#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA13	154664	genome.wustl.edu	37	7	48314170	48314170	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr7:48314170G>C	ENST00000435803.1	+	17	4931	c.4907G>C	c.(4906-4908)aGg>aCg	p.R1636T		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	1636					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						CAACTGATAAGGGATGTGTTC	0.383																																						dbGAP											0													194.0	183.0	187.0					7																	48314170		1878	4099	5977	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.4907G>C	7.37:g.48314170G>C	ENSP00000411096:p.Arg1636Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1636T	ENST00000435803.1	37	c.4907	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	G	11.65	1.702595	0.30232	.	.	ENSG00000179869	ENST00000435803	D	0.92249	-3.0	5.43	1.64	0.23874	.	0.240052	0.29145	N	0.013019	D	0.91369	0.7277	L	0.58101	1.795	0.23572	N	0.997382	D	0.59767	0.986	P	0.53266	0.722	D	0.84093	0.0391	9	.	.	.	.	8.0869	0.30777	0.3178:0.0:0.6822:0.0	.	1636	Q86UQ4	ABCAD_HUMAN	T	1636	ENSP00000411096:R1636T	.	R	+	2	0	ABCA13	48284716	0.926000	0.31397	0.104000	0.21259	0.150000	0.21749	1.084000	0.30828	0.034000	0.15491	0.563000	0.77884	AGG	ABCA13	-	NULL	ENSG00000179869		0.383	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	55	0.00	0	G	NM_152701		48314170	48314170	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	27	57.14	36	SNP	0.341	C
ACACB	32	genome.wustl.edu	37	12	109654462	109654462	+	Silent	SNP	G	G	T			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr12:109654462G>T	ENST00000338432.7	+	23	3509	c.3390G>T	c.(3388-3390)gtG>gtT	p.V1130V	ACACB_ENST00000377848.3_Silent_p.V1130V|ACACB_ENST00000377854.5_Intron			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1130					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AAACAGTGGTGTTGGATCTCC	0.522																																						dbGAP											0													109.0	106.0	107.0					12																	109654462		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.3390G>T	12.37:g.109654462G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Silent	SNP	pfam_AcCoA_COase_cen,pfam_Carboxyl_trans,pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_COA_CT_N,pfscan_COA_CT_C,pfscan_Biotin_lipoyl	p.V1130	ENST00000338432.7	37	c.3390	CCDS31898.1	12																																																																																			ACACB	-	pfam_AcCoA_COase_cen	ENSG00000076555		0.522	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	66	0.00	0	G	NM_001093		109654462	109654462	+1	no_errors	ENST00000338432	ensembl	human	known	69_37n	silent	24	14.29	4	SNP	0.985	T
ACAD11	84129	genome.wustl.edu	37	3	132277850	132277850	+	Missense_Mutation	SNP	G	G	A	rs200376706	byFrequency	TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr3:132277850G>A	ENST00000264990.6	-	20	3279	c.2308C>T	c.(2308-2310)Cgg>Tgg	p.R770W	ACAD11_ENST00000545291.1_Missense_Mutation_p.R295W|ACAD11_ENST00000355458.3_Missense_Mutation_p.R666W	NM_032169.4	NP_115545	Q709F0	ACD11_HUMAN	acyl-CoA dehydrogenase family, member 11	770					fatty acid beta-oxidation using acyl-CoA dehydrogenase (GO:0033539)	mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|peroxisome (GO:0005777)	flavin adenine dinucleotide binding (GO:0050660)|long-chain-acyl-CoA dehydrogenase activity (GO:0004466)|medium-chain-acyl-CoA dehydrogenase activity (GO:0070991)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|very-long-chain-acyl-CoA dehydrogenase activity (GO:0017099)			breast(2)|endometrium(6)|kidney(2)|large_intestine(8)|lung(10)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	36						GCTTGGTCCCGCAGCTCCATT	0.463													G|||	2	0.000399361	0.0	0.0	5008	,	,		18874	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													128.0	114.0	119.0					3																	132277850		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC019607	CCDS3074.1	3q22.1	2010-04-30	2010-04-30		ENSG00000240303	ENSG00000240303			30211	protein-coding gene	gene with protein product		614288	"""acyl-Coenzyme A dehydrogenase family, member 11"""				Standard	NM_032169		Approved	FLJ12592		Q709F0	OTTHUMG00000159780	ENST00000264990.6:c.2308C>T	3.37:g.132277850G>A	ENSP00000264990:p.Arg770Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AF0|Q658N9|Q658Y2|Q6ZND2|Q8WUT6|Q9H9R3	Missense_Mutation	SNP	pfam_Aminoglycoside_PTrfase,pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_DH_N,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C,superfamily_Kinase-like_dom	p.R770W	ENST00000264990.6	37	c.2308	CCDS3074.1	3	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	7.504	0.653178	0.14580	.	.	ENSG00000240303	ENST00000355458;ENST00000264990;ENST00000545291	D;D;D	0.96300	-3.97;-3.97;-3.97	5.28	2.49	0.30216	Acyl-CoA dehydrogenase/oxidase C-terminal (2);	.	.	.	.	D	0.94479	0.8223	M	0.82823	2.61	0.09310	N	0.999999	B	0.14438	0.01	B	0.08055	0.003	D	0.88080	0.2806	9	0.62326	D	0.03	.	1.5586	0.02589	0.1585:0.1589:0.4014:0.2811	.	770	Q709F0	ACD11_HUMAN	W	666;770;295	ENSP00000347636:R666W;ENSP00000264990:R770W;ENSP00000446263:R295W	ENSP00000264990:R770W	R	-	1	2	ACAD11	133760540	0.003000	0.15002	0.038000	0.18304	0.020000	0.10135	1.442000	0.35046	0.212000	0.20703	0.655000	0.94253	CGG	ACAD11	-	superfamily_AcylCo_DH/oxidase_C	ENSG00000240303		0.463	ACAD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAD11	HGNC	protein_coding	OTTHUMT00000357279.2	39	0.00	0	G	NM_032169		132277850	132277850	-1	no_errors	ENST00000264990	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	0.037	A
ANK2	287	genome.wustl.edu	37	4	114203939	114203939	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr4:114203939A>C	ENST00000357077.4	+	18	2043	c.1990A>C	c.(1990-1992)Act>Cct	p.T664P	ANK2_ENST00000506722.1_Missense_Mutation_p.T643P|ANK2_ENST00000394537.3_Missense_Mutation_p.T664P|ANK2_ENST00000264366.6_Missense_Mutation_p.T664P	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	664					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GCAAGGAGTAACTCCACTCCA	0.463																																						dbGAP											0													143.0	111.0	122.0					4																	114203939		2203	4300	6503	-	-	-	SO:0001583	missense	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1990A>C	4.37:g.114203939A>C	ENSP00000349588:p.Thr664Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.T664P	ENST00000357077.4	37	c.1990	CCDS3702.1	4	.	.	.	.	.	.	.	.	.	.	A	16.82	3.229533	0.58777	.	.	ENSG00000145362	ENST00000503271;ENST00000503423;ENST00000506722;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056	T;D;T;T;T;T;T	0.85484	-0.88;-1.99;-0.88;-0.88;-0.88;-0.88;-0.88	5.13	5.13	0.70059	Ankyrin repeat-containing domain (3);	0.000000	0.56097	D	0.000030	D	0.93674	0.7979	M	0.91612	3.225	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.994;1.0;0.984;0.994	D;D;D;P;D	0.79108	0.992;0.919;0.987;0.882;0.986	D	0.95057	0.8192	10	0.87932	D	0	.	15.2245	0.73339	1.0:0.0:0.0:0.0	.	664;664;664;643;643	Q01484;Q01484-2;Q01484-4;Q01484-5;F8WEF9	ANK2_HUMAN;.;.;.;.	P	643;610;643;679;664;664;664;643	ENSP00000423799:T643P;ENSP00000421011:T610P;ENSP00000421067:T643P;ENSP00000424722:T679P;ENSP00000378044:T664P;ENSP00000349588:T664P;ENSP00000264366:T664P	ENSP00000264366:T664P	T	+	1	0	ANK2	114423388	0.991000	0.36638	0.111000	0.21465	0.829000	0.46940	6.262000	0.72514	2.031000	0.59945	0.533000	0.62120	ACT	ANK2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145362		0.463	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	38	0.00	0	A	NM_001148		114203939	114203939	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	missense	28	37.78	17	SNP	0.363	C
ARRDC3	57561	genome.wustl.edu	37	5	90670780	90670780	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr5:90670780T>C	ENST00000265138.3	-	5	1095	c.829A>G	c.(829-831)Atc>Gtc	p.I277V	ARRDC3_ENST00000503192.1_5'Flank	NM_020801.2	NP_065852.1	Q96B67	ARRD3_HUMAN	arrestin domain containing 3	277					fat pad development (GO:0060613)|negative regulation of heat generation (GO:0031651)|negative regulation of locomotion involved in locomotory behavior (GO:0090327)|negative regulation of multicellular organismal metabolic process (GO:0044252)|positive regulation of adrenergic receptor signaling pathway (GO:0071879)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|skin development (GO:0043588)|temperature homeostasis (GO:0001659)	endosome (GO:0005768)|plasma membrane (GO:0005886)	beta-3 adrenergic receptor binding (GO:0031699)			breast(2)|endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)|urinary_tract(1)	18		all_cancers(142;2.22e-05)|all_epithelial(76;1.58e-07)|all_lung(232;0.000521)|Lung NSC(167;0.000548)|Ovarian(174;0.0798)|Colorectal(57;0.207)		OV - Ovarian serous cystadenocarcinoma(54;4.56e-30)|Epithelial(54;7.55e-26)|all cancers(79;3.63e-22)		CAGTCGAGGATAGAGGGAGAA	0.403																																						dbGAP											0													102.0	98.0	99.0					5																	90670780		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037797	CCDS34202.1	5q14.3	2013-10-11			ENSG00000113369	ENSG00000113369			29263	protein-coding gene	gene with protein product	"""alpha-arrestin 3"""	612464				10718198, 19605364	Standard	NM_020801		Approved	KIAA1376	uc003kjz.2	Q96B67	OTTHUMG00000162616	ENST00000265138.3:c.829A>G	5.37:g.90670780T>C	ENSP00000265138:p.Ile277Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T8|Q9P2H1	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.I277V	ENST00000265138.3	37	c.829	CCDS34202.1	5	.	.	.	.	.	.	.	.	.	.	T	29.7	5.024984	0.93518	.	.	ENSG00000113369	ENST00000265138	T	0.07021	3.23	5.69	5.69	0.88448	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.36524	0.0970	M	0.90922	3.16	0.80722	D	1	P	0.47604	0.898	D	0.68192	0.956	T	0.29761	-1.0001	10	0.29301	T	0.29	-37.1379	15.9348	0.79694	0.0:0.0:0.0:1.0	.	277	Q96B67	ARRD3_HUMAN	V	277	ENSP00000265138:I277V	ENSP00000265138:I277V	I	-	1	0	ARRDC3	90706536	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.933000	0.87642	2.153000	0.67306	0.482000	0.46254	ATC	ARRDC3	-	pfam_Arrestin_C-like,superfamily_Ig_E-set	ENSG00000113369		0.403	ARRDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC3	HGNC	protein_coding	OTTHUMT00000369763.2	38	0.00	0	T	NM_020801		90670780	90670780	-1	no_errors	ENST00000265138	ensembl	human	known	69_37n	missense	29	32.56	14	SNP	1.000	C
BTF3L4	91408	genome.wustl.edu	37	1	52530570	52530571	+	Frame_Shift_Ins	INS	-	-	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr1:52530570_52530571insA	ENST00000313334.8	+	3	396_397	c.128_129insA	c.(127-132)ctaaaafs	p.LK43fs	BTF3L4_ENST00000472944.2_5'UTR|BTF3L4_ENST00000484036.1_Frame_Shift_Ins_p.LK43fs|BTF3L4_ENST00000489308.2_Frame_Shift_Ins_p.LK43fs|BTF3L4_ENST00000533836.1_3'UTR	NM_152265.4	NP_689478.1	Q96K17	BT3L4_HUMAN	basic transcription factor 3-like 4	43	NAC-A/B. {ECO:0000255|PROSITE- ProRule:PRU00507}.									endometrium(2)|kidney(1)|large_intestine(2)	5						CAGAGTTCTCTAAAAAAACTGG	0.391																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC021004	CCDS30713.1, CCDS44146.1, CCDS58001.1	1p32.3	2011-05-26			ENSG00000134717	ENSG00000134717			30547	protein-coding gene	gene with protein product						12477932	Standard	NM_001136497		Approved	MGC23908	uc001ctk.3	Q96K17	OTTHUMG00000008960	ENST00000313334.8:c.135dupA	1.37:g.52530577_52530577dupA	ENSP00000360664:p.Leu43fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNJ1|D3DQ32|G3V1C6	Frame_Shift_Ins	INS	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	p.L46fs	ENST00000313334.8	37	c.128_129	CCDS30713.1	1																																																																																			BTF3L4	-	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	ENSG00000134717		0.391	BTF3L4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTF3L4	HGNC	protein_coding	OTTHUMT00000024848.1	75	0.00	0	-	NM_152265		52530570	52530571	+1	no_errors	ENST00000313334	ensembl	human	known	69_37n	frame_shift_ins	35	20.45	9	INS	0.999:0.252	A
C7orf26	79034	genome.wustl.edu	37	7	6634119	6634119	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr7:6634119C>A	ENST00000344417.5	+	3	735	c.468C>A	c.(466-468)taC>taA	p.Y156*	C7orf26_ENST00000359073.5_Nonsense_Mutation_p.Y137*|C7orf26_ENST00000472693.1_3'UTR	NM_024067.2	NP_076972.2	Q96N11	CG026_HUMAN	chromosome 7 open reading frame 26	156										endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|skin(1)	11		Ovarian(82;0.232)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0986)		TAGATGACTACTGCTGTTTGG	0.532																																						dbGAP											0													237.0	210.0	219.0					7																	6634119		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC005121	CCDS5353.1	7p22.1	2011-11-24			ENSG00000146576	ENSG00000146576			21702	protein-coding gene	gene with protein product							Standard	NM_024067		Approved	MGC2718	uc003sqo.1	Q96N11	OTTHUMG00000125517	ENST00000344417.5:c.468C>A	7.37:g.6634119C>A	ENSP00000340220:p.Tyr156*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQ43	Nonsense_Mutation	SNP	NULL	p.Y156*	ENST00000344417.5	37	c.468	CCDS5353.1	7	.	.	.	.	.	.	.	.	.	.	C	38	7.038116	0.98021	.	.	ENSG00000146576	ENST00000344417;ENST00000359073	.	.	.	4.66	4.66	0.58398	.	0.114139	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-30.2909	15.8491	0.78912	0.0:1.0:0.0:0.0	.	.	.	.	X	156;137	.	ENSP00000340220:Y156X	Y	+	3	2	C7orf26	6600644	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.999000	0.57031	2.513000	0.84729	0.655000	0.94253	TAC	C7orf26	-	NULL	ENSG00000146576		0.532	C7orf26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf26	HGNC	protein_coding	OTTHUMT00000246844.2	69	0.00	0	C	NM_024067		6634119	6634119	+1	no_errors	ENST00000344417	ensembl	human	known	69_37n	nonsense	51	29.17	21	SNP	1.000	A
CARM1	10498	genome.wustl.edu	37	19	11027383	11027383	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr19:11027383C>T	ENST00000327064.4	+	8	1140	c.950C>T	c.(949-951)tCt>tTt	p.S317F	CARM1_ENST00000344150.4_Missense_Mutation_p.S317F	NM_199141.1	NP_954592.1	Q86X55	CARM1_HUMAN	coactivator-associated arginine methyltransferase 1	317	SAM-dependent MTase PRMT-type. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cellular lipid metabolic process (GO:0044255)|endochondral bone morphogenesis (GO:0060350)|histone H3-R17 methylation (GO:0034971)|histone H3-R2 methylation (GO:0034970)|histone methylation (GO:0016571)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of protein binding (GO:0032091)|pathogenesis (GO:0009405)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	beta-catenin binding (GO:0008013)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-R17 specific) (GO:0035642)|histone-arginine N-methyltransferase activity (GO:0008469)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|lysine-acetylated histone binding (GO:0070577)|protein methyltransferase activity (GO:0008276)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	13						TACCAGCCATCTTTCCATGGA	0.637																																						dbGAP											0													42.0	32.0	35.0					19																	11027383		2197	4293	6490	-	-	-	SO:0001583	missense	0			AF055027	CCDS12250.1	19p13.2	2010-10-11			ENSG00000142453	ENSG00000142453		"""Protein arginine methyltransferases"""	23393	protein-coding gene	gene with protein product		603934				10381882, 11724789	Standard	NM_199141		Approved	PRMT4	uc002mpz.3	Q86X55		ENST00000327064.4:c.950C>T	19.37:g.11027383C>T	ENSP00000325690:p.Ser317Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN38	Missense_Mutation	SNP	pfam_Histone-Arg_MeTrfase_N,pfam_Arg_MeTrfase,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_mo5U34_MeTrfase,pfam_Methyltransf_11	p.S317F	ENST00000327064.4	37	c.950	CCDS12250.1	19	.	.	.	.	.	.	.	.	.	.	C	18.09	3.547208	0.65311	.	.	ENSG00000142453	ENST00000327064;ENST00000344150	T;T	0.24151	1.87;1.87	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.60689	0.2288	M	0.90977	3.165	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.72075	0.959;0.976	T	0.70490	-0.4857	10	0.72032	D	0.01	-5.5641	17.6726	0.88222	0.0:1.0:0.0:0.0	.	317;317	Q86X55-1;Q86X55	.;CARM1_HUMAN	F	317	ENSP00000325690:S317F;ENSP00000340934:S317F	ENSP00000325690:S317F	S	+	2	0	CARM1	10888383	1.000000	0.71417	0.980000	0.43619	0.112000	0.19704	5.495000	0.66912	2.472000	0.83506	0.561000	0.74099	TCT	CARM1	-	pfam_Arg_MeTrfase	ENSG00000142453		0.637	CARM1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CARM1	HGNC	protein_coding	OTTHUMT00000452625.1	30	0.00	0	C	XM_032719		11027383	11027383	+1	no_errors	ENST00000327064	ensembl	human	known	69_37n	missense	31	29.55	13	SNP	1.000	T
CCDC73	493860	genome.wustl.edu	37	11	32675581	32675581	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr11:32675581T>G	ENST00000335185.5	-	11	820	c.777A>C	c.(775-777)gaA>gaC	p.E259D	CCDC73_ENST00000534415.1_5'UTR	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	259										NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					TTAATTCCAATTCCTTTAAAA	0.264																																						dbGAP											0													47.0	45.0	46.0					11																	32675581		1772	4036	5808	-	-	-	SO:0001583	missense	0			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.777A>C	11.37:g.32675581T>G	ENSP00000335325:p.Glu259Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	NULL	p.E259D	ENST00000335185.5	37	c.777	CCDS41630.1	11	.	.	.	.	.	.	.	.	.	.	T	17.97	3.519395	0.64634	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.85	2.27	0.28462	.	0.330507	0.28834	N	0.013992	T	0.68348	0.2991	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.85130	0.99;0.997	T	0.64136	-0.6478	9	0.49607	T	0.09	.	8.1316	0.31031	0.0:0.3711:0.0:0.6289	.	259;259	Q6ZRK6-2;Q6ZRK6	.;CCD73_HUMAN	D	259	.	ENSP00000335325:E259D	E	-	3	2	CCDC73	32632157	0.999000	0.42202	0.998000	0.56505	0.826000	0.46750	0.928000	0.28831	0.139000	0.18822	0.528000	0.53228	GAA	CCDC73	-	NULL	ENSG00000186714		0.264	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC73	HGNC	protein_coding	OTTHUMT00000388874.2	68	0.00	0	T	NM_001008391		32675581	32675581	-1	no_errors	ENST00000335185	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	0.987	G
CKMT2	1160	genome.wustl.edu	37	5	80553653	80553653	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr5:80553653G>A	ENST00000424301.2	+	8	1095	c.857G>A	c.(856-858)cGa>cAa	p.R286Q	CKMT2-AS1_ENST00000501927.2_RNA|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000500148.2_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2_ENST00000254035.4_Missense_Mutation_p.R286Q|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2_ENST00000437669.1_Missense_Mutation_p.R286Q	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	286	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	GTATTTGAGCGATTCTGTCGT	0.328																																						dbGAP											0													110.0	106.0	107.0					5																	80553653		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.857G>A	5.37:g.80553653G>A	ENSP00000404203:p.Arg286Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.R286Q	ENST00000424301.2	37	c.857	CCDS4053.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.852216	0.97023	.	.	ENSG00000131730	ENST00000254035;ENST00000437669;ENST00000424301	T;T;T	0.13420	2.59;2.59;2.59	5.82	5.82	0.92795	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.55800	0.1943	H	0.96633	3.855	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.70824	-0.4767	10	0.87932	D	0	0.2746	20.0905	0.97816	0.0:0.0:1.0:0.0	.	286	P17540	KCRS_HUMAN	Q	286	ENSP00000254035:R286Q;ENSP00000410289:R286Q;ENSP00000404203:R286Q	ENSP00000254035:R286Q	R	+	2	0	CKMT2	80589409	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.341000	0.97041	2.762000	0.94881	0.650000	0.86243	CGA	CKMT2	-	pfam_ATP-guanido_PTrfase_cat	ENSG00000131730		0.328	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CKMT2	HGNC	protein_coding	OTTHUMT00000369600.1	48	0.00	0	G	NM_001825		80553653	80553653	+1	no_errors	ENST00000254035	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	1.000	A
DHX30	22907	genome.wustl.edu	37	3	47882665	47882665	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr3:47882665C>G	ENST00000445061.1	+	7	1072	c.665C>G	c.(664-666)tCa>tGa	p.S222*	DHX30_ENST00000348968.4_Nonsense_Mutation_p.S194*|DHX30_ENST00000457607.1_Nonsense_Mutation_p.S250*|DHX30_ENST00000446256.2_Nonsense_Mutation_p.S183*	NM_138615.2	NP_619520.1	Q7L2E3	DHX30_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 30	222						cytoplasm (GO:0005737)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(11)|lung(13)|ovary(4)|pancreas(1)|prostate(1)|skin(3)	37				BRCA - Breast invasive adenocarcinoma(193;0.000696)|KIRC - Kidney renal clear cell carcinoma(197;0.00609)|Kidney(197;0.007)		CTCAGGGACTCAAGGTACAGA	0.562																																						dbGAP											0													38.0	39.0	39.0					3																	47882665		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB020697	CCDS2759.1	3p24.3-p22.1	2013-07-16	2013-07-16	2003-06-13	ENSG00000132153	ENSG00000132153		"""DEAH-boxes"""	16716	protein-coding gene	gene with protein product			"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 30"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 30"""	DDX30		10048485, 18022663	Standard	NM_138615		Approved	KIAA0890, FLJ11214	uc003cru.3	Q7L2E3	OTTHUMG00000133522	ENST00000445061.1:c.665C>G	3.37:g.47882665C>G	ENSP00000405620:p.Ser222*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5F1|O94965|Q7Z753|Q96CH4|Q9NUQ0	Nonsense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_DUF1605,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S222*	ENST00000445061.1	37	c.665	CCDS2759.1	3	.	.	.	.	.	.	.	.	.	.	C	39	7.765353	0.98477	.	.	ENSG00000132153	ENST00000446256;ENST00000445061;ENST00000348968;ENST00000457607	.	.	.	5.02	3.11	0.35812	.	0.696895	0.13366	N	0.393273	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	5.5126	0.16888	0.1958:0.7029:0.0:0.1013	.	.	.	.	X	183;222;194;250	.	ENSP00000343442:S194X	S	+	2	0	DHX30	47857669	0.849000	0.29639	0.997000	0.53966	0.974000	0.67602	1.421000	0.34815	1.087000	0.41251	0.655000	0.94253	TCA	DHX30	-	NULL	ENSG00000132153		0.562	DHX30-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DHX30	HGNC	protein_coding	OTTHUMT00000257495.2	39	0.00	0	C	NM_138615		47882665	47882665	+1	no_errors	ENST00000445061	ensembl	human	known	69_37n	nonsense	23	20.69	6	SNP	0.972	G
FSTL5	56884	genome.wustl.edu	37	4	162680584	162680584	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr4:162680584C>T	ENST00000306100.5	-	6	1142	c.706G>A	c.(706-708)Gaa>Aaa	p.E236K	FSTL5_ENST00000427802.2_Missense_Mutation_p.E235K|FSTL5_ENST00000536695.1_Missense_Mutation_p.E235K|FSTL5_ENST00000379164.4_Missense_Mutation_p.E235K	NM_001128427.2|NM_020116.4	NP_001121899.1|NP_064501.2	Q8N475	FSTL5_HUMAN	follistatin-like 5	236	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(18)|lung(43)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	91	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.179)		TAAAATTCTTCAAGAGCCAGG	0.358																																						dbGAP											0													93.0	100.0	98.0					4																	162680584		2203	4297	6500	-	-	-	SO:0001583	missense	0			BC036502	CCDS3802.1, CCDS47157.1, CCDS47158.1	4q32.3	2013-01-11			ENSG00000168843	ENSG00000168843		"""EF-hand domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	21386	protein-coding gene	gene with protein product						10574462, 15527507	Standard	NM_020116		Approved	DKFZp566D234, KIAA1263	uc003iqh.4	Q8N475	OTTHUMG00000161397	ENST00000306100.5:c.706G>A	4.37:g.162680584C>T	ENSP00000305334:p.Glu236Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCP6|Q9NSW7|Q9ULF7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Kazal-type_dom,pfam_Ig_V-set,pfam_Prot_inh_Kazal,smart_Prot_inh_Kazal,smart_Ig_sub,smart_Ig_sub2,pfscan_EF_HAND_2,pfscan_Ig-like	p.E236K	ENST00000306100.5	37	c.706	CCDS3802.1	4	.	.	.	.	.	.	.	.	.	.	C	14.64	2.594563	0.46214	.	.	ENSG00000168843	ENST00000306100;ENST00000379164;ENST00000427802;ENST00000536695	T;T;T;T	0.23950	1.88;1.88;1.88;1.88	5.37	5.37	0.77165	EF-hand-like domain (1);	0.099783	0.64402	D	0.000002	T	0.30198	0.0757	M	0.67625	2.065	0.58432	D	0.999996	P;P;P	0.46395	0.877;0.828;0.682	B;B;B	0.40741	0.339;0.221;0.156	T	0.09185	-1.0686	10	0.18276	T	0.48	.	18.078	0.89433	0.0:1.0:0.0:0.0	.	235;235;236	E9PCP6;F8VZ90;Q8N475	.;.;FSTL5_HUMAN	K	236;235;235;235	ENSP00000305334:E236K;ENSP00000368462:E235K;ENSP00000389270:E235K;ENSP00000440409:E235K	ENSP00000305334:E236K	E	-	1	0	FSTL5	162900034	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	5.677000	0.68142	2.510000	0.84645	0.579000	0.79373	GAA	FSTL5	-	NULL	ENSG00000168843		0.358	FSTL5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FSTL5	HGNC	protein_coding	OTTHUMT00000364773.2	52	0.00	0	C	NM_020116		162680584	162680584	-1	no_errors	ENST00000306100	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	T
GANAB	23193	genome.wustl.edu	37	11	62394094	62394094	+	Silent	SNP	T	T	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr11:62394094T>G	ENST00000356638.3	-	21	2476	c.2460A>C	c.(2458-2460)tcA>tcC	p.S820S	GANAB_ENST00000534779.1_Silent_p.S728S|GANAB_ENST00000346178.4_Silent_p.S842S|GANAB_ENST00000540933.1_Silent_p.S723S	NM_198334.1	NP_938148.1	Q14697	GANAB_HUMAN	glucosidase, alpha; neutral AB	820					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|glucosidase II complex (GO:0017177)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|glucan 1,3-alpha-glucosidase activity (GO:0033919)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|ovary(3)|skin(2)|urinary_tract(3)	35					Miglitol(DB00491)	TCATACATTCTGAAGACCGCC	0.547																																					Melanoma(23;1005 1074 15747 18937)	dbGAP											0													64.0	53.0	57.0					11																	62394094		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF144074	CCDS8026.1, CCDS41656.1, CCDS60817.1, CCDS60818.1	11q12.3	2012-10-02			ENSG00000089597	ENSG00000089597	3.2.1.20		4138	protein-coding gene	gene with protein product		104160				10764838, 6342981	Standard	NM_198335		Approved	GluII, G2AN, KIAA0088	uc001nua.4	Q14697	OTTHUMG00000167696	ENST00000356638.3:c.2460A>C	11.37:g.62394094T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC20|Q8WTS9|Q9P0X0	Silent	SNP	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd	p.S842	ENST00000356638.3	37	c.2526	CCDS8026.1	11																																																																																			GANAB	-	NULL	ENSG00000089597		0.547	GANAB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GANAB	HGNC	protein_coding	OTTHUMT00000395689.1	28	0.00	0	T	NM_198334		62394094	62394094	-1	no_errors	ENST00000346178	ensembl	human	known	69_37n	silent	10	69.70	23	SNP	0.969	G
GPAT2	150763	genome.wustl.edu	37	2	96688929	96688929	+	Missense_Mutation	SNP	G	G	A	rs201647131	byFrequency	TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr2:96688929G>A	ENST00000434632.1	-	20	2533	c.2074C>T	c.(2074-2076)Cgc>Tgc	p.R692C	FAHD2CP_ENST00000607780.1_RNA|GPAT2_ENST00000453542.1_Missense_Mutation_p.R621C|GPAT2_ENST00000377137.3_Intron|GPAT2_ENST00000359548.4_Missense_Mutation_p.R692C			Q6NUI2	GPAT2_HUMAN	glycerol-3-phosphate acyltransferase 2, mitochondrial	692					CDP-diacylglycerol biosynthetic process (GO:0016024)|glycerol-3-phosphate metabolic process (GO:0006072)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	glycerol-3-phosphate O-acyltransferase activity (GO:0004366)	p.R692C(3)		NS(1)|breast(1)|cervix(1)|endometrium(4)|large_intestine(1)|lung(5)|skin(3)	16						CTGAGCAGGCGGCAGAGGAAA	0.652																																						dbGAP											3	Substitution - Missense(3)	large_intestine(1)|NS(1)|skin(1)											14.0	17.0	16.0					2																	96688929		1816	4045	5861	-	-	-	SO:0001583	missense	0			BC042847	CCDS42714.1	2q11.2	2010-05-04			ENSG00000186281	ENSG00000186281			27168	protein-coding gene	gene with protein product	"""cancer/testis antigen 123"""					12477932	Standard	NM_207328		Approved	CT123	uc010yuf.1	Q6NUI2	OTTHUMG00000155208	ENST00000434632.1:c.2074C>T	2.37:g.96688929G>A	ENSP00000389395:p.Arg692Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2E4|Q6ZNI3|Q6ZNI5|Q6ZWJ4	Missense_Mutation	SNP	smart_Acyltransferase	p.R692C	ENST00000434632.1	37	c.2074	CCDS42714.1	2	152	0.0695970695970696	8	0.016260162601626018	16	0.04419889502762431	27	0.0472027972027972	101	0.13324538258575197	g	16.45	3.127649	0.56721	.	.	ENSG00000186281	ENST00000359548;ENST00000434632;ENST00000453542	T;T;T	0.80480	-1.38;-1.38;-0.41	5.44	5.44	0.79542	.	0.381151	0.27411	N	0.019488	T	0.02727	0.0082	L	0.50333	1.59	0.80722	D	1	P;D;P;B	0.54207	0.584;0.965;0.953;0.354	B;B;B;B	0.42062	0.093;0.374;0.267;0.065	T	0.41840	-0.9486	10	0.66056	D	0.02	-11.9956	16.7485	0.85479	0.0:0.0:1.0:0.0	.	621;698;692;621	E9PE95;Q6NUI2-4;Q6NUI2;B4DNZ9	.;.;GPAT2_HUMAN;.	C	692;692;621	ENSP00000352547:R692C;ENSP00000389395:R692C;ENSP00000393770:R621C	ENSP00000352547:R692C	R	-	1	0	GPAT2	96052656	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	3.041000	0.49807	2.569000	0.86673	0.637000	0.83480	CGC	GPAT2	-	NULL	ENSG00000186281		0.652	GPAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPAT2	HGNC	protein_coding	OTTHUMT00000338786.1	24	0.00	0	G	NM_207328		96688929	96688929	-1	no_errors	ENST00000359548	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	1.000	A
H2AFY2	55506	genome.wustl.edu	37	10	71835425	71835425	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr10:71835425G>A	ENST00000373255.4	+	2	275	c.11G>A	c.(10-12)cGg>cAg	p.R4Q		NM_018649.2	NP_061119.1	Q9P0M6	H2AW_HUMAN	H2A histone family, member Y2	4	Histone H2A.				brain development (GO:0007420)|chromatin modification (GO:0016568)|dosage compensation (GO:0007549)|establishment of protein localization to chromatin (GO:0071169)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901837)|nucleosome assembly (GO:0006334)	Barr body (GO:0001740)|extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|nucleosome (GO:0000786)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|transcription regulatory region DNA binding (GO:0044212)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(4)|skin(1)	15						ATGTCGGGCCGGAGTGGGAAG	0.517																																						dbGAP											0													194.0	163.0	173.0					10																	71835425		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF336304	CCDS7296.1	10q22.1	2011-01-27			ENSG00000099284	ENSG00000099284		"""Histones / Replication-independent"""	14453	protein-coding gene	gene with protein product						11331621, 11262398	Standard	NM_018649		Approved	macroH2A2	uc001jqm.3	Q9P0M6	OTTHUMG00000018396	ENST00000373255.4:c.11G>A	10.37:g.71835425G>A	ENSP00000362352:p.Arg4Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SQT2	Missense_Mutation	SNP	pfam_A1pp,pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,smart_A1pp,pirsf_Core_histone_macro-H2A,pfscan_A1pp,prints_Histone_H2A	p.R4Q	ENST00000373255.4	37	c.11	CCDS7296.1	10	.	.	.	.	.	.	.	.	.	.	G	31	5.079369	0.94050	.	.	ENSG00000099284	ENST00000373255;ENST00000395046;ENST00000455786	T;D	0.84146	1.81;-1.81	6.06	6.06	0.98353	Histone H2A (1);	0.000000	0.85682	D	0.000000	D	0.94089	0.8105	M	0.90369	3.11	0.53688	D	0.999975	D	0.69078	0.997	D	0.70227	0.968	D	0.94266	0.7506	10	0.87932	D	0	.	20.2312	0.98350	0.0:0.0:1.0:0.0	.	4	Q9P0M6	H2AW_HUMAN	Q	4	ENSP00000362352:R4Q;ENSP00000404584:R4Q	ENSP00000362352:R4Q	R	+	2	0	H2AFY2	71505431	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.751000	0.98889	2.882000	0.98803	0.655000	0.94253	CGG	H2AFY2	-	smart_Histone_H2A,pirsf_Core_histone_macro-H2A	ENSG00000099284		0.517	H2AFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	H2AFY2	HGNC	protein_coding	OTTHUMT00000048480.2	63	0.00	0	G	NM_018649		71835425	71835425	+1	no_errors	ENST00000373255	ensembl	human	known	69_37n	missense	30	26.19	11	SNP	1.000	A
KIAA1551	55196	genome.wustl.edu	37	12	32137328	32137328	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr12:32137328T>C	ENST00000312561.4	+	4	3853	c.3439T>C	c.(3439-3441)Tgt>Cgt	p.C1147R	KIAA1551_ENST00000535596.1_Intron	NM_018169.3	NP_060639	Q9HCM1	K1551_HUMAN	KIAA1551	1147																	AGTTAGCCAGTGTGACCTGCA	0.463																																						dbGAP											0													118.0	120.0	119.0					12																	32137328		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001514	CCDS8725.2	12p11.21	2012-08-14	2012-08-14	2012-08-14	ENSG00000174718	ENSG00000174718			25559	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 35"""	C12orf35		10997877	Standard	NM_018169		Approved	FLJ20696, FLJ10652	uc001rks.3	Q9HCM1	OTTHUMG00000128501	ENST00000312561.4:c.3439T>C	12.37:g.32137328T>C	ENSP00000310338:p.Cys1147Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU5|Q4KN17|Q9NVL6|Q9NWP9	Missense_Mutation	SNP	NULL	p.C1147R	ENST00000312561.4	37	c.3439	CCDS8725.2	12	.	.	.	.	.	.	.	.	.	.	T	14.14	2.447379	0.43429	.	.	ENSG00000174718	ENST00000312561	T	0.13089	2.62	5.28	-4.55	0.03441	.	0.893808	0.09707	N	0.766240	T	0.15478	0.0373	M	0.64997	1.995	0.09310	N	1	P	0.43701	0.815	P	0.48840	0.592	T	0.13415	-1.0510	9	.	.	.	.	1.5543	0.02581	0.3895:0.0807:0.2662:0.2636	.	1147	Q9HCM1	CL035_HUMAN	R	1147	ENSP00000310338:C1147R	.	C	+	1	0	C12orf35	32028595	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.687000	0.05156	-0.625000	0.05604	-0.530000	0.04314	TGT	KIAA1551	-	NULL	ENSG00000174718		0.463	KIAA1551-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1551	HGNC	protein_coding	OTTHUMT00000250307.2	64	0.00	0	T	NM_018169		32137328	32137328	+1	no_errors	ENST00000312561	ensembl	human	known	69_37n	missense	34	45.16	28	SNP	0.000	C
LAMB2	3913	genome.wustl.edu	37	3	49163267	49163267	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr3:49163267G>A	ENST00000418109.1	-	19	2565	c.2401C>T	c.(2401-2403)Cag>Tag	p.Q801*	LAMB2_ENST00000305544.4_Nonsense_Mutation_p.Q801*|LAMB2_ENST00000464891.1_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	801	Laminin EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CACAGGCACTGACCACCATGA	0.607																																						dbGAP											0													124.0	114.0	117.0					3																	49163267		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.2401C>T	3.37:g.49163267G>A	ENSP00000388325:p.Gln801*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16321	Nonsense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.Q801*	ENST00000418109.1	37	c.2401	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	G	41	8.807319	0.98962	.	.	ENSG00000172037	ENST00000418109;ENST00000305544	.	.	.	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	19.4635	0.94929	0.0:0.0:1.0:0.0	.	.	.	.	X	801	.	ENSP00000307156:Q801X	Q	-	1	0	LAMB2	49138271	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.429000	0.97481	2.599000	0.87857	0.563000	0.77884	CAG	LAMB2	-	pfam_EGF_laminin,smart_EGF-like,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000172037		0.607	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	41	0.00	0	G	NM_002292		49163267	49163267	-1	no_errors	ENST00000305544	ensembl	human	known	69_37n	nonsense	19	34.48	10	SNP	1.000	A
LAMB4	22798	genome.wustl.edu	37	7	107684275	107684275	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr7:107684275C>G	ENST00000388781.3	-	29	4476	c.4393G>C	c.(4393-4395)Gga>Cga	p.G1465R	LAMB4_ENST00000205386.4_Missense_Mutation_p.G1465R|LAMB4_ENST00000388780.3_Missense_Mutation_p.G1465R	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	1465	Domain I.				cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						CTTATATTTCCCAGTTTTTCC	0.313																																						dbGAP											0													123.0	112.0	116.0					7																	107684275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.4393G>C	7.37:g.107684275C>G	ENSP00000373433:p.Gly1465Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.G1465R	ENST00000388781.3	37	c.4393	CCDS34732.1	7	.	.	.	.	.	.	.	.	.	.	C	0.410	-0.913941	0.02415	.	.	ENSG00000091128	ENST00000205386;ENST00000388781;ENST00000422975;ENST00000388780	T;T;T;T	0.29655	1.56;1.56;1.97;1.58	4.93	-1.94	0.07571	.	1.848600	0.03139	N	0.166346	T	0.11665	0.0284	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.09037	-1.0693	10	0.20519	T	0.43	.	1.0771	0.01634	0.1559:0.2576:0.1543:0.4322	.	1465;1465	A4D0S4-3;A4D0S4	.;LAMB4_HUMAN	R	1465;1465;491;1465	ENSP00000205386:G1465R;ENSP00000373433:G1465R;ENSP00000416562:G491R;ENSP00000373432:G1465R	ENSP00000205386:G1465R	G	-	1	0	LAMB4	107471511	0.001000	0.12720	0.000000	0.03702	0.032000	0.12392	0.289000	0.18957	-0.642000	0.05480	0.563000	0.77884	GGA	LAMB4	-	NULL	ENSG00000091128		0.313	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	104	0.94	1	C	XM_209857		107684275	107684275	-1	no_errors	ENST00000205386	ensembl	human	known	69_37n	missense	69	20.69	18	SNP	0.000	G
MAB21L3	126868	genome.wustl.edu	37	1	116663694	116663694	+	Splice_Site	SNP	G	G	T			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr1:116663694G>T	ENST00000369500.3	+	3	454		c.e3+1			NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)											breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						AAATATTAAGGTAAGCAAGTC	0.448																																						dbGAP											0													175.0	165.0	168.0					1																	116663694		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.189+1G>T	1.37:g.116663694G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDL7	Splice_Site	SNP	-	e2+1	ENST00000369500.3	37	c.189+1	CCDS886.1	1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.706865	0.30232	.	.	ENSG00000173212	ENST00000369500	.	.	.	4.99	4.99	0.66335	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.636	0.85060	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAB21L3	116465217	1.000000	0.71417	0.997000	0.53966	0.133000	0.20885	7.252000	0.78309	2.593000	0.87608	0.561000	0.74099	.	MAB21L3	-	-	ENSG00000173212		0.448	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L3	HGNC	protein_coding	OTTHUMT00000033486.1	47	0.00	0	G	NM_152367	Intron	116663694	116663694	+1	no_errors	ENST00000369500	ensembl	human	known	69_37n	splice_site	22	15.38	4	SNP	1.000	T
MAT2A	4144	genome.wustl.edu	37	2	85769862	85769862	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr2:85769862C>G	ENST00000306434.3	+	7	1066	c.943C>G	c.(943-945)Ctt>Gtt	p.L315V	MAT2A_ENST00000409017.1_Missense_Mutation_p.L252V	NM_005911.5	NP_005902.1	P31153	METK2_HUMAN	methionine adenosyltransferase II, alpha	315					cellular nitrogen compound metabolic process (GO:0034641)|methylation (GO:0032259)|one-carbon metabolic process (GO:0006730)|S-adenosylmethionine biosynthetic process (GO:0006556)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|methionine adenosyltransferase complex (GO:0048269)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methionine adenosyltransferase activity (GO:0004478)			breast(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	9					L-Methionine(DB00134)|S-Adenosylmethionine(DB00118)	CCGGAGGGTTCTTGTTCAGGT	0.413																																						dbGAP											0													88.0	88.0	88.0					2																	85769862		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1977.1	2p11.2	2008-06-03			ENSG00000168906	ENSG00000168906			6904	protein-coding gene	gene with protein product		601468				1426236, 9703951	Standard	NM_005911		Approved	SAMS2, MATA2, MATII	uc002spr.3	P31153	OTTHUMG00000130174	ENST00000306434.3:c.943C>G	2.37:g.85769862C>G	ENSP00000303147:p.Leu315Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K511|B4DN45|D6W5L1|Q53SP5	Missense_Mutation	SNP	pfam_S-AdoMet_synt_C,pfam_S-AdoMet_synt_central,pfam_S-AdoMet_synt_N,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	p.L315V	ENST00000306434.3	37	c.943	CCDS1977.1	2	.	.	.	.	.	.	.	.	.	.	C	18.07	3.541117	0.65085	.	.	ENSG00000168906	ENST00000306434;ENST00000424323;ENST00000409017	D;D	0.97791	-4.54;-4.54	5.9	5.9	0.94986	S-adenosylmethionine synthetase, C-terminal (1);S-adenosylmethionine synthetase superfamily (1);	0.000000	0.85682	D	0.000000	D	0.99029	0.9668	M	0.93283	3.4	0.80722	D	1	D;D	0.63880	0.993;0.993	D;D	0.74674	0.963;0.984	D	0.99194	1.0871	10	0.40728	T	0.16	-9.9777	17.7661	0.88478	0.0:1.0:0.0:0.0	.	315;315	B4DEX8;P31153	.;METK2_HUMAN	V	315;96;252	ENSP00000303147:L315V;ENSP00000386353:L252V	ENSP00000303147:L315V	L	+	1	0	MAT2A	85623373	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.702000	0.54800	2.793000	0.96121	0.563000	0.77884	CTT	MAT2A	-	pfam_S-AdoMet_synt_C,superfamily_S-AdoMet_synthetase_sfam,pirsf_S-AdoMet_synthetase,tigrfam_S-AdoMet_synthetase	ENSG00000168906		0.413	MAT2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAT2A	HGNC	protein_coding	OTTHUMT00000252491.2	70	0.00	0	C	NM_005911		85769862	85769862	+1	no_errors	ENST00000306434	ensembl	human	known	69_37n	missense	38	63.46	66	SNP	1.000	G
MFSD8	256471	genome.wustl.edu	37	4	128886286	128886286	+	Start_Codon_SNP	SNP	C	C	T			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr4:128886286C>T	ENST00000296468.3	-	2	130	c.3G>A	c.(1-3)atG>atA	p.M1I	C4orf29_ENST00000388795.5_5'Flank|MFSD8_ENST00000513559.1_Intron|C4orf29_ENST00000444616.1_5'Flank|MFSD8_ENST00000541133.1_Intron|MFSD8_ENST00000515130.1_5'UTR|C4orf29_ENST00000398965.1_5'Flank	NM_152778.2	NP_689991.1	Q8NHS3	MFSD8_HUMAN	major facilitator superfamily domain containing 8	1					cell death (GO:0008219)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)				cervix(2)|endometrium(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)	23						GCAGGCCGGCCATAGTTACAC	0.607																																						dbGAP											0													68.0	62.0	64.0					4																	128886286		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AK074564	CCDS3736.1	4q28.2	2014-09-17			ENSG00000164073	ENSG00000164073			28486	protein-coding gene	gene with protein product		611124	"""ceroid-lipofuscinosis, neuronal 7, late infantile, variant"""	CLN7		17564970	Standard	NM_152778		Approved	MGC33302	uc003ifp.3	Q8NHS3	OTTHUMG00000133303	ENST00000296468.3:c.3G>A	4.37:g.128886286C>T	ENSP00000296468:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDM1|B7Z205|Q8N2P3	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.M1I	ENST00000296468.3	37	c.3	CCDS3736.1	4	.	.	.	.	.	.	.	.	.	.	C	15.85	2.954067	0.53293	.	.	ENSG00000164073	ENST00000296468	D	0.83992	-1.79	4.52	4.52	0.55395	.	0.287235	0.33753	N	0.004586	T	0.77025	0.4070	.	.	.	0.80722	D	1	B;B	0.25105	0.118;0.067	B;B	0.19391	0.025;0.018	T	0.76921	-0.2780	9	0.87932	D	0	-7.8818	12.9581	0.58442	0.0:1.0:0.0:0.0	.	1;1	B7Z280;Q8NHS3	.;MFSD8_HUMAN	I	1	ENSP00000296468:M1I	ENSP00000296468:M1I	M	-	3	0	MFSD8	129105736	0.973000	0.33851	0.455000	0.27031	0.003000	0.03518	3.175000	0.50855	2.503000	0.84419	0.561000	0.74099	ATG	MFSD8	-	NULL	ENSG00000164073		0.607	MFSD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD8	HGNC	protein_coding	OTTHUMT00000257097.1	20	0.00	0	C	NM_152778	Missense_Mutation	128886286	128886286	-1	no_errors	ENST00000296468	ensembl	human	known	69_37n	missense	5	54.55	6	SNP	0.738	T
MID1	4281	genome.wustl.edu	37	X	10491176	10491176	+	Missense_Mutation	SNP	C	C	G	rs387906719		TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chrX:10491176C>G	ENST00000317552.4	-	3	1112	c.712G>C	c.(712-714)Gag>Cag	p.E238Q	MID1_ENST00000380780.1_Missense_Mutation_p.E238Q|MID1_ENST00000380782.2_Missense_Mutation_p.E238Q|MID1_ENST00000453318.2_Missense_Mutation_p.E238Q|MID1_ENST00000380785.1_Missense_Mutation_p.E238Q|MID1_ENST00000380787.1_Missense_Mutation_p.E238Q|MID1_ENST00000380779.1_Missense_Mutation_p.E238Q	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	238					microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						AAAAGGGTCTCCAGTTCTGTG	0.343																																						dbGAP											0			GRCh37	CM071001	MID1	M							214.0	198.0	203.0					X																	10491176		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.712G>C	X.37:g.10491176C>G	ENSP00000312678:p.Glu238Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG2|O75361|Q9BZX5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E238Q	ENST00000317552.4	37	c.712	CCDS14138.1	X	.	.	.	.	.	.	.	.	.	.	C	16.02	3.003587	0.54254	.	.	ENSG00000101871	ENST00000453318;ENST00000317552;ENST00000380785;ENST00000380779;ENST00000380787;ENST00000380780;ENST00000380782;ENST00000454373;ENST00000413894	T;T;T;T;T;T;T;T	0.54866	0.55;0.55;0.55;0.55;0.55;0.55;1.02;1.01	4.96	4.96	0.65561	B-box, C-terminal (1);	0.125430	0.56097	D	0.000022	T	0.47783	0.1464	L	0.43923	1.385	0.58432	D	0.999998	P;B;B	0.35700	0.516;0.382;0.382	B;B;B	0.38755	0.281;0.265;0.146	T	0.38222	-0.9671	10	0.15066	T	0.55	.	17.2878	0.87146	0.0:1.0:0.0:0.0	.	238;238;238	O15344-2;A8K5A0;O15344	.;.;TRI18_HUMAN	Q	238;238;238;238;238;238;238;188;238	ENSP00000414521:E238Q;ENSP00000312678:E238Q;ENSP00000370162:E238Q;ENSP00000370156:E238Q;ENSP00000370164:E238Q;ENSP00000370157:E238Q;ENSP00000370159:E238Q;ENSP00000391154:E238Q	ENSP00000312678:E238Q	E	-	1	0	MID1	10451176	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.042000	0.76565	2.195000	0.70347	0.506000	0.49869	GAG	MID1	-	smart_Bbox_C	ENSG00000101871		0.343	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MID1	HGNC	protein_coding	OTTHUMT00000055738.1	88	0.00	0	C			10491176	10491176	-1	no_errors	ENST00000317552	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	G
MINPP1	9562	genome.wustl.edu	37	10	89268241	89268241	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr10:89268241A>T	ENST00000371996.4	+	2	827	c.786A>T	c.(784-786)ttA>ttT	p.L262F	MINPP1_ENST00000536010.1_Missense_Mutation_p.L61F|MINPP1_ENST00000371994.4_Missense_Mutation_p.L262F	NM_004897.4	NP_004888.2	Q9UNW1	MINP1_HUMAN	multiple inositol-polyphosphate phosphatase 1	262					bone mineralization (GO:0030282)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|ossification (GO:0001503)|polyphosphate metabolic process (GO:0006797)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	acid phosphatase activity (GO:0003993)|bisphosphoglycerate 3-phosphatase activity (GO:0034417)|inositol hexakisphosphate 2-phosphatase activity (GO:0052826)|phosphohistidine phosphatase activity (GO:0008969)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|urinary_tract(2)	5		Colorectal(252;0.122)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00123)		AGAACATTTTAAAAAAAGTTG	0.318																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF046915	CCDS7384.1, CCDS53551.1, CCDS53552.1	10q23	2010-05-04	2010-05-04		ENSG00000107789	ENSG00000107789	3.1.3.62		7102	protein-coding gene	gene with protein product		605391	"""multiple inositol polyphosphate histidine phosphatase, 1"""			10087200	Standard	NM_004897		Approved	MIPP	uc001keu.3	Q9UNW1	OTTHUMG00000018678	ENST00000371996.4:c.786A>T	10.37:g.89268241A>T	ENSP00000361064:p.Leu262Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H683|O95172|O95286|Q59EJ2|Q9UGA3	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2,pirsf_Histidine_acid_Pase_euk	p.L262F	ENST00000371996.4	37	c.786	CCDS7384.1	10	.	.	.	.	.	.	.	.	.	.	A	17.05	3.291127	0.59976	.	.	ENSG00000107789	ENST00000371996;ENST00000371994;ENST00000546140;ENST00000536010	T;T;T	0.81330	-1.21;-1.48;-1.21	5.95	0.748	0.18376	.	0.790442	0.11183	N	0.590747	T	0.75752	0.3892	L	0.55481	1.735	0.33520	D	0.592254	P;P	0.43633	0.813;0.748	P;P	0.45577	0.468;0.486	T	0.75816	-0.3184	10	0.54805	T	0.06	0.4322	3.1763	0.06570	0.3645:0.0:0.2029:0.4327	.	262;262	Q9UNW1-2;Q9UNW1	.;MINP1_HUMAN	F	262;262;121;61	ENSP00000361064:L262F;ENSP00000361062:L262F;ENSP00000437823:L61F	ENSP00000361062:L262F	L	+	3	2	MINPP1	89258221	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	0.567000	0.23608	0.473000	0.27368	0.528000	0.53228	TTA	MINPP1	-	pfam_His_Pase_superF_clade-2,pirsf_Histidine_acid_Pase_euk	ENSG00000107789		0.318	MINPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MINPP1	HGNC	protein_coding	OTTHUMT00000049221.1	29	0.00	0	A			89268241	89268241	+1	no_errors	ENST00000371996	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.876	T
TENM2	57451	genome.wustl.edu	37	5	167645851	167645851	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr5:167645851C>A	ENST00000518659.1	+	23	4994	c.4955C>A	c.(4954-4956)cCt>cAt	p.P1652H	TENM2_ENST00000545108.1_Missense_Mutation_p.P1651H|TENM2_ENST00000403607.2_Missense_Mutation_p.P1476H|TENM2_ENST00000520394.1_Missense_Mutation_p.P1413H|TENM2_ENST00000519204.1_Missense_Mutation_p.P1531H	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1652					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CTGCTCATGCCTGACAACCAG	0.512																																						dbGAP											0													157.0	159.0	158.0					5																	167645851		2088	4228	6316	-	-	-	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.4955C>A	5.37:g.167645851C>A	ENSP00000429430:p.Pro1652His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl,superfamily_Cytokine_IL1-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.P1652H	ENST00000518659.1	37	c.4955		5	.	.	.	.	.	.	.	.	.	.	C	19.02	3.746528	0.69418	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	T;T;T;T;T	0.56611	1.7;0.45;1.7;1.7;1.7	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.77412	0.4126	M	0.85041	2.73	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.998	T	0.78145	-0.2318	10	0.52906	T	0.07	.	20.1577	0.98120	0.0:1.0:0.0:0.0	.	1651;1652;1413	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	H	1652;1651;1531;1413;1476	ENSP00000429430:P1652H;ENSP00000438635:P1651H;ENSP00000428964:P1531H;ENSP00000427874:P1413H;ENSP00000384905:P1476H	ENSP00000384905:P1476H	P	+	2	0	ODZ2	167578429	1.000000	0.71417	0.974000	0.42286	0.956000	0.61745	6.089000	0.71384	2.767000	0.95098	0.655000	0.94253	CCT	ODZ2	-	superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl	ENSG00000145934		0.512	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	HGNC	protein_coding	OTTHUMT00000376096.1	22	0.00	0	C	NM_001122679		167645851	167645851	+1	no_errors	ENST00000518659	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	A
OSGEPL1	64172	genome.wustl.edu	37	2	190620045	190620045	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr2:190620045T>C	ENST00000264151.5	-	3	565	c.463A>G	c.(463-465)Att>Gtt	p.I155V	Y_RNA_ENST00000411317.1_RNA|OSGEPL1_ENST00000519810.1_Missense_Mutation_p.I155V|OSGEPL1_ENST00000522700.1_Missense_Mutation_p.I155V	NM_022353.2	NP_071748.2			O-sialoglycoprotein endopeptidase-like 1											large_intestine(2)|upper_aerodigestive_tract(1)	3			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0293)|all cancers(119;0.0831)			GTCAACCTAATAGTAAGTGCA	0.383																																						dbGAP											0													78.0	73.0	74.0					2																	190620045		1857	4093	5950	-	-	-	SO:0001583	missense	0			AJ295148	CCDS46472.1	2q32	2011-08-12			ENSG00000128694	ENSG00000128694			23075	protein-coding gene	gene with protein product						19578062	Standard	NM_022353		Approved	Qri7	uc002uqz.1	Q9H4B0	OTTHUMG00000164096	ENST00000264151.5:c.463A>G	2.37:g.190620045T>C	ENSP00000264151:p.Ile155Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_M22,prints_Peptidase_M22_subgr,tigrfam_Peptidase_M22_subgr	p.I155V	ENST00000264151.5	37	c.463	CCDS46472.1	2	.	.	.	.	.	.	.	.	.	.	T	2.539	-0.306813	0.05458	.	.	ENSG00000128694	ENST00000264151;ENST00000519810;ENST00000522700;ENST00000520350;ENST00000517895;ENST00000521630	T;T;T;D;D;T	0.99080	2.38;2.38;2.38;-5.4;-5.4;1.03	5.64	3.26	0.37387	Peptidase M22, glycoprotease (1);	0.237722	0.44902	N	0.000416	D	0.93009	0.7775	N	0.03209	-0.39	0.38483	D	0.947789	B;B	0.10296	0.003;0.001	B;B	0.14023	0.01;0.007	D	0.88966	0.3397	10	0.02654	T	1	-17.7548	7.7733	0.29021	0.0:0.2883:0.0:0.7117	.	155;155	B4DGY7;Q9H4B0	.;OSGP2_HUMAN	V	155;155;155;8;155;155	ENSP00000264151:I155V;ENSP00000428859:I155V;ENSP00000429697:I155V;ENSP00000430062:I8V;ENSP00000430879:I155V;ENSP00000429385:I155V	ENSP00000264151:I155V	I	-	1	0	OSGEPL1	190328290	0.255000	0.24002	0.999000	0.59377	0.985000	0.73830	0.509000	0.22707	1.064000	0.40671	0.455000	0.32223	ATT	OSGEPL1	-	pfam_Peptidase_M22,tigrfam_Peptidase_M22_subgr	ENSG00000128694		0.383	OSGEPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSGEPL1	HGNC	protein_coding	OTTHUMT00000377257.1	47	0.00	0	T	NM_022353		190620045	190620045	-1	no_errors	ENST00000264151	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	0.998	C
PCDHA2	56146	genome.wustl.edu	37	5	140174750	140174750	+	Silent	SNP	G	G	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr5:140174750G>A	ENST00000526136.1	+	1	201	c.201G>A	c.(199-201)gcG>gcA	p.A67A	PCDHA2_ENST00000520672.2_Silent_p.A67A|PCDHA2_ENST00000378132.1_Silent_p.A67A|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018905.2	NP_061728.1	Q9Y5H9	PCDA2_HUMAN	protocadherin alpha 2	67	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(16)|lung(26)|ovary(4)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCGGGTGGCGTCCAAAAGAC	0.647																																						dbGAP											0													55.0	67.0	63.0					5																	140174750		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			AF152480	CCDS54914.1, CCDS64269.1	5q31	2010-11-26				ENSG00000204969		"""Cadherins / Protocadherins : Clustered"""	8668	other	complex locus constituent	"""KIAA0345-like 12"""	606308				10380929	Standard	NM_018905		Approved			Q9Y5H9		ENST00000526136.1:c.201G>A	5.37:g.140174750G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75287|Q9BTV3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A67	ENST00000526136.1	37	c.201	CCDS54914.1	5																																																																																			PCDHA2	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204969		0.647	PCDHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA2	HGNC	protein_coding	OTTHUMT00000372877.3	30	0.00	0	G	NM_018905		140174750	140174750	+1	no_errors	ENST00000526136	ensembl	human	known	69_37n	silent	24	29.41	10	SNP	0.493	A
PCDHGA1	56114	genome.wustl.edu	37	5	140711823	140711823	+	Silent	SNP	G	G	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr5:140711823G>A	ENST00000517417.1	+	1	1572	c.1572G>A	c.(1570-1572)caG>caA	p.Q524Q	AC005618.6_ENST00000606901.1_lincRNA|PCDHGA1_ENST00000378105.3_Silent_p.Q524Q	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	524	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACTATGAGCAGTTCCGGGACA	0.572																																						dbGAP											0													184.0	195.0	191.0					5																	140711823		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.1572G>A	5.37:g.140711823G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M273|Q9Y5D6	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q524	ENST00000517417.1	37	c.1572	CCDS54922.1	5																																																																																			PCDHGA1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000204956		0.572	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	41	0.00	0	G	NM_018912		140711823	140711823	+1	no_errors	ENST00000517417	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	0.914	A
PCID2	55795	genome.wustl.edu	37	13	113838712	113838712	+	Silent	SNP	T	T	C			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr13:113838712T>C	ENST00000337344.4	-	9	709	c.633A>G	c.(631-633)acA>acG	p.T211T	PCID2_ENST00000493650.1_5'UTR|PCID2_ENST00000375479.2_Silent_p.T211T|PCID2_ENST00000375457.2_Silent_p.T209T|PCID2_ENST00000375477.1_Silent_p.T211T|PCID2_ENST00000375459.1_Silent_p.T209T|PCID2_ENST00000246505.5_Silent_p.T265T	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2	211					negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			AGTATTTGTATGTTACTCTCT	0.353																																						dbGAP											0													245.0	212.0	223.0					13																	113838712		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.633A>G	13.37:g.113838712T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Silent	SNP	pfam_PCI_dom,smart_PAM	p.T265	ENST00000337344.4	37	c.795	CCDS9532.2	13																																																																																			PCID2	-	smart_PAM	ENSG00000126226		0.353	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PCID2	HGNC	protein_coding	OTTHUMT00000045897.1	97	0.00	0	T	NM_018386		113838712	113838712	-1	no_errors	ENST00000246505	ensembl	human	known	69_37n	silent	11	77.08	37	SNP	0.012	C
PRKCSH	5589	genome.wustl.edu	37	19	11558370	11558370	+	Silent	SNP	G	G	A	rs77563879		TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr19:11558370G>A	ENST00000589838.1	+	10	966	c.966G>A	c.(964-966)gaG>gaA	p.E322E	PRKCSH_ENST00000252455.2_Silent_p.E322E|PRKCSH_ENST00000412601.1_Silent_p.E322E|PRKCSH_ENST00000591462.1_Silent_p.E322E|PRKCSH_ENST00000592741.1_Silent_p.E322E|PRKCSH_ENST00000587327.1_Silent_p.E322E			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	322	Glu-rich (acidic).				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)	p.E321_E322delEE(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						aggaggaggaggaagaagagg	0.632																																						dbGAP											1	Deletion - In frame(1)	central_nervous_system(1)											27.0	27.0	27.0					19																	11558370		2200	4298	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.966G>A	19.37:g.11558370G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K318|Q96BU9|Q96D06|Q9P0W9	Silent	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_LDrepeatLR_classA_rpt,pfscan_EF_HAND_2	p.E322	ENST00000589838.1	37	c.966	CCDS32911.1	19																																																																																			PRKCSH	-	NULL	ENSG00000130175		0.632	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKCSH	HGNC	protein_coding	OTTHUMT00000458817.1	15	0.00	0	G			11558370	11558370	+1	no_errors	ENST00000252455	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.000	A
PTCHD2	57540	genome.wustl.edu	37	1	11594443	11594443	+	Silent	SNP	G	G	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr1:11594443G>A	ENST00000294484.6	+	18	3519	c.3381G>A	c.(3379-3381)acG>acA	p.T1127T	PTCHD2_ENST00000304391.6_Missense_Mutation_p.V14I|PTCHD2_ENST00000389575.3_Silent_p.T1127T	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1127					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		CACAGACCACGTACAAGGGCA	0.627																																						dbGAP											0													103.0	115.0	111.0					1																	11594443		2105	4229	6334	-	-	-	SO:0001819	synonymous_variant	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3381G>A	1.37:g.11594443G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	NULL	p.V14I	ENST00000294484.6	37	c.40	CCDS41247.1	1	.	.	.	.	.	.	.	.	.	.	G	12.63	1.995376	0.35226	.	.	ENSG00000204624	ENST00000304391	.	.	.	5.17	-0.827	0.10802	.	.	.	.	.	T	0.59905	0.2228	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60291	-0.7292	5	0.87932	D	0	-14.7096	6.9912	0.24755	0.2688:0.4238:0.3074:0.0	.	.	.	.	I	14	.	ENSP00000303400:V14I	V	+	1	0	PTCHD2	11517030	0.957000	0.32711	0.997000	0.53966	0.937000	0.57800	0.145000	0.16157	-0.070000	0.12908	0.561000	0.74099	GTA	PTCHD2	-	NULL	ENSG00000204624		0.627	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	40	0.00	0	G	XM_052561		11594443	11594443	+1	no_errors	ENST00000304391	ensembl	human	putative	69_37n	missense	14	26.32	5	SNP	0.997	A
RNF168	165918	genome.wustl.edu	37	3	196199594	196199594	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr3:196199594A>G	ENST00000318037.3	-	6	1406	c.812T>C	c.(811-813)aTa>aCa	p.I271T	CTD-2002J20.1_ENST00000610042.1_RNA	NM_152617.3	NP_689830.2	Q8IYW5	RN168_HUMAN	ring finger protein 168, E3 ubiquitin protein ligase	271					cellular response to DNA damage stimulus (GO:0006974)|double-strand break repair (GO:0006302)|histone H2A K63-linked ubiquitination (GO:0070535)|histone H2A monoubiquitination (GO:0035518)|histone H2A-K13 ubiquitination (GO:0036351)|histone H2A-K15 ubiquitination (GO:0036352)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|negative regulation of translational elongation (GO:0045900)|positive regulation of DNA repair (GO:0045739)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)|ubiquitin ligase complex (GO:0000151)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|K63-linked polyubiquitin binding (GO:0070530)|ligase activity (GO:0016874)|nucleosome binding (GO:0031491)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(2)|large_intestine(7)|lung(9)|ovary(1)	20	all_cancers(143;1e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;5.25e-24)|all cancers(36;5.47e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00348)		CATATCTTCTATTTCTGTGTC	0.428																																						dbGAP											0													82.0	78.0	80.0					3																	196199594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054732	CCDS3317.1	3q29	2014-09-17	2012-02-23		ENSG00000163961	ENSG00000163961		"""RING-type (C3HC4) zinc fingers"""	26661	protein-coding gene	gene with protein product		612688	"""ring finger protein 168"""			12477932	Standard	NM_152617		Approved	FLJ35794	uc003fwq.3	Q8IYW5	OTTHUMG00000155582	ENST00000318037.3:c.812T>C	3.37:g.196199594A>G	ENSP00000320898:p.Ile271Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA67|Q96NS4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I271T	ENST00000318037.3	37	c.812	CCDS3317.1	3	.	.	.	.	.	.	.	.	.	.	A	10.86	1.469100	0.26335	.	.	ENSG00000163961	ENST00000318037	T	0.06294	3.32	6.08	-5.31	0.02730	.	2.176830	0.01388	N	0.013160	T	0.04815	0.0130	L	0.57536	1.79	0.09310	N	1	P	0.34462	0.454	B	0.22152	0.038	T	0.38993	-0.9635	10	0.19590	T	0.45	4.066	0.2492	0.00203	0.2227:0.2477:0.2452:0.2844	.	271	Q8IYW5	RN168_HUMAN	T	271	ENSP00000320898:I271T	ENSP00000320898:I271T	I	-	2	0	RNF168	197683991	0.002000	0.14202	0.000000	0.03702	0.485000	0.33311	0.294000	0.19047	-0.621000	0.05633	0.482000	0.46254	ATA	RNF168	-	NULL	ENSG00000163961		0.428	RNF168-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF168	HGNC	protein_coding	OTTHUMT00000340778.1	35	0.00	0	A	NM_152617		196199594	196199594	-1	no_errors	ENST00000318037	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.000	G
SUPT16H	11198	genome.wustl.edu	37	14	21834653	21834653	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr14:21834653C>A	ENST00000216297.2	-	8	1329	c.991G>T	c.(991-993)Gac>Tac	p.D331Y		NM_007192.3	NP_009123.1	Q9Y5B9	SP16H_HUMAN	suppressor of Ty 16 homolog (S. cerevisiae)	331					DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|nucleosome disassembly (GO:0006337)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of viral transcription (GO:0050434)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(95;0.00115)		Epithelial(56;1.62e-06)|all cancers(55;1.49e-05)	GBM - Glioblastoma multiforme(265;0.0159)		TTAACCACGTCCATGACAGCG	0.348																																						dbGAP											0													233.0	211.0	219.0					14																	21834653		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152961	CCDS9569.1	14q11.1	2008-08-13	2001-11-28		ENSG00000092201	ENSG00000092201			11465	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 140 kDa subunit"""	605012	"""suppressor of Ty (S.cerevisiae) 16 homolog"""			9489704, 11239457	Standard	NM_007192		Approved	FACT, FACTP140, SPT16/CDC68, FLJ14010, FLJ10857, CDC68	uc001wao.2	Q9Y5B9	OTTHUMG00000029685	ENST00000216297.2:c.991G>T	14.37:g.21834653C>A	ENSP00000216297:p.Asp331Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GMT8|Q6P2F1|Q6PJM1|Q9NRX0	Missense_Mutation	SNP	pfam_FACT_Spt16p,pfam_Pept_M24_structural-domain,pfam_DUF1747,superfamily_Pept_M24_structural-domain	p.D331Y	ENST00000216297.2	37	c.991	CCDS9569.1	14	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192899	0.78902	.	.	ENSG00000092201	ENST00000216297;ENST00000538230	T	0.77358	-1.09	5.44	5.44	0.79542	Peptidase M24, structural domain (3);	0.153716	0.56097	D	0.000035	D	0.85873	0.5798	M	0.71036	2.16	0.80722	D	1	P	0.51791	0.948	P	0.57776	0.827	D	0.87180	0.2227	10	0.72032	D	0.01	-15.1632	18.0429	0.89324	0.0:1.0:0.0:0.0	.	331	Q9Y5B9	SP16H_HUMAN	Y	331	ENSP00000216297:D331Y	ENSP00000216297:D331Y	D	-	1	0	SUPT16H	20904493	1.000000	0.71417	0.999000	0.59377	0.389000	0.30415	7.121000	0.77160	2.539000	0.85634	0.655000	0.94253	GAC	SUPT16H	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain	ENSG00000092201		0.348	SUPT16H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUPT16H	HGNC	protein_coding	OTTHUMT00000074025.2	66	0.00	0	C			21834653	21834653	-1	no_errors	ENST00000216297	ensembl	human	known	69_37n	missense	44	20.00	11	SNP	1.000	A
SUV420H1	51111	genome.wustl.edu	37	11	67925891	67925891	+	Missense_Mutation	SNP	G	G	A	rs575248505		TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr11:67925891G>A	ENST00000304363.4	-	11	2275	c.1922C>T	c.(1921-1923)gCg>gTg	p.A641V		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	641					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						ATCTGGTACCGCGTCGTCTTT	0.512													G|||	1	0.000199681	0.0	0.0	5008	,	,		21258	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													84.0	76.0	79.0					11																	67925891		2200	4294	6494	-	-	-	SO:0001583	missense	0			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.1922C>T	11.37:g.67925891G>A	ENSP00000305899:p.Ala641Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.A641V	ENST00000304363.4	37	c.1922	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	G	7.362	0.625138	0.14257	.	.	ENSG00000110066	ENST00000304363	T	0.40756	1.02	4.52	-9.05	0.00730	.	1.710600	0.03152	N	0.168139	T	0.20901	0.0503	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11179	-1.0598	10	0.14252	T	0.57	0.9127	5.4434	0.16521	0.1294:0.1882:0.5119:0.1705	.	641	Q4FZB7	SV421_HUMAN	V	641	ENSP00000305899:A641V	ENSP00000305899:A641V	A	-	2	0	SUV420H1	67682467	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-1.998000	0.01469	-2.620000	0.00440	0.491000	0.48974	GCG	SUV420H1	-	NULL	ENSG00000110066		0.512	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	HGNC	protein_coding	OTTHUMT00000318319.1	65	0.00	0	G	NM_017635		67925891	67925891	-1	no_errors	ENST00000304363	ensembl	human	known	69_37n	missense	39	30.36	17	SNP	0.000	A
TCP10	6953	genome.wustl.edu	37	6	167790110	167790110	+	Missense_Mutation	SNP	C	C	T	rs201005141		TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr6:167790110C>T	ENST00000397829.4	-	5	667	c.500G>A	c.(499-501)cGt>cAt	p.R167H	TCP10_ENST00000366827.2_Missense_Mutation_p.R167H	NM_004610.3	NP_004601.3	Q12799	TCP10_HUMAN	t-complex 10	194						cytosol (GO:0005829)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(2)|lung(6)	18		Breast(66;1.53e-05)|Ovarian(120;0.024)		OV - Ovarian serous cystadenocarcinoma(33;4.05e-20)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)|GBM - Glioblastoma multiforme(31;0.0386)		TCTGTCTTGACGTCTCCCGGG	0.507																																						dbGAP											0													34.0	33.0	33.0					6																	167790110		1384	2863	4247	-	-	-	SO:0001583	missense	0			U03399	CCDS43527.1	6q27	2012-09-20	2012-09-20		ENSG00000203690	ENSG00000203690			11656	protein-coding gene	gene with protein product		187020	"""t-complex 10 (a murine tcp homolog)"", ""t-complex 10 (mouse)"", ""t-complex 10 homolog (mouse)"""			8111376	Standard	NM_004610		Approved		uc003qvv.1	Q12799	OTTHUMG00000016026	ENST00000397829.4:c.500G>A	6.37:g.167790110C>T	ENSP00000380929:p.Arg167His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JR60|Q6P4F4	Missense_Mutation	SNP	NULL	p.R167H	ENST00000397829.4	37	c.500	CCDS43527.1	6	259	0.11858974358974358	19	0.03861788617886179	43	0.11878453038674033	77	0.1346153846153846	120	0.158311345646438	C	4.738	0.137311	0.09032	.	.	ENSG00000203690	ENST00000366827;ENST00000397829;ENST00000460930	T;T;T	0.46063	2.31;2.31;0.88	2.01	-3.81	0.04294	.	.	.	.	.	T	0.05823	0.0152	N	0.22421	0.69	0.80722	P	0.0	B;B;B	0.10296	0.0;0.001;0.003	B;B;B	0.04013	0.0;0.001;0.001	T	0.33445	-0.9868	8	0.14656	T	0.56	.	0.1293	0.00072	0.3461:0.2399:0.1818:0.2322	.	167;194;194	D1MPS5;Q12799;Q12799-2	.;TCP10_HUMAN;.	H	167;167;163	ENSP00000355792:R167H;ENSP00000380929:R167H;ENSP00000426065:R163H	ENSP00000355792:R167H	R	-	2	0	TCP10	167710100	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.003000	0.13083	-1.001000	0.03434	-1.021000	0.02439	CGT	TCP10	-	NULL	ENSG00000203690		0.507	TCP10-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCP10	HGNC	protein_coding	OTTHUMT00000365570.1	28	0.00	0	C	NM_004610		167790110	167790110	-1	no_errors	ENST00000397829	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.001	T
TRBV5-1	28614	genome.wustl.edu	37	7	142021186	142021186	+	RNA	SNP	C	C	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr7:142021186C>G	ENST00000390381.3	+	0	475									T cell receptor beta variable 5-1																		CTGGTACCAACAGACCCCAGG	0.498																																						dbGAP											0													50.0	48.0	49.0					7																	142021186		1922	4131	6053	-	-	-			0			L36092		7q34	2012-02-07			ENSG00000211734	ENSG00000211734		"""T cell receptors / TRB locus"""	12218	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV51, TCRBV5S1, TCRBV5S1A1T			OTTHUMG00000158520		7.37:g.142021186C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.Q56E	ENST00000390381.3	37	c.166		7																																																																																			TRBV5-1	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211734		0.498	TRBV5-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV5-1	HGNC	TR_V_gene	OTTHUMT00000351226.1	57	0.00	0	C	NG_001333		142021186	142021186	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390381	ensembl	human	known	69_37n	missense	33	29.79	14	SNP	0.414	G
TSEN2	80746	genome.wustl.edu	37	3	12531481	12531481	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr3:12531481A>G	ENST00000284995.6	+	2	569	c.182A>G	c.(181-183)tAt>tGt	p.Y61C	TSEN2_ENST00000402228.3_Missense_Mutation_p.Y61C|TSEN2_ENST00000454502.2_Missense_Mutation_p.Y61C|TSEN2_ENST00000444864.1_Missense_Mutation_p.Y61C|TSEN2_ENST00000314571.7_Missense_Mutation_p.Y61C|TSEN2_ENST00000415684.1_Missense_Mutation_p.Y61C|TSEN2_ENST00000383797.5_Missense_Mutation_p.Y61C	NM_025265.3	NP_079541.1	Q8NCE0	SEN2_HUMAN	TSEN2 tRNA splicing endonuclease subunit	61					mRNA processing (GO:0006397)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|tRNA-intron endonuclease complex (GO:0000214)	lyase activity (GO:0016829)|nucleic acid binding (GO:0003676)|tRNA-intron endonuclease activity (GO:0000213)			central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)	19						GAGCAGCTCTATGGGAAAGTA	0.478																																						dbGAP											0													113.0	108.0	110.0					3																	12531481		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019582	CCDS2611.1, CCDS46757.1, CCDS46758.1, CCDS46759.1	3p25.2	2013-08-06	2013-08-06		ENSG00000154743	ENSG00000154743		"""tRNA splicing endonuclease subunits"""	28422	protein-coding gene	gene with protein product		608753	"""tRNA splicing endonuclease 2 homolog (SEN2, S. cerevisiae)"", ""tRNA splicing endonuclease 2 homolog (S. cerevisiae)"""			15109492	Standard	NM_025265		Approved	SEN2, SEN2L, MGC2776	uc003bxb.3	Q8NCE0	OTTHUMG00000129765	ENST00000284995.6:c.182A>G	3.37:g.12531481A>G	ENSP00000284995:p.Tyr61Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6K1|C9IZI7|G5E9Q3|Q8WTW7|Q9BPU7	Missense_Mutation	SNP	pfam_tRNA_intron_Endonuc_cat-like,pfam_tRNA_intron_Endonuc_N,superfamily_tRNA_intron_Endonuc_cat-like,pirsf_tRNA_splic_SEN2	p.Y61C	ENST00000284995.6	37	c.182	CCDS2611.1	3	.	.	.	.	.	.	.	.	.	.	.	15.59	2.878873	0.51801	.	.	ENSG00000154743	ENST00000446004;ENST00000314571;ENST00000454502;ENST00000383797;ENST00000402228;ENST00000284995;ENST00000444864;ENST00000537959;ENST00000415684	T;T;T;T;T;T;T;T	0.66280	-0.15;-0.17;-0.0;-0.12;-0.04;-0.04;-0.2;-0.17	5.7	5.7	0.88788	.	0.143817	0.48286	D	0.000194	T	0.78953	0.4365	M	0.77103	2.36	0.42695	D	0.993592	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.997;0.999;0.997	T	0.82086	-0.0631	10	0.87932	D	0	-19.8498	13.4978	0.61436	1.0:0.0:0.0:0.0	.	61;61;61;61	G5E9Q3;Q8NCE0;Q8NCE0-3;C9IZI7	.;SEN2_HUMAN;.;.	C	61	ENSP00000406238:Y61C;ENSP00000323188:Y61C;ENSP00000392029:Y61C;ENSP00000373307:Y61C;ENSP00000385976:Y61C;ENSP00000284995:Y61C;ENSP00000407974:Y61C;ENSP00000416510:Y61C	ENSP00000284995:Y61C	Y	+	2	0	TSEN2	12506481	0.998000	0.40836	0.467000	0.27180	0.339000	0.28857	5.598000	0.67585	2.168000	0.68352	0.533000	0.62120	TAT	TSEN2	-	pirsf_tRNA_splic_SEN2	ENSG00000154743		0.478	TSEN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSEN2	HGNC	protein_coding	OTTHUMT00000251981.1	31	0.00	0	A	NM_025265		12531481	12531481	+1	no_errors	ENST00000284995	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.975	G
VPS13D	55187	genome.wustl.edu	37	1	12378344	12378344	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr1:12378344C>T	ENST00000358136.3	+	31	7494	c.7364C>T	c.(7363-7365)tCc>tTc	p.S2455F	VPS13D_ENST00000356315.4_Missense_Mutation_p.S2455F	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AAGCGGTCTTCCCTTCCTGTG	0.448																																						dbGAP											0													130.0	127.0	128.0					1																	12378344		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7364C>T	1.37:g.12378344C>T	ENSP00000350854:p.Ser2455Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.S2455F	ENST00000358136.3	37	c.7364	CCDS30588.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.7|28.7	4.939301|4.939301	0.92526|0.92526	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136	.|T;T	.|0.47528	.|0.84;0.84	5.67|5.67	5.67|5.67	0.87782|0.87782	.|.	.|0.054979	.|0.64402	.|D	.|0.000001	T|T	0.59609|0.59609	0.2206|0.2206	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.71674	.|0.998;0.996;0.993	.|P;P;P	.|0.62014	.|0.897;0.827;0.825	T|T	0.58521|0.58521	-0.7622|-0.7622	5|10	.|0.56958	.|D	.|0.05	.|.	20.1421|20.1421	0.98061|0.98061	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|362;2455;2455	.|B1AJZ2;Q5THJ4-2;Q5THJ4	.|.;.;VP13D_HUMAN	S|F	1278|2455	.|ENSP00000348666:S2455F;ENSP00000350854:S2455F	.|ENSP00000348666:S2455F	P|S	+|+	1|2	0|0	VPS13D|VPS13D	12300931|12300931	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.414000|7.414000	0.80117|0.80117	2.836000|2.836000	0.97738|0.97738	0.655000|0.655000	0.94253|0.94253	CCC|TCC	VPS13D	-	NULL	ENSG00000048707		0.448	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	46	0.00	0	C	NM_015378		12378344	12378344	+1	no_errors	ENST00000358136	ensembl	human	known	69_37n	missense	30	36.17	17	SNP	1.000	T
ZNF330	27309	genome.wustl.edu	37	4	142150852	142150852	+	Splice_Site	SNP	G	G	T			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr4:142150852G>T	ENST00000262990.4	+	6	646		c.e6+1		ZNF330_ENST00000421169.2_Splice_Site	NM_014487.4	NP_055302.1	Q9Y3S2	ZN330_HUMAN	zinc finger protein 330							chromosome, centromeric region (GO:0000775)|midbody (GO:0030496)|nucleolus (GO:0005730)	metal ion binding (GO:0046872)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	14	all_hematologic(180;0.162)					TGGGACCATGGTGAGTCATTA	0.418																																						dbGAP											0													217.0	193.0	201.0					4																	142150852		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ006591	CCDS3754.1	4q31.21	2008-05-15			ENSG00000109445	ENSG00000109445		"""Zinc fingers, C2H2-type"""	15462	protein-coding gene	gene with protein product		609550				11528117, 10593942	Standard	NM_001292002		Approved	NOA36, HSA6591	uc003iiq.4	Q9Y3S2	OTTHUMG00000133413	ENST00000262990.4:c.418+1G>T	4.37:g.142150852G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDA3	Splice_Site	SNP	-	e5+1	ENST00000262990.4	37	c.418+1	CCDS3754.1	4	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743976	0.89663	.	.	ENSG00000109445	ENST00000262990;ENST00000512809;ENST00000512738;ENST00000421169	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.047	0.97613	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZNF330	142370302	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.864000	0.99589	2.802000	0.96397	0.563000	0.77884	.	ZNF330	-	-	ENSG00000109445		0.418	ZNF330-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF330	HGNC	protein_coding	OTTHUMT00000257271.2	61	0.00	0	G	NM_014487	Intron	142150852	142150852	+1	no_errors	ENST00000262990	ensembl	human	known	69_37n	splice_site	35	22.22	10	SNP	1.000	T
ZNF671	79891	genome.wustl.edu	37	19	58232276	58232276	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A1RG-01A-11D-A14G-09	TCGA-E9-A1RG-10A-01D-A14G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	81896525-0e3f-47ff-9b0d-95b45aef718c	6db47e2e-f864-4b04-8a81-45bf16681178	g.chr19:58232276C>G	ENST00000317398.6	-	4	1273	c.1178G>C	c.(1177-1179)gGa>gCa	p.G393A	ZNF671_ENST00000335820.3_Missense_Mutation_p.G295A|ZNF671_ENST00000594803.1_5'Flank|AC003006.7_ENST00000599221.1_Intron|AC003006.7_ENST00000594684.1_Intron	NM_024833.2	NP_079109.2	Q8TAW3	ZN671_HUMAN	zinc finger protein 671	393					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(6)|liver(1)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		AGGCCTGGCTCCTGTGTGAAC	0.468																																						dbGAP											0													98.0	78.0	85.0					19																	58232276		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12961.1	19q13.43	2013-01-08				ENSG00000083814		"""Zinc fingers, C2H2-type"", ""-"""	26279	protein-coding gene	gene with protein product	"""hypothetical protein FLJ23506"""					12477932	Standard	NM_024833		Approved	FLJ23506	uc002qpz.4	Q8TAW3		ENST00000317398.6:c.1178G>C	19.37:g.58232276C>G	ENSP00000321848:p.Gly393Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF07|Q9H5E9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G393A	ENST00000317398.6	37	c.1178	CCDS12961.1	19	.	.	.	.	.	.	.	.	.	.	C	20.7	4.027372	0.75390	.	.	ENSG00000083814	ENST00000317398;ENST00000335820	T;T	0.26373	1.74;1.74	1.88	1.88	0.25563	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45955	0.1368	M	0.70275	2.135	0.33847	D	0.632212	D	0.89917	1.0	D	0.77557	0.99	T	0.60388	-0.7273	9	0.87932	D	0	.	9.7464	0.40448	0.0:1.0:0.0:0.0	.	393	Q8TAW3	ZN671_HUMAN	A	393;295	ENSP00000321848:G393A;ENSP00000338670:G295A	ENSP00000321848:G393A	G	-	2	0	ZNF671	62924088	0.002000	0.14202	0.148000	0.22405	0.946000	0.59487	0.976000	0.29462	1.359000	0.45940	0.467000	0.42956	GGA	ZNF671	-	pfscan_Znf_C2H2	ENSG00000083814		0.468	ZNF671-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF671	HGNC	protein_coding	OTTHUMT00000466817.1	30	0.00	0	C	NM_024833		58232276	58232276	-1	no_errors	ENST00000317398	ensembl	human	known	69_37n	missense	22	47.62	20	SNP	1.000	G
