#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM29	11086	genome.wustl.edu	37	4	175897897	175897899	+	In_Frame_Del	DEL	AGG	AGG	-			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	AGG	AGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr4:175897897_175897899delAGG	ENST00000359240.3	+	5	1891_1893	c.1221_1223delAGG	c.(1219-1224)gaagga>gaa	p.G408del	ADAM29_ENST00000404450.4_In_Frame_Del_p.G408del|ADAM29_ENST00000514159.1_In_Frame_Del_p.G408del|ADAM29_ENST00000445694.1_In_Frame_Del_p.G408del|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	408	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TTGTTGAAGAAGGAGAAGAGTGT	0.424																																					Ovarian(140;1727 1835 21805 25838 41440)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.1221_1223delAGG	4.37:g.175897897_175897899delAGG	ENSP00000352177:p.Gly408del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	In_Frame_Del	DEL	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.G408in_frame_del	ENST00000359240.3	37	c.1221_1223	CCDS3823.1	4																																																																																			ADAM29	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000168594		0.424	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		92	0.00	0	AGG			175897897	175897899	+1	no_errors	ENST00000359240	ensembl	human	known	69_37n	in_frame_del	36	16.28	7	DEL	0.000:0.000:0.000	-
ADAM33	80332	genome.wustl.edu	37	20	3649431	3649431	+	3'UTR	SNP	A	A	G	rs677044	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr20:3649431A>G	ENST00000356518.2	-	0	2862				ADAM33_ENST00000350009.2_3'UTR|ADAM33_ENST00000466620.1_5'UTR|ADAM33_ENST00000379861.4_3'UTR	NM_025220.2	NP_079496.1	Q9BZ11	ADA33_HUMAN	ADAM metallopeptidase domain 33						proteolysis (GO:0006508)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|skin(3)	29						GGAACTTCTAATGTGGCTCTG	0.577													A|||	1331	0.265775	0.3722	0.2147	5008	,	,		19016	0.249		0.2097	False		,,,				2504	0.2331					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AL117415, AB055891	CCDS13058.1, CCDS63219.1	20p13	2010-04-06	2005-08-18		ENSG00000149451	ENSG00000149451		"""ADAM metallopeptidase domain containing"""	15478	protein-coding gene	gene with protein product		607114	"""a disintegrin and metalloproteinase domain 33"", ""chromosome 20 open reading frame 153"""	C20orf153		11814695	Standard	XM_005260843		Approved	DKFZp434K0521, dJ964F7.1	uc002wit.3	Q9BZ11	OTTHUMG00000031758	ENST00000356518.2:c.*179T>C	20.37:g.3649431A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0A1K6|Q5JT75|Q5JT76|Q8N0W6	RNA	SNP	-	NULL	ENST00000356518.2	37	NULL	CCDS13058.1	20																																																																																			ADAM33	-	-	ENSG00000149451		0.577	ADAM33-001	KNOWN	basic|CCDS	protein_coding	ADAM33	HGNC	protein_coding	OTTHUMT00000077763.2	117	0.00	0	A	NM_025220		3649431	3649431	-1	no_errors	ENST00000466620	ensembl	human	known	69_37n	rna	29	12.12	4	SNP	0.001	G
ANKRD20A5P	440482	genome.wustl.edu	37	18	14187501	14187501	+	RNA	SNP	C	C	T	rs200251125		TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr18:14187501C>T	ENST00000581935.1	+	0	2089							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TCATGGAGTCCTTCTCTTGGG	0.303																																						dbGAP											0																																										-	-	-			0			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14187501C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G1B6	RNA	SNP	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481		0.303	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	HGNC	pseudogene	OTTHUMT00000442833.1	8	0.00	0	C			14187501	14187501	+1	no_errors	ENST00000581181	ensembl	human	known	69_37n	rna	6	40.00	4	SNP	0.064	T
AP3D1	8943	genome.wustl.edu	37	19	2120922	2120922	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr19:2120922delG	ENST00000345016.5	-	14	1651	c.1420delC	c.(1420-1422)cagfs	p.Q474fs	AP3D1_ENST00000355272.6_Frame_Shift_Del_p.Q474fs|AP3D1_ENST00000356926.4_Frame_Shift_Del_p.Q383fs|AP3D1_ENST00000350812.6_Frame_Shift_Del_p.Q305fs|AP3D1_ENST00000590683.1_5'Flank	NM_003938.6	NP_003929.4	O14617	AP3D1_HUMAN	adaptor-related protein complex 3, delta 1 subunit	474					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|endosome to melanosome transport (GO:0035646)|eye pigment biosynthetic process (GO:0006726)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein localization to membrane (GO:0072657)|protein localization to organelle (GO:0033365)|regulation of sequestering of zinc ion (GO:0061088)|synaptic vesicle membrane organization (GO:0048499)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane coat (GO:0030117)|terminal bouton (GO:0043195)	protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(23)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGTTCCGCTGGGTGCTGCTG	0.642																																						dbGAP											0													43.0	48.0	46.0					19																	2120922		2189	4279	6468	-	-	-	SO:0001589	frameshift_variant	0			U91930	CCDS42459.1, CCDS58638.1	19p13.3	2014-09-04			ENSG00000065000	ENSG00000065000			568	protein-coding gene	gene with protein product		607246				9151686, 9303295	Standard	NM_003938		Approved	ADTD	uc002lva.4	O14617	OTTHUMG00000180354	ENST00000345016.5:c.1420delC	19.37:g.2120922delG	ENSP00000344055:p.Gln474fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O00202|O75262|Q59HF5|Q96G11|Q9H3C6	Frame_Shift_Del	DEL	pfam_BLV_receptor,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	p.Q474fs	ENST00000345016.5	37	c.1420	CCDS42459.1	19																																																																																			AP3D1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_complex_dsu	ENSG00000065000		0.642	AP3D1-002	KNOWN	basic|CCDS	protein_coding	AP3D1	HGNC	protein_coding	OTTHUMT00000450912.1	60	0.00	0	G			2120922	2120922	-1	no_errors	ENST00000355272	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	1.000	-
ARMC9	80210	genome.wustl.edu	37	2	232070952	232070952	+	Start_Codon_SNP	SNP	A	A	G			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr2:232070952A>G	ENST00000349938.4	+	2	195	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	ARMC9_ENST00000483477.1_3'UTR	NM_001271466.1|NM_025139.4	NP_001258395.1|NP_079415	Q7Z3E5	ARMC9_HUMAN	armadillo repeat containing 9	1						extracellular vesicular exosome (GO:0070062)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(5)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		Renal(207;0.0112)|all_lung(227;0.0744)|all_hematologic(139;0.0749)|Acute lymphoblastic leukemia(138;0.167)|Medulloblastoma(418;0.184)|Lung NSC(271;0.205)		Epithelial(121;1.43e-10)|LUSC - Lung squamous cell carcinoma(224;0.017)|Lung(119;0.0189)		ACAGTTCAATATGGGGGACAT	0.358																																						dbGAP											0													114.0	113.0	113.0					2																	232070952		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			BC004514	CCDS2484.1, CCDS74666.1	2q37.1	2013-02-14			ENSG00000135931	ENSG00000135931		"""Armadillo repeat containing"""	20730	protein-coding gene	gene with protein product						11347906	Standard	NM_025139		Approved	FLJ12584, KIAA1868, ARM, KU-MEL-1	uc031rrs.1	Q7Z3E5	OTTHUMG00000133229	ENST00000349938.4:c.1A>G	2.37:g.232070952A>G	ENSP00000258417:p.Met1Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TI3|Q6P162|Q7L594|Q86WG2|Q96JF9|Q9H9R8	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.M1V	ENST00000349938.4	37	c.1	CCDS2484.1	2	.	.	.	.	.	.	.	.	.	.	A	15.21	2.767165	0.49574	.	.	ENSG00000135931	ENST00000349938;ENST00000359743;ENST00000440107	T;T	0.48522	2.09;0.81	5.2	5.2	0.72013	.	0.041854	0.85682	D	0.000000	T	0.68742	0.3034	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	T	0.73646	-0.3917	9	0.87932	D	0	-29.4464	14.0669	0.64837	1.0:0.0:0.0:0.0	.	1	Q7Z3E5	ARMC9_HUMAN	V	1	ENSP00000258417:M1V;ENSP00000387391:M1V	ENSP00000258417:M1V	M	+	1	0	ARMC9	231779196	1.000000	0.71417	0.794000	0.32065	0.317000	0.28152	7.257000	0.78362	1.974000	0.57490	0.533000	0.62120	ATG	ARMC9	-	NULL	ENSG00000135931		0.358	ARMC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC9	HGNC	protein_coding	OTTHUMT00000256966.3	69	0.00	0	A	NM_025139	Missense_Mutation	232070952	232070952	+1	no_errors	ENST00000349938	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.992	G
ASXL1	171023	genome.wustl.edu	37	20	31023332	31023332	+	Silent	SNP	A	A	G			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr20:31023332A>G	ENST00000375687.4	+	13	3241	c.2817A>G	c.(2815-2817)gcA>gcG	p.A939A	ASXL1_ENST00000306058.5_Silent_p.A934A	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	939					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						CCCCTCCTGCATTGCCTGGGG	0.542			"""F, N, Mis"""		"""MDS, CMML"""																																	dbGAP		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0													57.0	53.0	55.0					20																	31023332		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.2817A>G	20.37:g.31023332A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	NULL	p.A939	ENST00000375687.4	37	c.2817	CCDS13201.1	20																																																																																			ASXL1	-	NULL	ENSG00000171456		0.542	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	51	0.00	0	A	NM_015338		31023332	31023332	+1	no_errors	ENST00000375687	ensembl	human	known	69_37n	silent	12	47.83	11	SNP	0.000	G
COLCA1	399948	genome.wustl.edu	37	11	111169268	111169268	+	5'UTR	SNP	T	T	A			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr11:111169268T>A	ENST00000532918.1	-	0	341				COLCA1_ENST00000526150.1_5'UTR|COLCA2_ENST00000398035.2_5'Flank|COLCA1_ENST00000540738.1_5'Flank|COLCA2_ENST00000526216.1_5'Flank|COLCA1_ENST00000355430.4_5'UTR			Q6ZS62	COLC1_HUMAN	colorectal cancer associated 1							integral component of membrane (GO:0016021)|membrane (GO:0016020)											TCCCTGCTGCTGCAGCATCCA	0.602																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK127703		11q23.1	2013-08-22	2013-08-22	2013-08-22	ENSG00000196167	ENSG00000196167			33789	other	unknown	"""cancer susceptibility candidate 12"""	615693	"""chromosome 11 open reading frame 92"""	C11orf92			Standard	NR_034154		Approved	FLJ45803, CASC12	uc001pld.3	Q6ZS62	OTTHUMG00000166658	ENST00000532918.1:c.-2065A>T	11.37:g.111169268T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000532918.1	37	NULL		11																																																																																			C11orf92	-	-	ENSG00000196167		0.602	COLCA1-001	KNOWN	basic|appris_principal	protein_coding	C11orf92	HGNC	protein_coding	OTTHUMT00000390999.1	91	0.00	0	T			111169268	111169268	-1	no_errors	ENST00000526150	ensembl	human	putative	69_37n	rna	28	30.00	12	SNP	1.000	A
C1orf87	127795	genome.wustl.edu	37	1	60474375	60474375	+	Intron	SNP	C	C	T	rs17119974	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:60474375C>T	ENST00000371201.3	-	9	1300				C1orf87_ENST00000450089.2_Intron|C1orf87_ENST00000486478.1_5'UTR|C1orf87_ENST00000395552.1_Silent_p.T13T	NM_152377.2	NP_689590.1	Q8N0U7	CA087_HUMAN	chromosome 1 open reading frame 87								calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|large_intestine(6)|lung(19)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33						GCCCTAGCCACGTGTGAAACC	0.458													C|||	631	0.125998	0.0862	0.2017	5008	,	,		22069	0.1389		0.1541	False		,,,				2504	0.0838				NSCLC(75;811 1386 4923 13371 51772)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK124828	CCDS614.1	1p32.1	2014-04-03			ENSG00000162598	ENSG00000162598			28547	protein-coding gene	gene with protein product	"""carcinoma-related EF-hand protein"""					12477932	Standard	NM_152377		Approved	MGC34837, CREF	uc001czs.2	Q8N0U7	OTTHUMG00000008992	ENST00000371201.3:c.1192+1688G>A	1.37:g.60474375C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU07|Q8IVS0	Silent	SNP	NULL	p.T13	ENST00000371201.3	37	c.39	CCDS614.1	1																																																																																			C1orf87	-	NULL	ENSG00000162598		0.458	C1orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf87	HGNC	protein_coding	OTTHUMT00000024943.1	59	0.00	0	C	NM_152377		60474375	60474375	-1	no_errors	ENST00000395552	ensembl	human	known	69_37n	silent	20	13.04	3	SNP	0.000	T
TXNDC9	10190	genome.wustl.edu	37	2	99939031	99939031	+	Intron	SNP	A	A	G	rs17022564	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr2:99939031A>G	ENST00000264255.3	-	4	564				TXNDC9_ENST00000434323.1_3'UTR|TXNDC9_ENST00000409434.1_Intron|C2orf15_ENST00000465095.1_3'UTR	NM_005783.3	NP_005774.2	O14530	TXND9_HUMAN	thioredoxin domain containing 9						cell redox homeostasis (GO:0045454)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)				lung(1)	1						TACAAGAATCAGAAGTGCACA	0.388													A|||	2043	0.407947	0.4554	0.6239	5008	,	,		15374	0.3115		0.4294	False		,,,				2504	0.2679					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC005968	CCDS2044.1	2q11.2	2008-02-05			ENSG00000115514	ENSG00000115514			24110	protein-coding gene	gene with protein product		612564				12477932	Standard	NM_005783		Approved	APACD	uc002szz.3	O14530	OTTHUMG00000130641	ENST00000264255.3:c.309-359T>C	2.37:g.99939031A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9G8|D3DVI4|Q53HG4|Q53RV8|Q6NSF5|Q8TB70|Q9BRU6	RNA	SNP	-	NULL	ENST00000264255.3	37	NULL	CCDS2044.1	2																																																																																			C2orf15	-	-	ENSG00000241962		0.388	TXNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf15	HGNC	protein_coding	OTTHUMT00000253129.1	47	0.00	0	A	NM_005783		99939031	99939031	+1	no_errors	ENST00000465095	ensembl	human	known	69_37n	rna	20	13.04	3	SNP	0.000	G
CACNA1F	778	genome.wustl.edu	37	X	49071881	49071881	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chrX:49071881A>T	ENST00000376265.2	-	28	3453	c.3392T>A	c.(3391-3393)aTc>aAc	p.I1131N	CACNA1F_ENST00000376251.1_Missense_Mutation_p.I1066N|CACNA1F_ENST00000323022.5_Missense_Mutation_p.I1120N	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1131	Dihydropyridine binding. {ECO:0000250}.				axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GCCCACGAAGATGTTCATCAT	0.502																																						dbGAP											0													156.0	111.0	127.0					X																	49071881		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.3392T>A	X.37:g.49071881A>T	ENSP00000365441:p.Ile1131Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.I1131N	ENST00000376265.2	37	c.3392	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	.	22.3	4.266764	0.80358	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.98567	-5.0;-5.0;-5.0	5.3	5.3	0.74995	Ion transport (1);	0.167537	0.49916	D	0.000137	D	0.99318	0.9761	H	0.97265	3.97	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.98630	1.0671	10	0.87932	D	0	.	13.1764	0.59629	1.0:0.0:0.0:0.0	.	1120;1131	F5CIQ9;O60840	.;CAC1F_HUMAN	N	1066;1120;1131	ENSP00000365427:I1066N;ENSP00000321618:I1120N;ENSP00000365441:I1131N	ENSP00000321618:I1120N	I	-	2	0	CACNA1F	48958825	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.266000	0.95659	1.752000	0.51891	0.486000	0.48141	ATC	CACNA1F	-	pfam_Ion_trans_dom	ENSG00000102001		0.502	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	100	0.00	0	A	NM_005183		49071881	49071881	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	1.000	T
CAMK2B	816	genome.wustl.edu	37	7	44284564	44284564	+	Intron	SNP	A	A	G	rs2075069	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr7:44284564A>G	ENST00000395749.2	-	7	491				CAMK2B_ENST00000502837.2_Intron|CAMK2B_ENST00000395747.2_Intron|CAMK2B_ENST00000440254.2_Intron|CAMK2B_ENST00000346990.4_Intron|CAMK2B_ENST00000350811.3_Intron|CAMK2B_ENST00000353625.4_Intron|CAMK2B_ENST00000347193.4_Intron|CAMK2B_ENST00000258682.6_Intron|CAMK2B_ENST00000457475.1_Intron|CAMK2B_ENST00000358707.3_Intron	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta						activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						GCCACTGGACATGGTGATTTT	0.622													.|||	1933	0.385982	0.2481	0.3718	5008	,	,		18814	0.3938		0.4702	False		,,,				2504	0.4877					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.415-1438T>C	7.37:g.44284564A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.H155	ENST00000395749.2	37	c.465	CCDS5483.1	7																																																																																			CAMK2B	-	smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000058404		0.622	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	CAMK2B	HGNC	protein_coding	OTTHUMT00000251138.2	72	0.00	0	A	NM_172084		44284564	44284564	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000421607	ensembl	human	novel	69_37n	silent	32	11.11	4	SNP	0.000	G
PSG9	5678	genome.wustl.edu	37	19	43724248	43724248	+	Intron	SNP	C	C	G	rs7247829	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr19:43724248C>G	ENST00000418820.2	-	5	1063				CEACAMP10_ENST00000489959.1_RNA			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				GAGATAAAGACCTCTTGTCCT	0.463													G|||	2986	0.596246	0.6218	0.4035	5008	,	,		14971	0.8859		0.328	False		,,,				2504	0.6759					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000418820.2:c.965-7621G>C	19.37:g.43724248C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	RNA	SNP	-	NULL	ENST00000418820.2	37	NULL		19																																																																																			CEACAMP10	-	-	ENSG00000241104		0.463	PSG9-011	PUTATIVE	basic	protein_coding	CEACAMP10	HGNC	protein_coding	OTTHUMT00000463916.1	58	0.00	0	C	NM_002784		43724248	43724248	-1	no_errors	ENST00000489959	ensembl	human	known	69_37n	rna	25	13.79	4	SNP	0.000	G
CNTNAP3	79937	genome.wustl.edu	37	9	39287976	39287976	+	Splice_Site	SNP	C	C	T	rs1810212		TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr9:39287976C>T	ENST00000297668.6	-	1	159		c.e1+1		CNTNAP3_ENST00000323947.7_Splice_Site|CNTNAP3_ENST00000377659.1_Splice_Site|CNTNAP3_ENST00000377656.2_Splice_Site	NM_033655.3	NP_387504.2	Q9BZ76	CNTP3_HUMAN	contactin associated protein-like 3						cell adhesion (GO:0007155)|cell recognition (GO:0008037)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(2)	24				GBM - Glioblastoma multiforme(29;0.02)|Lung(182;0.0681)		GCTGTACTTACGTGGATTTCC	0.473																																						dbGAP											0													3.0	2.0	2.0					9																	39287976		1084	1357	2441	-	-	-	SO:0001630	splice_region_variant	0			AF333769	CCDS6616.1	9q12	2008-02-05			ENSG00000106714	ENSG00000106714			13834	protein-coding gene	gene with protein product	"""cell recognition molecule CASPR3 (FLJ14195, KIAA1714)"""	610517				12093160	Standard	NM_033655		Approved	CASPR3, KIAA1714, FLJ14195, CNTNAP3A	uc004abi.3	Q9BZ76	OTTHUMG00000019954	ENST00000297668.6:c.85+1G>A	9.37:g.39287976C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMA0|Q9C0E9	Splice_Site	SNP	-	e1+1	ENST00000297668.6	37	c.85+1	CCDS6616.1	9	.	.	.	.	.	.	.	.	.	.	c	6.627	0.484094	0.12581	.	.	ENSG00000106714	ENST00000297668;ENST00000377656;ENST00000323947;ENST00000377659	.	.	.	2.56	2.56	0.30785	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.9999999999998991	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8036	0.40779	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CNTNAP3	39277976	1.000000	0.71417	0.068000	0.19968	0.309000	0.27889	3.085000	0.50151	1.259000	0.44117	0.313000	0.20887	.	CNTNAP3	-	-	ENSG00000106714		0.473	CNTNAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3	HGNC	protein_coding	OTTHUMT00000052511.1	80	0.00	0	C	NM_033655	Intron	39287976	39287976	-1	no_errors	ENST00000297668	ensembl	human	known	69_37n	splice_site	25	13.79	4	SNP	0.729	T
CR1L	1379	genome.wustl.edu	37	1	207884105	207884105	+	Intron	SNP	C	C	A	rs10779386|rs71585861	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:207884105C>A	ENST00000508064.2	+	10	1474				CR1L_ENST00000530905.1_3'UTR	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like							cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CAAATGGGAGCCGGAGCTACC	0.522													c|||	3646	0.728035	0.7526	0.5807	5008	,	,		18999	0.9246		0.5835	False		,,,				2504	0.7454					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1414+2497C>A	1.37:g.207884105C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MC9|Q8NEU7	RNA	SNP	-	NULL	ENST00000508064.2	37	NULL	CCDS44310.1	1																																																																																			CR1L	-	-	ENSG00000197721		0.522	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1L	HGNC	protein_coding	OTTHUMT00000390247.1	112	0.88	1	C	XM_114735		207884105	207884105	+1	no_errors	ENST00000530905	ensembl	human	known	69_37n	rna	45	18.18	10	SNP	0.051	A
CROCC	9696	genome.wustl.edu	37	1	17264939	17264939	+	Silent	SNP	T	T	C	rs4558023	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:17264939T>C	ENST00000375541.5	+	11	1404	c.1335T>C	c.(1333-1335)gaT>gaC	p.D445D	CROCC_ENST00000467938.1_3'UTR	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin									p.D445D(1)		breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		AGACAGAGGATGGAGAGGGGC	0.632																																						dbGAP											1	Substitution - coding silent(1)	prostate(1)											19.0	16.0	17.0					1																	17264939		2178	4273	6451	-	-	-	SO:0001819	synonymous_variant	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.1335T>C	1.37:g.17264939T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.D445	ENST00000375541.5	37	c.1335	CCDS30616.1	1																																																																																			CROCC	-	NULL	ENSG00000058453		0.632	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	150	0.66	1	T	NM_014675		17264939	17264939	+1	no_errors	ENST00000375541	ensembl	human	known	69_37n	silent	82	10.87	10	SNP	0.001	C
CR1L	1379	genome.wustl.edu	37	1	207884107	207884107	+	Intron	SNP	G	G	A	rs10779387|rs71585861	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:207884107G>A	ENST00000508064.2	+	10	1474				CR1L_ENST00000530905.1_3'UTR	NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like							cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						AATGGGAGCCGGAGCTACCAA	0.527													g|||	3646	0.728035	0.7526	0.5807	5008	,	,		19070	0.9246		0.5835	False		,,,				2504	0.7454					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1414+2499G>A	1.37:g.207884107G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MC9|Q8NEU7	RNA	SNP	-	NULL	ENST00000508064.2	37	NULL	CCDS44310.1	1																																																																																			CR1L	-	-	ENSG00000197721		0.527	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1L	HGNC	protein_coding	OTTHUMT00000390247.1	109	0.91	1	G	XM_114735		207884107	207884107	+1	no_errors	ENST00000530905	ensembl	human	known	69_37n	rna	44	16.98	9	SNP	0.000	A
CXADRP3	440224	genome.wustl.edu	37	18	14478229	14478229	+	lincRNA	SNP	T	T	C	rs9956181	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr18:14478229T>C	ENST00000581457.1	-	0	1679					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		CCCATTCGACTTAGATTAGGG	0.478													T|||	1611	0.321685	0.2201	0.3991	5008	,	,		16129	0.131		0.6183	False		,,,				2504	0.2955					dbGAP											0																																										-	-	-			0					18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14478229T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000581457.1	37	NULL		18																																																																																			CXADRP3	-	-	ENSG00000265766		0.478	CXADRP3-001	KNOWN	basic	lincRNA	CXADRP3	HGNC	lincRNA	OTTHUMT00000443008.1	74	0.00	0	T	NR_024076		14478229	14478229	-1	no_errors	ENST00000581457	ensembl	human	known	69_37n	rna	37	13.95	6	SNP	1.000	C
CXorf24	203414	genome.wustl.edu	37	X	47343254	47343254	+	Missense_Mutation	SNP	C	C	T	rs2071778	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chrX:47343254C>T	ENST00000357412.1	+	1	285	c.251C>T	c.(250-252)aCc>aTc	p.T84I	ZNF41_ENST00000377065.4_5'Flank|ZNF41_ENST00000313116.7_5'Flank|ZNF41_ENST00000397050.2_5'Flank					chromosome X open reading frame 24																		GGTCTTAACACCATTTTGCAT	0.428													C|||	938	0.248477	0.2171	0.1801	3775	,	,		15626	0.0675		0.2734	False		,,,				2504	0.1871					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC025179		Xp11.23	2010-06-02			ENSG00000196741	ENSG00000196741			27333	protein-coding gene	gene with protein product						12477932	Standard			Approved			Q8TB33	OTTHUMG00000021445	ENST00000357412.1:c.251C>T	X.37:g.47343254C>T	ENSP00000349989:p.Thr84Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.T84I	ENST00000357412.1	37	c.251		X	414	0.24954792043399637	72	0.16589861751152074	53	0.16878980891719744	19	0.034420289855072464	141	0.22523961661341854	C	2.787	-0.252204	0.05829	.	.	ENSG00000196741	ENST00000357412	.	.	.	2.07	1.18	0.20946	.	.	.	.	.	T	0.00039	0.0001	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.12837	-1.0532	4	0.87932	D	0	.	3.8882	0.09107	0.0:0.7704:0.0:0.2296	rs2071778;rs17261728;rs60999236;rs2071778	.	.	.	I	84	.	ENSP00000349989:T84I	T	+	2	0	CXorf24	47228198	0.001000	0.12720	0.002000	0.10522	0.002000	0.02628	0.250000	0.18235	0.325000	0.23359	0.422000	0.28245	ACC	CXorf24	-	NULL	ENSG00000196741		0.428	CXorf24-001	KNOWN	basic|appris_principal	protein_coding	CXorf24	HGNC	protein_coding	OTTHUMT00000056417.1	106	0.00	0	C			47343254	47343254	+1	no_errors	ENST00000357412	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.002	T
DDHD2	23259	genome.wustl.edu	37	8	38111111	38111111	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr8:38111111A>C	ENST00000397166.2	+	16	2454	c.1929A>C	c.(1927-1929)gaA>gaC	p.E643D	DDHD2_ENST00000517385.1_Missense_Mutation_p.E262D|DDHD2_ENST00000529845.1_Missense_Mutation_p.E94D|DDHD2_ENST00000520272.2_Missense_Mutation_p.E643D	NM_015214.2	NP_056029.2	O94830	DDHD2_HUMAN	DDHD domain containing 2	643	DDHD. {ECO:0000255|PROSITE- ProRule:PRU00378}.				cell death (GO:0008219)|lipid catabolic process (GO:0016042)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|microtubule organizing center (GO:0005815)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(4)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|skin(1)|urinary_tract(2)	28	Colorectal(12;0.000442)	all_lung(54;0.0657)|Lung NSC(58;0.175)	BRCA - Breast invasive adenocarcinoma(5;3.76e-25)|COAD - Colon adenocarcinoma(9;0.0977)			CAGTTAAAGAAGAAGTCCTGC	0.398																																						dbGAP											0													156.0	149.0	152.0					8																	38111111		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056525	CCDS34883.1	8p11.23	2014-03-03	2004-04-05	2004-04-07				"""Sterile alpha motif (SAM) domain containing"""	29106	protein-coding gene	gene with protein product		615003	"""SAM, WWE and DDHD domain containing 1"""	SAMWD1		9872452, 11788596, 19632984, 20932832	Standard	NM_015214		Approved	KIAA0725, SPG54	uc003xlc.3	O94830		ENST00000397166.2:c.1929A>C	8.37:g.38111111A>C	ENSP00000380352:p.Glu643Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWV2|B3KXB5|Q9H8X7	Missense_Mutation	SNP	pfam_DDHD,pfam_WWE-dom,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_DDHD,pfscan_WWE-dom	p.E643D	ENST00000397166.2	37	c.1929	CCDS34883.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	a|a	15.68|15.68	2.904876|2.904876	0.52333|0.52333	.|.	.|.	ENSG00000085788|ENSG00000085788	ENST00000397166;ENST00000520272;ENST00000517385;ENST00000529845;ENST00000528613|ENST00000526144	T;T|.	0.32515|.	1.45;1.45|.	5.35|5.35	-5.83|-5.83	0.02325|0.02325	DDHD (2);|.	0.357947|.	0.31404|.	N|.	0.007716|.	T|T	0.25865|0.25865	0.0630|0.0630	L|L	0.33668|0.33668	1.02|1.02	0.24214|0.24214	N|N	0.99546|0.99546	B|.	0.09022|.	0.002|.	B|.	0.15052|.	0.012|.	T|T	0.28267|0.28267	-1.0049|-1.0049	10|5	0.09843|.	T|.	0.71|.	-8.401|-8.401	4.1777|4.1777	0.10360|0.10360	0.4115:0.1041:0.3832:0.1012|0.4115:0.1041:0.3832:0.1012	.|.	643|.	O94830|.	DDHD2_HUMAN|.	D|T	643;643;262;94;11|145	ENSP00000380352:E643D;ENSP00000429932:E643D|.	ENSP00000380352:E643D|.	E|K	+|+	3|2	2|0	DDHD2|DDHD2	38230268|38230268	0.754000|0.754000	0.28360|0.28360	0.001000|0.001000	0.08648|0.08648	0.353000|0.353000	0.29299|0.29299	-0.032000|-0.032000	0.12266|0.12266	-1.270000|-1.270000	0.02433|0.02433	0.379000|0.379000	0.24179|0.24179	GAA|AAG	DDHD2	-	pfam_DDHD,pfscan_DDHD	ENSG00000085788		0.398	DDHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDHD2	HGNC	protein_coding	OTTHUMT00000377251.2	144	0.00	0	A	XM_291291		38111111	38111111	+1	no_errors	ENST00000397166	ensembl	human	known	69_37n	missense	47	25.40	16	SNP	0.465	C
DOK3	79930	genome.wustl.edu	37	5	176936654	176936654	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr5:176936654G>C	ENST00000357198.4	-	2	60	c.56C>G	c.(55-57)tCt>tGt	p.S19C	DOK3_ENST00000501403.2_5'UTR|DOK3_ENST00000377112.4_5'UTR|DOK3_ENST00000312943.6_Intron	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	19					Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			TCCGTCTAGAGACAGCTGCAG	0.652																																						dbGAP											0													27.0	31.0	29.0					5																	176936654		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.56C>G	5.37:g.176936654G>C	ENSP00000349727:p.Ser19Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.S19C	ENST00000357198.4	37	c.56	CCDS4426.1	5	.	.	.	.	.	.	.	.	.	.	G	8.474	0.858132	0.17178	.	.	ENSG00000146094	ENST00000357198	T	0.20881	2.04	4.2	3.33	0.38152	.	2.652290	0.02208	U	0.062888	T	0.14960	0.0361	N	0.14661	0.345	0.80722	D	1	P	0.50710	0.938	B	0.38803	0.282	T	0.08371	-1.0725	10	0.72032	D	0.01	-11.6168	8.5467	0.33426	0.1103:0.0:0.8897:0.0	.	19	Q7L591	DOK3_HUMAN	C	19	ENSP00000349727:S19C	ENSP00000349727:S19C	S	-	2	0	DOK3	176869260	0.863000	0.29885	0.999000	0.59377	0.203000	0.24098	0.658000	0.24979	0.904000	0.36572	-0.327000	0.08410	TCT	DOK3	-	NULL	ENSG00000146094		0.652	DOK3-001	KNOWN	basic|CCDS	protein_coding	DOK3	HGNC	protein_coding	OTTHUMT00000253420.4	78	0.00	0	G	NM_024872		176936654	176936654	-1	no_errors	ENST00000357198	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	0.996	C
EBLN2	55096	genome.wustl.edu	37	3	73111481	73111482	+	Frame_Shift_Ins	INS	-	-	A	rs3832186|rs201649088	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr3:73111481_73111482insA	ENST00000533473.1	+	1	672_673	c.249_250insA	c.(250-252)agafs	p.R84fs	PPP4R2_ENST00000356692.5_Intron|PPP4R2_ENST00000394284.3_Intron|PPP4R2_ENST00000295862.9_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	84										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						CTGGGAAAAACAGACAGTATCC	0.48													A|A|AA|insertion	1036	0.206869	0.1165	0.0908	5008	,	,		18256	0.3542		0.1203	False		,,,				2504	0.3487					dbGAP											0									,	400,3336		31,338,1499					,	0.5	0.0		dbSNP_107	34	874,7042		44,786,3128	no	intron,frameshift	EBLN2,PPP4R2	NM_174907.2,NM_018029.3	,	75,1124,4627	A1A1,A1R,RR		11.0409,10.7066,10.9337	,	,		1274,10378				-	-	-	SO:0001589	frameshift_variant	0				CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.250dupA	3.37:g.73111482_73111482dupA	ENSP00000432104:p.Arg84fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WWH3|Q9NW89	Frame_Shift_Ins	INS	pfam_P40_nucleoprot_BD-vir,superfamily_P40_nucleoprot_BD-vir	p.R83fs	ENST00000533473.1	37	c.249_250	CCDS54608.1	3																																																																																			EBLN2	-	pfam_P40_nucleoprot_BD-vir,superfamily_P40_nucleoprot_BD-vir	ENSG00000255423		0.480	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBLN2	HGNC	protein_coding	OTTHUMT00000386932.1	45	0.00	0	-	NM_018029		73111481	73111482	+1	no_errors	ENST00000533473	ensembl	human	known	69_37n	frame_shift_ins	23	11.54	3	INS	0.006:0.006	A
ECRP	643332	genome.wustl.edu	37	14	21388266	21388266	+	lincRNA	SNP	G	G	C	rs3748340	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr14:21388266G>C	ENST00000555642.1	-	0	344				RP11-219E7.4_ENST00000553534.1_lincRNA|RP11-84C10.2_ENST00000258817.2_lincRNA																							AGTTCACCTGGATACCATCAT	0.498													-|||	2792	0.557508	0.261	0.7882	5008	,	,		19374	0.5119		0.7068	False		,,,				2504	0.6881					dbGAP											0																																										-	-	-			0																															14.37:g.21388266G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000555642.1	37	NULL		14																																																																																			RP11-84C10.2	-	-	ENSG00000136315		0.498	RP11-84C10.3-001	KNOWN	basic	lincRNA	ECRP	Clone_based_vega_gene	lincRNA	OTTHUMT00000411340.1	118	0.00	0	G			21388266	21388266	+1	no_errors	ENST00000258817	ensembl	human	known	69_37n	rna	50	13.79	8	SNP	0.867	C
EIF1	10209	genome.wustl.edu	37	17	39847716	39847716	+	3'UTR	SNP	A	A	G			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr17:39847716A>G	ENST00000469257.1	+	0	1126				EIF1_ENST00000310837.4_3'UTR|JUP_ENST00000540235.1_Intron			P41567	EIF1_HUMAN	eukaryotic translation initiation factor 1						dosage compensation by inactivation of X chromosome (GO:0009048)|regulation of translational initiation (GO:0006446)|response to stress (GO:0006950)	cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(2)|skin(1)	5		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TTGACAAGGGAACAAATCTCA	0.433																																					Pancreas(176;1692 2837 16734 17588)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF083441	CCDS11403.1	17q21.2	2006-02-02			ENSG00000173812	ENSG00000173812			3249	protein-coding gene	gene with protein product						7904817, 10347211	Standard	NM_005801		Approved	EIF-1, ISO1, A121, SUI1, EIF1A	uc002hxj.3	P41567	OTTHUMG00000133492	ENST00000469257.1:c.*638A>G	17.37:g.39847716A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UNQ9	RNA	SNP	-	NULL	ENST00000469257.1	37	NULL	CCDS11403.1	17																																																																																			EIF1	-	-	ENSG00000173812		0.433	EIF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1	HGNC	protein_coding	OTTHUMT00000257390.1	53	0.00	0	A	NM_005801		39847716	39847716	+1	no_errors	ENST00000310837	ensembl	human	known	69_37n	rna	15	28.57	6	SNP	1.000	G
ELF1	1997	genome.wustl.edu	37	13	41515071	41515071	+	Silent	SNP	G	G	C			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr13:41515071G>C	ENST00000239882.3	-	8	1556	c.1242C>G	c.(1240-1242)tcC>tcG	p.S414S	ELF1_ENST00000442101.1_Silent_p.S390S|ELF1_ENST00000498824.1_5'UTR	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	414					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		TACTCTGAACGGAAGAATTTA	0.418																																						dbGAP											0													97.0	91.0	93.0					13																	41515071		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.1242C>G	13.37:g.41515071G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Silent	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.S414	ENST00000239882.3	37	c.1242	CCDS9374.1	13																																																																																			ELF1	-	NULL	ENSG00000120690		0.418	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF1	HGNC	protein_coding	OTTHUMT00000044654.3	149	0.00	0	G	NM_172373		41515071	41515071	-1	no_errors	ENST00000239882	ensembl	human	known	69_37n	silent	47	37.33	28	SNP	0.000	C
SPATA31A6	389730	genome.wustl.edu	37	9	43626820	43626820	+	Missense_Mutation	SNP	G	G	C	rs138779714	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr9:43626820G>C	ENST00000332857.6	-	4	1895	c.1867C>G	c.(1867-1869)Cgg>Ggg	p.R623G	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	623					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											GATTCGTCCCGAAGCTGCATC	0.542													G|||	1620	0.323482	0.0764	0.5303	5008	,	,		10590	0.2411		0.4334	False		,,,				2504	0.4826					dbGAP											0													2.0	2.0	2.0					9																	43626820		38	330	368	-	-	-	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1867C>G	9.37:g.43626820G>C	ENSP00000329825:p.Arg623Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R623G	ENST00000332857.6	37	c.1867	CCDS47973.1	9	524	0.23992673992673993	19	0.03861788617886179	149	0.4116022099447514	95	0.1660839160839161	261	0.34432717678100266	G	6.183	0.401995	0.11696	.	.	ENSG00000185775	ENST00000332857	T	0.06687	3.27	2.97	2.06	0.26882	.	0.721119	0.12036	N	0.505462	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.08055	0.003	T	0.45629	-0.9248	9	0.52906	T	0.07	-2.4748	6.1646	0.20384	0.1491:0.0:0.8509:0.0	.	623	Q5VVP1	F75A6_HUMAN	G	623	ENSP00000329825:R623G	ENSP00000329825:R623G	R	-	1	2	FAM75A6	43566816	0.028000	0.19301	0.001000	0.08648	0.001000	0.01503	0.853000	0.27777	0.610000	0.30035	-0.559000	0.04183	CGG	FAM75A6	-	NULL	ENSG00000185775		0.542	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	HGNC	protein_coding	OTTHUMT00000036987.1	33	0.00	0	G	NM_001145196		43626820	43626820	-1	no_errors	ENST00000332857	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	0.003	C
FOXK2	3607	genome.wustl.edu	37	17	80545148	80545148	+	Splice_Site	DEL	G	G	-			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr17:80545148delG	ENST00000335255.5	+	8	1960	c.1786delG	c.(1786-1788)gcc>cc	p.A598fs	RP13-638C3.3_ENST00000575085.1_RNA	NM_004514.3	NP_004505.2	Q01167	FOXK2_HUMAN	forkhead box K2	598					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|urinary_tract(1)	17	Breast(20;0.00106)|all_neural(118;0.0952)		OV - Ovarian serous cystadenocarcinoma(97;0.0371)|BRCA - Breast invasive adenocarcinoma(99;0.0415)			GGTGAACAATGGTAAGACATG	0.537																																						dbGAP											0													70.0	53.0	59.0					17																	80545148		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			U58196	CCDS11813.1	17q25	2006-12-15	2004-03-09	2004-03-10	ENSG00000141568	ENSG00000141568		"""Forkhead boxes"""	6036	protein-coding gene	gene with protein product		147685	"""interleukin enhancer binding factor 1"""	ILF, ILF1		3260003	Standard	NM_004514		Approved		uc002kfn.3	Q01167	OTTHUMG00000140374	ENST00000335255.5:c.1786+1G>-	17.37:g.80545148delG		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEP5|Q13622|Q13623|Q13624	Frame_Shift_Del	DEL	pfam_TF_fork_head,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,smart_TF_fork_head,prints_TF_fork_head,pfscan_FHA_dom,pfscan_TF_fork_head	p.A596fs	ENST00000335255.5	37	c.1786	CCDS11813.1	17																																																																																			FOXK2	-	NULL	ENSG00000141568		0.537	FOXK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXK2	HGNC	protein_coding	OTTHUMT00000277099.2	32	0.00	0	G	NM_181430	Frame_Shift_Del	80545148	80545148	+1	no_errors	ENST00000335255	ensembl	human	known	69_37n	frame_shift_del	9	18.18	2	DEL	0.980	-
GAST	2520	genome.wustl.edu	37	17	39871711	39871711	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr17:39871711T>C	ENST00000329402.3	+	2	90	c.23T>C	c.(22-24)gTg>gCg	p.V8A	RNA5SP442_ENST00000365050.1_RNA|JUP_ENST00000540235.1_Intron	NM_000805.4	NP_000796.1	P01350	GAST_HUMAN	gastrin	8					G-protein coupled receptor signaling pathway (GO:0007186)|signal transduction (GO:0007165)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7		Breast(137;0.000307)	BRCA - Breast invasive adenocarcinoma(4;0.0677)			TGTGTGTATGTGCTGATCTTT	0.597																																						dbGAP											0													274.0	270.0	271.0					17																	39871711		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11404.1	17q21.2	2013-02-26	2005-06-14	2005-06-14	ENSG00000184502	ENSG00000184502		"""Endogenous ligands"""	4164	protein-coding gene	gene with protein product	"""preprogastrin"""	137250		GAS			Standard	NM_000805		Approved		uc002hxl.3	P01350	OTTHUMG00000133496	ENST00000329402.3:c.23T>C	17.37:g.39871711T>C	ENSP00000331358:p.Val8Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	P78463|P78464	Missense_Mutation	SNP	pfam_Gastrin,smart_Gastrin	p.V8A	ENST00000329402.3	37	c.23	CCDS11404.1	17	.	.	.	.	.	.	.	.	.	.	T	7.413	0.635168	0.14322	.	.	ENSG00000184502	ENST00000329402	T	0.29655	1.56	4.41	-4.9	0.03094	Gastrin/cholecystokinin peptide hormone (1);	1.513610	0.03922	N	0.283756	T	0.32882	0.0844	M	0.67953	2.075	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.31308	-0.9948	10	0.33940	T	0.23	-0.1986	13.0563	0.58982	0.0:0.6478:0.0:0.3522	.	8	P01350	GAST_HUMAN	A	8	ENSP00000331358:V8A	ENSP00000331358:V8A	V	+	2	0	GAST	37125237	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-2.762000	0.00785	-1.504000	0.01810	-2.033000	0.00422	GTG	GAST	-	pfam_Gastrin	ENSG00000184502		0.597	GAST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAST	HGNC	protein_coding	OTTHUMT00000257409.1	75	0.00	0	T			39871711	39871711	+1	no_errors	ENST00000329402	ensembl	human	known	69_37n	missense	27	34.15	14	SNP	0.001	C
GKAP1	80318	genome.wustl.edu	37	9	86354511	86354511	+	3'UTR	SNP	G	G	C	rs4750	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr9:86354511G>C	ENST00000376371.2	-	0	1602				GKAP1_ENST00000376362.1_5'UTR|GKAP1_ENST00000376365.3_3'UTR	NM_025211.3	NP_079487.2	Q5VSY0	GKAP1_HUMAN	G kinase anchoring protein 1						signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)				endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|prostate(2)	14						GTTCCTTCAAGAAAAACTGCA	0.318													C|||	2673	0.533746	0.3729	0.6945	5008	,	,		15606	0.5992		0.5875	False		,,,				2504	0.5143					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC014476	CCDS35049.1, CCDS47988.1	9q22.1	2008-02-05			ENSG00000165113	ENSG00000165113			17496	protein-coding gene	gene with protein product	"""cGMP-dependent protein kinase anchoring protein 42kDa"""	611356					Standard	NM_025211		Approved	GKAP42, FKSG21	uc004amy.3	Q5VSY0	OTTHUMG00000020106	ENST00000376371.2:c.*101C>G	9.37:g.86354511G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96LI0|Q9BYI1|Q9BYI2|Q9H225	RNA	SNP	-	NULL	ENST00000376371.2	37	NULL	CCDS35049.1	9																																																																																			GKAP1	-	-	ENSG00000165113		0.318	GKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GKAP1	HGNC	protein_coding	OTTHUMT00000052839.2	86	0.00	0	G	NM_025211		86354511	86354511	-1	no_errors	ENST00000376362	ensembl	human	known	69_37n	rna	27	12.90	4	SNP	1.000	C
GVINP1	387751	genome.wustl.edu	37	11	6738952	6738952	+	RNA	SNP	G	G	T	rs10769716	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr11:6738952G>T	ENST00000526769.3	-	0	4252					NR_003945.1		Q7Z2Y8	GVIN1_HUMAN	GTPase, very large interferon inducible pseudogene 1							cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTP binding (GO:0005525)										ATCAGGGAGTGACTATTAGGT	0.418													-|||	1304	0.260383	0.1309	0.4553	5008	,	,		20753	0.3562		0.2346	False		,,,				2504	0.2249					dbGAP											0																																										-	-	-			0			BX538318		11p15.4	2014-03-18	2010-09-28	2010-09-28	ENSG00000254838	ENSG00000254838			25813	pseudogene	pseudogene	"""very large inducible GTPase 1"""		"""GTPase, very large interferon inducible 1"", ""GTPase, very large interferon inducible 1, pseudogene"""	GVIN1, GVIN1P		12874213, 19369598	Standard	NR_003945		Approved	VLIG-1, FLJ13373, VLIG1	uc001meo.4	Q7Z2Y8	OTTHUMG00000165506		11.37:g.6738952G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFL2|Q9H8N5	RNA	SNP	-	NULL	ENST00000526769.3	37	NULL		11																																																																																			GVINP1	-	-	ENSG00000254838		0.418	GVINP1-002	KNOWN	basic|exp_conf	processed_transcript	GVINP1	HGNC	pseudogene	OTTHUMT00000386960.3	33	0.00	0	G	NR_003945		6738952	6738952	-1	no_errors	ENST00000526769	ensembl	human	known	69_37n	rna	20	16.67	4	SNP	0.000	T
HIP1	3092	genome.wustl.edu	37	7	75221831	75221831	+	Splice_Site	SNP	C	C	T			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr7:75221831C>T	ENST00000336926.6	-	3	212	c.186G>A	c.(184-186)acG>acA	p.T62T	HIP1_ENST00000434438.2_Splice_Site_p.T62T	NM_005338.5	NP_005329.3	O00291	HIP1_HUMAN	huntingtin interacting protein 1	62	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cell differentiation (GO:0030154)|clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|positive regulation of receptor-mediated endocytosis (GO:0048260)|regulation of apoptotic process (GO:0042981)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)	clathrin binding (GO:0030276)|phosphatidylinositol binding (GO:0035091)|structural constituent of cytoskeleton (GO:0005200)			breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51						CCAGTATGCACGGTGAGGGGG	0.602			T	PDGFRB	CMML																																	dbGAP		Dom	yes		7	7q11.23	3092	huntingtin interacting protein 1		L	0													64.0	51.0	55.0					7																	75221831		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF052288	CCDS34669.1, CCDS59060.1	7q11.23	2008-07-18			ENSG00000127946	ENSG00000127946			4913	protein-coding gene	gene with protein product		601767				9140394, 9147654	Standard	NM_005338		Approved	ILWEQ	uc003uds.2	O00291	OTTHUMG00000156050	ENST00000336926.6:c.185-1G>A	7.37:g.75221831C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3I7|E7ES17|O00328|Q2TB58|Q8TDL4	Silent	SNP	pfam_ANTH,pfam_ILWEQ,pfam_Epsin_dom_N,superfamily_ENTH_VHS,superfamily_ARM-type_fold,superfamily_Prefoldin,smart_Epsin-like_N,smart_ILWEQ,pfscan_Epsin-like_N,pfscan_ILWEQ	p.T62	ENST00000336926.6	37	c.186	CCDS34669.1	7																																																																																			HIP1	-	pfam_ANTH,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	ENSG00000127946		0.602	HIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIP1	HGNC	protein_coding	OTTHUMT00000342863.2	40	0.00	0	C	NM_005338	Silent	75221831	75221831	-1	no_errors	ENST00000336926	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	0.048	T
IQCG	84223	genome.wustl.edu	37	3	197639381	197639381	+	Intron	SNP	A	A	G	rs9809736	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr3:197639381A>G	ENST00000265239.6	-	9	1388				IQCG_ENST00000455191.1_Intron	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G							extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TTACAGCTATATAAGATATCT	0.299													A|||	1956	0.390575	0.7693	0.2176	5008	,	,		16998	0.2609		0.2336	False		,,,				2504	0.2965					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.963+164T>C	3.37:g.197639381A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BST2|Q9HAG8	RNA	SNP	-	NULL	ENST00000265239.6	37	NULL	CCDS3331.1	3																																																																																			IQCG	-	-	ENSG00000114473		0.299	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	33	0.00	0	A	NM_032263		197639381	197639381	-1	no_errors	ENST00000469822	ensembl	human	putative	69_37n	rna	16	27.27	6	SNP	0.104	G
ITGB6	3694	genome.wustl.edu	37	2	160958145	160958145	+	3'UTR	SNP	T	T	C	rs7586751	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr2:160958145T>C	ENST00000283249.2	-	0	2706					NM_001282353.1|NM_001282354.1|NM_001282388.1	NP_001269282.1|NP_001269283.1|NP_001269317.1	P18564	ITB6_HUMAN	integrin, beta 6						cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|inflammatory response (GO:0006954)|integrin-mediated signaling pathway (GO:0007229)|multicellular organismal development (GO:0007275)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	virus receptor activity (GO:0001618)			breast(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	23						CCTATTATTATCTTAAACCAA	0.318													T|||	353	0.0704872	0.025	0.0836	5008	,	,		18898	0.001		0.2366	False		,,,				2504	0.0235					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS2212.1, CCDS63040.1, CCDS74596.1, CCDS74597.1	2q24.2	2010-03-23			ENSG00000115221	ENSG00000115221		"""Integrins"""	6161	protein-coding gene	gene with protein product		147558				1729173, 8120056	Standard	NM_001282353		Approved		uc002ubh.2	P18564	OTTHUMG00000132026	ENST00000283249.2:c.*102A>G	2.37:g.160958145T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9W5|C9JA97|Q0VA95|Q16500|Q53RG5|Q53RR6	RNA	SNP	-	NULL	ENST00000283249.2	37	NULL	CCDS2212.1	2																																																																																			ITGB6	-	-	ENSG00000115221		0.318	ITGB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB6	HGNC	protein_coding	OTTHUMT00000255036.1	35	0.00	0	T	NM_000888		160958145	160958145	-1	no_errors	ENST00000475438	ensembl	human	known	69_37n	rna	13	18.75	3	SNP	0.998	C
KBTBD4	55709	genome.wustl.edu	37	11	47597215	47597215	+	Missense_Mutation	SNP	A	A	G	rs545835504		TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr11:47597215A>G	ENST00000526005.1	-	3	779	c.626T>C	c.(625-627)aTa>aCa	p.I209T	KBTBD4_ENST00000533290.1_Missense_Mutation_p.I234T|RNU5E-10P_ENST00000363506.1_RNA|KBTBD4_ENST00000395288.2_Missense_Mutation_p.I209T|KBTBD4_ENST00000430070.2_Missense_Mutation_p.I225T|NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000450908.1_5'Flank|KBTBD4_ENST00000525720.1_Missense_Mutation_p.I258T			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	209	BACK.									NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						CCAGGCTTCTATTGCCTCTGT	0.443													A|||	1	0.000199681	0.0	0.0	5008	,	,		16992	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													141.0	139.0	139.0					11																	47597215		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.626T>C	11.37:g.47597215A>G	ENSP00000433340:p.Ile209Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.I225T	ENST00000526005.1	37	c.674	CCDS7940.1	11	.	.	.	.	.	.	.	.	.	.	A	27.8	4.867020	0.91511	.	.	ENSG00000123444	ENST00000526005;ENST00000533290;ENST00000395288;ENST00000359900;ENST00000430070;ENST00000525720	T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51	5.52	5.52	0.82312	BTB/Kelch-associated (2);	0.000000	0.85682	D	0.000000	T	0.81800	0.4899	L	0.57536	1.79	0.80722	D	1	D;D;D	0.62365	0.989;0.968;0.991	D;D;D	0.76071	0.978;0.954;0.987	D	0.83663	0.0162	10	0.87932	D	0	-14.6083	15.9389	0.79739	1.0:0.0:0.0:0.0	.	225;209;234	Q9NVX7-2;Q9NVX7;B3KRH9	.;KBTB4_HUMAN;.	T	209;234;209;218;225;258	ENSP00000433340:I209T;ENSP00000436713:I234T;ENSP00000378703:I209T;ENSP00000415106:I225T;ENSP00000434477:I258T	ENSP00000352971:I218T	I	-	2	0	KBTBD4	47553791	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.807000	0.91935	2.232000	0.73038	0.528000	0.53228	ATA	KBTBD4	-	pfam_BACK,smart_BACK	ENSG00000123444		0.443	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	KBTBD4	HGNC	protein_coding	OTTHUMT00000391763.1	43	0.00	0	A	NM_016506		47597215	47597215	-1	no_errors	ENST00000430070	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	G
KPTN	11133	genome.wustl.edu	37	19	47979891	47979891	+	Silent	SNP	C	C	A			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr19:47979891C>A	ENST00000338134.3	-	11	1187	c.1080G>T	c.(1078-1080)cgG>cgT	p.R360R	KPTN_ENST00000536339.1_Silent_p.R120R	NM_007059.2	NP_008990.2	Q9Y664	KPTN_HUMAN	kaptin (actin binding protein)	360					actin filament organization (GO:0007015)|cellular component movement (GO:0006928)|sensory perception of sound (GO:0007605)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			breast(1)|lung(3)|ovary(2)|pancreas(2)	8		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000428)|all cancers(93;0.000631)|Epithelial(262;0.0153)|GBM - Glioblastoma multiforme(486;0.0694)		TGGAGAAGCTCCGCTGCCACA	0.642																																						dbGAP											0													17.0	20.0	19.0					19																	47979891		2020	4165	6185	-	-	-	SO:0001819	synonymous_variant	0			AF105369	CCDS42583.1	19q13.32	2014-08-13	2001-11-28		ENSG00000118162	ENSG00000118162			6404	protein-coding gene	gene with protein product		615620	"""kaptin (actin-binding protein)"""			10099934	Standard	XM_005258467		Approved	2E4	uc002pgy.3	Q9Y664	OTTHUMG00000183443	ENST00000338134.3:c.1080G>T	19.37:g.47979891C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN86|B4DQ76|Q96GT1	Silent	SNP	NULL	p.R360	ENST00000338134.3	37	c.1080	CCDS42583.1	19																																																																																			KPTN	-	NULL	ENSG00000118162		0.642	KPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPTN	HGNC	protein_coding	OTTHUMT00000466672.2	72	0.00	0	C			47979891	47979891	-1	no_errors	ENST00000338134	ensembl	human	known	69_37n	silent	17	29.17	7	SNP	0.934	A
KRT17P2	339241	genome.wustl.edu	37	17	18333915	18333915	+	RNA	SNP	C	C	T	rs148961204	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr17:18333915C>T	ENST00000326333.8	+	0	1148				KRT16P1_ENST00000581027.1_RNA					keratin 17 pseudogene 2																		CAGAGAACCGCTACTGCATGC	0.612													c|||	2322	0.463658	0.4766	0.4856	5008	,	,		21453	0.4107		0.4384	False		,,,				2504	0.5112					dbGAP											0																																										-	-	-			0					17p11.2	2013-06-25			ENSG00000186831	ENSG00000186831			6429	pseudogene	pseudogene						1281771	Standard	NG_002778		Approved				OTTHUMG00000059248		17.37:g.18333915C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000326333.8	37	NULL		17																																																																																			KRT17P2	-	-	ENSG00000186831		0.612	KRT17P2-002	KNOWN	basic	processed_transcript	KRT17P2	HGNC	pseudogene	OTTHUMT00000446573.1	77	0.00	0	C	NG_002778		18333915	18333915	+1	no_errors	ENST00000326333	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	1.000	T
JUP	3728	genome.wustl.edu	37	17	39785011	39785011	+	Intron	DEL	G	G	-			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr17:39785011delG	ENST00000540235.1	-	5	909				KRT42P_ENST00000438131.1_RNA			P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		ctaggataccggagatactca	0.468																																					Colon(16;42 520 6044 17852 28530)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000540235.1:c.910-5727C>-	17.37:g.39785011delG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	RNA	DEL	-	NULL	ENST00000540235.1	37	NULL		17																																																																																			KRT42P	-	-	ENSG00000214514		0.468	JUP-201	KNOWN	basic	protein_coding	KRT42P	HGNC	protein_coding		132	0.00	0	G			39785011	39785011	-1	no_errors	ENST00000438131	ensembl	human	known	69_37n	rna	47	26.87	18	DEL	0.000	-
LPHN2	23266	genome.wustl.edu	37	1	82432213	82432213	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:82432213G>A	ENST00000370728.1	+	15	2902	c.2257G>A	c.(2257-2259)Gtc>Atc	p.V753I	LPHN2_ENST00000370721.1_Missense_Mutation_p.V678I|LPHN2_ENST00000319517.6_Missense_Mutation_p.V740I|LPHN2_ENST00000370715.1_Missense_Mutation_p.V740I|LPHN2_ENST00000370723.1_Missense_Mutation_p.V740I|LPHN2_ENST00000370717.2_Missense_Mutation_p.V753I|LPHN2_ENST00000335786.5_Missense_Mutation_p.V753I|LPHN2_ENST00000370713.1_Missense_Mutation_p.V740I|LPHN2_ENST00000359929.3_Missense_Mutation_p.V740I|LPHN2_ENST00000370725.1_Missense_Mutation_p.V753I|LPHN2_ENST00000469377.2_Intron|LPHN2_ENST00000370727.1_Missense_Mutation_p.V753I|LPHN2_ENST00000370730.1_Missense_Mutation_p.V753I|LPHN2_ENST00000394879.1_Missense_Mutation_p.V740I|LPHN2_ENST00000271029.4_Missense_Mutation_p.V753I			O95490	LPHN2_HUMAN	latrophilin 2	753					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)|latrotoxin receptor activity (GO:0016524)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(18)|liver(2)|lung(37)|ovary(3)|pancreas(1)|prostate(3)|skin(22)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	119				all cancers(265;0.00142)|Epithelial(280;0.00829)|OV - Ovarian serous cystadenocarcinoma(397;0.077)|STAD - Stomach adenocarcinoma(256;0.248)		GAACTCTCACGTCATTTCAGT	0.413																																						dbGAP											0													173.0	164.0	167.0					1																	82432213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ131581	CCDS689.1, CCDS72811.1	1p31.1	2014-08-08	2003-03-17	2003-05-02	ENSG00000117114	ENSG00000117114		"""-"", ""GPCR / Class B : Orphans"""	18582	protein-coding gene	gene with protein product		607018	"""latrophilin 1"""	LPHH1		10760572	Standard	XR_248786		Approved	KIAA0786, LEC1	uc001diu.3	O95490	OTTHUMG00000009844	ENST00000370728.1:c.2257G>A	1.37:g.82432213G>A	ENSP00000359763:p.Val753Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A5XEI2|B1ALT8|B1ALT9|B1ALU0|B1ALU2|B1ALU4|B1ALU5|B1ALU6|O94882|Q5VX76|Q9UKY5|Q9UKY6	Missense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_Olfac-like,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_Lectin_gal-bd_dom,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_Olfac-like,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_latrophilin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Lectin_gal-bd_dom,pfscan_Olfac-like,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.V753I	ENST00000370728.1	37	c.2257		1	.	.	.	.	.	.	.	.	.	.	G	16.49	3.137456	0.56936	.	.	ENSG00000117114	ENST00000370721;ENST00000370728;ENST00000370730;ENST00000370727;ENST00000370725;ENST00000370723;ENST00000359929;ENST00000370715;ENST00000370713;ENST00000319517;ENST00000370717;ENST00000394879;ENST00000271029;ENST00000335786	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.13538	2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58;2.58	6.17	6.17	0.99709	.	0.059064	0.64402	D	0.000002	T	0.06735	0.0172	N	0.21194	0.64	0.54753	D	0.999983	B;B;B	0.30605	0.287;0.124;0.127	B;B;B	0.26416	0.069;0.016;0.022	T	0.19712	-1.0297	10	0.54805	T	0.06	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	740;740;740	O95490-3;O95490-4;O95490-2	.;.;.	I	678;753;753;753;753;740;740;740;740;740;753;740;753;753	ENSP00000359756:V678I;ENSP00000359763:V753I;ENSP00000359765:V753I;ENSP00000359762:V753I;ENSP00000359760:V753I;ENSP00000359758:V740I;ENSP00000353006:V740I;ENSP00000359750:V740I;ENSP00000359748:V740I;ENSP00000322270:V740I;ENSP00000359752:V753I;ENSP00000378344:V740I;ENSP00000271029:V753I;ENSP00000337306:V753I	ENSP00000271029:V753I	V	+	1	0	LPHN2	82204801	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.111000	0.71541	2.941000	0.99782	0.655000	0.94253	GTC	LPHN2	-	pfam_DUF3497	ENSG00000117114		0.413	LPHN2-007	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	LPHN2	HGNC	protein_coding	OTTHUMT00000027188.1	49	0.00	0	G	NM_012302		82432213	82432213	+1	no_errors	ENST00000370717	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	1.000	A
MAP4K1	11184	genome.wustl.edu	37	19	39104522	39104522	+	Nonsense_Mutation	SNP	G	G	C			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr19:39104522G>C	ENST00000591517.1	-	8	559	c.531C>G	c.(529-531)taC>taG	p.Y177*	MAP4K1_ENST00000586296.1_Nonsense_Mutation_p.Y177*|MAP4K1_ENST00000589130.1_Nonsense_Mutation_p.Y173*|MAP4K1_ENST00000396857.2_Nonsense_Mutation_p.Y177*|MAP4K1_ENST00000423454.2_5'UTR|MAP4K1_ENST00000589002.1_5'UTR	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	177	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCACTCACCAGTAGGGTGTCC	0.607																																						dbGAP											0													30.0	36.0	34.0					19																	39104522		1956	4154	6110	-	-	-	SO:0001587	stop_gained	0			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.531C>G	19.37:g.39104522G>C	ENSP00000465039:p.Tyr177*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Y177*	ENST00000591517.1	37	c.531	CCDS59385.1	19	.	.	.	.	.	.	.	.	.	.	G	38	6.663251	0.97743	.	.	ENSG00000104814	ENST00000396857;ENST00000221409	.	.	.	4.6	2.45	0.29901	.	0.161030	0.42420	D	0.000711	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.4491	0.38714	0.1728:0.0:0.8272:0.0	.	.	.	.	X	177	.	ENSP00000221409:Y177X	Y	-	3	2	MAP4K1	43796362	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	3.024000	0.49674	0.373000	0.24621	0.558000	0.71614	TAC	MAP4K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000104814		0.607	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	HGNC	protein_coding	OTTHUMT00000453390.1	55	0.00	0	G	NM_001042600		39104522	39104522	-1	no_errors	ENST00000591517	ensembl	human	known	69_37n	nonsense	9	30.77	4	SNP	1.000	C
MATN1	4146	genome.wustl.edu	37	1	31192304	31192304	+	Intron	SNP	G	G	T	rs1149040	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:31192304G>T	ENST00000373765.4	-	3	477				MATN1_ENST00000477320.1_5'Flank|MATN1-AS1_ENST00000414763.1_RNA|MATN1-AS1_ENST00000414532.2_RNA|MATN1-AS1_ENST00000454613.1_RNA	NM_002379.3	NP_002370.1	P21941	MATN1_HUMAN	matrilin 1, cartilage matrix protein						extracellular matrix organization (GO:0030198)|growth plate cartilage chondrocyte morphogenesis (GO:0003429)|protein complex assembly (GO:0006461)|regulation of bone mineralization (GO:0030500)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.00792)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)|Ovarian(437;0.0563)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		Colorectal(126;1.29e-05)|COAD - Colon adenocarcinoma(152;0.000726)|STAD - Stomach adenocarcinoma(196;0.0183)|READ - Rectum adenocarcinoma(331;0.0649)		TCCTTGTCCCGGTAAGACCGG	0.627											OREG0013305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	2889	0.576877	0.8169	0.6585	5008	,	,		17083	0.5169		0.4672	False		,,,				2504	0.3691					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M55675	CCDS336.1	1p35	2008-02-05			ENSG00000162510	ENSG00000162510			6907	protein-coding gene	gene with protein product		115437		CRTM, CMP		2246248, 9083061	Standard	NM_002379		Approved		uc001brz.3	P21941	OTTHUMG00000003705	ENST00000373765.4:c.442-500C>A	1.37:g.31192304G>T		Somatic	822	WXS	Illumina GAIIx	Phase_IV	B2R7E3|Q5TBB9	RNA	SNP	-	NULL	ENST00000373765.4	37	NULL	CCDS336.1	1																																																																																			MATN1-AS1	-	-	ENSG00000186056		0.627	MATN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MATN1-AS1	HGNC	protein_coding	OTTHUMT00000010458.1	125	0.79	1	G	NM_002379		31192304	31192304	+1	no_errors	ENST00000414532	ensembl	human	known	69_37n	rna	43	14.00	7	SNP	0.000	T
MDN1	23195	genome.wustl.edu	37	6	90385864	90385864	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr6:90385864G>A	ENST00000369393.3	-	77	12717	c.12602C>T	c.(12601-12603)gCa>gTa	p.A4201V	RP1-122O8.7_ENST00000438877.1_RNA|MDN1_ENST00000428876.1_Missense_Mutation_p.A4201V			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4201					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GGCATGCCGTGCAAGAGAGCG	0.448																																						dbGAP											0													117.0	103.0	108.0					6																	90385864		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.12602C>T	6.37:g.90385864G>A	ENSP00000358400:p.Ala4201Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.A4201V	ENST00000369393.3	37	c.12602	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	G	22.2	4.253434	0.80135	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.03635	3.86;3.86	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.12178	0.0296	M	0.80616	2.505	0.54753	D	0.999988	D	0.76494	0.999	D	0.64144	0.922	T	0.07233	-1.0783	10	0.28530	T	0.3	.	20.0666	0.97706	0.0:0.0:1.0:0.0	.	4201	Q9NU22	MDN1_HUMAN	V	4201	ENSP00000358400:A4201V;ENSP00000413970:A4201V	ENSP00000358400:A4201V	A	-	2	0	MDN1	90442585	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.666000	0.74446	2.826000	0.97356	0.561000	0.74099	GCA	MDN1	-	pirsf_Midasin	ENSG00000112159		0.448	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	36	0.00	0	G			90385864	90385864	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	A
MUC5B	727897	genome.wustl.edu	37	11	1271321	1271321	+	Missense_Mutation	SNP	C	C	G	rs2943517	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr11:1271321C>G	ENST00000529681.1	+	31	13269	c.13211C>G	c.(13210-13212)gCc>gGc	p.A4404G	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.A4407G	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4404	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.		A -> G (in dbSNP:rs2943517). {ECO:0000269|PubMed:9013550}.		cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACAACTGCAGCCACTGGCCCC	0.647													-|||	2263	0.451877	0.3071	0.5447	5008	,	,		17919	0.629		0.4195	False		,,,				2504	0.4325					dbGAP											0													51.0	64.0	60.0					11																	1271321		1918	4115	6033	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.13211C>G	11.37:g.1271321C>G	ENSP00000436812:p.Ala4404Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A4407G	ENST00000529681.1	37	c.13220	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	-	4.216	0.038984	0.08148	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844;ENST00000535652	T;T	0.17370	2.28;2.47	2.36	-0.666	0.11399	.	.	.	.	.	T	0.18215	0.0437	L	0.54323	1.7	0.80722	P	0.0	P;P	0.51933	0.86;0.949	B;P	0.46825	0.431;0.528	T	0.20605	-1.0270	8	0.87932	D	0	.	5.3307	0.15930	0.0:0.5875:0.0:0.4125	rs2943517	4877;4407	A7Y9J9;E9PBJ0	.;.	G	4404;4407;4348;4254;183	ENSP00000436812:A4404G;ENSP00000415793:A4407G	ENSP00000343037:A4348G	A	+	2	0	MUC5B	1227897	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.172000	0.09868	-0.552000	0.06167	-0.706000	0.03657	GCC	MUC5B	-	NULL	ENSG00000117983		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	130	0.00	0	C	XM_001126093		1271321	1271321	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	0.042	G
WBP2NL	164684	genome.wustl.edu	37	22	42428727	42428727	+	IGR	SNP	A	A	T	rs133349	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr22:42428727A>T	ENST00000543212.1	+	0	1001							Q6ICG8	WBP2L_HUMAN	WBP2 N-terminal like						egg activation (GO:0007343)|male pronucleus assembly (GO:0035039)|meiotic nuclear division (GO:0007126)	perinuclear theca (GO:0033011)	WW domain binding (GO:0050699)			breast(2)|large_intestine(3)|lung(5)|ovary(3)|prostate(1)	14						GGTGGGGCAGACAACCATGGA	0.443													A|||	2279	0.455072	0.0545	0.5173	5008	,	,		14210	0.8522		0.4771	False		,,,				2504	0.5204					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			BC022546	CCDS14029.1	22q13.2	2007-07-18			ENSG00000183066	ENSG00000183066			28389	protein-coding gene	gene with protein product	"""postacrosomal sheath WW domain-binding protein"""	610981				17289678	Standard	NM_152613		Approved	FLJ26145, MGC26816, PAWP	uc003bbt.3	Q6ICG8	OTTHUMG00000151270		22.37:g.42428727A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFF7|A8MSG5|B3KXX4|Q8TBF0|Q8TBF3	Missense_Mutation	SNP	superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_27	p.S211T	ENST00000543212.1	37	c.631		22	1065	0.4876373626373626	32	0.06504065040650407	190	0.5248618784530387	479	0.8374125874125874	364	0.48021108179419525	A	13.32	2.200828	0.38905	.	.	ENSG00000198951	ENST00000481068	.	.	.	1.98	1.98	0.26296	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.54753	P	2.0000000000020002E-5	.	.	.	.	.	.	T	0.20140	-1.0284	3	.	.	.	.	5.9708	0.19351	1.0:0.0:0.0:0.0	rs133349;rs133349	.	.	.	T	211	.	.	S	-	1	0	NAGA	40758673	0.000000	0.05858	0.016000	0.15963	0.938000	0.57974	-0.355000	0.07671	1.157000	0.42530	0.533000	0.62120	TCT	NAGA	-	NULL	ENSG00000198951		0.443	WBP2NL-201	KNOWN	basic	protein_coding	NAGA	HGNC	protein_coding		36	0.00	0	A	NM_152613		42428727	42428727	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000481068	ensembl	human	putative	69_37n	missense	14	22.22	4	SNP	0.033	T
NBPF12	149013	genome.wustl.edu	37	1	146420082	146420082	+	Missense_Mutation	SNP	T	T	G	rs150070080	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:146420082T>G	ENST00000442909.2	+	24	3671	c.2835T>G	c.(2833-2835)tgT>tgG	p.C945W	NBPF12_ENST00000309471.8_Missense_Mutation_p.C564W|NBPF12_ENST00000446760.2_Missense_Mutation_p.C612W|NBPF12_ENST00000446080.2_5'UTR			Q5TAG4	NBPFC_HUMAN	neuroblastoma breakpoint family, member 12	41						cytoplasm (GO:0005737)				ovary(2)	2						TGGATAGATGTTATTCAACTC	0.488													.|||	1503	0.30012	0.1059	0.2666	5008	,	,		14102	0.3919		0.2744	False		,,,				2504	0.5184					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BG154169	CCDS72881.1	1q21.1	2013-01-17	2011-06-28	2011-06-28	ENSG00000186275	ENSG00000268043		"""neuroblastoma breakpoint family"""	24297	protein-coding gene	gene with protein product		608607	"""KIAA1245"""	KIAA1245		11948409	Standard	NM_001278141		Approved	COAS1		Q5TAG4	OTTHUMG00000043708	ENST00000442909.2:c.2835T>G	1.37:g.146420082T>G	ENSP00000391116:p.Cys945Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O95877	Missense_Mutation	SNP	pfam_NBPF_dom	p.C612W	ENST00000442909.2	37	c.1836		1	422	0.19322344322344323	48	0.0975609756097561	68	0.1878453038674033	158	0.2762237762237762	148	0.19525065963060687	-	7.585	0.669490	0.14776	.	.	ENSG00000186275	ENST00000446760;ENST00000442909;ENST00000309471	T;T;T	0.09163	3.01;3.01;3.01	0.726	-1.04	0.10068	.	.	.	.	.	T	0.03827	0.0108	L	0.43923	1.385	0.80722	P	0.0	.	.	.	.	.	.	T	0.40156	-0.9578	6	0.54805	T	0.06	.	3.4103	0.07356	0.0:0.0:0.4326:0.5674	.	.	.	.	W	612;945;564	ENSP00000396525:C612W;ENSP00000391116:C945W;ENSP00000311131:C564W	ENSP00000311131:C564W	C	+	3	2	NBPF12	144750456	0.121000	0.22262	0.000000	0.03702	0.003000	0.03518	0.131000	0.15870	-0.311000	0.08754	0.316000	0.21350	TGT	NBPF12	-	pfam_NBPF_dom	ENSG00000186275		0.488	NBPF12-001	NOVEL	basic|appris_principal	protein_coding	NBPF12	HGNC	protein_coding	OTTHUMT00000102086.3	79	0.00	0	T	XM_003119146		146420082	146420082	+1	no_errors	ENST00000446760	ensembl	human	known	69_37n	missense	26	10.34	3	SNP	0.000	G
NCOA6	23054	genome.wustl.edu	37	20	33337587	33337587	+	Frame_Shift_Del	DEL	G	G	-			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr20:33337587delG	ENST00000374796.2	-	10	4981	c.2411delC	c.(2410-2412)cctfs	p.P804fs	NCOA6_ENST00000359003.2_Frame_Shift_Del_p.P804fs			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	804	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|NCOA6IP-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TGTAGTAGCAGGATCACCATG	0.542																																						dbGAP											0													91.0	76.0	81.0					20																	33337587		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.2411delC	20.37:g.33337587delG	ENSP00000363929:p.Pro804fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Frame_Shift_Del	DEL	NULL	p.P804fs	ENST00000374796.2	37	c.2411	CCDS13241.1	20																																																																																			NCOA6	-	NULL	ENSG00000198646		0.542	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	77	0.00	0	G	NM_014071		33337587	33337587	-1	no_errors	ENST00000359003	ensembl	human	known	69_37n	frame_shift_del	36	12.20	5	DEL	1.000	-
NCSTN	23385	genome.wustl.edu	37	1	160326465	160326465	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:160326465C>T	ENST00000294785.5	+	15	1840	c.1715C>T	c.(1714-1716)gCa>gTa	p.A572V	NCSTN_ENST00000368065.4_Missense_Mutation_p.A314V|NCSTN_ENST00000368063.1_Missense_Mutation_p.A552V|NCSTN_ENST00000535857.1_Missense_Mutation_p.A434V|NCSTN_ENST00000392212.4_Missense_Mutation_p.A552V	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	572					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TATGCCTTGGCAAATTTGACT	0.522																																						dbGAP											0													168.0	159.0	162.0					1																	160326465		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.1715C>T	1.37:g.160326465C>T	ENSP00000294785:p.Ala572Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T207|Q5T208|Q86VV5	Nonsense_Mutation	SNP	pfam_Nicastrin	p.Q249*	ENST00000294785.5	37	c.745	CCDS1203.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.304526|5.304526	0.95601|0.95601	.|.	.|.	ENSG00000162736|ENSG00000162736	ENST00000294785;ENST00000368063;ENST00000535857;ENST00000368067;ENST00000392212;ENST00000368065|ENST00000435149	T;T;T;T|.	0.78246|.	-1.16;-1.16;-0.18;-1.16|.	5.72|5.72	5.72|5.72	0.89469|0.89469	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.64638|.	0.2616|.	L|L	0.55990|0.55990	1.75|1.75	0.80722|0.80722	D|D	1|1	D;D;D|.	0.60575|.	0.988;0.982;0.983|.	P;P;P|.	0.58721|.	0.844;0.767;0.787|.	T|.	0.60682|.	-0.7215|.	10|.	0.42905|.	T|.	0.14|.	-12.5663|-12.5663	18.4423|18.4423	0.90671|0.90671	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	434;552;572|.	F6Y097;Q92542-2;Q92542|.	.;.;NICA_HUMAN|.	V|X	572;552;434;279;552;314|249	ENSP00000294785:A572V;ENSP00000357042:A552V;ENSP00000442605:A434V;ENSP00000376047:A552V|.	ENSP00000294785:A572V|.	A|Q	+|+	2|1	0|0	NCSTN|NCSTN	158593089|158593089	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	3.731000|3.731000	0.55013|0.55013	2.699000|2.699000	0.92147|0.92147	0.650000|0.650000	0.86243|0.86243	GCA|CAA	NCSTN	-	NULL	ENSG00000162736		0.522	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCSTN	HGNC	protein_coding	OTTHUMT00000080622.1	166	0.00	0	C	NM_015331		160326465	160326465	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000435149	ensembl	human	known	69_37n	nonsense	90	25.00	30	SNP	1.000	T
NFAT5	10725	genome.wustl.edu	37	16	69687152	69687152	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr16:69687152C>G	ENST00000354436.2	+	4	1090	c.772C>G	c.(772-774)Caa>Gaa	p.Q258E	NFAT5_ENST00000349945.1_Missense_Mutation_p.Q182E|NFAT5_ENST00000567239.1_Missense_Mutation_p.Q276E|NFAT5_ENST00000566899.1_Missense_Mutation_p.Q182E|NFAT5_ENST00000393742.2_Missense_Mutation_p.Q182E|NFAT5_ENST00000432919.1_Missense_Mutation_p.Q276E	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	258					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						ATTGGAAAACCAAAAAGGAAC	0.358																																						dbGAP											0													80.0	80.0	80.0					16																	69687152		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.772C>G	16.37:g.69687152C>G	ENSP00000346420:p.Gln258Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.Q276E	ENST00000354436.2	37	c.826	CCDS10881.1	16	.	.	.	.	.	.	.	.	.	.	C	12.47	1.947401	0.34377	.	.	ENSG00000102908	ENST00000432919;ENST00000426654;ENST00000349945;ENST00000354436;ENST00000393742	T;T;T;T	0.41758	1.0;0.99;1.0;0.99	4.99	4.99	0.66335	.	0.226765	0.45361	D	0.000367	T	0.23846	0.0577	N	0.14661	0.345	0.34213	D	0.674479	B;B;B;B	0.22851	0.003;0.003;0.076;0.002	B;B;B;B	0.21360	0.003;0.003;0.034;0.002	T	0.25467	-1.0131	10	0.11485	T	0.65	-1.3771	12.0586	0.53550	0.0:0.9201:0.0:0.0799	.	276;258;276;182	A2RRB4;O94916;E9PHR7;O94916-2	.;NFAT5_HUMAN;.;.	E	276;276;182;258;182	ENSP00000396538:Q276E;ENSP00000338806:Q182E;ENSP00000346420:Q258E;ENSP00000377343:Q182E	ENSP00000338806:Q182E	Q	+	1	0	NFAT5	68244653	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.825000	0.55730	2.473000	0.83533	0.460000	0.39030	CAA	NFAT5	-	NULL	ENSG00000102908		0.358	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2	54	0.00	0	C	NM_138714		69687152	69687152	+1	no_errors	ENST00000432919	ensembl	human	known	69_37n	missense	14	50.00	14	SNP	1.000	G
OR6C68	403284	genome.wustl.edu	37	12	55886699	55886699	+	Silent	SNP	T	T	C			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr12:55886699T>C	ENST00000548615.1	+	1	538	c.538T>C	c.(538-540)Ttg>Ctg	p.L180L	RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA|OR6C68_ENST00000379662.1_Silent_p.L185L|RP11-110A12.2_ENST00000555138.1_RNA	NM_001005519.2	NP_001005519.2	A6NDL8	O6C68_HUMAN	olfactory receptor, family 6, subfamily C, member 68	180						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15						CTGTGATGCATTGCCTATTCT	0.383																																						dbGAP											0													131.0	119.0	123.0					12																	55886699		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31826.1, CCDS31826.2	12q13.2	2013-09-23			ENSG00000205327	ENSG00000205327		"""GPCR / Class A : Olfactory receptors"""	31297	protein-coding gene	gene with protein product							Standard	NM_001005519		Approved		uc031qhq.1	A6NDL8	OTTHUMG00000169958	ENST00000548615.1:c.538T>C	12.37:g.55886699T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L185	ENST00000548615.1	37	c.553	CCDS31826.2	12																																																																																			OR6C68	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000205327		0.383	OR6C68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C68	HGNC	protein_coding	OTTHUMT00000406677.1	80	0.00	0	T			55886699	55886699	+1	no_errors	ENST00000379662	ensembl	human	known	69_37n	silent	30	26.83	11	SNP	0.000	C
PAQR3	152559	genome.wustl.edu	37	4	79838944	79838944	+	3'UTR	SNP	G	G	A	rs10518208	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr4:79838944G>A	ENST00000512733.1	-	0	3898				PAQR3_ENST00000295462.3_3'UTR|PAQR3_ENST00000515541.1_5'UTR	NM_001040202.1	NP_001035292.1	Q6TCH7	PAQR3_HUMAN	progestin and adipoQ receptor family member III						negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron projection development (GO:0010977)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|negative regulation of protein phosphorylation (GO:0001933)|protein localization to Golgi apparatus (GO:0034067)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	8						ACAGTTTTACGGAAGTCAATC	0.408													G|||	515	0.102835	0.0764	0.0447	5008	,	,		19226	0.2351		0.0398	False		,,,				2504	0.1084					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK055774	CCDS34020.1	4q21	2008-02-05				ENSG00000163291			30130	protein-coding gene	gene with protein product		614577				16044242	Standard	XM_006714104		Approved		uc003hlp.1	Q6TCH7		ENST00000512733.1:c.*2749C>T	4.37:g.79838944G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5B7|B3KP59|Q6PIQ1|Q86X05|Q8NCP9	RNA	SNP	-	NULL	ENST00000512733.1	37	NULL	CCDS34020.1	4																																																																																			PAQR3	-	-	ENSG00000163291		0.408	PAQR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAQR3	HGNC	protein_coding	OTTHUMT00000363442.1	22	0.00	0	G	NM_177453		79838944	79838944	-1	no_errors	ENST00000503343	ensembl	human	known	69_37n	rna	8	33.33	4	SNP	0.001	A
PDE10A	10846	genome.wustl.edu	37	6	165801900	165801900	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr6:165801900G>A	ENST00000366882.1	-	18	1823	c.1669C>T	c.(1669-1671)Cac>Tac	p.H557Y	PDE10A_ENST00000354448.4_Missense_Mutation_p.H557Y|PDE10A_ENST00000539869.2_Missense_Mutation_p.H567Y			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	557					blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	AAGCCCCTGTGGTCCAGGTCA	0.502																																					Esophageal Squamous(22;308 615 5753 12038 40624)	dbGAP											0													147.0	125.0	132.0					6																	165801900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1669C>T	6.37:g.165801900G>A	ENSP00000355847:p.His557Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.H567Y	ENST00000366882.1	37	c.1699		6	.	.	.	.	.	.	.	.	.	.	G	27.1	4.801740	0.90538	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	D;D	0.97870	-4.58;-4.58	5.89	5.89	0.94794	Metal-dependent phosphohydrolase, HD domain (1);-cyclic nucleotide phosphodiesterase, conserved site (1);5&apos (3);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (3);	0.000000	0.85682	D	0.000000	D	0.99004	0.9660	M	0.88241	2.94	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.97110	0.997;1.0	D	0.99589	1.0975	10	0.87932	D	0	.	20.2561	0.98419	0.0:0.0:1.0:0.0	.	567;557	Q9ULW9;Q9Y233	.;PDE10_HUMAN	Y	557;585;567;557;556	ENSP00000355847:H557Y;ENSP00000346435:H557Y	ENSP00000341187:H567Y	H	-	1	0	PDE10A	165721890	1.000000	0.71417	1.000000	0.80357	0.750000	0.42670	9.113000	0.94321	2.797000	0.96272	0.563000	0.77884	CAC	PDE10A	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	ENSG00000112541		0.502	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	70	0.00	0	G			165801900	165801900	-1	no_errors	ENST00000539869	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	1.000	A
PEX5L	51555	genome.wustl.edu	37	3	179597794	179597794	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr3:179597794C>A	ENST00000467460.1	-	5	758	c.428G>T	c.(427-429)gGa>gTa	p.G143V	PEX5L_ENST00000467440.2_Intron|PEX5L_ENST00000468741.1_5'UTR|PEX5L_ENST00000392649.3_Intron|PEX5L_ENST00000476138.1_Missense_Mutation_p.G100V|PEX5L_ENST00000485199.1_Missense_Mutation_p.G108V|PEX5L_ENST00000263962.8_Missense_Mutation_p.G141V|PEX5L_ENST00000472994.1_Missense_Mutation_p.G84V|PEX5L_ENST00000464614.1_Intron|PEX5L-AS1_ENST00000466064.1_RNA|PEX5L_ENST00000465751.1_Missense_Mutation_p.G119V	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	143					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			GAGGTCAGATCCATCGGCCTT	0.517																																						dbGAP											0													202.0	188.0	193.0					3																	179597794		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.428G>T	3.37:g.179597794C>A	ENSP00000419975:p.Gly143Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G143V	ENST00000467460.1	37	c.428	CCDS3236.1	3	.	.	.	.	.	.	.	.	.	.	C	11.47	1.648004	0.29336	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000476138;ENST00000472994;ENST00000465751;ENST00000469198;ENST00000463761	D;D;D;D;D;D	0.88124	-2.33;-2.34;-2.31;-2.31;-2.31;-2.31	5.62	4.74	0.60224	.	0.178491	0.49916	D	0.000137	T	0.72898	0.3518	N	0.14661	0.345	0.80722	D	1	B;B;P;P;P	0.37864	0.165;0.165;0.467;0.61;0.475	B;B;B;B;B	0.35353	0.069;0.069;0.201;0.201;0.099	T	0.72090	-0.4395	10	0.51188	T	0.08	-23.2155	4.7898	0.13243	0.1879:0.6412:0.0:0.1709	.	84;119;141;108;143	E7EUZ0;E9PH97;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;PEX5R_HUMAN	V	143;141;108;141;100;84;119;132;167	ENSP00000419975:G143V;ENSP00000263962:G141V;ENSP00000418440:G108V;ENSP00000420555:G100V;ENSP00000418054:G84V;ENSP00000419348:G119V	ENSP00000263962:G141V	G	-	2	0	PEX5L	181080488	0.984000	0.35163	0.991000	0.47740	0.460000	0.32559	2.106000	0.41835	1.496000	0.48567	-0.158000	0.13435	GGA	PEX5L	-	NULL	ENSG00000114757		0.517	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	HGNC	protein_coding	OTTHUMT00000348577.1	89	0.00	0	C	NM_016559		179597794	179597794	-1	no_errors	ENST00000467460	ensembl	human	known	69_37n	missense	33	37.74	20	SNP	0.997	A
PHF8	23133	genome.wustl.edu	37	X	54020225	54020225	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chrX:54020225T>C	ENST00000357988.5	-	13	1901	c.1543A>G	c.(1543-1545)Atg>Gtg	p.M515V	PHF8_ENST00000338154.6_Missense_Mutation_p.M479V|PHF8_ENST00000338946.6_Intron|PHF8_ENST00000322659.8_Missense_Mutation_p.M479V	NM_001184896.1	NP_001171825.1	Q9UPP1	PHF8_HUMAN	PHD finger protein 8	515					brain development (GO:0007420)|G1/S transition of mitotic cell cycle (GO:0000082)|histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of chromatin silencing at rDNA (GO:0061188)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	40						AGCCTGGACATGGACACTGAA	0.532													T|||	1	0.000264901	0.0	0.0	3775	,	,		15372	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													97.0	90.0	92.0					X																	54020225		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029034	CCDS14355.1, CCDS55418.1, CCDS55419.1, CCDS55420.1	Xp11.22	2013-01-28			ENSG00000172943	ENSG00000172943		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	20672	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1F"""	300560				10470851, 20023638, 20644565	Standard	NM_015107		Approved	ZNF422, KIAA1111, JHDM1F	uc004dsu.3	Q9UPP1	OTTHUMG00000021622	ENST00000357988.5:c.1543A>G	X.37:g.54020225T>C	ENSP00000350676:p.Met515Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMV4|B7Z911|Q5H9U5|Q5JPR9|Q5JPS0|Q5JPS2|Q5JPS3|Q5VUJ4|Q7Z6D4|Q9HAH2	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.M515V	ENST00000357988.5	37	c.1543	CCDS55420.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.948|3.948	-0.012898|-0.012898	0.07727|0.07727	.|.	.|.	ENSG00000172943|ENSG00000172943	ENST00000443302|ENST00000357988;ENST00000338154;ENST00000322659	.|T;T;T	.|0.21031	.|2.62;2.36;2.03	5.77|5.77	4.59|4.59	0.56863|0.56863	.|.	.|0.618453	.|0.18716	.|N	.|0.133151	T|T	0.10465|0.10465	0.0256|0.0256	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.06786	.|0.001;0.001;0.001	.|B;B;B	.|0.06405	.|0.002;0.001;0.002	T|T	0.15578|0.15578	-1.0432|-1.0432	5|10	.|0.27785	.|T	.|0.31	-3.1631|-3.1631	9.3665|9.3665	0.38228|0.38228	0.0:0.09:0.0:0.91|0.0:0.09:0.0:0.91	.|.	.|1;479;515	.|B3KMV4;Q9UPP1-2;Q9UPP1	.|.;.;PHF8_HUMAN	R|V	242|515;479;479	.|ENSP00000350676:M515V;ENSP00000338868:M479V;ENSP00000319473:M479V	.|ENSP00000319473:M479V	H|M	-|-	2|1	0|0	PHF8|PHF8	54036950|54036950	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	1.630000|1.630000	0.37081|0.37081	2.054000|2.054000	0.61138|0.61138	0.481000|0.481000	0.45027|0.45027	CAT|ATG	PHF8	-	NULL	ENSG00000172943		0.532	PHF8-001	KNOWN	basic|CCDS	protein_coding	PHF8	HGNC	protein_coding	OTTHUMT00000056784.2	130	0.00	0	T	NM_015107		54020225	54020225	-1	no_errors	ENST00000357988	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	1.000	C
PILRB	29990	genome.wustl.edu	37	7	99950006	99950006	+	5'UTR	SNP	C	C	T	rs13246354	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr7:99950006C>T	ENST00000452089.1	+	0	208				PILRB_ENST00000444073.1_5'Flank|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA|STAG3L5P_ENST00000493499.1_RNA|PILRB_ENST00000610247.1_5'UTR|PILRB_ENST00000448382.1_5'UTR			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCACAGGTGCCGGCCCTGCAG	0.647													c|||	514	0.102636	0.0053	0.0865	5008	,	,		16385	0.1617		0.162	False		,,,				2504	0.1237					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.-852C>T	7.37:g.99950006C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YF9|Q9HBS0	RNA	SNP	-	NULL	ENST00000452089.1	37	NULL	CCDS43622.1	7																																																																																			PILRB	-	-	ENSG00000121716		0.647	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PILRB	HGNC	protein_coding	OTTHUMT00000339923.2	87	0.00	0	C	NM_178238		99950006	99950006	+1	no_errors	ENST00000470714	ensembl	human	known	69_37n	rna	32	11.11	4	SNP	0.001	T
POP1	10940	genome.wustl.edu	37	8	99146855	99146855	+	Silent	SNP	C	C	T			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr8:99146855C>T	ENST00000401707.2	+	7	1060	c.979C>T	c.(979-981)Ctg>Ttg	p.L327L	POP1_ENST00000349693.3_Silent_p.L327L	NM_001145860.1|NM_001145861.1	NP_001139332.1|NP_001139333.1	Q99575	POP1_HUMAN	processing of precursor 1, ribonuclease P/MRP subunit (S. cerevisiae)	327					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA 5'-leader removal (GO:0001682)|tRNA catabolic process (GO:0016078)	extracellular space (GO:0005615)|nucleolar ribonuclease P complex (GO:0005655)|ribonuclease MRP complex (GO:0000172)	poly(A) RNA binding (GO:0044822)|ribonuclease MRP activity (GO:0000171)|ribonuclease P activity (GO:0004526)			autonomic_ganglia(1)|breast(3)|endometrium(4)|large_intestine(9)|lung(15)|ovary(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Breast(36;1.78e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.145)			GAGCAGGCAGCTGTGGATCTG	0.468																																						dbGAP											0													86.0	89.0	88.0					8																	99146855		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D31765	CCDS6277.1	8q22.2	2012-05-21			ENSG00000104356	ENSG00000104356			30129	protein-coding gene	gene with protein product	"""processing of precursors 1"""	602486				10199568, 8918471	Standard	NM_015029		Approved		uc011lgv.2	Q99575	OTTHUMG00000164635	ENST00000401707.2:c.979C>T	8.37:g.99146855C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5W9|Q15037	Silent	SNP	pfam_RNase_P/MRP_POP1,pfam_POPLD	p.L327	ENST00000401707.2	37	c.979	CCDS6277.1	8																																																																																			POP1	-	NULL	ENSG00000104356		0.468	POP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POP1	HGNC	protein_coding	OTTHUMT00000379470.1	99	0.00	0	C	NM_015029		99146855	99146855	+1	no_errors	ENST00000349693	ensembl	human	known	69_37n	silent	28	35.56	16	SNP	0.906	T
PPM1A	5494	genome.wustl.edu	37	14	60749615	60749615	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr14:60749615C>G	ENST00000395076.4	+	2	624	c.194C>G	c.(193-195)tCt>tGt	p.S65C	PPM1A_ENST00000325642.3_Missense_Mutation_p.S138C|PPM1A_ENST00000529574.1_Missense_Mutation_p.S65C|PPM1A_ENST00000325658.3_Missense_Mutation_p.S65C	NM_021003.4	NP_066283.1	P35813	PPM1A_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1A	65					cell cycle arrest (GO:0007050)|dephosphorylation (GO:0016311)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|N-terminal protein myristoylation (GO:0006499)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|protein dephosphorylation (GO:0006470)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|voltage-gated calcium channel complex (GO:0005891)	calmodulin-dependent protein phosphatase activity (GO:0033192)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)|R-SMAD binding (GO:0070412)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(1)|large_intestine(8)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.046)		CATGCTGGTTCTCAGGTTGCC	0.458																																						dbGAP											0													401.0	344.0	364.0					14																	60749615		2203	4300	6503	-	-	-	SO:0001583	missense	0			S87759	CCDS9744.1, CCDS9745.1, CCDS45120.1	14q23.1	2013-01-24	2010-03-05		ENSG00000100614	ENSG00000100614	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9275	protein-coding gene	gene with protein product	"""phosphatase 2C alpha"", ""protein phosphatase 2C, alpha isoform"""	606108	"""protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform"""			1311954	Standard	NM_177952		Approved	MGC9201, PP2Calpha, PP2CA	uc001xew.4	P35813	OTTHUMG00000140333	ENST00000395076.4:c.194C>G	14.37:g.60749615C>G	ENSP00000378514:p.Ser65Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BU11|J3KNM0|O75551	Missense_Mutation	SNP	pfam_PP2C-like,pfam_PP2C_C,superfamily_PP2C-like,superfamily_PP2C_C,smart_PP2C-like	p.S138C	ENST00000395076.4	37	c.413	CCDS9744.1	14	.	.	.	.	.	.	.	.	.	.	C	15.49	2.850432	0.51270	.	.	ENSG00000100614	ENST00000325642;ENST00000529574;ENST00000395076;ENST00000325658;ENST00000528241;ENST00000525399;ENST00000531937	T;T;T;T;T;T;T	0.10573	2.86;2.86;2.86;2.86;2.86;2.86;2.86	5.75	5.75	0.90469	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.19406	0.0466	M	0.78223	2.4	0.80722	D	1	B;B;B	0.32620	0.378;0.077;0.378	B;B;B	0.30029	0.11;0.058;0.11	T	0.01476	-1.1345	10	0.52906	T	0.07	-3.0486	19.9233	0.97095	0.0:1.0:0.0:0.0	.	65;65;65	P35813;P35813-2;B2R8E4	PPM1A_HUMAN;.;.	C	138;65;65;65;65;65;65	ENSP00000327255:S138C;ENSP00000432966:S65C;ENSP00000378514:S65C;ENSP00000314850:S65C;ENSP00000431453:S65C;ENSP00000435398:S65C;ENSP00000435575:S65C	ENSP00000327255:S138C	S	+	2	0	PPM1A	59819368	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.704000	0.92352	0.591000	0.81541	TCT	PPM1A	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000100614		0.458	PPM1A-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPM1A	HGNC	protein_coding	OTTHUMT00000276949.2	244	0.00	0	C	NM_021003		60749615	60749615	+1	no_errors	ENST00000325642	ensembl	human	known	69_37n	missense	105	23.91	33	SNP	1.000	G
PTPRJ	5795	genome.wustl.edu	37	11	48142578	48142578	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr11:48142578delA	ENST00000418331.2	+	4	728	c.376delA	c.(376-378)aaafs	p.K126fs	PTPRJ_ENST00000440289.2_Frame_Shift_Del_p.K126fs|PTPRJ_ENST00000526550.1_3'UTR	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	126	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GTTTGACATTAAAGCTGTTTC	0.338																																						dbGAP											0													64.0	58.0	60.0					11																	48142578		2201	4298	6499	-	-	-	SO:0001589	frameshift_variant	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.376delA	11.37:g.48142578delA	ENSP00000400010:p.Lys126fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Frame_Shift_Del	DEL	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A127fs	ENST00000418331.2	37	c.376	CCDS7945.1	11																																																																																			PTPRJ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000149177		0.338	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1	30	0.00	0	A			48142578	48142578	+1	no_errors	ENST00000418331	ensembl	human	known	69_37n	frame_shift_del	8	20.00	2	DEL	0.545	-
PYGO1	26108	genome.wustl.edu	37	15	55839191	55839191	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr15:55839191C>T	ENST00000302000.6	-	3	384	c.290G>A	c.(289-291)gGc>gAc	p.G97D	PYGO1_ENST00000563719.1_Missense_Mutation_p.G97D	NM_015617.1	NP_056432.1	Q9Y3Y4	PYGO1_HUMAN	pygopus family PHD finger 1	97	Pro-rich.				hematopoietic progenitor cell differentiation (GO:0002244)|kidney development (GO:0001822)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein localization to nucleus (GO:0034504)|spermatid nucleus differentiation (GO:0007289)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(6)|lung(6)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	27				all cancers(107;0.0131)|GBM - Glioblastoma multiforme(80;0.18)		GCCTCCAAAGCCAGGATAACC	0.458																																						dbGAP											0													112.0	101.0	105.0					15																	55839191		2193	4292	6485	-	-	-	SO:0001583	missense	0			AF457207	CCDS10155.1	15q21.1	2013-10-09	2013-10-09		ENSG00000171016	ENSG00000171016		"""Zinc fingers, PHD-type"""	30256	protein-coding gene	gene with protein product		606902	"""pygopus homolog 1 (Drosophila)"""			11988739	Standard	NM_015617		Approved		uc002adf.1	Q9Y3Y4	OTTHUMG00000132009	ENST00000302000.6:c.290G>A	15.37:g.55839191C>T	ENSP00000302327:p.Gly97Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A7Y2D6	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G97D	ENST00000302000.6	37	c.290	CCDS10155.1	15	.	.	.	.	.	.	.	.	.	.	C	15.87	2.959486	0.53400	.	.	ENSG00000171016	ENST00000302000;ENST00000401688	T	0.58060	0.36	5.23	4.29	0.51040	.	0.063920	0.64402	D	0.000006	T	0.43743	0.1261	N	0.14661	0.345	0.43642	D	0.996047	P;P	0.51240	0.761;0.943	P;P	0.49012	0.598;0.598	T	0.34725	-0.9817	10	0.30078	T	0.28	-3.8658	15.0345	0.71734	0.0:0.8572:0.1428:0.0	.	97;97	A7Y2D6;Q9Y3Y4	.;PYGO1_HUMAN	D	97	ENSP00000302327:G97D	ENSP00000302327:G97D	G	-	2	0	PYGO1	53626483	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.436000	0.44819	1.298000	0.44778	0.585000	0.79938	GGC	PYGO1	-	NULL	ENSG00000171016		0.458	PYGO1-001	KNOWN	basic|CCDS	protein_coding	PYGO1	HGNC	protein_coding	OTTHUMT00000254977.2	56	0.00	0	C	NM_015617		55839191	55839191	-1	no_errors	ENST00000302000	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.999	T
RBP3	5949	genome.wustl.edu	37	10	48382254	48382254	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr10:48382254C>A	ENST00000224600.4	-	4	3508	c.3395G>T	c.(3394-3396)cGc>cTc	p.R1132L		NM_002900.2	NP_002891.1	P10745	RET3_HUMAN	retinol binding protein 3, interstitial	1132	4 X approximate tandem repeats.				lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transport (GO:0006810)|visual perception (GO:0007601)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interphotoreceptor matrix (GO:0033165)|vesicle (GO:0031982)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(30)|ovary(1)|prostate(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59					Vitamin A(DB00162)	GGAGCCATAGCGTTCACCTGG	0.592																																						dbGAP											0													24.0	26.0	25.0					10																	48382254		2203	4300	6503	-	-	-	SO:0001583	missense	0			M22453	CCDS73119.1	10q11.2	2014-05-06	2001-11-28		ENSG00000107618	ENSG00000265203			9921	protein-coding gene	gene with protein product		180290	"""retinol-binding protein 3, interstitial"""				Standard	NM_002900		Approved	D10S64, D10S65, D10S66, RP66	uc001jez.3	P10745	OTTHUMG00000188321	ENST00000224600.4:c.3395G>T	10.37:g.48382254C>A	ENSP00000224600:p.Arg1132Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0QD34|Q5VSR0|Q8IXN0	Missense_Mutation	SNP	pfam_Interphotoreceptor_retinol-bd,pfam_Interphotorcpt_retinol-bd_N,smart_Interphotoreceptor_retinol-bd	p.R1132L	ENST00000224600.4	37	c.3395	CCDS7218.1	10	.	.	.	.	.	.	.	.	.	.	C	18.88	3.717435	0.68844	.	.	ENSG00000107618	ENST00000224600	T	0.64991	-0.13	5.69	5.69	0.88448	Interphotoreceptor retinol-binding (2);	0.166677	0.49916	D	0.000131	T	0.80253	0.4589	M	0.85299	2.745	0.49483	D	0.99979	D	0.76494	0.999	D	0.68943	0.961	T	0.83027	-0.0164	10	0.87932	D	0	-12.5098	14.4247	0.67207	0.0:0.8529:0.1471:0.0	.	1132	P10745	RET3_HUMAN	L	1132	ENSP00000224600:R1132L	ENSP00000224600:R1132L	R	-	2	0	RBP3	48002260	1.000000	0.71417	0.965000	0.40720	0.864000	0.49448	5.608000	0.67654	2.692000	0.91855	0.655000	0.94253	CGC	RBP3	-	pfam_Interphotoreceptor_retinol-bd,smart_Interphotoreceptor_retinol-bd	ENSG00000107618		0.592	RBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBP3	HGNC	protein_coding	OTTHUMT00000047888.1	41	0.00	0	C	NM_002900		48382254	48382254	-1	no_errors	ENST00000224600	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	1.000	A
REXO1	57455	genome.wustl.edu	37	19	1827021	1827023	+	In_Frame_Del	DEL	GGA	GGA	-	rs367705891		TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr19:1827021_1827023delGGA	ENST00000170168.4	-	2	1859_1861	c.1765_1767delTCC	c.(1765-1767)tccdel	p.S589del	CTB-31O20.4_ENST00000593201.1_RNA|REXO1_ENST00000587524.1_5'Flank|CTB-31O20.4_ENST00000587741.1_RNA	NM_020695.3	NP_065746.3	Q8N1G1	REXO1_HUMAN	REX1, RNA exonuclease 1 homolog (S. cerevisiae)	589	Ser-rich.					nucleus (GO:0005634)	exonuclease activity (GO:0004527)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	16		Ovarian(11;1.78e-06)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGCTggaggtggaggaggaggag	0.7																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB032964	CCDS32866.1	19p13.3	2014-05-28	2005-08-22	2005-08-22	ENSG00000079313	ENSG00000079313			24616	protein-coding gene	gene with protein product	"""elongin A binding protein 1"""	609614	"""transcription elongation factor B polypeptide 3 binding protein 1"""	TCEB3BP1		10574461	Standard	NM_020695		Approved	EloA-BP1, KIAA1138	uc002lua.4	Q8N1G1	OTTHUMG00000179991	ENST00000170168.4:c.1765_1767delTCC	19.37:g.1827030_1827032delGGA	ENSP00000170168:p.Ser589del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULT2	In_Frame_Del	DEL	pfam_Exonuclease_RNaseT/DNA_pol3,superfamily_RNaseH-like_dom,smart_Exonuclease	p.S589in_frame_del	ENST00000170168.4	37	c.1767_1765	CCDS32866.1	19																																																																																			REXO1	-	NULL	ENSG00000079313		0.700	REXO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REXO1	HGNC	protein_coding	OTTHUMT00000449200.1	25	0.00	0	GGA	NM_020695		1827021	1827023	-1	no_errors	ENST00000170168	ensembl	human	known	69_37n	in_frame_del	14	17.65	3	DEL	0.247:0.228:0.208	-
RYR2	6262	genome.wustl.edu	37	1	237993724	237993724	+	Intron	SNP	C	C	T	rs2275692	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:237993724C>T	ENST00000366574.2	+	103	14972				RYR2_ENST00000542537.1_Intron|RYR2_ENST00000360064.6_Intron	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)						BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGATCTTTGACGTGTATTGAG	0.413													c|||	422	0.0842652	0.0136	0.0951	5008	,	,		22567	0.0546		0.2237	False		,,,				2504	0.0593					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14656-106C>T	1.37:g.237993724C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	RNA	SNP	-	NULL	ENST00000366574.2	37	NULL	CCDS55691.1	1																																																																																			RYR2	-	-	ENSG00000198626		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	120	0.00	0	C	NM_001035		237993724	237993724	+1	no_errors	ENST00000462585	ensembl	human	known	69_37n	rna	59	14.49	10	SNP	0.000	T
SDR16C6P	442388	genome.wustl.edu	37	8	57294501	57294501	+	RNA	SNP	T	T	C	rs10216893	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr8:57294501T>C	ENST00000517787.1	-	0	407					NR_103832.1				short chain dehydrogenase/reductase family 16C, member 6, pseudogene																		CAAAGATTACTTTAAGAGTTA	0.328													T|||	1758	0.351038	0.2708	0.4784	5008	,	,		15100	0.373		0.325	False		,,,				2504	0.3732					dbGAP											0													91.0	79.0	83.0					8																	57294501		692	1591	2283	-	-	-			0					8q12.1	2011-09-20	2010-12-20	2010-12-20	ENSG00000253542	ENSG00000253542		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	35413	pseudogene	pseudogene			"""short chain dehydrogenase/reductase family 16C, member 6"""	SDR16C6		19027726	Standard	NR_103832		Approved				OTTHUMG00000164408		8.37:g.57294501T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000517787.1	37	NULL		8																																																																																			SDR16C6P	-	-	ENSG00000253542		0.328	SDR16C6P-001	KNOWN	basic	processed_transcript	SDR16C6P	HGNC	pseudogene	OTTHUMT00000378641.3	47	0.00	0	T			57294501	57294501	-1	no_errors	ENST00000517787	ensembl	human	known	69_37n	rna	33	13.16	5	SNP	0.000	C
SIRPB2	284759	genome.wustl.edu	37	20	1456906	1456906	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr20:1456906G>T	ENST00000359801.3	-	5	971	c.935C>A	c.(934-936)gCt>gAt	p.A312D	SIRPB2_ENST00000444444.2_Missense_Mutation_p.A214D|SIRPB2_ENST00000608747.1_5'Flank	NM_001122962.1	NP_001116434.1	Q9P1W8	SIRPG_HUMAN	signal-regulatory protein beta 2	346	Ig-like C1-type 2.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|negative regulation of cell proliferation (GO:0008285)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of T cell activation (GO:0050870)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						CCGAGAGGTAGCCAGGGCCAG	0.602																																						dbGAP											0													97.0	86.0	89.0					20																	1456906		1568	3582	5150	-	-	-	SO:0001583	missense	0			AL109658	CCDS42849.1, CCDS46570.1	20p13	2013-01-11	2006-02-03	2006-02-03	ENSG00000196209	ENSG00000196209		"""Signal-regulatory proteins"", ""Immunoglobulin superfamily / V-set domain containing"""	16247	protein-coding gene	gene with protein product			"""protein tyrosine phosphatase, non-receptor type 1-like"", ""protein tyrosine phosphatase, non-receptor type substrate 1-like 3"""	PTPN1L, PTPNS1L3		16339511	Standard	NM_001122962		Approved	dJ776F14.2	uc002wfg.2	Q5JXA9	OTTHUMG00000031670	ENST00000359801.3:c.935C>A	20.37:g.1456906G>T	ENSP00000352849:p.Ala312Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKP6|Q5D051|Q5JV25|Q5MKL4|Q8WWA5|Q9NQK8	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.A312D	ENST00000359801.3	37	c.935	CCDS42849.1	20	.	.	.	.	.	.	.	.	.	.	G	5.080	0.200486	0.09652	.	.	ENSG00000196209	ENST00000359801;ENST00000444444	T;T	0.02737	4.38;4.18	3.73	1.77	0.24775	.	4.301020	0.01970	U	0.044037	T	0.02455	0.0075	N	0.08118	0	0.19300	N	0.999974	P;D	0.54047	0.952;0.964	P;P	0.46585	0.521;0.521	T	0.43032	-0.9416	10	0.12766	T	0.61	-31.5637	5.7853	0.18331	0.3381:0.0:0.6619:0.0	.	214;312	E9PCW6;Q5JXA9	.;SIRB2_HUMAN	D	312;214	ENSP00000352849:A312D;ENSP00000402438:A214D	ENSP00000352849:A312D	A	-	2	0	SIRPB2	1404906	0.013000	0.17824	0.147000	0.22382	0.012000	0.07955	0.585000	0.23879	0.558000	0.29135	0.491000	0.48974	GCT	SIRPB2	-	NULL	ENSG00000196209		0.602	SIRPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRPB2	HGNC	protein_coding	OTTHUMT00000077544.1	52	0.00	0	G	NM_178459		1456906	1456906	-1	no_errors	ENST00000359801	ensembl	human	known	69_37n	missense	23	34.29	12	SNP	0.221	T
SLC6A10P	386757	genome.wustl.edu	37	16	32890616	32890616	+	RNA	SNP	G	G	C			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr16:32890616G>C	ENST00000330048.5	-	0	3182					NR_003083.2				solute carrier family 6 (neurotransmitter transporter), member 10, pseudogene																		GGTACACGTTGGTGTTTTTGT	0.612																																						dbGAP											0																																										-	-	-			0			U41163		16p11.2	2013-07-19	2013-07-19	2013-07-19	ENSG00000214617	ENSG00000214617		"""Solute carriers"""	11043	pseudogene	pseudogene	"""creatine transporter-2"""		"""solute carrier family 6 (neurotransmitter transporter, creatine), member 10"""	SLC6A10		9154116	Standard	NR_003083		Approved	CT-2	uc002edh.1		OTTHUMG00000132481		16.37:g.32890616G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000330048.5	37	NULL		16																																																																																			SLC6A10P	-	-	ENSG00000214617		0.612	SLC6A10P-002	KNOWN	basic	processed_transcript	SLC6A10P	HGNC	pseudogene	OTTHUMT00000432081.2	99	0.00	0	G			32890616	32890616	-1	no_errors	ENST00000330048	ensembl	human	known	69_37n	rna	27	20.59	7	SNP	1.000	C
SPINT3	10816	genome.wustl.edu	37	20	44141331	44141331	+	Missense_Mutation	SNP	A	A	G	rs6032259	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr20:44141331A>G	ENST00000217428.6	-	2	245	c.230T>C	c.(229-231)tTg>tCg	p.L77S		NM_006652.1	NP_006643.1	P49223	SPIT3_HUMAN	serine peptidase inhibitor, Kunitz type, 3	77	BPTI/Kunitz inhibitor. {ECO:0000255|PROSITE-ProRule:PRU00031}.		L -> S (in dbSNP:rs6032259).			extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)	1						TTCTTTCCTCAAAAAGTTGTT	0.443													G|||	2303	0.459864	0.5545	0.4481	5008	,	,		21673	0.3264		0.5109	False		,,,				2504	0.4254					dbGAP											0													105.0	91.0	95.0					20																	44141331		692	1591	2283	-	-	-	SO:0001583	missense	0			X77166	CCDS46608.1	20q12-q13.2	2012-08-20	2005-08-17		ENSG00000101446	ENSG00000101446			11248	protein-coding gene	gene with protein product		613941	"""serine protease inhibitor, Kunitz type, 3"""			21988899	Standard	NM_006652		Approved	HKIB9	uc010ghg.1	P49223	OTTHUMG00000032585	ENST00000217428.6:c.230T>C	20.37:g.44141331A>G	ENSP00000217428:p.Leu77Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCQ6|Q6UDR8|Q96KK2	Missense_Mutation	SNP	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.L77S	ENST00000217428.6	37	c.230	CCDS46608.1	20	967	0.44276556776556775	249	0.5060975609756098	168	0.46408839779005523	165	0.28846153846153844	385	0.5079155672823219	G	0.018	-1.474504	0.01044	.	.	ENSG00000101446	ENST00000217428	T	0.56444	0.46	3.25	-6.5	0.01884	Proteinase inhibitor I2, Kunitz metazoa (6);Proteinase inhibitor I2, Kunitz, conserved site (1);	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.15141	0.012	B	0.18263	0.021	T	0.29243	-1.0018	7	0.21014	T	0.42	.	1.4375	0.02346	0.2518:0.0918:0.2376:0.4187	rs6032259;rs7274991;rs52805157;rs59517836;rs6032259	77	P49223	SPIT3_HUMAN	S	77	ENSP00000217428:L77S	ENSP00000217428:L77S	L	-	2	0	SPINT3	43574745	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-1.126000	0.03254	-3.407000	0.00169	-1.690000	0.00728	TTG	SPINT3	-	pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	ENSG00000101446		0.443	SPINT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPINT3	HGNC	protein_coding	OTTHUMT00000079464.5	91	0.00	0	A	NM_006652		44141331	44141331	-1	no_errors	ENST00000217428	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.000	G
SSH2	85464	genome.wustl.edu	37	17	27993928	27993928	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr17:27993928C>T	ENST00000269033.3	-	10	1059	c.908G>A	c.(907-909)gGt>gAt	p.G303D	SSH2_ENST00000540801.1_Missense_Mutation_p.G330D|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	303					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ATCCATTTGACCAAGGATCAC	0.398																																						dbGAP											0													174.0	166.0	169.0					17																	27993928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.908G>A	17.37:g.27993928C>T	ENSP00000269033:p.Gly303Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.G303D	ENST00000269033.3	37	c.908	CCDS11253.1	17	.	.	.	.	.	.	.	.	.	.	C	34	5.293809	0.95546	.	.	ENSG00000141298	ENST00000269033;ENST00000540801;ENST00000394848	T;T	0.61274	0.12;0.12	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.79828	0.4513	M	0.82823	2.61	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.997;0.993;0.998	T	0.81024	-0.1120	10	0.66056	D	0.02	-12.3186	20.1432	0.98067	0.0:1.0:0.0:0.0	.	330;303;303	F5H527;Q76I76-4;Q76I76	.;.;SSH2_HUMAN	D	303;330;303	ENSP00000269033:G303D;ENSP00000444743:G330D	ENSP00000269033:G303D	G	-	2	0	SSH2	25018054	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.769000	0.95229	0.561000	0.74099	GGT	SSH2	-	NULL	ENSG00000141298		0.398	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	85	0.00	0	C	NM_033389		27993928	27993928	-1	no_errors	ENST00000269033	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	T
RP11-556N21.1	0	genome.wustl.edu	37	13	25144717	25144717	+	RNA	SNP	C	C	A	rs71218558|rs3742168	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr13:25144717C>A	ENST00000453498.1	+	0	258																											TTAACACAGCCCCTGCTGGTA	0.403													a|||	1419	0.283347	0.1566	0.3473	5008	,	,		15761	0.378		0.3151	False		,,,				2504	0.2791					dbGAP											0																																										-	-	-			0																															13.37:g.25144717C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000453498.1	37	NULL		13																																																																																			TPTE2P6	-	-	ENSG00000205822		0.403	RP11-556N21.1-001	KNOWN	basic|readthrough_transcript	processed_transcript	TPTE2P6	HGNC	processed_transcript	OTTHUMT00000044193.1	108	0.00	0	C			25144717	25144717	+1	no_errors	ENST00000453498	ensembl	human	known	69_37n	rna	32	13.51	5	SNP	0.958	A
TPTEP1	387590	genome.wustl.edu	37	22	17178601	17178601	+	IGR	SNP	G	G	A	rs8135902	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr22:17178601G>A								KB-7G2.8 (3063 upstream) : AC005301.8 (49157 downstream)																							GCTTCAGGGCGGTCGATCTTG	0.612													G|||	407	0.08127	0.0877	0.1081	5008	,	,		12395	0.0218		0.1511	False		,,,				2504	0.0429					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															22.37:g.17178601G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		22																																																																																			TPTEP1	-	-	ENSG00000100181	0	0.612					TPTEP1	HGNC			69	0.00	0	G			17178601	17178601	+1	no_errors	ENST00000558085	ensembl	human	known	69_37n	rna	35	12.50	5	SNP	0.543	A
TRAPPC3	27095	genome.wustl.edu	37	1	36614713	36614713	+	Intron	SNP	C	C	G	rs10752586	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:36614713C>G	ENST00000373166.3	-	1	133				TRAPPC3_ENST00000373163.1_Intron|TRAPPC3_ENST00000373159.1_Intron|TRAPPC3_ENST00000373162.1_5'UTR	NM_001270894.1|NM_014408.4	NP_001257823.1|NP_055223.1	O43617	TPPC3_HUMAN	trafficking protein particle complex 3						ER to Golgi vesicle-mediated transport (GO:0006888)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|TRAPP complex (GO:0030008)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(1)	4		Myeloproliferative disorder(586;0.0393)				GTTGGCTTAGCACAGAGCTGC	0.572													G|||	4054	0.809505	0.8759	0.8689	5008	,	,		17145	0.9157		0.7475	False		,,,				2504	0.6319					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF041432	CCDS404.1, CCDS59194.1, CCDS72757.1, CCDS72758.1	1p34.2	2011-10-10			ENSG00000054116	ENSG00000054116		"""Trafficking protein particle complex"""	19942	protein-coding gene	gene with protein product		610955				8619474	Standard	NM_014408		Approved	BET3	uc031pls.1	O43617	OTTHUMG00000007664	ENST00000373166.3:c.42+224G>C	1.37:g.36614713C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDN0|B2RDN2|D3DPS2	RNA	SNP	-	NULL	ENST00000373166.3	37	NULL	CCDS404.1	1																																																																																			TRAPPC3	-	-	ENSG00000054116		0.572	TRAPPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC3	HGNC	protein_coding	OTTHUMT00000020384.1	77	0.00	0	C	NM_014408		36614713	36614713	-1	no_errors	ENST00000497251	ensembl	human	known	69_37n	rna	19	17.39	4	SNP	0.005	G
TRIM66	9866	genome.wustl.edu	37	11	8693405	8693405	+	5'UTR	SNP	G	G	A	rs11517718	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr11:8693405G>A	ENST00000402157.2	-	0	8				TRIM66_ENST00000531498.1_5'UTR			O15016	TRI66_HUMAN	tripartite motif containing 66							aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						CAGTCCTTACGGAGCAAATGC	0.522													A|||	2454	0.490016	0.5401	0.4207	5008	,	,		20308	0.5952		0.3718	False		,,,				2504	0.4847					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000402157.2:c.-433C>T	11.37:g.8693405G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQQ4	RNA	SNP	-	NULL	ENST00000402157.2	37	NULL		11																																																																																			TRIM66	-	-	ENSG00000166436		0.522	TRIM66-001	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	TRIM66	HGNC	protein_coding	OTTHUMT00000318299.2	68	0.00	0	G	XM_084529		8693405	8693405	-1	no_errors	ENST00000531498	ensembl	human	known	69_37n	rna	33	17.50	7	SNP	1.000	A
UGGT1	56886	genome.wustl.edu	37	2	128939819	128939819	+	Nonsense_Mutation	SNP	C	C	G			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr2:128939819C>G	ENST00000259253.6	+	37	4246	c.4199C>G	c.(4198-4200)tCa>tGa	p.S1400*	UGGT1_ENST00000375990.3_Nonsense_Mutation_p.S1376*	NM_020120.3	NP_064505.1	Q9NYU2	UGGG1_HUMAN	UDP-glucose glycoprotein glucosyltransferase 1	1400	Glucosyltransferase. {ECO:0000250}.				'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(14)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TTCTGGAAGTCAGGGTACTGG	0.438																																						dbGAP											0													100.0	102.0	101.0					2																	128939819		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF227905	CCDS2154.1	2q14.3	2009-07-23	2009-07-23	2009-07-23	ENSG00000136731	ENSG00000136731			15663	protein-coding gene	gene with protein product		605897	"""UDP-glucose ceramide glucosyltransferase-like 1"""	UGCGL1		10694380	Standard	NM_020120		Approved	HUGT1	uc002tps.3	Q9NYU2	OTTHUMG00000131570	ENST00000259253.6:c.4199C>G	2.37:g.128939819C>G	ENSP00000259253:p.Ser1400*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QP2|Q53SL3|Q8IW30|Q9H8I4	Nonsense_Mutation	SNP	pfam_UDP-g_GGtrans	p.S1400*	ENST00000259253.6	37	c.4199	CCDS2154.1	2	.	.	.	.	.	.	.	.	.	.	C	44	11.232198	0.99534	.	.	ENSG00000136731	ENST00000375990;ENST00000259253	.	.	.	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.577	0.95449	0.0:1.0:0.0:0.0	.	.	.	.	X	1376;1400	.	.	S	+	2	0	UGGT1	128656289	1.000000	0.71417	0.993000	0.49108	0.989000	0.77384	7.445000	0.80570	2.693000	0.91896	0.650000	0.86243	TCA	UGGT1	-	NULL	ENSG00000136731		0.438	UGGT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT1	HGNC	protein_coding	OTTHUMT00000254435.2	85	0.00	0	C	NM_020120		128939819	128939819	+1	no_errors	ENST00000259253	ensembl	human	known	69_37n	nonsense	39	27.78	15	SNP	1.000	G
UHMK1	127933	genome.wustl.edu	37	1	162493009	162493009	+	3'UTR	SNP	C	C	T	rs1062174	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr1:162493009C>T	ENST00000489294.1	+	0	2087				UHMK1_ENST00000282169.8_3'UTR|UHMK1_ENST00000538489.1_3'UTR|UHMK1_ENST00000545294.1_3'UTR	NM_175866.4	NP_787062.1	Q8TAS1	UHMK1_HUMAN	U2AF homology motif (UHM) kinase 1						cell cycle arrest (GO:0007050)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of translational initiation (GO:0045948)|protein autophosphorylation (GO:0046777)|regulation of protein export from nucleus (GO:0046825)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|neuronal ribonucleoprotein granule (GO:0071598)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)|transferase activity (GO:0016740)			endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	11	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			AGTGAATGTGCGAGTATGAAT	0.323													C|||	2106	0.420527	0.3502	0.4308	5008	,	,		19516	0.4633		0.4443	False		,,,				2504	0.4397					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC026046	CCDS1239.1, CCDS53423.1, CCDS53424.1	1q23.1	2013-02-12			ENSG00000152332	ENSG00000152332		"""RNA binding motif (RRM) containing"""	19683	protein-coding gene	gene with protein product		608849				12093740, 12782393	Standard	NM_175866		Approved	KIS, Kist	uc001gcc.2	Q8TAS1	OTTHUMG00000031373	ENST00000489294.1:c.*669C>T	1.37:g.162493009C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8K4|G3V1M1|Q96C22	RNA	SNP	-	NULL	ENST00000489294.1	37	NULL	CCDS1239.1	1																																																																																			UHMK1	-	-	ENSG00000152332		0.323	UHMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHMK1	HGNC	protein_coding	OTTHUMT00000076788.1	91	0.00	0	C	NM_175866		162493009	162493009	+1	no_errors	ENST00000282169	ensembl	human	known	69_37n	rna	42	12.50	6	SNP	0.340	T
ULBP2	80328	genome.wustl.edu	37	6	150267527	150267527	+	Silent	SNP	A	A	C	rs2282235	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr6:150267527A>C	ENST00000367351.3	+	3	442	c.369A>C	c.(367-369)gcA>gcC	p.A123A		NM_025217.2	NP_079493.1	Q9BZM5	N2DL2_HUMAN	UL16 binding protein 2	123	MHC class I alpha-2 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular space (GO:0005615)	natural killer cell lectin-like receptor binding (GO:0046703)			breast(3)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.58e-12)		CCCTGCAGGCAAGGATGTCTT	0.507													N|||	3467	0.692292	0.8638	0.5922	5008	,	,		20462	0.8046		0.5606	False		,,,				2504	0.5511					dbGAP											0													98.0	94.0	95.0					6																	150267527		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AF304378	CCDS5222.1	6q25	2008-04-11			ENSG00000131015	ENSG00000131015			14894	protein-coding gene	gene with protein product		605698				11239445	Standard	NM_025217		Approved	RAET1H	uc003qno.3	Q9BZM5	OTTHUMG00000015803	ENST00000367351.3:c.369A>C	6.37:g.150267527A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUN4	Silent	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.A123	ENST00000367351.3	37	c.369	CCDS5222.1	6																																																																																			ULBP2	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000131015		0.507	ULBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULBP2	HGNC	protein_coding	OTTHUMT00000042669.1	137	0.72	1	A			150267527	150267527	+1	no_errors	ENST00000367351	ensembl	human	known	69_37n	silent	51	12.07	7	SNP	0.000	C
USP34	9736	genome.wustl.edu	37	2	61622358	61622359	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr2:61622358_61622359delGT	ENST00000398571.2	-	4	638_639	c.562_563delAC	c.(562-564)actfs	p.T188fs		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	188					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			ACTTTCTTGAGTTGATATATCC	0.233																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.562_563delAC	2.37:g.61622358_61622359delGT	ENSP00000381577:p.Thr188fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Frame_Shift_Del	DEL	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.T188fs	ENST00000398571.2	37	c.563_562	CCDS42686.1	2																																																																																			USP34	-	NULL	ENSG00000115464		0.233	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	87	0.00	0	GT			61622358	61622359	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	frame_shift_del	38	21.57	11	DEL	1.000:1.000	-
WBP11P1	441818	genome.wustl.edu	37	18	30092327	30092327	+	RNA	SNP	G	G	A	rs1985293	byFrequency	TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr18:30092327G>A	ENST00000567636.1	+	0	702					NR_003558.1				WW domain binding protein 11 pseudogene 1																		CCCTCAGCCTGTGGACCTCCA	0.517													A|||	3268	0.652556	0.4887	0.562	5008	,	,		20192	0.8522		0.661	False		,,,				2504	0.7239					dbGAP											0																																										-	-	-			0			BC059403		18q12.1	2007-05-15				ENSG00000260389			26250	pseudogene	pseudogene							Standard	NR_003558		Approved	HsT3017	uc010dmc.3				18.37:g.30092327G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567636.1	37	NULL		18																																																																																			WBP11P1	-	-	ENSG00000260389		0.517	WBP11P1-002	KNOWN	basic	processed_transcript	WBP11P1	HGNC	pseudogene	OTTHUMT00000435119.1	27	0.00	0	G			30092327	30092327	+1	no_errors	ENST00000567636	ensembl	human	known	69_37n	rna	13	27.78	5	SNP	1.000	A
ZNF292	23036	genome.wustl.edu	37	6	87865299	87865299	+	5'UTR	SNP	G	G	A			TCGA-E9-A3Q9-01A-11D-A21Q-09	TCGA-E9-A3Q9-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d053c0fd-c2fe-4f49-a333-da17c45d75c9	b1cc02ca-7fca-4132-9a9b-a14a9056bf37	g.chr6:87865299G>A	ENST00000369577.3	+	0	33				RP11-393I2.4_ENST00000606274.1_RNA|ZNF292_ENST00000369578.2_3'UTR|ZNF292_ENST00000339907.4_5'UTR|ZNF292_ENST00000392985.3_5'UTR	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292							nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		GCGACGGAGCGGGGTGTGAAG	0.687																																						dbGAP											0													13.0	16.0	15.0					6																	87865299		2052	4158	6210	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.-11G>A	6.37:g.87865299G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	RNA	SNP	-	NULL	ENST00000369577.3	37	NULL	CCDS47457.1	6																																																																																			ZNF292	-	-	ENSG00000188994		0.687	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	100	0.00	0	G	NM_015021		87865299	87865299	+1	no_errors	ENST00000369578	ensembl	human	known	69_37n	rna	29	30.95	13	SNP	1.000	A
