#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
BRE	9577	genome.wustl.edu	37	2	28521330	28521330	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr2:28521330G>A	ENST00000342045.2	+	12	1201	c.1060G>A	c.(1060-1062)Gat>Aat	p.D354N	BRE_ENST00000344773.2_Missense_Mutation_p.D354N|BRE_ENST00000379632.2_Missense_Mutation_p.D354N|BRE_ENST00000379624.1_Missense_Mutation_p.D354N|BRE_ENST00000361704.2_Missense_Mutation_p.D354N	NM_199194.2	NP_954664.1			brain and reproductive organ-expressed (TNFRSF1A modulator)									p.D354N(2)		NS(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(11)|prostate(2)|skin(2)	23	Acute lymphoblastic leukemia(172;0.155)					CCCCAGATGGGATGGAAATGA	0.438																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											109.0	111.0	110.0					2																	28521330		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015767	CCDS1763.1, CCDS1764.1, CCDS1765.1	2p23	2008-02-05			ENSG00000158019	ENSG00000158019			1106	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 4"""	610497				9737713, 7826398	Standard	NM_004899		Approved	BRCC45, BRCC4	uc002rls.3	Q9NXR7	OTTHUMG00000097831	ENST00000342045.2:c.1060G>A	2.37:g.28521330G>A	ENSP00000339371:p.Asp354Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Brain/reproduct-express_prot	p.D354N	ENST00000342045.2	37	c.1060	CCDS1763.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.288473	0.95517	.	.	ENSG00000158019	ENST00000344773;ENST00000379624;ENST00000342045;ENST00000379632;ENST00000361704;ENST00000379623	.	.	.	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.75939	0.3918	L	0.50333	1.59	0.80722	D	1	D;D;D;D	0.71674	0.998;0.993;0.996;0.996	D;D;D;D	0.78314	0.991;0.971;0.987;0.987	T	0.73088	-0.4093	9	0.41790	T	0.15	-22.4261	19.9501	0.97195	0.0:0.0:1.0:0.0	.	354;354;354;354	Q9NXR7-1;Q9NXR7;Q9NXR7-4;Q9NXR7-3	.;BRE_HUMAN;.;.	N	354;354;354;354;354;256	.	ENSP00000339371:D354N	D	+	1	0	BRE	28374834	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.837000	0.99465	2.732000	0.93576	0.655000	0.94253	GAT	BRE	-	NULL	ENSG00000158019		0.438	BRE-004	KNOWN	basic|appris_principal|CCDS	protein_coding	BRE	HGNC	protein_coding	OTTHUMT00000215114.1	102	0.00	0	G			28521330	28521330	+1	no_errors	ENST00000344773	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	A
CCR2	729230	genome.wustl.edu	37	3	46400009	46400009	+	Intron	SNP	C	C	T			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr3:46400009C>T	ENST00000400888.2	+	1	980				CCR2_ENST00000292301.4_Intron|CCR2_ENST00000465202.1_3'UTR|CCR2_ENST00000445132.2_Nonsense_Mutation_p.Q331*			P41597	CCR2_HUMAN	chemokine (C-C motif) receptor 2						blood vessel remodeling (GO:0001974)|cellular calcium ion homeostasis (GO:0006874)|cellular defense response (GO:0006968)|cellular homeostasis (GO:0019725)|chemokine-mediated signaling pathway (GO:0070098)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell chemotaxis (GO:0002407)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|JAK-STAT cascade (GO:0007259)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of angiogenesis (GO:0016525)|negative regulation of eosinophil degranulation (GO:0043310)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of astrocyte chemotaxis (GO:2000464)|positive regulation of CD8-positive, alpha-beta T cell extravasation (GO:2000451)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of immune complex clearance by monocytes and macrophages (GO:0090265)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of monocyte extravasation (GO:2000439)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of vascular endothelial growth factor production (GO:0010574)|response to wounding (GO:0009611)|T-helper 17 cell chemotaxis (GO:0035705)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|CCR2 chemokine receptor binding (GO:0031727)|chemokine receptor activity (GO:0004950)|protein homodimerization activity (GO:0042803)			breast(3)|endometrium(1)|large_intestine(1)|liver(2)|lung(7)	14				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0174)|Kidney(197;0.0206)		CTTCTGCAAACAATGTCCAGT	0.493																																						dbGAP											0													67.0	60.0	62.0					3																	46400009		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0				CCDS43078.1, CCDS46813.1	3p21	2012-08-08			ENSG00000121807	ENSG00000121807		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1603	protein-coding gene	gene with protein product		601267		CMKBR2		8146186	Standard	NM_001123041		Approved	CC-CKR-2, CKR2, MCP-1-R, CD192, FLJ78302	uc003cpn.4	P41597	OTTHUMG00000156466	ENST00000400888.2:c.941+50C>T	3.37:g.46400009C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ3|B2RMT0|Q4VBL2	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Chemokine_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Chemokine_CCR2	p.Q331*	ENST00000400888.2	37	c.991	CCDS43078.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.421916	0.96111	.	.	ENSG00000121807	ENST00000445132	.	.	.	4.91	3.97	0.46021	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	12.2277	0.54470	0.2505:0.7495:0.0:0.0	.	.	.	.	X	331	.	ENSP00000399285:Q331X	Q	+	1	0	CCR2	46375013	0.100000	0.21855	0.995000	0.50966	0.151000	0.21798	0.323000	0.19593	2.442000	0.82660	0.557000	0.71058	CAA	CCR2	-	prints_Chemokine_CCR2	ENSG00000121807		0.493	CCR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCR2	HGNC	protein_coding	OTTHUMT00000344292.1	70	0.00	0	C	NM_000647		46400009	46400009	+1	no_errors	ENST00000445132	ensembl	human	known	69_37n	nonsense	30	42.31	22	SNP	0.980	T
CDC42EP1	11135	genome.wustl.edu	37	22	37964419	37964419	+	Silent	SNP	T	T	C	rs200195385|rs13056859|rs66468174	byFrequency	TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr22:37964419T>C	ENST00000249014.4	+	3	1188	c.768T>C	c.(766-768)gcT>gcC	p.A256A		NM_152243.2	NP_689449.1	Q00587	BORG5_HUMAN	CDC42 effector protein (Rho GTPase binding) 1	256	8 X 7 AA tandem repeats of [PT]-[AT]-A- [ENT]-[PT]-[PTS]-[AG].				positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)		p.N258_A264delNPSAPAA(3)		endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(4)|prostate(5)	15	Melanoma(58;0.0574)					CAGCGCCTGCTGCAAACCCCT	0.672																																						dbGAP											3	Deletion - In frame(3)	large_intestine(2)|haematopoietic_and_lymphoid_tissue(1)											11.0	10.0	11.0					22																	37964419		2170	3752	5922	-	-	-	SO:0001819	synonymous_variant	0			M88338	CCDS13949.1	22q13.1	2008-06-11			ENSG00000128283	ENSG00000128283			17014	protein-coding gene	gene with protein product	"""55 kDa bone marrow stromal/endothelial cell protein"", ""serum constituent protein"""	606084				1629197, 10430899	Standard	NM_152243		Approved	MSE55, CEP1, Borg5	uc003asz.4	Q00587	OTTHUMG00000150591	ENST00000249014.4:c.768T>C	22.37:g.37964419T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K825|Q96GN1	Silent	SNP	pfam_PAK_box_Rho-bd,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd	p.A256	ENST00000249014.4	37	c.768	CCDS13949.1	22																																																																																			CDC42EP1	-	NULL	ENSG00000128283		0.672	CDC42EP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP1	HGNC	protein_coding	OTTHUMT00000318993.1	17	0.00	0	T	NM_152243		37964419	37964419	+1	no_errors	ENST00000249014	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	0.000	C
CNTNAP3	79937	genome.wustl.edu	37	9	39103829	39103829	+	Silent	SNP	G	G	A			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr9:39103829G>A	ENST00000297668.6	-	16	2521	c.2448C>T	c.(2446-2448)gaC>gaT	p.D816D	CNTNAP3_ENST00000377656.2_Silent_p.D815D|CNTNAP3_ENST00000358144.2_Silent_p.D728D	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3	816	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		AGAAGCACACGTCAGCAGTGA	0.458																																						dbGAP											0													21.0	25.0	23.0					9																	39103829		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.2448C>T	9.37:g.39103829G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMA0|Q9C0E9	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.D816	ENST00000297668.6	37	c.2448	CCDS6616.1	9																																																																																			CNTNAP3	-	superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000106714		0.458	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	HGNC	protein_coding	OTTHUMT00000052511.1	55	0.00	0	G	NM_033655		39103829	39103829	-1	no_errors	ENST00000297668	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	0.993	A
DOLPP1	57171	genome.wustl.edu	37	9	131848528	131848528	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr9:131848528T>G	ENST00000372546.4	+	6	604	c.572T>G	c.(571-573)tTc>tGc	p.F191C	DOLPP1_ENST00000406974.3_Intron|DOLPP1_ENST00000540102.1_Intron	NM_020438.4	NP_065171.2	Q86YN1	DOPP1_HUMAN	dolichyldiphosphatase 1	191					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|lipid biosynthetic process (GO:0008610)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichyldiphosphatase activity (GO:0047874)			endometrium(3)|kidney(2)|lung(7)|skin(1)	13						ACCCCGCTGTTCCCCAGGATA	0.642																																						dbGAP											0													85.0	66.0	73.0					9																	131848528		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009493	CCDS6918.1, CCDS48039.1	9q34.1	2013-05-21	2013-05-21		ENSG00000167130	ENSG00000167130	3.6.1.43		29565	protein-coding gene	gene with protein product	"""linked to Surfeit genes in Fugu rubripes 2"""	614516	"""dolichyl pyrophosphate phosphatase 1"""			10369878, 12198133	Standard	NM_020438		Approved	LSFR2	uc004bxc.3	Q86YN1	OTTHUMG00000020771	ENST00000372546.4:c.572T>G	9.37:g.131848528T>G	ENSP00000361625:p.Phe191Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3U8|B0QZG4|Q96GF8|Q9Y3G1	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.F191C	ENST00000372546.4	37	c.572	CCDS6918.1	9	.	.	.	.	.	.	.	.	.	.	T	22.7	4.326611	0.81690	.	.	ENSG00000167130	ENST00000372546	.	.	.	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	T	0.81616	0.4860	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.85173	0.0999	9	0.87932	D	0	-7.9171	14.8551	0.70329	0.0:0.0:0.0:1.0	.	191	Q86YN1	DOPP1_HUMAN	C	191	.	ENSP00000361625:F191C	F	+	2	0	DOLPP1	130888349	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.667000	0.83888	2.105000	0.64084	0.374000	0.22700	TTC	DOLPP1	-	NULL	ENSG00000167130		0.642	DOLPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOLPP1	HGNC	protein_coding	OTTHUMT00000054548.4	38	0.00	0	T	NM_020438		131848528	131848528	+1	no_errors	ENST00000372546	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	1.000	G
DUSP10	11221	genome.wustl.edu	37	1	221912851	221912851	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr1:221912851delC	ENST00000366899.3	-	2	474	c.236delG	c.(235-237)agcfs	p.S79fs	DUSP10_ENST00000468085.1_5'Flank|DUSP10_ENST00000323825.3_Intron|DUSP10_ENST00000544095.1_5'Flank	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10	79					inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		AGTGCAGCAGCTGGCACTGCT	0.597																																						dbGAP											0													92.0	68.0	76.0					1																	221912851		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.236delG	1.37:g.221912851delC	ENSP00000355866:p.Ser79fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTB4|Q6GSI4|Q9H9Z5	Frame_Shift_Del	DEL	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,superfamily_Blood-coag_inhib_Disintegrin,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.S79fs	ENST00000366899.3	37	c.236	CCDS1528.1	1																																																																																			DUSP10	-	superfamily_Blood-coag_inhib_Disintegrin	ENSG00000143507		0.597	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1	53	0.00	0	C	NM_007207		221912851	221912851	-1	no_errors	ENST00000366899	ensembl	human	known	69_37n	frame_shift_del	31	17.95	7	DEL	1.000	-
FAM71E2	284418	genome.wustl.edu	37	19	55874336	55874336	+	Silent	SNP	G	G	A			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr19:55874336G>A	ENST00000424985.3	-	1	292	c.99C>T	c.(97-99)ggC>ggT	p.G33G		NM_001145402.1	NP_001138874.1	Q8N5Q1	F71E2_HUMAN	family with sequence similarity 71, member E2	33										NS(1)|breast(3)|endometrium(2)|kidney(1)|skin(1)	8						GCAGGTACTCGCCCTTCTGGA	0.617																																						dbGAP											0													47.0	49.0	49.0					19																	55874336		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AL834316		19q13.42	2014-04-02	2007-11-20	2007-11-20	ENSG00000180043	ENSG00000180043			25278	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 16"""	C19orf16			Standard	NM_001145402		Approved	DKFZp434G1729	uc002qkr.2	Q8N5Q1	OTTHUMG00000170357	ENST00000424985.3:c.99C>T	19.37:g.55874336G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8ND99	Splice_Site	SNP	-	e1+2	ENST00000424985.3	37	c.97+2		19																																																																																			FAM71E2	-	-	ENSG00000180043		0.617	FAM71E2-010	NOVEL	basic|appris_principal	protein_coding	FAM71E2	HGNC	protein_coding	OTTHUMT00000409063.4	32	0.00	0	G	NM_001145402		55874336	55874336	-1	no_errors	ENST00000585734	ensembl	human	known	69_37n	splice_site	27	15.62	5	SNP	1.000	A
FIP1L1	81608	genome.wustl.edu	37	4	54319278	54319278	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr4:54319278C>T	ENST00000337488.6	+	16	1671	c.1477C>T	c.(1477-1479)Cct>Tct	p.P493S	FIP1L1_ENST00000507166.1_Intron|FIP1L1_ENST00000358575.5_Missense_Mutation_p.P487S|FIP1L1_ENST00000306932.6_Missense_Mutation_p.P419S	NM_030917.3	NP_112179.2	Q6UN15	FIP1_HUMAN	factor interacting with PAPOLA and CPSF1	493	Arg-rich.|Glu-rich.|Sufficient for interaction with CPSF1 and CSTF3.				mRNA processing (GO:0006397)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			large_intestine(3)|liver(1)|ovary(1)|skin(1)	6			GBM - Glioblastoma multiforme(3;3.31e-36)|LUSC - Lung squamous cell carcinoma(32;0.0134)			TGATCACAGTCCTACACCAAG	0.438			T	PDGFRA	idiopathic hypereosinophilic syndrome																																	dbGAP		Dom	yes		4	4q12	81608	FIP1 like 1 (S. cerevisiae)		L	0													73.0	63.0	67.0					4																	54319278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF161429	CCDS3491.1, CCDS47055.1, CCDS47056.1	4q12	2013-06-18	2013-06-18		ENSG00000145216	ENSG00000145216			19124	protein-coding gene	gene with protein product		607686	"""FIP1 like 1 (S. cerevisiae)"", ""FIP1L1 cleavage and polyadenylation specific factor subunit"""			11230166, 14749727	Standard	NM_030917		Approved	DKFZp586K0717, FIP1	uc003hae.3	Q6UN15	OTTHUMG00000128701	ENST00000337488.6:c.1477C>T	4.37:g.54319278C>T	ENSP00000336752:p.Pro493Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIR3|G3XAD6|Q0VGE0|Q499Y4|Q49AU3|Q7Z608|Q8WVN3|Q96F80|Q9H077	Missense_Mutation	SNP	pfam_Fip1	p.P493S	ENST00000337488.6	37	c.1477	CCDS3491.1	4	.	.	.	.	.	.	.	.	.	.	C	22.0	4.225047	0.79576	.	.	ENSG00000145216	ENST00000337488;ENST00000358575;ENST00000306932;ENST00000504094	T;T;D	0.93366	2.36;0.03;-3.21	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000002	D	0.95862	0.8653	L	0.59436	1.845	0.80722	D	1	D;D;D;D	0.67145	0.996;0.993;0.996;0.993	D;D;D;D	0.75484	0.986;0.968;0.986;0.979	D	0.94497	0.7706	10	0.33141	T	0.24	-13.3352	19.2836	0.94061	0.0:1.0:0.0:0.0	.	487;487;419;493	G3XAD6;B4DIR3;Q6UN15-3;Q6UN15	.;.;.;FIP1_HUMAN	S	493;487;419;150	ENSP00000336752:P493S;ENSP00000351383:P487S;ENSP00000302993:P419S	ENSP00000302993:P419S	P	+	1	0	FIP1L1	54014035	1.000000	0.71417	0.690000	0.30148	0.671000	0.39405	5.947000	0.70242	2.641000	0.89580	0.655000	0.94253	CCT	FIP1L1	-	NULL	ENSG00000145216		0.438	FIP1L1-001	KNOWN	basic|CCDS	protein_coding	FIP1L1	HGNC	protein_coding	OTTHUMT00000250602.1	71	0.00	0	C	NM_030917		54319278	54319278	+1	no_errors	ENST00000337488	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	0.991	T
GATA3	2625	genome.wustl.edu	37	10	8115874	8115875	+	Frame_Shift_Ins	INS	-	-	T	rs144824106		TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr10:8115874_8115875insT	ENST00000346208.3	+	6	1675_1676	c.1220_1221insT	c.(1219-1224)tcgcccfs	p.P408fs	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Frame_Shift_Ins_p.P409fs			P23771	GATA3_HUMAN	GATA binding protein 3	408					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.P409fs*>37(6)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						AGCCACATCTCGCCCTTCAGCC	0.604			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	6	Insertion - Frameshift(6)	breast(6)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	Exception_encountered	10.37:g.8115874_8115875insT	ENSP00000341619:p.Pro408fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.P409fs	ENST00000346208.3	37	c.1223_1224	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.604	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	60	0.00	0	-	NM_001002295		8115874	8115875	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	34	24.44	11	INS	0.903:0.359	T
KCNMB2	10242	genome.wustl.edu	37	3	178560711	178560711	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr3:178560711C>T	ENST00000432997.1	+	5	1046	c.694C>T	c.(694-696)Cgg>Tgg	p.R232W	KCNMB2_ENST00000420517.2_Missense_Mutation_p.R232W|KCNMB2_ENST00000358316.3_Missense_Mutation_p.R232W|KCNMB2_ENST00000452583.1_Missense_Mutation_p.R232W|RP11-385J1.2_ENST00000432385.1_RNA|RP11-385J1.2_ENST00000425330.1_RNA|RP11-385J1.2_ENST00000451742.1_RNA|RP11-385J1.2_ENST00000437488.1_RNA	NM_001278911.1	NP_001265840.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 2	246					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)	p.R232W(1)		NS(2)|endometrium(4)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12	all_cancers(143;5.38e-18)|Ovarian(172;0.00769)|Breast(254;0.125)		OV - Ovarian serous cystadenocarcinoma(80;1.32e-27)|GBM - Glioblastoma multiforme(14;0.0321)|BRCA - Breast invasive adenocarcinoma(182;0.0841)		Miconazole(DB01110)|Procaine(DB00721)	GAGGATCCAACGGATCAATAG	0.383																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											60.0	60.0	60.0					3																	178560711		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF099137	CCDS3223.1	3q26.32	2005-10-13			ENSG00000197584	ENSG00000197584		"""Potassium channels"""	6286	protein-coding gene	gene with protein product		605214				10097176	Standard	NM_181361		Approved		uc003fjd.3	Q9Y691	OTTHUMG00000157264	ENST00000432997.1:c.694C>T	3.37:g.178560711C>T	ENSP00000407592:p.Arg232Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_bsu,pfam_KCNMB2_ball_chain_dom,prints_K_chnl_Ca-activ_BK_bsu	p.R232W	ENST00000432997.1	37	c.694	CCDS3223.1	3	.	.	.	.	.	.	.	.	.	.	C	15.46	2.838724	0.51057	.	.	ENSG00000197584	ENST00000420517;ENST00000452583;ENST00000432997;ENST00000358316;ENST00000457763	T;T;T;T	0.11063	2.81;2.81;2.81;2.81	5.76	4.87	0.63330	.	0.054480	0.64402	D	0.000002	T	0.20700	0.0498	L	0.29908	0.895	0.46437	D	0.999049	D	0.89917	1.0	D	0.66979	0.948	T	0.01266	-1.1401	10	0.72032	D	0.01	-15.5841	13.7575	0.62946	0.3955:0.6045:0.0:0.0	.	232	Q9Y691	KCMB2_HUMAN	W	232;232;232;232;213	ENSP00000408252:R232W;ENSP00000397483:R232W;ENSP00000407592:R232W;ENSP00000351068:R232W	ENSP00000351068:R232W	R	+	1	2	KCNMB2	180043405	0.577000	0.26708	0.988000	0.46212	0.996000	0.88848	1.175000	0.31944	1.391000	0.46566	0.655000	0.94253	CGG	KCNMB2	-	NULL	ENSG00000197584		0.383	KCNMB2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCNMB2	HGNC	protein_coding	OTTHUMT00000348251.1	46	0.00	0	C	NM_181361		178560711	178560711	+1	no_errors	ENST00000358316	ensembl	human	known	69_37n	missense	23	36.11	13	SNP	0.930	T
NWD2	57495	genome.wustl.edu	37	4	37448092	37448092	+	Silent	SNP	C	C	T			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr4:37448092C>T	ENST00000309447.5	+	7	5330	c.4482C>T	c.(4480-4482)atC>atT	p.I1494I		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		1494										breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						CTGATATCATCGTGTTTATCA	0.438																																						dbGAP											0													101.0	82.0	88.0					4																	37448092		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000309447.5:c.4482C>T	4.37:g.37448092C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRU1	Silent	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.I1494	ENST00000309447.5	37	c.4482	CCDS47040.1	4																																																																																			KIAA1239	-	superfamily_WD40_repeat_dom	ENSG00000174145		0.438	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	HGNC	protein_coding	OTTHUMT00000347551.2	64	0.00	0	C			37448092	37448092	+1	no_errors	ENST00000309447	ensembl	human	known	69_37n	silent	65	10.96	8	SNP	0.006	T
NTRK2	4915	genome.wustl.edu	37	9	87285830	87285830	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr9:87285830C>T	ENST00000323115.4	+	1	520	c.167C>T	c.(166-168)cCg>cTg	p.P56L	NTRK2_ENST00000304053.6_Missense_Mutation_p.P56L|NTRK2_ENST00000376213.1_Missense_Mutation_p.P56L|NTRK2_ENST00000376208.1_Missense_Mutation_p.P56L|NTRK2_ENST00000395866.2_5'Flank|NTRK2_ENST00000359847.3_Missense_Mutation_p.P56L|NTRK2_ENST00000376214.1_Missense_Mutation_p.P56L|NTRK2_ENST00000277120.3_Missense_Mutation_p.P56L|NTRK2_ENST00000395882.1_Missense_Mutation_p.P56L			Q16620	NTRK2_HUMAN	neurotrophic tyrosine kinase, receptor, type 2	56	LRRNT.				activation of adenylate cyclase activity (GO:0007190)|aging (GO:0007568)|brain-derived neurotrophic factor receptor signaling pathway (GO:0031547)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|central nervous system neuron development (GO:0021954)|cerebral cortex development (GO:0021987)|circadian rhythm (GO:0007623)|feeding behavior (GO:0007631)|glutamate secretion (GO:0014047)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mechanoreceptor differentiation (GO:0042490)|negative regulation of anoikis (GO:2000811)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular junction development (GO:0007528)|neuron differentiation (GO:0030182)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peripheral nervous system neuron development (GO:0048935)|positive regulation of axonogenesis (GO:0050772)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein autophosphorylation (GO:0046777)|regulation of dendrite development (GO:0050773)|regulation of neurotransmitter secretion (GO:0046928)|regulation of protein kinase B signaling (GO:0051896)|regulation of Rac GTPase activity (GO:0032314)|response to auditory stimulus (GO:0010996)|retinal rod cell development (GO:0046548)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vasculogenesis (GO:0001570)	cell surface (GO:0009986)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|endosome (GO:0005768)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|brain-derived neurotrophic factor binding (GO:0048403)|brain-derived neurotrophic factor-activated receptor activity (GO:0060175)|neurotrophin binding (GO:0043121)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|skin(2)	46					Amitriptyline(DB00321)	GTGGCATTTCCGAGATTGGAG	0.572										TSP Lung(25;0.17)																												dbGAP											0													104.0	87.0	93.0					9																	87285830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF410902	CCDS6671.1, CCDS35050.1, CCDS35051.1, CCDS35052.1, CCDS35053.1	9q22.1	2013-01-11			ENSG00000148053	ENSG00000148053	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"""	8032	protein-coding gene	gene with protein product		600456				7789988	Standard	NM_001018065		Approved	TRKB	uc004anz.1	Q16620	OTTHUMG00000020120	ENST00000323115.4:c.167C>T	9.37:g.87285830C>T	ENSP00000314586:p.Pro56Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANZ4|B4DFV9|Q16675|Q59GJ1|Q8WXJ5|Q8WXJ6|Q8WXJ7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_LRR-contain_N,superfamily_Kinase-like_dom,smart_LRR-contain_N,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_NGF_rcpt,prints_Tyr_kin_neurotrophic_rcpt_2	p.P56L	ENST00000323115.4	37	c.167	CCDS35050.1	9	.	.	.	.	.	.	.	.	.	.	C	17.59	3.427881	0.62733	.	.	ENSG00000148053	ENST00000376214;ENST00000376213;ENST00000395882;ENST00000376208;ENST00000304053;ENST00000277120;ENST00000323115;ENST00000359847	D;D;D;D;D;D;D;D	0.99857	-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22;-7.22	5.01	5.01	0.66863	Leucine-rich repeat-containing N-terminal (2);	0.000000	0.85682	D	0.000000	D	0.99796	0.9913	M	0.62723	1.935	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D	0.96841	0.9618	10	0.62326	D	0.03	.	18.1136	0.89543	0.0:1.0:0.0:0.0	.	56;56;56;56;56;102;56	Q16620-3;Q16620-5;Q5VWE5;Q16620;Q16620-4;Q59GJ1;Q16620-2	.;.;.;NTRK2_HUMAN;.;.;.	L	56	ENSP00000365387:P56L;ENSP00000365386:P56L;ENSP00000379221:P56L;ENSP00000365381:P56L;ENSP00000306167:P56L;ENSP00000277120:P56L;ENSP00000314586:P56L;ENSP00000352906:P56L	ENSP00000277120:P56L	P	+	2	0	NTRK2	86475650	0.999000	0.42202	0.995000	0.50966	0.596000	0.36781	4.911000	0.63328	2.596000	0.87737	0.561000	0.74099	CCG	NTRK2	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000148053		0.572	NTRK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTRK2	HGNC	protein_coding	OTTHUMT00000052882.1	58	0.00	0	C			87285830	87285830	+1	no_errors	ENST00000277120	ensembl	human	known	69_37n	missense	49	14.04	8	SNP	0.998	T
OR7C2	26658	genome.wustl.edu	37	19	15052846	15052846	+	Silent	SNP	C	C	T			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr19:15052846C>T	ENST00000248072.3	+	1	546	c.546C>T	c.(544-546)tcC>tcT	p.S182S		NM_012377.1	NP_036509.1	O60412	OR7C2_HUMAN	olfactory receptor, family 7, subfamily C, member 2	182						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(8)|ovary(2)|skin(2)	15	Ovarian(108;0.203)					GTGATCCTTCCGAAGTCCTGA	0.448																																						dbGAP											0													201.0	193.0	196.0					19																	15052846		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U86255	CCDS12320.1	19p13.1	2012-08-09				ENSG00000127529		"""GPCR / Class A : Olfactory receptors"""	8374	protein-coding gene	gene with protein product				OR7C3			Standard	NM_012377		Approved	OR19-18	uc010xoc.2	O60412		ENST00000248072.3:c.546C>T	19.37:g.15052846C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43881|Q6IFP9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S182	ENST00000248072.3	37	c.546	CCDS12320.1	19																																																																																			OR7C2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000127529		0.448	OR7C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C2	HGNC	protein_coding	OTTHUMT00000466281.1	244	0.00	0	C			15052846	15052846	+1	no_errors	ENST00000248072	ensembl	human	known	69_37n	silent	154	12.00	21	SNP	0.000	T
PEG3	5178	genome.wustl.edu	37	19	57328299	57328299	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr19:57328299C>T	ENST00000326441.9	-	10	1874	c.1511G>A	c.(1510-1512)cGt>cAt	p.R504H	ZIM2_ENST00000601070.1_Intron|PEG3_ENST00000598410.1_Missense_Mutation_p.R380H|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.R378H|ZIM2_ENST00000391708.3_Intron|ZIM2_ENST00000599935.1_Intron|PEG3_ENST00000423103.2_Missense_Mutation_p.R504H	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	504					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.R504H(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		ACATTCAAAACGTTTCCCTCC	0.438																																						dbGAP											2	Substitution - Missense(2)	pancreas(2)											206.0	198.0	201.0					19																	57328299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.1511G>A	19.37:g.57328299C>T	ENSP00000326581:p.Arg504His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R504H	ENST00000326441.9	37	c.1511	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	C	14.16	2.452334	0.43531	.	.	ENSG00000198300	ENST00000326441;ENST00000423103;ENST00000292074	T;T	0.28666	1.6;1.6	3.99	-0.496	0.12027	Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.641780	0.13942	N	0.352137	T	0.33118	0.0852	L	0.28694	0.88	.	.	.	D;D;D	0.89917	0.996;0.999;1.0	D;D;D	0.67382	0.927;0.926;0.951	T	0.39210	-0.9625	9	0.72032	D	0.01	-6.8667	3.4942	0.07649	0.1732:0.4338:0.0:0.393	.	380;504;439	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	H	504;504;474	ENSP00000326581:R504H;ENSP00000403051:R504H	ENSP00000292074:R474H	R	-	2	0	ZIM2	62020111	0.003000	0.15002	0.693000	0.30195	0.545000	0.35147	0.613000	0.24299	0.020000	0.15106	-0.781000	0.03364	CGT	PEG3	-	NULL	ENSG00000198300		0.438	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	156	0.00	0	C			57328299	57328299	-1	no_errors	ENST00000326441	ensembl	human	known	69_37n	missense	75	25.00	25	SNP	0.941	T
STARD8	9754	genome.wustl.edu	37	X	67935135	67935135	+	Splice_Site	SNP	G	G	C			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chrX:67935135G>C	ENST00000374597.3	+	3	248		c.e3-1		STARD8_ENST00000374599.3_Splice_Site|STARD8_ENST00000252336.6_Intron	NM_001142504.2	NP_001135976.1	Q92502	STAR8_HUMAN	StAR-related lipid transfer (START) domain containing 8						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(2)	50						CTGCCATACAGAAGGTTCGTT	0.557																																						dbGAP											0													91.0	68.0	75.0					X																	67935135		1568	3581	5149	-	-	-	SO:0001630	splice_region_variant	0			D80011	CCDS14390.1, CCDS48134.1	Xq13.1	2011-09-13	2007-08-16		ENSG00000130052	ENSG00000130052		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19161	protein-coding gene	gene with protein product		300689	"""START domain containing 8"""			8724849	Standard	NM_001142504		Approved	KIAA0189, ARHGAP38	uc004dxb.3	Q92502	OTTHUMG00000021748	ENST00000374597.3:c.-89-1G>C	X.37:g.67935135G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T2|D3DVT9|Q5JST0|Q68DG7	Splice_Site	SNP	-	e4-1	ENST00000374597.3	37	c.152-1	CCDS14390.1	X	.	.	.	.	.	.	.	.	.	.	G	17.96	3.515557	0.64634	.	.	ENSG00000130052	ENST00000374599	.	.	.	4.44	4.44	0.53790	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.5163	0.61543	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STARD8	67851860	1.000000	0.71417	0.999000	0.59377	0.357000	0.29423	3.303000	0.51858	2.049000	0.60858	0.600000	0.82982	.	STARD8	-	-	ENSG00000130052		0.557	STARD8-003	KNOWN	basic|CCDS	protein_coding	STARD8	HGNC	protein_coding	OTTHUMT00000057026.2	166	0.00	0	G	NM_014725	Intron	67935135	67935135	+1	no_errors	ENST00000374599	ensembl	human	known	69_37n	splice_site	87	10.31	10	SNP	1.000	C
TCEB3B	51224	genome.wustl.edu	37	18	44560939	44560939	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr18:44560939C>G	ENST00000332567.4	-	1	1049	c.697G>C	c.(697-699)Gaa>Caa	p.E233Q	KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron|KATNAL2_ENST00000245121.5_Intron	NM_016427.2	NP_057511.2	Q8IYF1	ELOA2_HUMAN	transcription elongation factor B polypeptide 3B (elongin A2)	233					regulation of DNA-templated transcription, elongation (GO:0032784)|transcription from RNA polymerase II promoter (GO:0006366)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|lung(24)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						GGGCGTTTTTCCTGGCGAGAC	0.617																																						dbGAP											0													42.0	43.0	43.0					18																	44560939		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036022	CCDS11932.1	18q21.1	2009-08-04			ENSG00000206181	ENSG00000206181			30771	protein-coding gene	gene with protein product	"""transcription elongation factor (SIII) elongin A2"", ""elongin A2"""	609522				7660129, 8244996	Standard	NM_016427		Approved	HsT832, TCEB3L	uc002lcr.1	Q8IYF1	OTTHUMG00000132649	ENST00000332567.4:c.697G>C	18.37:g.44560939C>G	ENSP00000331302:p.Glu233Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2V9	Missense_Mutation	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.E233Q	ENST00000332567.4	37	c.697	CCDS11932.1	18	.	.	.	.	.	.	.	.	.	.	C	9.769	1.172062	0.21704	.	.	ENSG00000206181	ENST00000332567	T	0.10960	2.82	1.95	1.95	0.26073	.	0.718773	0.11539	U	0.553972	T	0.05640	0.0148	L	0.27053	0.805	0.09310	N	1	P	0.45126	0.851	B	0.28991	0.097	T	0.32666	-0.9898	10	0.49607	T	0.09	0.0088	7.4064	0.26993	0.0:1.0:0.0:0.0	.	233	Q8IYF1	ELOA2_HUMAN	Q	233	ENSP00000331302:E233Q	ENSP00000331302:E233Q	E	-	1	0	TCEB3B	42814937	0.177000	0.23109	0.019000	0.16419	0.006000	0.05464	2.757000	0.47557	1.419000	0.47118	0.462000	0.41574	GAA	TCEB3B	-	NULL	ENSG00000206181		0.617	TCEB3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3B	HGNC	protein_coding	OTTHUMT00000255900.1	51	0.00	0	C	NM_016427		44560939	44560939	-1	no_errors	ENST00000332567	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	0.019	G
WDR11	55717	genome.wustl.edu	37	10	122618231	122618231	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr10:122618231A>G	ENST00000263461.6	+	3	521	c.275A>G	c.(274-276)aAt>aGt	p.N92S		NM_018117.11	NP_060587.8	Q8WWQ0	PHIP_HUMAN	WD repeat domain 11	488					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(9)|prostate(2)|skin(2)|stomach(5)	38						GCTGATGTCAATGGGAAGATC	0.463																																						dbGAP											0													197.0	161.0	173.0					10																	122618231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF320223	CCDS7619.1	10q26	2013-01-21	2010-01-06	2010-01-06	ENSG00000120008	ENSG00000120008		"""WD repeat domain containing"""	13831	protein-coding gene	gene with protein product		606417	"""bromodomain and WD repeat domain containing 2"""	BRWD2		10718198, 11536051	Standard	NM_018117		Approved	KIAA1351, FLJ10506, WDR15, HH14, DR11	uc021pzt.1	Q9BZH6	OTTHUMG00000019171	ENST00000263461.6:c.275A>G	10.37:g.122618231A>G	ENSP00000263461:p.Asn92Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.N92S	ENST00000263461.6	37	c.275	CCDS7619.1	10	.	.	.	.	.	.	.	.	.	.	A	2.592	-0.294995	0.05568	.	.	ENSG00000120008	ENST00000263461	T	0.29917	1.55	5.68	2.04	0.26737	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);	0.492508	0.24056	N	0.041954	T	0.07007	0.0178	N	0.00517	-1.405	0.22933	N	0.998546	B	0.02656	0.0	B	0.06405	0.002	T	0.38520	-0.9657	10	0.07813	T	0.8	-11.2782	7.6896	0.28561	0.3152:0.5451:0.1397:0.0	.	92	Q9BZH6	WDR11_HUMAN	S	92	ENSP00000263461:N92S	ENSP00000263461:N92S	N	+	2	0	WDR11	122608221	0.398000	0.25279	0.994000	0.49952	0.680000	0.39746	0.587000	0.23909	0.389000	0.25086	0.533000	0.62120	AAT	WDR11	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000120008		0.463	WDR11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	WDR11	HGNC	protein_coding	OTTHUMT00000050707.2	119	0.00	0	A			122618231	122618231	+1	no_errors	ENST00000263461	ensembl	human	known	69_37n	missense	52	34.18	27	SNP	0.998	G
XIRP1	165904	genome.wustl.edu	37	3	39229655	39229655	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr3:39229655C>T	ENST00000340369.3	-	2	1510	c.1282G>A	c.(1282-1284)Gcc>Acc	p.A428T	XIRP1_ENST00000396251.1_Missense_Mutation_p.A428T|XIRP1_ENST00000421646.1_Intron	NM_194293.2	NP_919269.2	Q702N8	XIRP1_HUMAN	xin actin-binding repeat containing 1	428					cardiac muscle cell development (GO:0055013)|negative regulation of cell proliferation (GO:0008285)|regulation of membrane potential (GO:0042391)|sarcomere organization (GO:0045214)	fascia adherens (GO:0005916)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(14)|lung(22)|ovary(4)|pancreas(1)|prostate(2)|skin(6)	71				KIRC - Kidney renal clear cell carcinoma(284;0.0517)|Kidney(284;0.065)		CTCTGGGGGGCACTCTGAGAG	0.557																																						dbGAP											0													145.0	155.0	152.0					3																	39229655		2203	4300	6503	-	-	-	SO:0001583	missense	0			AW755250	CCDS2683.1, CCDS56245.1	3p21.33	2008-02-05	2007-06-27	2007-06-27	ENSG00000168334	ENSG00000168334			14301	protein-coding gene	gene with protein product		609777	"""cardiomyopathy associated 1"""	CMYA1		12203715, 15454575	Standard	NM_001198621		Approved	DKFZp451D042, Xin	uc003cjk.2	Q702N8	OTTHUMG00000131297	ENST00000340369.3:c.1282G>A	3.37:g.39229655C>T	ENSP00000343140:p.Ala428Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP25|A4QPE2|Q68DF2|Q6ZTR3|Q702N9|Q8IVN7|Q8N1N3|Q8N904|Q8TCG7	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat	p.A428T	ENST00000340369.3	37	c.1282	CCDS2683.1	3	.	.	.	.	.	.	.	.	.	.	C	2.528	-0.309082	0.05458	.	.	ENSG00000168334	ENST00000396251;ENST00000340369	T;T	0.05199	3.48;3.87	4.64	1.65	0.23941	.	0.914721	0.09385	N	0.809382	T	0.07369	0.0186	L	0.60455	1.87	0.09310	N	1	B;B	0.22909	0.012;0.077	B;B	0.20767	0.01;0.031	T	0.39981	-0.9587	10	0.24483	T	0.36	.	6.2882	0.21045	0.0:0.5346:0.3652:0.1001	.	428;428	Q702N8;Q702N8-2	XIRP1_HUMAN;.	T	428	ENSP00000379550:A428T;ENSP00000343140:A428T	ENSP00000343140:A428T	A	-	1	0	XIRP1	39204659	0.001000	0.12720	0.476000	0.27291	0.728000	0.41692	1.081000	0.30791	0.683000	0.31428	0.655000	0.94253	GCC	XIRP1	-	NULL	ENSG00000168334		0.557	XIRP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	XIRP1	HGNC	protein_coding	OTTHUMT00000254065.1	55	0.00	0	C	XM_093522		39229655	39229655	-1	no_errors	ENST00000340369	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	0.000	T
ZSCAN5B	342933	genome.wustl.edu	37	19	56703240	56703240	+	Silent	SNP	G	G	A	rs571234303		TCGA-E9-A22D-01A-11D-A159-09	TCGA-E9-A22D-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	3dfdc7fd-3f69-4297-a4cf-1a05b75d302f	08d6a08e-ed54-49c7-a413-cc442771eb34	g.chr19:56703240G>A	ENST00000586855.2	-	3	880	c.567C>T	c.(565-567)gtC>gtT	p.V189V	ZSCAN5B_ENST00000358992.3_Silent_p.V189V			A6NJL1	ZSA5B_HUMAN	zinc finger and SCAN domain containing 5B	189					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			breast(1)|endometrium(5)|large_intestine(3)|lung(23)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						ACAGTGCAGCGACCCTGGGCA	0.617																																						dbGAP											0													35.0	35.0	35.0					19																	56703240		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS46203.1	19q13.42	2013-01-08			ENSG00000197213	ENSG00000197213		"""-"", ""Zinc fingers, C2H2-type"""	34246	protein-coding gene	gene with protein product							Standard	NM_001080456		Approved	ZNF495B, ZNF371	uc010ygh.2	A6NJL1		ENST00000586855.2:c.567C>T	19.37:g.56703240G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.V189	ENST00000586855.2	37	c.567	CCDS46203.1	19																																																																																			ZSCAN5B	-	NULL	ENSG00000197213		0.617	ZSCAN5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN5B	HGNC	protein_coding	OTTHUMT00000457834.2	42	0.00	0	G	NM_001080456		56703240	56703240	-1	no_errors	ENST00000358992	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	0.000	A
