#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS13	11093	genome.wustl.edu	37	9	136302057	136302057	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr9:136302057G>T	ENST00000371929.3	+	12	1861	c.1417G>T	c.(1417-1419)Gct>Tct	p.A473S	ADAMTS13_ENST00000371916.1_3'UTR|ADAMTS13_ENST00000356589.2_Missense_Mutation_p.A442S|ADAMTS13_ENST00000355699.2_Missense_Mutation_p.A473S|ADAMTS13_ENST00000536611.1_Missense_Mutation_p.A145S|ADAMTS13_ENST00000485925.1_Intron	NM_139025.3|NM_139027.3	NP_620594.1|NP_620596.2	Q76LX8	ATS13_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 13	473	Cysteine-rich.				cell-matrix adhesion (GO:0007160)|glycoprotein metabolic process (GO:0009100)|integrin-mediated signaling pathway (GO:0007229)|peptide catabolic process (GO:0043171)|platelet activation (GO:0030168)|protein processing (GO:0016485)|proteolysis (GO:0006508)|response to interferon-gamma (GO:0034341)|response to interleukin-4 (GO:0070670)|response to tumor necrosis factor (GO:0034612)	cell surface (GO:0009986)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(4)	36				OV - Ovarian serous cystadenocarcinoma(145;1.06e-07)|Epithelial(140;1.28e-06)|all cancers(34;1.46e-05)		CTGGGGTGCTGCTGTACCACA	0.682																																						dbGAP											0													13.0	13.0	13.0					9																	136302057		2196	4293	6489	-	-	-	SO:0001583	missense	0			AJ011374	CCDS6970.1, CCDS6971.1, CCDS6972.1	9q34	2008-07-21	2005-08-19	2001-09-21	ENSG00000160323	ENSG00000160323		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	1366	protein-coding gene	gene with protein product		604134	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 13"""	C9orf8		11557746, 11535495	Standard	NM_139025		Approved	VWFCP, TTP, vWF-CP, FLJ42993, MGC118899, MGC118900, DKFZp434C2322	uc004cdv.4	Q76LX8	OTTHUMG00000020876	ENST00000371929.3:c.1417G>T	9.37:g.136302057G>T	ENSP00000360997:p.Ala473Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UY16|Q710F6|Q711T8|Q96L37|Q9H0G3|Q9UGQ1	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,superfamily_CUB,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.A473S	ENST00000371929.3	37	c.1417	CCDS6970.1	9	.	.	.	.	.	.	.	.	.	.	G	16.23	3.063966	0.55432	.	.	ENSG00000160323	ENST00000371929;ENST00000355699;ENST00000356589;ENST00000536611	T;T;T;T	0.68331	-0.3;-0.32;-0.29;3.9	5.1	5.1	0.69264	.	.	.	.	.	T	0.79701	0.4491	M	0.70275	2.135	0.49051	D	0.999745	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.999;0.997;0.998	T	0.76135	-0.3070	9	0.23891	T	0.37	.	16.0379	0.80642	0.0:0.0:1.0:0.0	.	473;442;473	Q76LX8;Q76LX8-3;Q76LX8-2	ATS13_HUMAN;.;.	S	473;473;442;145	ENSP00000360997:A473S;ENSP00000347927:A473S;ENSP00000348997:A442S;ENSP00000444504:A145S	ENSP00000347927:A473S	A	+	1	0	ADAMTS13	135291878	1.000000	0.71417	0.094000	0.20943	0.030000	0.12068	7.351000	0.79395	2.537000	0.85549	0.561000	0.74099	GCT	ADAMTS13	-	NULL	ENSG00000160323		0.682	ADAMTS13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADAMTS13	HGNC	protein_coding	OTTHUMT00000054920.1	17	0.00	0	G	NM_139025		136302057	136302057	+1	no_errors	ENST00000371929	ensembl	human	known	69_37n	missense	7	56.25	9	SNP	0.964	T
AMH	268	genome.wustl.edu	37	19	2251714	2251714	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr19:2251714G>A	ENST00000221496.4	+	5	1463	c.1441G>A	c.(1441-1443)Gag>Aag	p.E481K	MIR4321_ENST00000592276.1_RNA	NM_000479.3	NP_000470	P03971	MIS_HUMAN	anti-Mullerian hormone	481					aging (GO:0007568)|cell-cell signaling (GO:0007267)|gonadal mesoderm development (GO:0007506)|Mullerian duct regression (GO:0001880)|positive regulation of gene expression (GO:0010628)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|preantral ovarian follicle growth (GO:0001546)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|urogenital system development (GO:0001655)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	hormone activity (GO:0005179)|receptor binding (GO:0005102)			lung(2)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACTCATCCCCGAGACCTACCA	0.711									Persistant Mullerian Duct Syndrome (type I and II)																													dbGAP											0													31.0	31.0	31.0					19																	2251714		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	PMDS, Persistent Oviduct Syndrome	K03474	CCDS12085.1	19p13.3	2014-01-30				ENSG00000104899		"""Endogenous ligands"""	464	protein-coding gene	gene with protein product		600957				3754790, 18784351	Standard	NM_000479		Approved	MIS	uc002lvh.2	P03971		ENST00000221496.4:c.1441G>A	19.37:g.2251714G>A	ENSP00000221496:p.Glu481Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75246|Q6GTN3	Missense_Mutation	SNP	pfam_AMH_N,pfam_TGF-b_C,smart_TGF-b_C,pirsf_Muellerian-inhibiting_factor	p.E481K	ENST00000221496.4	37	c.1441	CCDS12085.1	19	.	.	.	.	.	.	.	.	.	.	G	17.70	3.454959	0.63290	.	.	ENSG00000104899	ENST00000221496	D	0.84070	-1.8	3.77	2.73	0.32206	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.826358	0.10796	U	0.633244	T	0.80549	0.4644	N	0.16037	0.36	0.21416	N	0.999692	D	0.76494	0.999	D	0.70487	0.969	T	0.67133	-0.5747	10	0.26408	T	0.33	-17.2016	7.2197	0.25979	0.241:0.0:0.759:0.0	.	481	P03971	MIS_HUMAN	K	481	ENSP00000221496:E481K	ENSP00000221496:E481K	E	+	1	0	AMH	2202714	0.085000	0.21516	0.950000	0.38849	0.696000	0.40369	1.583000	0.36579	0.589000	0.29677	0.306000	0.20318	GAG	AMH	-	pfam_TGF-b_C,smart_TGF-b_C,pirsf_Muellerian-inhibiting_factor	ENSG00000104899		0.711	AMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMH	HGNC	protein_coding	OTTHUMT00000451276.3	9	0.00	0	G	NM_000479		2251714	2251714	+1	no_errors	ENST00000221496	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	0.485	A
ANKRD20A11P	391267	genome.wustl.edu	37	21	15352393	15352394	+	RNA	DEL	CC	CC	-			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr21:15352393_15352394delCC	ENST00000344693.5	-	0	364_365					NR_027270.1				ankyrin repeat domain 20 family, member A11, pseudogene																		ATTATCTAATCCAAAATCCGCG	0.619																																						dbGAP											0																																										-	-	-			0					21q11.2	2011-11-23			ENSG00000215559	ENSG00000215559			42024	pseudogene	pseudogene			"""chromosome 21 open reading frame 81"""	C21orf81			Standard	NR_027270		Approved		uc002yjj.4		OTTHUMG00000074237		21.37:g.15352393_15352394delCC		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000344693.5	37	NULL		21																																																																																			ANKRD20A11P	-	-	ENSG00000215559		0.619	ANKRD20A11P-005	KNOWN	basic	processed_transcript	ANKRD20A11P	HGNC	pseudogene	OTTHUMT00000157750.1	11	0.00	0	CC			15352393	15352394	-1	no_errors	ENST00000344693	ensembl	human	known	69_37n	rna	4	33.33	2	DEL	0.028:0.033	-
ARHGAP39	80728	genome.wustl.edu	37	8	145757696	145757696	+	Silent	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr8:145757696G>A	ENST00000276826.5	-	8	3081	c.2880C>T	c.(2878-2880)caC>caT	p.H960H	ARHGAP39_ENST00000377307.2_Silent_p.H991H|ARHGAP39_ENST00000540274.1_Silent_p.H960H			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	960	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						CACCAGGGACGTGGGGGTCTT	0.672																																						dbGAP											0													67.0	52.0	57.0					8																	145757696		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2880C>T	8.37:g.145757696G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1I1	Silent	SNP	pfam_RhoGAP_dom,pfam_MyTH4_dom,superfamily_Rho_GTPase_activation_prot,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_MyTH4_dom,smart_RhoGAP_dom,pfscan_MyTH4_dom,pfscan_WW_Rsp5_WWP,pfscan_RhoGAP_dom	p.H991	ENST00000276826.5	37	c.2973		8																																																																																			ARHGAP39	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000147799		0.672	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	ARHGAP39	HGNC	protein_coding	OTTHUMT00000382509.1	50	0.00	0	G			145757696	145757696	-1	no_errors	ENST00000377307	ensembl	human	known	69_37n	silent	54	22.86	16	SNP	0.811	A
BAHCC1	57597	genome.wustl.edu	37	17	79414752	79414752	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr17:79414752C>A	ENST00000307745.7	+	15	3854	c.3854C>A	c.(3853-3855)gCg>gAg	p.A1285E																								CAGCCCCCAGCGGCCTCTGGG	0.692																																						dbGAP											0													10.0	14.0	12.0					17																	79414752		1962	4109	6071	-	-	-	SO:0001583	missense	0																														ENST00000307745.7:c.3854C>A	17.37:g.79414752C>A	ENSP00000303486:p.Ala1285Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.A1285E	ENST00000307745.7	37	c.3854		17	.	.	.	.	.	.	.	.	.	.	c	11.51	1.660208	0.29515	.	.	ENSG00000171282	ENST00000307745	T	0.25414	1.8	3.87	1.71	0.24356	.	0.858058	0.09469	U	0.797916	T	0.19685	0.0473	L	0.44542	1.39	0.09310	N	1	B;B	0.33940	0.199;0.433	B;B	0.35413	0.099;0.202	T	0.25467	-1.0131	10	0.30078	T	0.28	.	3.9354	0.09304	0.0:0.5714:0.2013:0.2273	.	1285;1285	Q9P281;F8WBW8	BAHC1_HUMAN;.	E	1285	ENSP00000303486:A1285E	ENSP00000303486:A1285E	A	+	2	0	AC110285.1	77029347	0.000000	0.05858	0.002000	0.10522	0.056000	0.15407	-0.216000	0.09266	0.818000	0.34468	0.457000	0.33378	GCG	BAHCC1	-	NULL	ENSG00000171282		0.692	RP11-1055B8.7-201	KNOWN	basic|appris_principal	protein_coding	BAHCC1	HGNC	protein_coding		29	0.00	0	C			79414752	79414752	+1	no_errors	ENST00000307745	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	0.000	A
BMPR1B	658	genome.wustl.edu	37	4	96051023	96051024	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr4:96051023_96051024insTA	ENST00000515059.1	+	9	879_880	c.596_597insTA	c.(595-600)actatafs	p.TI199fs	BMPR1B_ENST00000440890.2_Frame_Shift_Ins_p.TI229fs|BMPR1B_ENST00000264568.4_Frame_Shift_Ins_p.TI199fs|BMPR1B_ENST00000394931.1_Frame_Shift_Ins_p.TI199fs	NM_001203.2	NP_001194.1	O00238	BMR1B_HUMAN	bone morphogenetic protein receptor, type IB	199	GS. {ECO:0000255|PROSITE- ProRule:PRU00585}.				BMP signaling pathway (GO:0030509)|cartilage condensation (GO:0001502)|chondrocyte differentiation (GO:0002062)|dorsal/ventral pattern formation (GO:0009953)|eye development (GO:0001654)|inflammatory response (GO:0006954)|limb morphogenesis (GO:0035108)|ovarian cumulus expansion (GO:0001550)|ovulation cycle (GO:0042698)|positive regulation of bone mineralization (GO:0030501)|positive regulation of cell differentiation (GO:0045597)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of osteoblast differentiation (GO:0045669)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|skeletal system development (GO:0001501)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta receptor activity, type I (GO:0005025)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(11)|lung(8)|ovary(1)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.51e-07)		GTCCAAAGGACTATAGCTAAGC	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D89675	CCDS3642.1, CCDS58919.1	4q23-q24	2008-02-05			ENSG00000138696	ENSG00000138696		"""CD molecules"""	1077	protein-coding gene	gene with protein product		603248				8140412, 9730621	Standard	NM_001203		Approved	ALK6, CDw293	uc031sgn.1	O00238	OTTHUMG00000130991	ENST00000515059.1:c.599_600dupTA	4.37:g.96051026_96051027dupTA	ENSP00000426617:p.Thr199fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R953|B4DSV1|P78366	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Activin_II/TGFBeta-II_recpt	p.A231fs	ENST00000515059.1	37	c.686_687	CCDS3642.1	4																																																																																			BMPR1B	-	pfam_TGF_beta_rcpt_GS,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS	ENSG00000138696		0.421	BMPR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR1B	HGNC	protein_coding	OTTHUMT00000253609.3	101	0.00	0	-	NM_001203		96051023	96051024	+1	no_errors	ENST00000440890	ensembl	human	known	69_37n	frame_shift_ins	129	27.93	50	INS	1.000:0.005	TA
CAV1	857	genome.wustl.edu	37	7	116199190	116199190	+	Missense_Mutation	SNP	C	C	A	rs200865381		TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr7:116199190C>A	ENST00000341049.2	+	3	664	c.386C>A	c.(385-387)gCa>gAa	p.A129E	CAV1_ENST00000393468.1_Missense_Mutation_p.A98E|CAV1_ENST00000405348.1_Missense_Mutation_p.A98E|CAV1_ENST00000393470.1_Missense_Mutation_p.A118E|CAV1_ENST00000393467.1_Missense_Mutation_p.A98E	NM_001753.4	NP_001744.2	Q03135	CAV1_HUMAN	caveolin 1, caveolae protein, 22kDa	129					angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion transport (GO:0006816)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cellular calcium ion homeostasis (GO:0006874)|cellular response to hyperoxia (GO:0071455)|cellular response to starvation (GO:0009267)|cholesterol homeostasis (GO:0042632)|cholesterol transport (GO:0030301)|cytosolic calcium ion homeostasis (GO:0051480)|inactivation of MAPK activity (GO:0000188)|lactation (GO:0007595)|leukocyte migration (GO:0050900)|lipid storage (GO:0019915)|maintenance of protein location in cell (GO:0032507)|mammary gland development (GO:0030879)|mammary gland involution (GO:0060056)|MAPK cascade (GO:0000165)|membrane depolarization (GO:0051899)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of pinocytosis (GO:0048550)|negative regulation of protein binding (GO:0032091)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|nitric oxide homeostasis (GO:0033484)|nitric oxide metabolic process (GO:0046209)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of vasoconstriction (GO:0045907)|protein homooligomerization (GO:0051260)|protein localization (GO:0008104)|receptor internalization involved in canonical Wnt signaling pathway (GO:2000286)|regulation of blood coagulation (GO:0030193)|regulation of fatty acid metabolic process (GO:0019217)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of peptidase activity (GO:0052547)|regulation of smooth muscle contraction (GO:0006940)|regulation of the force of heart contraction by chemical signal (GO:0003057)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|response to ischemia (GO:0002931)|response to progesterone (GO:0032570)|skeletal muscle tissue development (GO:0007519)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|triglyceride metabolic process (GO:0006641)|vasculogenesis (GO:0001570)|vasoconstriction (GO:0042310)|vesicle organization (GO:0016050)|viral process (GO:0016032)	acrosomal membrane (GO:0002080)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell cortex (GO:0005938)|cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|lipid particle (GO:0005811)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	cholesterol binding (GO:0015485)|enzyme binding (GO:0019899)|nitric-oxide synthase binding (GO:0050998)|patched binding (GO:0005113)|peptidase activator activity (GO:0016504)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4	all_epithelial(6;1.42e-06)|Lung NSC(10;0.0056)|all_lung(10;0.00609)		STAD - Stomach adenocarcinoma(10;0.00878)			CACATCTGGGCAGTTGTACCA	0.493																																						dbGAP											0													159.0	122.0	134.0					7																	116199190		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF125348	CCDS5767.1, CCDS55156.1	7q31	2006-02-09	2002-08-29		ENSG00000105974	ENSG00000105974			1527	protein-coding gene	gene with protein product		601047	"""caveolin 1, caveolae protein, 22kD"""	CAV		10087206	Standard	NM_001753		Approved		uc003vif.2	Q03135	OTTHUMG00000023413	ENST00000341049.2:c.386C>A	7.37:g.116199190C>A	ENSP00000339191:p.Ala129Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UGP1|Q9UNG1|Q9UQH6	Missense_Mutation	SNP	pfam_Caveolin	p.A129E	ENST00000341049.2	37	c.386	CCDS5767.1	7	.	.	.	.	.	.	.	.	.	.	C	18.90	3.721644	0.68959	.	.	ENSG00000105974	ENST00000341049;ENST00000393470;ENST00000405348;ENST00000456473;ENST00000393468;ENST00000393467	D;D;D;D;D;D	0.93019	-3.15;-3.15;-3.15;-3.15;-3.15;-3.15	5.7	4.76	0.60689	.	0.047537	0.85682	D	0.000000	D	0.94788	0.8317	M	0.77103	2.36	0.80722	D	1	B	0.33171	0.4	P	0.46208	0.507	D	0.93209	0.6598	10	0.35671	T	0.21	0.2259	13.4635	0.61241	0.0:0.9186:0.0:0.0814	.	129	Q03135	CAV1_HUMAN	E	129;118;98;98;98;98	ENSP00000339191:A129E;ENSP00000377113:A118E;ENSP00000384348:A98E;ENSP00000389033:A98E;ENSP00000377111:A98E;ENSP00000377110:A98E	ENSP00000339191:A129E	A	+	2	0	CAV1	115986426	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.734000	0.68580	1.271000	0.44313	0.650000	0.86243	GCA	CAV1	-	pfam_Caveolin	ENSG00000105974		0.493	CAV1-001	KNOWN	basic|CCDS	protein_coding	CAV1	HGNC	protein_coding	OTTHUMT00000059734.4	112	0.00	0	C	NM_001753		116199190	116199190	+1	no_errors	ENST00000341049	ensembl	human	known	69_37n	missense	70	38.05	43	SNP	1.000	A
CCDC125	202243	genome.wustl.edu	37	5	68609471	68609471	+	Intron	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr5:68609471G>A	ENST00000396496.2	-	3	474				CCDC125_ENST00000396499.1_Intron|CCDC125_ENST00000383374.2_Intron|CCDC125_ENST00000511257.1_Intron|CCDC125_ENST00000460090.1_Intron			Q86Z20	CC125_HUMAN	coiled-coil domain containing 125							cytoplasm (GO:0005737)				breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(7)|urinary_tract(1)	19		Lung NSC(167;7.26e-05)|Prostate(74;0.0143)|Ovarian(174;0.0448)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.2e-56)|Epithelial(20;2.31e-52)|all cancers(19;5.85e-48)|Lung(70;0.0183)		ATCCTTATCCGGTAGCATCTT	0.522																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB024691	CCDS4000.1, CCDS75255.1	5q13.2	2008-02-05			ENSG00000183323	ENSG00000183323			28924	protein-coding gene	gene with protein product		613781					Standard	XM_005248461		Approved	KENAE	uc003jvv.1	Q86Z20	OTTHUMG00000131259	ENST00000396496.2:c.366+340C>T	5.37:g.68609471G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86Z19	RNA	SNP	-	NULL	ENST00000396496.2	37	NULL	CCDS4000.1	5																																																																																			CCDC125	-	-	ENSG00000183323		0.522	CCDC125-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC125	HGNC	protein_coding	OTTHUMT00000254027.4	43	0.00	0	G	NM_176816		68609471	68609471	-1	no_errors	ENST00000513172	ensembl	human	known	69_37n	rna	19	42.42	14	SNP	1.000	A
SLC35F6	54978	genome.wustl.edu	37	2	26987173	26987173	+	5'UTR	DEL	G	G	-	rs375148795	byFrequency	TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr2:26987173delG	ENST00000344420.5	+	0	18				SLC35F6_ENST00000482746.1_3'UTR|SLC35F6_ENST00000416475.2_5'UTR|CENPA_ENST00000475662.1_3'UTR	NM_017877.3	NP_060347.2	Q8N357	S35F6_HUMAN	solute carrier family 35, member F6						negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)|positive regulation of cell proliferation (GO:0008284)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)											CCCGGGTGACGGGGCCCGGCG	0.741																																						dbGAP											0													19.0	19.0	19.0					2																	26987173		1637	3006	4643	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK075164	CCDS1728.1	2p24.1	2012-12-13	2012-12-07	2012-12-07	ENSG00000213699	ENSG00000213699			26055	protein-coding gene	gene with protein product	"""ANT2-binding protein"", ""transport and golgi organization 9 homolog (Drosophila)"""		"""chromosome 2 open reading frame 18"""	C2orf18		15911612, 19154410	Standard	NM_017877		Approved	FLJ20555, ANT2BP, TANGO9	uc002rhp.1	Q8N357	OTTHUMG00000128407	ENST00000344420.5:c.-45G>-	2.37:g.26987173delG		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W543|Q53GK2|Q8NBX6|Q9NWX0	RNA	DEL	-	NULL	ENST00000344420.5	37	NULL	CCDS1728.1	2																																																																																			CENPA	-	-	ENSG00000115163		0.741	SLC35F6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPA	HGNC	protein_coding	OTTHUMT00000250187.2	10	0.00	0	G	NM_017877		26987173	26987173	+1	no_errors	ENST00000475662	ensembl	human	known	69_37n	rna	7	22.22	2	DEL	0.084	-
CCDC138	165055	genome.wustl.edu	37	2	109411103	109411103	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr2:109411103G>A	ENST00000295124.4	+	5	562	c.502G>A	c.(502-504)Gac>Aac	p.D168N	CCDC138_ENST00000470608.1_3'UTR|CCDC138_ENST00000412964.2_Missense_Mutation_p.D168N	NM_144978.1	NP_659415.1	Q96M89	CC138_HUMAN	coiled-coil domain containing 138	168										endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	14						TAAAGCATCAGACAAGCGGAG	0.413																																						dbGAP											0													81.0	79.0	79.0					2																	109411103		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057307	CCDS2080.1	2q13	2008-02-05			ENSG00000163006	ENSG00000163006			26531	protein-coding gene	gene with protein product						12477932	Standard	NM_144978		Approved	FLJ32745	uc002ten.1	Q96M89	OTTHUMG00000130980	ENST00000295124.4:c.502G>A	2.37:g.109411103G>A	ENSP00000295124:p.Asp168Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DF1|Q4ZG07|Q53TE1|Q6ZUY5|Q86VL7	Missense_Mutation	SNP	NULL	p.D168N	ENST00000295124.4	37	c.502	CCDS2080.1	2	.	.	.	.	.	.	.	.	.	.	G	3.992	-0.004372	0.07773	.	.	ENSG00000163006	ENST00000412964;ENST00000295124	D;D	0.89415	-2.51;-2.51	5.53	1.76	0.24704	.	0.921955	0.09243	N	0.828922	T	0.72309	0.3444	N	0.03115	-0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.56685	-0.7938	10	0.13108	T	0.6	-10.8545	7.4025	0.26973	0.4967:0.4263:0.077:0.0	.	168;168	Q96M89-2;Q96M89	.;CC138_HUMAN	N	168	ENSP00000411800:D168N;ENSP00000295124:D168N	ENSP00000295124:D168N	D	+	1	0	CCDC138	108777535	0.000000	0.05858	0.123000	0.21794	0.726000	0.41606	0.899000	0.28417	0.119000	0.18210	-0.367000	0.07326	GAC	CCDC138	-	NULL	ENSG00000163006		0.413	CCDC138-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC138	HGNC	protein_coding	OTTHUMT00000253593.1	71	0.00	0	G	NM_144978		109411103	109411103	+1	no_errors	ENST00000295124	ensembl	human	known	69_37n	missense	20	67.21	41	SNP	0.129	A
CHIC1	53344	genome.wustl.edu	37	X	72804295	72804295	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chrX:72804295G>T	ENST00000373502.5	+	3	471	c.394G>T	c.(394-396)Gca>Tca	p.A132S	CHIC1_ENST00000373504.6_Missense_Mutation_p.A132S	NM_001039840.2	NP_001034929.2	Q5VXU3	CHIC1_HUMAN	cysteine-rich hydrophobic domain 1	132						cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(2)	4	Renal(35;0.156)					CCGTGTGAATGCATGTTTGAA	0.463																																						dbGAP											0													146.0	120.0	129.0					X																	72804295		2198	4287	6485	-	-	-	SO:0001583	missense	0			Y11897	CCDS35335.2, CCDS75993.1	Xq13.2	2008-05-14			ENSG00000204116	ENSG00000204116			1934	protein-coding gene	gene with protein product		300922				9321471, 11257495	Standard	NM_001039840		Approved	BRX	uc004ebk.4	Q5VXU3	OTTHUMG00000021835	ENST00000373502.5:c.394G>T	X.37:g.72804295G>T	ENSP00000362601:p.Ala132Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJZ2|B0QZ87|B9EGS5|Q5CZ84	Missense_Mutation	SNP	pfam_Golgin_A_7/ERF4	p.A132S	ENST00000373502.5	37	c.394	CCDS35335.2	X	.	.	.	.	.	.	.	.	.	.	G	3.897	-0.022905	0.07634	.	.	ENSG00000204116	ENST00000373502;ENST00000373504	.	.	.	5.14	2.19	0.27852	Golgin subfamily A member 7/ERF4 (1);	0.202934	0.42821	N	0.000652	T	0.17152	0.0412	N	0.04746	-0.17	0.31071	N	0.713048	B;B;B	0.31383	0.321;0.111;0.072	B;B;B	0.26094	0.066;0.039;0.037	T	0.31558	-0.9939	9	0.06365	T	0.9	-10.3658	11.9735	0.53078	0.0:0.0:0.5813:0.4187	.	132;132;132	B7Z3I1;Q5VXU3-2;Q5VXU3	.;.;CHIC1_HUMAN	S	132	.	ENSP00000362601:A132S	A	+	1	0	CHIC1	72721020	1.000000	0.71417	0.996000	0.52242	0.997000	0.91878	2.449000	0.44935	0.177000	0.19895	0.594000	0.82650	GCA	CHIC1	-	pfam_Golgin_A_7/ERF4	ENSG00000204116		0.463	CHIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIC1	HGNC	protein_coding	OTTHUMT00000057233.3	186	0.00	0	G			72804295	72804295	+1	no_errors	ENST00000373502	ensembl	human	known	69_37n	missense	138	19.65	34	SNP	1.000	T
CHRM4	1132	genome.wustl.edu	37	11	46407681	46407681	+	Missense_Mutation	SNP	G	G	A	rs200330011		TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr11:46407681G>A	ENST00000433765.2	-	1	426	c.427C>T	c.(427-429)Cgg>Tgg	p.R143W		NM_000741.2	NP_000732.2	P08173	ACM4_HUMAN	cholinergic receptor, muscarinic 4	143					adenylate cyclase-inhibiting G-protein coupled acetylcholine receptor signaling pathway (GO:0007197)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|regulation of locomotion (GO:0040012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			breast(1)|endometrium(7)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	20				GBM - Glioblastoma multiforme(35;0.0254)|Lung(87;0.14)	Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Atropine(DB00572)|Brompheniramine(DB00835)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cryptenamine(DB00785)|Darifenacin(DB00496)|Desipramine(DB01151)|Doxepin(DB01142)|Fesoterodine(DB06702)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Isopropamide(DB01625)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Metixene(DB00340)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paroxetine(DB00715)|Pethidine(DB00454)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Scopolamine(DB00747)|Solifenacin(DB01591)|Tolterodine(DB01036)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	GTGGTGCGCCGGGCAGGGTAG	0.597																																					Esophageal Squamous(171;1020 1936 4566 30205 42542)	dbGAP											0													56.0	68.0	64.0					11																	46407681		2186	4293	6479	-	-	-	SO:0001583	missense	0			M16405	CCDS44581.1	11p12-p11.2	2012-08-08			ENSG00000180720	ENSG00000180720		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1953	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 4"""	118495				1577490	Standard	NM_000741		Approved		uc001nct.1	P08173	OTTHUMG00000154371	ENST00000433765.2:c.427C>T	11.37:g.46407681G>A	ENSP00000409378:p.Arg143Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPP4|Q0VD60|Q4VBK7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Musac_M4_rcpt	p.R143W	ENST00000433765.2	37	c.427	CCDS44581.1	11	.	.	.	.	.	.	.	.	.	.	G	15.83	2.948623	0.53186	.	.	ENSG00000180720	ENST00000433765	T	0.73363	-0.74	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.69495	0.3117	L	0.41573	1.285	0.48236	D	0.99961	D	0.57899	0.981	P	0.46917	0.531	T	0.73329	-0.4017	9	0.87932	D	0	-24.1546	11.0438	0.47846	0.0:0.0:0.6815:0.3185	.	143	P08173	ACM4_HUMAN	W	143	ENSP00000409378:R143W	ENSP00000409378:R143W	R	-	1	2	CHRM4	46364257	0.375000	0.25089	0.995000	0.50966	0.979000	0.70002	0.436000	0.21526	2.494000	0.84150	0.462000	0.41574	CGG	CHRM4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_rcpt	ENSG00000180720		0.597	CHRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM4	HGNC	protein_coding	OTTHUMT00000334985.1	114	0.00	0	G	NM_000741		46407681	46407681	-1	no_errors	ENST00000433765	ensembl	human	known	69_37n	missense	75	25.74	26	SNP	1.000	A
CHRNB3	1142	genome.wustl.edu	37	8	42563923	42563923	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr8:42563923G>T	ENST00000289957.2	+	2	244	c.116G>T	c.(115-117)gGt>gTt	p.G39V	RP11-412B14.1_ENST00000527318.1_RNA	NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	39					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	TTGTTCCAAGGTTATCAGAAA	0.418																																						dbGAP											0													124.0	118.0	120.0					8																	42563923		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.116G>T	8.37:g.42563923G>T	ENSP00000289957:p.Gly39Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15827	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.G39V	ENST00000289957.2	37	c.116	CCDS6134.1	8	.	.	.	.	.	.	.	.	.	.	g	23.7	4.451021	0.84209	.	.	ENSG00000147432	ENST00000289957	T	0.71222	-0.55	5.74	5.74	0.90152	Neurotransmitter-gated ion-channel ligand-binding (3);	0.104258	0.64402	D	0.000003	D	0.83945	0.5364	M	0.79011	2.435	0.80722	D	1	D	0.63880	0.993	D	0.68621	0.959	D	0.83786	0.0228	9	.	.	.	.	17.4865	0.87689	0.0:0.0:1.0:0.0	.	39	Q05901	ACHB3_HUMAN	V	39	ENSP00000289957:G39V	.	G	+	2	0	CHRNB3	42683080	0.933000	0.31639	0.999000	0.59377	0.985000	0.73830	1.277000	0.33167	2.745000	0.94114	0.650000	0.86243	GGT	CHRNB3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000147432		0.418	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB3	HGNC	protein_coding	OTTHUMT00000383055.1	111	0.00	0	G			42563923	42563923	+1	no_errors	ENST00000289957	ensembl	human	known	69_37n	missense	221	12.65	32	SNP	0.998	T
COL19A1	1310	genome.wustl.edu	37	6	70637853	70637853	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr6:70637853C>T	ENST00000322773.4	+	5	421	c.319C>T	c.(319-321)Cga>Tga	p.R107*		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	107	Laminin G-like.			FRVRRNAKKERWFL -> ETTVPFWRFFVLET (in Ref. 6; AAA36358). {ECO:0000305}.	cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.R107*(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TGCCATGTTTCGAGTACGAAG	0.433																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											132.0	131.0	132.0					6																	70637853		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.319C>T	6.37:g.70637853C>T	ENSP00000316030:p.Arg107*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Nonsense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.R107*	ENST00000322773.4	37	c.319	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.382792	0.95967	.	.	ENSG00000082293	ENST00000322773	.	.	.	5.71	5.71	0.89125	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8644	0.96799	0.0:1.0:0.0:0.0	.	.	.	.	X	107	.	ENSP00000316030:R107X	R	+	1	2	COL19A1	70694574	1.000000	0.71417	1.000000	0.80357	0.366000	0.29705	3.412000	0.52679	2.691000	0.91804	0.655000	0.94253	CGA	COL19A1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000082293		0.433	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	93	0.00	0	C			70637853	70637853	+1	no_errors	ENST00000322773	ensembl	human	known	69_37n	nonsense	33	67.33	68	SNP	1.000	T
CPNE6	9362	genome.wustl.edu	37	14	24542738	24542738	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr14:24542738T>C	ENST00000397016.2	+	4	510	c.199T>C	c.(199-201)Tcc>Ccc	p.S67P	CPNE6_ENST00000560092.1_3'UTR|CPNE6_ENST00000537691.1_Missense_Mutation_p.S122P|CPNE6_ENST00000216775.2_Missense_Mutation_p.S67P	NM_001280558.1	NP_001267487.1	O95741	CPNE6_HUMAN	copine VI (neuronal)	67	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid metabolic process (GO:0006629)|nervous system development (GO:0007399)|synaptic transmission (GO:0007268)|vesicle-mediated transport (GO:0016192)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(4)|large_intestine(3)|liver(2)|lung(5)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	22				GBM - Glioblastoma multiforme(265;0.0184)		TCGCTCCTGTTCCAGCCCTGT	0.592																																						dbGAP											0													97.0	95.0	96.0					14																	24542738		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB009288	CCDS9607.1, CCDS61413.1	14q11.2	2008-07-09			ENSG00000100884	ENSG00000100884			2319	protein-coding gene	gene with protein product		605688				9645480	Standard	NM_001280558		Approved		uc001wll.3	O95741	OTTHUMG00000028781	ENST00000397016.2:c.199T>C	14.37:g.24542738T>C	ENSP00000380211:p.Ser67Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAG6|B7Z1M3|D3DS55|F5GXN1|Q53HA6|Q8WVG1	Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.S122P	ENST00000397016.2	37	c.364	CCDS9607.1	14	.	.	.	.	.	.	.	.	.	.	T	18.27	3.587468	0.66105	.	.	ENSG00000100884	ENST00000537691;ENST00000397016;ENST00000216775	T;T;T	0.39787	1.06;1.06;1.06	4.41	4.41	0.53225	C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.47852	D	0.000220	T	0.41811	0.1175	L	0.38175	1.15	0.28878	N	0.894556	D;D	0.54601	0.959;0.967	P;P	0.54210	0.702;0.745	T	0.38866	-0.9641	10	0.72032	D	0.01	-22.9574	6.5088	0.22210	0.0:0.1075:0.0:0.8925	.	122;67	F5GXN1;O95741	.;CPNE6_HUMAN	P	122;67;67	ENSP00000440077:S122P;ENSP00000380211:S67P;ENSP00000216775:S67P	ENSP00000216775:S67P	S	+	1	0	CPNE6	23612578	0.960000	0.32886	1.000000	0.80357	0.954000	0.61252	1.819000	0.39022	1.849000	0.53698	0.260000	0.18958	TCC	CPNE6	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep	ENSG00000100884		0.592	CPNE6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE6	HGNC	protein_coding	OTTHUMT00000071869.5	54	0.00	0	T			24542738	24542738	+1	no_errors	ENST00000537691	ensembl	human	known	69_37n	missense	21	52.27	23	SNP	0.985	C
CR1L	1379	genome.wustl.edu	37	1	207870999	207870999	+	Nonsense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr1:207870999G>A	ENST00000508064.2	+	6	1074	c.1014G>A	c.(1012-1014)tgG>tgA	p.W338*	CR1L_ENST00000530905.1_Intron	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	338	Sushi 5. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AGGGAGACTGGAGCCCTGCAG	0.512																																						dbGAP											0													177.0	176.0	176.0					1																	207870999		1912	4130	6042	-	-	-	SO:0001587	stop_gained	0			AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1014G>A	1.37:g.207870999G>A	ENSP00000421736:p.Trp338*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MC9|Q8NEU7	Nonsense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.W338*	ENST00000508064.2	37	c.1014	CCDS44310.1	1	.	.	.	.	.	.	.	.	.	.	.	18.67	3.672776	0.67928	.	.	ENSG00000197721	ENST00000444269;ENST00000508064	.	.	.	2.44	2.44	0.29823	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.4091	0.32634	0.0:0.0:1.0:0.0	.	.	.	.	X	338	.	ENSP00000434864:W282X	W	+	3	0	CR1L	205937622	1.000000	0.71417	0.907000	0.35723	0.295000	0.27426	3.858000	0.55979	1.355000	0.45865	0.298000	0.19748	TGG	CR1L	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000197721		0.512	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1L	HGNC	protein_coding	OTTHUMT00000390247.1	159	0.00	0	G	XM_114735		207870999	207870999	+1	no_errors	ENST00000508064	ensembl	human	known	69_37n	nonsense	138	45.67	116	SNP	0.820	A
CYTH2	9266	genome.wustl.edu	37	19	48978182	48978182	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr19:48978182C>T	ENST00000452733.2	+	8	1260	c.784C>T	c.(784-786)Cgg>Tgg	p.R262W	CYTH2_ENST00000427476.1_Missense_Mutation_p.R262W			Q99418	CYH2_HUMAN	cytohesin 2	262	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|inositol 1,4,5 trisphosphate binding (GO:0070679)|lipid binding (GO:0008289)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						CAACCCGGACCGGGAGGGCTG	0.612																																						dbGAP											0													127.0	107.0	114.0					19																	48978182		2203	4300	6503	-	-	-	SO:0001583	missense	0			X99753	CCDS12722.1	19q13.32	2014-05-02	2008-08-14	2008-08-14	ENSG00000105443	ENSG00000105443		"""Pleckstrin homology (PH) domain containing"""	9502	protein-coding gene	gene with protein product		602488	"""pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2)"", ""pleckstrin homology, Sec7 and coiled-coil domains 2"""	PSCD2L, PSCD2		8706128, 8945478, 20525696	Standard	NM_004228		Approved	CTS18.1, Sec7p-L, ARNO, Sec7p-like, cytohesin-2	uc002pjj.4	Q99418	OTTHUMG00000150245	ENST00000452733.2:c.784C>T	19.37:g.48978182C>T	ENSP00000408236:p.Arg262Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8P0|Q8IXY9|Q92958	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.R262W	ENST00000452733.2	37	c.784	CCDS12722.1	19	.	.	.	.	.	.	.	.	.	.	C	20.3	3.961956	0.74016	.	.	ENSG00000105443	ENST00000452733;ENST00000427476	T;T	0.76968	2.21;-1.06	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	D	0.89832	0.6829	H	0.95470	3.675	0.58432	D	0.999993	D	0.89917	1.0	D	0.68621	0.959	D	0.91377	0.5124	10	0.87932	D	0	.	9.9027	0.41357	0.2035:0.7965:0.0:0.0	.	262	Q99418-2	.	W	262	ENSP00000408236:R262W;ENSP00000391648:R262W	ENSP00000375753:R262W	R	+	1	2	CYTH2	53669994	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.283000	0.43470	2.421000	0.82119	0.491000	0.48974	CGG	CYTH2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000105443		0.612	CYTH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYTH2	HGNC	protein_coding	OTTHUMT00000317060.1	110	0.00	0	C	NM_004228		48978182	48978182	+1	no_errors	ENST00000427476	ensembl	human	known	69_37n	missense	115	11.54	15	SNP	1.000	T
CYTH2	9266	genome.wustl.edu	37	19	48981327	48981327	+	Splice_Site	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr19:48981327G>A	ENST00000452733.2	+	9	1286	c.810G>A	c.(808-810)ggG>ggA	p.G270G	CYTH2_ENST00000427476.1_Silent_p.G271G|CTC-273B12.8_ENST00000599877.1_lincRNA			Q99418	CYH2_HUMAN	cytohesin 2	271	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.|Phosphatidylinositol 1,4,5-trisphosphate binding. {ECO:0000250}.				actin cytoskeleton organization (GO:0030036)|endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|inositol 1,4,5 trisphosphate binding (GO:0070679)|lipid binding (GO:0008289)			endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15						CCCTTTCAGGGGGCCGGGTGA	0.632																																						dbGAP											0													36.0	38.0	37.0					19																	48981327		2201	4294	6495	-	-	-	SO:0001630	splice_region_variant	0			X99753	CCDS12722.1	19q13.32	2014-05-02	2008-08-14	2008-08-14	ENSG00000105443	ENSG00000105443		"""Pleckstrin homology (PH) domain containing"""	9502	protein-coding gene	gene with protein product		602488	"""pleckstrin homology, Sec7 and coiled/coil domains 2 (cytohesin-2)"", ""pleckstrin homology, Sec7 and coiled-coil domains 2"""	PSCD2L, PSCD2		8706128, 8945478, 20525696	Standard	NM_004228		Approved	CTS18.1, Sec7p-L, ARNO, Sec7p-like, cytohesin-2	uc002pjj.4	Q99418	OTTHUMG00000150245	ENST00000452733.2:c.809-1G>A	19.37:g.48981327G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8P0|Q8IXY9|Q92958	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	p.G272R	ENST00000452733.2	37	c.814	CCDS12722.1	19																																																																																			CYTH2	-	NULL	ENSG00000105443		0.632	CYTH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYTH2	HGNC	protein_coding	OTTHUMT00000317060.1	29	0.00	0	G	NM_004228	Silent	48981327	48981327	+1	no_errors	ENST00000391881	ensembl	human	known	69_37n	missense	30	51.61	32	SNP	1.000	A
DDC	1644	genome.wustl.edu	37	7	50607722	50607722	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr7:50607722G>A	ENST00000444124.2	-	3	406	c.206C>T	c.(205-207)aCg>aTg	p.T69M	DDC_ENST00000357936.5_Missense_Mutation_p.T69M|DDC_ENST00000489162.1_5'UTR|DDC_ENST00000380984.4_Missense_Mutation_p.T69M|AC018705.5_ENST00000454521.1_RNA|DDC_ENST00000431062.1_Missense_Mutation_p.T69M|DDC_ENST00000426377.1_Intron	NM_001082971.1	NP_001076440	P20711	DDC_HUMAN	dopa decarboxylase (aromatic L-amino acid decarboxylase)	69	2 X approximate tandem repeats.				catecholamine biosynthetic process (GO:0042423)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to growth factor stimulus (GO:0071363)|circadian rhythm (GO:0007623)|dopamine biosynthetic process (GO:0042416)|indolalkylamine biosynthetic process (GO:0046219)|isoquinoline alkaloid metabolic process (GO:0033076)|multicellular organismal aging (GO:0010259)|phytoalexin metabolic process (GO:0052314)|response to pyrethroid (GO:0046684)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)|synaptic vesicle amine transport (GO:0015842)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|synaptic vesicle (GO:0008021)	amino acid binding (GO:0016597)|aromatic-L-amino-acid decarboxylase activity (GO:0004058)|enzyme binding (GO:0019899)|L-dopa decarboxylase activity (GO:0036468)|pyridoxal phosphate binding (GO:0030170)	p.T69M(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(23)|ovary(4)|skin(2)|stomach(1)	40	Glioma(55;0.08)|all_neural(89;0.245)				Amantadine(DB00915)|Carbidopa(DB00190)|Cycloserine(DB00260)|Droxidopa(DB06262)|Flupentixol(DB00875)|L-DOPA(DB01235)|L-Tryptophan(DB00150)|Methyldopa(DB00968)	GTGCCAGTGCGTCACCTGCAT	0.647																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											93.0	75.0	81.0					7																	50607722		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS5511.1, CCDS56485.1, CCDS56486.1, CCDS56487.1, CCDS75598.1, CCDS75599.1	7p12.1	2012-08-30			ENSG00000132437	ENSG00000132437	4.1.1.28		2719	protein-coding gene	gene with protein product		107930				1612608	Standard	NM_001082971		Approved	AADC	uc003tpf.4	P20711	OTTHUMG00000023353	ENST00000444124.2:c.206C>T	7.37:g.50607722G>A	ENSP00000403644:p.Thr69Met	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IYA0|E7ER62|E7EU95|Q16723|Q5W5T9|Q75MJ6	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_Aromatic_deC	p.T69M	ENST00000444124.2	37	c.206	CCDS5511.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.9|23.9	4.476472|4.476472	0.84640|0.84640	.|.	.|.	ENSG00000132437|ENSG00000132437	ENST00000430300|ENST00000357936;ENST00000431062;ENST00000444124;ENST00000380984	.|T;T;T;T	.|0.39787	.|1.06;1.06;1.06;1.06	5.5|5.5	5.5|5.5	0.81552|0.81552	.|Pyridoxal phosphate-dependent transferase, major domain (1);	.|0.045704	.|0.85682	.|D	.|0.000000	T|T	0.76579|0.76579	0.4007|0.4007	H|H	0.95816|0.95816	3.725|3.725	0.58432|0.58432	D|D	0.999999|0.999999	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.91635	.|0.999;0.999	D|D	0.83972|0.83972	0.0327|0.0327	5|10	.|0.87932	.|D	.|0	-10.3752|-10.3752	19.4023|19.4023	0.94635|0.94635	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|69;69	.|Q53Y41;P20711	.|.;DDC_HUMAN	C|M	35|69	.|ENSP00000350616:T69M;ENSP00000399184:T69M;ENSP00000403644:T69M;ENSP00000370371:T69M	.|ENSP00000350616:T69M	R|T	-|-	1|2	0|0	DDC|DDC	50575216|50575216	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.920000|0.920000	0.55202|0.55202	6.744000|6.744000	0.74854|0.74854	2.573000|2.573000	0.86826|0.86826	0.655000|0.655000	0.94253|0.94253	CGC|ACG	DDC	-	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000132437		0.647	DDC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DDC	HGNC	protein_coding	OTTHUMT00000342593.1	59	0.00	0	G			50607722	50607722	-1	no_errors	ENST00000357936	ensembl	human	known	69_37n	missense	36	50.68	37	SNP	1.000	A
DGAT2L6	347516	genome.wustl.edu	37	X	69424319	69424319	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chrX:69424319G>A	ENST00000333026.3	+	6	912	c.812G>A	c.(811-813)cGc>cAc	p.R271H		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	271					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						GGCTTCACTCGCGGATCCTGG	0.502																																						dbGAP											0													74.0	69.0	71.0					X																	69424319		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.812G>A	X.37:g.69424319G>A	ENSP00000328036:p.Arg271His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEE2	Missense_Mutation	SNP	pfam_DAGAT	p.R271H	ENST00000333026.3	37	c.812	CCDS14397.1	X	.	.	.	.	.	.	.	.	.	.	G	4.247	0.044849	0.08196	.	.	ENSG00000184210	ENST00000333026	T	0.14022	2.54	4.98	1.3	0.21679	.	0.760798	0.11324	N	0.575729	T	0.10809	0.0264	L	0.39245	1.2	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.32693	-0.9897	10	0.42905	T	0.14	-13.1803	5.2833	0.15688	0.2715:0.0:0.5826:0.1459	.	271	Q6ZPD8	DG2L6_HUMAN	H	271	ENSP00000328036:R271H	ENSP00000328036:R271H	R	+	2	0	DGAT2L6	69341044	0.000000	0.05858	0.750000	0.31169	0.053000	0.15095	-1.212000	0.02994	-0.055000	0.13244	-1.016000	0.02456	CGC	DGAT2L6	-	pfam_DAGAT	ENSG00000184210		0.502	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT2L6	HGNC	protein_coding	OTTHUMT00000057067.1	72	0.00	0	G	NM_198512		69424319	69424319	+1	no_errors	ENST00000333026	ensembl	human	known	69_37n	missense	57	15.94	11	SNP	0.023	A
DNHD1	144132	genome.wustl.edu	37	11	6585602	6585602	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr11:6585602C>T	ENST00000527990.2	+	30	10324	c.10324C>T	c.(10324-10326)Ctc>Ttc	p.L3442F	DNHD1_ENST00000254579.6_Missense_Mutation_p.L3442F			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3442					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		TGGAGATACCCTCCTATGTTC	0.562																																						dbGAP											0													138.0	125.0	129.0					11																	6585602		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.10324C>T	11.37:g.6585602C>T	ENSP00000436180:p.Leu3442Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.L3442F	ENST00000527990.2	37	c.10324	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	C	12.18	1.861340	0.32884	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000529821	D;D	0.81499	-1.5;-1.5	4.23	2.24	0.28232	Dynein heavy chain, coiled coil stalk (1);	.	.	.	.	D	0.82384	0.5025	L	0.39898	1.24	0.29567	N	0.850162	D	0.71674	0.998	D	0.68943	0.961	T	0.74179	-0.3749	9	0.14252	T	0.57	.	12.7322	0.57204	0.0:0.6824:0.3176:0.0	.	3442	Q96M86	DNHD1_HUMAN	F	3442;3442;23	ENSP00000254579:L3442F;ENSP00000436180:L3442F	ENSP00000254579:L3442F	L	+	1	0	DNHD1	6542178	0.996000	0.38824	0.987000	0.45799	0.187000	0.23431	0.740000	0.26188	0.377000	0.24735	0.313000	0.20887	CTC	DNHD1	-	NULL	ENSG00000179532		0.562	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	75	0.00	0	C	NM_144666		6585602	6585602	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	missense	34	38.18	21	SNP	0.999	T
DOCK3	1795	genome.wustl.edu	37	3	51399358	51399358	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr3:51399358C>G	ENST00000266037.9	+	48	5098	c.5075C>G	c.(5074-5076)gCa>gGa	p.A1692G		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	1692					small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		TCTAGTGAAGCAGGAAACATG	0.567																																						dbGAP											0													95.0	98.0	97.0					3																	51399358		2156	4258	6414	-	-	-	SO:0001583	missense	0			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.5075C>G	3.37:g.51399358C>G	ENSP00000266037:p.Ala1692Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O15017	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.A1692G	ENST00000266037.9	37	c.5075	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	C	18.07	3.540626	0.65085	.	.	ENSG00000088538	ENST00000266037;ENST00000402669	T	0.05319	3.46	5.31	5.31	0.75309	.	0.167991	0.53938	D	0.000059	T	0.08492	0.0211	L	0.47716	1.5	0.46542	D	0.999091	B	0.21821	0.061	B	0.19946	0.027	T	0.29792	-1.0000	10	0.13853	T	0.58	.	19.3488	0.94376	0.0:1.0:0.0:0.0	.	1692	Q8IZD9	DOCK3_HUMAN	G	1692;488	ENSP00000266037:A1692G	ENSP00000266037:A1692G	A	+	2	0	DOCK3	51374398	1.000000	0.71417	0.952000	0.39060	0.963000	0.63663	5.787000	0.69013	2.629000	0.89072	0.655000	0.94253	GCA	DOCK3	-	NULL	ENSG00000088538		0.567	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	115	0.00	0	C	NM_004947		51399358	51399358	+1	no_errors	ENST00000266037	ensembl	human	known	69_37n	missense	41	35.94	23	SNP	1.000	G
EDC3	80153	genome.wustl.edu	37	15	74925124	74925124	+	Silent	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr15:74925124G>T	ENST00000315127.4	-	7	1537	c.1356C>A	c.(1354-1356)ggC>ggA	p.G452G	EDC3_ENST00000568176.1_Silent_p.G452G|EDC3_ENST00000426797.3_Silent_p.G452G	NM_001142444.1|NM_025083.3	NP_001135916.1|NP_079359.2	Q96F86	EDC3_HUMAN	enhancer of mRNA decapping 3	452	YjeF N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00719}.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)|membrane (GO:0016020)	identical protein binding (GO:0042802)|RNA binding (GO:0003723)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						TGGCATCAATGCCCTGTTCGA	0.592											OREG0023286	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													109.0	85.0	93.0					15																	74925124		2197	4296	6493	-	-	-	SO:0001819	synonymous_variant	0			BC011534	CCDS10267.1	15q24.1	2013-05-02	2013-05-02	2006-07-07	ENSG00000179151	ENSG00000179151			26114	protein-coding gene	gene with protein product		609842	"""yjeF domain containing (E.coli)"", ""LSM16 homolog (EDC3, S. cerevisiae)"", ""enhancer of mRNA decapping 3 homolog (S. cerevisiae)"""	YJDC, LSM16		15225602, 17533573, 22483619	Standard	NM_025083		Approved	FLJ21128, hYjeF_N2-15q23, YJEFN2	uc002aym.3	Q96F86	OTTHUMG00000142815	ENST00000315127.4:c.1356C>A	15.37:g.74925124G>T		Somatic	1156	WXS	Illumina GAIIx	Phase_IV	B3KPH0|D3DW61|Q9H797	Silent	SNP	pfam_YjeF_N,pfam_FDF_dom,superfamily_YjeF_N	p.G452	ENST00000315127.4	37	c.1356	CCDS10267.1	15																																																																																			EDC3	-	pfam_YjeF_N,superfamily_YjeF_N	ENSG00000179151		0.592	EDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDC3	HGNC	protein_coding	OTTHUMT00000286399.1	80	0.00	0	G	NM_025083		74925124	74925124	-1	no_errors	ENST00000315127	ensembl	human	known	69_37n	silent	45	11.76	6	SNP	1.000	T
EVC	2121	genome.wustl.edu	37	4	5812121	5812121	+	Silent	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr4:5812121G>T	ENST00000264956.6	+	20	3022	c.2838G>T	c.(2836-2838)ctG>ctT	p.L946L	EVC_ENST00000382674.2_Silent_p.L946L	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	946					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				GAGGGGACCTGGGGGTGCCCA	0.587																																						dbGAP											0													39.0	44.0	42.0					4																	5812121		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2838G>T	4.37:g.5812121G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L946	ENST00000264956.6	37	c.2838	CCDS3383.1	4																																																																																			EVC	-	NULL	ENSG00000072840		0.587	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	67	0.00	0	G			5812121	5812121	+1	no_errors	ENST00000264956	ensembl	human	known	69_37n	silent	42	19.23	10	SNP	0.000	T
F8	2157	genome.wustl.edu	37	X	154133244	154133244	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chrX:154133244A>G	ENST00000360256.4	-	16	5628	c.5428T>C	c.(5428-5430)Tct>Cct	p.S1810P		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	1810	F5/8 type A 3.|Plastocyanin-like 5.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	TCCTCATAAGAAATAAGGCTA	0.363																																						dbGAP											0			GRCh37	CM057454	F8	M							111.0	102.0	105.0					X																	154133244		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.5428T>C	X.37:g.154133244A>G	ENSP00000353393:p.Ser1810Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S1810P	ENST00000360256.4	37	c.5428	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	A	16.70	3.196630	0.58126	.	.	ENSG00000185010	ENST00000360256	D	0.99232	-5.6	4.97	4.97	0.65823	Cupredoxin (2);	0.429433	0.25798	N	0.028231	D	0.98185	0.9400	L	0.41824	1.3	0.27716	N	0.94531	B	0.27192	0.171	B	0.42112	0.376	D	0.96705	0.9521	10	0.52906	T	0.07	-7.9139	9.728	0.40344	0.8287:0.1713:0.0:0.0	.	1810	P00451	FA8_HUMAN	P	1810	ENSP00000353393:S1810P	ENSP00000353393:S1810P	S	-	1	0	F8	153786438	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.092000	0.41700	1.780000	0.52325	0.408000	0.27601	TCT	F8	-	superfamily_Cupredoxin	ENSG00000185010		0.363	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	144	0.00	0	A			154133244	154133244	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	113	13.74	18	SNP	0.999	G
FAM86B1	85002	genome.wustl.edu	37	8	12051159	12051159	+	Intron	SNP	T	T	C	rs62494609	byFrequency	TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr8:12051159T>C	ENST00000448228.2	-	1	146				FAM86B1_ENST00000533513.1_Intron|FAM86B1_ENST00000534520.1_Intron|FAM86B1_ENST00000321602.8_Intron|FAM86B1_ENST00000533852.2_Intron|FAM85A_ENST00000528514.1_RNA	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1											kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		AATGGGCGAGTGCAGCTGTGT	0.582													t|||	136	0.0271565	0.0809	0.0072	5008	,	,		22304	0.0		0.0109	False		,,,				2504	0.0133					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.96+324A>G	8.37:g.12051159T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.H44R	ENST00000448228.2	37	c.131	CCDS59512.1	8																																																																																			FAM86B1	-	NULL	ENSG00000186523		0.582	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	HGNC	protein_coding	OTTHUMT00000383317.1	11	0.00	0	T	NM_032916		12051159	12051159	-1	no_errors	ENST00000530289	ensembl	human	known	69_37n	missense	5	37.50	3	SNP	0.001	C
FLG	2312	genome.wustl.edu	37	1	152278876	152278876	+	Missense_Mutation	SNP	C	C	T	rs140749305	byFrequency	TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr1:152278876C>T	ENST00000368799.1	-	3	8521	c.8486G>A	c.(8485-8487)cGt>cAt	p.R2829H	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2829	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGACTGCCCACGGGAGGCATC	0.577									Ichthyosis				T|||	19	0.00379393	0.0121	0.0043	5008	,	,		31097	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													188.0	278.0	248.0					1																	152278876		2145	4296	6441	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8486G>A	1.37:g.152278876C>T	ENSP00000357789:p.Arg2829His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.R2829H	ENST00000368799.1	37	c.8486	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	c	3.115	-0.181716	0.06340	.	.	ENSG00000143631	ENST00000368799;ENST00000368796	T	0.01474	4.85	2.83	-5.66	0.02451	.	.	.	.	.	T	0.00210	0.0006	N	0.11064	0.09	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.46442	-0.9191	9	0.02654	T	1	-9.0E-4	5.4585	0.16604	0.0:0.2407:0.2546:0.5047	.	2829	P20930	FILA_HUMAN	H	2829;91	ENSP00000357789:R2829H	ENSP00000357786:R91H	R	-	2	0	FLG	150545500	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.883000	0.04170	-2.938000	0.00298	-2.146000	0.00336	CGT	FLG	-	NULL	ENSG00000143631		0.577	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	457	0.44	2	C	NM_002016		152278876	152278876	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	509	15.59	94	SNP	0.000	T
GABRA4	2557	genome.wustl.edu	37	4	46967070	46967070	+	Missense_Mutation	SNP	C	C	A	rs182887885	byFrequency	TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr4:46967070C>A	ENST00000264318.3	-	8	2033	c.1051G>T	c.(1051-1053)Gcc>Tcc	p.A351S		NM_000809.3|NM_001204266.1|NM_001204267.1	NP_000800.2|NP_001191195.1|NP_001191196.1	P48169	GBRA4_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 4	351					central nervous system development (GO:0007417)|gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|regulation of response to drug (GO:2001023)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45					Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	TTCCTTTTGGCTTTTTCCATT	0.468																																					Ovarian(6;283 369 8234 12290 33402)	dbGAP											0													118.0	118.0	118.0					4																	46967070		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS3473.1	4p12	2012-06-22			ENSG00000109158	ENSG00000109158		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4078	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 4"""	137141				7607683	Standard	NM_000809		Approved		uc021xnz.1	P48169	OTTHUMG00000099431	ENST00000264318.3:c.1051G>T	4.37:g.46967070C>A	ENSP00000264318:p.Ala351Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYR7	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABBAa4_rcpt,prints_GABAA_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.A351S	ENST00000264318.3	37	c.1051	CCDS3473.1	4	.	.	.	.	.	.	.	.	.	.	C	16.18	3.051578	0.55218	.	.	ENSG00000109158	ENST00000264318	D	0.83591	-1.74	4.81	4.81	0.61882	Neurotransmitter-gated ion-channel transmembrane domain (2);	6.124600	0.00772	N	0.001212	T	0.77491	0.4138	L	0.31371	0.925	0.46981	D	0.999278	P	0.38250	0.624	B	0.39590	0.304	T	0.62305	-0.6882	10	0.09843	T	0.71	.	10.6072	0.45400	0.0:0.9128:0.0:0.0872	.	351	P48169	GBRA4_HUMAN	S	351	ENSP00000264318:A351S	ENSP00000264318:A351S	A	-	1	0	GABRA4	46661827	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	3.192000	0.50989	2.481000	0.83766	0.591000	0.81541	GCC	GABRA4	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABBAa4_rcpt,prints_GABBAg_rcpt,tigrfam_Neur_channel	ENSG00000109158		0.468	GABRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA4	HGNC	protein_coding	OTTHUMT00000216893.1	166	0.60	1	C			46967070	46967070	-1	no_errors	ENST00000264318	ensembl	human	known	69_37n	missense	111	24.49	36	SNP	1.000	A
GK2	2712	genome.wustl.edu	37	4	80329160	80329160	+	Silent	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr4:80329160G>A	ENST00000358842.3	-	1	212	c.195C>T	c.(193-195)taC>taT	p.Y65Y		NM_033214.2	NP_149991.2	Q01415	GALK2_HUMAN	glycerol kinase 2	0					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|galactokinase activity (GO:0004335)|N-acetylgalactosamine kinase activity (GO:0033858)	p.Y65Y(1)		autonomic_ganglia(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	39						CTATACACTCGTAGACAGACT	0.408																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											179.0	175.0	176.0					4																	80329160		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC029820	CCDS3585.1	4q13	2008-02-05	2002-10-03	2002-10-04	ENSG00000196475	ENSG00000196475		"""Glycerol kinases"""	4291	protein-coding gene	gene with protein product		600148	"""glycerol kinase pseudogene 2"""	GKP2		7987308	Standard	NM_033214		Approved	GKTA	uc003hlu.3	Q14410	OTTHUMG00000130199	ENST00000358842.3:c.195C>T	4.37:g.80329160G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z4Q4	Silent	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.Y65	ENST00000358842.3	37	c.195	CCDS3585.1	4																																																																																			GK2	-	pfam_Carb_kinase_FGGY_N,tigrfam_Glycerol_kin	ENSG00000196475		0.408	GK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GK2	HGNC	protein_coding	OTTHUMT00000252517.2	115	0.00	0	G	NM_033214		80329160	80329160	-1	no_errors	ENST00000358842	ensembl	human	known	69_37n	silent	117	37.10	69	SNP	1.000	A
GLYR1	84656	genome.wustl.edu	37	16	4867659	4867659	+	Silent	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr16:4867659G>A	ENST00000321919.9	-	10	922	c.846C>T	c.(844-846)atC>atT	p.I282I	GLYR1_ENST00000436648.5_Silent_p.I201I|GLYR1_ENST00000381983.3_Silent_p.I265I|GLYR1_ENST00000591451.1_Silent_p.I282I	NM_032569.3	NP_115958	Q49A26	GLYR1_HUMAN	glyoxylate reductase 1 homolog (Arabidopsis)	282					pentose-phosphate shunt (GO:0006098)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methylated histone binding (GO:0035064)|NAD binding (GO:0051287)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|prostate(2)|skin(1)|urinary_tract(1)	19						AGTTGGAGACGATTCCACTTC	0.502																																						dbGAP											0													178.0	149.0	159.0					16																	4867659		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF244907	CCDS10524.1	16p13.3	2010-02-17			ENSG00000140632	ENSG00000140632			24434	protein-coding gene	gene with protein product	"""nuclear protein 60kDa"""	610660				16352664	Standard	NM_032569		Approved	BM045, HIBDL, NP60, N-PAC	uc002cxx.4	Q49A26	OTTHUMG00000129530	ENST00000321919.9:c.846C>T	16.37:g.4867659G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DL47|C9JJ40|C9JJ60|Q5U632|Q6P1Q2|Q6V3W7|Q9BTI1|Q9BXK2	Missense_Mutation	SNP	pfam_6PGDH_NADP-bd,pfam_PWWP,pfam_NADP_OxRdtase_F420,superfamily_6-PGluconate_DH_C-like,smart_PWWP,pfscan_PWWP	p.R253C	ENST00000321919.9	37	c.757	CCDS10524.1	16																																																																																			GLYR1	-	pfam_6PGDH_NADP-bd,pfam_NADP_OxRdtase_F420	ENSG00000140632		0.502	GLYR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLYR1	HGNC	protein_coding	OTTHUMT00000251717.2	85	0.00	0	G	NM_032569		4867659	4867659	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000589389	ensembl	human	novel	69_37n	missense	86	33.33	43	SNP	0.991	A
GON4L	54856	genome.wustl.edu	37	1	155755112	155755112	+	Intron	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr1:155755112G>A	ENST00000368331.1	-	13	1837				GON4L_ENST00000437809.1_Intron|GON4L_ENST00000271883.5_Intron|GON4L_ENST00000471341.1_Intron|GON4L_ENST00000361040.5_Intron	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					CTCACTCGAGGATCATTACTC	0.418																																						dbGAP											0													186.0	165.0	172.0					1																	155755112		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1788+12C>T	1.37:g.155755112G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	RNA	SNP	-	NULL	ENST00000368331.1	37	NULL		1																																																																																			GON4L	-	-	ENSG00000116580		0.418	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		148	0.00	0	G	NM_032292		155755112	155755112	-1	no_errors	ENST00000467009	ensembl	human	known	69_37n	rna	155	18.85	36	SNP	0.000	A
GRIN3B	116444	genome.wustl.edu	37	19	1004642	1004642	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr19:1004642C>T	ENST00000234389.3	+	3	1161	c.1142C>T	c.(1141-1143)cCg>cTg	p.P381L	GRIN3B_ENST00000588335.1_Intron|AC004528.4_ENST00000588380.1_RNA	NM_138690.1	NP_619635.1	O60391	NMD3B_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3B	381					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|protein insertion into membrane (GO:0051205)|regulation of calcium ion transport (GO:0051924)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|neurotransmitter receptor activity (GO:0030594)			breast(1)|kidney(1)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000226)|all_lung(49;0.000353)|Breast(49;0.00066)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Acamprosate(DB00659)|Atomoxetine(DB00289)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CGGGGCGCCCCGGCCTGGGCC	0.731																																						dbGAP											0													9.0	10.0	10.0					19																	1004642		2144	4170	6314	-	-	-	SO:0001583	missense	0				CCDS32861.1	19p13.3	2014-05-06			ENSG00000116032	ENSG00000116032		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16768	protein-coding gene	gene with protein product		606651					Standard	XM_003403700		Approved	GluN3B	uc002lqo.1	O60391	OTTHUMG00000181904	ENST00000234389.3:c.1142C>T	19.37:g.1004642C>T	ENSP00000234389:p.Pro381Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5EAK7|Q7RTW9	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.P381L	ENST00000234389.3	37	c.1142	CCDS32861.1	19	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834048	0.71373	.	.	ENSG00000116032	ENST00000234389	D	0.85339	-1.97	4.69	4.69	0.59074	.	0.000000	0.85682	U	0.000000	D	0.91845	0.7419	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92927	0.6360	10	0.72032	D	0.01	.	16.2221	0.82265	0.0:1.0:0.0:0.0	.	381	O60391	NMD3B_HUMAN	L	381	ENSP00000234389:P381L	ENSP00000234389:P381L	P	+	2	0	GRIN3B	955642	1.000000	0.71417	0.836000	0.33094	0.500000	0.33767	7.451000	0.80668	2.169000	0.68431	0.466000	0.42574	CCG	GRIN3B	-	NULL	ENSG00000116032		0.731	GRIN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3B	HGNC	protein_coding	OTTHUMT00000103923.2	29	0.00	0	C			1004642	1004642	+1	no_errors	ENST00000234389	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.997	T
GRM8	2918	genome.wustl.edu	37	7	126173023	126173023	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr7:126173023C>A	ENST00000339582.2	-	9	3221	c.2413G>T	c.(2413-2415)Gcc>Tcc	p.A805S	GRM8_ENST00000444921.2_Missense_Mutation_p.A805S|GRM8_ENST00000358373.3_Missense_Mutation_p.A805S|GRM8_ENST00000480995.1_5'Flank			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	805					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				GCTGACTGGGCTGTACCAAAA	0.388										HNSCC(24;0.065)																												dbGAP											0													94.0	85.0	88.0					7																	126173023		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2413G>T	7.37:g.126173023C>A	ENSP00000344173:p.Ala805Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.A805S	ENST00000339582.2	37	c.2413	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	C	6.806	0.517827	0.13005	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	D;D;D	0.87334	-2.24;-2.24;-2.24	5.62	5.62	0.85841	GPCR, family 3, C-terminal (2);	0.055642	0.64402	D	0.000001	T	0.81569	0.4850	L	0.39514	1.22	0.80722	D	1	B;B	0.27971	0.196;0.003	B;B	0.23150	0.044;0.006	T	0.77335	-0.2626	10	0.10377	T	0.69	.	18.6646	0.91485	0.0:1.0:0.0:0.0	.	805;805	O00222-2;O00222	.;GRM8_HUMAN	S	805	ENSP00000344173:A805S;ENSP00000409790:A805S;ENSP00000351142:A805S	ENSP00000344173:A805S	A	-	1	0	GRM8	125960259	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.439000	0.44846	2.660000	0.90430	0.655000	0.94253	GCC	GRM8	-	pfam_GPCR_3_C,pfscan_GPCR_3_C	ENSG00000179603		0.388	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	76	0.00	0	C			126173023	126173023	-1	no_errors	ENST00000339582	ensembl	human	known	69_37n	missense	71	18.39	16	SNP	1.000	A
HEATR1	55127	genome.wustl.edu	37	1	236739582	236739582	+	Silent	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr1:236739582C>A	ENST00000366582.3	-	22	3135	c.3021G>T	c.(3019-3021)gtG>gtT	p.V1007V	HEATR1_ENST00000366581.2_Silent_p.V1007V	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1007					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			GGCAACTATACACACAACTAA	0.358																																						dbGAP											0													158.0	162.0	161.0					1																	236739582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.3021G>T	1.37:g.236739582C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3Q8|Q6P197|Q9NW23	Silent	SNP	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.V1007	ENST00000366582.3	37	c.3021	CCDS31066.1	1																																																																																			HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.358	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	118	0.00	0	C	XM_375853		236739582	236739582	-1	no_errors	ENST00000366582	ensembl	human	known	69_37n	silent	79	37.30	47	SNP	0.569	A
IFNA13	3447	genome.wustl.edu	37	9	21367501	21367501	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr9:21367501G>T	ENST00000449498.1	-	1	574	c.509C>A	c.(508-510)gCa>gAa	p.A170E		NM_006900.3	NP_008831.3	P01562	IFNA1_HUMAN	interferon, alpha 13	169					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)	9				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		CATGATTTCTGCTCTGACAAC	0.418																																						dbGAP											0													120.0	115.0	117.0					9																	21367501		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS6505.2	9p22	2010-12-10			ENSG00000233816	ENSG00000233816		"""Interferons"""	5419	protein-coding gene	gene with protein product		147578				1385305	Standard	NM_006900		Approved		uc003zpa.2	P01562	OTTHUMG00000019675	ENST00000449498.1:c.509C>A	9.37:g.21367501G>T	ENSP00000394494:p.Ala170Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D4Q9M8|Q14605|Q2M1L8|Q52LB8|Q5VYQ2|Q7M4Q1|Q8WZ68|Q9UMJ3	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.A170E	ENST00000449498.1	37	c.509	CCDS6505.2	9	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412567	0.42817	.	.	ENSG00000233816	ENST00000449498	T	0.03982	3.74	2.45	-0.623	0.11556	.	0.558993	0.19740	N	0.107158	T	0.09555	0.0235	M	0.81802	2.56	0.09310	N	0.999994	B	0.17268	0.021	B	0.36464	0.225	T	0.29701	-1.0003	10	0.72032	D	0.01	.	5.4801	0.16719	0.5999:0.0:0.4001:0.0	.	170	E9PB07	.	E	170	ENSP00000394494:A170E	ENSP00000394494:A170E	A	-	2	0	IFNA13	21357501	0.000000	0.05858	0.466000	0.27168	0.851000	0.48451	-1.464000	0.02359	-0.027000	0.13873	-0.657000	0.03884	GCA	IFNA13	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	ENSG00000233816		0.418	IFNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA13	HGNC	protein_coding	OTTHUMT00000051904.2	120	0.00	0	G	NM_006900		21367501	21367501	-1	no_errors	ENST00000449498	ensembl	human	known	69_37n	missense	89	20.54	23	SNP	0.223	T
KAT2B	8850	genome.wustl.edu	37	3	20113931	20113931	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr3:20113931G>A	ENST00000263754.4	+	2	865	c.410G>A	c.(409-411)cGg>cAg	p.R137Q	KAT2B_ENST00000426228.1_3'UTR	NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	137					cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.R137L(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						GAATCCTGTCGGAGTTGTAGC	0.458																																						dbGAP											1	Substitution - Missense(1)	lung(1)											104.0	113.0	110.0					3																	20113931		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.410G>A	3.37:g.20113931G>A	ENSP00000263754:p.Arg137Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSK1	Missense_Mutation	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom,prints_Bromodomain	p.R137Q	ENST00000263754.4	37	c.410	CCDS2634.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.079117	0.94050	.	.	ENSG00000114166	ENST00000263754	T	0.23552	1.9	5.75	5.75	0.90469	PCAF, N-terminal (1);	0.055141	0.64402	D	0.000001	T	0.52725	0.1752	M	0.74881	2.28	0.80722	D	1	D	0.76494	0.999	D	0.66979	0.948	T	0.53975	-0.8362	10	0.87932	D	0	-15.8534	18.7119	0.91661	0.0:0.0:1.0:0.0	.	137	Q92831	KAT2B_HUMAN	Q	137	ENSP00000263754:R137Q	ENSP00000263754:R137Q	R	+	2	0	KAT2B	20088935	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	8.155000	0.89643	2.708000	0.92522	0.655000	0.94253	CGG	KAT2B	-	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N	ENSG00000114166		0.458	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1	62	0.00	0	G	NM_003884		20113931	20113931	+1	no_errors	ENST00000263754	ensembl	human	known	69_37n	missense	53	36.14	30	SNP	1.000	A
KCNH3	23416	genome.wustl.edu	37	12	49938036	49938036	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr12:49938036C>A	ENST00000257981.6	+	7	1320	c.1060C>A	c.(1060-1062)Cag>Aag	p.Q354K		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	354					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						CCGGTACTCGCAGTACAGCGC	0.662																																						dbGAP											0													26.0	23.0	24.0					12																	49938036		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.1060C>A	12.37:g.49938036C>A	ENSP00000257981:p.Gln354Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQ06	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,tigrfam_PAS	p.Q354K	ENST00000257981.6	37	c.1060	CCDS8786.1	12	.	.	.	.	.	.	.	.	.	.	C	25.9	4.683568	0.88639	.	.	ENSG00000135519	ENST00000257981	D	0.97066	-4.23	4.66	4.66	0.58398	Ion transport (1);	0.000000	0.40908	D	0.000987	D	0.97879	0.9303	L	0.59436	1.845	0.52501	D	0.999953	P	0.36048	0.534	P	0.59171	0.853	D	0.98362	1.0549	10	0.87932	D	0	.	15.4492	0.75259	0.0:1.0:0.0:0.0	.	354	Q9ULD8	KCNH3_HUMAN	K	354	ENSP00000257981:Q354K	ENSP00000257981:Q354K	Q	+	1	0	KCNH3	48224303	1.000000	0.71417	0.974000	0.42286	0.599000	0.36880	4.820000	0.62671	2.605000	0.88082	0.561000	0.74099	CAG	KCNH3	-	pfam_Ion_trans_dom,prints_K_chnl_volt-dep_ELK	ENSG00000135519		0.662	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	HGNC	protein_coding	OTTHUMT00000404571.2	45	0.00	0	C	NM_012284		49938036	49938036	+1	no_errors	ENST00000257981	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	A
KIF16B	55614	genome.wustl.edu	37	20	16486748	16486748	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr20:16486748C>G	ENST00000354981.2	-	8	944	c.787G>C	c.(787-789)Gga>Cga	p.G263R	KIF16B_ENST00000378003.2_5'UTR|KIF16B_ENST00000408042.1_Missense_Mutation_p.G263R|KIF16B_ENST00000355755.3_Missense_Mutation_p.G263R	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	263	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						CCGGTGGCTCCGGTGGCATCT	0.493																																						dbGAP											0													133.0	127.0	129.0					20																	16486748		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.787G>C	20.37:g.16486748C>G	ENSP00000347076:p.Gly263Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.G263R	ENST00000354981.2	37	c.787	CCDS13122.1	20	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851609	0.91355	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997;ENST00000408042	T;T;T	0.75050	-0.9;-0.9;-0.9	5.32	5.32	0.75619	Kinesin, motor domain (5);	0.000000	0.85682	D	0.000000	D	0.88912	0.6566	M	0.89785	3.06	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.996;0.998;0.999	D	0.90894	0.4763	10	0.87932	D	0	.	17.5381	0.87839	0.0:1.0:0.0:0.0	.	263;263;263;263	Q96L93-4;Q96L93-2;Q96L93-6;Q96L93	.;.;.;KI16B_HUMAN	R	263	ENSP00000347076:G263R;ENSP00000347995:G263R;ENSP00000384164:G263R	ENSP00000347076:G263R	G	-	1	0	KIF16B	16434748	1.000000	0.71417	0.968000	0.41197	0.950000	0.60333	5.717000	0.68446	2.644000	0.89710	0.563000	0.77884	GGA	KIF16B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000089177		0.493	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	HGNC	protein_coding	OTTHUMT00000078104.2	34	0.00	0	C	NM_017683		16486748	16486748	-1	no_errors	ENST00000408042	ensembl	human	known	69_37n	missense	32	34.69	17	SNP	1.000	G
KLHL42	57542	genome.wustl.edu	37	12	27944828	27944828	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr12:27944828A>G	ENST00000381271.2	+	2	1371	c.1060A>G	c.(1060-1062)Acc>Gcc	p.T354A		NM_020782.1	NP_065833.1	Q9P2K6	KLH42_HUMAN	kelch-like family member 42	354					mitotic nuclear division (GO:0007067)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|regulation of microtubule-based process (GO:0032886)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)											AGGATACACTACCAGAGGTAA	0.532																																						dbGAP											0													83.0	84.0	84.0					12																	27944828		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037761	CCDS31763.1	12p11.22	2013-04-24	2013-02-22	2013-01-30	ENSG00000087448	ENSG00000087448		"""Kelch-like"""	29252	protein-coding gene	gene with protein product			"""kelch domain containing 5"""	KLHDC5		19261606	Standard	NM_020782		Approved	KIAA1340, Ctb9	uc001rij.3	Q9P2K6	OTTHUMG00000169217	ENST00000381271.2:c.1060A>G	12.37:g.27944828A>G	ENSP00000370671:p.Thr354Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2VPK1|Q8N334	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,superfamily_BTB/POZ_fold,smart_Kelch_1,pfscan_BTB/POZ-like	p.T354A	ENST00000381271.2	37	c.1060	CCDS31763.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.731|6.731	0.503585|0.503585	0.12822|0.12822	.|.	.|.	ENSG00000087448|ENSG00000087448	ENST00000381271|ENST00000543254	T|.	0.65549|.	-0.16|.	4.86|4.86	4.86|4.86	0.63082|0.63082	Kelch-type beta propeller (1);|.	0.119525|.	0.64402|.	D|.	0.000019|.	T|T	0.45013|0.45013	0.1321|0.1321	L|L	0.48642|0.48642	1.525|1.525	0.31649|0.31649	N|N	0.647097|0.647097	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.53041|0.53041	-0.8494|-0.8494	10|5	0.08179|.	T|.	0.78|.	.|.	6.1786|6.1786	0.20457|0.20457	0.7526:0.163:0.0843:0.0|0.7526:0.163:0.0843:0.0	.|.	354|.	Q9P2K6|.	KLDC5_HUMAN|.	A|C	354|175	ENSP00000370671:T354A|.	ENSP00000370671:T354A|.	T|Y	+|+	1|2	0|0	KLHDC5|KLHDC5	27836095|27836095	0.862000|0.862000	0.29867|0.29867	0.615000|0.615000	0.29064|0.29064	0.994000|0.994000	0.84299|0.84299	1.821000|1.821000	0.39041|0.39041	2.028000|2.028000	0.59812|0.59812	0.528000|0.528000	0.53228|0.53228	ACC|TAC	KLHDC5	-	pfam_Kelch_1,smart_Kelch_1	ENSG00000087448		0.532	KLHL42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHDC5	HGNC	protein_coding	OTTHUMT00000402904.1	39	0.00	0	A	NM_020782		27944828	27944828	+1	no_errors	ENST00000381271	ensembl	human	known	69_37n	missense	67	22.09	19	SNP	0.501	G
LGALS14	56891	genome.wustl.edu	37	19	40196607	40196607	+	Intron	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr19:40196607G>T	ENST00000392052.3	+	2	238				LGALS14_ENST00000360675.3_Silent_p.V20V	NM_020129.2	NP_064514.1	Q8TCE9	PPL13_HUMAN	lectin, galactoside-binding, soluble, 14						apoptotic process (GO:0006915)	nucleus (GO:0005634)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|skin(2)|stomach(2)	14	all_cancers(60;4.39e-06)|all_lung(34;6.76e-08)|Lung NSC(34;7.98e-08)|Ovarian(47;0.06)	Myeloproliferative disorder(2;0.0741)	Epithelial(26;1.08e-24)|OV - Ovarian serous cystadenocarcinoma(5;1.92e-24)|all cancers(26;4.12e-22)			TCAGTAATGTGTGCCGCTTCT	0.502																																						dbGAP											0													204.0	152.0	170.0					19																	40196607		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF267852	CCDS12542.1, CCDS46073.1	19q13.2	2014-03-19			ENSG00000006659	ENSG00000006659		"""Lectins, galactoside-binding"""	30054	protein-coding gene	gene with protein product		607260				11997112	Standard	NM_020129		Approved	PPL13, CLC2	uc002omg.3	Q8TCE9	OTTHUMG00000183143	ENST00000392052.3:c.16-630G>T	19.37:g.40196607G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPV8|B2R530|C5HZ19|Q7Z4X8|Q96KD4|Q96KD5|Q96KD6|Q9NR03	Silent	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.V20	ENST00000392052.3	37	c.60	CCDS46073.1	19																																																																																			LGALS14	-	NULL	ENSG00000006659		0.502	LGALS14-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LGALS14	HGNC	protein_coding	OTTHUMT00000465222.1	98	0.00	0	G	NM_020129		40196607	40196607	+1	no_errors	ENST00000360675	ensembl	human	known	69_37n	silent	59	30.59	26	SNP	0.003	T
MAGEA6	4105	genome.wustl.edu	37	X	151869895	151869895	+	Silent	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chrX:151869895C>A	ENST00000329342.5	+	3	810	c.585C>A	c.(583-585)atC>atA	p.I195I		NM_005363.2	NP_005354.1	P43360	MAGA6_HUMAN	melanoma antigen family A, 6	195	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(3)|large_intestine(3)|lung(16)|prostate(3)|skin(1)|urinary_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					ACAATCAGATCATGCCCAAGA	0.552																																						dbGAP											0													122.0	117.0	119.0					X																	151869895		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS76050.1	Xq28	2009-03-13			ENSG00000197172	ENSG00000197172			6804	protein-coding gene	gene with protein product	"""MAGE-6 antigen"", ""melanoma-associated antigen 6"", ""melanoma antigen family A 6"", ""cancer/testis antigen family 1, member 6"""	300176		MAGE6		8575766	Standard	NM_005363		Approved	CT1.6	uc004ffq.1	P43360	OTTHUMG00000022642	ENST00000329342.5:c.585C>A	X.37:g.151869895C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8IF93|Q6NW44	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.I195	ENST00000329342.5	37	c.585	CCDS14708.1	X																																																																																			MAGEA6	-	pfam_MAGE,pfscan_MAGE	ENSG00000197172		0.552	MAGEA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA6	HGNC	protein_coding	OTTHUMT00000058747.2	156	0.00	0	C	NM_005363		151869895	151869895	+1	no_errors	ENST00000329342	ensembl	human	known	69_37n	silent	93	19.83	23	SNP	0.000	A
MAP4K3	8491	genome.wustl.edu	37	2	39552677	39552677	+	Silent	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr2:39552677G>A	ENST00000263881.3	-	12	1224	c.900C>T	c.(898-900)ttC>ttT	p.F300F	RP11-449G16.1_ENST00000609671.1_RNA|MAP4K3_ENST00000437545.1_Silent_p.F237F|MAP4K3_ENST00000341681.5_Silent_p.F300F|MAP4K3_ENST00000536018.1_5'UTR	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	300					intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)	p.F300F(1)		NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				CATCATCATCGAAATCATGGT	0.358																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											102.0	98.0	99.0					2																	39552677		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.900C>T	2.37:g.39552677G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Silent	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.F300	ENST00000263881.3	37	c.900	CCDS1803.1	2																																																																																			MAP4K3	-	superfamily_Kinase-like_dom	ENSG00000011566		0.358	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP4K3	HGNC	protein_coding	OTTHUMT00000219966.2	86	0.00	0	G	NM_003618		39552677	39552677	-1	no_errors	ENST00000263881	ensembl	human	known	69_37n	silent	101	16.53	20	SNP	0.997	A
MARS	4141	genome.wustl.edu	37	12	57910283	57910283	+	Silent	SNP	G	G	A	rs201214343		TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr12:57910283G>A	ENST00000262027.5	+	21	2756	c.2622G>A	c.(2620-2622)gcG>gcA	p.A874A	MIR616_ENST00000385293.1_RNA|RN7SL312P_ENST00000582079.1_RNA	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase	874	WHEP-TRS.				gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	CGGAGGTGGCGAAACTCTTGG	0.488													G|||	1	0.000199681	0.0	0.0	5008	,	,		18642	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													66.0	64.0	65.0					12																	57910283		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.2622G>A	12.37:g.57910283G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	Missense_Mutation	SNP	pfam_Methionyl/Leucyl_tRNA_Synth	p.E47K	ENST00000262027.5	37	c.139	CCDS8942.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	2.900	-0.227707	0.06022	.	.	ENSG00000166986	ENST00000548944	.	.	.	5.47	3.09	0.35607	.	.	.	.	.	T	0.17619	0.0423	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.18840	-1.0324	5	0.02654	T	1	-6.3228	1.6488	0.02767	0.2615:0.0825:0.1509:0.5052	.	.	.	.	K	47	.	ENSP00000449071:E47K	E	+	1	0	MARS	56196550	0.998000	0.40836	1.000000	0.80357	0.954000	0.61252	0.725000	0.25970	1.022000	0.39626	-0.410000	0.06199	GAA	MARS	-	pfam_Methionyl/Leucyl_tRNA_Synth	ENSG00000166986		0.488	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS	HGNC	protein_coding	OTTHUMT00000407014.1	58	0.00	0	G	NM_004990		57910283	57910283	+1	no_start_codon	ENST00000548944	ensembl	human	putative	69_37n	missense	28	42.86	21	SNP	1.000	A
MC3R	4159	genome.wustl.edu	37	20	54824148	54824148	+	Silent	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr20:54824148C>T	ENST00000243911.2	+	1	361	c.249C>T	c.(247-249)gcC>gcT	p.A83A		NM_019888.3	NP_063941.3	P41968	MC3R_HUMAN	melanocortin 3 receptor	83					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|homoiothermy (GO:0042309)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cAMP biosynthetic process (GO:0030819)|regulation of blood pressure (GO:0008217)|regulation of heart rate (GO:0002027)|sodium ion homeostasis (GO:0055078)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|neuropeptide binding (GO:0042923)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(3)|skin(1)	26			Colorectal(105;0.202)			TGGCGGTGGCCGACATGCTGG	0.562																																						dbGAP											0													84.0	66.0	72.0					20																	54824148		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13449.2	20q13.2-q13.3	2012-08-10			ENSG00000124089	ENSG00000124089		"""GPCR / Class A : Melanocortin receptors"""	6931	protein-coding gene	gene with protein product		155540				8463333	Standard	NM_019888		Approved	MC3	uc002xxb.2	P41968	OTTHUMG00000032785	ENST00000243911.2:c.249C>T	20.37:g.54824148C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN27|Q9H517	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Melcrt_ACTH_rcpt,prints_Mcort_3_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Melancort_rcpt	p.A83	ENST00000243911.2	37	c.249	CCDS13449.2	20																																																																																			MC3R	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000124089		0.562	MC3R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC3R	HGNC	protein_coding	OTTHUMT00000079786.2	49	0.00	0	C			54824148	54824148	+1	no_errors	ENST00000243911	ensembl	human	known	69_37n	silent	44	33.33	22	SNP	0.993	T
MGAT4B	11282	genome.wustl.edu	37	5	179226611	179226611	+	Silent	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr5:179226611C>T	ENST00000292591.7	-	9	1286	c.936G>A	c.(934-936)ctG>ctA	p.L312L	MGAT4B_ENST00000337755.5_Silent_p.L327L|MGAT4B_ENST00000521305.1_5'Flank|MIR1229_ENST00000408467.1_RNA	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	312					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAATCAGGCTCAGGTCCAGCG	0.577																																					GBM(13;414 434 4098 22176 23230)	dbGAP											0													99.0	101.0	101.0					5																	179226611		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.936G>A	5.37:g.179226611C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Missense_Mutation	SNP	pfam_Glyco_transf_54	p.E138K	ENST00000292591.7	37	c.412	CCDS4448.1	5	.	.	.	.	.	.	.	.	.	.	C	9.340	1.062800	0.19987	.	.	ENSG00000161013	ENST00000518778;ENST00000520875;ENST00000518867	.	.	.	4.37	4.37	0.52481	.	.	.	.	.	T	0.63745	0.2537	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62329	-0.6877	4	.	.	.	-23.3517	12.2715	0.54708	0.1694:0.8305:0.0:0.0	.	.	.	.	K	138;111;124	.	.	E	-	1	0	MGAT4B	179159217	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	1.066000	0.30604	2.269000	0.75478	0.561000	0.74099	GAG	MGAT4B	-	pfam_Glyco_transf_54	ENSG00000161013		0.577	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4B	HGNC	protein_coding	OTTHUMT00000253503.3	38	0.00	0	C	NM_014275		179226611	179226611	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000518778	ensembl	human	novel	69_37n	missense	60	14.29	10	SNP	1.000	T
RP11-481J13.1	0	genome.wustl.edu	37	2	56227909	56227909	+	lincRNA	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr2:56227909C>T	ENST00000606639.1	+	0	82				AC011306.2_ENST00000446139.1_lincRNA|MIR216B_ENST00000390186.2_RNA																							TCACATTTGCCTGCAGAGATT	0.373																																						dbGAP											0													91.0	87.0	88.0					2																	56227909		1567	3581	5148	-	-	-			0																															2.37:g.56227909C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000606639.1	37	NULL		2																																																																																			MIR216B	-	-	ENSG00000211520		0.373	RP11-481J13.1-001	KNOWN	basic	lincRNA	MIR216B	HGNC	lincRNA	OTTHUMT00000470754.1	138	0.00	0	C			56227909	56227909	-1	no_errors	ENST00000390186	ensembl	human	known	69_37n	rna	149	12.87	22	SNP	1.000	T
MMAA	166785	genome.wustl.edu	37	4	146567239	146567239	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr4:146567239A>G	ENST00000281317.5	+	4	1874	c.664A>G	c.(664-666)Agg>Ggg	p.R222G	MMAA_ENST00000541599.1_5'UTR|RP11-557J10.4_ENST00000504555.1_RNA	NM_172250.2	NP_758454.1	Q8IVH4	MMAA_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblA type	222					cellular lipid metabolic process (GO:0044255)|cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)	GTP binding (GO:0005525)|hydrolase activity (GO:0016787)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)	17	all_hematologic(180;0.151)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	AGGCGTGACAAGGACCACAAA	0.393																																						dbGAP											0													189.0	176.0	181.0					4																	146567239		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF524841	CCDS3766.1	4q31.1	2011-05-12	2005-07-11			ENSG00000151611			18871	protein-coding gene	gene with protein product		607481	"""methylmalonic aciduria (cobalamin deficiency) type A"""			12438653	Standard	NM_172250		Approved	cblA	uc003ikh.4	Q8IVH4		ENST00000281317.5:c.664A>G	4.37:g.146567239A>G	ENSP00000281317:p.Arg222Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX40|Q495G7	Missense_Mutation	SNP	pfam_ArgK,pfam_Cbl_biosynth_CobW-like,tigrfam_ArgK	p.R222G	ENST00000281317.5	37	c.664	CCDS3766.1	4	.	.	.	.	.	.	.	.	.	.	A	23.8	4.457722	0.84317	.	.	ENSG00000151611	ENST00000281317;ENST00000537246	D	0.90676	-2.71	5.42	5.42	0.78866	ATPase, AAA+ type, core (1);	0.000000	0.85682	D	0.000000	D	0.94981	0.8376	M	0.84082	2.675	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74674	0.978;0.984	D	0.95409	0.8496	10	0.87932	D	0	-24.6087	12.048	0.53491	0.8561:0.1439:0.0:0.0	.	222;222	Q8IVH4;D6RIS5	MMAA_HUMAN;.	G	222	ENSP00000281317:R222G	ENSP00000281317:R222G	R	+	1	2	MMAA	146786689	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.441000	0.44864	2.046000	0.60703	0.528000	0.53228	AGG	MMAA	-	pfam_ArgK,pfam_Cbl_biosynth_CobW-like,tigrfam_ArgK	ENSG00000151611		0.393	MMAA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMAA	HGNC	protein_coding	OTTHUMT00000364668.2	126	0.00	0	A			146567239	146567239	+1	no_errors	ENST00000281317	ensembl	human	known	69_37n	missense	50	51.46	53	SNP	1.000	G
MORN5	254956	genome.wustl.edu	37	9	124962240	124962240	+	3'UTR	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr9:124962240G>A	ENST00000373764.3	+	0	578				MORN5_ENST00000486801.1_3'UTR	NM_198469.2	NP_940871.2	Q5VZ52	MORN5_HUMAN	MORN repeat containing 5											endometrium(3)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	9						GGCCCGAGCCGTGAACTCTGT	0.557																																						dbGAP											0													82.0	63.0	70.0					9																	124962240		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK128877	CCDS6836.1, CCDS75894.1	9q34.11	2008-06-23	2008-06-23	2008-06-23	ENSG00000185681	ENSG00000185681			17841	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 113"", ""chromosome 9 open reading frame 18"""	C9orf113, C9orf18			Standard	XM_005251878		Approved	FLJ46909	uc004blw.2	Q5VZ52	OTTHUMG00000020599	ENST00000373764.3:c.*30G>A	9.37:g.124962240G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7I5|Q6ZQN1	RNA	SNP	-	NULL	ENST00000373764.3	37	NULL	CCDS6836.1	9																																																																																			MORN5	-	-	ENSG00000185681		0.557	MORN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MORN5	HGNC	protein_coding	OTTHUMT00000053910.2	58	0.00	0	G	NM_198469		124962240	124962240	+1	no_errors	ENST00000486801	ensembl	human	known	69_37n	rna	43	15.69	8	SNP	0.005	A
MT1A	4489	genome.wustl.edu	37	16	56669901	56669901	+	5'Flank	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr16:56669901G>A	ENST00000290705.8	+	0	0				MT1JP_ENST00000564564.1_RNA	NM_005946.2	NP_005937.2	P04731	MT1A_HUMAN	metallothionein 1A						cellular response to cadmium ion (GO:0071276)|cellular response to zinc ion (GO:0071294)|negative regulation of growth (GO:0045926)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)	3					Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	TCCTGATCGCGCTCCTGAGAG	0.557																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			BC029475	CCDS32454.1	16q13	2012-10-02	2007-03-02			ENSG00000205362		"""Metallothioneins"""	7393	protein-coding gene	gene with protein product		156350	"""metallothionein 1S"""	MT1, MT1S		6089206, 6327055	Standard	NM_005946		Approved		uc002ejq.3	P04731			16.37:g.56669901G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YX5	RNA	SNP	-	NULL	ENST00000290705.8	37	NULL	CCDS32454.1	16																																																																																			MT1JP	-	-	ENSG00000255986		0.557	MT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MT1JP	HGNC	protein_coding	OTTHUMT00000434324.1	13	0.00	0	G	NM_005946		56669901	56669901	+1	no_errors	ENST00000564564	ensembl	human	known	69_37n	rna	5	50.00	5	SNP	0.000	A
MTPAP	55149	genome.wustl.edu	37	10	30605071	30605072	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr10:30605071_30605072insT	ENST00000263063.4	-	7	1330_1331	c.1287_1288insA	c.(1285-1290)aaacctfs	p.P430fs	MTPAP_ENST00000358107.4_Frame_Shift_Ins_p.P560fs|MTPAP_ENST00000488290.1_5'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	430					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						TTCTGTGAAGGTTTAATTCTAC	0.337																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.1288dupA	10.37:g.30605074_30605074dupT	ENSP00000263063:p.Pro430fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Frame_Shift_Ins	INS	pfam_PAP_assoc	p.P559fs	ENST00000263063.4	37	c.1678_1677	CCDS7165.1	10																																																																																			MTPAP	-	NULL	ENSG00000107951		0.337	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	HGNC	protein_coding	OTTHUMT00000047426.2	128	0.00	0	-	NM_018109		30605071	30605072	-1	no_errors	ENST00000358107	ensembl	human	known	69_37n	frame_shift_ins	82	25.45	28	INS	1.000:0.931	T
NSUN2	54888	genome.wustl.edu	37	5	6600335	6600335	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr5:6600335C>A	ENST00000264670.6	-	19	2319	c.2008G>T	c.(2008-2010)Gct>Tct	p.A670S	NSUN2_ENST00000539938.1_Missense_Mutation_p.A434S|NSUN2_ENST00000506139.1_Missense_Mutation_p.A635S	NM_017755.5	NP_060225.4	Q08J23	NSUN2_HUMAN	NOP2/Sun RNA methyltransferase family, member 2	670					mitotic nuclear division (GO:0007067)|tRNA methylation (GO:0030488)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|tRNA (cytosine-5-)-methyltransferase activity (GO:0016428)|tRNA binding (GO:0000049)			breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	41						CACTGCAGAGCGTCTGGATTC	0.428																																						dbGAP											0													46.0	47.0	47.0					5																	6600335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000310	CCDS3869.1, CCDS54832.1	5p15.32	2014-01-31	2012-06-12		ENSG00000037474	ENSG00000037474		"""NOP2/Sun domain containing"""	25994	protein-coding gene	gene with protein product	"""tRNA methyltransferase 4 homolog (S. cerevisiae)"", ""Myc-induced SUN-domain-containing protein"""	610916	"""NOL1/NOP2/Sun domain family, member 2"", ""NOP2/Sun domain family, member 2"", ""mental retardation, non-syndromic, autosomal recessive, 5"""	MRT5		17071714, 22541559	Standard	NM_017755		Approved	FLJ20303, TRM4, Misu	uc003jdu.3	Q08J23	OTTHUMG00000090455	ENST00000264670.6:c.2008G>T	5.37:g.6600335C>A	ENSP00000264670:p.Ala670Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K529|B2RNR4|B3KP09|B4DQW2|G3V1R4|Q9BVN4|Q9H858|Q9NXD9	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,prints_RCMT,prints_RCMT_NCL1	p.A670S	ENST00000264670.6	37	c.2008	CCDS3869.1	5	.	.	.	.	.	.	.	.	.	.	C	0.028	-1.353155	0.01256	.	.	ENSG00000037474	ENST00000264670;ENST00000539938;ENST00000506139	T;T;T	0.64085	-0.08;-0.08;-0.08	5.43	-0.77	0.11005	.	0.527621	0.22224	N	0.062918	T	0.38321	0.1036	N	0.24115	0.695	0.09310	N	1	B;B;B	0.16396	0.017;0.007;0.006	B;B;B	0.17979	0.015;0.02;0.009	T	0.18587	-1.0332	10	0.14656	T	0.56	-12.7342	6.3889	0.21576	0.1167:0.2715:0.0:0.6118	.	635;670;670	B4DQW2;Q08J23;A8K529	.;NSUN2_HUMAN;.	S	670;434;635	ENSP00000264670:A670S;ENSP00000444338:A434S;ENSP00000420957:A635S	ENSP00000264670:A670S	A	-	1	0	NSUN2	6653335	0.045000	0.20229	0.000000	0.03702	0.002000	0.02628	0.299000	0.19138	-0.355000	0.08199	-0.261000	0.10672	GCT	NSUN2	-	NULL	ENSG00000037474		0.428	NSUN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NSUN2	HGNC	protein_coding	OTTHUMT00000206902.1	58	0.00	0	C	NM_017755		6600335	6600335	-1	no_errors	ENST00000264670	ensembl	human	known	69_37n	missense	15	66.67	30	SNP	0.034	A
NUDCD2	134492	genome.wustl.edu	37	5	162884615	162884615	+	Splice_Site	SNP	C	C	G			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr5:162884615C>G	ENST00000302764.4	-	2	280	c.191G>C	c.(190-192)gGc>gCc	p.G64A	HMMR_ENST00000353866.3_5'Flank|HMMR_ENST00000393915.4_5'Flank|NUDCD2_ENST00000519395.1_5'UTR|NUDCD2_ENST00000517501.1_Splice_Site_p.G64A	NM_145266.4	NP_660309.1	Q8WVJ2	NUDC2_HUMAN	NudC domain containing 2	64	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)				large_intestine(1)|prostate(1)	2	Renal(175;0.000281)	Medulloblastoma(196;0.0207)|all_neural(177;0.0966)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0981)|OV - Ovarian serous cystadenocarcinoma(192;0.183)|Epithelial(171;0.247)		AAAGAGTTTGCCCTGAAAAAT	0.279																																						dbGAP											0													71.0	82.0	78.0					5																	162884615		2203	4297	6500	-	-	-	SO:0001630	splice_region_variant	0			BX538290	CCDS4361.1	5q34	2008-02-05			ENSG00000170584	ENSG00000170584			30535	protein-coding gene	gene with protein product							Standard	NM_145266		Approved	DKFZp686E10109	uc003lze.3	Q8WVJ2	OTTHUMG00000130378	ENST00000302764.4:c.190-1G>C	5.37:g.162884615C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4V0	Missense_Mutation	SNP	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.G64A	ENST00000302764.4	37	c.191	CCDS4361.1	5	.	.	.	.	.	.	.	.	.	.	C	26.4	4.734166	0.89482	.	.	ENSG00000170584	ENST00000302764;ENST00000517501	T;T	0.16597	2.33;2.33	5.49	5.49	0.81192	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.000000	0.85682	D	0.000000	T	0.53174	0.1780	M	0.91510	3.215	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.63207	-0.6689	10	0.66056	D	0.02	-10.9262	18.9503	0.92638	0.0:1.0:0.0:0.0	.	64	Q8WVJ2	NUDC2_HUMAN	A	64	ENSP00000304854:G64A;ENSP00000430347:G64A	ENSP00000304854:G64A	G	-	2	0	NUDCD2	162817193	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.866000	0.75506	2.583000	0.87209	0.655000	0.94253	GGC	NUDCD2	-	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	ENSG00000170584		0.279	NUDCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD2	HGNC	protein_coding	OTTHUMT00000252747.3	75	0.00	0	C	NM_145266	Missense_Mutation	162884615	162884615	-1	no_errors	ENST00000302764	ensembl	human	known	69_37n	missense	106	12.40	15	SNP	1.000	G
NUPL1	9818	genome.wustl.edu	37	13	25914162	25914162	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr13:25914162G>A	ENST00000381736.3	+	16	1940	c.1690G>A	c.(1690-1692)Gct>Act	p.A564T	NUPL1_ENST00000381718.3_Missense_Mutation_p.A552T	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1	564	14 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		CACGGCATCAGCTGGTTTGAC	0.443																																					Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)	dbGAP											0													171.0	159.0	163.0					13																	25914162		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.1690G>A	13.37:g.25914162G>A	ENSP00000371155:p.Ala564Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	Missense_Mutation	SNP	NULL	p.A564T	ENST00000381736.3	37	c.1690	CCDS9314.1	13	.	.	.	.	.	.	.	.	.	.	G	32	5.158266	0.94686	.	.	ENSG00000139496	ENST00000381736;ENST00000313619;ENST00000381718	T;T	0.36699	1.28;1.24	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.55114	0.1900	L	0.43152	1.355	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.81914	0.995;0.995	T	0.43327	-0.9398	10	0.40728	T	0.16	-17.1042	20.422	0.99049	0.0:0.0:1.0:0.0	.	552;564	A6NI12;Q9BVL2	.;NUPL1_HUMAN	T	564;541;552	ENSP00000371155:A564T;ENSP00000371137:A552T	ENSP00000318459:A541T	A	+	1	0	NUPL1	24812162	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.372000	0.97165	2.832000	0.97577	0.655000	0.94253	GCT	NUPL1	-	NULL	ENSG00000139496		0.443	NUPL1-001	KNOWN	basic|CCDS	protein_coding	NUPL1	HGNC	protein_coding	OTTHUMT00000044228.2	112	0.00	0	G			25914162	25914162	+1	no_errors	ENST00000381736	ensembl	human	known	69_37n	missense	34	68.22	73	SNP	1.000	A
OR14C36	127066	genome.wustl.edu	37	1	248512625	248512625	+	Silent	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr1:248512625G>T	ENST00000317861.1	+	1	549	c.549G>T	c.(547-549)ctG>ctT	p.L183L		NM_001001918.1	NP_001001918.1	Q8NHC7	O14CZ_HUMAN	olfactory receptor, family 14, subfamily C, member 36	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|liver(2)|lung(20)|ovary(2)|prostate(3)|skin(7)|upper_aerodigestive_tract(2)	43						CCTCTCTGCTGAAGCTCTCTT	0.498																																						dbGAP											0													162.0	144.0	150.0					1																	248512625		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004466	CCDS31112.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000177174	ENSG00000177174		"""GPCR / Class A : Olfactory receptors"""	15026	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BF, member 1"""	OR5BF1			Standard	NM_001001918		Approved		uc010pzl.2	Q8NHC7	OTTHUMG00000040463	ENST00000317861.1:c.549G>T	1.37:g.248512625G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEZ6	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L183	ENST00000317861.1	37	c.549	CCDS31112.1	1																																																																																			OR14C36	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000177174		0.498	OR14C36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14C36	HGNC	protein_coding	OTTHUMT00000097359.1	128	0.00	0	G	NM_001001918		248512625	248512625	+1	no_errors	ENST00000317861	ensembl	human	known	69_37n	silent	121	21.94	34	SNP	0.003	T
OR4A5	81318	genome.wustl.edu	37	11	51411541	51411541	+	Silent	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr11:51411541C>T	ENST00000319760.6	-	1	907	c.855G>A	c.(853-855)acG>acA	p.T285T		NM_001005272.3	NP_001005272.3	Q8NH83	OR4A5_HUMAN	olfactory receptor, family 4, subfamily A, member 5	285						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.T285T(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(28)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	49		all_lung(304;0.236)				AATTTCTCAACGTATATATTA	0.328																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											34.0	36.0	35.0					11																	51411541		2201	4293	6494	-	-	-	SO:0001819	synonymous_variant	0			AB065506	CCDS73289.1	11p11.12	2012-08-09			ENSG00000221840	ENSG00000221840		"""GPCR / Class A : Olfactory receptors"""	15162	protein-coding gene	gene with protein product							Standard	NM_001005272		Approved		uc001nhi.2	Q8NH83	OTTHUMG00000166764	ENST00000319760.6:c.855G>A	11.37:g.51411541C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF84	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T285	ENST00000319760.6	37	c.855	CCDS31497.1	11																																																																																			OR4A5	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000221840		0.328	OR4A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4A5	HGNC	protein_coding	OTTHUMT00000391399.1	50	0.00	0	C	NM_001005272		51411541	51411541	-1	no_errors	ENST00000319760	ensembl	human	known	69_37n	silent	38	20.83	10	SNP	0.314	T
OR4N4	283694	genome.wustl.edu	37	15	22383382	22383382	+	Silent	SNP	C	C	A	rs200740894	byFrequency	TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr15:22383382C>A	ENST00000328795.4	+	1	1001	c.910C>A	c.(910-912)Cga>Aga	p.R304R	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	304						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		GTTATTGAGTCGACATGTAGT	0.373																																						dbGAP											0													56.0	53.0	54.0					15																	22383382		2182	4250	6432	-	-	-	SO:0001819	synonymous_variant	0			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.910C>A	15.37:g.22383382C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEY3|Q6IF56	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R304	ENST00000328795.4	37	c.910	CCDS32173.1	15																																																																																			OR4N4	-	NULL	ENSG00000183706		0.373	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N4	HGNC	protein_coding	OTTHUMT00000414922.1	63	0.00	0	C			22383382	22383382	+1	no_errors	ENST00000328795	ensembl	human	known	69_37n	silent	37	13.95	6	SNP	0.004	A
OTUD3	23252	genome.wustl.edu	37	1	20224226	20224226	+	Intron	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr1:20224226C>T	ENST00000375120.3	+	4	607				OTUD3_ENST00000466697.1_3'UTR	NM_015207.1	NP_056022.1	Q5T2D3	OTUD3_HUMAN	OTU deubiquitinase 3						protein K11-linked deubiquitination (GO:0035871)|protein K6-linked deubiquitination (GO:0044313)		ubiquitin-specific protease activity (GO:0004843)			breast(1)|kidney(2)|large_intestine(4)|lung(1)|skin(1)	9		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000276)|Lung NSC(340;0.000338)|Breast(348;0.000812)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|COAD - Colon adenocarcinoma(152;1.12e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000142)|Kidney(64;0.000177)|GBM - Glioblastoma multiforme(114;0.000408)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)		GTATATCTGGCGCTAAAAACC	0.428																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB007928	CCDS41279.1	1p36.13	2014-02-24	2014-02-24		ENSG00000169914	ENSG00000169914		"""OTU domain containing"""	29038	protein-coding gene	gene with protein product		611758	"""OTU domain containing 3"""			9455484, 23827681	Standard	NM_015207		Approved	KIAA0459, DUBA4	uc001bcs.4	Q5T2D3	OTTHUMG00000002696	ENST00000375120.3:c.606+71C>T	1.37:g.20224226C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75047	RNA	SNP	-	NULL	ENST00000375120.3	37	NULL	CCDS41279.1	1																																																																																			OTUD3	-	-	ENSG00000169914		0.428	OTUD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD3	HGNC	protein_coding	OTTHUMT00000007655.1	21	0.00	0	C			20224226	20224226	+1	no_errors	ENST00000466697	ensembl	human	known	69_37n	rna	4	60.00	6	SNP	0.010	T
PCDHA9	9752	genome.wustl.edu	37	5	140230084	140230084	+	Silent	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr5:140230084G>A	ENST00000532602.1	+	1	3037	c.2004G>A	c.(2002-2004)tcG>tcA	p.S668S	PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA9_ENST00000378122.3_Silent_p.S668S|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	668	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGCTGGTGTCGCTGGTGGAGA	0.677																																					Melanoma(55;1800 1972 14909)	dbGAP											0													43.0	47.0	46.0					5																	140230084		2197	4267	6464	-	-	-	SO:0001819	synonymous_variant	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.2004G>A	5.37:g.140230084G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15053|Q2M3S5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S668	ENST00000532602.1	37	c.2004	CCDS54920.1	5																																																																																			PCDHA9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000204961		0.677	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	51	0.00	0	G	NM_031857		140230084	140230084	+1	no_errors	ENST00000532602	ensembl	human	known	69_37n	silent	55	14.06	9	SNP	0.159	A
PCDHA11	56138	genome.wustl.edu	37	5	140250385	140250385	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr5:140250385C>T	ENST00000398640.2	+	1	1697	c.1697C>T	c.(1696-1698)gCg>gTg	p.A566V	PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000512229.2_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	566					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCACTGCTGGCGACTCAGGCT	0.692																																						dbGAP											0													85.0	95.0	92.0					5																	140250385		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1697C>T	5.37:g.140250385C>T	ENSP00000381636:p.Ala566Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN58|O75279	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A566V	ENST00000398640.2	37	c.1697	CCDS47284.1	5	.	.	.	.	.	.	.	.	.	.	C	2.753	-0.259701	0.05791	.	.	ENSG00000249158	ENST00000398640	T	0.37752	1.18	5.11	3.32	0.38043	Cadherin-like (1);	.	.	.	.	T	0.24967	0.0606	L	0.31294	0.92	0.09310	N	1	B;B	0.16802	0.019;0.016	B;B	0.13407	0.009;0.004	T	0.22730	-1.0208	9	0.18710	T	0.47	.	9.8934	0.41304	0.0:0.8303:0.0:0.1697	.	566;566	Q9Y5I1-2;Q9Y5I1	.;PCDAB_HUMAN	V	566	ENSP00000381636:A566V	ENSP00000381636:A566V	A	+	2	0	PCDHA11	140230569	0.460000	0.25776	0.074000	0.20217	0.169000	0.22640	1.601000	0.36773	0.558000	0.29135	-0.265000	0.10407	GCG	PCDHA11	-	superfamily_Cadherin-like	ENSG00000249158		0.692	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA11	HGNC	protein_coding	OTTHUMT00000372885.2	43	0.00	0	C	NM_018902		140250385	140250385	+1	no_errors	ENST00000398640	ensembl	human	known	69_37n	missense	61	20.78	16	SNP	0.012	T
PHLDB1	23187	genome.wustl.edu	37	11	118502193	118502193	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr11:118502193G>T	ENST00000361417.2	+	8	2508	c.2097G>T	c.(2095-2097)caG>caT	p.Q699H	PHLDB1_ENST00000356063.5_Missense_Mutation_p.Q699H|PHLDB1_ENST00000534672.1_3'UTR	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	699										breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		GCACCCAGCAGGAGGTGAGAT	0.582																																						dbGAP											0													27.0	27.0	27.0					11																	118502193		2198	4295	6493	-	-	-	SO:0001583	missense	0				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.2097G>T	11.37:g.118502193G>T	ENSP00000354498:p.Gln699His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q699H	ENST00000361417.2	37	c.2097	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	G	11.42	1.634809	0.29068	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000358191;ENST00000356063	T;T	0.31247	1.5;1.5	4.87	3.74	0.42951	.	0.175611	0.52532	D	0.000063	T	0.25827	0.0629	L	0.58101	1.795	0.80722	D	1	B;P;B;B	0.34462	0.044;0.454;0.011;0.126	B;B;B;B	0.35813	0.015;0.211;0.013;0.023	T	0.07712	-1.0758	10	0.35671	T	0.21	-29.3892	4.201	0.10466	0.1:0.2001:0.5643:0.1357	.	443;699;699;699	Q5W9G0;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	H	699;458;21;699	ENSP00000354498:Q699H;ENSP00000348359:Q699H	ENSP00000348359:Q699H	Q	+	3	2	PHLDB1	118007403	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.397000	0.34543	2.274000	0.75844	0.555000	0.69702	CAG	PHLDB1	-	NULL	ENSG00000019144		0.582	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	42	0.00	0	G	NM_015157		118502193	118502193	+1	no_errors	ENST00000361417	ensembl	human	known	69_37n	missense	10	65.52	19	SNP	1.000	T
POC1B	282809	genome.wustl.edu	37	12	89864272	89864273	+	Splice_Site	DNP	CT	CT	AG			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C|T	C|T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr12:89864272_89864273CT>AG	ENST00000313546.3	-	7	805		c.e7-1		POC1B_ENST00000541909.1_Splice_Site|POC1B_ENST00000378528.2_Intron|POC1B_ENST00000549035.1_Splice_Site|POC1B_ENST00000393179.4_Splice_Site|POC1B_ENST00000549504.1_Intron	NM_172240.2	NP_758440.1	Q8TC44	POC1B_HUMAN	POC1 centriolar protein B						cell proliferation (GO:0008283)|cilium assembly (GO:0042384)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	14						CCGCTGTGAACTGATTTGTAGA	0.381																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AL832918	CCDS31869.1, CCDS55859.1	12q21.33	2014-05-02	2013-08-21	2010-03-26	ENSG00000139323	ENSG00000139323		"""WD repeat domain containing"""	30836	protein-coding gene	gene with protein product		614784	"""WD repeat domain 51B"", ""POC1 centriolar protein homolog B (Chlamydomonas)"""	WDR51B		19109428	Standard	NM_172240		Approved	TUWD12, FLJ14923		Q8TC44	OTTHUMG00000169944	ENST00000313546.3:c.677_677delinsAG	12.37:g.89864272_89864273delinsAG		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1X0	Splice_Site	SNP	-	e7-1|e7-2	ENST00000313546.3	37	c.677-1|c.677-2	CCDS31869.1	12																																																																																			POC1B	-	-	ENSG00000139323		0.381	POC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC1B	HGNC	protein_coding	OTTHUMT00000406637.1	78	0.00	0	C|T	NM_172240	Intron	89864272|89864273	89864272|89864273	-1	no_errors	ENST00000313546	ensembl	human	known	69_37n	splice_site	66	23.26|21.43	20|18	SNP	1.000	A|G
PRR14	78994	genome.wustl.edu	37	16	30666190	30666190	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr16:30666190C>T	ENST00000542965.2	+	7	1355	c.899C>T	c.(898-900)aCt>aTt	p.T300I	PRR14_ENST00000571654.1_3'UTR|PRR14_ENST00000300835.4_Missense_Mutation_p.T300I			Q9BWN1	PRR14_HUMAN	proline rich 14	300	Pro-rich.									breast(3)|endometrium(5)|kidney(1)|large_intestine(3)|lung(5)|skin(1)	18			Colorectal(24;0.103)			GCTGAGGGCACTGCGTCTGTC	0.642																																						dbGAP											0													43.0	46.0	45.0					16																	30666190		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK074783	CCDS10687.1	16p11.2	2008-02-05			ENSG00000156858	ENSG00000156858			28458	protein-coding gene	gene with protein product						12477932	Standard	NM_024031		Approved	MGC3121	uc002dyy.3	Q9BWN1	OTTHUMG00000132414	ENST00000542965.2:c.899C>T	16.37:g.30666190C>T	ENSP00000441641:p.Thr300Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WTX2	Missense_Mutation	SNP	NULL	p.T300I	ENST00000542965.2	37	c.899	CCDS10687.1	16	.	.	.	.	.	.	.	.	.	.	C	8.979	0.974918	0.18736	.	.	ENSG00000156858	ENST00000287463;ENST00000300835;ENST00000542965	T;T	0.43294	0.95;0.95	5.77	2.42	0.29668	.	1.216040	0.05770	N	0.606630	T	0.32164	0.0820	L	0.36672	1.1	0.09310	N	1	B	0.15141	0.012	B	0.12156	0.007	T	0.27673	-1.0067	10	0.45353	T	0.12	0.115	3.278	0.06906	0.144:0.5646:0.1274:0.1641	.	300	Q9BWN1	PRR14_HUMAN	I	273;300;300	ENSP00000300835:T300I;ENSP00000441641:T300I	ENSP00000287463:T273I	T	+	2	0	PRR14	30573691	0.000000	0.05858	0.001000	0.08648	0.995000	0.86356	0.336000	0.19823	0.768000	0.33290	0.655000	0.94253	ACT	PRR14	-	NULL	ENSG00000156858		0.642	PRR14-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRR14	HGNC	protein_coding	OTTHUMT00000434433.1	31	0.00	0	C	NM_024031		30666190	30666190	+1	no_errors	ENST00000300835	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	0.000	T
RPL5	6125	genome.wustl.edu	37	1	93307451	93307451	+	3'UTR	SNP	A	A	G			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr1:93307451A>G	ENST00000370321.3	+	0	1013				SNORA66_ENST00000384792.1_RNA	NM_000969.3	NP_000960.2	P46777	RL5_HUMAN	ribosomal protein L5						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal large subunit biogenesis (GO:0042273)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	5S rRNA binding (GO:0008097)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	9		all_lung(203;0.00265)|Lung NSC(277;0.0056)|all_neural(321;0.185)|Melanoma(281;0.192)|Glioma(108;0.203)		GBM - Glioblastoma multiforme(16;0.000305)|all cancers(265;0.000343)|Epithelial(280;0.0927)		ATTTTTTCAGATATAGATAAT	0.383																																						dbGAP											0													11.0	14.0	13.0					1																	93307451		2106	4009	6115	-	-	-	SO:0001624	3_prime_UTR_variant	0			U14966	CCDS741.1	1p22.1	2014-06-13			ENSG00000122406	ENSG00000122406		"""L ribosomal proteins"""	10360	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 135"""	603634				7937132, 7772601	Standard	NM_000969		Approved	L5, PPP1R135	uc001doz.3	P46777	OTTHUMG00000010899	ENST00000370321.3:c.*29A>G	1.37:g.93307451A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32LZ3|Q53HH6|Q9H3F4	RNA	SNP	-	NULL	ENST00000370321.3	37	NULL	CCDS741.1	1																																																																																			RPL5	-	-	ENSG00000122406		0.383	RPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL5	HGNC	protein_coding	OTTHUMT00000030058.2	12	0.00	0	A	NM_000969		93307451	93307451	+1	no_errors	ENST00000490963	ensembl	human	known	69_37n	rna	6	40.00	4	SNP	0.852	G
RTP3	83597	genome.wustl.edu	37	3	46541919	46541921	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr3:46541919_46541921delGAG	ENST00000296142.3	+	2	801_803	c.229_231delGAG	c.(229-231)gagdel	p.E78del		NM_031440.1	NP_113628.1	Q9BQQ7	RTP3_HUMAN	receptor (chemosensory) transporter protein 3	78					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|ovary(3)|prostate(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.00114)|KIRC - Kidney renal clear cell carcinoma(197;0.0173)|Kidney(197;0.0204)		GAACTGGAGTGAGGAGAAGTCCA	0.537																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AJ312776	CCDS2740.1	3p21.3	2014-02-20	2006-11-21	2006-02-07	ENSG00000163825	ENSG00000163825		"""Receptor transporter proteins"""	15572	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 3"""	607181	"""transmembrane protein 7"", ""receptor transporter protein 3"""	TMEM7		16271481, 15550249, 16720576	Standard	NM_031440		Approved	LTM1, Z3CXXC3	uc003cps.1	Q9BQQ7	OTTHUMG00000133483	ENST00000296142.3:c.229_231delGAG	3.37:g.46541922_46541924delGAG	ENSP00000296142:p.Glu78del	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRP6	In_Frame_Del	DEL	NULL	p.E78in_frame_del	ENST00000296142.3	37	c.229_231	CCDS2740.1	3																																																																																			RTP3	-	NULL	ENSG00000163825		0.537	RTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP3	HGNC	protein_coding	OTTHUMT00000257379.2	45	0.00	0	GAG	NM_031440		46541919	46541921	+1	no_errors	ENST00000296142	ensembl	human	known	69_37n	in_frame_del	16	52.94	18	DEL	0.001:0.001:0.002	-
SDPR	8436	genome.wustl.edu	37	2	192711272	192711272	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr2:192711272G>A	ENST00000304141.4	-	1	709	c.380C>T	c.(379-381)gCg>gTg	p.A127V	AC098617.1_ENST00000424116.2_RNA	NM_004657.5	NP_004648.1			serum deprivation response											NS(1)|central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(3)	23			OV - Ovarian serous cystadenocarcinoma(117;0.0647)			CTCTTTGACCGCGCGCGTGTG	0.597																																						dbGAP											0													71.0	64.0	66.0					2																	192711272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF085481	CCDS2313.1	2q32-q33	2011-04-20	2009-09-18		ENSG00000168497	ENSG00000168497			10690	protein-coding gene	gene with protein product	"""phosphatidylserine binding protein"""	606728	"""serum deprivation response (phosphatidylserine-binding protein)"", ""serum deprivation response (phosphatidylserine binding protein)"""			10191091, 8241023	Standard	NM_004657		Approved	SDR, PS-p68, cavin-2, CAVIN2	uc002utb.3	O95810	OTTHUMG00000154309	ENST00000304141.4:c.380C>T	2.37:g.192711272G>A	ENSP00000305675:p.Ala127Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A127V	ENST00000304141.4	37	c.380	CCDS2313.1	2	.	.	.	.	.	.	.	.	.	.	G	17.19	3.326885	0.60743	.	.	ENSG00000168497	ENST00000304141	T	0.60299	0.2	4.62	3.67	0.42095	.	0.129816	0.51477	D	0.000091	T	0.51736	0.1692	M	0.63843	1.955	0.39708	D	0.971296	P	0.51147	0.942	B	0.39503	0.301	T	0.62196	-0.6905	10	0.51188	T	0.08	-15.3575	12.7153	0.57111	0.0:0.0:0.7158:0.2842	.	127	O95810	SDPR_HUMAN	V	127	ENSP00000305675:A127V	ENSP00000305675:A127V	A	-	2	0	SDPR	192419517	0.934000	0.31675	0.539000	0.28077	0.990000	0.78478	3.265000	0.51561	2.564000	0.86499	0.484000	0.47621	GCG	SDPR	-	NULL	ENSG00000168497		0.597	SDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDPR	HGNC	protein_coding	OTTHUMT00000334791.2	58	0.00	0	G	NM_004657		192711272	192711272	-1	no_errors	ENST00000304141	ensembl	human	known	69_37n	missense	45	37.50	27	SNP	0.981	A
SH3TC1	54436	genome.wustl.edu	37	4	8239229	8239229	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr4:8239229delC	ENST00000245105.3	+	17	3652	c.3585delC	c.(3583-3585)tacfs	p.Y1195fs	SH3TC1_ENST00000539824.1_Frame_Shift_Del_p.Y1119fs	NM_018986.3	NP_061859	Q8TE82	S3TC1_HUMAN	SH3 domain and tetratricopeptide repeats 1	1195										NS(1)|breast(3)|endometrium(4)|kidney(4)|large_intestine(6)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33						GCGTGGCCTACCACCGGCTGG	0.697																																					NSCLC(145;2298 2623 35616 37297)	dbGAP											0													24.0	24.0	24.0					4																	8239229		2202	4296	6498	-	-	-	SO:0001589	frameshift_variant	0			AK074093	CCDS3399.1	4p16.1	2013-01-11			ENSG00000125089	ENSG00000125089		"""Tetratricopeptide (TTC) repeat domain containing"""	26009	protein-coding gene	gene with protein product							Standard	NM_018986		Approved	FLJ20356	uc003gkv.4	Q8TE82	OTTHUMG00000160934	ENST00000245105.3:c.3585delC	4.37:g.8239229delC	ENSP00000245105:p.Tyr1195fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5G5	Frame_Shift_Del	DEL	superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.H1196fs	ENST00000245105.3	37	c.3585	CCDS3399.1	4																																																																																			SH3TC1	-	smart_TPR_repeat	ENSG00000125089		0.697	SH3TC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SH3TC1	HGNC	protein_coding	OTTHUMT00000206991.2	13	0.00	0	C	NM_018986		8239229	8239229	+1	no_errors	ENST00000245105	ensembl	human	known	69_37n	frame_shift_del	16	33.33	8	DEL	1.000	-
SPECC1L	23384	genome.wustl.edu	37	22	24717613	24717613	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr22:24717613G>A	ENST00000314328.9	+	5	950	c.665G>A	c.(664-666)gGt>gAt	p.G222D	SPECC1L_ENST00000437398.1_Missense_Mutation_p.G222D|SPECC1L-ADORA2A_ENST00000358654.2_Missense_Mutation_p.G222D|SPECC1L_ENST00000541492.1_Missense_Mutation_p.G222D|SPECC1L_ENST00000416735.1_Intron	NM_001254733.1|NM_015330.3	NP_001241662.1|NP_056145	Q69YQ0	CYTSA_HUMAN	sperm antigen with calponin homology and coiled-coil domains 1-like	222					actin cytoskeleton organization (GO:0030036)|cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|negative regulation of actin filament depolymerization (GO:0030835)|negative regulation of microtubule depolymerization (GO:0007026)	cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|gap junction (GO:0005921)|microtubule organizing center (GO:0005815)				breast(1)|endometrium(1)|kidney(4)|large_intestine(7)|lung(6)|ovary(1)|prostate(1)|skin(3)|stomach(2)|urinary_tract(1)	27						CATTCTGAGGGTGATGAAAAA	0.448																																						dbGAP											0													103.0	107.0	106.0					22																	24717613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025531	CCDS33619.1, CCDS58797.1	22q11.23	2012-12-20	2010-09-17	2010-09-17	ENSG00000100014	ENSG00000100014			29022	protein-coding gene	gene with protein product	"""cytokinesis and spindle organization A"", ""cytospin A"""	614140	"""SPECC1-like"""			9205841	Standard	NM_001254733		Approved	KIAA0376, CYTSA	uc002zzv.4	Q69YQ0	OTTHUMG00000171450	ENST00000314328.9:c.665G>A	22.37:g.24717613G>A	ENSP00000325785:p.Gly222Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z758|F5H1H6|O15081	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_HLH_DNA-bd,smart_CH-domain,pfscan_CH-domain	p.G222D	ENST00000314328.9	37	c.665	CCDS33619.1	22	.	.	.	.	.	.	.	.	.	.	G	10.92	1.487809	0.26686	.	.	ENSG00000100014	ENST00000398280;ENST00000437398;ENST00000421374;ENST00000314328;ENST00000541492;ENST00000440893	T;T;T;T;T	0.60797	0.16;2.64;0.16;3.16;0.87	5.31	5.31	0.75309	.	0.268309	0.35708	N	0.003038	T	0.37237	0.0996	N	0.14661	0.345	0.38862	D	0.956516	P;B	0.40602	0.723;0.041	B;B	0.30943	0.122;0.01	T	0.39014	-0.9634	10	0.30854	T	0.27	-16.2017	16.5177	0.84305	0.0:0.0:1.0:0.0	.	222;222	F5H1H6;Q69YQ0	.;CYTSA_HUMAN	D	250;222;222;222;222;161	ENSP00000393363:G222D;ENSP00000405671:G222D;ENSP00000325785:G222D;ENSP00000439633:G222D;ENSP00000414354:G161D	ENSP00000325785:G222D	G	+	2	0	SPECC1L	23047613	1.000000	0.71417	0.954000	0.39281	0.430000	0.31655	4.256000	0.58810	2.675000	0.91044	0.591000	0.81541	GGT	SPECC1L	-	NULL	ENSG00000100014		0.448	SPECC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPECC1L	HGNC	protein_coding	OTTHUMT00000319986.2	42	0.00	0	G	NM_015330		24717613	24717613	+1	no_errors	ENST00000314328	ensembl	human	known	69_37n	missense	26	55.17	32	SNP	0.989	A
SPTA1	6708	genome.wustl.edu	37	1	158639209	158639209	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr1:158639209C>T	ENST00000368147.4	-	14	2002	c.1822G>A	c.(1822-1824)Gaa>Aaa	p.E608K		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	608					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TTGTAATCTTCATCATCTGCC	0.403																																						dbGAP											0													278.0	263.0	268.0					1																	158639209		1923	4140	6063	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.1822G>A	1.37:g.158639209C>T	ENSP00000357129:p.Glu608Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E608K	ENST00000368147.4	37	c.1822	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	27.8	4.866736	0.91511	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.52983	0.64;0.64	4.72	4.72	0.59763	.	0.255251	0.20588	N	0.089407	T	0.59101	0.2169	M	0.81497	2.545	0.45490	D	0.998457	P	0.42456	0.78	P	0.54174	0.744	T	0.62034	-0.6939	10	0.54805	T	0.06	.	16.8008	0.85614	0.0:1.0:0.0:0.0	.	608	P02549	SPTA1_HUMAN	K	608	ENSP00000357130:E608K;ENSP00000357129:E608K	ENSP00000357129:E608K	E	-	1	0	SPTA1	156905833	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	6.760000	0.74939	2.618000	0.88619	0.655000	0.94253	GAA	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.403	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	146	0.68	1	C	NM_003126		158639209	158639209	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	115	42.21	84	SNP	1.000	T
ST14	6768	genome.wustl.edu	37	11	130068454	130068454	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr11:130068454G>T	ENST00000278742.5	+	14	2040	c.1622G>T	c.(1621-1623)aGc>aTc	p.S541I		NM_021978.3	NP_068813.1	Q9Y5Y6	ST14_HUMAN	suppression of tumorigenicity 14 (colon carcinoma)	541	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				keratinocyte differentiation (GO:0030216)|proteolysis (GO:0006508)	basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(3)|pancreas(2)|prostate(1)|skin(3)	32	all_hematologic(175;0.0429)	Lung NSC(97;0.000602)|Breast(109;0.000962)|all_lung(97;0.00126)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0183)|Lung(977;0.228)	Urokinase(DB00013)	CTCTCGAAAAGCCAGCAGTGC	0.657																																						dbGAP											0													56.0	59.0	58.0					11																	130068454		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF118224	CCDS8487.1	11q24-q25	2011-08-31	2005-11-19		ENSG00000149418	ENSG00000149418		"""Serine peptidases / Transmembrane"""	11344	protein-coding gene	gene with protein product	"""epithin"", ""matriptase"""	606797		PRSS14		9925927, 10373424	Standard	NM_021978		Approved	SNC19, HAI, MT-SP1, TMPRSS14	uc001qfw.3	Q9Y5Y6	OTTHUMG00000165768	ENST00000278742.5:c.1622G>T	11.37:g.130068454G>T	ENSP00000278742:p.Ser541Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BS01|Q9H3S0|Q9HB36|Q9HCA3	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_LDrepeatLR_classA_rpt,pfam_CUB,pfam_SEA,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,pirsf_Peptidase_S1A_matripase,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S541I	ENST00000278742.5	37	c.1622	CCDS8487.1	11	.	.	.	.	.	.	.	.	.	.	G	12.53	1.965417	0.34659	.	.	ENSG00000149418	ENST00000278742;ENST00000525779	T	0.42900	0.96	4.73	0.398	0.16319	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.491701	0.17106	N	0.186797	T	0.42154	0.1190	M	0.70787	2.145	0.09310	N	1	P	0.49307	0.922	P	0.50136	0.632	T	0.29088	-1.0023	10	0.36615	T	0.2	.	1.482	0.02439	0.2778:0.2598:0.3414:0.1209	.	541	Q9Y5Y6	ST14_HUMAN	I	541;443	ENSP00000278742:S541I	ENSP00000278742:S541I	S	+	2	0	ST14	129573664	0.001000	0.12720	0.440000	0.26846	0.233000	0.25261	0.341000	0.19909	-0.223000	0.09943	0.462000	0.41574	AGC	ST14	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pirsf_Peptidase_S1A_matripase,pfscan_LDrepeatLR_classA_rpt	ENSG00000149418		0.657	ST14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST14	HGNC	protein_coding	OTTHUMT00000386119.1	33	0.00	0	G			130068454	130068454	+1	no_errors	ENST00000278742	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	0.194	T
SUZ12	23512	genome.wustl.edu	37	17	30325875	30325875	+	Silent	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr17:30325875G>A	ENST00000322652.5	+	16	2302	c.2073G>A	c.(2071-2073)ggG>ggA	p.G691G	SUZ12_ENST00000580398.1_Silent_p.G668G	NM_015355.2	NP_056170.2	Q15022	SUZ12_HUMAN	SUZ12 polycomb repressive complex 2 subunit	691					histone ubiquitination (GO:0016574)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|transcription, DNA-templated (GO:0006351)	ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|RNA binding (GO:0003723)|sequence-specific DNA binding (GO:0043565)		SSH2/SUZ12(2)|JAZF1/SUZ12(133)	breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(5)|skin(1)	21		Myeloproliferative disorder(56;0.0255)|all_hematologic(16;0.041)|Ovarian(249;0.182)|Breast(31;0.231)				TAGAAAAGGGGGAATCTGCTT	0.363			T	JAZF1	endometrial stromal tumours																																	dbGAP		Dom	yes		17	17q11.2	23512	suppressor of zeste 12 homolog (Drosophila)		M	0													35.0	37.0	36.0					17																	30325875		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			D63881	CCDS11270.1	17q21	2013-06-05	2013-06-05		ENSG00000178691	ENSG00000178691		"""Zinc fingers, C2H2-type"""	17101	protein-coding gene	gene with protein product		606245	"""suppressor of zeste 12 homolog (Drosophila)"""			8590280, 11371647, 18784248	Standard	NM_015355		Approved	JJAZ1, KIAA0160, CHET9	uc002hgs.2	Q15022	OTTHUMG00000132813	ENST00000322652.5:c.2073G>A	17.37:g.30325875G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BD9	Silent	SNP	pfam_Polycomb_protein_VEFS-Box	p.G691	ENST00000322652.5	37	c.2073	CCDS11270.1	17																																																																																			SUZ12	-	NULL	ENSG00000178691		0.363	SUZ12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUZ12	HGNC	protein_coding	OTTHUMT00000256260.2	17	0.00	0	G	NM_015355		30325875	30325875	+1	no_errors	ENST00000322652	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	1.000	A
TPCN1	53373	genome.wustl.edu	37	12	113715121	113715121	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr12:113715121G>A	ENST00000335509.6	+	12	1450	c.1136G>A	c.(1135-1137)cGc>cAc	p.R379H	TPCN1_ENST00000550785.1_Missense_Mutation_p.R451H|TPCN1_ENST00000541517.1_Missense_Mutation_p.R451H|TPCN1_ENST00000392569.4_Missense_Mutation_p.R311H	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	379					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						GCCAGGGAGCGCTATCTTACC	0.582																																						dbGAP											0													63.0	60.0	61.0					12																	113715121		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.1136G>A	12.37:g.113715121G>A	ENSP00000335300:p.Arg379His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.R451H	ENST00000335509.6	37	c.1352	CCDS31908.1	12	.	.	.	.	.	.	.	.	.	.	G	22.9	4.345910	0.82022	.	.	ENSG00000186815	ENST00000335509;ENST00000550785;ENST00000541517;ENST00000392569	D;D;D;D	0.97186	-4.17;-4.28;-4.28;-4.23	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.97151	0.9069	L	0.44542	1.39	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;0.999	D;D;P	0.75020	0.965;0.985;0.861	D	0.95290	0.8394	10	0.15499	T	0.54	-24.9386	16.8004	0.85612	0.0:0.0:1.0:0.0	.	379;451;379	A5PKY2;Q9ULQ1-3;Q9ULQ1	.;.;TPC1_HUMAN	H	379;451;451;311	ENSP00000335300:R379H;ENSP00000448083:R451H;ENSP00000438125:R451H;ENSP00000376350:R311H	ENSP00000335300:R379H	R	+	2	0	TPCN1	112199504	1.000000	0.71417	0.993000	0.49108	0.384000	0.30261	6.401000	0.73256	2.733000	0.93635	0.609000	0.83330	CGC	TPCN1	-	NULL	ENSG00000186815		0.582	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN1	HGNC	protein_coding	OTTHUMT00000405156.3	43	0.00	0	G	NM_017901		113715121	113715121	+1	no_errors	ENST00000541517	ensembl	human	known	69_37n	missense	74	14.94	13	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179611429	179611429	+	Intron	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr2:179611429C>A	ENST00000591111.1	-	46	10585				TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.R5233I|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342992.6_Intron			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTACCCACTCTTTCCATTTT	0.398																																						dbGAP											0													123.0	118.0	120.0					2																	179611429		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4781G>T	2.37:g.179611429C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R5233I	ENST00000591111.1	37	c.15698		2	.	.	.	.	.	.	.	.	.	.	C	15.37	2.814851	0.50527	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.67171	-0.25	5.95	5.95	0.96441	.	.	.	.	.	T	0.75803	0.3899	L	0.58101	1.795	0.80722	D	1	D	0.59767	0.986	D	0.72075	0.976	T	0.71227	-0.4655	9	0.25106	T	0.35	.	11.3086	0.49351	0.0:0.8913:0.0:0.1087	.	5233	Q8WZ42-6	.	I	5233;514	ENSP00000354117:R5233I	ENSP00000304714:R514I	R	-	2	0	TTN	179319674	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.787000	0.62432	2.825000	0.97269	0.655000	0.94253	AGA	TTN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	91	0.00	0	C	NM_133378		179611429	179611429	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	missense	73	16.09	14	SNP	1.000	A
TTYH2	94015	genome.wustl.edu	37	17	72233552	72233552	+	Silent	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr17:72233552G>A	ENST00000269346.4	+	4	608	c.534G>A	c.(532-534)gcG>gcA	p.A178A	TTYH2_ENST00000529107.1_Silent_p.A157A	NM_032646.5	NP_116035.5	Q9BSA4	TTYH2_HUMAN	tweety family member 2	178						chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)	p.A178A(1)		breast(2)|endometrium(1)|kidney(3)|large_intestine(8)|lung(14)|ovary(3)|pancreas(1)|stomach(3)|upper_aerodigestive_tract(1)	36						AGCAGATGGCGGGCAGCGTTG	0.582																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											81.0	74.0	76.0					17																	72233552		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32717.1, CCDS45770.1	17q25.1	2013-09-02	2013-09-02		ENSG00000141540	ENSG00000141540			13877	protein-coding gene	gene with protein product		608855	"""tweety (Drosophila) homolog 2"", ""tweety homolog 2 (Drosophila)"""			11597145	Standard	XM_005257824		Approved	C17orf29	uc002jkc.3	Q9BSA4	OTTHUMG00000166018	ENST00000269346.4:c.534G>A	17.37:g.72233552G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX97|Q3B7H8|Q3B7R9|Q6AWB4|Q8NBB7|Q96PK1	Silent	SNP	pfam_Tweety	p.A178	ENST00000269346.4	37	c.534	CCDS32717.1	17																																																																																			TTYH2	-	pfam_Tweety	ENSG00000141540		0.582	TTYH2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TTYH2	HGNC	protein_coding	OTTHUMT00000387459.1	52	0.00	0	G			72233552	72233552	+1	no_errors	ENST00000269346	ensembl	human	known	69_37n	silent	63	17.11	13	SNP	0.000	A
USP20	10868	genome.wustl.edu	37	9	132637217	132637217	+	Silent	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr9:132637217C>A	ENST00000315480.4	+	19	2189	c.2031C>A	c.(2029-2031)ggC>ggA	p.G677G	USP20_ENST00000358355.1_Silent_p.G677G|USP20_ENST00000372429.3_Silent_p.G677G			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	677	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				ACGCCGAGGGCTACGTACTCT	0.607																																						dbGAP											0													59.0	61.0	60.0					9																	132637217		2099	4203	6302	-	-	-	SO:0001819	synonymous_variant	0			AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2031C>A	9.37:g.132637217C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Silent	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.G677	ENST00000315480.4	37	c.2031	CCDS43892.1	9																																																																																			USP20	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000136878		0.607	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	USP20	HGNC	protein_coding	OTTHUMT00000054604.2	43	0.00	0	C			132637217	132637217	+1	no_errors	ENST00000315480	ensembl	human	known	69_37n	silent	32	27.27	12	SNP	1.000	A
USP35	57558	genome.wustl.edu	37	11	77921402	77921402	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr11:77921402G>A	ENST00000529308.1	+	10	2762	c.2501G>A	c.(2500-2502)cGc>cAc	p.R834H	USP35_ENST00000530535.1_3'UTR|USP35_ENST00000526425.1_Missense_Mutation_p.R565H|USP35_ENST00000530267.1_Missense_Mutation_p.R402H|USP35_ENST00000441408.2_Missense_Mutation_p.R420H	NM_020798.2	NP_065849.1	Q9P2H5	UBP35_HUMAN	ubiquitin specific peptidase 35	834	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)			endometrium(6)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(3)|urinary_tract(1)	23	all_cancers(14;3.77e-18)|all_epithelial(13;6.16e-21)|Breast(9;5.6e-16)|Ovarian(111;0.152)		OV - Ovarian serous cystadenocarcinoma(8;1.04e-25)			CTGCTGCTCCGCCTGCCACTG	0.622																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB037793	CCDS41693.1	11q13.4	2008-02-05	2005-08-08			ENSG00000118369		"""Ubiquitin-specific peptidases"""	20061	protein-coding gene	gene with protein product			"""ubiquitin specific protease 35"""			12838346	Standard	NM_020798		Approved	KIAA1372	uc021qny.1	Q9P2H5		ENST00000529308.1:c.2501G>A	11.37:g.77921402G>A	ENSP00000431876:p.Arg834His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.R834H	ENST00000529308.1	37	c.2501	CCDS41693.1	11	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458809	0.63401	.	.	ENSG00000118369	ENST00000530267;ENST00000529308;ENST00000441408;ENST00000526425	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	4.42	4.42	0.53409	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.122241	0.35970	N	0.002861	T	0.41719	0.1171	L	0.52126	1.63	0.28451	N	0.916345	D;D	0.89917	1.0;1.0	D;D	0.71870	0.963;0.975	T	0.30001	-0.9993	10	0.41790	T	0.15	-37.1956	5.235	0.15441	0.2543:0.0:0.7457:0.0	.	834;420	Q9P2H5;E7EWV7	UBP35_HUMAN;.	H	402;834;420;565	ENSP00000435468:R402H;ENSP00000431876:R834H;ENSP00000400825:R420H;ENSP00000434942:R565H	ENSP00000400825:R420H	R	+	2	0	USP35	77599050	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	3.385000	0.52485	2.292000	0.77174	0.491000	0.48974	CGC	USP35	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000118369		0.622	USP35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP35	HGNC	protein_coding	OTTHUMT00000390026.1	63	0.00	0	G	XM_290527		77921402	77921402	+1	no_errors	ENST00000529308	ensembl	human	known	69_37n	missense	59	24.00	24	SNP	0.997	A
ZSCAN5A	79149	genome.wustl.edu	37	19	56734013	56734013	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A2JS-01A-11D-A17W-09	TCGA-E9-A2JS-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca32f508-7c87-4747-b6d5-e27e3f28b211	d8eec44c-d3a2-4ba6-9fa7-a36a9fc338bd	g.chr19:56734013C>A	ENST00000587340.1	-	6	1381	c.686G>T	c.(685-687)aGg>aTg	p.R229M	ZSCAN5A_ENST00000592355.1_Missense_Mutation_p.R229M|ZSCAN5A_ENST00000254165.3_Missense_Mutation_p.R112M|ZSCAN5A_ENST00000587492.1_Missense_Mutation_p.R83M|ZSCAN5A_ENST00000391713.1_Missense_Mutation_p.R229M			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A	229					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						GTTCTCTTCCCTGTTTTCCTT	0.512																																						dbGAP											0													210.0	181.0	191.0					19																	56734013		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.686G>T	19.37:g.56734013C>A	ENSP00000467631:p.Arg229Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX98|Q49A73|Q53F04|Q8N7B3	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.R229M	ENST00000587340.1	37	c.686	CCDS12941.1	19	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918665	0.33908	.	.	ENSG00000131848	ENST00000391713;ENST00000254165	T;T	0.06687	3.27;3.27	2.27	-0.189	0.13260	.	.	.	.	.	T	0.13970	0.0338	M	0.69823	2.125	0.09310	N	1	P;P	0.52842	0.956;0.924	P;P	0.50231	0.635;0.635	T	0.13495	-1.0507	9	0.72032	D	0.01	.	4.4747	0.11729	0.2418:0.4771:0.2812:0.0	.	112;229	B4DX98;Q9BUG6	.;ZSA5A_HUMAN	M	229;112	ENSP00000375593:R229M;ENSP00000254165:R112M	ENSP00000254165:R112M	R	-	2	0	ZSCAN5A	61425825	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.500000	0.02283	0.041000	0.15688	0.561000	0.74099	AGG	ZSCAN5A	-	NULL	ENSG00000131848		0.512	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN5A	HGNC	protein_coding	OTTHUMT00000458110.1	233	0.00	0	C	NM_024303		56734013	56734013	-1	no_errors	ENST00000391713	ensembl	human	known	69_37n	missense	277	12.62	40	SNP	0.008	A
