D|IL17RC_ENST00000455057.1_5'Flank|IL17RE_ENST00000421412.1_Intron|IL17RC_ENST00000416074.2_5'Flank|IL17RE_ENST00000295980.3_Intron|IL17RC_ENST00000295981.3_5'Flank	NM_153480.1	NP_705613.1	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E						inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(11)|skin(1)	21				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		GAGGAGAAGATGCCTGGCTCA	0.607																																						dbGAP											0													81.0	84.0	83.0					3																	9956194		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF458069	CCDS2589.1, CCDS54552.1	3p25.3	2008-02-05			ENSG00000163701	ENSG00000163701		"""Interleukins and interleukin receptors"""	18439	protein-coding gene	gene with protein product		614995					Standard	NM_153480		Approved	FLJ23658	uc003btu.3	Q8NFR9	OTTHUMG00000128649	ENST00000383814.3:c.1297-38T>C	3.37:g.9956194T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB34|B2RNR1|B9EH65|Q6P532|Q8N8H7|Q8N8H8|Q8TEC2	Silent	SNP	NULL	p.D444	ENST00000383814.3	37	c.1332	CCDS2589.1	3																																																																																			IL17RE	-	NULL	ENSG00000163701		0.607	IL17RE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RE	HGNC	protein_coding	OTTHUMT00000250529.1	28	0.00	0	T	NM_153480		9956194	9956194	+1	no_errors	ENST00000454190	ensembl	human	known	69_37n	silent	20	63.16	36	SNP	0.000	C
ITGA3	3675	genome.wustl.edu	37	17	48166523	48166523	+	3'UTR	SNP	A	A	G			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr17:48166523A>G	ENST00000320031.8	+	0	3567				ITGA3_ENST00000007722.7_Missense_Mutation_p.H1032R	NM_002204.2|NM_005501.2	NP_002195.1|NP_005492.1	P26006	ITA3_HUMAN	integrin, alpha 3 (antigen CD49C, alpha 3 subunit of VLA-3 receptor)						blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|lung development (GO:0030324)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|mesodermal cell differentiation (GO:0048333)|negative regulation of cell projection organization (GO:0031345)|nephron development (GO:0072006)|neuron migration (GO:0001764)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|regulation of BMP signaling pathway (GO:0030510)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|regulation of Wnt signaling pathway (GO:0030111)|renal filtration (GO:0097205)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|skin development (GO:0043588)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integrin alpha3-beta1 complex (GO:0034667)|integrin complex (GO:0008305)|invadopodium membrane (GO:0071438)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	glycoprotein binding (GO:0001948)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(2)	31						CCCAAGTACCACGCAGTGCGG	0.562																																						dbGAP											0													219.0	219.0	219.0					17																	48166523		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			M59911	CCDS11557.1, CCDS11558.1	17q21.33	2010-03-23	2003-10-13		ENSG00000005884	ENSG00000005884		"""CD molecules"", ""Integrins"""	6139	protein-coding gene	gene with protein product		605025	"""antigen identified by monoclonal antibody J143"""	MSK18		1655803, 9704023	Standard	NM_005501		Approved	CD49c, VLA3a, VCA-2, GAP-B3	uc010dbm.3	P26006	OTTHUMG00000161890	ENST00000320031.8:c.*81A>G	17.37:g.48166523A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E246|B7ZM80|B9EGQ1|D3DTX4|D3DTX5	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.H1032R	ENST00000320031.8	37	c.3095	CCDS11558.1	17	.	.	.	.	.	.	.	.	.	.	A	14.15	2.448436	0.43429	.	.	ENSG00000005884	ENST00000007722	T	0.68903	-0.36	4.87	4.87	0.63330	.	0.427413	0.25481	N	0.030380	T	0.58452	0.2123	.	.	.	0.80722	D	1	B	0.26258	0.145	B	0.27380	0.079	T	0.56547	-0.7961	9	0.35671	T	0.21	.	13.7505	0.62904	1.0:0.0:0.0:0.0	.	1032	P26006-1	.	R	1032	ENSP00000007722:H1032R	ENSP00000007722:H1032R	H	+	2	0	ITGA3	45521522	1.000000	0.71417	0.979000	0.43373	0.659000	0.38960	6.862000	0.75484	1.963000	0.57068	0.533000	0.62120	CAC	ITGA3	-	NULL	ENSG00000005884		0.562	ITGA3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA3	HGNC	protein_coding	OTTHUMT00000366298.1	43	0.00	0	A	NM_005501		48166523	48166523	+1	no_errors	ENST00000007722	ensembl	human	novel	69_37n	missense	72	18.18	16	SNP	1.000	G
KY	339855	genome.wustl.edu	37	3	134323234	134323234	+	Silent	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr3:134323234C>T	ENST00000423778.2	-	11	1234	c.1173G>A	c.(1171-1173)ggG>ggA	p.G391G	KY_ENST00000503669.1_3'UTR|KY_ENST00000508956.1_Silent_p.G370G	NM_178554.4	NP_848649.3	Q8NBH2	KY_HUMAN	kyphoscoliosis peptidase	391					muscle organ development (GO:0007517)|neuromuscular junction development (GO:0007528)	cytoskeleton (GO:0005856)|Z disc (GO:0030018)	peptidase activity (GO:0008233)			central_nervous_system(1)|endometrium(3)|kidney(1)|lung(12)|ovary(2)|upper_aerodigestive_tract(2)	21						GGCTCAGCAGCCCATGCTCTT	0.542																																						dbGAP											0													90.0	87.0	88.0					3																	134323234		2126	4223	6349	-	-	-	SO:0001819	synonymous_variant	0			AK090526	CCDS46920.1	3q22.1	2010-11-23			ENSG00000174611	ENSG00000174611			26576	protein-coding gene	gene with protein product		605739					Standard	NM_178554		Approved	FLJ33207	uc010hty.3	Q8NBH2	OTTHUMG00000159788	ENST00000423778.2:c.1173G>A	3.37:g.134323234C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1S4|Q6ZT15	Silent	SNP	pfam_Transglutaminase-like,smart_Transglutaminase-like	p.G391	ENST00000423778.2	37	c.1173	CCDS46920.1	3																																																																																			KY	-	NULL	ENSG00000174611		0.542	KY-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KY	HGNC	protein_coding	OTTHUMT00000357320.1	27	0.00	0	C	NM_178554		134323234	134323234	-1	no_errors	ENST00000423778	ensembl	human	known	69_37n	silent	8	68.00	17	SNP	1.000	T
LCN8	138307	genome.wustl.edu	37	9	139650268	139650269	+	5'UTR	INS	-	-	CA			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr9:139650268_139650269insCA	ENST00000482893.1	-	0	1276_1277				LCN8_ENST00000371688.3_Intron			Q6JVE9	LCN8_HUMAN	lipocalin 8						response to hormone (GO:0009725)|transport (GO:0006810)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)	10	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;5.56e-06)|Epithelial(140;8.32e-05)		atggggaacagtgcagggaaca	0.584																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK124003	CCDS35183.1	9q34.3	2011-10-24	2005-01-11		ENSG00000204001	ENSG00000204001		"""Lipocalins"""	27038	protein-coding gene	gene with protein product		612902	"""chromosome 9 open reading frame 137"", ""lipocalin 5"""	LCN5			Standard	XM_005266058		Approved		uc004cjb.1	Q6JVE9	OTTHUMG00000020942	ENST00000482893.1:c.-1349->TG	9.37:g.139650268_139650269insCA		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4A8|A6NMN9|Q5T5R4	RNA	INS	-	NULL	ENST00000482893.1	37	NULL		9																																																																																			LCN8	-	-	ENSG00000204001		0.584	LCN8-003	KNOWN	basic	processed_transcript	LCN8	HGNC	protein_coding	OTTHUMT00000055111.1	11	0.00	0	-	NM_178469		139650268	139650269	-1	no_errors	ENST00000482893	ensembl	human	known	69_37n	rna	2	50.00	2	INS	0.005:0.005	CA
MAST1	22983	genome.wustl.edu	37	19	12962989	12962989	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr19:12962989G>A	ENST00000251472.4	+	9	976	c.937G>A	c.(937-939)Ggc>Agc	p.G313S	MAST1_ENST00000591495.1_Missense_Mutation_p.G309S	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						CGCCAAGGAGGGCCACCTTGT	0.667																																						dbGAP											0													63.0	70.0	68.0					19																	12962989		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.937G>A	19.37:g.12962989G>A	ENSP00000251472:p.Gly313Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.G313S	ENST00000251472.4	37	c.937	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.643529	0.96704	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.29397	1.57	5.49	5.49	0.81192	Microtubule-associated serine/threonine-protein kinase, domain (1);	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	M	0.71920	2.185	0.58432	D	0.999999	D;P	0.89917	1.0;0.707	D;P	0.97110	1.0;0.495	T	0.55667	-0.8105	10	0.56958	D	0.05	-35.5207	17.246	0.87028	0.0:0.0:1.0:0.0	.	313;313	Q9Y2H9;F5H2S9	MAST1_HUMAN;.	S	313	ENSP00000251472:G313S	ENSP00000251472:G313S	G	+	1	0	MAST1	12823989	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.796000	0.99103	2.765000	0.95021	0.591000	0.81541	GGC	MAST1	-	pfam_MA_Ser/Thr_Kinase_dom	ENSG00000105613		0.667	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2	27	0.00	0	G	NM_014975		12962989	12962989	+1	no_errors	ENST00000251472	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	1.000	A
MOCS1	4337	genome.wustl.edu	37	6	39874865	39874865	+	Silent	SNP	T	T	G			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr6:39874865T>G	ENST00000340692.5	-	11	1182	c.1179A>C	c.(1177-1179)ccA>ccC	p.P393P	MOCS1_ENST00000373186.4_3'UTR|MOCS1_ENST00000308559.7_Silent_p.P377P|MOCS1_ENST00000373175.4_3'UTR|MOCS1_ENST00000373195.3_Silent_p.P290P|MOCS1_ENST00000373188.2_3'UTR|MOCS1_ENST00000425303.2_Silent_p.P393P			Q9NZB8	MOCS1_HUMAN	molybdenum cofactor synthesis 1	393					Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|molybdopterin synthase complex (GO:0019008)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|cyclic pyranopterin monophosphate synthase activity (GO:0061597)|GTP binding (GO:0005525)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	21	Ovarian(28;0.0355)|Colorectal(47;0.196)					GATTGGCTGGTGGGGAATTGG	0.468																																					NSCLC(84;861 1413 23785 24908 42279)|Melanoma(182;611 2047 9114 11847 26639)	dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AJ224328	CCDS4846.1, CCDS43460.1	6p21.2	2012-05-08			ENSG00000124615	ENSG00000124615			7190	protein-coding gene	gene with protein product		603707				9731530, 10053004	Standard	NM_001075098		Approved	MOCOD	uc003opb.3	Q9NZB8	OTTHUMG00000014656	ENST00000340692.5:c.1179A>C	6.37:g.39874865T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPT7|B4DTP1|O14940|O14941|O75710|Q5J7W0|Q5TCE1|Q5TCE2|Q5TCE6|Q5TCE9|Q5TCF0|Q5TCF1|Q8N418|Q9NZB7|Q9UEM1	Silent	SNP	pfam_Mopterin_CF_biosynth-C_dom,pfam_Mob_synth_C,pfam_rSAM,superfamily_Mopterin_CF_biosynth-C_dom,smart_Elp3/MiaB/NifB,tigrfam_MoaA,tigrfam_Mo_CF_biosynth-C	p.P393	ENST00000340692.5	37	c.1179		6																																																																																			MOCS1	-	NULL	ENSG00000124615		0.468	MOCS1-005	KNOWN	basic|appris_candidate_longest	protein_coding	MOCS1	HGNC	protein_coding	OTTHUMT00000040476.2	12	0.00	0	T	NM_005943		39874865	39874865	-1	no_errors	ENST00000340692	ensembl	human	known	69_37n	silent	17	32.00	8	SNP	1.000	G
MRPS27	23107	genome.wustl.edu	37	5	71616019	71616019	+	Missense_Mutation	SNP	C	C	T	rs147211361		TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr5:71616019C>T	ENST00000261413.5	-	1	69	c.30G>A	c.(28-30)atG>atA	p.M10I	MRPS27_ENST00000522095.1_Missense_Mutation_p.M10I|PTCD2_ENST00000536805.1_5'Flank|MRPS27_ENST00000513900.1_Missense_Mutation_p.M10I|PTCD2_ENST00000503868.1_5'Flank|PTCD2_ENST00000380639.5_5'Flank|PTCD2_ENST00000543322.1_5'Flank|MRPS27_ENST00000515404.1_5'UTR|MRPS27_ENST00000457646.4_5'UTR	NM_015084.2	NP_055899.2	Q92552	RT27_HUMAN	mitochondrial ribosomal protein S27	10						mitochondrion (GO:0005739)|ribosome (GO:0005840)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)	6		Lung NSC(167;0.00237)|Ovarian(174;0.0175)|Prostate(461;0.141)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;1.46e-53)		GCGCCAGGAGCATCCCGCGCC	0.587																																						dbGAP											0													46.0	47.0	47.0					5																	71616019		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87453	CCDS4013.1, CCDS68890.1, CCDS75257.1	5q13.2	2012-09-13			ENSG00000113048	ENSG00000113048		"""Mitochondrial ribosomal proteins / small subunits"""	14512	protein-coding gene	gene with protein product		611989					Standard	NM_015084		Approved	KIAA0264	uc003kbz.4	Q92552	OTTHUMG00000100951	ENST00000261413.5:c.30G>A	5.37:g.71616019C>T	ENSP00000261413:p.Met10Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRT2|Q6P1S1	Missense_Mutation	SNP	pfam_Ribosomal_S27_mit	p.M10I	ENST00000261413.5	37	c.30	CCDS4013.1	5	.	.	.	.	.	.	.	.	.	.	C	10.23	1.292318	0.23564	.	.	ENSG00000113048	ENST00000261413;ENST00000513900;ENST00000522095	T;T;T	0.45276	0.9;0.9;0.9	5.19	-5.06	0.02946	.	1.539810	0.03013	N	0.149754	T	0.25827	0.0629	N	0.21448	0.665	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17077	-1.0381	10	0.14252	T	0.57	4.749	8.9331	0.35684	0.3662:0.292:0.3418:0.0	.	10;10	B4DRT2;Q92552	.;RT27_HUMAN	I	10	ENSP00000261413:M10I;ENSP00000426941:M10I;ENSP00000430590:M10I	ENSP00000261413:M10I	M	-	3	0	MRPS27	71651775	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.997000	0.03705	-0.830000	0.04262	-0.932000	0.02703	ATG	MRPS27	-	pfam_Ribosomal_S27_mit	ENSG00000113048		0.587	MRPS27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS27	HGNC	protein_coding	OTTHUMT00000218560.2	46	0.00	0	C	NM_015084		71616019	71616019	-1	no_errors	ENST00000513900	ensembl	human	known	69_37n	missense	32	25.58	11	SNP	0.000	T
NCF2	4688	genome.wustl.edu	37	1	183556058	183556058	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr1:183556058G>A	ENST00000367535.3	-	2	480	c.229C>T	c.(229-231)Cga>Tga	p.R77*	NCF2_ENST00000413720.1_Nonsense_Mutation_p.R77*|NCF2_ENST00000418089.1_Nonsense_Mutation_p.R77*|NCF2_ENST00000367536.1_Nonsense_Mutation_p.R77*	NM_000433.3	NP_000424.2	P19878	NCF2_HUMAN	neutrophil cytosolic factor 2	77			R -> Q (in CGD2; dbSNP:rs119103275). {ECO:0000269|PubMed:10598813, ECO:0000269|PubMed:20167518}.		aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cellular response to hormone stimulus (GO:0032870)|innate immune response (GO:0045087)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|positive regulation of blood pressure (GO:0045777)|positive regulation of neuron apoptotic process (GO:0043525)|respiratory burst (GO:0045730)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to hyperoxia (GO:0055093)|response to laminar fluid shear stress (GO:0034616)|response to lipopolysaccharide (GO:0032496)|response to progesterone (GO:0032570)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	acrosomal vesicle (GO:0001669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|NADPH oxidase complex (GO:0043020)|nucleolus (GO:0005730)|phagolysosome (GO:0032010)	electron carrier activity (GO:0009055)|protein C-terminus binding (GO:0008022)	p.R77*(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30					Dextromethorphan(DB00514)	AGCATCCCTCGTTGGAAGTAA	0.512																																						dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											196.0	163.0	174.0					1																	183556058		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC001606	CCDS1356.1, CCDS53446.1, CCDS53447.1	1q25	2014-09-17	2008-07-31		ENSG00000116701	ENSG00000116701		"""Tetratricopeptide (TTC) repeat domain containing"""	7661	protein-coding gene	gene with protein product	"""NADPH oxidase activator 2"", ""chronic granulomatous disease, autosomal 2"""	608515	"""neutrophil cytosolic factor 2 (65kD, chronic granulomatous disease, autosomal 2)"""				Standard	NM_000433		Approved	p67phox, NOXA2	uc001gqk.4	P19878	OTTHUMG00000035329	ENST00000367535.3:c.229C>T	1.37:g.183556058G>A	ENSP00000356505:p.Arg77*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Q1|B4DKQ7|B4DQA7|E9PHJ2|E9PHX3|Q2PP06|Q8NFC7|Q9BV51	Nonsense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_TPR-1,pfam_OPR_PB1,superfamily_SH3_domain,smart_TPR_repeat,smart_SH3_domain,smart_OPR_PB1,pfscan_SH3_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_p67phox,prints_SH3_domain	p.R77*	ENST00000367535.3	37	c.229	CCDS1356.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.296761	0.97453	.	.	ENSG00000116701	ENST00000367536;ENST00000392014;ENST00000413720;ENST00000418089;ENST00000367535	.	.	.	5.17	3.24	0.37175	.	0.108829	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-39.466	13.5056	0.61481	0.0:0.0:0.7019:0.2981	.	.	.	.	X	77;105;77;77;77	.	ENSP00000356505:R77X	R	-	1	2	NCF2	181822681	0.693000	0.27728	0.325000	0.25375	0.716000	0.41182	0.924000	0.28777	0.621000	0.30232	0.561000	0.74099	CGA	NCF2	-	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000116701		0.512	NCF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NCF2	HGNC	protein_coding	OTTHUMT00000085483.1	49	0.00	0	G	NM_000433		183556058	183556058	-1	no_errors	ENST00000367535	ensembl	human	known	69_37n	nonsense	73	29.52	31	SNP	0.946	A
OR52K1	390036	genome.wustl.edu	37	11	4510284	4510284	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr11:4510284C>T	ENST00000307632.3	+	1	176	c.154C>T	c.(154-156)Cag>Tag	p.Q52*		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	52			Q -> R (in dbSNP:rs96489). {ECO:0000269|PubMed:14983052, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.1}.			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTTCATTATCCAGGCTGATGC	0.498																																						dbGAP											0													166.0	157.0	160.0					11																	4510284		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.154C>T	11.37:g.4510284C>T	ENSP00000302422:p.Gln52*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH54|Q6IFK5	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q52*	ENST00000307632.3	37	c.154	CCDS31352.1	11	.	.	.	.	.	.	.	.	.	.	C	7.598	0.672184	0.14776	.	.	ENSG00000196778	ENST00000307632	.	.	.	3.59	0.678	0.17969	.	1.211190	0.06110	N	0.666991	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.0392	0.06133	0.2706:0.417:0.0:0.3124	.	.	.	.	X	52	.	ENSP00000302422:Q52X	Q	+	1	0	OR52K1	4466860	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-1.092000	0.03366	0.149000	0.19098	-0.362000	0.07510	CAG	OR52K1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196778		0.498	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K1	HGNC	protein_coding	OTTHUMT00000385846.1	111	0.00	0	C	NM_001005171		4510284	4510284	+1	no_errors	ENST00000307632	ensembl	human	known	69_37n	nonsense	131	25.14	44	SNP	0.000	T
PCDHB8	56128	genome.wustl.edu	37	5	140558070	140558070	+	Missense_Mutation	SNP	C	C	A	rs17844484		TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr5:140558070C>A	ENST00000239444.2	+	1	700	c.455C>A	c.(454-456)gCg>gAg	p.A152E	PCDHB16_ENST00000361016.2_5'Flank	NM_019120.3	NP_061993.2	Q9UN66	PCDB8_HUMAN	protocadherin beta 8	152	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(14)|liver(1)|lung(38)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCTGGGACTGCGTTTCCTCTG	0.433																																						dbGAP											0													74.0	114.0	101.0					5																	140558070		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152501	CCDS4250.1	5q31	2010-01-26			ENSG00000120322	ENSG00000120322		"""Cadherins / Protocadherins : Clustered"""	8693	other	protocadherin		606334				10380929	Standard	NM_019120		Approved	PCDH-BETA8, PCDH3I	uc011dai.2	Q9UN66	OTTHUMG00000129621	ENST00000239444.2:c.455C>A	5.37:g.140558070C>A	ENSP00000239444:p.Ala152Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGV1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A152E	ENST00000239444.2	37	c.455	CCDS4250.1	5	.	.	.	.	.	.	.	.	.	.	c	0.005	-2.153975	0.00325	.	.	ENSG00000120322	ENST00000239444	T	0.46819	0.86	4.25	-0.378	0.12497	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.28067	0.0692	L	0.29908	0.895	0.09310	N	1	B	0.06786	0.001	B	0.13407	0.009	T	0.22977	-1.0201	9	0.38643	T	0.18	.	0.4972	0.00573	0.3792:0.2281:0.1886:0.2041	.	152	Q9UN66	PCDB8_HUMAN	E	152	ENSP00000239444:A152E	ENSP00000239444:A152E	A	+	2	0	PCDHB8	140538254	0.000000	0.05858	0.002000	0.10522	0.534000	0.34807	0.218000	0.17622	0.263000	0.21812	-0.237000	0.12165	GCG	PCDHB8	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000120322		0.433	PCDHB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB8	HGNC	protein_coding	OTTHUMT00000251816.2	68	0.00	0	C	NM_019120		140558070	140558070	+1	no_errors	ENST00000239444	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	0.000	A
PDE12	201626	genome.wustl.edu	37	3	57542637	57542637	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr3:57542637delC	ENST00000311180.8	+	1	634	c.531delC	c.(529-531)ttcfs	p.F177fs	PDE12_ENST00000487257.1_Frame_Shift_Del_p.F177fs	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	177					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		TGGCCGGGTTCCCTGTGTGCC	0.637																																					Colon(125;308 1634 19198 50622 50717)	dbGAP											0													42.0	47.0	45.0					3																	57542637		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.531delC	3.37:g.57542637delC	ENSP00000309142:p.Phe177fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Frame_Shift_Del	DEL	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.P178fs	ENST00000311180.8	37	c.531	CCDS33772.1	3																																																																																			PDE12	-	NULL	ENSG00000174840		0.637	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE12	HGNC	protein_coding	OTTHUMT00000351440.2	26	0.00	0	C	NM_177966		57542637	57542637	+1	no_errors	ENST00000311180	ensembl	human	known	69_37n	frame_shift_del	25	26.47	9	DEL	1.000	-
PIK3CA	5290	genome.wustl.edu	37	3	178916924	178916924	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr3:178916924C>T	ENST00000263967.3	+	2	468	c.311C>T	c.(310-312)cCa>cTa	p.P104L		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	104	PI3K-ABD. {ECO:0000255|PROSITE- ProRule:PRU00877}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.P104L(1)|p.P104R(1)|p.P104_G106>R(1)|p.E103_G106>D(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GTAATTGAACCAGTAGGCAAC	0.353		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	4	Substitution - Missense(2)|Complex - deletion inframe(2)	large_intestine(2)|NS(1)|breast(1)											92.0	88.0	89.0					3																	178916924		1819	4069	5888	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.311C>T	3.37:g.178916924C>T	ENSP00000263967:p.Pro104Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.P104L	ENST00000263967.3	37	c.311	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255170	0.80135	.	.	ENSG00000121879	ENST00000263967;ENST00000468036	T;T	0.73575	-0.76;-0.76	5.52	5.52	0.82312	Phosphatidylinositol 3-kinase, p85-binding (2);	0.000000	0.85682	D	0.000000	D	0.83843	0.5342	L	0.56769	1.78	0.80722	D	1	D	0.67145	0.996	D	0.67382	0.951	T	0.82456	-0.0448	9	.	.	.	-19.3096	19.4272	0.94746	0.0:1.0:0.0:0.0	.	104	P42336	PK3CA_HUMAN	L	104	ENSP00000263967:P104L;ENSP00000417479:P104L	.	P	+	2	0	PIK3CA	180399618	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.484000	0.81180	2.584000	0.87258	0.555000	0.69702	CCA	PIK3CA	-	pfam_PI3K_adapt-bd_dom,smart_PI3K_adapt-bd_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	27	0.00	0	C			178916924	178916924	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	19	62.00	31	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110527447	110527447	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr8:110527447T>C	ENST00000378402.5	+	72	11706	c.11602T>C	c.(11602-11604)Tat>Cat	p.Y3868H		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3868					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTTGGATGTCTATGTGAACAA	0.323										HNSCC(38;0.096)																												dbGAP											0													100.0	87.0	91.0					8																	110527447		1831	4089	5920	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11602T>C	8.37:g.110527447T>C	ENSP00000367655:p.Tyr3868His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.Y3868H	ENST00000378402.5	37	c.11602	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	21.8	4.202654	0.79127	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.91237	-2.81;-2.3	5.29	5.29	0.74685	.	0.066708	0.64402	D	0.000008	D	0.95108	0.8415	M	0.85041	2.73	0.31318	N	0.686362	D	0.89917	1.0	D	0.80764	0.994	D	0.94440	0.7657	10	0.62326	D	0.03	.	11.6105	0.51057	0.0:0.0:0.0:1.0	.	3868	Q86WI1	PKHL1_HUMAN	H	3868;796	ENSP00000367655:Y3868H;ENSP00000437376:Y796H	ENSP00000367655:Y3868H	Y	+	1	0	PKHD1L1	110596623	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.481000	0.66826	2.012000	0.59069	0.477000	0.44152	TAT	PKHD1L1	-	NULL	ENSG00000205038		0.323	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	83	0.00	0	T	NM_177531		110527447	110527447	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	371	32.55	179	SNP	1.000	C
PLA2G4D	283748	genome.wustl.edu	37	15	42374005	42374005	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr15:42374005C>T	ENST00000290472.3	-	10	905	c.811G>A	c.(811-813)Gca>Aca	p.A271T		NM_178034.3	NP_828848.3	Q86XP0	PA24D_HUMAN	phospholipase A2, group IVD (cytosolic)	271					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid catabolic process (GO:0009395)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)	metal ion binding (GO:0046872)|phospholipase A2 activity (GO:0004623)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|stomach(1)	27		all_cancers(109;6.37e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;5.01e-09)|all_lung(180;2.24e-08)|Melanoma(134;0.019)|Ovarian(310;0.143)|Colorectal(260;0.245)		OV - Ovarian serous cystadenocarcinoma(18;4.9e-17)|GBM - Glioblastoma multiforme(94;1.02e-06)		CAGCCCTCTGCCTTGAGCTGC	0.582																																						dbGAP											0													117.0	117.0	117.0					15																	42374005		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB090876	CCDS32203.1	15q14	2008-09-19				ENSG00000159337	3.1.1.4		30038	protein-coding gene	gene with protein product		612864				14709560	Standard	NM_178034		Approved	cPLA2delta	uc001zox.3	Q86XP0		ENST00000290472.3:c.811G>A	15.37:g.42374005C>T	ENSP00000290472:p.Ala271Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N176	Missense_Mutation	SNP	pfam_LysoPLipase_cat_dom,pfam_C2_Ca-dep,superfamily_Acyl_Trfase/lysoPLipase,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_LysoPLipase_cat_dom,pfscan_C2_membr_targeting,pfscan_LysoPLipase_cat_dom	p.A271T	ENST00000290472.3	37	c.811	CCDS32203.1	15	.	.	.	.	.	.	.	.	.	.	C	8.679	0.904755	0.17760	.	.	ENSG00000159337	ENST00000290472	T	0.01228	5.14	4.88	-0.631	0.11526	Lysophospholipase, catalytic domain (1);	0.686699	0.13210	N	0.405239	T	0.00875	0.0029	N	0.16567	0.415	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.48222	-0.9054	10	0.14252	T	0.57	-0.4079	4.3737	0.11260	0.1447:0.5122:0.0:0.343	.	271	Q86XP0	PA24D_HUMAN	T	271	ENSP00000290472:A271T	ENSP00000290472:A271T	A	-	1	0	PLA2G4D	40161297	0.396000	0.25262	0.857000	0.33713	0.776000	0.43924	0.001000	0.13038	-0.121000	0.11787	0.650000	0.86243	GCA	PLA2G4D	-	smart_LysoPLipase_cat_dom	ENSG00000159337		0.582	PLA2G4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G4D	HGNC	protein_coding	OTTHUMT00000419317.1	53	0.00	0	C	NM_178034		42374005	42374005	-1	no_errors	ENST00000290472	ensembl	human	known	69_37n	missense	26	36.59	15	SNP	0.260	T
PRRX1	5396	genome.wustl.edu	37	1	170695530	170695530	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr1:170695530C>T	ENST00000239461.6	+	3	900	c.587C>T	c.(586-588)gCg>gTg	p.A196V	PRRX1_ENST00000497230.2_Missense_Mutation_p.A196V|PRRX1_ENST00000476867.2_3'UTR|PRRX1_ENST00000367760.3_Missense_Mutation_p.A196V	NM_022716.2	NP_073207.1	P54821	PRRX1_HUMAN	paired related homeobox 1	196					artery morphogenesis (GO:0048844)|cartilage development (GO:0051216)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|inner ear morphogenesis (GO:0042472)|middle ear morphogenesis (GO:0042474)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|palate development (GO:0060021)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of smoothened signaling pathway (GO:0045880)	nucleolus (GO:0005730)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)	p.A196V(2)		large_intestine(2)|ovary(1)	3	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TGGGGGACAGCGTCTCCGTAC	0.572																																						dbGAP											2	Substitution - Missense(2)	breast(2)											98.0	89.0	92.0					1																	170695530		2203	4300	6503	-	-	-	SO:0001583	missense	0			M95929	CCDS1290.1, CCDS1291.1	1q24.3	2011-06-20	2003-11-12	2003-11-14	ENSG00000116132	ENSG00000116132		"""Homeoboxes / PRD class"""	9142	protein-coding gene	gene with protein product		167420	"""paired mesoderm homeo box 1"""	PMX1		1509260	Standard	NM_006902		Approved	PHOX1	uc001ghf.3	P54821	OTTHUMG00000035231	ENST00000239461.6:c.587C>T	1.37:g.170695530C>T	ENSP00000239461:p.Ala196Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUM7|O60807	Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.A196V	ENST00000239461.6	37	c.587	CCDS1290.1	1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423433	0.83559	.	.	ENSG00000116132	ENST00000367760;ENST00000239461;ENST00000497230;ENST00000476867;ENST00000495280	D;D;D;T	0.91843	-2.85;-2.92;-2.87;-1.24	5.39	5.39	0.77823	.	0.055492	0.64402	D	0.000001	D	0.87696	0.6242	L	0.51422	1.61	0.80722	D	1	P;D	0.54047	0.825;0.964	B;B	0.41510	0.142;0.359	D	0.89561	0.3806	10	0.62326	D	0.03	.	17.7361	0.88394	0.0:1.0:0.0:0.0	.	196;196	P54821;P54821-2	PRRX1_HUMAN;.	V	196;196;196;41;41	ENSP00000356734:A196V;ENSP00000239461:A196V;ENSP00000450762:A196V;ENSP00000451225:A41V	ENSP00000239461:A196V	A	+	2	0	PRRX1	168962154	1.000000	0.71417	0.998000	0.56505	0.952000	0.60782	7.164000	0.77533	2.533000	0.85409	0.650000	0.86243	GCG	PRRX1	-	NULL	ENSG00000116132		0.572	PRRX1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRX1	HGNC	protein_coding	OTTHUMT00000085236.3	28	0.00	0	C	NM_006902		170695530	170695530	+1	no_errors	ENST00000239461	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	T
PTPRD	5789	genome.wustl.edu	37	9	8504378	8504378	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr9:8504378A>G	ENST00000381196.4	-	20	2248	c.1705T>C	c.(1705-1707)Tca>Cca	p.S569P	PTPRD_ENST00000356435.5_Missense_Mutation_p.S569P|PTPRD_ENST00000397606.3_Missense_Mutation_p.S559P|PTPRD_ENST00000397611.3_Missense_Mutation_p.S566P|PTPRD_ENST00000360074.4_Missense_Mutation_p.S556P|PTPRD_ENST00000537002.1_Missense_Mutation_p.S566P|PTPRD_ENST00000358503.5_Missense_Mutation_p.S556P|PTPRD_ENST00000355233.5_Missense_Mutation_p.S569P|PTPRD_ENST00000486161.1_Missense_Mutation_p.S569P|PTPRD_ENST00000397617.3_Missense_Mutation_p.S559P|PTPRD_ENST00000540109.1_Missense_Mutation_p.S569P	NM_002839.3	NP_002830.1	P23468	PTPRD_HUMAN	protein tyrosine phosphatase, receptor type, D	569	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				heterophilic cell-cell adhesion (GO:0007157)|neuron differentiation (GO:0030182)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|positive regulation of dendrite morphogenesis (GO:0050775)|presynaptic membrane assembly (GO:0097105)|protein dephosphorylation (GO:0006470)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cell adhesion molecule binding (GO:0050839)|receptor binding (GO:0005102)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|liver(1)|lung(83)|ovary(4)|pancreas(1)|prostate(7)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	168		all_cancers(3;3.38e-95)|all_epithelial(3;2.84e-91)|all_lung(3;7.3e-56)|Lung NSC(3;1.82e-52)|Renal(3;3.42e-19)|all_hematologic(3;0.000134)|all_neural(3;0.00409)|Acute lymphoblastic leukemia(23;0.0069)|Melanoma(3;0.0121)|Myeloproliferative disorder(4;0.0122)|Medulloblastoma(3;0.0144)|Lung SC(3;0.0301)|Ovarian(56;0.0694)|Hepatocellular(3;0.0824)		all cancers(1;3.38e-12)|Epithelial(1;2.12e-09)|STAD - Stomach adenocarcinoma(1;1.29e-07)|KIRC - Kidney renal clear cell carcinoma(3;5.49e-07)|Kidney(3;6.36e-07)|GBM - Glioblastoma multiforme(50;9.05e-05)|Lung(1;0.000189)|BRCA - Breast invasive adenocarcinoma(1;0.00178)|LUSC - Lung squamous cell carcinoma(1;0.0115)|LUAD - Lung adenocarcinoma(58;0.119)		AGCCTATATGATGTCCCTGGC	0.443										TSP Lung(15;0.13)																												dbGAP											0													277.0	236.0	250.0					9																	8504378		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54133	CCDS6472.1, CCDS43786.1, CCDS6472.2, CCDS55288.1, CCDS55289.1, CCDS55290.1, CCDS75813.1	9p24.1-p23	2013-02-11			ENSG00000153707	ENSG00000153707		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9668	protein-coding gene	gene with protein product		601598				7896816, 8355697	Standard	NM_002839		Approved	PTPD, HPTP	uc003zkk.3	P23468	OTTHUMG00000021005	ENST00000381196.4:c.1705T>C	9.37:g.8504378A>G	ENSP00000370593:p.Ser569Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALA0|F5GWT7|Q3KPJ0|Q3KPJ1|Q3KPJ2	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.S569P	ENST00000381196.4	37	c.1705	CCDS43786.1	9	.	.	.	.	.	.	.	.	.	.	A	18.04	3.535597	0.64972	.	.	ENSG00000153707	ENST00000381196;ENST00000356435;ENST00000360074;ENST00000358503;ENST00000355233;ENST00000397617;ENST00000397611;ENST00000537002;ENST00000346816;ENST00000540109;ENST00000486161;ENST00000397606	T;T;T;T;T;T;T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2;0.2	5.4	5.4	0.78164	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.054782	0.64402	D	0.000001	T	0.79816	0.4511	M	0.90252	3.1	0.53005	D	0.999967	P;P;D;P;B;P;D;D;B	0.65815	0.956;0.907;0.979;0.953;0.183;0.946;0.995;0.961;0.226	P;P;P;P;P;P;D;P;B	0.68621	0.864;0.864;0.864;0.864;0.477;0.786;0.959;0.868;0.199	D	0.84076	0.0382	9	.	.	.	.	15.7159	0.77667	1.0:0.0:0.0:0.0	.	559;563;569;569;566;566;556;569;569	Q3KPJ2;Q3KPI9;Q3KPJ0;Q3KPJ1;F5GWT7;F5GWY7;G3XAE2;Q2HXI4;P23468	.;.;.;.;.;.;.;.;PTPRD_HUMAN	P	569;569;556;556;569;559;566;566;569;569;569;559	ENSP00000370593:S569P;ENSP00000348812:S569P;ENSP00000353187:S556P;ENSP00000351293:S556P;ENSP00000347373:S569P;ENSP00000380741:S559P;ENSP00000380735:S566P;ENSP00000440515:S566P;ENSP00000438164:S569P;ENSP00000417093:S569P;ENSP00000380731:S559P	.	S	-	1	0	PTPRD	8494378	0.999000	0.42202	0.965000	0.40720	0.970000	0.65996	3.346000	0.52190	2.170000	0.68504	0.482000	0.46254	TCA	PTPRD	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000153707		0.443	PTPRD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRD	HGNC	protein_coding	OTTHUMT00000055395.3	145	0.00	0	A			8504378	8504378	-1	no_errors	ENST00000356435	ensembl	human	known	69_37n	missense	28	56.92	37	SNP	0.998	G
PTPRZ1	5803	genome.wustl.edu	37	7	121695126	121695126	+	Silent	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr7:121695126C>T	ENST00000393386.2	+	27	6924	c.6513C>T	c.(6511-6513)atC>atT	p.I2171I	PTPRZ1_ENST00000449182.1_Silent_p.I1304I	NM_001206838.1|NM_002851.2	NP_001193767.1|NP_002842.2	P23471	PTPRZ_HUMAN	protein tyrosine phosphatase, receptor-type, Z polypeptide 1	2171	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|hematopoietic progenitor cell differentiation (GO:0002244)|learning or memory (GO:0007611)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of oligodendrocyte progenitor proliferation (GO:0070445)	integral component of plasma membrane (GO:0005887)|perineuronal net (GO:0072534)|proteinaceous extracellular matrix (GO:0005578)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(12)|large_intestine(17)|liver(1)|lung(42)|ovary(4)|prostate(5)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	106						AGGACTTTATCTTAGAAGCTA	0.318																																						dbGAP											0													71.0	74.0	73.0					7																	121695126		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			M93426	CCDS34740.1, CCDS56505.1	7q31.3	2013-02-11			ENSG00000106278	ENSG00000106278		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9685	protein-coding gene	gene with protein product		176891		PTPZ, PTPRZ		7736789, 8387522	Standard	NM_001206838		Approved	PTP18, RPTPB, phosphacan	uc003vjy.3	P23471	OTTHUMG00000157057	ENST00000393386.2:c.6513C>T	7.37:g.121695126C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0W5|C9JFM0|O76043|Q9UDR6	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a	p.I2171	ENST00000393386.2	37	c.6513	CCDS34740.1	7																																																																																			PTPRZ1	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000106278		0.318	PTPRZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRZ1	HGNC	protein_coding	OTTHUMT00000347288.1	37	0.00	0	C	NM_002851		121695126	121695126	+1	no_errors	ENST00000393386	ensembl	human	known	69_37n	silent	41	22.64	12	SNP	0.999	T
QSOX1	5768	genome.wustl.edu	37	1	180135688	180135688	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr1:180135688T>A	ENST00000367602.3	+	2	402	c.328T>A	c.(328-330)Tgc>Agc	p.C110S	QSOX1_ENST00000367600.5_Missense_Mutation_p.C110S			O00391	QSOX1_HUMAN	quiescin Q6 sulfhydryl oxidase 1	110	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)	flavin-linked sulfhydryl oxidase activity (GO:0016971)|protein disulfide isomerase activity (GO:0003756)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31						CAGTGCAGTCTGCAGAGACTT	0.567																																						dbGAP											0													83.0	77.0	79.0					1																	180135688		2203	4300	6503	-	-	-	SO:0001583	missense	0			U97276	CCDS1337.1, CCDS30950.1	1q24	2008-02-05	2007-04-23	2007-04-23	ENSG00000116260	ENSG00000116260			9756	protein-coding gene	gene with protein product		603120	"""quiescin Q6"""	QSCN6		9878249, 8396966	Standard	NM_002826		Approved		uc001gnz.3	O00391	OTTHUMG00000035256	ENST00000367602.3:c.328T>A	1.37:g.180135688T>A	ENSP00000356574:p.Cys110Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59G29|Q5T2X0|Q8TDL6|Q8WVP4	Missense_Mutation	SNP	pfam_Evr1_Alr,pfam_Thioredoxin_domain,superfamily_Evr1_Alr,superfamily_Thioredoxin-like_fold	p.C110S	ENST00000367602.3	37	c.328	CCDS1337.1	1	.	.	.	.	.	.	.	.	.	.	T	20.9	4.061258	0.76187	.	.	ENSG00000116260	ENST00000367602;ENST00000367600	T;T	0.17528	2.27;2.27	4.83	4.83	0.62350	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.35068	0.0919	L	0.52823	1.66	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.07501	-1.0769	10	0.87932	D	0	-25.2976	11.0763	0.48034	0.0:0.0:0.0:1.0	.	110;110;110	A8K477;O00391;O00391-2	.;QSOX1_HUMAN;.	S	110	ENSP00000356574:C110S;ENSP00000356572:C110S	ENSP00000356572:C110S	C	+	1	0	QSOX1	178402311	1.000000	0.71417	0.969000	0.41365	0.857000	0.48899	4.938000	0.63519	1.939000	0.56221	0.460000	0.39030	TGC	QSOX1	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000116260		0.567	QSOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSOX1	HGNC	protein_coding	OTTHUMT00000085289.1	49	0.00	0	T	NM_002826		180135688	180135688	+1	no_errors	ENST00000367602	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	0.986	A
RHPN2	85415	genome.wustl.edu	37	19	33490500	33490500	+	Missense_Mutation	SNP	C	C	T	rs201438314		TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr19:33490500C>T	ENST00000254260.3	-	10	1252	c.1217G>A	c.(1216-1218)cGa>cAa	p.R406Q	RHPN2_ENST00000400226.4_Missense_Mutation_p.R255Q	NM_033103.4	NP_149094.3	Q8IUC4	RHPN2_HUMAN	rhophilin, Rho GTPase binding protein 2	406	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)		p.R406Q(1)		NS(1)|breast(3)|central_nervous_system(5)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(3)|skin(3)|urinary_tract(1)	44	Esophageal squamous(110;0.137)					ACCCAGCTGTCGGCGCTGCTG	0.637																																						dbGAP											1	Substitution - Missense(1)	skin(1)											46.0	40.0	42.0					19																	33490500		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF268032	CCDS12427.1	19q13.12	2008-02-05				ENSG00000131941			19974	protein-coding gene	gene with protein product						12221077	Standard	NM_033103		Approved		uc002nuf.3	Q8IUC4		ENST00000254260.3:c.1217G>A	19.37:g.33490500C>T	ENSP00000254260:p.Arg406Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG8|B3KUY8|B4DUS7|Q8N3T7|Q8N9D6|Q8NE33|Q96RU1	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,superfamily_HR1_rho-bd,superfamily_PDZ,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom	p.R406Q	ENST00000254260.3	37	c.1217	CCDS12427.1	19	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628137	0.66901	.	.	ENSG00000131941	ENST00000254260;ENST00000544458;ENST00000400226	T;T	0.44482	1.92;0.92	4.72	-6.97	0.01616	BRO1 domain (3);	1.251570	0.05432	N	0.546131	T	0.27098	0.0664	L	0.43923	1.385	0.09310	N	1	B	0.20550	0.046	B	0.14578	0.011	T	0.14309	-1.0477	10	0.30854	T	0.27	0.7441	3.3955	0.07304	0.1977:0.0875:0.0954:0.6194	.	406	Q8IUC4	RHPN2_HUMAN	Q	406;136;255	ENSP00000254260:R406Q;ENSP00000402244:R255Q	ENSP00000254260:R406Q	R	-	2	0	RHPN2	38182340	0.000000	0.05858	0.018000	0.16275	0.900000	0.52787	-0.317000	0.08060	-1.575000	0.01655	0.484000	0.47621	CGA	RHPN2	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000131941		0.637	RHPN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN2	HGNC	protein_coding	OTTHUMT00000450828.2	63	0.00	0	C	NM_033103		33490500	33490500	-1	no_errors	ENST00000254260	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.000	T
RPGR	6103	genome.wustl.edu	37	X	38146589	38146589	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chrX:38146589T>C	ENST00000339363.3	-	14	2445	c.2278A>G	c.(2278-2280)Aaa>Gaa	p.K760E	TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000378505.2_Intron|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000318842.7_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator	760	Glu-rich.				cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						TCAATCAATTTCCTGCCATAC	0.388																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2278A>G	X.37:g.38146589T>C	ENSP00000343671:p.Lys760Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.K760E	ENST00000339363.3	37	c.2278		X	.	.	.	.	.	.	.	.	.	.	t	12.63	1.996999	0.35226	.	.	ENSG00000156313	ENST00000339363	T	0.16597	2.33	4.1	-1.11	0.09840	.	.	.	.	.	T	0.09113	0.0225	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.36138	-0.9760	5	.	.	.	.	2.1715	0.03850	0.1408:0.1001:0.2502:0.5089	.	.	.	.	E	760	ENSP00000343671:K760E	.	K	-	1	0	RPGR	38031533	0.002000	0.14202	0.001000	0.08648	0.001000	0.01503	0.402000	0.20965	-0.047000	0.13423	-0.468000	0.05107	AAA	RPGR	-	superfamily_Reg_csome_cond/b-lactamase_inh	ENSG00000156313		0.388	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		14	0.00	0	T	NM_000328		38146589	38146589	-1	no_errors	ENST00000339363	ensembl	human	known	69_37n	missense	2	77.78	7	SNP	0.000	C
RYR3	6263	genome.wustl.edu	37	15	33872233	33872233	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr15:33872233C>A	ENST00000389232.4	+	13	1395	c.1325C>A	c.(1324-1326)aCc>aAc	p.T442N	RYR3_ENST00000415757.3_Missense_Mutation_p.T442N	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	442					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GTCCTGCAGACCCTACAGGAC	0.512																																						dbGAP											0													59.0	61.0	60.0					15																	33872233		2004	4168	6172	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.1325C>A	15.37:g.33872233C>A	ENSP00000373884:p.Thr442Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.T442N	ENST00000389232.4	37	c.1325	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163493	0.78226	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.89343	-2.5;-2.5	5.15	5.15	0.70609	Intracellular calcium-release channel (1);	0.000000	0.85682	D	0.000000	D	0.92172	0.7518	L	0.57536	1.79	0.58432	D	0.999994	D;D	0.57257	0.972;0.979	P;P	0.57846	0.742;0.828	D	0.91813	0.5461	10	0.48119	T	0.1	.	18.8252	0.92115	0.0:1.0:0.0:0.0	.	442;442	Q15413-2;Q15413	.;RYR3_HUMAN	N	442	ENSP00000373884:T442N;ENSP00000399610:T442N	ENSP00000354735:T442N	T	+	2	0	RYR3	31659525	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.588000	0.60999	2.674000	0.91012	0.655000	0.94253	ACC	RYR3	-	pfam_Ca-rel_channel	ENSG00000198838		0.512	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	45	0.00	0	C			33872233	33872233	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	22	46.34	19	SNP	1.000	A
SECISBP2	79048	genome.wustl.edu	37	9	91934622	91934622	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr9:91934622A>G	ENST00000375807.3	+	2	163	c.92A>G	c.(91-93)aAt>aGt	p.N31S	SECISBP2_ENST00000534113.2_5'UTR|SECISBP2_ENST00000339901.4_5'UTR	NM_001282688.1|NM_001282690.1|NM_024077.3	NP_001269617.1|NP_001269619.1|NP_076982.3	Q96T21	SEBP2_HUMAN	SECIS binding protein 2	31					translation (GO:0006412)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|selenocysteine insertion sequence binding (GO:0035368)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(3)|skin(2)	32						GCCGGGCTCAATGTGGCATGG	0.463																																						dbGAP											0													175.0	173.0	174.0					9																	91934622		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380995	CCDS6683.1, CCDS65076.1, CCDS65077.1	9q22	2008-02-05			ENSG00000187742	ENSG00000187742			30972	protein-coding gene	gene with protein product		607693				11230166	Standard	XM_005252193		Approved		uc004aqj.1	Q96T21	OTTHUMG00000020182	ENST00000375807.3:c.92A>G	9.37:g.91934622A>G	ENSP00000364965:p.Asn31Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W892|Q5HYY1|Q8IYC0|Q9H0A1	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.N31S	ENST00000375807.3	37	c.92	CCDS6683.1	9	.	.	.	.	.	.	.	.	.	.	A	2.473	-0.321506	0.05386	.	.	ENSG00000187742	ENST00000375807;ENST00000395669	T	0.71222	-0.55	4.47	-2.02	0.07388	.	0.753221	0.12798	N	0.438276	T	0.39759	0.1090	N	0.08118	0	0.18873	N	0.999985	B;B;B	0.23540	0.022;0.087;0.022	B;B;B	0.15052	0.01;0.012;0.007	T	0.31779	-0.9931	10	0.07482	T	0.82	-2.3905	7.2807	0.26310	0.6484:0.1523:0.1994:0.0	.	51;31;31	Q59H19;B4DZC7;Q96T21	.;.;SEBP2_HUMAN	S	31;51	ENSP00000364965:N31S	ENSP00000364965:N31S	N	+	2	0	SECISBP2	91124442	0.006000	0.16342	0.000000	0.03702	0.207000	0.24258	0.273000	0.18662	-0.407000	0.07576	0.533000	0.62120	AAT	SECISBP2	-	NULL	ENSG00000187742		0.463	SECISBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SECISBP2	HGNC	protein_coding	OTTHUMT00000052990.3	87	0.00	0	A	NM_024077		91934622	91934622	+1	no_errors	ENST00000375807	ensembl	human	known	69_37n	missense	109	25.34	37	SNP	0.008	G
SLC7A9	11136	genome.wustl.edu	37	19	33355671	33355671	+	Silent	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr19:33355671G>A	ENST00000023064.4	-	3	290	c.99C>T	c.(97-99)atC>atT	p.I33I	SLC7A9_ENST00000587772.1_Silent_p.I33I|RN7SKP22_ENST00000365097.1_RNA|SLC7A9_ENST00000590341.1_Silent_p.I33I	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	33					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)	p.I33I(1)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	AGATGCCACTGATGAGGCCCA	0.637																																					GBM(181;1335 2108 9644 44178 46689)	dbGAP											1	Substitution - coding silent(1)	lung(1)											159.0	149.0	153.0					19																	33355671		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.99C>T	19.37:g.33355671G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9A6	Silent	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1	p.I33	ENST00000023064.4	37	c.99	CCDS12425.1	19																																																																																			SLC7A9	-	pirsf_AA/rel_permease1	ENSG00000021488		0.637	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A9	HGNC	protein_coding	OTTHUMT00000450585.1	60	0.00	0	G			33355671	33355671	-1	no_errors	ENST00000023064	ensembl	human	known	69_37n	silent	27	38.64	17	SNP	0.991	A
SPTA1	6708	genome.wustl.edu	37	1	158627369	158627369	+	Missense_Mutation	SNP	G	G	T	rs144579942		TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr1:158627369G>T	ENST00000368147.4	-	19	2883	c.2703C>A	c.(2701-2703)ttC>ttA	p.F901L		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	901					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.F901F(1)		NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GGTACTGCTGGAACTGGACAT	0.468																																						dbGAP											1	Substitution - coding silent(1)	skin(1)											182.0	179.0	180.0					1																	158627369		2010	4201	6211	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.2703C>A	1.37:g.158627369G>T	ENSP00000357129:p.Phe901Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.F901L	ENST00000368147.4	37	c.2703	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	G	10.12	1.262227	0.23051	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.59772	0.24;0.24	4.67	4.67	0.58626	.	0.258923	0.20546	N	0.090218	T	0.12092	0.0294	N	0.05534	-0.03	0.31224	N	0.697164	B	0.06786	0.001	B	0.12837	0.008	T	0.14980	-1.0453	10	0.02654	T	1	.	7.2158	0.25959	0.1815:0.0:0.8185:0.0	.	901	P02549	SPTA1_HUMAN	L	901	ENSP00000357130:F901L;ENSP00000357129:F901L	ENSP00000357129:F901L	F	-	3	2	SPTA1	156893993	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.186000	0.32078	2.573000	0.86826	0.655000	0.94253	TTC	SPTA1	-	pfam_Spectrin_repeat	ENSG00000163554		0.468	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	80	0.00	0	G	NM_003126		158627369	158627369	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	74	20.43	19	SNP	1.000	T
STX10	8677	genome.wustl.edu	37	19	13255448	13255448	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr19:13255448G>C	ENST00000587230.1	-	7	680	c.616C>G	c.(616-618)Cag>Gag	p.Q206E	STX10_ENST00000242770.5_Silent_p.P204P|STX10_ENST00000589083.1_Missense_Mutation_p.Q206E|STX10_ENST00000343587.5_Missense_Mutation_p.Q157E	NM_001271609.1	NP_001258538.1	O60499	STX10_HUMAN	syntaxin 10	206	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion (GO:0006906)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)			breast(1)|endometrium(1)|kidney(1)|lung(2)|prostate(1)	6			OV - Ovarian serous cystadenocarcinoma(19;3.41e-21)			ATGCGGGACTGGGTGTGGTCC	0.632																																						dbGAP											0													94.0	82.0	86.0					19																	13255448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035531	CCDS32922.1, CCDS62569.1, CCDS62570.1, CCDS62571.1	19p13.13	2008-07-22				ENSG00000104915			11428	protein-coding gene	gene with protein product		603765				9446797	Standard	NM_003765		Approved	hsyn10, SYN10	uc021upq.2	O60499		ENST00000587230.1:c.616C>G	19.37:g.13255448G>C	ENSP00000466298:p.Gln206Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC41|Q6IAP4|Q96AE8	Missense_Mutation	SNP	pfam_Syntaxin-6_N,pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.Q206E	ENST00000587230.1	37	c.616	CCDS32922.1	19	.	.	.	.	.	.	.	.	.	.	G	3.695	-0.062698	0.07273	.	.	ENSG00000104915	ENST00000343587;ENST00000242770;ENST00000440593	.	.	.	4.3	2.64	0.31445	Target SNARE coiled-coil domain (3);	0.291218	0.29767	N	0.011248	T	0.23727	0.0574	L	0.45470	1.425	0.25908	N	0.983278	B;P	0.35011	0.165;0.48	B;B	0.34991	0.051;0.193	T	0.23013	-1.0200	9	0.02654	T	1	.	7.6249	0.28206	0.1899:0.0:0.8101:0.0	.	157;206	O60499-2;O60499	.;STX10_HUMAN	E	157;206;206	.	ENSP00000242770:Q206E	Q	-	1	0	STX10	13116448	0.883000	0.30277	0.997000	0.53966	0.890000	0.51754	2.422000	0.44696	0.558000	0.29135	0.462000	0.41574	CAG	STX10	-	pfam_T_SNARE_dom,smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000104915		0.632	STX10-002	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	STX10	HGNC	protein_coding	OTTHUMT00000452918.1	43	0.00	0	G	NM_003765		13255448	13255448	-1	no_errors	ENST00000587230	ensembl	human	known	69_37n	missense	40	21.15	11	SNP	0.993	C
TRIM49	57093	genome.wustl.edu	37	11	89531780	89531780	+	Missense_Mutation	SNP	G	G	C	rs149578071	byFrequency	TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr11:89531780G>C	ENST00000329758.1	-	8	1205	c.877C>G	c.(877-879)Cat>Gat	p.H293D	TRIM49_ENST00000532501.2_Missense_Mutation_p.H216D	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	293	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GCTTCTTCATGATGCAGAGTA	0.313																																						dbGAP											0													27.0	37.0	34.0					11																	89531780		2150	4292	6442	-	-	-	SO:0001583	missense	0			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.877C>G	11.37:g.89531780G>C	ENSP00000327604:p.His293Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.H293D	ENST00000329758.1	37	c.877	CCDS8287.1	11	314	0.14377289377289376	57	0.11585365853658537	86	0.23756906077348067	96	0.16783216783216784	75	0.09894459102902374	G	1.031	-0.681762	0.03353	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	T	0.60672	0.17	0.539	0.539	0.17156	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.00012	0.0000	L	0.40543	1.245	0.80722	P	0.0	B	0.14438	0.01	B	0.13407	0.009	T	0.13818	-1.0495	6	.	.	.	.	.	.	.	.	293	P0CI25	TRI49_HUMAN	D	293;216	ENSP00000327604:H293D	.	H	-	1	0	TRIM49	89171428	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.486000	0.02312	0.568000	0.29311	0.194000	0.17425	CAT	TRIM49	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000168930		0.313	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1	23	0.00	0	G	NM_020358		89531780	89531780	-1	no_errors	ENST00000329758	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	0.033	C
TRIP6	7205	genome.wustl.edu	37	7	100470878	100470878	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr7:100470878G>A	ENST00000200457.4	+	9	1744	c.1384G>A	c.(1384-1386)Gcc>Acc	p.A462T	SRRT_ENST00000347433.4_5'Flank|SRRT_ENST00000388793.4_5'Flank|SRRT_ENST00000457580.2_5'Flank|SRRT_ENST00000432932.1_5'Flank	NM_003302.2	NP_003293.2	Q15654	TRIP6_HUMAN	thyroid hormone receptor interactor 6	462	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				focal adhesion assembly (GO:0048041)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|kinase binding (GO:0019900)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|liver(1)|lung(5)	14	Lung NSC(181;0.041)|all_lung(186;0.0581)					GGCCTGCAGCGCCTGGCGCAT	0.577																																						dbGAP											0													87.0	78.0	81.0					7																	100470878		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40374, AF000974	CCDS5708.1	7q22	2006-09-05			ENSG00000087077	ENSG00000087077			12311	protein-coding gene	gene with protein product		602933				9598321, 7776974	Standard	NM_003302		Approved	ZRP-1, OIP1, MGC10556, MGC10558, MGC29959, MGC3837, MGC4423	uc003uww.3	Q15654	OTTHUMG00000157029	ENST00000200457.4:c.1384G>A	7.37:g.100470878G>A	ENSP00000200457:p.Ala462Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2E7|F2ZC07|F2ZC08|O15170|O15275|Q9BTB2|Q9BUE5|Q9BXP3|Q9UNT4	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.A462T	ENST00000200457.4	37	c.1384	CCDS5708.1	7	.	.	.	.	.	.	.	.	.	.	G	18.41	3.618777	0.66787	.	.	ENSG00000087077	ENST00000200457	T	0.58210	0.35	4.37	4.37	0.52481	Zinc finger, LIM-type (1);	0.000000	0.85682	D	0.000000	T	0.46852	0.1414	N	0.21448	0.665	0.80722	D	1	P	0.51537	0.946	P	0.51453	0.67	T	0.27872	-1.0061	10	0.18276	T	0.48	.	14.4634	0.67467	0.0:0.0:1.0:0.0	.	462	Q15654	TRIP6_HUMAN	T	462	ENSP00000200457:A462T	ENSP00000200457:A462T	A	+	1	0	TRIP6	100308814	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	3.514000	0.53422	2.268000	0.75426	0.561000	0.74099	GCC	TRIP6	-	pfscan_Znf_LIM	ENSG00000087077		0.577	TRIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP6	HGNC	protein_coding	OTTHUMT00000347151.2	34	0.00	0	G	NM_003302		100470878	100470878	+1	no_errors	ENST00000200457	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	1.000	A
TRPC4	7223	genome.wustl.edu	37	13	38213437	38213437	+	Splice_Site	SNP	C	C	G			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr13:38213437C>G	ENST00000379705.3	-	9	2937		c.e9-1		TRPC4_ENST00000355779.2_Splice_Site|TRPC4_ENST00000358477.2_Splice_Site|TRPC4_ENST00000338947.5_Splice_Site|TRPC4_ENST00000379679.1_Splice_Site|TRPC4_ENST00000426868.2_Splice_Site|TRPC4_ENST00000379673.2_Splice_Site|TRPC4_ENST00000447043.1_Splice_Site|TRPC4_ENST00000379681.3_Splice_Site			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4						axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		CAGCTCGCCTCTGAAAAGGAA	0.303																																						dbGAP											0													118.0	122.0	121.0					13																	38213437		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.2080-1G>C	13.37:g.38213437C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Splice_Site	SNP	-	e8-1	ENST00000379705.3	37	c.2095-1	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	C	24.8	4.576011	0.86645	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1041	0.97884	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TRPC4	37111437	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.982000	0.70532	2.826000	0.97356	0.655000	0.94253	.	TRPC4	-	-	ENSG00000133107		0.303	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	72	0.00	0	C	NM_003306	Intron	38213437	38213437	-1	no_errors	ENST00000379681	ensembl	human	known	69_37n	splice_site	54	56.80	71	SNP	1.000	G
TUBGCP3	10426	genome.wustl.edu	37	13	113140381	113140381	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr13:113140381C>T	ENST00000261965.3	-	22	2836	c.2650G>A	c.(2650-2652)Gag>Aag	p.E884K		NM_006322.4	NP_006313.1	Q96CW5	GCP3_HUMAN	tubulin, gamma complex associated protein 3	884					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|single fertilization (GO:0007338)	centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|polar microtubule (GO:0005827)|spindle (GO:0005819)	gamma-tubulin binding (GO:0043015)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(9)|prostate(3)|urinary_tract(1)	25	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)					TTGTAATGCTCGTTGAAGTCC	0.567																																						dbGAP											0													29.0	25.0	26.0					13																	113140381		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF042378	CCDS9525.1, CCDS66584.1, CCDS73599.1	13q34	2008-07-18			ENSG00000126216	ENSG00000126216			18598	protein-coding gene	gene with protein product	"""spindle pole body protein"""					9566967, 9566969	Standard	XM_005268293		Approved	GCP3, Spc98p, SPBC98	uc001vse.1	Q96CW5	OTTHUMG00000017367	ENST00000261965.3:c.2650G>A	13.37:g.113140381C>T	ENSP00000261965:p.Glu884Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43631|O60852|O60853|Q5T8L2|Q7Z4K1|Q96I79	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.E884K	ENST00000261965.3	37	c.2650	CCDS9525.1	13	.	.	.	.	.	.	.	.	.	.	C	18.23	3.576995	0.65878	.	.	ENSG00000126216	ENST00000261965	T	0.25912	1.77	4.74	4.74	0.60224	.	0.048284	0.85682	D	0.000000	T	0.53318	0.1789	M	0.82716	2.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72982	0.979;0.969	T	0.53620	-0.8413	10	0.23302	T	0.38	-27.6204	18.1014	0.89507	0.0:1.0:0.0:0.0	.	874;884	B4DYP7;Q96CW5	.;GCP3_HUMAN	K	884	ENSP00000261965:E884K	ENSP00000261965:E884K	E	-	1	0	TUBGCP3	112188382	1.000000	0.71417	0.092000	0.20876	0.023000	0.10783	7.085000	0.76875	2.319000	0.78375	0.655000	0.94253	GAG	TUBGCP3	-	NULL	ENSG00000126216		0.567	TUBGCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP3	HGNC	protein_coding	OTTHUMT00000045825.2	43	0.00	0	C	NM_006322		113140381	113140381	-1	no_errors	ENST00000261965	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	T
UNC5B	219699	genome.wustl.edu	37	10	73044530	73044530	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr10:73044530C>A	ENST00000335350.6	+	3	774	c.358C>A	c.(358-360)Ctc>Atc	p.L120I	UNC5B_ENST00000373192.4_Missense_Mutation_p.L120I	NM_170744.4	NP_734465.2	Q8IZJ1	UNC5B_HUMAN	unc-5 homolog B (C. elegans)	120	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|prostate(4)|skin(4)	49						GGTGGAGGAGCTCTTTGGGCT	0.672																																						dbGAP											0													94.0	85.0	88.0					10																	73044530		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB096256	CCDS7309.1, CCDS58083.1	10q22.2	2013-01-11	2001-11-28		ENSG00000107731	ENSG00000107731		"""Immunoglobulin superfamily / I-set domain containing"""	12568	protein-coding gene	gene with protein product		607870	"""unc5 (C.elegans homolog) b"""				Standard	NM_170744		Approved	UNC5H2, p53RDL1	uc001jro.3	Q8IZJ1	OTTHUMG00000018422	ENST00000335350.6:c.358C>A	10.37:g.73044530C>A	ENSP00000334329:p.Leu120Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3R9|Q5T3S0|Q86SN3|Q8N1Y2|Q9H9F3	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Death,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.L120I	ENST00000335350.6	37	c.358	CCDS7309.1	10	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252372	0.80135	.	.	ENSG00000107731	ENST00000335350;ENST00000373192	T;T	0.22539	1.95;1.95	4.82	3.9	0.45041	Immunoglobulin-like fold (1);	0.075197	0.53938	D	0.000042	T	0.33177	0.0854	L	0.38953	1.18	0.58432	D	0.999998	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.996	T	0.02026	-1.1227	10	0.27082	T	0.32	-17.3404	13.2781	0.60198	0.0:0.9215:0.0:0.0785	.	120;120	Q8IZJ1-2;Q8IZJ1	.;UNC5B_HUMAN	I	120	ENSP00000334329:L120I;ENSP00000362288:L120I	ENSP00000334329:L120I	L	+	1	0	UNC5B	72714536	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.048000	0.57390	2.207000	0.71202	0.555000	0.69702	CTC	UNC5B	-	smart_Ig_sub	ENSG00000107731		0.672	UNC5B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5B	HGNC	protein_coding	OTTHUMT00000048541.1	40	0.00	0	C	NM_170744		73044530	73044530	+1	no_errors	ENST00000335350	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	1.000	A
USP1	7398	genome.wustl.edu	37	1	62910497	62910497	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A1RE-01A-11D-A159-09	TCGA-E9-A1RE-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4a9c0873-f496-48a4-853c-2b41b2dbaa9e	56e80c27-e4b1-4c17-a104-61ae05c5ce82	g.chr1:62910497C>T	ENST00000339950.4	+	6	1461	c.646C>T	c.(646-648)Caa>Taa	p.Q216*	USP1_ENST00000371146.1_Nonsense_Mutation_p.Q216*	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	216	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		AGAAACATGCCAACTCCTAAA	0.338																																					Ovarian(122;1846 2315 3982 19504)	dbGAP											0													70.0	77.0	74.0					1																	62910497		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.646C>T	1.37:g.62910497C>T	ENSP00000343526:p.Gln216*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Nonsense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.Q216*	ENST00000339950.4	37	c.646	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	C	38	7.192038	0.98125	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	.	.	.	5.5	5.5	0.81552	.	0.227242	0.45867	D	0.000331	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-5.5554	19.5818	0.95469	0.0:1.0:0.0:0.0	.	.	.	.	X	216	.	ENSP00000343526:Q216X	Q	+	1	0	USP1	62683085	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.969000	0.70422	2.850000	0.98022	0.650000	0.86243	CAA	USP1	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000162607		0.338	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	25	0.00	0	C	NM_001017415		62910497	62910497	+1	no_errors	ENST00000339950	ensembl	human	known	69_37n	nonsense	21	25.00	7	SNP	1.000	T
