#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC5	10057	genome.wustl.edu	37	3	183681187	183681187	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr3:183681187T>C	ENST00000334444.6	-	15	2461	c.2221A>G	c.(2221-2223)Acc>Gcc	p.T741A	ABCC5_ENST00000265586.6_Missense_Mutation_p.T741A	NM_005688.2	NP_005679.2	O15440	MRP5_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 5	741	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	62	all_cancers(143;1.85e-10)|Ovarian(172;0.0303)		Epithelial(37;1.74e-35)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Adefovir Dipivoxil(DB00718)|Alprostadil(DB00770)|Atorvastatin(DB01076)|Cisplatin(DB00515)|Dinoprostone(DB00917)|Dipyridamole(DB00975)|Fluorouracil(DB00544)|Glutathione(DB00143)|Mercaptopurine(DB01033)|Probenecid(DB01032)|Rifampicin(DB01045)|Sildenafil(DB00203)|Sulfinpyrazone(DB01138)|Zidovudine(DB00495)	AACTGGTGGGTAACAAACAGA	0.502																																						dbGAP											0													159.0	168.0	165.0					3																	183681187		1925	4119	6044	-	-	-	SO:0001583	missense	0			AF104942	CCDS33898.1, CCDS43176.1	3q27	2012-03-14			ENSG00000114770	ENSG00000114770		"""ATP binding cassette transporters / subfamily C"""	56	protein-coding gene	gene with protein product		605251				8894702, 9827529	Standard	XM_005247058		Approved	MRP5, SMRP, EST277145, MOAT-C	uc003fmg.3	O15440	OTTHUMG00000156871	ENST00000334444.6:c.2221A>G	3.37:g.183681187T>C	ENSP00000333926:p.Thr741Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ2|O14517|Q29ZA9|Q29ZB1|Q86UX3|Q86W30|Q9UN85|Q9UNP5|Q9UQC3	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.T741A	ENST00000334444.6	37	c.2221	CCDS43176.1	3	.	.	.	.	.	.	.	.	.	.	T	24.4	4.527884	0.85706	.	.	ENSG00000114770	ENST00000334444;ENST00000382495;ENST00000265586	T;T	0.69926	-0.44;-0.44	5.4	5.4	0.78164	ABC transporter, transmembrane domain, type 1 (1);ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	T	0.78266	0.4256	L	0.59436	1.845	0.80722	D	1	D;D	0.67145	0.991;0.996	D;D	0.66716	0.931;0.946	T	0.80779	-0.1230	10	0.87932	D	0	-25.1604	15.4129	0.74941	0.0:0.0:0.0:1.0	.	741;741	Q86UX3;O15440	.;MRP5_HUMAN	A	741;677;741	ENSP00000333926:T741A;ENSP00000265586:T741A	ENSP00000265586:T741A	T	-	1	0	ABCC5	185163881	1.000000	0.71417	0.999000	0.59377	0.900000	0.52787	7.682000	0.84083	2.052000	0.61016	0.533000	0.62120	ACC	ABCC5	-	superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000114770		0.502	ABCC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC5	HGNC	protein_coding	OTTHUMT00000346350.1	52	0.00	0	T	NM_005688		183681187	183681187	-1	no_errors	ENST00000334444	ensembl	human	known	69_37n	missense	43	30.16	19	SNP	1.000	C
ACVR1B	91	genome.wustl.edu	37	12	52374849	52374849	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr12:52374849G>A	ENST00000257963.4	+	4	754	c.677G>A	c.(676-678)tGg>tAg	p.W226*	ACVR1B_ENST00000415850.2_Nonsense_Mutation_p.W226*|ACVR1B_ENST00000541224.1_Nonsense_Mutation_p.W226*|ACVR1B_ENST00000426655.2_Nonsense_Mutation_p.W226*|ACVR1B_ENST00000542485.1_Nonsense_Mutation_p.W174*	NM_004302.4|NM_020328.3	NP_004293.1|NP_064733.3	P36896	ACV1B_HUMAN	activin A receptor, type IB	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|central nervous system development (GO:0007417)|development of primary female sexual characteristics (GO:0046545)|extrinsic apoptotic signaling pathway (GO:0097191)|G1/S transition of mitotic cell cycle (GO:0000082)|hair follicle development (GO:0001942)|in utero embryonic development (GO:0001701)|negative regulation of cell growth (GO:0030308)|nodal signaling pathway (GO:0038092)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of trophoblast cell migration (GO:1901165)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	activin receptor activity, type I (GO:0016361)|ATP binding (GO:0005524)|inhibin binding (GO:0034711)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|endometrium(4)|kidney(5)|large_intestine(12)|lung(10)|ovary(1)|pancreas(6)|prostate(1)	44				BRCA - Breast invasive adenocarcinoma(357;0.104)	Adenosine triphosphate(DB00171)	CGGGGCCGCTGGAGGGGTGGT	0.532											OREG0021829	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													63.0	67.0	66.0					12																	52374849		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS8816.1, CCDS44893.1, CCDS44894.1, CCDS44893.2, CCDS44894.2	12q13	2006-11-09			ENSG00000135503	ENSG00000135503			172	protein-coding gene	gene with protein product		601300		ACVRLK4		8397373	Standard	NM_020327		Approved	ALK4, SKR2, ActRIB	uc010snn.2	P36896	OTTHUMG00000167920	ENST00000257963.4:c.677G>A	12.37:g.52374849G>A	ENSP00000257963:p.Trp226*	Somatic	984	WXS	Illumina GAIIx	Phase_IV	B7Z5L8|B7Z5W5|Q15479|Q15480|Q15481|Q15482	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.W226*	ENST00000257963.4	37	c.677	CCDS8816.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.568410	0.96540	.	.	ENSG00000135503	ENST00000257963;ENST00000541224;ENST00000426655;ENST00000415850;ENST00000542485	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.9637	0.92687	0.0:0.0:1.0:0.0	.	.	.	.	X	226;226;226;226;174	.	ENSP00000257963:W226X	W	+	2	0	ACVR1B	50661116	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.563000	0.86464	0.650000	0.86243	TGG	ACVR1B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000135503		0.532	ACVR1B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1B	HGNC	protein_coding	OTTHUMT00000397000.1	43	0.00	0	G	NM_020328		52374849	52374849	+1	no_errors	ENST00000257963	ensembl	human	known	69_37n	nonsense	7	83.33	35	SNP	1.000	A
NDUFS8	4728	genome.wustl.edu	37	11	67795240	67795240	+	5'Flank	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr11:67795240C>A	ENST00000313468.5	+	0	0				ALDH3B1_ENST00000007633.8_Missense_Mutation_p.H412N|RP5-901A4.1_ENST00000532296.1_RNA|NDUFS8_ENST00000528492.1_5'Flank|ALDH3B1_ENST00000342456.6_Missense_Mutation_p.H376N|ALDH3B1_ENST00000434449.1_3'UTR|ALDH3B1_ENST00000316367.6_Intron|ALDH3B1_ENST00000539229.1_Missense_Mutation_p.H412N	NM_002496.3	NP_002487.1	O00217	NDUS8_HUMAN	NADH dehydrogenase (ubiquinone) Fe-S protein 8, 23kDa (NADH-coenzyme Q reductase)						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|mitochondrial respiratory chain complex I assembly (GO:0032981)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|metal ion binding (GO:0046872)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(1)|kidney(1)|lung(5)|skin(1)	8						GGGCCGGTACCATGGCAAGTT	0.647																																					Colon(116;1205 2770 20054)	dbGAP											0													64.0	71.0	69.0					11																	67795240		2147	4230	6377	-	-	-	SO:0001631	upstream_gene_variant	0			U65579	CCDS8176.1	11q13.2	2011-07-04	2002-08-29		ENSG00000110717	ENSG00000110717	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7715	protein-coding gene	gene with protein product	"""complex I 23kDa subunit"", ""NADH dehydrogenase [ubiquinone] iron-sulfur protein 8, mitochondrial"""	602141	"""NADH dehydrogenase (ubiquinone) Fe-S protein 8 (23kD) (NADH-coenzyme Q reductase)"""			9666055, 9116042	Standard	NM_002496		Approved	TYKY, CI-23k	uc001onc.3	O00217	OTTHUMG00000167331		11.37:g.67795240C>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB86|Q0VDA8	RNA	SNP	-	NULL	ENST00000313468.5	37	NULL	CCDS8176.1	11																																																																																			ALDH3B1	-	-	ENSG00000006534		0.647	NDUFS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH3B1	HGNC	protein_coding	OTTHUMT00000394193.1	33	0.00	0	C	NM_002496		67795240	67795240	+1	no_errors	ENST00000007633	ensembl	human	known	69_37n	rna	28	33.33	14	SNP	1.000	A
ANKRD30BL	554226	genome.wustl.edu	37	2	133015540	133015540	+	5'UTR	DEL	T	T	-	rs75269596		TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr2:133015540delT	ENST00000470729.1	-	0	2				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCACGCGTCATCTGCCCCAGC	0.692																																						dbGAP											0													28.0	32.0	31.0					2																	133015540		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1423A>-	2.37:g.133015540delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL7	RNA	DEL	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.692	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	22	0.00	0	T	NR_027019		133015540	133015540	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	13	14.29	3	DEL	0.001	-
APEX1	328	genome.wustl.edu	37	14	20924849	20924849	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr14:20924849delA	ENST00000216714.3	+	4	537	c.269delA	c.(268-270)gatfs	p.D90fs	APEX1_ENST00000557365.1_3'UTR|APEX1_ENST00000555414.1_Frame_Shift_Del_p.D90fs|OSGEP_ENST00000556252.1_5'Flank|APEX1_ENST00000557054.1_Intron|OSGEP_ENST00000206542.4_5'Flank|APEX1_ENST00000398030.4_Frame_Shift_Del_p.D90fs	NM_001244249.1|NM_001641.3	NP_001231178.1|NP_001632.2	P27695	APEX1_HUMAN	APEX nuclease (multifunctional DNA repair enzyme) 1	90					aging (GO:0007568)|base-excision repair (GO:0006284)|cell redox homeostasis (GO:0045454)|cellular response to cAMP (GO:0071320)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to peptide hormone stimulus (GO:0071375)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA demethylation (GO:0080111)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|negative regulation of smooth muscle cell migration (GO:0014912)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|oxidation-reduction process (GO:0055114)|positive regulation of DNA repair (GO:0045739)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribosome (GO:0005840)|transcription factor complex (GO:0005667)	3'-5' exonuclease activity (GO:0008408)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)|phosphodiesterase I activity (GO:0004528)|phosphoric diester hydrolase activity (GO:0008081)|poly(A) RNA binding (GO:0044822)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|uracil DNA N-glycosylase activity (GO:0004844)			breast(2)|endometrium(1)|large_intestine(4)|ovary(2)	9	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;1.09e-07)|all cancers(55;1.19e-06)	GBM - Glioblastoma multiforme(265;0.0224)|READ - Rectum adenocarcinoma(17;0.193)	Lucanthone(DB04967)	GAAGCCCCAGATATACTGTGC	0.408								Other BER factors																														dbGAP											0													69.0	73.0	72.0					14																	20924849		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X59764	CCDS9550.1	14q11.2	2008-02-05	2002-09-11	2002-09-13	ENSG00000100823	ENSG00000100823	4.2.99.18		587	protein-coding gene	gene with protein product		107748	"""APEX nuclease (multifunctional DNA repair enzyme)"""	APEX			Standard	NM_001641		Approved	APE, REF1, HAP1, APX, APEN, REF-1, APE-1	uc021rnr.1	P27695	OTTHUMG00000029544	ENST00000216714.3:c.269delA	14.37:g.20924849delA	ENSP00000216714:p.Asp90fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q969L5|Q99775	Frame_Shift_Del	DEL	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	p.D90fs	ENST00000216714.3	37	c.269	CCDS9550.1	14																																																																																			APEX1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	ENSG00000100823		0.408	APEX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX1	HGNC	protein_coding	OTTHUMT00000073641.3	29	0.00	0	A	NM_001641		20924849	20924849	+1	no_errors	ENST00000216714	ensembl	human	known	69_37n	frame_shift_del	12	14.29	2	DEL	1.000	-
APLF	200558	genome.wustl.edu	37	2	68717336	68717336	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr2:68717336A>C	ENST00000303795.4	+	2	282	c.111A>C	c.(109-111)agA>agC	p.R37S		NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	37	FHA-like.				cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						CAGACAAGAGAGTATCCAGAA	0.358																																						dbGAP											0													74.0	76.0	75.0					2																	68717336		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.111A>C	2.37:g.68717336A>C	ENSP00000307004:p.Arg37Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	pfam_Znf_C2H2_APLF-like,superfamily_SMAD_FHA_domain	p.R37S	ENST00000303795.4	37	c.111	CCDS1888.1	2	.	.	.	.	.	.	.	.	.	.	A	20.7	4.037002	0.75617	.	.	ENSG00000169621	ENST00000303795	T	0.24151	1.87	5.93	4.78	0.61160	Forkhead-associated (FHA) domain (1);SMAD/FHA domain (1);	0.048785	0.85682	D	0.000000	T	0.39784	0.1091	M	0.79926	2.475	0.36658	D	0.877807	D	0.59767	0.986	P	0.50970	0.655	T	0.53968	-0.8363	10	0.87932	D	0	.	8.681	0.34209	0.9145:0.0:0.0855:0.0	.	37	Q8IW19	APLF_HUMAN	S	37	ENSP00000307004:R37S	ENSP00000307004:R37S	R	+	3	2	APLF	68570840	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.554000	0.60760	1.075000	0.40932	0.533000	0.62120	AGA	APLF	-	superfamily_SMAD_FHA_domain	ENSG00000169621		0.358	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APLF	HGNC	protein_coding	OTTHUMT00000251759.1	65	0.00	0	A	NM_173545		68717336	68717336	+1	no_errors	ENST00000303795	ensembl	human	known	69_37n	missense	74	35.65	41	SNP	1.000	C
LVRN	206338	genome.wustl.edu	37	5	115346461	115346461	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr5:115346461C>G	ENST00000357872.4	+	14	2241	c.2117C>G	c.(2116-2118)aCa>aGa	p.T706R		NM_173800.4	NP_776161.3	Q6Q4G3	AMPQ_HUMAN		706						integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)										GAGATTGAAACAGCACTTGAG	0.348																																						dbGAP											0													122.0	121.0	121.0					5																	115346461		2201	4300	6501	-	-	-	SO:0001583	missense	0																														ENST00000357872.4:c.2117C>G	5.37:g.115346461C>G	ENSP00000350541:p.Thr706Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J0|C9JGD2|Q32MR1|Q4G0I9|Q4G0V2|Q86XA3|Q8NBZ2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.T706R	ENST00000357872.4	37	c.2117	CCDS4124.1	5	.	.	.	.	.	.	.	.	.	.	C	19.85	3.904108	0.72754	.	.	ENSG00000172901	ENST00000357872;ENST00000379578	T	0.05382	3.45	6.03	6.03	0.97812	.	0.216187	0.36338	N	0.002654	T	0.21590	0.0520	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	D	0.75020	0.985	T	0.00986	-1.1490	10	0.19147	T	0.46	.	19.3283	0.94273	0.0:1.0:0.0:0.0	.	706	Q6Q4G3	AMPQ_HUMAN	R	706;695	ENSP00000350541:T706R	ENSP00000350541:T706R	T	+	2	0	AC010282.1	115374360	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.242000	0.51384	2.861000	0.98227	0.655000	0.94253	ACA	LVRN	-	NULL	ENSG00000172901		0.348	AQPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQPEP	Clone_based_vega_gene	protein_coding	OTTHUMT00000250852.1	71	0.00	0	C			115346461	115346461	+1	no_errors	ENST00000357872	ensembl	human	known	69_37n	missense	7	87.93	51	SNP	1.000	G
ATP6V1E1	529	genome.wustl.edu	37	22	18077351	18077351	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr22:18077351G>A	ENST00000253413.5	-	8	744	c.562C>T	c.(562-564)Cgt>Tgt	p.R188C	ATP6V1E1_ENST00000399798.2_Missense_Mutation_p.R166C|ATP6V1E1_ENST00000399796.2_Missense_Mutation_p.R158C	NM_001696.3	NP_001687.1	P36543	VATE1_HUMAN	ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E1	188					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|mitochondrion (GO:0005739)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting two-sector ATPase complex, catalytic domain (GO:0033178)	ATPase binding (GO:0051117)|hydrogen-exporting ATPase activity, phosphorylative mechanism (GO:0008553)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|urinary_tract(1)	10		all_epithelial(15;0.206)		Lung(27;0.19)		TTTATTTTACGATCTCCATTA	0.423																																						dbGAP											0													56.0	50.0	52.0					22																	18077351		2203	4299	6502	-	-	-	SO:0001583	missense	0			X76228	CCDS13745.1, CCDS42977.1, CCDS42978.1	22q11.2	2010-04-21	2006-01-13	2002-06-21	ENSG00000131100	ENSG00000131100	3.6.3.14	"""ATPases / V-type"""	857	protein-coding gene	gene with protein product		108746	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) 31kD"", ""ATPase, H+ transporting, lysosomal 31kDa, V1 subunit E isoform 1"""	ATP6E, ATP6V1E		8004105, 8250920	Standard	NM_001696		Approved	P31, Vma4, ATP6E2	uc002zmr.1	P36543	OTTHUMG00000059320	ENST00000253413.5:c.562C>T	22.37:g.18077351G>A	ENSP00000253413:p.Arg188Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUE4|A8MUN4	Missense_Mutation	SNP	pfam_ATPase_V1/A1-cplx_esu	p.R188C	ENST00000253413.5	37	c.562	CCDS13745.1	22	.	.	.	.	.	.	.	.	.	.	G	13.83	2.352887	0.41700	.	.	ENSG00000131100	ENST00000253413;ENST00000399796;ENST00000399798;ENST00000413576	.	.	.	3.94	-1.0	0.10196	.	0.054253	0.64402	D	0.000001	T	0.31358	0.0794	L	0.31752	0.955	0.40705	D	0.982514	B;B;B	0.14438	0.001;0.004;0.01	B;B;B	0.18561	0.008;0.009;0.022	T	0.09773	-1.0659	9	0.87932	D	0	1.2328	1.5464	0.02566	0.2079:0.3114:0.3419:0.1388	.	166;158;188	A8MUE4;A8MUN4;P36543	.;.;VATE1_HUMAN	C	188;158;166;189	.	ENSP00000253413:R188C	R	-	1	0	ATP6V1E1	16457351	1.000000	0.71417	0.703000	0.30354	0.985000	0.73830	2.929000	0.48916	0.091000	0.17302	-0.142000	0.14014	CGT	ATP6V1E1	-	pfam_ATPase_V1/A1-cplx_esu	ENSG00000131100		0.423	ATP6V1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1E1	HGNC	protein_coding	OTTHUMT00000131790.3	31	0.00	0	G	NM_001696		18077351	18077351	-1	no_errors	ENST00000253413	ensembl	human	known	69_37n	missense	34	43.33	26	SNP	0.984	A
BAIAP3	8938	genome.wustl.edu	37	16	1395871	1395871	+	Silent	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr16:1395871C>T	ENST00000324385.5	+	23	2451	c.2293C>T	c.(2293-2295)Ctg>Ttg	p.L765L	BAIAP3_ENST00000426824.3_Silent_p.L730L|BAIAP3_ENST00000421665.2_Silent_p.L694L|BAIAP3_ENST00000397489.1_Silent_p.L747L|BAIAP3_ENST00000568887.1_Silent_p.L702L|BAIAP3_ENST00000397488.2_Silent_p.L747L|BAIAP3_ENST00000562208.1_Silent_p.L707L	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	765	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				GGCTCAGGGGCTGGGCACCCA	0.706																																						dbGAP											0													11.0	14.0	13.0					16																	1395871		2175	4277	6452	-	-	-	SO:0001819	synonymous_variant	0			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.2293C>T	16.37:g.1395871C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Silent	SNP	pfam_C2_Ca-dep,pfam_Munc13_subgr_dom-2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L765	ENST00000324385.5	37	c.2293	CCDS10434.1	16																																																																																			BAIAP3	-	NULL	ENSG00000007516		0.706	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	HGNC	protein_coding	OTTHUMT00000109056.3	10	0.00	0	C			1395871	1395871	+1	no_errors	ENST00000324385	ensembl	human	known	69_37n	silent	0	100.00	7	SNP	0.724	T
BCL6B	255877	genome.wustl.edu	37	17	6928049	6928050	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr17:6928049_6928050delGT	ENST00000293805.5	+	4	823_824	c.731_732delGT	c.(730-732)agtfs	p.S244fs		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	244	Ser-rich.			S -> SS (in Ref. 1; BAC00962/BAC00963 and 3; AAH59404). {ECO:0000305}.	negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						agcagcagcagTGAAGAAGGAC	0.584																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.731_732delGT	17.37:g.6928049_6928050delGT	ENSP00000293805:p.Ser244fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PCB4	Frame_Shift_Del	DEL	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S244fs	ENST00000293805.5	37	c.731_732	CCDS42248.1	17																																																																																			BCL6B	-	NULL	ENSG00000161940		0.584	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6B	HGNC	protein_coding	OTTHUMT00000439455.2	11	0.00	0	GT	NM_181844		6928049	6928050	+1	no_errors	ENST00000293805	ensembl	human	known	69_37n	frame_shift_del	7	36.36	4	DEL	0.972:0.064	-
MROH9	80133	genome.wustl.edu	37	1	170959084	170959084	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:170959084C>A	ENST00000367758.3	+	11	1067	c.968C>A	c.(967-969)aCa>aAa	p.T323K	MROH9_ENST00000367759.4_Missense_Mutation_p.T323K	NM_025063.2	NP_079339.2	Q5TGP6	MROH9_HUMAN	maestro heat-like repeat family member 9	323																	ACTTTGTTGACATGCACTTCA	0.458																																						dbGAP											0													145.0	139.0	141.0					1																	170959084		1944	4144	6088	-	-	-	SO:0001583	missense	0			AK027203	CCDS41436.1, CCDS53429.1	1q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000117501	ENSG00000117501		"""maestro heat-like repeat containing"""	26287	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 129"""	C1orf129			Standard	NM_025063		Approved	FLJ23550, ARMC11	uc010plz.2	Q5TGP6	OTTHUMG00000041456	ENST00000367758.3:c.968C>A	1.37:g.170959084C>A	ENSP00000356732:p.Thr323Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJM0|A0PJM2|F5GWX6|Q9H5D7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.T323K	ENST00000367758.3	37	c.968	CCDS41436.1	1	.	.	.	.	.	.	.	.	.	.	C	15.29	2.790947	0.50102	.	.	ENSG00000117501	ENST00000367759;ENST00000367758	T;T	0.30448	3.99;1.53	5.18	3.29	0.37713	Armadillo-like helical (1);	0.395551	0.24649	N	0.036731	T	0.30262	0.0759	L	0.60455	1.87	0.09310	N	1	D;D	0.76494	0.999;0.998	D;D	0.66351	0.93;0.943	T	0.04976	-1.0914	10	0.62326	D	0.03	-6.3771	7.1863	0.25801	0.0:0.8015:0.0:0.1985	.	323;323	F5GWX6;Q5TGP6	.;CA129_HUMAN	K	323	ENSP00000356733:T323K;ENSP00000356732:T323K	ENSP00000356732:T323K	T	+	2	0	C1orf129	169225708	0.014000	0.17966	0.003000	0.11579	0.038000	0.13279	0.878000	0.28126	1.169000	0.42739	0.467000	0.42956	ACA	C1orf129	-	superfamily_ARM-type_fold	ENSG00000117501		0.458	MROH9-001	KNOWN	basic|CCDS	protein_coding	C1orf129	HGNC	protein_coding	OTTHUMT00000099327.1	58	0.00	0	C	NM_025063		170959084	170959084	+1	no_errors	ENST00000367759	ensembl	human	known	69_37n	missense	70	26.80	26	SNP	0.002	A
C6orf165	154313	genome.wustl.edu	37	6	88144769	88144769	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr6:88144769C>A	ENST00000507897.1	+	11	1575	c.1492C>A	c.(1492-1494)Cag>Aag	p.Q498K	C6ORF165_ENST00000369562.4_Missense_Mutation_p.Q498K			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	498										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		TCCATATTCTCAGGTAAGCAG	0.284																																						dbGAP											0													66.0	71.0	69.0					6																	88144769		2202	4297	6499	-	-	-	SO:0001583	missense	0			BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.1492C>A	6.37:g.88144769C>A	ENSP00000426769:p.Gln498Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K969|E1P507|Q8N9U4	Missense_Mutation	SNP	pfam_DUF3508	p.Q498K	ENST00000507897.1	37	c.1492	CCDS34498.1	6	.	.	.	.	.	.	.	.	.	.	C	9.312	1.055905	0.19907	.	.	ENSG00000213204	ENST00000369562	T	0.32023	1.47	5.34	3.42	0.39159	.	0.186994	0.47093	D	0.000244	T	0.10937	0.0267	L	0.36672	1.1	0.35978	D	0.835808	B	0.10296	0.003	B	0.14023	0.01	T	0.05937	-1.0855	10	0.29301	T	0.29	.	11.4077	0.49908	0.1418:0.7215:0.1367:0.0	.	498	Q8IYR0	CF165_HUMAN	K	498	ENSP00000358575:Q498K	ENSP00000358575:Q498K	Q	+	1	0	C6orf165	88201488	0.999000	0.42202	1.000000	0.80357	0.437000	0.31866	1.835000	0.39181	1.206000	0.43276	0.491000	0.48974	CAG	C6orf165	-	NULL	ENSG00000213204		0.284	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	HGNC	protein_coding	OTTHUMT00000470406.1	57	0.00	0	C	NM_178823		88144769	88144769	+1	no_errors	ENST00000369562	ensembl	human	known	69_37n	missense	40	52.38	44	SNP	1.000	A
CASR	846	genome.wustl.edu	37	3	122002995	122002995	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr3:122002995A>G	ENST00000490131.1	+	7	2566	c.2194A>G	c.(2194-2196)Acc>Gcc	p.T732A	AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000296154.5_Missense_Mutation_p.T732A|CASR_ENST00000498619.1_Missense_Mutation_p.T742A	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	732					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	TTTCCTCTGCACCTTCATGCA	0.567																																						dbGAP											0													56.0	52.0	53.0					3																	122002995		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2194A>G	3.37:g.122002995A>G	ENSP00000418685:p.Thr732Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.T742A	ENST00000490131.1	37	c.2224	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	A	16.51	3.143119	0.57044	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.88277	-2.36;-2.36;-2.36	6.04	6.04	0.98038	GPCR, family 3, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.93579	0.7950	M	0.86573	2.825	0.80722	D	1	P;P	0.47106	0.89;0.78	P;B	0.53035	0.716;0.334	D	0.93942	0.7224	10	0.54805	T	0.06	.	15.7575	0.78046	1.0:0.0:0.0:0.0	.	742;732	E7ENE0;P41180	.;CASR_HUMAN	A	732;742;732	ENSP00000418685:T732A;ENSP00000420194:T742A;ENSP00000296154:T732A	ENSP00000296154:T732A	T	+	1	0	CASR	123485685	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.339000	0.96797	2.317000	0.78254	0.459000	0.35465	ACC	CASR	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000036828		0.567	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	14	0.00	0	A	NM_000388		122002995	122002995	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	2	80.00	8	SNP	1.000	G
DDB1	1642	genome.wustl.edu	37	11	61071447	61071447	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr11:61071447T>G	ENST00000301764.7	-	22	3119	c.2722A>C	c.(2722-2724)Aac>Cac	p.N908H	DDB1_ENST00000538470.1_5'Flank|DDB1_ENST00000450997.2_Missense_Mutation_p.N219H|DDB1_ENST00000451943.2_5'Flank	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	908	Interaction with CDT1 and CUL4A.|WD repeat beta-propeller C.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						GCCATGATGTTGTTGTAGTGG	0.562								Nucleotide excision repair (NER)																														dbGAP											0													198.0	192.0	194.0					11																	61071447		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.2722A>C	11.37:g.61071447T>G	ENSP00000301764:p.Asn908His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Missense_Mutation	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.N908H	ENST00000301764.7	37	c.2722	CCDS31576.1	11	.	.	.	.	.	.	.	.	.	.	T	10.74	1.435468	0.25813	.	.	ENSG00000167986	ENST00000301764;ENST00000450997;ENST00000539332	T;T;T	0.43688	0.94;0.94;0.94	5.92	5.92	0.95590	WD40/YVTN repeat-like-containing domain (1);Cleavage/polyadenylation specificity factor, A subunit, C-terminal (1);	0.043426	0.85682	D	0.000000	T	0.27933	0.0688	N	0.20304	0.555	0.80722	D	1	B;B	0.31705	0.336;0.082	B;B	0.29267	0.1;0.061	T	0.10019	-1.0648	10	0.10636	T	0.68	-32.0629	16.3634	0.83296	0.0:0.0:0.0:1.0	.	219;908	B4DG00;Q16531	.;DDB1_HUMAN	H	908;219;74	ENSP00000301764:N908H;ENSP00000388705:N219H;ENSP00000439787:N74H	ENSP00000301764:N908H	N	-	1	0	DDB1	60828023	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.270000	0.75569	0.459000	0.35465	AAC	DDB1	-	pfam_Cleavage/polyA-sp_fac_asu_C	ENSG00000167986		0.562	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DDB1	HGNC	protein_coding	OTTHUMT00000398816.1	75	0.00	0	T	NM_001923		61071447	61071447	-1	no_errors	ENST00000301764	ensembl	human	known	69_37n	missense	58	37.63	35	SNP	1.000	G
DDX41	51428	genome.wustl.edu	37	5	176939348	176939348	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr5:176939348delG	ENST00000507955.1	-	15	2119	c.1596delC	c.(1594-1596)gccfs	p.A532fs	DOK3_ENST00000377112.4_5'Flank|DOK3_ENST00000357198.4_5'Flank|DOK3_ENST00000312943.6_5'Flank|DOK3_ENST00000501403.2_5'Flank|DDX41_ENST00000506965.1_5'Flank	NM_016222.2	NP_057306.2	Q9UJV9	DDX41_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 41	532	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				apoptotic process (GO:0006915)|cellular response to interferon-beta (GO:0035458)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)|RNA processing (GO:0006396)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)					all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TGAAGGTAGTGGCGATGCCTG	0.617																																						dbGAP											0													124.0	113.0	117.0					5																	176939348		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF195417	CCDS4427.1	5q35.3	2008-02-05			ENSG00000183258	ENSG00000183258		"""DEAD-boxes"""	18674	protein-coding gene	gene with protein product		608170				10607561	Standard	NM_016222		Approved	ABS, MGC8828	uc003mho.3	Q9UJV9	OTTHUMG00000130858	ENST00000507955.1:c.1596delC	5.37:g.176939348delG	ENSP00000422753:p.Ala532fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDC8|Q96BK6|Q96K05|Q9NT96|Q9NW04	Frame_Shift_Del	DEL	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_Znf_CCHC,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.T533fs	ENST00000507955.1	37	c.1596	CCDS4427.1	5																																																																																			DDX41	-	pfscan_Helicase_C	ENSG00000183258		0.617	DDX41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX41	HGNC	protein_coding	OTTHUMT00000253432.2	49	0.00	0	G	NM_016222		176939348	176939348	-1	no_errors	ENST00000507955	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	0.987	-
DLX6	1750	genome.wustl.edu	37	7	96639203	96639203	+	Silent	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr7:96639203G>A	ENST00000518156.2	+	3	1156	c.726G>A	c.(724-726)gcG>gcA	p.A242A	DLX6-AS1_ENST00000437541.1_RNA|DLX6_ENST00000007660.5_Silent_p.A214A|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000430027.3_RNA|DLX6_ENST00000493273.2_3'UTR|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS1_ENST00000452769.2_RNA|DLX6_ENST00000555308.1_Silent_p.A114A|DLX6-AS1_ENST00000437331.2_RNA|DLX6-AS2_ENST00000606174.1_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	124					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					AGGGCTCGGCGGCCCTGTCGC	0.577																																						dbGAP											0													38.0	42.0	41.0					7																	96639203		2138	4261	6399	-	-	-	SO:0001819	synonymous_variant	0				CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.726G>A	7.37:g.96639203G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa,pfscan_Homeodomain	p.A242	ENST00000518156.2	37	c.726	CCDS47647.2	7																																																																																			DLX6	-	NULL	ENSG00000006377		0.577	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLX6	HGNC	protein_coding	OTTHUMT00000334373.4	29	0.00	0	G	NM_005222		96639203	96639203	+1	no_errors	ENST00000518156	ensembl	human	known	69_37n	silent	17	41.38	12	SNP	0.800	A
DNAH14	127602	genome.wustl.edu	37	1	225546213	225546213	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:225546213C>G	ENST00000445597.2	+	53	9064	c.9064C>G	c.(9064-9066)Cca>Gca	p.P3022A	DNAH14_ENST00000430092.1_Missense_Mutation_p.P3786A|DNAH14_ENST00000439375.2_Missense_Mutation_p.P3786A			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	3022					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						AGTTCTTAGACCAGAAAGTTT	0.289																																						dbGAP											0													43.0	37.0	39.0					1																	225546213		692	1590	2282	-	-	-	SO:0001583	missense	0			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.9064C>G	1.37:g.225546213C>G	ENSP00000409472:p.Pro3022Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.P3786A	ENST00000445597.2	37	c.11356		1	.	.	.	.	.	.	.	.	.	.	C	10.52	1.374264	0.24857	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375	T;T;T	0.09073	3.02;3.02;3.02	5.4	4.48	0.54585	.	.	.	.	.	T	0.24236	0.0587	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	T	0.00153	-1.1982	8	0.49607	T	0.09	.	10.7102	0.45980	0.0:0.8481:0.0:0.1519	.	3786	Q0VDD8-4	.	A	3022;3786;3786	ENSP00000409472:P3022A;ENSP00000414402:P3786A;ENSP00000392061:P3786A	ENSP00000414402:P3786A	P	+	1	0	DNAH14	223612836	0.980000	0.34600	0.894000	0.35097	0.343000	0.28985	2.465000	0.45075	2.518000	0.84900	0.603000	0.83216	CCA	DNAH14	-	pfam_Dynein_heavy	ENSG00000185842		0.289	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	31	0.00	0	C	XM_059166		225546213	225546213	+1	no_errors	ENST00000430092	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	0.920	G
ECEL1	9427	genome.wustl.edu	37	2	233345461	233345461	+	Silent	SNP	T	T	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr2:233345461T>A	ENST00000304546.1	-	16	2328	c.2118A>T	c.(2116-2118)acA>acT	p.T706T	ECEL1_ENST00000409941.1_Silent_p.T704T	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	706					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GCTGGTCATGTGTGTACTTGA	0.637																																						dbGAP											0													84.0	84.0	84.0					2																	233345461		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.2118A>T	2.37:g.233345461T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Silent	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.T706	ENST00000304546.1	37	c.2118	CCDS2493.1	2																																																																																			ECEL1	-	pfam_Peptidase_M13_C	ENSG00000171551		0.637	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECEL1	HGNC	protein_coding	OTTHUMT00000257039.2	27	0.00	0	T	NM_004826		233345461	233345461	-1	no_errors	ENST00000304546	ensembl	human	known	69_37n	silent	2	90.91	20	SNP	0.015	A
EPHX2	2053	genome.wustl.edu	37	8	27369412	27369412	+	Silent	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr8:27369412G>C	ENST00000521400.1	+	6	1150	c.720G>C	c.(718-720)ggG>ggC	p.G240G	EPHX2_ENST00000380476.3_Silent_p.G187G|EPHX2_ENST00000518379.1_Silent_p.G240G|EPHX2_ENST00000521780.1_Silent_p.G174G|EPHX2_ENST00000517536.1_Intron	NM_001979.5	NP_001970.2	P34913	HYES_HUMAN	epoxide hydrolase 2, cytoplasmic	240	Epoxide hydrolase.				arachidonic acid metabolic process (GO:0019369)|cellular calcium ion homeostasis (GO:0006874)|cholesterol homeostasis (GO:0042632)|dephosphorylation (GO:0016311)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|inflammatory response (GO:0006954)|phospholipid dephosphorylation (GO:0046839)|positive regulation of gene expression (GO:0010628)|positive regulation of vasodilation (GO:0045909)|reactive oxygen species metabolic process (GO:0072593)|regulation of blood pressure (GO:0008217)|regulation of cholesterol metabolic process (GO:0090181)|response to toxic substance (GO:0009636)|small molecule metabolic process (GO:0044281)|stilbene catabolic process (GO:0046272)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	10-hydroxy-9-(phosphonooxy)octadecanoate phosphatase activity (GO:0033885)|epoxide hydrolase activity (GO:0004301)|lipid phosphatase activity (GO:0042577)|magnesium ion binding (GO:0000287)|phosphatase activity (GO:0016791)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxic substance binding (GO:0015643)			cervix(1)|endometrium(8)|kidney(1)|large_intestine(1)|lung(8)|ovary(1)|skin(5)|stomach(1)|urinary_tract(1)	27		Ovarian(32;2.61e-05)|all_epithelial(46;0.207)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0226)|Epithelial(17;1.12e-09)|Colorectal(74;0.157)		TGAGCCATGGGTACGTGACAG	0.537																																						dbGAP											0													227.0	198.0	208.0					8																	27369412		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L05779	CCDS6060.1, CCDS59097.1, CCDS59098.1	8p21	2010-04-23			ENSG00000120915	ENSG00000120915	3.3.2.10		3402	protein-coding gene	gene with protein product		132811					Standard	NM_001979		Approved		uc003xfu.4	P34913	OTTHUMG00000102115	ENST00000521400.1:c.720G>C	8.37:g.27369412G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2Z3B1|B3KTU8|B3KUA0|G3V134|J3KPH7|Q16764|Q9HBJ1|Q9HBJ2	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,prints_Haloacid_DH/epoxide_hydro,prints_Epox_hydrolase-like,prints_AB_hydrolase_1	p.G199A	ENST00000521400.1	37	c.596	CCDS6060.1	8	.	.	.	.	.	.	.	.	.	.	G	5.777	0.327644	0.10956	.	.	ENSG00000120915	ENST00000521684	T	0.03801	3.8	4.76	-6.99	0.01605	.	0.099394	0.64402	D	0.000001	T	0.02455	0.0075	.	.	.	0.27767	N	0.943631	.	.	.	.	.	.	T	0.32851	-0.9891	7	0.25751	T	0.34	0.2247	2.4324	0.04475	0.399:0.3294:0.1605:0.111	.	.	.	.	A	199	ENSP00000428191:G199A	ENSP00000428191:G199A	G	+	2	0	EPHX2	27425329	0.002000	0.14202	0.074000	0.20217	0.181000	0.23173	-2.657000	0.00853	-1.486000	0.01851	-0.305000	0.09177	GGT	EPHX2	-	NULL	ENSG00000120915		0.537	EPHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX2	HGNC	protein_coding	OTTHUMT00000219954.4	77	0.00	0	G			27369412	27369412	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000521684	ensembl	human	putative	69_37n	missense	64	32.63	31	SNP	0.125	C
EPS8	2059	genome.wustl.edu	37	12	15803878	15803878	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr12:15803878T>A	ENST00000281172.5	-	14	1749	c.1313A>T	c.(1312-1314)gAg>gTg	p.E438V	EPS8_ENST00000543612.1_Missense_Mutation_p.E438V|EPS8_ENST00000540613.1_Missense_Mutation_p.E178V|EPS8_ENST00000543523.1_Missense_Mutation_p.E438V|EPS8_ENST00000542903.1_Missense_Mutation_p.E178V	NM_004447.5	NP_004438.3	Q12929	EPS8_HUMAN	epidermal growth factor receptor pathway substrate 8	438	Pro-rich.				actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|actin filament bundle assembly (GO:0051017)|actin polymerization-dependent cell motility (GO:0070358)|adult locomotory behavior (GO:0008344)|barbed-end actin filament capping (GO:0051016)|behavioral response to ethanol (GO:0048149)|cell proliferation (GO:0008283)|dendritic cell migration (GO:0036336)|epidermal growth factor receptor signaling pathway (GO:0007173)|exit from mitosis (GO:0010458)|positive regulation of signal transduction (GO:0009967)|Rac protein signal transduction (GO:0016601)|regulation of actin filament length (GO:0030832)|regulation of cell shape (GO:0008360)|signal transduction (GO:0007165)	cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|ruffle membrane (GO:0032587)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actin binding (GO:0003779)|Rac GTPase binding (GO:0048365)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33		all_epithelial(100;1.87e-05)|Breast(259;0.000286)|Hepatocellular(102;0.244)		BRCA - Breast invasive adenocarcinoma(232;4.29e-05)|GBM - Glioblastoma multiforme(207;0.0264)		CATTGGGGGCTCCCAGCCATT	0.448																																						dbGAP											0													123.0	120.0	121.0					12																	15803878		2203	4300	6503	-	-	-	SO:0001583	missense	0			U12535	CCDS31753.1	12p12.3	2008-05-02				ENSG00000151491			3420	protein-coding gene	gene with protein product		600206				8084614	Standard	NM_004447		Approved		uc001rdb.3	Q12929		ENST00000281172.5:c.1313A>T	12.37:g.15803878T>A	ENSP00000281172:p.Glu438Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMC3|A8K6W2|A8KA66|B4DX66|Q8N6J0	Missense_Mutation	SNP	pfam_PTB,pfam_SH3_domain,pfam_PTyr_interaction_dom,pfam_SH3_2,superfamily_SH3_domain,superfamily_SAM/pointed,smart_PTyr_interaction_dom,smart_SH3_domain,pfscan_SH3_domain	p.E438V	ENST00000281172.5	37	c.1313	CCDS31753.1	12	.	.	.	.	.	.	.	.	.	.	T	24.5	4.533261	0.85812	.	.	ENSG00000151491	ENST00000543523;ENST00000281172;ENST00000543612;ENST00000540613;ENST00000542903;ENST00000543223	T;T;T;T;T	0.08546	3.19;3.19;3.19;3.08;3.08	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.17577	0.0422	M	0.68593	2.085	0.58432	D	0.999999	P	0.38420	0.63	P	0.44732	0.459	T	0.00514	-1.1695	10	0.49607	T	0.09	-22.9196	15.6327	0.76923	0.0:0.0:0.0:1.0	.	438	Q12929	EPS8_HUMAN	V	438;438;438;178;178;438	ENSP00000441867:E438V;ENSP00000281172:E438V;ENSP00000442388:E438V;ENSP00000441888:E178V;ENSP00000437806:E178V	ENSP00000281172:E438V	E	-	2	0	EPS8	15695145	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.494000	0.81503	2.085000	0.62840	0.528000	0.53228	GAG	EPS8	-	NULL	ENSG00000151491		0.448	EPS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS8	HGNC	protein_coding	OTTHUMT00000401093.1	82	0.00	0	T			15803878	15803878	-1	no_errors	ENST00000281172	ensembl	human	known	69_37n	missense	129	27.93	50	SNP	1.000	A
ERCC6	2074	genome.wustl.edu	37	10	50681587	50681587	+	Missense_Mutation	SNP	T	T	G	rs116431130		TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr10:50681587T>G	ENST00000355832.5	-	14	2723	c.2645A>C	c.(2644-2646)tAt>tCt	p.Y882S	RP11-123B3.2_ENST00000423283.1_RNA|ERCC6_ENST00000542458.1_Missense_Mutation_p.Y252S	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	882	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CATCTTGAGATAGGTATACTT	0.433								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													351.0	282.0	305.0					10																	50681587		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.2645A>C	10.37:g.50681587T>G	ENSP00000348089:p.Tyr882Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Y882S	ENST00000355832.5	37	c.2645	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	T	29.7	5.027073	0.93518	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	T;T	0.76060	-0.99;-0.99	5.69	5.69	0.88448	Helicase, C-terminal (3);	.	.	.	.	D	0.89403	0.6705	M	0.92784	3.345	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.995	D	0.91935	0.5558	9	0.87932	D	0	-24.1668	15.9482	0.79809	0.0:0.0:0.0:1.0	.	882;259	Q03468;Q59FF6	ERCC6_HUMAN;.	S	882;259;252	ENSP00000348089:Y882S;ENSP00000445134:Y252S	ENSP00000348089:Y882S	Y	-	2	0	ERCC6	50351593	1.000000	0.71417	0.996000	0.52242	0.964000	0.63967	4.948000	0.63590	2.163000	0.67991	0.482000	0.46254	TAT	ERCC6	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000225830		0.433	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	82	0.00	0	T	NM_000124		50681587	50681587	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	missense	116	19.44	28	SNP	1.000	G
FAM160B2	64760	genome.wustl.edu	37	8	21951949	21951949	+	Splice_Site	SNP	A	A	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr8:21951949A>G	ENST00000289921.7	+	2	91		c.e2-1			NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2											endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						TGCCCTCCGCAGCGCGAGCCC	0.627																																						dbGAP											0													38.0	43.0	41.0					8																	21951949		2076	4205	6281	-	-	-	SO:0001630	splice_region_variant	0			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.46-1A>G	8.37:g.21951949A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Splice_Site	SNP	-	e2-2	ENST00000289921.7	37	c.46-2	CCDS6021.2	8	.	.	.	.	.	.	.	.	.	.	A	20.2	3.955009	0.73902	.	.	ENSG00000158863	ENST00000289921	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6263	0.56632	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM160B2	22007895	1.000000	0.71417	0.999000	0.59377	0.888000	0.51559	7.785000	0.85724	1.879000	0.54435	0.459000	0.35465	.	FAM160B2	-	-	ENSG00000158863		0.627	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160B2	HGNC	protein_coding	OTTHUMT00000375334.2	27	0	0	A		Intron	21951949	21951949	+1	no_errors	ENST00000289921	ensembl	human	known	69_37n	splice_site	15	31.82	7	SNP	1.000	G
FAM180B	399888	genome.wustl.edu	37	11	47608354	47608354	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr11:47608354G>A	ENST00000356737.2	+	1	157	c.157G>A	c.(157-159)Gtg>Atg	p.V53M	FAM180B_ENST00000538490.1_Missense_Mutation_p.V30M			Q6P0A1	F180B_HUMAN	family with sequence similarity 180, member B	53						integral component of membrane (GO:0016021)											GGTTTGCCTGGTGGTAGCCAT	0.587																																						dbGAP											0													229.0	200.0	209.0					11																	47608354		692	1591	2283	-	-	-	SO:0001583	missense	0			BC065704		11p11.2	2008-07-21			ENSG00000196666	ENSG00000196666			34451	protein-coding gene	gene with protein product	"""hypothetical gene supported by BC065704"""					12477932	Standard	NM_001164379		Approved	LOC399888	uc001ngb.2	Q6P0A1		ENST00000356737.2:c.157G>A	11.37:g.47608354G>A	ENSP00000349175:p.Val53Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.V53M	ENST00000356737.2	37	c.157		11	.	.	.	.	.	.	.	.	.	.	G	7.668	0.686292	0.14973	.	.	ENSG00000196666	ENST00000356737;ENST00000538490	T;T	0.35048	1.33;1.34	5.3	0.241	0.15494	.	1.269270	0.05759	N	0.604599	T	0.15349	0.0370	N	0.02539	-0.55	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.21895	-1.0232	10	0.49607	T	0.09	-0.0028	4.2098	0.10505	0.3217:0.0:0.5084:0.1699	.	53	Q6P0A1	F180B_HUMAN	M	53;30	ENSP00000349175:V53M;ENSP00000443133:V30M	ENSP00000349175:V53M	V	+	1	0	FAM180B	47564930	0.001000	0.12720	0.000000	0.03702	0.064000	0.16182	0.392000	0.20801	0.132000	0.18615	-0.378000	0.06908	GTG	FAM180B	-	NULL	ENSG00000196666		0.587	FAM180B-201	KNOWN	basic|appris_candidate_longest	protein_coding	FAM180B	HGNC	protein_coding		85	0.00	0	G	XM_941808		47608354	47608354	+1	no_errors	ENST00000356737	ensembl	human	known	69_37n	missense	45	35.71	25	SNP	0.000	A
NUTM2D	728130	genome.wustl.edu	37	10	89124824	89124824	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr10:89124824G>C	ENST00000381697.2	+	5	1980	c.1382G>C	c.(1381-1383)gGg>gCg	p.G461A	NUTM2D_ENST00000412718.1_Missense_Mutation_p.G461A			Q5VT03	NTM2D_HUMAN	NUT family member 2D	461																	CCTTCTCTCGGGGCCACGGGG	0.637																																						dbGAP											0													12.0	25.0	21.0					10																	89124824		850	1957	2807	-	-	-	SO:0001583	missense	0					10q23.31	2013-03-14	2013-03-14	2013-03-14	ENSG00000214562	ENSG00000214562			23447	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member D"""	FAM22D			Standard	NR_075100		Approved		uc001kes.3	Q5VT03	OTTHUMG00000018672	ENST00000381697.2:c.1382G>C	10.37:g.89124824G>C	ENSP00000371116:p.Gly461Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGV9	Missense_Mutation	SNP	NULL	p.G461A	ENST00000381697.2	37	c.1382		10	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.547508	0.00140	.	.	ENSG00000214562	ENST00000330762;ENST00000381697;ENST00000381691;ENST00000412718	T;T	0.21031	2.84;2.03	0.628	-1.16	0.09678	Nuclear Testis protein, C-terminal (1);	2.637000	0.01269	N	0.009410	T	0.10680	0.0261	.	.	.	0.09310	N	1	B;P	0.45283	0.014;0.855	B;B	0.41174	0.025;0.349	T	0.15407	-1.0438	8	0.07990	T	0.79	.	.	.	.	.	461;461	Q5VT03-2;Q5VT03	.;FA22D_HUMAN	A	532;461;10;461	ENSP00000371116:G461A;ENSP00000396080:G461A	ENSP00000328439:G532A	G	+	2	0	FAM22D	89114804	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.585000	0.05794	-0.359000	0.08150	0.195000	0.17529	GGG	FAM22D	-	NULL	ENSG00000214562		0.637	NUTM2D-004	KNOWN	basic|appris_candidate_longest	protein_coding	FAM22D	HGNC	protein_coding	OTTHUMT00000470142.1	82	0.00	0	G	NR_075100		89124824	89124824	+1	no_errors	ENST00000381697	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	0.000	C
FAM60A	58516	genome.wustl.edu	37	12	31435670	31435670	+	Silent	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr12:31435670C>A	ENST00000337682.4	-	6	1010	c.642G>T	c.(640-642)ctG>ctT	p.L214L	FAM60A_ENST00000542983.1_Silent_p.L66L|FAM60A_ENST00000454658.2_Silent_p.L214L|FAM60A_ENST00000539409.1_Silent_p.L66L|FAM60A_ENST00000395766.1_Silent_p.L66L	NM_001135812.1	NP_001129284.1	Q9NP50	FA60A_HUMAN	family with sequence similarity 60, member A	214					negative regulation of cell migration (GO:0030336)	Sin3 complex (GO:0016580)				large_intestine(1)|lung(2)	3	all_cancers(9;5.22e-13)|all_epithelial(9;4e-13)|all_lung(12;1.2e-11)|Lung NSC(12;2.17e-09)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0207)|Lung SC(12;0.0592)|Esophageal squamous(101;0.162)					TGGAGATGGGCAGAGGCTCTG	0.458																																						dbGAP											0													39.0	41.0	41.0					12																	31435670		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212220	CCDS8723.1	12p11.21	2012-11-30	2005-04-07	2005-04-07	ENSG00000139146	ENSG00000139146			30702	protein-coding gene	gene with protein product		615027	"""chromosome 12 open reading frame 14"""	C12orf14		11042152, 22984288, 22865885	Standard	NM_021238		Approved	TERA	uc001rke.3	Q9NP50	OTTHUMG00000168586	ENST00000337682.4:c.642G>T	12.37:g.31435670C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUV8|Q9BSZ8	Silent	SNP	NULL	p.L214	ENST00000337682.4	37	c.642	CCDS8723.1	12																																																																																			FAM60A	-	NULL	ENSG00000139146		0.458	FAM60A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM60A	HGNC	protein_coding	OTTHUMT00000400347.1	22	0.00	0	C	NM_021238		31435670	31435670	-1	no_errors	ENST00000337682	ensembl	human	known	69_37n	silent	26	46.94	23	SNP	1.000	A
FAT4	79633	genome.wustl.edu	37	4	126369679	126369679	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr4:126369679A>G	ENST00000394329.3	+	9	7521	c.7508A>G	c.(7507-7509)tAt>tGt	p.Y2503C	FAT4_ENST00000335110.5_Missense_Mutation_p.Y801C	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2503	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GAACTGCATTATTCTCTTTCG	0.428																																						dbGAP											0													76.0	79.0	78.0					4																	126369679		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7508A>G	4.37:g.126369679A>G	ENSP00000377862:p.Tyr2503Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.Y2503C	ENST00000394329.3	37	c.7508	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	A	17.39	3.377169	0.61735	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.63255	-0.03;-0.03	5.92	3.3	0.37823	Cadherin (4);Cadherin-like (1);	0.000000	0.31834	U	0.006992	D	0.84261	0.5433	H	0.97240	3.965	0.80722	D	1	D;D	0.89917	0.998;1.0	P;D	0.79108	0.891;0.992	D	0.86931	0.2073	10	0.87932	D	0	.	10.1254	0.42646	0.6194:0.0:0.0:0.3806	.	801;2503	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	C	2503;801	ENSP00000377862:Y2503C;ENSP00000335169:Y801C	ENSP00000335169:Y801C	Y	+	2	0	FAT4	126589129	1.000000	0.71417	0.981000	0.43875	0.993000	0.82548	4.764000	0.62264	1.027000	0.39758	0.528000	0.53228	TAT	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.428	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	37	0.00	0	A	NM_024582		126369679	126369679	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	missense	5	84.38	27	SNP	1.000	G
FCN1	2219	genome.wustl.edu	37	9	137804958	137804958	+	Silent	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr9:137804958C>T	ENST00000371806.3	-	6	463	c.372G>A	c.(370-372)cgG>cgA	p.R124R		NM_002003.3	NP_001994.2	O00602	FCN1_HUMAN	ficolin (collagen/fibrinogen domain containing) 1	124	A domain; contributes to trimerization.|Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell surface pattern recognition receptor signaling pathway (GO:0002752)|complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|opsonization (GO:0008228)|positive regulation of interleukin-8 secretion (GO:2000484)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|extrinsic component of external side of plasma membrane (GO:0031232)	antigen binding (GO:0003823)|calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|G-protein coupled receptor binding (GO:0001664)|signaling pattern recognition receptor activity (GO:0008329)			endometrium(3)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	37		Myeloproliferative disorder(178;0.0333)		OV - Ovarian serous cystadenocarcinoma(145;3.46e-08)|Epithelial(140;6.01e-08)|all cancers(34;3.69e-07)		GGAAATACCCCCGGTCTAGCA	0.677																																						dbGAP											0													45.0	43.0	44.0					9																	137804958		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D83920	CCDS6985.1	9q34	2013-02-06	2002-01-14		ENSG00000085265	ENSG00000085265		"""Fibrinogen C domain containing"""	3623	protein-coding gene	gene with protein product		601252	"""ficolin (collagen/fibrinogen domain-containing) 1"""			8573080, 8884275	Standard	NM_002003		Approved	FCNM	uc004cfi.3	O00602	OTTHUMG00000020895	ENST00000371806.3:c.372G>A	9.37:g.137804958C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYV5|Q92596	Silent	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Collagen,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.R124	ENST00000371806.3	37	c.372	CCDS6985.1	9																																																																																			FCN1	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	ENSG00000085265		0.677	FCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCN1	HGNC	protein_coding	OTTHUMT00000054963.1	30	0.00	0	C	NM_002003		137804958	137804958	-1	no_errors	ENST00000371806	ensembl	human	known	69_37n	silent	13	85.06	74	SNP	0.000	T
FLG	2312	genome.wustl.edu	37	1	152279627	152279627	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:152279627C>G	ENST00000368799.1	-	3	7770	c.7735G>C	c.(7735-7737)Gac>Cac	p.D2579H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2579	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTCTCAGAGTCTTCTGAGTGT	0.562									Ichthyosis																													dbGAP											0													125.0	139.0	134.0					1																	152279627		2203	4298	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7735G>C	1.37:g.152279627C>G	ENSP00000357789:p.Asp2579His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.D2579H	ENST00000368799.1	37	c.7735	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	8.075	0.771146	0.16051	.	.	ENSG00000143631	ENST00000368799	T	0.02525	4.26	3.08	-0.296	0.12824	.	.	.	.	.	T	0.03095	0.0091	M	0.76002	2.32	0.09310	N	1	D	0.69078	0.997	P	0.58970	0.849	T	0.32079	-0.9920	9	0.41790	T	0.15	.	3.9255	0.09262	0.3858:0.4859:0.0:0.1283	.	2579	P20930	FILA_HUMAN	H	2579	ENSP00000357789:D2579H	ENSP00000357789:D2579H	D	-	1	0	FLG	150546251	0.000000	0.05858	0.000000	0.03702	0.095000	0.18619	-1.104000	0.03326	-0.181000	0.10619	0.306000	0.20318	GAC	FLG	-	NULL	ENSG00000143631		0.562	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	94	0.00	0	C	NM_002016		152279627	152279627	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	152	33.04	75	SNP	0.000	G
GJB6	10804	genome.wustl.edu	37	13	20797418	20797418	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr13:20797418A>T	ENST00000356192.6	-	5	822	c.202T>A	c.(202-204)Ttt>Att	p.F68I	GJB6_ENST00000400066.3_Missense_Mutation_p.F68I|GJB6_ENST00000400065.3_Missense_Mutation_p.F68I|GJB6_ENST00000241124.6_Missense_Mutation_p.F68I	NM_001110219.2	NP_001103689.1	O95452	CXB6_HUMAN	gap junction protein, beta 6, 30kDa	68					apoptotic process (GO:0006915)|cell communication (GO:0007154)|ear morphogenesis (GO:0042471)|inner ear development (GO:0048839)|negative regulation of cell proliferation (GO:0008285)|sensory perception of sound (GO:0007605)	apical plasma membrane (GO:0016324)|connexon complex (GO:0005922)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)				biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|ovary(1)	9		all_cancers(29;2.04e-22)|all_epithelial(30;1.19e-19)|all_lung(29;2.27e-18)|Lung SC(185;0.0257)|Ovarian(182;0.0822)		all cancers(112;2.17e-05)|Epithelial(112;0.00075)|OV - Ovarian serous cystadenocarcinoma(117;0.00978)|Lung(94;0.0238)|GBM - Glioblastoma multiforme(144;0.0323)|LUSC - Lung squamous cell carcinoma(192;0.0744)		ACCGGGAAAAAGTGGTCATAG	0.592																																						dbGAP											0													84.0	66.0	72.0					13																	20797418		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005585	CCDS9291.1	13q12	2010-01-06	2007-11-06		ENSG00000121742	ENSG00000121742		"""Ion channels / Gap junction proteins (connexins)"""	4288	protein-coding gene	gene with protein product	"""connexin 30"""	604418	"""ectodermal dysplasia 2, hidrotic (Clouston syndrome)"", ""gap junction protein, beta 6 (connexin 30)"", ""gap junction protein, beta 6"""	DFNA3, ED2		10471490, 8845850	Standard	NM_006783		Approved	EDH, HED, CX30	uc001und.4	O95452	OTTHUMG00000016515	ENST00000356192.6:c.202T>A	13.37:g.20797418A>T	ENSP00000348521:p.Phe68Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQN2|Q5Q1H9|Q5Q1I0|Q5Q1I1|Q5T5U0|Q8IUP0	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.F68I	ENST00000356192.6	37	c.202	CCDS9291.1	13	.	.	.	.	.	.	.	.	.	.	A	19.89	3.910386	0.72983	.	.	ENSG00000121742	ENST00000241124;ENST00000400065;ENST00000400066;ENST00000356192	D;D;D;D	0.99080	-5.4;-5.4;-5.4;-5.4	5.38	5.38	0.77491	Connexin, N-terminal (2);	0.209202	0.39083	N	0.001463	D	0.99045	0.9673	M	0.81802	2.56	0.43522	D	0.995793	D	0.56746	0.977	P	0.58873	0.847	D	0.99323	1.0907	10	0.48119	T	0.1	.	15.4198	0.75003	1.0:0.0:0.0:0.0	.	68	O95452	CXB6_HUMAN	I	68	ENSP00000241124:F68I;ENSP00000382938:F68I;ENSP00000382939:F68I;ENSP00000348521:F68I	ENSP00000241124:F68I	F	-	1	0	GJB6	19695418	1.000000	0.71417	1.000000	0.80357	0.428000	0.31595	5.037000	0.64170	2.030000	0.59900	0.533000	0.62120	TTT	GJB6	-	pfam_Connexin_N,smart_Connexin_N,prints_Connexin	ENSG00000121742		0.592	GJB6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB6	HGNC	protein_coding	OTTHUMT00000272906.1	30	0.00	0	A			20797418	20797418	-1	no_errors	ENST00000241124	ensembl	human	known	69_37n	missense	8	63.64	14	SNP	1.000	T
GOLGA6A	342096	genome.wustl.edu	37	15	74368107	74368107	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr15:74368107G>T	ENST00000290438.3	-	9	716	c.676C>A	c.(676-678)Cag>Aag	p.Q226K		NM_001038640.2	NP_001033729.2	Q9NYA3	GOG6A_HUMAN	golgin A6 family, member A	226						Golgi apparatus (GO:0005794)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|liver(1)|lung(6)|prostate(1)|urinary_tract(1)	16						CGCTCTAGCTGGACTTGTTTT	0.532																																						dbGAP											0													2.0	3.0	3.0					15																	74368107		689	1559	2248	-	-	-	SO:0001583	missense	0			AF263742	CCDS32290.1	15q24.1	2013-05-10	2010-02-12	2009-09-28	ENSG00000159289	ENSG00000159289			13567	protein-coding gene	gene with protein product		610288	"""golgi autoantigen, golgin subfamily a, member 6"", ""golgi autoantigen, golgin subfamily a, 6"", ""golgi autoantigen, golgin subfamily a, 6A"""	GOLGA6		11161787	Standard	NM_001038640		Approved	GLP	uc002axa.1	Q9NYA3	OTTHUMG00000173035	ENST00000290438.3:c.676C>A	15.37:g.74368107G>T	ENSP00000290438:p.Gln226Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K959|Q9NYA7	Missense_Mutation	SNP	NULL	p.Q226K	ENST00000290438.3	37	c.676	CCDS32290.1	15	.	.	.	.	.	.	.	.	.	.	G	7.179	0.589199	0.13812	.	.	ENSG00000159289	ENST00000290438	T	0.23950	1.88	1.51	1.51	0.23008	.	.	.	.	.	T	0.27278	0.0669	M	0.83384	2.64	0.09310	N	1	P	0.45594	0.862	B	0.37943	0.261	T	0.30563	-0.9974	9	0.59425	D	0.04	.	5.1487	0.14998	0.0:0.0:0.6549:0.3451	.	226	Q9NYA3	GOG6A_HUMAN	K	226	ENSP00000290438:Q226K	ENSP00000290438:Q226K	Q	-	1	0	GOLGA6A	72155160	0.051000	0.20477	0.013000	0.15412	0.029000	0.11900	1.307000	0.33516	1.187000	0.43000	0.121000	0.15741	CAG	GOLGA6A	-	NULL	ENSG00000159289		0.532	GOLGA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6A	HGNC	protein_coding	OTTHUMT00000421835.1	8	0.00	0	G	XM_292357		74368107	74368107	-1	no_errors	ENST00000290438	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.154	T
GRK1	6011	genome.wustl.edu	37	13	114324074	114324074	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr13:114324074G>C	ENST00000335678.6	+	2	1004	c.772G>C	c.(772-774)Gaa>Caa	p.E258Q		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	258	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			CTATGCGTTTGAAACCAAAGC	0.547																																						dbGAP											0													168.0	172.0	171.0					13																	114324074		2069	4199	6268	-	-	-	SO:0001583	missense	0					13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.772G>C	13.37:g.114324074G>C	ENSP00000334876:p.Glu258Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X14	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_GPCR_kinase,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom	p.E258Q	ENST00000335678.6	37	c.772		13	.	.	.	.	.	.	.	.	.	.	g	9.732	1.162580	0.21538	.	.	ENSG00000185974	ENST00000335678	T	0.66815	-0.23	4.36	4.36	0.52297	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.122880	0.56097	D	0.000032	T	0.54870	0.1885	.	.	.	0.39217	D	0.963435	B	0.18968	0.032	B	0.19391	0.025	T	0.55611	-0.8114	9	0.38643	T	0.18	-29.9322	10.7872	0.46411	0.0:0.1932:0.8068:0.0	.	258	Q15835	RK_HUMAN	Q	258	ENSP00000334876:E258Q	ENSP00000334876:E258Q	E	+	1	0	GRK1	113372075	0.997000	0.39634	0.988000	0.46212	0.313000	0.28021	1.976000	0.40579	2.131000	0.65755	0.511000	0.50034	GAA	GRK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000185974		0.547	GRK1-001	KNOWN	basic|appris_principal	protein_coding	GRK1	HGNC	protein_coding	OTTHUMT00000470655.1	65	0.00	0	G	NM_002929		114324074	114324074	+1	no_errors	ENST00000335678	ensembl	human	known	69_37n	missense	28	60.56	43	SNP	1.000	C
GRK1	6011	genome.wustl.edu	37	13	114325949	114325949	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr13:114325949G>C	ENST00000335678.6	+	3	1195	c.963G>C	c.(961-963)gaG>gaC	p.E321D		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	321	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			TCAAGCCCGAGAACGTGCTGC	0.483																																						dbGAP											0													18.0	20.0	19.0					13																	114325949		2057	4192	6249	-	-	-	SO:0001583	missense	0					13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.963G>C	13.37:g.114325949G>C	ENSP00000334876:p.Glu321Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X14	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_GPCR_kinase,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom	p.E321D	ENST00000335678.6	37	c.963		13	.	.	.	.	.	.	.	.	.	.	g	17.22	3.333792	0.60853	.	.	ENSG00000185974	ENST00000335678	T	0.27104	1.69	4.43	4.43	0.53597	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.46776	0.1410	.	.	.	0.42507	D	0.992959	D	0.67145	0.996	D	0.74348	0.983	T	0.49606	-0.8922	9	0.87932	D	0	-55.6427	8.7174	0.34419	0.1061:0.0:0.8939:0.0	.	321	Q15835	RK_HUMAN	D	321	ENSP00000334876:E321D	ENSP00000334876:E321D	E	+	3	2	GRK1	113373950	1.000000	0.71417	0.998000	0.56505	0.668000	0.39293	1.381000	0.34362	2.148000	0.66965	0.506000	0.49869	GAG	GRK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000185974		0.483	GRK1-001	KNOWN	basic|appris_principal	protein_coding	GRK1	HGNC	protein_coding	OTTHUMT00000470655.1	16	0.00	0	G	NM_002929		114325949	114325949	+1	no_errors	ENST00000335678	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	C
GUCY2D	3000	genome.wustl.edu	37	17	7909959	7909959	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr17:7909959C>A	ENST00000254854.4	+	4	1455	c.1305C>A	c.(1303-1305)caC>caA	p.H435Q		NM_000180.3	NP_000171.1	Q02846	GUC2D_HUMAN	guanylate cyclase 2D, membrane (retina-specific)	435					intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			skin(1)	1		Prostate(122;0.157)				CCCGGATGCACTTCCCGCGTG	0.652																																						dbGAP											0													23.0	23.0	23.0					17																	7909959		2203	4300	6503	-	-	-	SO:0001583	missense	0			L26921	CCDS11127.1	17p13.1	2013-06-06			ENSG00000132518	ENSG00000132518			4689	protein-coding gene	gene with protein product		600179	"""cone rod dystrophy 6"""	CORD6, LCA, GUC2D, GUC1A4		1356371, 12552567	Standard	NM_000180		Approved	retGC, RETGC-1, ROS-GC1, CYGD, LCA1	uc002gjt.2	Q02846	OTTHUMG00000108169	ENST00000254854.4:c.1305C>A	17.37:g.7909959C>A	ENSP00000254854:p.His435Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LEA7	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Haem_no_assoc-bd,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H435Q	ENST00000254854.4	37	c.1305	CCDS11127.1	17	.	.	.	.	.	.	.	.	.	.	C	10.34	1.322015	0.23994	.	.	ENSG00000132518	ENST00000254854	T	0.73363	-0.74	5.15	3.07	0.35406	.	0.000000	0.47093	D	0.000257	T	0.68970	0.3059	M	0.84326	2.69	0.33082	D	0.536759	P	0.36753	0.568	B	0.34093	0.175	T	0.68273	-0.5452	10	0.21540	T	0.41	.	5.9862	0.19436	0.0:0.4735:0.0:0.5265	.	435	Q02846	GUC2D_HUMAN	Q	435	ENSP00000254854:H435Q	ENSP00000254854:H435Q	H	+	3	2	GUCY2D	7850684	0.824000	0.29247	0.997000	0.53966	0.106000	0.19336	0.006000	0.13152	0.451000	0.26802	0.561000	0.74099	CAC	GUCY2D	-	NULL	ENSG00000132518		0.652	GUCY2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2D	HGNC	protein_coding	OTTHUMT00000226973.2	19	0.00	0	C			7909959	7909959	+1	no_errors	ENST00000254854	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	0.999	A
HADHB	3032	genome.wustl.edu	37	2	26492837	26492837	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr2:26492837C>A	ENST00000317799.5	+	5	330	c.226C>A	c.(226-228)Cca>Aca	p.P76T	HADHB_ENST00000405867.3_Missense_Mutation_p.P76T|HADHB_ENST00000545822.1_Missense_Mutation_p.P54T|HADHB_ENST00000537713.1_Intron|HADHB_ENST00000494615.1_3'UTR	NM_000183.2	NP_000174.1	P55084	ECHB_HUMAN	hydroxyacyl-CoA dehydrogenase/3-ketoacyl-CoA thiolase/enoyl-CoA hydratase (trifunctional protein), beta subunit	76					cardiolipin acyl-chain remodeling (GO:0035965)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|glycerophospholipid biosynthetic process (GO:0046474)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrial envelope (GO:0005740)|mitochondrial fatty acid beta-oxidation multienzyme complex (GO:0016507)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|acetyl-CoA C-acyltransferase activity (GO:0003988)|enoyl-CoA hydratase activity (GO:0004300)|fatty-acyl-CoA binding (GO:0000062)|long-chain-3-hydroxyacyl-CoA dehydrogenase activity (GO:0016509)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|NAD binding (GO:0051287)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGACCTGATGCCACATGATTT	0.348																																						dbGAP											0													132.0	127.0	128.0					2																	26492837		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1722.1, CCDS62871.1, CCDS62872.1	2p23	2010-04-30	2010-04-30		ENSG00000138029	ENSG00000138029	2.3.1.16		4803	protein-coding gene	gene with protein product	"""mitochondrial trifunctional protein, beta subunit"""	143450	"""hydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit"""			9605857	Standard	NM_000183		Approved	MTPB	uc002rgz.3	P55084	OTTHUMG00000096978	ENST00000317799.5:c.226C>A	2.37:g.26492837C>A	ENSP00000325136:p.Pro76Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB16|B4E2W0|O14969|Q53TA6|Q96C77|Q9H3F5|Q9T2V8	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,tigrfam_Thiolase	p.P76T	ENST00000317799.5	37	c.226	CCDS1722.1	2	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655458	0.67586	.	.	ENSG00000138029	ENST00000448743;ENST00000317799;ENST00000405867;ENST00000545822;ENST00000425035;ENST00000412805	D;D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6;-2.6	5.12	4.24	0.50183	Thiolase-like, subgroup (1);Thiolase, N-terminal (1);Thiolase-like (1);	0.000000	0.85682	D	0.000000	D	0.89602	0.6762	M	0.75447	2.3	0.80722	D	1	B;P;B	0.41232	0.201;0.743;0.201	B;B;B	0.44224	0.199;0.444;0.199	D	0.87977	0.2740	10	0.31617	T	0.26	-7.9498	14.5812	0.68292	0.0:0.8525:0.1475:0.0	.	54;76;76	B4E2W0;B5MD38;P55084	.;.;ECHB_HUMAN	T	76;76;76;54;76;76	ENSP00000415300:P76T;ENSP00000325136:P76T;ENSP00000385411:P76T;ENSP00000442665:P54T;ENSP00000404633:P76T;ENSP00000413103:P76T	ENSP00000325136:P76T	P	+	1	0	HADHB	26346341	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.398000	0.66308	1.249000	0.43950	0.655000	0.94253	CCA	HADHB	-	pfam_Thiolase_N,superfamily_Thiolase-like,tigrfam_Thiolase	ENSG00000138029		0.348	HADHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HADHB	HGNC	protein_coding	OTTHUMT00000214050.2	95	0.00	0	C	NM_000183		26492837	26492837	+1	no_errors	ENST00000317799	ensembl	human	known	69_37n	missense	101	31.76	47	SNP	1.000	A
HDAC1	3065	genome.wustl.edu	37	1	32797806	32797807	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:32797806_32797807delAG	ENST00000373548.3	+	12	1419_1420	c.1335_1336delAG	c.(1333-1338)acagagfs	p.E446fs	HDAC1_ENST00000373541.2_Frame_Shift_Del_p.E253fs	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	446					ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	GAGTCAAAACAGAGGATGAAAA	0.495																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.1335_1336delAG	1.37:g.32797808_32797809delAG	ENSP00000362649:p.Glu446fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92534	Frame_Shift_Del	DEL	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.E446fs	ENST00000373548.3	37	c.1335_1336	CCDS360.1	1																																																																																			HDAC1	-	pirsf_His_deacetylse_1	ENSG00000116478		0.495	HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC1	HGNC	protein_coding	OTTHUMT00000019815.3	52	0.00	0	AG	NM_004964		32797806	32797807	+1	no_errors	ENST00000373548	ensembl	human	known	69_37n	frame_shift_del	46	37.84	28	DEL	0.995:1.000	-
HEPH	9843	genome.wustl.edu	37	X	65409615	65409615	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chrX:65409615G>A	ENST00000343002.2	+	5	1562	c.898G>A	c.(898-900)Gaa>Aaa	p.E300K	HEPH_ENST00000441993.2_Missense_Mutation_p.E303K|HEPH_ENST00000336279.5_Missense_Mutation_p.E33K|HEPH_ENST00000419594.1_Missense_Mutation_p.E303K|HEPH_ENST00000519389.1_Missense_Mutation_p.E354K|HEPH_ENST00000374727.3_Missense_Mutation_p.E303K			Q9BQS7	HEPH_HUMAN	hephaestin	300	Plastocyanin-like 2.				cellular iron ion homeostasis (GO:0006879)|copper ion transport (GO:0006825)|iron ion transport (GO:0006826)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	copper ion binding (GO:0005507)|ferrous iron binding (GO:0008198)|ferroxidase activity (GO:0004322)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(56)|ovary(5)|prostate(1)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	89						CATGGGCAATGAAATTGATGT	0.468																																						dbGAP											0													170.0	131.0	144.0					X																	65409615		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014598	CCDS14384.2, CCDS14385.1, CCDS48133.1, CCDS14384.3, CCDS65277.1	Xq11-q12	2008-02-05			ENSG00000089472	ENSG00000089472			4866	protein-coding gene	gene with protein product		300167				9988272, 9734811	Standard	NM_014799		Approved	KIAA0698, CPL	uc011moz.2	Q9BQS7	OTTHUMG00000021732	ENST00000343002.2:c.898G>A	X.37:g.65409615G>A	ENSP00000343939:p.Glu300Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJX8|D3DVT7|E9PHN8|O75180|Q6UW45|Q9C058	Missense_Mutation	SNP	pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Cupredoxin	p.E354K	ENST00000343002.2	37	c.1060		X	.	.	.	.	.	.	.	.	.	.	G	31	5.073462	0.94000	.	.	ENSG00000089472	ENST00000519389;ENST00000374727;ENST00000336279;ENST00000441993;ENST00000419594;ENST00000343002;ENST00000425114	D;D;D;D;D;D;D	0.99789	-6.75;-6.75;-6.75;-6.75;-6.75;-6.75;-6.75	4.9	4.9	0.64082	Cupredoxin (2);	0.000000	0.85682	D	0.000000	D	0.99782	0.9909	M	0.88704	2.975	0.49213	D	0.99976	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.98;0.991;0.999	D	0.97069	0.9776	10	0.59425	D	0.04	.	15.7163	0.77670	0.0:0.0:1.0:0.0	.	354;303;300	E9PHN8;E7ES21;Q9BQS7	.;.;HEPH_HUMAN	K	354;303;33;303;303;300;300	ENSP00000430620:E354K;ENSP00000363859:E303K;ENSP00000337418:E33K;ENSP00000411687:E303K;ENSP00000413211:E303K;ENSP00000343939:E300K;ENSP00000398078:E300K	ENSP00000337418:E33K	E	+	1	0	HEPH	65326340	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.262000	0.95591	2.010000	0.58986	0.594000	0.82650	GAA	HEPH	-	superfamily_Cupredoxin	ENSG00000089472		0.468	HEPH-002	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	HEPH	HGNC	protein_coding	OTTHUMT00000056995.1	105	0.00	0	G	NM_138737		65409615	65409615	+1	no_errors	ENST00000519389	ensembl	human	known	69_37n	missense	60	18.92	14	SNP	1.000	A
HJURP	55355	genome.wustl.edu	37	2	234750032	234750032	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr2:234750032T>C	ENST00000411486.2	-	8	1459	c.1394A>G	c.(1393-1395)aAc>aGc	p.N465S	HJURP_ENST00000434039.1_5'Flank|HJURP_ENST00000432087.1_Missense_Mutation_p.N411S|HJURP_ENST00000441687.1_Missense_Mutation_p.N380S	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	465					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		TCTGTACATGTTCATGGCCCA	0.532																																						dbGAP											0													67.0	70.0	69.0					2																	234750032		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1394A>G	2.37:g.234750032T>C	ENSP00000414109:p.Asn465Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.N465S	ENST00000411486.2	37	c.1394	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	T	12.57	1.978544	0.34942	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.57273	0.41;0.41;0.41;0.41	4.12	-1.55	0.08558	Holliday junction regulator protein family C-terminal repeat (1);	0.845902	0.10286	N	0.692973	T	0.39517	0.1081	L	0.44542	1.39	0.09310	N	1	B;B;B	0.27286	0.078;0.029;0.174	B;B;B	0.26094	0.023;0.023;0.066	T	0.30504	-0.9976	10	0.41790	T	0.15	-4.4202	6.344	0.21339	0.0:0.0961:0.4995:0.4045	.	380;411;465	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	S	465;411;380;380	ENSP00000414109:N465S;ENSP00000407208:N411S;ENSP00000401944:N380S;ENSP00000393253:N380S	ENSP00000414109:N465S	N	-	2	0	HJURP	234414771	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.482000	0.06544	-0.235000	0.09767	-0.316000	0.08728	AAC	HJURP	-	pfam_HJURP_C	ENSG00000123485		0.532	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	HGNC	protein_coding	OTTHUMT00000130996.6	45	0.00	0	T	NM_018410		234750032	234750032	-1	no_errors	ENST00000411486	ensembl	human	known	69_37n	missense	6	78.79	26	SNP	0.000	C
HLA-F	3134	genome.wustl.edu	37	6	29693318	29693318	+	Silent	SNP	G	G	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr6:29693318G>T	ENST00000376861.1	+	6	1365	c.981G>T	c.(979-981)gtG>gtT	p.V327V	HLA-F_ENST00000440587.2_Silent_p.V209V|HLA-F_ENST00000259951.7_Silent_p.V327V|HLA-F_ENST00000434407.2_Silent_p.V235V|HLA-F_ENST00000475996.1_3'UTR|HLA-F_ENST00000334668.4_Silent_p.V327V			P30511	HLAF_HUMAN	major histocompatibility complex, class I, F	327					antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			cervix(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						TCGCTGCTGTGATGTGGAGGA	0.587																																						dbGAP											0													176.0	173.0	174.0					6																	29693318		1510	2709	4219	-	-	-	SO:0001819	synonymous_variant	0			AY253269	CCDS43437.1, CCDS43438.1, CCDS43439.1	6p21.3	2013-01-11			ENSG00000204642	ENSG00000204642		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4963	protein-coding gene	gene with protein product		143110				1688605	Standard	NM_018950		Approved		uc003nno.4	P30511	OTTHUMG00000031156	ENST00000376861.1:c.981G>T	6.37:g.29693318G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQI8|Q5JQJ1|Q5SPT5|Q860R0|Q8MGQ1|Q8WLP5|Q95HC0|Q9TP68	Nonstop_Mutation	SNP	NULL	p.*3L	ENST00000376861.1	37	c.8	CCDS43438.1	6	.	.	.	.	.	.	.	.	.	.	.	3.372	-0.128237	0.06753	.	.	ENSG00000204642	ENST00000429294;ENST00000444621	.	.	.	1.92	-2.17	0.07059	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.5981	0.12340	0.1805:0.2248:0.5947:0.0	.	.	.	.	L	206;3	.	.	X	+	2	2	HLA-F	29801297	0.000000	0.05858	0.003000	0.11579	0.111000	0.19643	-1.097000	0.03349	-0.269000	0.09298	-1.651000	0.00758	TGA	HLA-F	-	NULL	ENSG00000204642		0.587	HLA-F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-F	HGNC	protein_coding	OTTHUMT00000195083.1	21	0.00	0	G	NM_018950		29693318	29693318	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444621	ensembl	human	known	69_37n	nonstop	17	41.38	12	SNP	0.003	T
HMOX1	3162	genome.wustl.edu	37	22	35779123	35779123	+	Silent	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr22:35779123C>T	ENST00000216117.8	+	2	387	c.48C>T	c.(46-48)gcC>gcT	p.A16A		NM_002133.2	NP_002124.1	P09601	HMOX1_HUMAN	heme oxygenase (decycling) 1	16					angiogenesis (GO:0001525)|cell death (GO:0008219)|cellular iron ion homeostasis (GO:0006879)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to cadmium ion (GO:0071276)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient (GO:0031670)|endothelial cell proliferation (GO:0001935)|erythrocyte homeostasis (GO:0034101)|excretion (GO:0007588)|heme catabolic process (GO:0042167)|heme oxidation (GO:0006788)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|iron ion homeostasis (GO:0055072)|low-density lipoprotein particle clearance (GO:0034383)|negative regulation of DNA binding (GO:0043392)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of muscle cell apoptotic process (GO:0010656)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smooth muscle cell proliferation (GO:0048662)|porphyrin-containing compound metabolic process (GO:0006778)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine biosynthetic process (GO:0045080)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of vasodilation (GO:0045909)|protein homooligomerization (GO:0051260)|regulation of angiogenesis (GO:0045765)|regulation of blood pressure (GO:0008217)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter in response to iron (GO:0034395)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to estrogen (GO:0043627)|response to hydrogen peroxide (GO:0042542)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|smooth muscle hyperplasia (GO:0014806)|transmembrane transport (GO:0055085)|wound healing involved in inflammatory response (GO:0002246)	caveola (GO:0005901)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|heme oxygenase (decyclizing) activity (GO:0004392)|metal ion binding (GO:0046872)|phospholipase D activity (GO:0004630)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)	16					Vitamin E(DB00163)	TGTCAGAGGCCCTGAAGGAGG	0.577																																						dbGAP											0													82.0	76.0	78.0					22																	35779123		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13914.1	22q12	2003-10-13			ENSG00000100292	ENSG00000100292	1.14.99.3		5013	protein-coding gene	gene with protein product		141250				10591208	Standard	NM_002133		Approved	bK286B10, HO-1	uc003ant.2	P09601	OTTHUMG00000150960	ENST00000216117.8:c.48C>T	22.37:g.35779123C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Haem_Oase-like,superfamily_Haem_Oase-like_multi-hlx,pirsf_Haem_Oase,prints_Haem_Oase	p.A16	ENST00000216117.8	37	c.48	CCDS13914.1	22																																																																																			HMOX1	-	pfam_Haem_Oase-like,superfamily_Haem_Oase-like_multi-hlx,pirsf_Haem_Oase,prints_Haem_Oase	ENSG00000100292		0.577	HMOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMOX1	HGNC	protein_coding	OTTHUMT00000320657.1	43	0.00	0	C			35779123	35779123	+1	no_errors	ENST00000216117	ensembl	human	known	69_37n	silent	26	45.83	22	SNP	0.999	T
HNF4G	3174	genome.wustl.edu	37	8	76465339	76465339	+	Silent	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr8:76465339T>C	ENST00000354370.1	+	6	681	c.411T>C	c.(409-411)ggT>ggC	p.G137G	HNF4G_ENST00000396423.2_Silent_p.G174G			Q14541	HNF4G_HUMAN	hepatocyte nuclear factor 4, gamma	137					endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	37	Breast(64;0.0448)		BRCA - Breast invasive adenocarcinoma(89;0.161)			CAAGTATTGGTGATGTCTGTG	0.363																																						dbGAP											0													122.0	111.0	115.0					8																	76465339		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6220.2	8q21-q22	2013-01-16			ENSG00000164749	ENSG00000164749		"""Nuclear hormone receptors"""	5026	protein-coding gene	gene with protein product		605966				8622695, 12220494	Standard	NM_004133		Approved	NR2A2	uc003yar.3	Q14541	OTTHUMG00000149920	ENST00000354370.1:c.411T>C	8.37:g.76465339T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z2V9|Q9UH81|Q9UIS6	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.G174	ENST00000354370.1	37	c.522		8																																																																																			HNF4G	-	superfamily_Nucl_hormone_rcpt_ligand-bd,prints_COUP_TF	ENSG00000164749		0.363	HNF4G-002	KNOWN	basic|appris_candidate	protein_coding	HNF4G	HGNC	protein_coding	OTTHUMT00000313914.2	61	0.00	0	T	NM_004133		76465339	76465339	+1	no_errors	ENST00000396423	ensembl	human	known	69_37n	silent	95	28.03	37	SNP	1.000	C
HRNR	388697	genome.wustl.edu	37	1	152191305	152191305	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:152191305G>T	ENST00000368801.2	-	3	2875	c.2800C>A	c.(2800-2802)Cac>Aac	p.H934N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	934					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTAGACTTGTGACCAAAGCCA	0.592																																						dbGAP											0													224.0	232.0	229.0					1																	152191305		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2800C>A	1.37:g.152191305G>T	ENSP00000357791:p.His934Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.H934N	ENST00000368801.2	37	c.2800	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	G	4.415	0.076778	0.08485	.	.	ENSG00000197915	ENST00000368801	T	0.01629	4.72	2.77	2.77	0.32553	.	.	.	.	.	T	0.00608	0.0020	L	0.40543	1.245	0.09310	N	1	B	0.20261	0.043	B	0.10450	0.005	T	0.45205	-0.9277	9	0.16896	T	0.51	.	7.7705	0.29006	0.0:0.2616:0.7384:0.0	.	934	Q86YZ3	HORN_HUMAN	N	934	ENSP00000357791:H934N	ENSP00000357791:H934N	H	-	1	0	HRNR	150457929	0.060000	0.20803	0.004000	0.12327	0.029000	0.11900	2.037000	0.41174	1.546000	0.49388	0.505000	0.49811	CAC	HRNR	-	NULL	ENSG00000197915		0.592	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	86	0.00	0	G	XM_373868		152191305	152191305	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	107	34.36	56	SNP	0.002	T
HSD17B4	3295	genome.wustl.edu	37	5	118814681	118814681	+	Missense_Mutation	SNP	C	C	G	rs550705310		TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr5:118814681C>G	ENST00000256216.6	+	8	720	c.587C>G	c.(586-588)gCg>gGg	p.A196G	HSD17B4_ENST00000509514.1_5'UTR|HSD17B4_ENST00000510025.1_Missense_Mutation_p.A172G|HSD17B4_ENST00000515320.1_Missense_Mutation_p.A178G|HSD17B4_ENST00000504811.1_Missense_Mutation_p.A221G|HSD17B4_ENST00000513628.1_Missense_Mutation_p.A59G|HSD17B4_ENST00000414835.2_Missense_Mutation_p.A56G	NM_000414.3	NP_000405.1	P51659	DHB4_HUMAN	hydroxysteroid (17-beta) dehydrogenase 4	196	(3R)-hydroxyacyl-CoA dehydrogenase.				alpha-linolenic acid metabolic process (GO:0036109)|androgen metabolic process (GO:0008209)|bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|estrogen metabolic process (GO:0008210)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|metabolic process (GO:0008152)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|Sertoli cell development (GO:0060009)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)|very long-chain fatty-acyl-CoA metabolic process (GO:0036111)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	17-beta-hydroxysteroid dehydrogenase (NAD+) activity (GO:0044594)|3-hydroxyacyl-CoA dehydrogenase activity (GO:0003857)|3alpha,7alpha,12alpha-trihydroxy-5beta-cholest-24-enoyl-CoA hydratase activity (GO:0033989)|isomerase activity (GO:0016853)|long-chain-enoyl-CoA hydratase activity (GO:0016508)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(2)	25		all_cancers(142;0.0206)|Prostate(80;0.0322)		OV - Ovarian serous cystadenocarcinoma(64;0.000247)|Epithelial(69;0.000849)|all cancers(49;0.0122)		GCTCCTAATGCGGGATCACGG	0.408																																					Colon(35;490 801 34689 41394 43344)	dbGAP											0													144.0	131.0	135.0					5																	118814681		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4126.1, CCDS56378.1, CCDS56379.1	5q2	2011-09-20			ENSG00000133835	ENSG00000133835	4.2.1.107, 1.1.1.35	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5213	protein-coding gene	gene with protein product	"""17beta-estradiol dehydrogenase type IV"", ""peroxisomal multifunctional protein 2"", ""17-beta-HSD IV"", ""17-beta-hydroxysteroid dehydrogenase 4"", ""D-bifunctional protein, peroxisomal"", ""D-3-hydroxyacyl-CoA dehydratase"", ""3-alpha,7-alpha,12-alpha-trihydroxy-5-beta-cholest-24-enoyl-CoA hydratase"", ""beta-keto-reductase"", ""beta-hydroxyacyl dehydrogenase"", ""short chain dehydrogenase/reductase family 8C, member 1"""	601860				8938456, 19027726	Standard	NM_000414		Approved	MFE-2, DBP, SDR8C1	uc003ksj.3	P51659	OTTHUMG00000128899	ENST00000256216.6:c.587C>G	5.37:g.118814681C>G	ENSP00000256216:p.Ala196Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV1|B4DVS5|E9PB82|F5HE57	Missense_Mutation	SNP	pfam_MaoC_deHydtase,pfam_DH_sc/Rdtase_SDR,pfam_SCP2_sterol-bd_dom,pfam_PKS_KR,superfamily_SCP2_sterol-bd_dom,smart_PKS/FAS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR,prints_DHB_DH	p.A196G	ENST00000256216.6	37	c.587	CCDS4126.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.192467	0.94960	.	.	ENSG00000133835	ENST00000256216;ENST00000515320;ENST00000510025;ENST00000504811;ENST00000414835;ENST00000513628	D;D;D;D;D;D	0.89875	-2.58;-2.58;-2.58;-2.58;-2.58;-2.58	5.22	5.22	0.72569	NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.95554	0.8555	M	0.90019	3.08	0.80722	D	1	D;D;D;P	0.65815	0.983;0.995;0.969;0.884	D;D;P;P	0.72982	0.979;0.937;0.855;0.684	D	0.95929	0.8937	10	0.62326	D	0.03	-22.1316	18.7471	0.91797	0.0:1.0:0.0:0.0	.	221;178;172;196	F5HE57;E9PB82;E7EWE5;P51659	.;.;.;DHB4_HUMAN	G	196;178;172;221;56;59	ENSP00000256216:A196G;ENSP00000424613:A178G;ENSP00000424940:A172G;ENSP00000420914:A221G;ENSP00000411960:A56G;ENSP00000425993:A59G	ENSP00000256216:A196G	A	+	2	0	HSD17B4	118842580	1.000000	0.71417	0.265000	0.24526	0.978000	0.69477	7.670000	0.83925	2.586000	0.87340	0.655000	0.94253	GCG	HSD17B4	-	prints_DHB_DH	ENSG00000133835		0.408	HSD17B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B4	HGNC	protein_coding	OTTHUMT00000250863.3	45	0.00	0	C	NM_000414		118814681	118814681	+1	no_errors	ENST00000256216	ensembl	human	known	69_37n	missense	5	75.00	15	SNP	1.000	G
KCNC2	3747	genome.wustl.edu	37	12	75444928	75444928	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr12:75444928T>A	ENST00000549446.1	-	3	1537	c.857A>T	c.(856-858)gAa>gTa	p.E286V	KCNC2_ENST00000550433.1_Missense_Mutation_p.E286V|KCNC2_ENST00000548243.1_5'Flank|KCNC2_ENST00000298972.1_Missense_Mutation_p.E286V|KCNC2_ENST00000548513.1_Missense_Mutation_p.E286V|KCNC2_ENST00000350228.2_Missense_Mutation_p.E286V|KCNC2_ENST00000540018.1_Missense_Mutation_p.E286V|KCNC2_ENST00000393288.2_Missense_Mutation_p.E286V|KCNC2_ENST00000341669.3_Missense_Mutation_p.E286V	NM_001260497.1|NM_139137.3	NP_001247426.1|NP_631875.1	Q96PR1	KCNC2_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 2	286					action potential (GO:0001508)|energy reserve metabolic process (GO:0006112)|protein homooligomerization (GO:0051260)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(3)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(28)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	54					Dalfampridine(DB06637)	ACACACTCCTTCTACATACGT	0.348																																						dbGAP											0													161.0	143.0	149.0					12																	75444928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF268896	CCDS9005.1, CCDS9006.1, CCDS9007.1, CCDS58255.1, CCDS58256.1, CCDS58257.1	12q14.1	2012-07-05						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6234	protein-coding gene	gene with protein product		176256				8111118, 16382104	Standard	NM_139136		Approved	Kv3.2	uc001sxg.2	Q96PR1	OTTHUMG00000169717	ENST00000549446.1:c.857A>T	12.37:g.75444928T>A	ENSP00000449253:p.Glu286Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z231|F5H030|J3KPP5|Q4LE77|Q86W09|Q8N1V9|Q96PR0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv	p.E286V	ENST00000549446.1	37	c.857	CCDS9007.1	12	.	.	.	.	.	.	.	.	.	.	T	20.6	4.019696	0.75275	.	.	ENSG00000166006	ENST00000550433;ENST00000548513;ENST00000549446;ENST00000341669;ENST00000298972;ENST00000350228;ENST00000540018;ENST00000393288	D;D;D;D;D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68	5.52	5.52	0.82312	Ion transport (1);	0.000000	0.64402	D	0.000002	D	0.99223	0.9730	H	0.97659	4.05	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;0.998	D	0.98911	1.0780	10	0.87932	D	0	.	15.5986	0.76606	0.0:0.0:0.0:1.0	.	286;286;286;286;286	F5H030;Q96PR1-2;Q96PR1;Q96PR1-4;Q96PR1-3	.;.;KCNC2_HUMAN;.;.	V	286	ENSP00000448301:E286V;ENSP00000449941:E286V;ENSP00000449253:E286V;ENSP00000340121:E286V;ENSP00000298972:E286V;ENSP00000319877:E286V;ENSP00000438423:E286V;ENSP00000376966:E286V	ENSP00000298972:E286V	E	-	2	0	KCNC2	73731195	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.013000	0.88655	2.218000	0.71995	0.533000	0.62120	GAA	KCNC2	-	pfam_Ion_trans_dom,prints_K_chnl	ENSG00000166006		0.348	KCNC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNC2	HGNC	protein_coding	OTTHUMT00000405581.2	83	0.00	0	T	NM_153748		75444928	75444928	-1	no_errors	ENST00000549446	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	1.000	A
KIAA1211	57482	genome.wustl.edu	37	4	57181137	57181137	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr4:57181137C>G	ENST00000504228.1	+	6	1574	c.1469C>G	c.(1468-1470)cCt>cGt	p.P490R	KIAA1211_ENST00000541073.1_Missense_Mutation_p.P483R|KIAA1211_ENST00000264229.6_Missense_Mutation_p.P490R			Q6ZU35	K1211_HUMAN	KIAA1211	490	Glu-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					GACACGGAGCCTCTCCTGAAA	0.662																																						dbGAP											0													11.0	16.0	15.0					4																	57181137		1935	4105	6040	-	-	-	SO:0001583	missense	0			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.1469C>G	4.37:g.57181137C>G	ENSP00000423366:p.Pro490Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	NULL	p.P490R	ENST00000504228.1	37	c.1469	CCDS43230.1	4	.	.	.	.	.	.	.	.	.	.	C	12.58	1.981950	0.34942	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.11604	2.77;2.77;2.76	4.59	-2.53	0.06326	.	.	.	.	.	T	0.07863	0.0197	L	0.27053	0.805	0.09310	N	1	P;P;P	0.51351	0.944;0.944;0.867	P;P;P	0.47744	0.55;0.55;0.556	T	0.22208	-1.0223	9	0.31617	T	0.26	1.083	3.0185	0.06067	0.554:0.1789:0.1109:0.1562	.	483;483;490	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	R	490;490;483;400	ENSP00000264229:P490R;ENSP00000423366:P490R;ENSP00000444006:P483R	ENSP00000264229:P490R	P	+	2	0	KIAA1211	56875894	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.474000	0.06607	-0.444000	0.07170	0.462000	0.41574	CCT	KIAA1211	-	NULL	ENSG00000109265		0.662	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	8	0.00	0	C	NM_020722		57181137	57181137	+1	no_errors	ENST00000504228	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	0.000	G
LEPRE1	64175	genome.wustl.edu	37	1	43220572	43220572	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:43220572T>C	ENST00000296388.5	-	8	1364	c.1313A>G	c.(1312-1314)gAg>gGg	p.E438G	LEPRE1_ENST00000236040.4_Missense_Mutation_p.E438G|LEPRE1_ENST00000397054.3_Missense_Mutation_p.E438G			Q32P28	P3H1_HUMAN	leucine proline-enriched proteoglycan (leprecan) 1	438					bone development (GO:0060348)|cell growth (GO:0016049)|chaperone-mediated protein folding (GO:0061077)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|negative regulation of post-translational protein modification (GO:1901874)|peptidyl-proline hydroxylation (GO:0019511)|protein folding (GO:0006457)|protein hydroxylation (GO:0018126)|protein stabilization (GO:0050821)|regulation of ossification (GO:0030278)|regulation of protein secretion (GO:0050708)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|macromolecular complex (GO:0032991)|membrane (GO:0016020)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)|protein complex binding (GO:0032403)			large_intestine(2)|lung(15)|ovary(5)|prostate(1)|urinary_tract(3)	26	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	ATCCAGTGACTCCTTGGTCTT	0.542																																						dbGAP											0													137.0	118.0	124.0					1																	43220572		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027648	CCDS472.2, CCDS53307.1, CCDS57986.1	1p34.1	2014-09-17			ENSG00000117385	ENSG00000117385			19316	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 1"", ""growth suppressor 1"""	610339				10951563	Standard	NM_022356		Approved	GROS1, P3H1, LEPRECAN, MGC117314	uc001chx.4	Q32P28	OTTHUMG00000007525	ENST00000296388.5:c.1313A>G	1.37:g.43220572T>C	ENSP00000296388:p.Glu438Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7KZR4|Q96BR8|Q96SK8|Q96SL5|Q96SN3|Q9H6K3|Q9HC86|Q9HC87	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.E438G	ENST00000296388.5	37	c.1313	CCDS472.2	1	.	.	.	.	.	.	.	.	.	.	T	24.4	4.526508	0.85600	.	.	ENSG00000117385	ENST00000397054;ENST00000236040;ENST00000296388;ENST00000540027	T;T;T	0.65549	-0.16;-0.16;-0.16	5.57	4.41	0.53225	.	0.104671	0.64402	D	0.000005	T	0.71031	0.3292	L	0.59436	1.845	0.49582	D	0.999804	D;D;D	0.65815	0.995;0.963;0.963	D;P;P	0.63033	0.91;0.576;0.704	T	0.68812	-0.5310	10	0.38643	T	0.18	-30.9219	10.8901	0.46990	0.0:0.0:0.1579:0.842	.	438;303;438	Q32P28-3;B4DNM8;Q32P28	.;.;P3H1_HUMAN	G	438;438;438;303	ENSP00000380245:E438G;ENSP00000236040:E438G;ENSP00000296388:E438G	ENSP00000236040:E438G	E	-	2	0	LEPRE1	42993159	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.467000	0.80930	0.901000	0.36495	0.379000	0.24179	GAG	LEPRE1	-	NULL	ENSG00000117385		0.542	LEPRE1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LEPRE1	HGNC	protein_coding	OTTHUMT00000019790.2	72	0.00	0	T	NM_022356		43220572	43220572	-1	no_errors	ENST00000236040	ensembl	human	known	69_37n	missense	68	23.60	21	SNP	1.000	C
LPXN	9404	genome.wustl.edu	37	11	58317469	58317469	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr11:58317469A>C	ENST00000395074.2	-	6	725	c.637T>G	c.(637-639)Tac>Gac	p.Y213D	LPXN_ENST00000528954.1_Missense_Mutation_p.Y218D|LPXN_ENST00000528489.1_Missense_Mutation_p.Y193D	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	213	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				GCAGCGCAGTAAGCACAGCGT	0.502																																						dbGAP											0													108.0	104.0	105.0					11																	58317469		2201	4295	6496	-	-	-	SO:0001583	missense	0			AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.637T>G	11.37:g.58317469A>C	ENSP00000378512:p.Tyr213Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8B4|B4DV71|Q53FW6|Q6FI07	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pirsf_Leupaxin,pfscan_Znf_LIM	p.Y218D	ENST00000395074.2	37	c.652	CCDS7969.1	11	.	.	.	.	.	.	.	.	.	.	A	27.3	4.819406	0.90873	.	.	ENSG00000110031	ENST00000528954;ENST00000395074	D;D	0.86694	-2.16;-2.16	5.95	5.95	0.96441	Zinc finger, LIM-type (5);	0.000000	0.85682	D	0.000000	D	0.91586	0.7342	L	0.55481	1.735	0.80722	D	1	D;D;D	0.89917	0.991;1.0;0.997	D;D;D	0.97110	0.937;1.0;0.965	D	0.90991	0.4835	10	0.41790	T	0.15	.	15.4063	0.74881	1.0:0.0:0.0:0.0	.	193;218;213	B7Z5P7;B4DV71;O60711	.;.;LPXN_HUMAN	D	218;213	ENSP00000431284:Y218D;ENSP00000378512:Y213D	ENSP00000378512:Y213D	Y	-	1	0	LPXN	58074045	1.000000	0.71417	0.998000	0.56505	0.861000	0.49209	8.889000	0.92470	2.279000	0.76181	0.533000	0.62120	TAC	LPXN	-	pfam_Znf_LIM,smart_Znf_LIM,pirsf_Leupaxin,pfscan_Znf_LIM	ENSG00000110031		0.502	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPXN	HGNC	protein_coding	OTTHUMT00000394709.1	35	0.00	0	A	NM_004811		58317469	58317469	-1	no_errors	ENST00000528954	ensembl	human	known	69_37n	missense	22	46.34	19	SNP	1.000	C
LRRC71	149499	genome.wustl.edu	37	1	156901797	156901797	+	Silent	SNP	C	C	A	rs570343284		TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:156901797C>A	ENST00000337428.7	+	13	1573	c.1419C>A	c.(1417-1419)gtC>gtA	p.V473V	LRRC71_ENST00000490146.1_3'UTR|ARHGEF11_ENST00000487682.1_5'Flank	NM_144702.2	NP_653303.2	Q8N4P6	LRC71_HUMAN	leucine rich repeat containing 71	473										endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|stomach(1)	12						GGAACAAGGTCCTTTTGCACC	0.572																																						dbGAP											0													79.0	83.0	82.0					1																	156901797		2057	4188	6245	-	-	-	SO:0001819	synonymous_variant	0			BC033790	CCDS44249.1	1q23.1	2011-02-14	2011-02-14	2011-02-14	ENSG00000160838	ENSG00000160838			26556	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 92"""	C1orf92		14702039	Standard	NM_144702		Approved	FLJ32884	uc001fqm.2	Q8N4P6	OTTHUMG00000041298	ENST00000337428.7:c.1419C>A	1.37:g.156901797C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96M24	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.V473	ENST00000337428.7	37	c.1419	CCDS44249.1	1																																																																																			LRRC71	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000160838		0.572	LRRC71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC71	HGNC	protein_coding	OTTHUMT00000098961.1	56	0.00	0	C	NM_144702		156901797	156901797	+1	no_errors	ENST00000337428	ensembl	human	known	69_37n	silent	80	23.81	25	SNP	1.000	A
LTBP2	4053	genome.wustl.edu	37	14	74967607	74967607	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr14:74967607delG	ENST00000261978.4	-	36	5832	c.5446delC	c.(5446-5448)cacfs	p.H1816fs	LTBP2_ENST00000556690.1_Frame_Shift_Del_p.H1772fs	NM_000428.2	NP_000419.1	Q14767	LTBP2_HUMAN	latent transforming growth factor beta binding protein 2	1816	EGF-like 20; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein secretion (GO:0009306)|protein targeting (GO:0006605)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|heparin binding (GO:0008201)	p.H1816fs*>7(2)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|liver(1)|lung(29)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58				BRCA - Breast invasive adenocarcinoma(234;0.00219)|READ - Rectum adenocarcinoma(1;0.0649)		GCAGTGCAGTGGGGGGGCCCT	0.617																																						dbGAP											2	Insertion - Frameshift(2)	haematopoietic_and_lymphoid_tissue(2)											46.0	45.0	45.0					14																	74967607		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS9831.1	14q24.3	2011-10-20	2001-12-04			ENSG00000119681		"""Latent transforming growth factor, beta binding proteins"""	6715	protein-coding gene	gene with protein product		602091	"""chromosome 14 open reading frame 141"""	LTBP3, C14orf141		7798248	Standard	NM_000428		Approved		uc001xqa.3	Q14767		ENST00000261978.4:c.5446delC	14.37:g.74967607delG	ENSP00000261978:p.His1816fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99907|Q9NS51	Frame_Shift_Del	DEL	pfam_EGF-like_Ca-bd,pfam_TB_dom,pfam_EGF-like_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.H1816fs	ENST00000261978.4	37	c.5446	CCDS9831.1	14																																																																																			LTBP2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000119681		0.617	LTBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP2	HGNC	protein_coding	OTTHUMT00000413595.1	21	0.00	0	G	NM_000428		74967607	74967607	-1	no_errors	ENST00000261978	ensembl	human	known	69_37n	frame_shift_del	9	18.18	2	DEL	0.817	-
MAP1A	4130	genome.wustl.edu	37	15	43821506	43821506	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr15:43821506A>C	ENST00000300231.5	+	4	8285	c.7835A>C	c.(7834-7836)aAg>aCg	p.K2612T	MAP1A_ENST00000399453.1_Missense_Mutation_p.K2612T|MAP1A_ENST00000382031.1_Missense_Mutation_p.K2850T			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	2612					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	GCCCCAGGCAAGGCCAAGCCA	0.652																																						dbGAP											0													47.0	59.0	55.0					15																	43821506		2002	4162	6164	-	-	-	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.7835A>C	15.37:g.43821506A>C	ENSP00000300231:p.Lys2612Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.K2612T	ENST00000300231.5	37	c.7835	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	A	8.076	0.771415	0.16051	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01787	4.64;4.66;4.65	5.14	0.918	0.19386	.	.	.	.	.	T	0.02848	0.0085	L	0.52011	1.625	0.29536	N	0.852456	P	0.44478	0.836	P	0.45276	0.475	T	0.35599	-0.9782	9	0.52906	T	0.07	-9.9596	8.0226	0.30419	0.5511:0.0:0.4489:0.0	.	2612	P78559	MAP1A_HUMAN	T	2850;2612;2612	ENSP00000371462:K2850T;ENSP00000382380:K2612T;ENSP00000300231:K2612T	ENSP00000300231:K2612T	K	+	2	0	MAP1A	41608798	1.000000	0.71417	0.998000	0.56505	0.959000	0.62525	3.019000	0.49635	0.325000	0.23359	-0.624000	0.04008	AAG	MAP1A	-	NULL	ENSG00000166963		0.652	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	21	0.00	0	A	NM_002373		43821506	43821506	+1	no_errors	ENST00000399453	ensembl	human	known	69_37n	missense	2	84.62	11	SNP	1.000	C
PRKG1	5592	genome.wustl.edu	37	10	53059335	53059335	+	Intron	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr10:53059335C>G	ENST00000401604.2	+	2	627				RP11-539E19.2_ENST00000419889.1_RNA|MIR605_ENST00000385078.1_RNA|PRKG1_ENST00000373980.4_Intron|PRKG1_ENST00000373985.1_Intron			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I						actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TGTCTCTAGCCCTAGCTTGGT	0.443																																						dbGAP											0													39.0	37.0	38.0					10																	53059335		1535	3524	5059	-	-	-	SO:0001627	intron_variant	0				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.433+146245C>G	10.37:g.53059335C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	RNA	SNP	-	NULL	ENST00000401604.2	37	NULL	CCDS44399.1	10																																																																																			MIR605	-	-	ENSG00000207813		0.443	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR605	HGNC	protein_coding		35	0.00	0	C			53059335	53059335	+1	no_errors	ENST00000385078	ensembl	human	known	69_37n	rna	27	41.30	19	SNP	0.001	G
MRPL9	65005	genome.wustl.edu	37	1	151734858	151734858	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:151734858C>A	ENST00000368830.3	-	3	513	c.429G>T	c.(427-429)gaG>gaT	p.E143D	MRPL9_ENST00000368829.3_Missense_Mutation_p.E143D|RP11-98D18.15_ENST00000601684.1_RNA|OAZ3_ENST00000453029.2_5'Flank|OAZ3_ENST00000321531.5_5'Flank|OAZ3_ENST00000315067.8_5'Flank|MRPL9_ENST00000467306.1_5'UTR|RP11-98D18.3_ENST00000512280.1_RNA|OAZ3_ENST00000479764.1_5'Flank	NM_031420.2	NP_113608.1	Q9BYD2	RM09_HUMAN	mitochondrial ribosomal protein L9	143					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	12	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TCACCAATTTCTCCTCTTCAA	0.433																																						dbGAP											0													110.0	110.0	110.0					1																	151734858		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026363	CCDS1003.1, CCDS72916.1	1q21	2012-09-13			ENSG00000143436	ENSG00000143436		"""Mitochondrial ribosomal proteins / large subunits"""	14277	protein-coding gene	gene with protein product		611824					Standard	XM_005245455		Approved		uc001eyv.3	Q9BYD2	OTTHUMG00000013063	ENST00000368830.3:c.429G>T	1.37:g.151734858C>A	ENSP00000357823:p.Glu143Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD99|Q5SZR2|Q9BSW8	Missense_Mutation	SNP	pfam_Ribosomal_L9_N,superfamily_Ribosomal_L9/RNase_H1_N	p.E143D	ENST00000368830.3	37	c.429	CCDS1003.1	1	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965797	0.74131	.	.	ENSG00000143436	ENST00000368830;ENST00000368829	T;T	0.35605	1.3;1.31	4.94	4.94	0.65067	Ribosomal protein L9/RNase H1, N-terminal (1);Ribosomal protein L9, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.52468	0.1736	M	0.80183	2.485	0.36382	D	0.861975	D;B	0.76494	0.999;0.397	D;B	0.70935	0.971;0.189	T	0.58999	-0.7536	10	0.59425	D	0.04	-29.5454	13.565	0.61813	0.0:1.0:0.0:0.0	.	143;143	B4DDZ7;Q9BYD2	.;RM09_HUMAN	D	143	ENSP00000357823:E143D;ENSP00000357822:E143D	ENSP00000357822:E143D	E	-	3	2	MRPL9	150001482	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	1.250000	0.32850	2.571000	0.86741	0.650000	0.86243	GAG	MRPL9	-	superfamily_Ribosomal_L9/RNase_H1_N	ENSG00000143436		0.433	MRPL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL9	HGNC	protein_coding	OTTHUMT00000036653.2	68	0.00	0	C	NM_031420		151734858	151734858	-1	no_errors	ENST00000368830	ensembl	human	known	69_37n	missense	97	28.15	38	SNP	1.000	A
MUC4	4585	genome.wustl.edu	37	3	195515927	195515927	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr3:195515927G>C	ENST00000463781.3	-	2	2983	c.2524C>G	c.(2524-2526)Cag>Gag	p.Q842E	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.Q842E|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	847	Ser-rich.				cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTTGTTGACTGGGTTGTGTGA	0.562																																						dbGAP											0													68.0	75.0	72.0					3																	195515927		2124	4227	6351	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.2524C>G	3.37:g.195515927G>C	ENSP00000417498:p.Gln842Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.Q842E	ENST00000463781.3	37	c.2524	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	4.113	0.019156	0.08006	.	.	ENSG00000145113	ENST00000463781;ENST00000475231;ENST00000392409	T;T	0.42513	0.97;0.99	2.85	0.981	0.19756	.	3.154940	0.00964	N	0.003148	T	0.27731	0.0682	L	0.29908	0.895	0.09310	N	1	P;P	0.44090	0.826;0.779	B;B	0.40825	0.341;0.145	T	0.27806	-1.0063	10	0.02654	T	1	-0.1642	4.243	0.10658	0.137:0.2382:0.6247:0.0	.	842;847	E7ESK3;Q99102	.;MUC4_HUMAN	E	842;842;816	ENSP00000417498:Q842E;ENSP00000420243:Q842E	ENSP00000376209:Q816E	Q	-	1	0	MUC4	197000322	0.001000	0.12720	0.001000	0.08648	0.006000	0.05464	0.146000	0.16180	0.254000	0.21573	0.627000	0.83407	CAG	MUC4	-	NULL	ENSG00000145113		0.562	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	58	0.00	0	G	NM_018406		195515927	195515927	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.006	C
MYH7B	57644	genome.wustl.edu	37	20	33584219	33584219	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr20:33584219C>G	ENST00000262873.7	+	27	3232	c.3140C>G	c.(3139-3141)gCg>gGg	p.A1047G		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1005						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GAGAAGAAGGCGTTGCAGGAG	0.657																																						dbGAP											0													26.0	31.0	29.0					20																	33584219		2200	4297	6497	-	-	-	SO:0001583	missense	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.3140C>G	20.37:g.33584219C>G	ENSP00000262873:p.Ala1047Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.A1047G	ENST00000262873.7	37	c.3140	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	24.8	4.566161	0.86439	.	.	ENSG00000078814	ENST00000262873	D	0.87729	-2.29	4.41	3.46	0.39613	.	0.000000	0.32190	N	0.006448	D	0.87908	0.6296	M	0.82517	2.595	0.48511	D	0.999667	D	0.53745	0.962	B	0.43331	0.416	D	0.89260	0.3597	10	0.87932	D	0	.	12.5659	0.56310	0.0:0.9193:0.0:0.0807	.	1005	A7E2Y1	MYH7B_HUMAN	G	1047	ENSP00000262873:A1047G	ENSP00000262873:A1047G	A	+	2	0	MYH7B	33047880	1.000000	0.71417	0.864000	0.33941	0.970000	0.65996	7.647000	0.83462	1.223000	0.43536	0.655000	0.94253	GCG	MYH7B	-	superfamily_tRNA-bd_arm	ENSG00000078814		0.657	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	13	0.00	0	C	NM_020884		33584219	33584219	+1	no_errors	ENST00000262873	ensembl	human	novel	69_37n	missense	13	51.85	14	SNP	1.000	G
MYOCD	93649	genome.wustl.edu	37	17	12659782	12659782	+	Intron	SNP	A	A	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr17:12659782A>G	ENST00000343344.4	+	11	2058				AC005358.1_ENST00000609971.1_Missense_Mutation_p.S608G|MYOCD_ENST00000395988.1_3'UTR|MYOCD_ENST00000425538.1_Missense_Mutation_p.S704G			Q8IZQ8	MYCD_HUMAN	myocardin						cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		CCATTCTTCCAGCCTCCACCC	0.547																																						dbGAP											0													58.0	54.0	55.0					17																	12659782		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2059-1620A>G	17.37:g.12659782A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.S704G	ENST00000343344.4	37	c.2110	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	A	6.333	0.429512	0.11987	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000395988;ENST00000443061	T	0.44083	0.93	4.98	2.78	0.32641	.	0.417019	0.32473	N	0.006047	T	0.29126	0.0724	L	0.46157	1.445	0.24776	N	0.992844	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.23547	-1.0185	10	0.13108	T	0.6	-3.3776	6.2669	0.20932	0.8042:0.0:0.1958:0.0	.	423;608;704	E9PEP9;Q8IZQ8-2;Q8IZQ8-3	.;.;.	G	423;704;608;409	ENSP00000400148:S409G	ENSP00000379306:S423G	S	+	1	0	MYOCD	12600507	0.904000	0.30761	0.980000	0.43619	0.201000	0.24016	1.328000	0.33758	0.403000	0.25479	0.533000	0.62120	AGC	MYOCD	-	NULL	ENSG00000141052		0.547	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1	22	0.00	0	A	NM_153604		12659782	12659782	+1	no_errors	ENST00000425538	ensembl	human	known	69_37n	missense	6	71.43	15	SNP	0.843	G
MYOM3	127294	genome.wustl.edu	37	1	24400724	24400724	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:24400724T>C	ENST00000374434.3	-	23	3056	c.2894A>G	c.(2893-2895)gAt>gGt	p.D965G	MYOM3_ENST00000330966.7_Missense_Mutation_p.D966G|RP11-293P20.2_ENST00000439239.2_RNA|RP11-293P20.4_ENST00000429191.1_RNA|MYOM3_ENST00000329601.7_Missense_Mutation_p.D965G	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	965						M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GGTGCCCAAATCCTCGAGGCC	0.587																																						dbGAP											0													105.0	106.0	106.0					1																	24400724		2015	4183	6198	-	-	-	SO:0001583	missense	0			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.2894A>G	1.37:g.24400724T>C	ENSP00000363557:p.Asp965Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D966G	ENST00000374434.3	37	c.2897	CCDS41281.1	1	.	.	.	.	.	.	.	.	.	.	T	25.1	4.605897	0.87157	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.68181	-0.31;-0.31;-0.31	5.81	5.81	0.92471	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.82870	0.5131	M	0.82716	2.605	0.47819	D	0.999524	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.85544	0.1217	10	0.87932	D	0	.	14.7378	0.69430	0.0:0.0:0.0:1.0	.	965;965	Q5VTT5-2;Q5VTT5	.;MYOM3_HUMAN	G	965;966;965	ENSP00000363557:D965G;ENSP00000332670:D966G;ENSP00000328415:D965G	ENSP00000328415:D965G	D	-	2	0	MYOM3	24273311	1.000000	0.71417	0.893000	0.35052	0.953000	0.61014	6.288000	0.72679	2.210000	0.71456	0.533000	0.62120	GAT	MYOM3	-	smart_Ig_sub	ENSG00000142661		0.587	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYOM3	HGNC	protein_coding	OTTHUMT00000008272.2	48	0.00	0	T	NM_152372		24400724	24400724	-1	no_errors	ENST00000330966	ensembl	human	known	69_37n	missense	24	56.36	31	SNP	0.991	C
NCOR1	9611	genome.wustl.edu	37	17	15942922	15942922	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr17:15942922A>T	ENST00000268712.3	-	44	7037	c.6780T>A	c.(6778-6780)aaT>aaA	p.N2260K	AC002553.1_ENST00000442828.1_5'Flank|NCOR1_ENST00000395851.1_Missense_Mutation_p.N2157K|NCOR1_ENST00000395857.3_Missense_Mutation_p.N844K	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	2260	ID2. {ECO:0000250}.|Interaction with C1D. {ECO:0000250}.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CCAGCCCAAGATTACTGGCAG	0.448																																						dbGAP											0													73.0	62.0	66.0					17																	15942922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.6780T>A	17.37:g.15942922A>T	ENSP00000268712:p.Asn2260Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.N2260K	ENST00000268712.3	37	c.6780	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	A	11.06	1.526395	0.27299	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395857	T;T;T	0.59364	0.27;0.87;0.37	5.43	0.583	0.17417	.	0.000000	0.85682	D	0.000000	T	0.68274	0.2983	M	0.64997	1.995	0.58432	D	0.999998	D;D;D;D;D	0.89917	0.999;0.993;0.998;1.0;0.999	D;P;D;D;D	0.91635	0.993;0.823;0.993;0.999;0.997	T	0.65849	-0.6068	10	0.87932	D	0	-12.5771	9.1494	0.36953	0.6048:0.0:0.3952:0.0	.	2164;2260;2157;780;274	E7EVK1;O75376;O75376-2;Q86YY1;Q86YY2	.;NCOR1_HUMAN;.;.;.	K	2260;2157;2164;844	ENSP00000268712:N2260K;ENSP00000379192:N2157K;ENSP00000379198:N844K	ENSP00000268712:N2260K	N	-	3	2	NCOR1	15883647	0.999000	0.42202	0.937000	0.37676	0.764000	0.43329	0.877000	0.28106	-0.184000	0.10567	0.533000	0.62120	AAT	NCOR1	-	NULL	ENSG00000141027		0.448	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	42	0.00	0	A	NM_006311		15942922	15942922	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	5	78.26	18	SNP	0.997	T
NOTCH4	4855	genome.wustl.edu	37	6	32188059	32188059	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr6:32188059G>T	ENST00000375023.3	-	7	1300	c.1162C>A	c.(1162-1164)Ctc>Atc	p.L388I		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	388	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						TGGCACAGGAGTCCTGGAGGG	0.597																																						dbGAP											0													66.0	67.0	67.0					6																	32188059		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.1162C>A	6.37:g.32188059G>T	ENSP00000364163:p.Leu388Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.L388I	ENST00000375023.3	37	c.1162	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	G	7.505	0.653396	0.14580	.	.	ENSG00000204301	ENST00000375023	D	0.91686	-2.89	4.17	4.17	0.49024	EGF-like region, conserved site (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.36444	N	0.002589	D	0.89849	0.6834	N	0.25789	0.76	0.80722	D	1	D;B	0.71674	0.998;0.283	D;B	0.79108	0.992;0.018	D	0.87903	0.2692	10	0.22109	T	0.4	.	14.0125	0.64505	0.0:0.0:1.0:0.0	.	388;388	Q6P3V5;Q99466	.;NOTC4_HUMAN	I	388	ENSP00000364163:L388I	ENSP00000364163:L388I	L	-	1	0	NOTCH4	32296037	0.931000	0.31567	0.981000	0.43875	0.021000	0.10359	1.351000	0.34022	2.137000	0.66172	0.313000	0.20887	CTC	NOTCH4	-	smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Notch,pfscan_EG-like_dom	ENSG00000204301		0.597	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	32	0.00	0	G			32188059	32188059	-1	no_errors	ENST00000375023	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	0.964	T
NUDT3	11165	genome.wustl.edu	37	6	34256620	34256620	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr6:34256620C>G	ENST00000607016.1	-	5	740	c.429G>C	c.(427-429)ttG>ttC	p.L143F	RPS10-NUDT3_ENST00000605528.1_Missense_Mutation_p.L262F|RP11-513I15.6_ENST00000429998.2_lincRNA	NM_006703.3	NP_006694.1	O95989	NUDT3_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 3	143					cell-cell signaling (GO:0007267)|diadenosine polyphosphate catabolic process (GO:0015961)|diphosphoinositol polyphosphate catabolic process (GO:0071544)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	diphosphoinositol-polyphosphate diphosphatase activity (GO:0008486)|inositol diphosphate tetrakisphosphate diphosphatase activity (GO:0052840)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 1-diphosphatase activity (GO:0052846)|inositol-1,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052847)|inositol-1-diphosphate-2,3,4,5,6-pentakisphosphate diphosphatase activity (GO:0052843)|inositol-3,5-bisdiphosphate-2,3,4,6-tetrakisphosphate 5-diphosphatase activity (GO:0052848)|inositol-3-diphosphate-1,2,4,5,6-pentakisphosphate diphosphatase activity (GO:0052844)|inositol-5-diphosphate-1,2,3,4,6-pentakisphosphate diphosphatase activity (GO:0052845)|magnesium ion binding (GO:0000287)			lung(2)	2						AGCCTTGCCTCAATGTTTCAA	0.488																																					GBM(96;1206 1939 18658 39482)	dbGAP											0													195.0	165.0	175.0					6																	34256620		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF062530	CCDS4791.1	6p21.2	2014-07-16			ENSG00000272325	ENSG00000272325		"""Nudix motif containing"""	8050	protein-coding gene	gene with protein product		609228				9822604	Standard	NM_006703		Approved	DIPP		O95989	OTTHUMG00000014545	ENST00000607016.1:c.429G>C	6.37:g.34256620C>G	ENSP00000476119:p.Leu143Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8N4	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.L143F	ENST00000607016.1	37	c.429	CCDS4791.1	6	.	.	.	.	.	.	.	.	.	.	C	19.05	3.750985	0.69533	.	.	ENSG00000112664	ENST00000358797	T	0.36878	1.23	5.99	5.12	0.69794	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.000000	0.64402	D	0.000001	T	0.46249	0.1383	L	0.55213	1.73	0.50632	D	0.999889	D	0.76494	0.999	D	0.79784	0.993	T	0.50915	-0.8771	10	0.62326	D	0.03	-10.8748	15.4334	0.75121	0.0:0.9336:0.0:0.0664	.	143	O95989	NUDT3_HUMAN	F	143	ENSP00000351650:L143F	ENSP00000351650:L143F	L	-	3	2	NUDT3	34364598	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	2.259000	0.43259	1.540000	0.49301	0.655000	0.94253	TTG	NUDT3	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000112664		0.488	NUDT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT3	HGNC	protein_coding	OTTHUMT00000040224.2	77	0.00	0	C			34256620	34256620	-1	no_errors	ENST00000358797	ensembl	human	known	69_37n	missense	65	44.44	52	SNP	1.000	G
OCSTAMP	128506	genome.wustl.edu	37	20	45174574	45174574	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr20:45174574G>A	ENST00000279028.2	-	2	452	c.439C>T	c.(439-441)Cag>Tag	p.Q147*		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	147					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						CTCAGCACCTGCCCGGCCGCA	0.672																																						dbGAP											0													35.0	41.0	39.0					20																	45174574		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.439C>T	20.37:g.45174574G>A	ENSP00000279028:p.Gln147*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_DC_STAMP-like	p.Q147*	ENST00000279028.2	37	c.439	CCDS54468.1	20	.	.	.	.	.	.	.	.	.	.	G	19.57	3.852943	0.71719	.	.	ENSG00000149635	ENST00000279028	.	.	.	4.59	4.59	0.56863	.	0.360356	0.29515	N	0.011928	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-7.9967	10.9463	0.47301	0.0:0.1379:0.72:0.1421	.	.	.	.	X	147	.	ENSP00000279028:Q147X	Q	-	1	0	C20orf123	44607981	0.936000	0.31750	0.990000	0.47175	0.694000	0.40290	2.568000	0.45965	2.368000	0.80403	0.561000	0.74099	CAG	OCSTAMP	-	NULL	ENSG00000149635		0.672	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2	18	0.00	0	G	XM_496476		45174574	45174574	-1	no_errors	ENST00000279028	ensembl	human	known	69_37n	nonsense	4	73.33	11	SNP	0.471	A
OR4B1	119765	genome.wustl.edu	37	11	48238902	48238902	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr11:48238902C>G	ENST00000309562.2	+	1	559	c.541C>G	c.(541-543)Cct>Gct	p.P181A		NM_001005470.1	NP_001005470.1	Q8NGF8	OR4B1_HUMAN	olfactory receptor, family 4, subfamily B, member 1	181						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(3)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	28						TGACCTCCAGCCTTTATTCAA	0.473																																						dbGAP											0													153.0	145.0	148.0					11																	48238902		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065848	CCDS31485.1	11p11.2	2012-08-09			ENSG00000175619	ENSG00000175619		"""GPCR / Class A : Olfactory receptors"""	8290	protein-coding gene	gene with protein product							Standard	NM_001005470		Approved	OST208	uc010rhs.2	Q8NGF8	OTTHUMG00000166576	ENST00000309562.2:c.541C>G	11.37:g.48238902C>G	ENSP00000311605:p.Pro181Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF75|Q96R64	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P181A	ENST00000309562.2	37	c.541	CCDS31485.1	11	.	.	.	.	.	.	.	.	.	.	C	7.780	0.709248	0.15239	.	.	ENSG00000175619	ENST00000309562	T	0.00188	8.59	5.54	4.63	0.57726	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000056	T	0.00468	0.0015	M	0.64260	1.97	0.09310	N	1	D	0.55800	0.973	D	0.64506	0.926	T	0.50363	-0.8837	10	0.72032	D	0.01	.	14.3946	0.67003	0.0:0.8512:0.1488:0.0	.	181	Q8NGF8	OR4B1_HUMAN	A	181	ENSP00000311605:P181A	ENSP00000311605:P181A	P	+	1	0	OR4B1	48195478	0.001000	0.12720	0.042000	0.18584	0.047000	0.14425	0.665000	0.25083	1.346000	0.45694	-0.302000	0.09304	CCT	OR4B1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000175619		0.473	OR4B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4B1	HGNC	protein_coding	OTTHUMT00000390554.1	42	0.00	0	C	NM_001005470		48238902	48238902	+1	no_errors	ENST00000309562	ensembl	human	known	69_37n	missense	54	33.73	28	SNP	0.002	G
PDE4DIP	9659	genome.wustl.edu	37	1	144931537	144931537	+	Intron	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:144931537G>C	ENST00000369354.3	-	6	826				PDE4DIP_ENST00000479408.2_Intron|PDE4DIP_ENST00000313382.9_Intron|PDE4DIP_ENST00000529945.1_Missense_Mutation_p.L58V|PDE4DIP_ENST00000369359.4_Intron|PDE4DIP_ENST00000369351.3_Intron|PDE4DIP_ENST00000313431.9_Missense_Mutation_p.L58V|PDE4DIP_ENST00000369349.3_Intron|PDE4DIP_ENST00000530740.1_Intron|PDE4DIP_ENST00000369356.4_Intron			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein						cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		ATTCGATCAAGCATGAAAGCA	0.512			T	PDGFRB	MPD																																	dbGAP		Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	0													104.0	107.0	106.0					1																	144931537		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.637-7716C>G	1.37:g.144931537G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L58V	ENST00000369354.3	37	c.172	CCDS30824.1	1	.	.	.	.	.	.	.	.	.	.	G	21.0	4.079255	0.76528	.	.	ENSG00000178104	ENST00000369353;ENST00000313431;ENST00000529945	T;T	0.35421	1.31;1.35	5.3	5.3	0.74995	.	.	.	.	.	T	0.47764	0.1463	L	0.49126	1.545	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.49698	-0.8912	9	0.87932	D	0	.	16.4367	0.83878	0.0:0.0:1.0:0.0	.	58	Q5VU43-2	.	V	58	ENSP00000316434:L58V;ENSP00000433392:L58V	ENSP00000316434:L58V	L	-	1	0	PDE4DIP	143642894	1.000000	0.71417	0.998000	0.56505	0.801000	0.45260	7.972000	0.88022	2.467000	0.83353	0.462000	0.41574	CTT	PDE4DIP	-	NULL	ENSG00000178104		0.512	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	43	0.00	0	G	NM_022359		144931537	144931537	-1	no_errors	ENST00000313431	ensembl	human	known	69_37n	missense	47	21.67	13	SNP	1.000	C
PIEZO1	9780	genome.wustl.edu	37	16	88805107	88805107	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr16:88805107G>C	ENST00000301015.9	-	6	749	c.503C>G	c.(502-504)gCa>gGa	p.A168G	RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.7_ENST00000566114.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	168					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CTGCAGCCCTGCCGTCGGGCT	0.667																																						dbGAP											0													39.0	41.0	40.0					16																	88805107		692	1590	2282	-	-	-	SO:0001583	missense	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.503C>G	16.37:g.88805107G>C	ENSP00000301015:p.Ala168Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_DUF3595	p.A168G	ENST00000301015.9	37	c.503	CCDS54058.1	16	.	.	.	.	.	.	.	.	.	.	G	9.666	1.145506	0.21288	.	.	ENSG00000103335	ENST00000301015	T	0.72505	-0.66	3.92	-7.84	0.01196	.	.	.	.	.	T	0.36468	0.0968	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.33828	-0.9853	9	0.07990	T	0.79	.	4.0757	0.09902	0.5405:0.1041:0.2506:0.1049	.	168	Q92508	PIEZ1_HUMAN	G	168	ENSP00000301015:A168G	ENSP00000301015:A168G	A	-	2	0	FAM38A	87332608	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-1.916000	0.01576	-1.137000	0.02888	0.462000	0.41574	GCA	PIEZO1	-	NULL	ENSG00000103335		0.667	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	17	0.00	0	G	NM_014745		88805107	88805107	-1	no_errors	ENST00000301015	ensembl	human	novel	69_37n	missense	1	85.71	6	SNP	0.000	C
PKD2	5311	genome.wustl.edu	37	4	88940608	88940608	+	Splice_Site	SNP	A	A	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr4:88940608A>C	ENST00000237596.2	+	2	661		c.e2-1			NM_000297.3	NP_000288.1	Q9BZL6	KPCD2_HUMAN	polycystic kidney disease 2 (autosomal dominant)						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|liver(2)|lung(15)|skin(4)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)|Acute lymphoblastic leukemia(40;0.221)		OV - Ovarian serous cystadenocarcinoma(123;9.98e-10)|COAD - Colon adenocarcinoma(81;0.0237)		ATTATTTTAAAGGTCTCTGGG	0.333																																						dbGAP											0													53.0	53.0	53.0					4																	88940608		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U50928	CCDS3627.1	4q22.1	2014-01-28			ENSG00000118762	ENSG00000118762		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""EF-hand domain containing"""	9009	protein-coding gene	gene with protein product	"""transient receptor potential cation channel, subfamily P, member 2"""	173910				8298643	Standard	NM_000297		Approved	PKD4, PC2, Pc-2, TRPP2	uc003hre.3	Q13563	OTTHUMG00000160982	ENST00000237596.2:c.596-1A>C	4.37:g.88940608A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB08|Q9P0T6|Q9Y3X8	Splice_Site	SNP	-	e2-2	ENST00000237596.2	37	c.596-2	CCDS3627.1	4	.	.	.	.	.	.	.	.	.	.	A	21.2	4.110505	0.77210	.	.	ENSG00000118762	ENST00000237596	.	.	.	5.9	5.9	0.94986	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.562	0.68148	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PKD2	89159632	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	6.225000	0.72271	2.251000	0.74343	0.528000	0.53228	.	PKD2	-	-	ENSG00000118762		0.333	PKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD2	HGNC	protein_coding	OTTHUMT00000253042.4	38	0	0	A	NM_000297	Intron	88940608	88940608	+1	no_errors	ENST00000237596	ensembl	human	known	69_37n	splice_site	47	38.16	29	SNP	0.999	C
PLCZ1	89869	genome.wustl.edu	37	12	18852863	18852863	+	Silent	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr12:18852863G>A	ENST00000538330.1	-	6	766	c.385C>T	c.(385-387)Ctg>Ttg	p.L129L	PLCZ1_ENST00000542762.1_5'UTR|PLCZ1_ENST00000541695.1_Silent_p.L210L|PLCZ1_ENST00000266505.7_Silent_p.L347L|PLCZ1_ENST00000447925.2_Silent_p.L345L|PLCZ1_ENST00000435379.1_Silent_p.L152L|PLCZ1_ENST00000539875.1_Silent_p.L154L					phospholipase C, zeta 1											NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.0241)					GATAAGGCCAGAGCAATTTTT	0.269																																						dbGAP											0													32.0	34.0	33.0					12																	18852863		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			AY035866	CCDS8680.1	12p13.31	2013-01-10			ENSG00000139151	ENSG00000139151	3.1.4.11	"""EF-hand domain containing"""	19218	protein-coding gene	gene with protein product		608075				12117804	Standard	NM_033123		Approved	NYD-SP27, PLCzeta	uc021qvx.2	Q86YW0	OTTHUMG00000168937	ENST00000538330.1:c.385C>T	12.37:g.18852863G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.S218F	ENST00000538330.1	37	c.653		12																																																																																			PLCZ1	-	superfamily_PLC-like_Pdiesterase_TIM-brl	ENSG00000139151		0.269	PLCZ1-002	PUTATIVE	basic|exp_conf	protein_coding	PLCZ1	HGNC	protein_coding	OTTHUMT00000401666.3	47	0.00	0	G	NM_033123		18852863	18852863	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000540270	ensembl	human	known	69_37n	missense	38	37.70	23	SNP	0.017	A
POTEB	100996331	genome.wustl.edu	37	15	22077592	22077592	+	Missense_Mutation	SNP	T	T	C	rs28363950	byFrequency	TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr15:22077592T>C	ENST00000439682.1	-	3	689	c.638A>G	c.(637-639)gAa>gGa	p.E213G	POTEB_ENST00000553662.2_5'UTR	NM_001277304.1	NP_001264233.1	Q6S5H4	POTEB_HUMAN	POTE ankyrin domain family, member B	250										endometrium(2)|kidney(8)|lung(4)	14						TAATTTATCTTCATTGTAGAT	0.348																																						dbGAP											0													1.0	1.0	1.0					15																	22077592		194	310	504	-	-	-	SO:0001583	missense	0			AY465170	CCDS59250.1	15q11.2	2014-01-10	2008-11-26	2008-11-26	ENSG00000233917	ENSG00000233917		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33734	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 5"""	608912	"""ANKRD26-like family B, member 1"""	A26B1			Standard	NM_001277304		Approved	POTE15, POTE-15, CT104.5	uc031qqz.1	Q6S5H4		ENST00000439682.1:c.638A>G	15.37:g.22077592T>C	ENSP00000457689:p.Glu213Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NXN7|Q6S5H7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E213G	ENST00000439682.1	37	c.638	CCDS59250.1	15																																																																																			POTEB	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000233917		0.348	POTEB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEB	HGNC	protein_coding	OTTHUMT00000414911.2	11	0.00	0	T	NM_207355		22077592	22077592	-1	no_errors	ENST00000439682	ensembl	human	known	69_37n	missense	0	100.00	3	SNP	0.000	C
PRCC	5546	genome.wustl.edu	37	1	156737604	156737604	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:156737604C>T	ENST00000271526.4	+	1	313	c.41C>T	c.(40-42)cCg>cTg	p.P14L	HDGF_ENST00000465180.1_5'Flank|PRCC_ENST00000491853.1_Intron|PRCC_ENST00000353233.3_Missense_Mutation_p.P14L	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	14	Mediates interaction with MAD2L2.				mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)			PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GAGAGCGAGCCGGATGAGGCT	0.662			T	TFE3	papillary renal																																	dbGAP		Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	0													16.0	16.0	16.0					1																	156737604		2198	4298	6496	-	-	-	SO:0001583	missense	0			X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.41C>T	1.37:g.156737604C>T	ENSP00000271526:p.Pro14Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	pfam_PRCC_C	p.P14L	ENST00000271526.4	37	c.41	CCDS1157.1	1	.	.	.	.	.	.	.	.	.	.	C	19.99	3.929181	0.73327	.	.	ENSG00000143294	ENST00000271526;ENST00000353233	T;T	0.45668	0.89;0.89	5.55	5.55	0.83447	.	0.371959	0.27896	N	0.017402	T	0.20495	0.0493	L	0.44542	1.39	0.53688	D	0.999977	P;P	0.47545	0.897;0.897	B;B	0.29524	0.103;0.103	T	0.19192	-1.0313	10	0.66056	D	0.02	-14.7806	16.3527	0.83220	0.0:1.0:0.0:0.0	.	14;14	A6NG79;Q92733	.;PRCC_HUMAN	L	14	ENSP00000271526:P14L;ENSP00000339300:P14L	ENSP00000271526:P14L	P	+	2	0	PRCC	155004228	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.278000	0.58946	2.885000	0.99019	0.655000	0.94253	CCG	PRCC	-	NULL	ENSG00000143294		0.662	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRCC	HGNC	protein_coding	OTTHUMT00000098941.2	10	0.00	0	C	NM_005973		156737604	156737604	+1	no_errors	ENST00000271526	ensembl	human	known	69_37n	missense	9	59.09	13	SNP	1.000	T
PRDM7	11105	genome.wustl.edu	37	16	90142278	90142278	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr16:90142278T>C	ENST00000449207.2	-	1	60	c.41A>G	c.(40-42)gAc>gGc	p.D14G	PRDM7_ENST00000569206.1_Intron|PRDM7_ENST00000407825.1_5'UTR	NM_001098173.1	NP_001091643.1	Q9NQW5	PRDM7_HUMAN	PR domain containing 7	14					regulation of transcription, DNA-templated (GO:0006355)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleic acid binding (GO:0003676)			lung(2)|ovary(2)|stomach(1)	5		all_cancers(9;4.44e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.00118)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0278)		TCTCTCTGTGTCTCCTTCTGG	0.597																																						dbGAP											0													67.0	73.0	71.0					16																	90142278		1922	4129	6051	-	-	-	SO:0001583	missense	0			AF274347	CCDS45557.1	16q24.3	2013-01-09			ENSG00000126856	ENSG00000126856		"""Zinc fingers, C2H2-type"", ""-"""	9351	protein-coding gene	gene with protein product		609759				17916234	Standard	NM_001098173		Approved	ZNF910	uc010cje.3	Q9NQW5	OTTHUMG00000138990	ENST00000449207.2:c.41A>G	16.37:g.90142278T>C	ENSP00000396732:p.Asp14Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A4Q9G8|Q08EM4|Q9NQW4	Missense_Mutation	SNP	pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_SET_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.D14G	ENST00000449207.2	37	c.41	CCDS45557.1	16	.	.	.	.	.	.	.	.	.	.	.	8.041	0.763878	0.15914	.	.	ENSG00000126856	ENST00000449207;ENST00000414728	T	0.12361	2.69	1.39	0.241	0.15494	.	.	.	.	.	T	0.09512	0.0234	L	0.36672	1.1	0.09310	N	0.999999	P	0.48294	0.908	B	0.41860	0.368	T	0.21999	-1.0229	8	.	.	.	.	3.3974	0.07311	0.0:0.2399:0.0:0.7601	.	14	Q9NQW5	PRDM7_HUMAN	G	14	ENSP00000396732:D14G	.	D	-	2	0	PRDM7	88669779	0.002000	0.14202	0.001000	0.08648	0.006000	0.05464	0.306000	0.19279	0.037000	0.15575	-0.611000	0.04053	GAC	PRDM7	-	NULL	ENSG00000126856		0.597	PRDM7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM7	HGNC	protein_coding	OTTHUMT00000420560.1	60	0.00	0	T			90142278	90142278	-1	no_errors	ENST00000449207	ensembl	human	known	69_37n	missense	14	78.12	50	SNP	0.001	C
PRR21	643905	genome.wustl.edu	37	2	240982243	240982243	+	Missense_Mutation	SNP	G	G	A	rs80033040	byFrequency	TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr2:240982243G>A	ENST00000408934.1	-	1	156	c.157C>T	c.(157-159)Cgg>Tgg	p.R53W		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	53	Pro-rich.							p.R53W(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						GTGAAGAGCCGTGGATGAAGG	0.582																																						dbGAP											2	Substitution - Missense(2)	haematopoietic_and_lymphoid_tissue(2)											121.0	107.0	112.0					2																	240982243		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.157C>T	2.37:g.240982243G>A	ENSP00000386166:p.Arg53Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R53W	ENST00000408934.1	37	c.157	CCDS33417.1	2	.	.	.	.	.	.	.	.	.	.	N	7.137	0.581093	0.13686	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.13657	2.57;2.57	1.19	-1.7	0.08159	.	.	.	.	.	T	0.05640	0.0148	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35101	-0.9802	9	0.56958	D	0.05	.	2.7336	0.05234	0.2267:0.299:0.4742:0.0	.	53	Q8WXC7	PRR21_HUMAN	W	53	ENSP00000386166:R53W;ENSP00000418240:R53W	ENSP00000386166:R53W	R	-	1	2	PRR21	240630916	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.394000	0.07296	-0.428000	0.07339	-0.481000	0.04817	CGG	PRR21	-	NULL	ENSG00000221961		0.582	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR21	HGNC	protein_coding		180	0.55	1	G	NM_001080835		240982243	240982243	-1	no_errors	ENST00000408934	ensembl	human	known	69_37n	missense	70	12.50	10	SNP	0.000	A
PSMD12	5718	genome.wustl.edu	37	17	65340892	65340892	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr17:65340892G>T	ENST00000356126.3	-	9	1020	c.913C>A	c.(913-915)Ctt>Att	p.L305I	PSMD12_ENST00000357146.4_Missense_Mutation_p.L285I	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12	305	PCI.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					AGCTTTAAAAGATCCCTGAAA	0.323																																						dbGAP											0													45.0	44.0	44.0					17																	65340892		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.913C>A	17.37:g.65340892G>T	ENSP00000348442:p.Leu305Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP15|Q53HA2|Q6P053	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.L305I	ENST00000356126.3	37	c.913	CCDS11669.1	17	.	.	.	.	.	.	.	.	.	.	G	19.87	3.906963	0.72868	.	.	ENSG00000197170	ENST00000356126;ENST00000357146	T;T	0.48836	0.8;0.8	5.72	5.72	0.89469	Proteasome component (PCI) domain (1);	0.000000	0.85682	D	0.000000	T	0.59074	0.2167	M	0.73753	2.245	0.80722	D	1	P;P	0.36110	0.537;0.537	P;P	0.46917	0.531;0.531	T	0.59364	-0.7468	10	0.46703	T	0.11	-13.5004	13.1278	0.59364	0.073:0.0:0.927:0.0	.	285;305	A6NP15;O00232	.;PSD12_HUMAN	I	305;285	ENSP00000348442:L305I;ENSP00000349667:L285I	ENSP00000348442:L305I	L	-	1	0	PSMD12	62771354	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	7.409000	0.80053	2.693000	0.91896	0.585000	0.79938	CTT	PSMD12	-	pfam_PCI_dom	ENSG00000197170		0.323	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD12	HGNC	protein_coding	OTTHUMT00000277103.1	37	0.00	0	G	NM_002816, NM_174871		65340892	65340892	-1	no_errors	ENST00000356126	ensembl	human	known	69_37n	missense	31	42.59	23	SNP	1.000	T
QRICH2	84074	genome.wustl.edu	37	17	74303558	74303558	+	Silent	SNP	G	G	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr17:74303558G>T	ENST00000262765.5	-	1	203	c.24C>A	c.(22-24)ctC>ctA	p.L8L		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	8										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						TGGCAAAGCTGAGCTCCTCGG	0.701																																						dbGAP											0													57.0	51.0	53.0					17																	74303558		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.24C>A	17.37:g.74303558G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRE1|Q96LM3	Silent	SNP	NULL	p.L8	ENST00000262765.5	37	c.24	CCDS32741.1	17																																																																																			QRICH2	-	NULL	ENSG00000129646		0.701	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1	11	0.00	0	G	NM_032134		74303558	74303558	-1	no_errors	ENST00000262765	ensembl	human	known	69_37n	silent	5	79.17	19	SNP	0.001	T
RPTN	126638	genome.wustl.edu	37	1	152129003	152129003	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:152129003T>C	ENST00000316073.3	-	3	636	c.572A>G	c.(571-573)gAt>gGt	p.D191G		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	191	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						AAAGCTGAAATCCTTGTCTTG	0.463																																						dbGAP											0													388.0	333.0	350.0					1																	152129003		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.572A>G	1.37:g.152129003T>C	ENSP00000317895:p.Asp191Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.D191G	ENST00000316073.3	37	c.572	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	T	12.21	1.868176	0.32977	.	.	ENSG00000215853	ENST00000316073	T	0.14266	2.52	4.89	1.18	0.20946	.	.	.	.	.	T	0.03220	0.0094	M	0.62723	1.935	0.09310	N	1	B	0.34015	0.435	B	0.24974	0.057	T	0.44267	-0.9339	9	0.18710	T	0.47	-1.6568	4.573	0.12219	0.0:0.1612:0.3252:0.5136	.	191	Q6XPR3	RPTN_HUMAN	G	191	ENSP00000317895:D191G	ENSP00000317895:D191G	D	-	2	0	RPTN	150395627	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.281000	0.08456	-0.044000	0.13491	0.443000	0.29094	GAT	RPTN	-	NULL	ENSG00000215853		0.463	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	121	0.00	0	T	XM_371312		152129003	152129003	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	missense	147	29.33	61	SNP	0.000	C
SCN10A	6336	genome.wustl.edu	37	3	38802770	38802770	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr3:38802770G>A	ENST00000449082.2	-	6	795	c.796C>T	c.(796-798)Caa>Taa	p.Q266*		NM_006514.2	NP_006505.2	Q9Y5Y9	SCNAA_HUMAN	sodium channel, voltage-gated, type X, alpha subunit	266					AV node cell to bundle of His cell communication (GO:0086067)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of cardiac muscle contraction (GO:0055117)|regulation of heart rate (GO:0002027)|regulation of ion transmembrane transport (GO:0034765)|sensory perception (GO:0007600)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(5)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(14)|kidney(5)|large_intestine(33)|lung(54)|ovary(5)|pancreas(1)|prostate(5)|skin(13)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	150				KIRC - Kidney renal clear cell carcinoma(284;0.0769)|Kidney(284;0.0945)	Benzocaine(DB01086)|Bupivacaine(DB00297)|Chloroprocaine(DB01161)|Cinchocaine(DB00527)|Cocaine(DB00907)|Dyclonine(DB00645)|Hexylcaine(DB00473)|Lacosamide(DB06218)|Levobupivacaine(DB01002)|Lidocaine(DB00281)|Mepivacaine(DB00961)|Orphenadrine(DB01173)|Oxybuprocaine(DB00892)|Procaine(DB00721)|Proparacaine(DB00807)|Ropivacaine(DB00296)|Valproic Acid(DB00313)	TTGAAGAGTTGCAGCCCCACC	0.468																																						dbGAP											0													111.0	97.0	102.0					3																	38802770		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF117907	CCDS33736.1	3p22.2	2012-02-26	2007-01-23		ENSG00000185313	ENSG00000185313		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10582	protein-coding gene	gene with protein product		604427	"""sodium channel, voltage-gated, type X, alpha polypeptide"""			9839820, 10198179, 16382098	Standard	NM_006514		Approved	Nav1.8, hPN3, SNS, PN3	uc003ciq.3	Q9Y5Y9	OTTHUMG00000048245	ENST00000449082.2:c.796C>T	3.37:g.38802770G>A	ENSP00000390600:p.Gln266*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ1	Nonsense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_asu,prints_PKD_2	p.Q266*	ENST00000449082.2	37	c.796	CCDS33736.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.188761	0.97362	.	.	ENSG00000185313	ENST00000449082	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.1194	0.89566	0.0:0.0:1.0:0.0	.	.	.	.	X	266	.	ENSP00000390600:Q266X	Q	-	1	0	SCN10A	38777774	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.601000	0.98297	2.562000	0.86427	0.655000	0.94253	CAA	SCN10A	-	pfam_Ion_trans_dom	ENSG00000185313		0.468	SCN10A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN10A	HGNC	protein_coding	OTTHUMT00000109745.3	64	0.00	0	G	NM_006514		38802770	38802770	-1	no_errors	ENST00000449082	ensembl	human	known	69_37n	nonsense	6	90.16	55	SNP	1.000	A
SEZ6L2	26470	genome.wustl.edu	37	16	29899936	29899936	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr16:29899936delG	ENST00000308713.5	-	6	1491	c.964delC	c.(964-966)ctgfs	p.L322fs	SEZ6L2_ENST00000562159.1_5'UTR|SEZ6L2_ENST00000537485.1_Frame_Shift_Del_p.L278fs|SEZ6L2_ENST00000346932.5_Frame_Shift_Del_p.L208fs|SEZ6L2_ENST00000350527.3_Frame_Shift_Del_p.L252fs	NM_001114099.2|NM_201575.3	NP_001107571.1|NP_963869.2	Q6UXD5	SE6L2_HUMAN	seizure related 6 homolog (mouse)-like 2	322	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TCTCCCTGCAGCTGGTAGCCC	0.652																																						dbGAP											0													87.0	74.0	78.0					16																	29899936		2197	4300	6497	-	-	-	SO:0001589	frameshift_variant	0			AY358404	CCDS10658.1, CCDS10659.1, CCDS45458.1, CCDS58447.1, CCDS73865.1	16p12.1	2008-02-05			ENSG00000174938	ENSG00000174938			30844	protein-coding gene	gene with protein product	"""type I transmembrane receptor (seizure related protein)"""					12975309	Standard	NM_012410		Approved	PSK-1, FLJ90517	uc010vec.2	Q6UXD5	OTTHUMG00000132112	ENST00000308713.5:c.964delC	16.37:g.29899936delG	ENSP00000312550:p.Leu322fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1N0|F5H293|H7BXQ6|Q9BW82|Q9UJ45|Q9UJ46|Q9UJ47	Frame_Shift_Del	DEL	pfam_Sushi_SCR_CCP,pfam_CUB,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.L322fs	ENST00000308713.5	37	c.964	CCDS10659.1	16																																																																																			SEZ6L2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000174938		0.652	SEZ6L2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6L2	HGNC	protein_coding	OTTHUMT00000255154.2	37	0.00	0	G	NM_012410		29899936	29899936	-1	no_errors	ENST00000308713	ensembl	human	known	69_37n	frame_shift_del	6	75.00	18	DEL	1.000	-
SHOC2	8036	genome.wustl.edu	37	10	112745470	112745470	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr10:112745470T>C	ENST00000369452.4	+	3	1133	c.788T>C	c.(787-789)aTa>aCa	p.I263T	SHOC2_ENST00000489390.1_Intron|SHOC2_ENST00000265277.5_Intron	NM_007373.3	NP_031399.2	Q9UQ13	SHOC2_HUMAN	soc-2 suppressor of clear homolog (C. elegans)	263					fibroblast growth factor receptor signaling pathway (GO:0008543)|positive regulation of Ras protein signal transduction (GO:0046579)|Ras protein signal transduction (GO:0007265)|regulation of catalytic activity (GO:0050790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase binding (GO:0019903)|protein phosphatase regulator activity (GO:0019888)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|skin(2)	17				Epithelial(162;0.000796)|all cancers(201;0.011)|BRCA - Breast invasive adenocarcinoma(275;0.126)		TGTACACAGATAACCAACCTT	0.408																																						dbGAP											0													107.0	92.0	97.0					10																	112745470		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020669	CCDS7568.1, CCDS58095.1	10q25	2014-09-17	2001-11-28		ENSG00000108061	ENSG00000108061			15454	protein-coding gene	gene with protein product		602775	"""soc-2 (suppressor of clear, C.elegans) homolog"""			9618511, 9674433, 10783161	Standard	NM_007373		Approved	KIAA0862, SOC2, SUR-8, SOC-2, SUR8	uc001kzl.4	Q9UQ13	OTTHUMG00000019047	ENST00000369452.4:c.788T>C	10.37:g.112745470T>C	ENSP00000358464:p.Ile263Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W8|B3KR23|O76063|Q5VZS8|Q5VZS9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.I263T	ENST00000369452.4	37	c.788	CCDS7568.1	10	.	.	.	.	.	.	.	.	.	.	T	25.7	4.667797	0.88348	.	.	ENSG00000108061	ENST00000369452	T	0.58797	0.31	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.59293	0.2183	L	0.45352	1.415	0.80722	D	1	P	0.45986	0.87	P	0.47015	0.534	T	0.63346	-0.6658	10	0.87932	D	0	.	16.4696	0.84102	0.0:0.0:0.0:1.0	.	263	Q9UQ13	SHOC2_HUMAN	T	263	ENSP00000358464:I263T	ENSP00000358464:I263T	I	+	2	0	SHOC2	112735460	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.289000	0.77006	0.482000	0.46254	ATA	SHOC2	-	NULL	ENSG00000108061		0.408	SHOC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHOC2	HGNC	protein_coding	OTTHUMT00000050355.1	25	0.00	0	T	NM_007373		112745470	112745470	+1	no_errors	ENST00000369452	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	1.000	C
SIRT7	51547	genome.wustl.edu	37	17	79872224	79872224	+	Silent	SNP	C	C	G	rs374533546	byFrequency	TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr17:79872224C>G	ENST00000328666.6	-	7	824	c.762G>C	c.(760-762)gcG>gcC	p.A254A	PCYT2_ENST00000571105.1_5'Flank|PCYT2_ENST00000570388.1_5'Flank|PCYT2_ENST00000538721.2_5'Flank|PCYT2_ENST00000538936.2_5'Flank	NM_016538.2	NP_057622.1	Q9NRC8	SIR7_HUMAN	sirtuin 7	254	Deacetylase sirtuin-type. {ECO:0000255|PROSITE-ProRule:PRU00236}.				histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription on exit from mitosis (GO:0007072)|rRNA transcription (GO:0009303)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleolus organizer region (GO:0005731)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.0165)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CAGCCTCGGTCGCCGCTTCCC	0.637																																						dbGAP											0													50.0	43.0	46.0					17																	79872224		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF233395	CCDS11792.1	17q25.3	2010-06-25	2010-06-25			ENSG00000187531			14935	protein-coding gene	gene with protein product		606212	"""sirtuin (silent mating type information regulation 2, S.cerevisiae, homolog) 7"", ""sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae)"""			10873683, 16618798	Standard	NM_016538		Approved		uc002kcj.2	Q9NRC8		ENST00000328666.6:c.762G>C	17.37:g.79872224C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2K0|B3KSU8|Q3MIK4|Q9NSZ6|Q9NUS6	Silent	SNP	pfam_NAD-dep_deAcase_sirtuin,pfscan_NAD-dep_deAcase_sirtuin	p.A254	ENST00000328666.6	37	c.762	CCDS11792.1	17																																																																																			SIRT7	-	pfam_NAD-dep_deAcase_sirtuin,pfscan_NAD-dep_deAcase_sirtuin	ENSG00000187531		0.637	SIRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT7	HGNC	protein_coding	OTTHUMT00000439961.1	24	0.00	0	C	NM_016538		79872224	79872224	-1	no_errors	ENST00000328666	ensembl	human	known	69_37n	silent	5	54.55	6	SNP	0.542	G
SLAMF7	57823	genome.wustl.edu	37	1	160718170	160718171	+	In_Frame_Ins	INS	-	-	TCC			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:160718170_160718171insTCC	ENST00000368043.3	+	2	279_280	c.242_243insTCC	c.(241-246)gtagac>gtTCCagac	p.81_82VD>VPD	SLAMF7_ENST00000368042.3_Intron|SLAMF7_ENST00000458104.2_Intron|SLAMF7_ENST00000458602.2_Intron|SLAMF7_ENST00000359331.4_In_Frame_Ins_p.81_82VD>VPD|SLAMF7_ENST00000441662.2_In_Frame_Ins_p.81_82VD>VPD|SLAMF7_ENST00000444090.2_In_Frame_Ins_p.81_82VD>VPD	NM_001282595.1|NM_021181.3	NP_001269524.1|NP_067004.3	Q9NQ25	SLAF7_HUMAN	SLAM family member 7	81	Ig-like V-type.				cell adhesion (GO:0007155)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of natural killer cell activation (GO:0032814)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(4)	24	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			AGGGAGAGAGTAGACTTCCCAG	0.485																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB027233	CCDS1209.1, CCDS60321.1, CCDS60322.1, CCDS60323.1, CCDS60324.1, CCDS60325.1, CCDS72956.1, CCDS72957.1	1q23.1-q24.1	2013-01-11			ENSG00000026751	ENSG00000026751		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	21394	protein-coding gene	gene with protein product		606625				11802771, 11220635	Standard	XM_005245386		Approved	CRACC, 19A, CS1, CD319	uc001fwq.3	Q9NQ25	OTTHUMG00000024008	Exception_encountered	1.37:g.160718170_160718171insTCC	ENSP00000357022:p.Val81_Asp82insPro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3U1|B4DPU4|B4DPY3|B4DWA3|Q8N6Y8|Q8ND32|Q9NY08|Q9NY23	In_Frame_Ins	INS	pfam_Ig_V-set,pfscan_Ig-like	p.82in_frame_insP	ENST00000368043.3	37	c.242_243	CCDS1209.1	1																																																																																			SLAMF7	-	pfam_Ig_V-set	ENSG00000026751		0.485	SLAMF7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLAMF7	HGNC	protein_coding	OTTHUMT00000060464.1	30	0.00	0	-	NM_021181		160718170	160718171	+1	no_errors	ENST00000368043	ensembl	human	known	69_37n	in_frame_ins	19	56.82	25	INS	0.038:0.006	TCC
SLC22A9	114571	genome.wustl.edu	37	11	63138646	63138646	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr11:63138646G>A	ENST00000279178.3	+	2	691	c.442G>A	c.(442-444)Gct>Act	p.A148T	SLC22A9_ENST00000310969.4_Missense_Mutation_p.A148T	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	148					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						GACTTCAGTGGCTAAATTTGT	0.453																																						dbGAP											0													159.0	147.0	151.0					11																	63138646		2201	4298	6499	-	-	-	SO:0001583	missense	0			AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.442G>A	11.37:g.63138646G>A	ENSP00000279178:p.Ala148Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A148T	ENST00000279178.3	37	c.442	CCDS8043.1	11	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208547	0.39003	.	.	ENSG00000149742	ENST00000310969;ENST00000279178	T;T	0.79454	-1.27;0.26	3.27	-6.54	0.01860	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.700145	0.13677	U	0.370466	T	0.60301	0.2258	L	0.48935	1.535	0.09310	N	1	B	0.23128	0.08	B	0.24006	0.05	T	0.50566	-0.8813	10	0.13470	T	0.59	.	6.1938	0.20538	0.1718:0.0:0.2669:0.5613	.	148	Q8IVM8	S22A9_HUMAN	T	148	ENSP00000311527:A148T;ENSP00000279178:A148T	ENSP00000279178:A148T	A	+	1	0	SLC22A9	62895222	0.009000	0.17119	0.007000	0.13788	0.661000	0.39034	-0.437000	0.06914	-1.424000	0.01999	0.121000	0.15741	GCT	SLC22A9	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000149742		0.453	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A9	HGNC	protein_coding	OTTHUMT00000396371.1	84	0.00	0	G	NM_080866		63138646	63138646	+1	no_errors	ENST00000279178	ensembl	human	known	69_37n	missense	73	33.64	37	SNP	0.002	A
SLC44A5	204962	genome.wustl.edu	37	1	75684372	75684372	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:75684372delA	ENST00000370855.5	-	17	1445	c.1332delT	c.(1330-1332)ggtfs	p.G445fs	SLC44A5_ENST00000370859.3_Frame_Shift_Del_p.G445fs|SLC44A5_ENST00000535611.1_Frame_Shift_Del_p.G315fs	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	445					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						AGCTCTTTCCACCATAGAAAG	0.393																																						dbGAP											0													79.0	77.0	78.0					1																	75684372		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1332delT	1.37:g.75684372delA	ENSP00000359892:p.Gly445fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Frame_Shift_Del	DEL	pfam_Choline_transptr-like	p.G445fs	ENST00000370855.5	37	c.1332	CCDS667.1	1																																																																																			SLC44A5	-	pfam_Choline_transptr-like	ENSG00000137968		0.393	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026921.1	24	0.00	0	A	NM_152697		75684372	75684372	-1	no_errors	ENST00000370855	ensembl	human	known	69_37n	frame_shift_del	20	50.00	20	DEL	0.993	-
SLC30A1	7779	genome.wustl.edu	37	1	211749099	211749099	+	Silent	SNP	A	A	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:211749099A>G	ENST00000367001.4	-	2	1284	c.1155T>C	c.(1153-1155)acT>acC	p.T385T		NM_021194.2	NP_067017.2	Q9Y6M5	ZNT1_HUMAN	solute carrier family 30 (zinc transporter), member 1	385					cadmium ion transmembrane transport (GO:0070574)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|cellular zinc ion homeostasis (GO:0006882)|detoxification of cadmium ion (GO:0071585)|in utero embryonic development (GO:0001701)|negative regulation of calcium ion import (GO:0090281)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of zinc ion transmembrane import (GO:0071584)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	calcium channel inhibitor activity (GO:0019855)|zinc ion transmembrane transporter activity (GO:0005385)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|liver(1)|lung(1)|ovary(3)|prostate(1)	11				OV - Ovarian serous cystadenocarcinoma(81;0.00535)|GBM - Glioblastoma multiforme(131;0.051)|all cancers(67;0.0604)|Epithelial(68;0.0978)		TTATGTGAGCAGTGGCAATGA	0.373																																						dbGAP											0													86.0	82.0	84.0					1																	211749099		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF323590	CCDS1499.1	1q32.3	2013-05-22			ENSG00000170385	ENSG00000170385		"""Solute carriers"""	11012	protein-coding gene	gene with protein product		609521		ZNT1			Standard	NM_021194		Approved	ZRC1	uc001hio.1	Q9Y6M5	OTTHUMG00000036995	ENST00000367001.4:c.1155T>C	1.37:g.211749099A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAK9|Q9BZF6	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.T385	ENST00000367001.4	37	c.1155	CCDS1499.1	1																																																																																			SLC30A1	-	pfam_Cation_efflux	ENSG00000170385		0.373	SLC30A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A1	HGNC	protein_coding	OTTHUMT00000104738.2	25	0.00	0	A			211749099	211749099	-1	no_errors	ENST00000367001	ensembl	human	known	69_37n	silent	42	35.38	23	SNP	0.969	G
SLC45A2	51151	genome.wustl.edu	37	5	33984320	33984320	+	Silent	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr5:33984320C>A	ENST00000296589.4	-	1	515	c.369G>T	c.(367-369)ggG>ggT	p.G123G	SLC45A2_ENST00000342059.3_Silent_p.G123G|SLC45A2_ENST00000382102.3_Silent_p.G123G|SLC45A2_ENST00000509381.1_Silent_p.G123G|SLC45A2_ENST00000345083.5_Silent_p.G123G	NM_016180.3	NP_057264	Q9UMX9	S45A2_HUMAN	solute carrier family 45, member 2	123					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(25)|ovary(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	48						CAACAGTAGCCCCATTGAGGT	0.587																																					Ovarian(31;380 859 8490 22203 49048)	dbGAP											0													70.0	67.0	68.0					5																	33984320		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF172849	CCDS3901.1, CCDS43308.1, CCDS75232.1	5p13.3	2013-08-06	2005-10-06	2005-10-06	ENSG00000164175	ENSG00000164175		"""Solute carriers"""	16472	protein-coding gene	gene with protein product		606202	"""membrane associated transporter"""	MATP		11916009, 11574907	Standard	NM_001012509		Approved	AIM-1, OCA4	uc003jid.3	Q9UMX9	OTTHUMG00000090719	ENST00000296589.4:c.369G>T	5.37:g.33984320C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G123	ENST00000296589.4	37	c.369	CCDS3901.1	5																																																																																			SLC45A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000164175		0.587	SLC45A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A2	HGNC	protein_coding	OTTHUMT00000207443.2	38	0.00	0	C	NM_016180		33984320	33984320	-1	no_errors	ENST00000296589	ensembl	human	known	69_37n	silent	25	52.83	28	SNP	1.000	A
SLITRK3	22865	genome.wustl.edu	37	3	164905992	164905992	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr3:164905992C>A	ENST00000475390.1	-	2	3070	c.2627G>T	c.(2626-2628)gGa>gTa	p.G876V	SLITRK3_ENST00000241274.3_Missense_Mutation_p.G876V			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	876					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						ACCACAGCCTCCCCCAGGAGG	0.572										HNSCC(40;0.11)																												dbGAP											0													56.0	53.0	54.0					3																	164905992		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2627G>T	3.37:g.164905992C>A	ENSP00000420091:p.Gly876Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1RMY6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G876V	ENST00000475390.1	37	c.2627	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	C	14.84	2.654882	0.47467	.	.	ENSG00000121871	ENST00000475390;ENST00000241274	T;T	0.62788	-0.0;-0.0	5.75	5.75	0.90469	.	0.000000	0.33938	N	0.004420	T	0.64768	0.2628	N	0.14661	0.345	0.80722	D	1	D	0.76494	0.999	D	0.71184	0.972	T	0.67669	-0.5611	10	0.49607	T	0.09	-8.6777	15.4526	0.75285	0.0:1.0:0.0:0.0	.	876	O94933	SLIK3_HUMAN	V	876	ENSP00000420091:G876V;ENSP00000241274:G876V	ENSP00000241274:G876V	G	-	2	0	SLITRK3	166388686	1.000000	0.71417	1.000000	0.80357	0.875000	0.50365	3.008000	0.49544	2.719000	0.93026	0.655000	0.94253	GGA	SLITRK3	-	NULL	ENSG00000121871		0.572	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	31	0.00	0	C	NM_014926		164905992	164905992	-1	no_errors	ENST00000241274	ensembl	human	known	69_37n	missense	27	43.75	21	SNP	1.000	A
SMCHD1	23347	genome.wustl.edu	37	18	2750494	2750494	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr18:2750494G>C	ENST00000320876.6	+	32	4492	c.4154G>C	c.(4153-4155)gGt>gCt	p.G1385A	RP11-703M24.5_ENST00000583546.1_RNA|SMCHD1_ENST00000261598.8_Missense_Mutation_p.G1385A	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	1385					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TTAGCAGGGGGTCTTTTCACT	0.333																																						dbGAP											0													37.0	35.0	35.0					18																	2750494		1817	4082	5899	-	-	-	SO:0001583	missense	0			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.4154G>C	18.37:g.2750494G>C	ENSP00000326603:p.Gly1385Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_ATPase-like_ATP-bd,smart_SMC_hinge	p.G1385A	ENST00000320876.6	37	c.4154	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	G	11.74	1.728737	0.30593	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.22134	1.97;1.97	5.85	0.789	0.18607	.	0.666627	0.15779	N	0.245047	T	0.15435	0.0372	L	0.36672	1.1	0.09310	N	1	B	0.24483	0.104	B	0.19148	0.024	T	0.17992	-1.0351	10	0.51188	T	0.08	-2.585	9.7028	0.40198	0.4492:0.0:0.5508:0.0	.	1385	A6NHR9	SMHD1_HUMAN	A	1385	ENSP00000326603:G1385A;ENSP00000261598:G1385A	ENSP00000261598:G1385A	G	+	2	0	SMCHD1	2740494	0.010000	0.17322	0.077000	0.20336	0.984000	0.73092	0.743000	0.26231	0.208000	0.20626	0.655000	0.94253	GGT	SMCHD1	-	NULL	ENSG00000101596		0.333	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	39	0.00	0	G			2750494	2750494	+1	no_errors	ENST00000320876	ensembl	human	known	69_37n	missense	53	26.39	19	SNP	0.017	C
SPO11	23626	genome.wustl.edu	37	20	55909042	55909042	+	Splice_Site	SNP	G	G	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr20:55909042G>A	ENST00000371263.3	+	5	510		c.e5-1		SPO11_ENST00000345868.4_Splice_Site|SPO11_ENST00000371260.4_Splice_Site	NM_012444.2	NP_036576.1	Q9Y5K1	SPO11_HUMAN	SPO11 meiotic protein covalently bound to DSB						DNA catabolic process, endonucleolytic (GO:0000737)|female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|ovarian follicle development (GO:0001541)|protein localization to chromosome (GO:0034502)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|hydrolase activity (GO:0016787)			autonomic_ganglia(1)|breast(3)|large_intestine(4)|lung(8)|skin(2)	18	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			aattttCATAGGGACATATAT	0.294								Editing and processing nucleases																														dbGAP											0													25.0	26.0	26.0					20																	55909042		2202	4293	6495	-	-	-	SO:0001630	splice_region_variant	0			AF169385	CCDS13456.1, CCDS13457.1	20q13.31	2013-06-05	2013-06-05		ENSG00000054796	ENSG00000054796			11250	protein-coding gene	gene with protein product	"""cancer/testis antigen 35"", ""spermatogenesis associated 43"""	605114	"""SPO11, meiotic protein covalently bound to DSB (S. cerevisiae)-like"", ""SPO11 meiotic protein covalently bound to DSB-like (S. cerevisiae)"", ""SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)"""			10534401	Standard	NM_012444		Approved	CT35, SPATA43, TOPVIA	uc002xye.3	Q9Y5K1	OTTHUMG00000032817	ENST00000371263.3:c.402-1G>A	20.37:g.55909042G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCI1|Q8N4V0|Q9NQM7|Q9NQM8	Splice_Site	SNP	-	e5-1	ENST00000371263.3	37	c.402-1	CCDS13456.1	20	.	.	.	.	.	.	.	.	.	.	G	17.63	3.436480	0.62955	.	.	ENSG00000054796	ENST00000371263;ENST00000345868;ENST00000371260;ENST00000418127	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8585	0.96775	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SPO11	55342449	1.000000	0.71417	0.996000	0.52242	0.713000	0.41058	9.420000	0.97426	2.760000	0.94817	0.655000	0.94253	.	SPO11	-	-	ENSG00000054796		0.294	SPO11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPO11	HGNC	protein_coding	OTTHUMT00000079836.2	27	0.00	0	G	NM_012444	Intron	55909042	55909042	+1	no_errors	ENST00000371263	ensembl	human	known	69_37n	splice_site	7	66.67	14	SNP	1.000	A
STARD10	10809	genome.wustl.edu	37	11	72492197	72492197	+	Silent	SNP	G	G	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr11:72492197G>T	ENST00000334805.6	-	2	949	c.30C>A	c.(28-30)ccC>ccA	p.P10P	STARD10_ENST00000538536.1_Silent_p.P10P|ARAP1_ENST00000359373.5_Intron|STARD10_ENST00000545082.1_Silent_p.P10P|STARD10_ENST00000538437.1_5'Flank|MIR4692_ENST00000583200.1_RNA|STARD10_ENST00000543304.1_Silent_p.P10P	NM_006645.2	NP_006636.2	Q9Y365	PCTL_HUMAN	StAR-related lipid transfer (START) domain containing 10	10					bile acid secretion (GO:0032782)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)	cytosol (GO:0005829)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|microvillus (GO:0005902)	lipid binding (GO:0008289)			endometrium(4)|large_intestine(1)|lung(2)|prostate(1)	8			BRCA - Breast invasive adenocarcinoma(5;7.08e-07)			GAGGCCCTTGGGGCTCTGTAG	0.677																																						dbGAP											0													36.0	40.0	39.0					11																	72492197		1913	4102	6015	-	-	-	SO:0001819	synonymous_variant	0			AF039696	CCDS41688.1	11q13	2011-09-12	2007-08-16	2003-02-07		ENSG00000214530		"""StAR-related lipid transfer (START) domain containing"""	10666	protein-coding gene	gene with protein product			"""serologically defined colon cancer antigen 28"", ""START domain containing 10"""	SDCCAG28		9610721	Standard	NM_006645		Approved	NY-CO-28, CGI-52, PCTP2	uc001otb.3	Q9Y365		ENST00000334805.6:c.30C>A	11.37:g.72492197G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60532	Silent	SNP	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	p.P10	ENST00000334805.6	37	c.30	CCDS41688.1	11																																																																																			STARD10	-	NULL	ENSG00000214530		0.677	STARD10-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STARD10	HGNC	protein_coding	OTTHUMT00000397254.1	19	0.00	0	G			72492197	72492197	-1	no_errors	ENST00000334805	ensembl	human	known	69_37n	silent	15	51.61	16	SNP	0.058	T
TAS2R10	50839	genome.wustl.edu	37	12	10978499	10978499	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr12:10978499T>C	ENST00000240619.2	-	1	458	c.370A>G	c.(370-372)Aga>Gga	p.R124G		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	124					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						ATATTTGTTCTGCTCTTCAAC	0.333																																						dbGAP											0													57.0	61.0	59.0					12																	10978499		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.370A>G	12.37:g.10978499T>C	ENSP00000240619:p.Arg124Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIM9|Q6NTD9	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.R124G	ENST00000240619.2	37	c.370	CCDS8634.1	12	.	.	.	.	.	.	.	.	.	.	T	14.13	2.443225	0.43429	.	.	ENSG00000121318	ENST00000240619	T	0.01221	5.15	4.67	0.765	0.18470	.	0.423880	0.21413	N	0.074943	T	0.08537	0.0212	H	0.95079	3.62	0.09310	N	1	D	0.62365	0.991	D	0.74674	0.984	T	0.28106	-1.0054	10	0.87932	D	0	.	0.9133	0.01299	0.156:0.1825:0.1612:0.5002	.	124	Q9NYW0	T2R10_HUMAN	G	124	ENSP00000240619:R124G	ENSP00000240619:R124G	R	-	1	2	TAS2R10	10869766	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	0.470000	0.22084	-0.047000	0.13423	0.482000	0.46254	AGA	TAS2R10	-	pfam_TAS2_rcpt	ENSG00000121318		0.333	TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R10	HGNC	protein_coding	OTTHUMT00000399934.1	21	0.00	0	T			10978499	10978499	-1	no_errors	ENST00000240619	ensembl	human	known	69_37n	missense	16	68.63	35	SNP	0.000	C
TCTEX1D1	200132	genome.wustl.edu	37	1	67243066	67243066	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr1:67243066T>A	ENST00000282670.2	+	5	597	c.469T>A	c.(469-471)Ttt>Att	p.F157I		NM_152665.2	NP_689878.2	Q8N7M0	TC1D1_HUMAN	Tctex1 domain containing 1	157										large_intestine(2)|lung(10)|skin(1)	13						AAGTGATACCTTTTCATCTTA	0.368																																						dbGAP											0													160.0	168.0	165.0					1																	67243066		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098192	CCDS633.1	1p31.2	2008-02-05			ENSG00000152760	ENSG00000152760			26882	protein-coding gene	gene with protein product							Standard	NM_152665		Approved	FLJ40873	uc001dcv.3	Q8N7M0	OTTHUMG00000009162	ENST00000282670.2:c.469T>A	1.37:g.67243066T>A	ENSP00000282670:p.Phe157Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06YR9|Q5VYE1	Missense_Mutation	SNP	pfam_Tctex	p.F157I	ENST00000282670.2	37	c.469	CCDS633.1	1	.	.	.	.	.	.	.	.	.	.	T	16.19	3.053176	0.55218	.	.	ENSG00000152760	ENST00000282670	T	0.28895	1.59	5.93	2.36	0.29203	.	0.208592	0.51477	D	0.000100	T	0.40015	0.1100	M	0.90082	3.085	0.41383	D	0.987569	P	0.49783	0.928	P	0.51355	0.667	T	0.54476	-0.8288	10	0.56958	D	0.05	-0.5404	13.4647	0.61247	0.0:0.0:0.4899:0.5101	.	157	Q8N7M0	TC1D1_HUMAN	I	157	ENSP00000282670:F157I	ENSP00000282670:F157I	F	+	1	0	TCTEX1D1	67015654	0.982000	0.34865	0.571000	0.28486	0.277000	0.26821	1.912000	0.39946	0.593000	0.29745	0.533000	0.62120	TTT	TCTEX1D1	-	pfam_Tctex	ENSG00000152760		0.368	TCTEX1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCTEX1D1	HGNC	protein_coding	OTTHUMT00000025399.2	61	0.00	0	T	NM_152665		67243066	67243066	+1	no_errors	ENST00000282670	ensembl	human	known	69_37n	missense	50	34.21	26	SNP	0.913	A
TMPRSS7	344805	genome.wustl.edu	37	3	111795822	111795822	+	Silent	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr3:111795822C>T	ENST00000452346.2	+	16	2058	c.2055C>T	c.(2053-2055)taC>taT	p.Y685Y	TMPRSS7_ENST00000419127.1_Silent_p.Y559Y			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	685	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.Y414Y(1)		breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						TCCACGAGTACTATAACAGTC	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											226.0	215.0	219.0					3																	111795822		1968	4157	6125	-	-	-	SO:0001819	synonymous_variant	0			BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.2055C>T	3.37:g.111795822C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J8P7|E9PAS3|Q17RH4	Silent	SNP	pfam_Peptidase_S1_S6,pfam_SEA,pfam_LDrepeatLR_classA_rpt,pfam_CUB,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.Y559	ENST00000452346.2	37	c.1677		3																																																																																			TMPRSS7	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000176040		0.483	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	TMPRSS7	HGNC	protein_coding	OTTHUMT00000347592.2	63	0.00	0	C	XM_293599		111795822	111795822	+1	no_errors	ENST00000419127	ensembl	human	known	69_37n	silent	25	59.68	37	SNP	1.000	T
TOM1	10043	genome.wustl.edu	37	22	35729468	35729468	+	Silent	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr22:35729468C>G	ENST00000449058.2	+	10	1130	c.1005C>G	c.(1003-1005)ctC>ctG	p.L335L	TOM1_ENST00000411850.1_Silent_p.L335L|TOM1_ENST00000436462.2_Silent_p.L297L|MIR3909_ENST00000579518.1_RNA|TOM1_ENST00000447733.1_Silent_p.L302L|TOM1_ENST00000382034.5_3'UTR|TOM1_ENST00000425375.1_Silent_p.L290L	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	335					endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						CCGGCAACCTCTCATCCCAGC	0.612																																						dbGAP											0													41.0	41.0	41.0					22																	35729468		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.1005C>G	22.37:g.35729468C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Silent	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.L335	ENST00000449058.2	37	c.1005	CCDS13913.1	22																																																																																			TOM1	-	pirsf_TOM1	ENSG00000100284		0.612	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOM1	HGNC	protein_coding	OTTHUMT00000320641.1	20	0.00	0	C	NM_005488		35729468	35729468	+1	no_errors	ENST00000411850	ensembl	human	known	69_37n	silent	16	40.74	11	SNP	0.999	G
TRIM7	81786	genome.wustl.edu	37	5	180626095	180626095	+	Splice_Site	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr5:180626095C>T	ENST00000274773.7	-	4	933	c.872G>A	c.(871-873)aGg>aAg	p.R291K	TRIM7_ENST00000393315.1_Splice_Site_p.R83K|CTC-338M12.6_ENST00000514784.1_RNA|TRIM7_ENST00000422067.2_Splice_Site_p.R83K|CTC-338M12.6_ENST00000419707.2_RNA|CTC-338M12.6_ENST00000502812.2_RNA|CTC-338M12.6_ENST00000512508.1_RNA|CTC-338M12.6_ENST00000509080.1_RNA|TRIM7_ENST00000393319.3_Splice_Site_p.R109K|TRIM7_ENST00000504241.1_5'Flank|TRIM7_ENST00000361809.3_Splice_Site_p.R83K|CTC-338M12.6_ENST00000511517.1_RNA	NM_203293.1	NP_976038.1	Q9C029	TRIM7_HUMAN	tripartite motif containing 7	291						cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			NS(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|skin(1)|stomach(1)	17	all_cancers(89;6.03e-06)|all_epithelial(37;7.1e-07)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000172)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;2e-06)|Epithelial(171;1.35e-05)|OV - Ovarian serous cystadenocarcinoma(192;0.000128)|Kidney(146;0.0674)|GBM - Glioblastoma multiforme(465;0.0802)		GGTCACTCACCTGCTCAGCGT	0.498																																					Esophageal Squamous(128;2258 2308 35507 48647)	dbGAP											0													129.0	136.0	134.0					5																	180626095		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF220032	CCDS4462.1, CCDS4463.1, CCDS4464.1, CCDS43414.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146054	ENSG00000146054		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16278	protein-coding gene	gene with protein product	"""glycogenin-interacting protein"", ""tripartite motif protein TRIM7"""	609315	"""tripartite motif-containing 7"""			11331580	Standard	NM_203294		Approved	RNF90, GNIP	uc003mmz.1	Q9C029	OTTHUMG00000130963	ENST00000274773.7:c.872+1G>A	5.37:g.180626095C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE4|D3DWR7|Q969F5|Q96F67|Q96J89|Q96J90	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,prints_Znf_B-box_chordata,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.R291K	ENST00000274773.7	37	c.872	CCDS4462.1	5	.	.	.	.	.	.	.	.	.	.	c	10.09	1.256020	0.22965	.	.	ENSG00000146054	ENST00000274773;ENST00000393315;ENST00000361809;ENST00000393319;ENST00000422067	T;T;T;T;T	0.04758	3.56;3.56;3.56;3.56;3.56	4.67	2.66	0.31614	.	0.195959	0.35772	N	0.002997	T	0.03434	0.0099	L	0.28400	0.85	0.24774	N	0.992859	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.43782	-0.9370	9	.	.	.	.	6.0651	0.19858	0.0:0.6928:0.0:0.3072	.	291;109	Q9C029;Q9C029-4	TRIM7_HUMAN;.	K	291;83;83;109;83	ENSP00000274773:R291K;ENSP00000376991:R83K;ENSP00000355059:R83K;ENSP00000376994:R109K;ENSP00000391458:R83K	.	R	-	2	0	TRIM7	180558701	1.000000	0.71417	0.998000	0.56505	0.276000	0.26787	0.826000	0.27407	0.512000	0.28257	0.550000	0.68814	AGG	TRIM7	-	NULL	ENSG00000146054		0.498	TRIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM7	HGNC	protein_coding	OTTHUMT00000253569.3	49	0.00	0	C	NM_203296	Missense_Mutation	180626095	180626095	-1	no_errors	ENST00000274773	ensembl	human	known	69_37n	missense	7	73.08	19	SNP	1.000	T
TRPM2	7226	genome.wustl.edu	37	21	45784057	45784057	+	Silent	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr21:45784057C>G	ENST00000397928.1	+	3	760	c.315C>G	c.(313-315)ccC>ccG	p.P105P	TRPM2_ENST00000397932.2_Silent_p.P105P|TRPM2_ENST00000300481.9_Silent_p.P105P|TRPM2_ENST00000300482.5_Silent_p.P105P	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	105					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CTACCAAGCCCCACACCTTCC	0.587																																						dbGAP											0													135.0	100.0	112.0					21																	45784057		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.315C>G	21.37:g.45784057C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.P105	ENST00000397928.1	37	c.315	CCDS13710.1	21																																																																																			TRPM2	-	NULL	ENSG00000142185		0.587	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	32	0.00	0	C	NM_003307		45784057	45784057	+1	no_errors	ENST00000300482	ensembl	human	known	69_37n	silent	21	27.59	8	SNP	0.114	G
USO1	8615	genome.wustl.edu	37	4	76708240	76708240	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr4:76708240C>T	ENST00000538159.1	+	10	887	c.887C>T	c.(886-888)aCc>aTc	p.T296I	USO1_ENST00000514213.2_Missense_Mutation_p.T279I			O60763	USO1_HUMAN	USO1 vesicle transport factor	294	Globular head.				ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GTATCTCCCACCAACCCTCCT	0.433																																						dbGAP											0													130.0	122.0	124.0					4																	76708240		1850	4105	5955	-	-	-	SO:0001583	missense	0			AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.887C>T	4.37:g.76708240C>T	ENSP00000440586:p.Thr296Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	pfam_Vesicle_Uso1_P115_head,pfam_Uso1_p115_C,superfamily_ARM-type_fold,superfamily_t-SNARE	p.T296I	ENST00000538159.1	37	c.887		4	.	.	.	.	.	.	.	.	.	.	C	13.41	2.227685	0.39399	.	.	ENSG00000138768	ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904	.	.	.	5.71	1.82	0.25136	Armadillo-type fold (1);	0.413267	0.30003	N	0.010642	T	0.54481	0.1861	L	0.47716	1.5	0.37753	D	0.926033	B;B	0.27229	0.169;0.172	B;B	0.25291	0.056;0.059	T	0.54470	-0.8289	9	0.51188	T	0.08	.	14.4276	0.67227	0.5678:0.4322:0.0:0.0	.	296;294	F5GYR8;O60763	.;USO1_HUMAN	I	129;296;279;222	.	ENSP00000264904:T222I	T	+	2	0	USO1	76927264	0.971000	0.33674	0.996000	0.52242	0.995000	0.86356	1.256000	0.32921	0.013000	0.14918	-0.188000	0.12872	ACC	USO1	-	superfamily_ARM-type_fold	ENSG00000138768		0.433	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	USO1	HGNC	protein_coding		62	0.00	0	C	NM_003715		76708240	76708240	+1	no_errors	ENST00000538159	ensembl	human	known	69_37n	missense	86	32.81	42	SNP	0.999	T
USO1	8615	genome.wustl.edu	37	4	76734444	76734444	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr4:76734444T>C	ENST00000538159.1	+	25	2912	c.2912T>C	c.(2911-2913)aTc>aCc	p.I971T	USO1_ENST00000514213.2_Missense_Mutation_p.I947T			O60763	USO1_HUMAN	USO1 vesicle transport factor	962					ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi vesicle docking (GO:0048211)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|mitotic cell cycle (GO:0000278)|transcytosis (GO:0045056)|vesicle fusion with Golgi apparatus (GO:0048280)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			CTAGATCATATCTAGTTTTCA	0.363																																						dbGAP											0													74.0	75.0	75.0					4																	76734444		1857	4099	5956	-	-	-	SO:0001583	missense	0			AL832010	CCDS75144.1	4q21.1	2012-12-10	2012-12-10		ENSG00000138768	ENSG00000138768			30904	protein-coding gene	gene with protein product	"""vesicle docking protein"", ""transcytosis associated protein"""	603344	"""USO1 homolog, vesicle docking protein (yeast)"", ""USO1 vesicle docking protein homolog (yeast)"""			9478999, 9150144, 12077354, 15979508, 14736916	Standard	XM_006714395		Approved	TAP, VDP, p115	uc003hiu.3	O60763	OTTHUMG00000160952	ENST00000538159.1:c.2912T>C	4.37:g.76734444T>C	ENSP00000440586:p.Ile971Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAQ0|Q6PK63|Q86TB8|Q8N592	Missense_Mutation	SNP	pfam_Vesicle_Uso1_P115_head,pfam_Uso1_p115_C,superfamily_ARM-type_fold,superfamily_t-SNARE	p.I971T	ENST00000538159.1	37	c.2912		4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.467|9.467	1.094597|1.094597	0.20471|0.20471	.|.	.|.	ENSG00000138768|ENSG00000138768	ENST00000508939;ENST00000538159;ENST00000514213;ENST00000264904|ENST00000441296	.|.	.|.	.|.	6.01|6.01	-1.38|-1.38	0.09027|0.09027	.|.	1.001790|.	0.08049|.	N|.	0.996439|.	T|T	0.14700|0.14700	0.0355|0.0355	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.19200|.	0.034;0.02|.	B;B|.	0.19391|.	0.025;0.011|.	T|T	0.28004|0.28004	-1.0057|-1.0057	9|5	0.87932|.	D|.	0|.	.|.	4.4237|4.4237	0.11493|0.11493	0.1151:0.0647:0.359:0.4612|0.1151:0.0647:0.359:0.4612	.|.	971;962|.	F5GYR8;O60763|.	.;USO1_HUMAN|.	T|P	797;971;947;890|638	.|.	ENSP00000264904:I890T|.	I|S	+|+	2|1	0|0	USO1|USO1	76953468|76953468	0.000000|0.000000	0.05858|0.05858	0.105000|0.105000	0.21289|0.21289	0.341000|0.341000	0.28922|0.28922	-0.112000|-0.112000	0.10791|0.10791	-0.116000|-0.116000	0.11893|0.11893	-0.328000|-0.328000	0.08392|0.08392	ATC|TCT	USO1	-	NULL	ENSG00000138768		0.363	USO1-202	KNOWN	basic|appris_candidate_longest	protein_coding	USO1	HGNC	protein_coding		39	0.00	0	T	NM_003715		76734444	76734444	+1	no_errors	ENST00000538159	ensembl	human	known	69_37n	missense	31	59.21	45	SNP	0.000	C
WDR87	83889	genome.wustl.edu	37	19	38379529	38379529	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr19:38379529T>A	ENST00000303868.5	-	6	4889	c.4665A>T	c.(4663-4665)gaA>gaT	p.E1555D	WDR87_ENST00000447313.2_Missense_Mutation_p.E1594D	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1555	Glu-rich.									NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GTTCTTTTTCTTCCCCCTCCC	0.453																																						dbGAP											0													246.0	182.0	201.0					19																	38379529		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.4665A>T	19.37:g.38379529T>A	ENSP00000368025:p.Glu1555Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWV9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1594D	ENST00000303868.5	37	c.4782	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	T	9.453	1.091045	0.20471	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	T;T	0.44881	0.91;0.91	3.52	1.28	0.21552	.	.	.	.	.	T	0.27098	0.0664	L	0.29908	0.895	0.09310	N	1	P;P	0.47762	0.9;0.9	B;B	0.40677	0.337;0.337	T	0.11299	-1.0593	9	0.51188	T	0.08	.	4.3763	0.11272	0.1741:0.1074:0.0:0.7185	.	1555;1594	Q6ZQQ6;E7ESW6	WDR87_HUMAN;.	D	1594;1555	ENSP00000405012:E1594D;ENSP00000368025:E1555D	ENSP00000368025:E1555D	E	-	3	2	WDR87	43071369	0.000000	0.05858	0.020000	0.16555	0.249000	0.25844	-0.495000	0.06443	0.046000	0.15833	0.363000	0.22086	GAA	WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.453	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	127	0.00	0	T	XM_940478		38379529	38379529	-1	no_errors	ENST00000447313	ensembl	human	known	69_37n	missense	298	18.80	69	SNP	0.194	A
WDR87	83889	genome.wustl.edu	37	19	38380336	38380336	+	Silent	SNP	G	G	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr19:38380336G>C	ENST00000303868.5	-	6	4082	c.3858C>G	c.(3856-3858)ctC>ctG	p.L1286L	WDR87_ENST00000447313.2_Silent_p.L1325L	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1286										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						TCTCCTGAAAGAGTTCCCAGC	0.458																																						dbGAP											0													159.0	128.0	137.0					19																	38380336		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3858C>G	19.37:g.38380336G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWV9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1325	ENST00000303868.5	37	c.3975	CCDS46063.1	19																																																																																			WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.458	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	83	0.00	0	G	XM_940478		38380336	38380336	-1	no_errors	ENST00000447313	ensembl	human	known	69_37n	silent	175	15.87	33	SNP	0.935	C
WDR87	83889	genome.wustl.edu	37	19	38380480	38380480	+	Silent	SNP	A	A	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr19:38380480A>G	ENST00000303868.5	-	6	3938	c.3714T>C	c.(3712-3714)gaT>gaC	p.D1238D	WDR87_ENST00000447313.2_Silent_p.D1277D	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	1238										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						ATGATGAGCCATCTCCAGCGG	0.478																																						dbGAP											0													169.0	130.0	142.0					19																	38380480		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.3714T>C	19.37:g.38380480A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWV9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1277	ENST00000303868.5	37	c.3831	CCDS46063.1	19																																																																																			WDR87	-	superfamily_ARM-type_fold	ENSG00000171804		0.478	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	96	0.00	0	A	XM_940478		38380480	38380480	-1	no_errors	ENST00000447313	ensembl	human	known	69_37n	silent	200	12.66	29	SNP	0.000	G
WNK1	65125	genome.wustl.edu	37	12	994697	994697	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr12:994697T>C	ENST00000315939.6	+	19	5370	c.4727T>C	c.(4726-4728)aTa>aCa	p.I1576T	WNK1_ENST00000530271.2_Missense_Mutation_p.I2074T|WNK1_ENST00000535572.1_Missense_Mutation_p.I1329T|WNK1_ENST00000340908.4_Missense_Mutation_p.I1169T|WNK1_ENST00000537687.1_Missense_Mutation_p.I1836T	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	1576					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			CCATCAGTGATAGCTTCTACT	0.493																																					Colon(19;451 567 6672 12618 28860)	dbGAP											0													293.0	280.0	284.0					12																	994697		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.4727T>C	12.37:g.994697T>C	ENSP00000313059:p.Ile1576Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I2074T	ENST00000315939.6	37	c.6221	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	T	4.146	0.025457	0.08054	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000340908	T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61	5.41	4.24	0.50183	.	1.034590	0.07636	N	0.929475	T	0.34337	0.0894	N	0.14661	0.345	0.09310	N	1	B;B;B	0.22211	0.034;0.066;0.039	B;B;B	0.24394	0.053;0.036;0.016	T	0.13602	-1.0503	10	0.33141	T	0.24	-0.1227	11.8573	0.52446	0.0:0.0721:0.0:0.9279	.	1329;1329;1576	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	T	1329;1576;1836;749;2074;1169	ENSP00000441972:I1329T;ENSP00000313059:I1576T;ENSP00000444465:I1836T;ENSP00000433548:I2074T;ENSP00000341292:I1169T	ENSP00000252477:I749T	I	+	2	0	WNK1	864958	0.179000	0.23135	0.016000	0.15963	0.089000	0.18198	2.514000	0.45503	2.171000	0.68590	0.533000	0.62120	ATA	WNK1	-	NULL	ENSG00000060237		0.493	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	38	0.00	0	T	NM_018979		994697	994697	+1	no_errors	ENST00000530271	ensembl	human	known	69_37n	missense	64	23.81	20	SNP	0.015	C
YEATS2	55689	genome.wustl.edu	37	3	183436340	183436340	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr3:183436340C>G	ENST00000305135.5	+	4	446	c.251C>G	c.(250-252)gCa>gGa	p.A84G		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	84					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			TGCATTGTAGCAAACTACTAT	0.383																																						dbGAP											0													87.0	83.0	84.0					3																	183436340		1880	4100	5980	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.251C>G	3.37:g.183436340C>G	ENSP00000306983:p.Ala84Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.A84G	ENST00000305135.5	37	c.251	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.371945	0.95923	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.55413	0.52	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	T	0.70482	0.3229	M	0.65498	2.005	0.80722	D	1	D	0.76494	0.999	D	0.65323	0.934	T	0.72721	-0.4208	10	0.87932	D	0	-22.8179	17.9517	0.89055	0.0:1.0:0.0:0.0	.	84	Q9ULM3	YETS2_HUMAN	G	84	ENSP00000306983:A84G	ENSP00000306983:A84G	A	+	2	0	YEATS2	184919034	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.416000	0.80143	2.677000	0.91161	0.585000	0.79938	GCA	YEATS2	-	NULL	ENSG00000163872		0.383	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	60	0.00	0	C	NM_018023		183436340	183436340	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	25	58.33	35	SNP	1.000	G
ZBTB32	27033	genome.wustl.edu	37	19	36207192	36207192	+	Silent	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr19:36207192C>T	ENST00000392197.2	+	6	1500	c.1182C>T	c.(1180-1182)gtC>gtT	p.V394V	ZBTB32_ENST00000262630.3_Silent_p.V394V|KMT2B_ENST00000222270.7_5'Flank|KMT2B_ENST00000607650.1_RNA|KMT2B_ENST00000420124.1_5'Flank|KMT2B_ENST00000341701.1_5'Flank			Q9Y2Y4	ZBT32_HUMAN	zinc finger and BTB domain containing 32	394					DNA repair (GO:0006281)|hemopoiesis (GO:0030097)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of cytokine production (GO:0001817)|T cell proliferation (GO:0042098)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(1)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	14	all_lung(56;2.22e-07)|Lung NSC(56;3.47e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			ACTACCGAGTCCACACAGGTA	0.617																																						dbGAP											0													32.0	30.0	31.0					19																	36207192		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF130255	CCDS12471.1	19q13.1	2013-01-08			ENSG00000011590	ENSG00000011590		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	16763	protein-coding gene	gene with protein product	"""repressor of GATA"""	605859				10572087	Standard	XM_005258739		Approved	TZFP, FAZF, FAXF, Rog, ZNF538	uc002oay.3	Q9Y2Y4	OTTHUMG00000048118	ENST00000392197.2:c.1182C>T	19.37:g.36207192C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WVP2	Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.V394	ENST00000392197.2	37	c.1182	CCDS12471.1	19																																																																																			ZBTB32	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000011590		0.617	ZBTB32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB32	HGNC	protein_coding	OTTHUMT00000109491.3	15	0.00	0	C	NM_014383		36207192	36207192	+1	no_errors	ENST00000262630	ensembl	human	known	69_37n	silent	20	50.00	20	SNP	0.996	T
ZC2HC1C	79696	genome.wustl.edu	37	14	75537318	75537318	+	Silent	SNP	C	C	T			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr14:75537318C>T	ENST00000524913.1	+	2	531	c.42C>T	c.(40-42)ggC>ggT	p.G14G	ZC2HC1C_ENST00000238686.8_Silent_p.G14G|ZC2HC1C_ENST00000526748.1_Intron|ACYP1_ENST00000555463.1_5'Flank|ZC2HC1C_ENST00000439583.2_Silent_p.G14G	NM_024643.2	NP_078919.2	Q53FD0	ZC21C_HUMAN	zinc finger, C2HC-type containing 1C	14							metal ion binding (GO:0046872)										TGCCTGTGGGCGTTATGCTCC	0.557																																						dbGAP											0													74.0	72.0	73.0					14																	75537318		1990	4162	6152	-	-	-	SO:0001819	synonymous_variant	0			AK026746	CCDS41972.1, CCDS45138.1	14q24.3	2013-01-10	2012-02-03	2012-02-03	ENSG00000119703	ENSG00000119703		"""Zinc fingers, C2HC-type containing"""	20354	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 140"", ""family with sequence similarity 164, member C"""	C14orf140, FAM164C			Standard	XM_005268062		Approved		uc001xrh.3	Q53FD0	OTTHUMG00000167439	ENST00000524913.1:c.42C>T	14.37:g.75537318C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PJQ0|Q9BTA8|Q9H5S9	Silent	SNP	NULL	p.G14	ENST00000524913.1	37	c.42	CCDS41972.1	14																																																																																			ZC2HC1C	-	NULL	ENSG00000119703		0.557	ZC2HC1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC2HC1C	HGNC	protein_coding	OTTHUMT00000394616.4	45	0.00	0	C	NM_001042430		75537318	75537318	+1	no_errors	ENST00000524913	ensembl	human	known	69_37n	silent	7	68.18	15	SNP	0.872	T
ZNF569	148266	genome.wustl.edu	37	19	37904029	37904029	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr19:37904029T>C	ENST00000316950.6	-	6	2088	c.1531A>G	c.(1531-1533)Aca>Gca	p.T511A	ZNF569_ENST00000392149.2_Missense_Mutation_p.T511A|ZNF569_ENST00000392150.2_Missense_Mutation_p.T352A	NM_152484.2	NP_689697.2	Q5MCW4	ZN569_HUMAN	zinc finger protein 569	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(5)|endometrium(4)|large_intestine(16)|lung(11)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TTTTGATGTGTAATGAAGTTT	0.358																																						dbGAP											0													66.0	65.0	65.0					19																	37904029		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL833408	CCDS12503.1	19q13.12	2013-09-20			ENSG00000196437	ENSG00000196437		"""Zinc fingers, C2H2-type"", ""-"""	24737	protein-coding gene	gene with protein product		613904				12477932	Standard	NM_152484		Approved	FLJ32053, ZAP1	uc002ogi.3	Q5MCW4	OTTHUMG00000048172	ENST00000316950.6:c.1531A>G	19.37:g.37904029T>C	ENSP00000325018:p.Thr511Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1S2|Q15925|Q17RR6|Q96MQ2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T511A	ENST00000316950.6	37	c.1531	CCDS12503.1	19	.	.	.	.	.	.	.	.	.	.	T	7.263	0.605536	0.14002	.	.	ENSG00000196437	ENST00000316950;ENST00000392149;ENST00000392150	T;T	0.07216	3.21;3.21	4.1	3.06	0.35304	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.09113	0.0225	N	0.16066	0.365	0.09310	N	1	P;P	0.50528	0.539;0.936	B;D	0.63113	0.162;0.911	T	0.20739	-1.0266	9	0.09084	T	0.74	.	5.1603	0.15058	0.0:0.0963:0.1849:0.7188	.	352;511	Q17RR6;Q5MCW4	.;ZN569_HUMAN	A	511;167;352	ENSP00000325018:T511A;ENSP00000375993:T352A	ENSP00000325018:T511A	T	-	1	0	ZNF569	42595869	0.000000	0.05858	0.997000	0.53966	0.996000	0.88848	-1.803000	0.01740	0.700000	0.31782	0.533000	0.62120	ACA	ZNF569	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196437		0.358	ZNF569-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF569	HGNC	protein_coding	OTTHUMT00000109594.2	39	0.00	0	T	NM_152484		37904029	37904029	-1	no_errors	ENST00000316950	ensembl	human	known	69_37n	missense	79	36.80	46	SNP	0.225	C
ZNF785	146540	genome.wustl.edu	37	16	30593995	30593995	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr16:30593995C>A	ENST00000395216.2	-	3	1263	c.1104G>T	c.(1102-1104)agG>agT	p.R368S	AC002310.7_ENST00000492040.1_RNA|ZNF785_ENST00000470110.1_Missense_Mutation_p.R353S|AC002310.7_ENST00000486926.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	368					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						GCCACGCGCGCCTCTCGCTGC	0.637																																						dbGAP											0													54.0	58.0	57.0					16																	30593995		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.1104G>T	16.37:g.30593995C>A	ENSP00000378642:p.Arg368Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O75701|Q8IW91|Q8WV14|Q96MN0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R368S	ENST00000395216.2	37	c.1104	CCDS10685.1	16	.	.	.	.	.	.	.	.	.	.	c	10.33	1.319869	0.23994	.	.	ENSG00000197162	ENST00000470110;ENST00000395222;ENST00000395216	T;T	0.05513	3.43;3.48	3.21	-0.00493	0.14019	.	.	.	.	.	T	0.03915	0.0110	N	0.22421	0.69	0.09310	N	1	B;B;B	0.23891	0.056;0.056;0.093	B;B;B	0.20955	0.014;0.014;0.032	T	0.42565	-0.9444	9	0.72032	D	0.01	.	1.8496	0.03166	0.2105:0.4639:0.2046:0.1209	.	333;368;353	B4DQL1;A8K8V0;A8K8V0-2	.;ZN785_HUMAN;.	S	353;333;368	ENSP00000420340:R353S;ENSP00000378642:R368S	ENSP00000378642:R368S	R	-	3	2	ZNF785	30501496	0.044000	0.20184	0.002000	0.10522	0.024000	0.10985	2.002000	0.40835	0.055000	0.16094	0.644000	0.83932	AGG	ZNF785	-	NULL	ENSG00000197162		0.637	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF785	HGNC	protein_coding	OTTHUMT00000255529.2	21	0.00	0	C	NM_152458		30593995	30593995	-1	no_errors	ENST00000395216	ensembl	human	known	69_37n	missense	5	57.14	8	SNP	0.003	A
ZNF99	7652	genome.wustl.edu	37	19	22939859	22939859	+	IGR	SNP	A	A	G			TCGA-E9-A22G-01A-11D-A159-09	TCGA-E9-A22G-10A-01D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2be1b92a-6041-4d2b-9cf8-b9723921987f	b88f0c85-3a9c-44fa-a09a-563e6cf8521f	g.chr19:22939859A>G	ENST00000596209.1	-	0	2686				ZNF99_ENST00000397104.3_Silent_p.H824H|CTC-451A6.4_ENST00000442497.2_lincRNA	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				TCTCCCTAGTATGAATTAGCT	0.378																																						dbGAP											0													86.0	96.0	93.0					19																	22939859		2072	4233	6305	-	-	-	SO:0001628	intergenic_variant	0			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4			19.37:g.22939859A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	M0R335	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H824	ENST00000596209.1	37	c.2472	CCDS59369.1	19																																																																																			ZNF99	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213973		0.378	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	52	0.00	0	A	XM_065124		22939859	22939859	-1	no_errors	ENST00000397104	ensembl	human	known	69_37n	silent	93	22.50	27	SNP	0.963	G
