#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM21P1	145241	genome.wustl.edu	37	14	70714144	70714144	+	RNA	SNP	A	A	G	rs111296958		TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr14:70714144A>G	ENST00000530196.1	-	0	374					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		AGAGCTTCTTAACCCTCATAT	0.502																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70714144A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.502	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	35	0.00	0	A	NG_002467		70714144	70714144	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	12	20.00	3	SNP	0.121	G
AKIRIN1	79647	genome.wustl.edu	37	1	39463917	39463917	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:39463917C>G	ENST00000432648.3	+	2	453	c.295C>G	c.(295-297)Cag>Gag	p.Q99E	AKIRIN1_ENST00000446189.2_Missense_Mutation_p.Q99E|AKIRIN1_ENST00000372984.4_Intron	NM_024595.2	NP_078871.1	Q9H9L7	AKIR1_HUMAN	akirin 1	99						nuclear membrane (GO:0031965)|nucleus (GO:0005634)				lung(1)|prostate(1)|skin(1)	3						TGTTCTTAATCAGAGTGAAGC	0.388																																						dbGAP											0													91.0	89.0	90.0					1																	39463917		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022728	CCDS433.1, CCDS44113.1	1p34.3	2013-10-11	2008-06-23	2008-06-23	ENSG00000174574	ENSG00000174574			25744	protein-coding gene	gene with protein product		615164	"""chromosome 1 open reading frame 108"""	C1orf108		19200367	Standard	NM_024595		Approved	FLJ12666	uc001ccw.3	Q9H9L7	OTTHUMG00000007496	ENST00000432648.3:c.295C>G	1.37:g.39463917C>G	ENSP00000392678:p.Gln99Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZU6|Q0VDB3|Q53FK8	Missense_Mutation	SNP	NULL	p.Q99E	ENST00000432648.3	37	c.295	CCDS433.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	25.4|25.4	4.630283|4.630283	0.87660|0.87660	.|.	.|.	ENSG00000174574|ENSG00000174574	ENST00000531822|ENST00000432648;ENST00000446189	.|T;T	.|0.39997	.|1.05;1.05	5.14|5.14	5.14|5.14	0.70334|0.70334	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62974|0.62974	0.2472|0.2472	M|M	0.75447|0.75447	2.3|2.3	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.974;0.997	.|D;D	.|0.77557	.|0.969;0.99	T|T	0.58691|0.58691	-0.7592|-0.7592	5|10	.|0.21540	.|T	.|0.41	-11.0614|-11.0614	16.4569|16.4569	0.84021|0.84021	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|99;99	.|B4DZU6;Q9H9L7	.|.;AKIR1_HUMAN	M|E	60|99	.|ENSP00000392678:Q99E;ENSP00000389866:Q99E	.|ENSP00000392678:Q99E	I|Q	+|+	3|1	3|0	AKIRIN1|AKIRIN1	39236504|39236504	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.785000|6.785000	0.75089|0.75089	2.534000|2.534000	0.85438|0.85438	0.563000|0.563000	0.77884|0.77884	ATC|CAG	AKIRIN1	-	NULL	ENSG00000174574		0.388	AKIRIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKIRIN1	HGNC	protein_coding	OTTHUMT00000019687.2	40	0.00	0	C	NM_024595		39463917	39463917	+1	no_errors	ENST00000432648	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	G
ANKRD36	375248	genome.wustl.edu	37	2	97909714	97909714	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr2:97909714C>G	ENST00000461153.2	+	70	4761	c.4517C>G	c.(4516-4518)gCt>gGt	p.A1506G	ANKRD36_ENST00000357042.4_5'Flank|ANKRD36_ENST00000420699.2_Missense_Mutation_p.A1506G			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1506										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						ATTAAACCGGCTCTCAAATCA	0.328																																						dbGAP											0													33.0	25.0	27.0					2																	97909714		686	1573	2259	-	-	-	SO:0001583	missense	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.4517C>G	2.37:g.97909714C>G	ENSP00000419530:p.Ala1506Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A1506G	ENST00000461153.2	37	c.4517	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	9.589	1.125642	0.20959	.	.	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.17854	2.25;2.25	1.4	-2.79	0.05841	.	.	.	.	.	T	0.12050	0.0293	N	0.24115	0.695	0.09310	N	1	B;D	0.54964	0.188;0.969	B;P	0.46975	0.013;0.533	T	0.14615	-1.0466	9	0.72032	D	0.01	.	5.4386	0.16496	0.2012:0.4023:0.3965:0.0	.	1506;330	A6QL64;A6QL64-3	AN36A_HUMAN;.	G	1506;1506;773	ENSP00000419530:A1506G;ENSP00000391950:A1506G	ENSP00000391950:A1506G	A	+	2	0	ANKRD36	97273432	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-0.261000	0.08694	-1.014000	0.03379	0.184000	0.17185	GCT	ANKRD36	-	NULL	ENSG00000135976		0.328	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	92	0.00	0	C			97909714	97909714	+1	no_errors	ENST00000420699	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	0.000	G
ARID1A	8289	genome.wustl.edu	37	1	27100182	27100184	+	In_Frame_Del	DEL	GCA	GCA	-	rs370696498|rs374564889		TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:27100182_27100184delGCA	ENST00000324856.7	+	16	4349_4351	c.3978_3980delGCA	c.(3976-3981)ccgcag>ccg	p.Q1334del	ARID1A_ENST00000457599.2_In_Frame_Del_p.Q1334del|ARID1A_ENST00000540690.1_5'UTR|ARID1A_ENST00000374152.2_In_Frame_Del_p.Q951del	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	1334	Gln-rich.				androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)	p.Q1327*(1)|p.Q1334delQ(1)	ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCTACCCCCCgcagcagcagcag	0.591			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	2	Substitution - Nonsense(1)|Deletion - In frame(1)	large_intestine(1)|endometrium(1)																																								-	-	-	SO:0001651	inframe_deletion	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.3978_3980delGCA	1.37:g.27100191_27100193delGCA	ENSP00000320485:p.Gln1334del	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	In_Frame_Del	DEL	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q1330in_frame_del	ENST00000324856.7	37	c.3978_3980	CCDS285.1	1																																																																																			ARID1A	-	NULL	ENSG00000117713		0.591	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	65	0.00	0	GCA	NM_139135		27100182	27100184	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	in_frame_del	16	11.11	2	DEL	0.986:0.981:0.931	-
ATXN7L2	127002	genome.wustl.edu	37	1	110033786	110033786	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:110033786C>T	ENST00000369870.3	+	10	1616	c.1601C>T	c.(1600-1602)tCa>tTa	p.S534L	CYB561D1_ENST00000533024.1_5'Flank|CYB561D1_ENST00000310611.4_5'Flank|CYB561D1_ENST00000496961.1_5'Flank|CYB561D1_ENST00000528785.1_5'Flank|CYB561D1_ENST00000430195.2_5'Flank|ATXN7L2_ENST00000459635.1_3'UTR|CYB561D1_ENST00000369868.3_5'Flank|CYB561D1_ENST00000527072.1_5'Flank|CYB561D1_ENST00000420578.2_5'Flank|CYB561D1_ENST00000393709.3_5'Flank	NM_153340.4	NP_699171.3	Q5T6C5	AT7L2_HUMAN	ataxin 7-like 2	534										breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)	17		all_epithelial(167;0.00197)|all_lung(203;0.00291)|Lung NSC(277;0.00453)		Colorectal(144;0.0129)|Lung(183;0.0426)|Epithelial(280;0.0675)|READ - Rectum adenocarcinoma(129;0.0693)|all cancers(265;0.071)|LUSC - Lung squamous cell carcinoma(189;0.228)		GCTATCACCTCACCACTGCCT	0.652											OREG0013635	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													32.0	32.0	32.0					1																	110033786		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC037582	CCDS30794.1	1p13.2	2008-02-05			ENSG00000162650	ENSG00000162650			28713	protein-coding gene	gene with protein product						12477932	Standard	NM_153340		Approved	MGC46534, FLJ00381	uc001dxr.3	Q5T6C5	OTTHUMG00000011027	ENST00000369870.3:c.1601C>T	1.37:g.110033786C>T	ENSP00000358886:p.Ser534Leu	Somatic	1424	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SCA7_dom	p.S534L	ENST00000369870.3	37	c.1601	CCDS30794.1	1	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860505	0.51482	.	.	ENSG00000162650	ENST00000369870;ENST00000369869	T	0.42513	0.97	5.23	5.23	0.72850	.	0.000000	0.46145	D	0.000310	T	0.41119	0.1145	N	0.19112	0.55	0.39567	D	0.969222	P;D	0.57899	0.763;0.981	B;D	0.69824	0.163;0.966	T	0.45498	-0.9257	10	0.72032	D	0.01	-5.5649	15.8436	0.78871	0.0:1.0:0.0:0.0	.	161;534	Q5T6C4;Q5T6C5	.;AT7L2_HUMAN	L	534;161	ENSP00000358886:S534L	ENSP00000358885:S161L	S	+	2	0	ATXN7L2	109835309	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.742000	0.62103	2.724000	0.93272	0.462000	0.41574	TCA	ATXN7L2	-	NULL	ENSG00000162650		0.652	ATXN7L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN7L2	HGNC	protein_coding	OTTHUMT00000030331.1	35	0.00	0	C	NM_153340		110033786	110033786	+1	no_errors	ENST00000369870	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	T
BCL11B	64919	genome.wustl.edu	37	14	99641544	99641546	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr14:99641544_99641546delCTC	ENST00000357195.3	-	4	1636_1638	c.1627_1629delGAG	c.(1627-1629)gagdel	p.E543del	BCL11B_ENST00000345514.2_In_Frame_Del_p.E472del|BCL11B_ENST00000443726.2_In_Frame_Del_p.E349del	NM_001282237.1|NM_138576.2	NP_001269166.1|NP_612808.1	Q9C0K0	BC11B_HUMAN	B-cell CLL/lymphoma 11B (zinc finger protein)	543	Glu-rich.				alpha-beta T cell differentiation (GO:0046632)|epithelial cell morphogenesis (GO:0003382)|keratinocyte development (GO:0003334)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|odontogenesis of dentin-containing tooth (GO:0042475)|olfactory bulb axon guidance (GO:0071678)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive T cell selection (GO:0043368)|post-embryonic camera-type eye development (GO:0031077)|regulation of keratinocyte proliferation (GO:0010837)|regulation of lipid metabolic process (GO:0019216)|regulation of neuron differentiation (GO:0045664)|striatal medium spiny neuron differentiation (GO:0021773)|T cell differentiation in thymus (GO:0033077)|T cell receptor V(D)J recombination (GO:0033153)|thymus development (GO:0048538)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(1)|central_nervous_system(9)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(9)|prostate(2)|skin(2)	34		Melanoma(154;0.0866)|all_epithelial(191;0.241)		COAD - Colon adenocarcinoma(157;0.103)		CCAGTAGCAGctcctcctcctcc	0.7			T	TLX3	T-ALL																																	dbGAP		Dom	yes		14	14q32.1	64919	B-cell CLL/lymphoma 11B  (CTIP2)		L	0									,	259,3515		17,225,1645					,	1.8	1.0			6	544,6744		46,452,3146	no	coding,coding	BCL11B	NM_138576.2,NM_022898.1	,	63,677,4791	A1A1,A1R,RR		7.4643,6.8627,7.2591	,	,		803,10259				-	-	-	SO:0001651	inframe_deletion	0			AJ404614	CCDS9949.1, CCDS9950.1	14q32	2013-01-08			ENSG00000127152	ENSG00000127152		"""Zinc fingers, C2H2-type"""	13222	protein-coding gene	gene with protein product		606558		ZNF856B		11719382, 16950772	Standard	NM_138576		Approved	CTIP-2, CTIP2, hRIT1-alpha	uc001yga.3	Q9C0K0	OTTHUMG00000028967	ENST00000357195.3:c.1627_1629delGAG	14.37:g.99641553_99641555delCTC	ENSP00000349723:p.Glu543del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H162	In_Frame_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E543in_frame_del	ENST00000357195.3	37	c.1629_1627	CCDS9950.1	14																																																																																			BCL11B	-	NULL	ENSG00000127152		0.700	BCL11B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL11B	HGNC	protein_coding	OTTHUMT00000072332.2	8	0.00	0	CTC	NM_138576		99641544	99641546	-1	no_errors	ENST00000357195	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	1.000:1.000:1.000	-
BRD2	6046	genome.wustl.edu	37	6	32948215	32948215	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr6:32948215A>G	ENST00000374825.4	+	12	3944	c.2243A>G	c.(2242-2244)aAt>aGt	p.N748S	BRD2_ENST00000449085.2_Missense_Mutation_p.N701S|BRD2_ENST00000395289.2_Missense_Mutation_p.N783S|BRD2_ENST00000443797.2_Missense_Mutation_p.N628S|BRD2_ENST00000374831.4_Missense_Mutation_p.N748S|BRD2_ENST00000395287.1_Missense_Mutation_p.N783S	NM_005104.3	NP_005095.1	P25440	BRD2_HUMAN	bromodomain containing 2	748					chromatin modification (GO:0016568)|nucleosome assembly (GO:0006334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|lysine-acetylated histone binding (GO:0070577)			central_nervous_system(3)|stomach(2)	5						GGACAGCTCAATTCTACTAAA	0.423																																						dbGAP											0													72.0	82.0	78.0					6																	32948215		1511	2709	4220	-	-	-	SO:0001583	missense	0			X96670	CCDS4762.1, CCDS56420.1, CCDS56421.1	6p21.3	2010-12-23	2002-01-14		ENSG00000204256	ENSG00000204256			1103	protein-coding gene	gene with protein product		601540	"""bromodomain-containing 2"""			1352711, 8781126	Standard	NM_005104		Approved	KIAA9001, RING3, D6S113E, NAT, FSRG1	uc021ywf.1	P25440	OTTHUMG00000031241	ENST00000374825.4:c.2243A>G	6.37:g.32948215A>G	ENSP00000363958:p.Asn748Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2AAU0|B0S7P0|B1AZT1|O00699|O00700|Q15310|Q5STC9|Q63HQ9|Q658Y7|Q6P3U2|Q969U4	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.N783S	ENST00000374825.4	37	c.2348	CCDS4762.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.61|14.61	2.585611|2.585611	0.46110|0.46110	.|.	.|.	ENSG00000204256|ENSG00000204256	ENST00000449025|ENST00000374825;ENST00000374831;ENST00000395289;ENST00000443797;ENST00000395287;ENST00000449085	.|T;T;T;T;T;T	.|0.24151	.|1.87;1.87;1.87;1.87;1.87;1.87	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.000000	.|0.52532	.|D	.|0.000071	T|T	0.25005|0.25005	0.0607|0.0607	L|L	0.43598|0.43598	1.365|1.365	0.80722|0.80722	D|D	1|1	.|D;D	.|0.69078	.|0.997;0.993	.|D;D	.|0.70716	.|0.97;0.935	T|T	0.05402|0.05402	-1.0887|-1.0887	5|10	.|0.09338	.|T	.|0.73	-26.8284|-26.8284	13.5761|13.5761	0.61875|0.61875	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|783;748	.|A2AAU0;P25440	.|.;BRD2_HUMAN	V|S	754|748;748;783;628;783;701	.|ENSP00000363958:N748S;ENSP00000363964:N748S;ENSP00000378704:N783S;ENSP00000413495:N628S;ENSP00000378702:N783S;ENSP00000409145:N701S	.|ENSP00000363958:N748S	I|N	+|+	1|2	0|0	BRD2|BRD2	33056193|33056193	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.295000|0.295000	0.27426|0.27426	8.658000|8.658000	0.91110|0.91110	2.301000|2.301000	0.77427|0.77427	0.523000|0.523000	0.50628|0.50628	ATT|AAT	BRD2	-	NULL	ENSG00000204256		0.423	BRD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD2	HGNC	protein_coding	OTTHUMT00000076503.2	28	0.00	0	A			32948215	32948215	+1	no_errors	ENST00000395289	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	G
CARD9	64170	genome.wustl.edu	37	9	139261779	139261779	+	Intron	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr9:139261779G>T	ENST00000371732.5	-	9	1435				CARD9_ENST00000460290.1_5'UTR|CARD9_ENST00000371734.3_Intron	NM_052813.4	NP_434700.2	Q9H257	CARD9_HUMAN	caspase recruitment domain family, member 9						defense response to Gram-positive bacterium (GO:0050830)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of apoptotic process (GO:0042981)|regulation of interleukin-2 biosynthetic process (GO:0045076)|regulation of interleukin-6 biosynthetic process (GO:0045408)|regulation of tumor necrosis factor biosynthetic process (GO:0042534)|response to drug (GO:0042493)|response to exogenous dsRNA (GO:0043330)|response to fungus (GO:0009620)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)	cytoplasm (GO:0005737)	CARD domain binding (GO:0050700)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)|prostate(3)|skin(1)	15		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;4.58e-06)|Epithelial(140;5.65e-06)		GGTGGGCAGGGCACAGAGCGG	0.662																																						dbGAP											0													37.0	41.0	40.0					9																	139261779		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF311287	CCDS6997.1, CCDS48057.1	9q34	2014-09-17			ENSG00000187796	ENSG00000187796			16391	protein-coding gene	gene with protein product		607212				11053425	Standard	NM_052813		Approved		uc004chg.3	Q9H257	OTTHUMG00000020925	ENST00000371732.5:c.1270-70C>A	9.37:g.139261779G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SXM5|Q5SXM6|Q9H854	RNA	SNP	-	NULL	ENST00000371732.5	37	NULL	CCDS6997.1	9																																																																																			CARD9	-	-	ENSG00000187796		0.662	CARD9-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD9	HGNC	protein_coding	OTTHUMT00000055053.1	38	0.00	0	G	NM_052813		139261779	139261779	-1	no_errors	ENST00000460290	ensembl	human	known	69_37n	rna	10	23.08	3	SNP	0.001	T
CELSR1	9620	genome.wustl.edu	37	22	46859789	46859789	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr22:46859789G>C	ENST00000262738.3	-	2	3997	c.3998C>G	c.(3997-3999)tCc>tGc	p.S1333C	CELSR1_ENST00000395964.1_Missense_Mutation_p.S1333C	NM_014246.1	NP_055061.1	Q9NYQ6	CELR1_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 1	1333	EGF-like 1; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				anterior/posterior pattern specification (GO:0009952)|apical protein localization (GO:0045176)|central nervous system development (GO:0007417)|establishment of body hair planar orientation (GO:0048105)|establishment of planar polarity (GO:0001736)|establishment of planar polarity of embryonic epithelium (GO:0042249)|G-protein coupled receptor signaling pathway (GO:0007186)|hair follicle development (GO:0001942)|homophilic cell adhesion (GO:0007156)|inner ear morphogenesis (GO:0042472)|lateral sprouting involved in lung morphogenesis (GO:0060490)|locomotory behavior (GO:0007626)|neural tube closure (GO:0001843)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|orthogonal dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060488)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|planar dichotomous subdivision of terminal units involved in lung branching morphogenesis (GO:0060489)|protein localization involved in establishment of planar polarity (GO:0090251)|regulation of actin cytoskeleton organization (GO:0032956)|Rho protein signal transduction (GO:0007266)|wound healing (GO:0042060)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|protein dimerization activity (GO:0046983)|transmembrane signaling receptor activity (GO:0004888)			breast(8)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(13)|lung(27)|ovary(2)|pancreas(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	95		Ovarian(80;0.00142)|Breast(42;0.00296)|all_neural(38;0.0416)|Colorectal(5;0.0766)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00643)|BRCA - Breast invasive adenocarcinoma(115;0.171)		CACGGTGGTGGAGCTGAGGAA	0.657																																						dbGAP											0													88.0	67.0	74.0					22																	46859789		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231024	CCDS14076.1	22q13.31	2014-08-08	2013-02-18		ENSG00000075275	ENSG00000075275		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	1850	protein-coding gene	gene with protein product	"""flamingo homolog 2 (Drosophila)"""	604523	"""cadherin, EGF LAG seven-pass G-type receptor 1, flamingo (Drosophila) homolog"""			9339365	Standard	XM_006724383		Approved	ME2, HFMI2, FMI2, CDHF9	uc003bhw.1	Q9NYQ6	OTTHUMG00000150423	ENST00000262738.3:c.3998C>G	22.37:g.46859789G>C	ENSP00000262738:p.Ser1333Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95722|Q5TH47|Q9BWQ5|Q9Y506|Q9Y526	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S1333C	ENST00000262738.3	37	c.3998	CCDS14076.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	24.9|24.9	4.581041|4.581041	0.86748|0.86748	.|.	.|.	ENSG00000075275|ENSG00000075275	ENST00000454637|ENST00000262738;ENST00000395964	.|T;T	.|0.54479	.|0.57;0.57	4.75|4.75	4.75|4.75	0.60458|0.60458	.|Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	.|0.000000	.|0.64402	.|U	.|0.000003	T|T	0.76521|0.76521	0.3999|0.3999	M|M	0.86573|0.86573	2.825|2.825	0.52501|0.52501	D|D	0.999953|0.999953	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	T|T	0.82208|0.82208	-0.0571|-0.0571	5|10	.|0.87932	.|D	.|0	.|.	17.3622|17.3622	0.87354|0.87354	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1333	.|Q9NYQ6	.|CELR1_HUMAN	A|C	708|1333	.|ENSP00000262738:S1333C;ENSP00000379293:S1333C	.|ENSP00000262738:S1333C	P|S	-|-	1|2	0|0	CELSR1|CELSR1	45238453|45238453	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.996000|0.996000	0.88848|0.88848	7.116000|7.116000	0.77119|0.77119	2.173000|2.173000	0.68751|0.68751	0.655000|0.655000	0.94253|0.94253	CCA|TCC	CELSR1	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000075275		0.657	CELSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR1	HGNC	protein_coding	OTTHUMT00000318037.1	64	0.00	0	G	NM_014246		46859789	46859789	-1	no_errors	ENST00000262738	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	C
CHD1L	9557	genome.wustl.edu	37	1	146736198	146736198	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:146736198G>C	ENST00000369258.4	+	7	714	c.694G>C	c.(694-696)Gat>Cat	p.D232H	CHD1L_ENST00000431239.1_Missense_Mutation_p.D232H|CHD1L_ENST00000361293.5_Intron|CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000369259.3_Intron	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	232					ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					AGAGGTGGGAGATTTTATTCA	0.483																																						dbGAP											0													90.0	86.0	87.0					1																	146736198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.694G>C	1.37:g.146736198G>C	ENSP00000358262:p.Asp232His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_A1pp,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D232H	ENST00000369258.4	37	c.694	CCDS927.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.80|14.80	2.642822|2.642822	0.47153|0.47153	.|.	.|.	ENSG00000131778|ENSG00000131778	ENST00000431239;ENST00000369258;ENST00000436230|ENST00000254086	D;D|.	0.93189|.	-3.18;-3.18|.	5.27|5.27	5.27|5.27	0.74061|0.74061	SNF2-related (1);|.	0.259367|.	0.44688|.	D|.	0.000423|.	T|T	0.30947|0.30947	0.0781|0.0781	L|L	0.31207|0.31207	0.915|0.915	0.80722|0.80722	D|D	1|1	P;P|.	0.48764|.	0.731;0.915|.	P;P|.	0.51229|.	0.621;0.663|.	T|T	0.19679|0.19679	-1.0298|-1.0298	10|6	0.62326|0.02654	D|T	0.03|1	.|.	14.743|14.743	0.69469|0.69469	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	232;232|.	Q86WJ1-2;Q86WJ1|.	.;CHD1L_HUMAN|.	H|D	232;232;132|192	ENSP00000389031:D232H;ENSP00000358262:D232H|.	ENSP00000358262:D232H|ENSP00000254086:E192D	D|E	+|+	1|3	0|2	CHD1L|CHD1L	145202822|145202822	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.182000|0.182000	0.23217|0.23217	3.497000|3.497000	0.53295|0.53295	2.621000|2.621000	0.88768|0.88768	0.650000|0.650000	0.86243|0.86243	GAT|GAG	CHD1L	-	pfam_SNF2_N	ENSG00000131778		0.483	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	14	0.00	0	G	NM_004284		146736198	146736198	+1	no_errors	ENST00000369258	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.996	C
CRYBG3	131544	genome.wustl.edu	37	3	97593629	97593629	+	Silent	SNP	C	C	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr3:97593629C>G	ENST00000419587.2	+	4	3758	c.3591C>G	c.(3589-3591)ctC>ctG	p.L1197L	CRYBG3_ENST00000182096.4_5'Flank			Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	1197							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						GTAGTTTACTCAAAAAGGCCG	0.428																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000419587.2:c.3591C>G	3.37:g.97593629C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Silent	SNP	NULL	p.L1197	ENST00000419587.2	37	c.3591		3																																																																																			AC110491.1	-	NULL	ENSG00000233280		0.428	CRYBG3-001	PUTATIVE	mRNA_end_NF|cds_end_NF|basic|appris_principal	protein_coding	CRYBG3	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000469328.1	25	0.00	0	C	NM_153605		97593629	97593629	+1	no_stop_codon	ENST00000419587	ensembl	human	known	69_37n	silent	10	28.57	4	SNP	0.339	G
DMXL2	23312	genome.wustl.edu	37	15	51780803	51780803	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr15:51780803C>G	ENST00000251076.5	-	21	5280	c.4993G>C	c.(4993-4995)Gat>Cat	p.D1665H	RP11-707P17.1_ENST00000561007.1_RNA|DMXL2_ENST00000543779.2_Missense_Mutation_p.D1665H|DMXL2_ENST00000449909.3_Missense_Mutation_p.D1029H	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	1665						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		AGTGCAGCATCTAAGGCATCA	0.328																																						dbGAP											0													153.0	132.0	139.0					15																	51780803		2196	4293	6489	-	-	-	SO:0001583	missense	0			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.4993G>C	15.37:g.51780803C>G	ENSP00000251076:p.Asp1665His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1665H	ENST00000251076.5	37	c.4993	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	C	28.1	4.886717	0.91814	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909	T;T;T	0.47528	0.84;0.84;0.84	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	T	0.77280	0.4107	M	0.92923	3.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.83216	-0.0071	10	0.87932	D	0	.	18.7549	0.91828	0.0:1.0:0.0:0.0	.	1665;1029;1665	F5GWF1;B2RTR3;Q8TDJ6	.;.;DMXL2_HUMAN	H	1665;1665;1029	ENSP00000251076:D1665H;ENSP00000441858:D1665H;ENSP00000400855:D1029H	ENSP00000251076:D1665H	D	-	1	0	DMXL2	49568095	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.925000	0.70062	2.527000	0.85204	0.585000	0.79938	GAT	DMXL2	-	pfam_Rav1p_C	ENSG00000104093		0.328	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	50	0.00	0	C	NM_015263		51780803	51780803	-1	no_errors	ENST00000543779	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	1.000	G
DNHD1	144132	genome.wustl.edu	37	11	6587993	6587993	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr11:6587993G>T	ENST00000527990.2	+	33	11383	c.11383G>T	c.(11383-11385)Gag>Tag	p.E3795*	DNHD1_ENST00000254579.6_Nonsense_Mutation_p.E3795*			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3795					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GGAGGCTGCTGAGGTGCTTGG	0.547																																						dbGAP											0													38.0	42.0	40.0					11																	6587993		2035	4190	6225	-	-	-	SO:0001587	stop_gained	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.11383G>T	11.37:g.6587993G>T	ENSP00000436180:p.Glu3795*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.E3795*	ENST00000527990.2	37	c.11383	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	G	55	24.602041	0.99961	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000525883;ENST00000530197	.	.	.	4.52	4.52	0.55395	.	0.152009	0.30676	N	0.009117	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-17.0517	14.6471	0.68769	0.0:0.0:1.0:0.0	.	.	.	.	X	3795;3795;63;63	.	ENSP00000254579:E3795X	E	+	1	0	DNHD1	6544569	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.637000	0.61346	2.505000	0.84491	0.655000	0.94253	GAG	DNHD1	-	NULL	ENSG00000179532		0.547	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	69	0.00	0	G	NM_144666		6587993	6587993	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	nonsense	30	11.76	4	SNP	1.000	T
EDA2R	60401	genome.wustl.edu	37	X	65824951	65824951	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chrX:65824951G>C	ENST00000374719.3	-	3	261	c.205C>G	c.(205-207)Cgt>Ggt	p.R69G	EDA2R_ENST00000253392.5_Missense_Mutation_p.R69G|EDA2R_ENST00000451436.2_Intron|EDA2R_ENST00000396050.1_Missense_Mutation_p.R69G|EDA2R_ENST00000450752.1_Missense_Mutation_p.R69G|EDA2R_ENST00000456230.2_Missense_Mutation_p.R69G	NM_021783.3	NP_068555	Q9HAV5	TNR27_HUMAN	ectodysplasin A2 receptor	69					cell differentiation (GO:0030154)|embryo development (GO:0009790)|epidermis development (GO:0008544)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|tumor necrosis factor-activated receptor activity (GO:0005031)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	13						TTCTGAACACGATTGATGACA	0.537																																						dbGAP											0													139.0	82.0	101.0					X																	65824951		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF298812	CCDS14386.1, CCDS56603.1	Xq11.1	2013-05-22			ENSG00000131080	ENSG00000131080		"""Tumor necrosis factor receptor superfamily"""	17756	protein-coding gene	gene with protein product		300276				11039935	Standard	NM_021783		Approved	XEDAR, EDA-A2R, EDAA2R, TNFRSF27	uc004dwt.2	Q9HAV5	OTTHUMG00000021736	ENST00000374719.3:c.205C>G	X.37:g.65824951G>C	ENSP00000363851:p.Arg69Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYX9|Q5VYY0|Q6UWM2|Q8IZA6	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_27,pfscan_TNFR/NGFR_Cys_rich_reg	p.R69G	ENST00000374719.3	37	c.205	CCDS14386.1	X	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220912	0.58560	.	.	ENSG00000131080	ENST00000374719;ENST00000396050;ENST00000253392;ENST00000456230;ENST00000450752	D;D;D;D;D	0.91124	-2.79;-2.79;-2.79;-2.79;-2.79	3.9	2.12	0.27331	TNFR/CD27/30/40/95 cysteine-rich region (4);	0.394019	0.20802	N	0.085420	D	0.91408	0.7289	M	0.68317	2.08	0.80722	D	1	P;P;P	0.51537	0.946;0.938;0.8	P;P;P	0.55055	0.736;0.767;0.476	D	0.88851	0.3319	10	0.87932	D	0	-0.2188	7.0303	0.24962	0.2355:0.0:0.7645:0.0	.	69;69;69	Q9HAV5-2;B2RBZ9;Q9HAV5	.;.;TNR27_HUMAN	G	69	ENSP00000363851:R69G;ENSP00000379365:R69G;ENSP00000253392:R69G;ENSP00000393935:R69G;ENSP00000402929:R69G	ENSP00000253392:R69G	R	-	1	0	EDA2R	65741676	1.000000	0.71417	0.553000	0.28255	0.989000	0.77384	3.066000	0.50002	0.199000	0.20427	0.600000	0.82982	CGT	EDA2R	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg	ENSG00000131080		0.537	EDA2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDA2R	HGNC	protein_coding	OTTHUMT00000057002.1	48	0.00	0	G	NM_021783		65824951	65824951	-1	no_errors	ENST00000253392	ensembl	human	known	69_37n	missense	17	18.18	4	SNP	1.000	C
EPN3	55040	genome.wustl.edu	37	17	48616614	48616614	+	Nonsense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr17:48616614C>T	ENST00000268933.3	+	5	1408	c.829C>T	c.(829-831)Cag>Tag	p.Q277*	EPN3_ENST00000537145.1_Nonsense_Mutation_p.Q305*|EPN3_ENST00000541226.1_Nonsense_Mutation_p.Q194*|RP11-94C24.8_ENST00000513017.1_RNA	NM_017957.2	NP_060427.2	Q9H201	EPN3_HUMAN	epsin 3	277						clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	lipid binding (GO:0008289)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(1)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;2.88e-09)			GGTCCACCATCAGCGGGACAG	0.602																																						dbGAP											0													93.0	92.0	92.0					17																	48616614		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF324241	CCDS11570.1	17q21.33	2008-07-18				ENSG00000049283			18235	protein-coding gene	gene with protein product		607264				10951261, 11359770	Standard	NM_017957		Approved	FLJ20778, MGC129899	uc002ira.4	Q9H201		ENST00000268933.3:c.829C>T	17.37:g.48616614C>T	ENSP00000268933:p.Gln277*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J3|A8KAB2|Q9BVN6|Q9NWK2	Nonsense_Mutation	SNP	pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.Q305*	ENST00000268933.3	37	c.913	CCDS11570.1	17	.	.	.	.	.	.	.	.	.	.	C	22.0	4.235454	0.79800	.	.	ENSG00000049283	ENST00000268933;ENST00000442715;ENST00000537145;ENST00000541226;ENST00000411703	.	.	.	4.65	3.54	0.40534	.	1.875660	0.03564	N	0.227440	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	0.0976	8.3468	0.32277	0.0:0.8685:0.0:0.1315	.	.	.	.	X	277;305;305;194;277	.	ENSP00000268933:Q277X	Q	+	1	0	EPN3	45971613	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.044000	0.12023	0.702000	0.31825	0.313000	0.20887	CAG	EPN3	-	NULL	ENSG00000049283		0.602	EPN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN3	HGNC	protein_coding	OTTHUMT00000367573.1	46	0.00	0	C	NM_017957		48616614	48616614	+1	no_errors	ENST00000537145	ensembl	human	known	69_37n	nonsense	13	31.58	6	SNP	0.003	T
FAHD1	81889	genome.wustl.edu	37	16	1877569	1877569	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr16:1877569G>C	ENST00000427358.2	+	1	345	c.339G>C	c.(337-339)aaG>aaC	p.K113N	FAHD1_ENST00000382666.4_Missense_Mutation_p.K113N|HAGH_ENST00000397356.3_5'Flank|HAGH_ENST00000397353.2_5'Flank|HAGH_ENST00000455446.2_5'Flank|FAHD1_ENST00000382668.4_Missense_Mutation_p.K113N|HAGH_ENST00000566709.1_5'Flank	NM_031208.3	NP_112485.1	Q6P587	FAHD1_HUMAN	fumarylacetoacetate hydrolase domain containing 1	113						cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetylpyruvate hydrolase activity (GO:0018773)|acylpyruvate hydrolase activity (GO:0047621)|fumarylpyruvate hydrolase activity (GO:0034545)|metal ion binding (GO:0046872)			NS(1)|large_intestine(1)|liver(1)|ovary(2)|urinary_tract(1)	6						ACGAGTGCAAGAAGAAGGGGC	0.662																																						dbGAP											0													33.0	31.0	32.0					16																	1877569		2199	4300	6499	-	-	-	SO:0001583	missense	0			BC063017	CCDS10448.1, CCDS32367.1, CCDS45380.1	16p13.3	2011-10-21	2004-08-19	2004-08-26	ENSG00000180185	ENSG00000180185			14169	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 36"""	C16orf36		21878618	Standard	NM_001018104		Approved	DKFZP566J2046	uc002cnd.3	Q6P587	OTTHUMG00000128663	ENST00000427358.2:c.339G>C	16.37:g.1877569G>C	ENSP00000398053:p.Lys113Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK40|B1AK41|Q6FIC7|Q96RY1|Q9H0N6	Missense_Mutation	SNP	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	p.K113N	ENST00000427358.2	37	c.339	CCDS10448.1	16	.	.	.	.	.	.	.	.	.	.	G	21.6	4.180207	0.78564	.	.	ENSG00000180185	ENST00000382668;ENST00000382666;ENST00000427358	D;D;D	0.95035	-3.59;-3.59;-3.59	4.53	1.45	0.22620	Fumarylacetoacetase, C-terminal-related (2);Fumarylacetoacetase, C-terminal (1);	0.117349	0.56097	D	0.000027	D	0.97087	0.9048	M	0.94021	3.485	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.979;0.991;0.988	D	0.94948	0.8097	10	0.72032	D	0.01	.	5.9745	0.19371	0.2442:0.14:0.6158:0.0	.	113;113;113	Q6P587-2;B1AK40;Q6P587	.;.;FAHD1_HUMAN	N	113	ENSP00000372114:K113N;ENSP00000372112:K113N;ENSP00000398053:K113N	ENSP00000372112:K113N	K	+	3	2	FAHD1	1817570	1.000000	0.71417	0.964000	0.40570	0.967000	0.64934	3.769000	0.55303	0.163000	0.19507	-0.136000	0.14681	AAG	FAHD1	-	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	ENSG00000180185		0.662	FAHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAHD1	HGNC	protein_coding	OTTHUMT00000250550.2	60	0.00	0	G	NM_001018104		1877569	1877569	+1	no_errors	ENST00000382666	ensembl	human	known	69_37n	missense	36	11.90	5	SNP	1.000	C
FAM200A	221786	genome.wustl.edu	37	7	99145135	99145135	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr7:99145135G>A	ENST00000449309.1	-	2	1275	c.896C>T	c.(895-897)aCa>aTa	p.T299I		NM_145111.3	NP_659802.1	Q8TCP9	F200A_HUMAN	family with sequence similarity 200, member A	299						integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			endometrium(1)|kidney(5)|large_intestine(2)|ovary(2)|skin(1)	11						acgaacttctgtatgaaacaa	0.358																																						dbGAP											0													23.0	22.0	22.0					7																	99145135		1535	2697	4232	-	-	-	SO:0001583	missense	0				CCDS5668.1	7q22.1	2010-02-22	2010-02-22	2010-02-22	ENSG00000221909	ENSG00000221909			25401	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 38"""	C7orf38		10607616	Standard	NM_145111		Approved	FLJ36794, DKFZp727G131	uc003ura.3	Q8TCP9	OTTHUMG00000156723	ENST00000449309.1:c.896C>T	7.37:g.99145135G>A	ENSP00000411372:p.Thr299Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D293|A8K3V9|B2RD92|C9J6A8|D6W5T2|Q8N9P3	Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.T299I	ENST00000449309.1	37	c.896	CCDS5668.1	7	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933546	0.34096	.	.	ENSG00000221909	ENST00000449309;ENST00000408938	D;D	0.83837	-1.77;-1.77	2.12	2.12	0.27331	Ribonuclease H-like (1);	0.382752	0.19781	N	0.106206	D	0.86033	0.5836	M	0.66297	2.02	0.21878	N	0.999495	D	0.61080	0.989	P	0.61070	0.883	T	0.75096	-0.3438	10	0.52906	T	0.07	.	7.7759	0.29037	0.0:0.0:1.0:0.0	.	299	Q8TCP9	F200A_HUMAN	I	299	ENSP00000411372:T299I;ENSP00000386191:T299I	ENSP00000386191:T299I	T	-	2	0	FAM200A	98983071	0.992000	0.36948	0.707000	0.30419	0.600000	0.36913	2.286000	0.43496	1.480000	0.48289	0.467000	0.42956	ACA	FAM200A	-	superfamily_RNaseH-like_dom	ENSG00000221909		0.358	FAM200A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM200A	HGNC	protein_coding	OTTHUMT00000345467.1	31	0.00	0	G	NM_145111		99145135	99145135	-1	no_errors	ENST00000449309	ensembl	human	known	69_37n	missense	12	20.00	3	SNP	0.893	A
FBXW10	10517	genome.wustl.edu	37	17	18668054	18668054	+	Splice_Site	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr17:18668054G>C	ENST00000395665.4	+	8	1654		c.e8-1		FBXW10_ENST00000395667.1_Splice_Site|FBXW10_ENST00000308799.4_Splice_Site|FBXW10_ENST00000301938.4_Splice_Site			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10											NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GATTCCTGCAGATACTGGGAT	0.493																																						dbGAP											0													63.0	64.0	64.0					17																	18668054		2203	4298	6501	-	-	-	SO:0001630	splice_region_variant	0			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1434-1G>C	17.37:g.18668054G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Splice_Site	SNP	-	e7-1	ENST00000395665.4	37	c.1521-1	CCDS11199.3	17	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508135	0.44660	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	.	.	.	3.59	3.59	0.41128	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.7857	0.57504	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FBXW10	18608779	1.000000	0.71417	1.000000	0.80357	0.617000	0.37484	7.838000	0.86804	1.831000	0.53308	0.194000	0.17425	.	FBXW10	-	-	ENSG00000171931		0.493	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	HGNC	protein_coding	OTTHUMT00000313531.2	61	0.00	0	G	NM_031456	Intron	18668054	18668054	+1	no_errors	ENST00000308799	ensembl	human	known	69_37n	splice_site	36	12.20	5	SNP	1.000	C
FCRL1	115350	genome.wustl.edu	37	1	157771818	157771818	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:157771818C>T	ENST00000368176.3	-	5	840	c.773G>A	c.(772-774)gGa>gAa	p.G258E	FCRL1_ENST00000491942.1_Missense_Mutation_p.G258E|FCRL1_ENST00000358292.3_Missense_Mutation_p.G258E|FCRL1_ENST00000489998.1_5'UTR	NM_001159398.1|NM_052938.4	NP_001152870.1|NP_443170.1	Q96LA6	FCRL1_HUMAN	Fc receptor-like 1	258	Ig-like C2-type 3.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(24)|ovary(4)|prostate(1)|skin(6)	42	all_hematologic(112;0.0378)		LUSC - Lung squamous cell carcinoma(543;0.24)			GGAGGCTCCTCCTCCAGAGGG	0.587																																					GBM(54;482 1003 11223 30131 35730)	dbGAP											0													59.0	63.0	61.0					1																	157771818		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033690	CCDS1170.1, CCDS53382.1, CCDS53383.1	1q21-q22	2013-01-14			ENSG00000163534	ENSG00000163534		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18509	protein-coding gene	gene with protein product		606508				11493702, 11929751	Standard	NM_052938		Approved	FCRH1, IRTA5, IFGP1, CD307a	uc001frg.3	Q96LA6	OTTHUMG00000019398	ENST00000368176.3:c.773G>A	1.37:g.157771818C>T	ENSP00000357158:p.Gly258Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE05|Q8N759|Q8NDI0|Q96PJ6	Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G258E	ENST00000368176.3	37	c.773	CCDS1170.1	1	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681447	0.68042	.	.	ENSG00000163534	ENST00000358292;ENST00000368176;ENST00000491942	T;T;T	0.03212	4.01;4.01;4.01	5.1	4.17	0.49024	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.376631	0.26035	N	0.026726	T	0.09512	0.0234	M	0.83774	2.66	0.32028	N	0.599865	D;D;D	0.76494	0.996;0.999;0.995	D;D;D	0.74023	0.982;0.982;0.927	T	0.01819	-1.1267	9	.	.	.	.	9.9963	0.41902	0.0:0.9067:0.0:0.0933	.	258;258;258	Q96LA6-3;Q96LA6-2;Q96LA6	.;.;FCRL1_HUMAN	E	258	ENSP00000351039:G258E;ENSP00000357158:G258E;ENSP00000418130:G258E	.	G	-	2	0	FCRL1	156038442	0.631000	0.27164	0.996000	0.52242	0.949000	0.60115	2.105000	0.41825	1.497000	0.48584	0.650000	0.86243	GGA	FCRL1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000163534		0.587	FCRL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCRL1	HGNC	protein_coding	OTTHUMT00000051401.1	37	0.00	0	C	NM_052938		157771818	157771818	-1	no_errors	ENST00000368176	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.999	T
GPR116	221395	genome.wustl.edu	37	6	46826492	46826492	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr6:46826492G>A	ENST00000283296.7	-	17	3436	c.3148C>T	c.(3148-3150)Cgc>Tgc	p.R1050C	GPR116_ENST00000545669.1_Missense_Mutation_p.R479C|GPR116_ENST00000456426.2_Missense_Mutation_p.R908C|GPR116_ENST00000265417.7_Missense_Mutation_p.R1050C|GPR116_ENST00000362015.4_Missense_Mutation_p.R1050C	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	1050					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			CAGGTGTGGCGCATATAAGAA	0.517																																					NSCLC(59;410 1274 8751 36715 50546)	dbGAP											0													68.0	66.0	67.0					6																	46826492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.3148C>T	6.37:g.46826492G>A	ENSP00000283296:p.Arg1050Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.R1050C	ENST00000283296.7	37	c.3148	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	G	22.6	4.307436	0.81247	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27	5.31	5.31	0.75309	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000009	T	0.65585	0.2705	M	0.91196	3.185	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;0.999;1.0;0.999	T	0.73943	-0.3823	10	0.87932	D	0	-20.9214	19.3365	0.94320	0.0:0.0:1.0:0.0	.	479;605;1050;908;1050	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	C	1050;1050;1050;908;421;1050;479	ENSP00000283296:R1050C;ENSP00000354563:R1050C;ENSP00000412866:R908C;ENSP00000265417:R1050C;ENSP00000441581:R479C	ENSP00000265417:R1050C	R	-	1	0	GPR116	46934451	1.000000	0.71417	1.000000	0.80357	0.737000	0.42083	9.779000	0.99018	2.642000	0.89623	0.650000	0.86243	CGC	GPR116	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_Ig-hepta_rcpt	ENSG00000069122		0.517	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2	56	0.00	0	G	NM_015234		46826492	46826492	-1	no_errors	ENST00000265417	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	A
IL22RA1	58985	genome.wustl.edu	37	1	24469556	24469556	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:24469556G>A	ENST00000270800.1	-	1	55	c.17C>T	c.(16-18)aCc>aTc	p.T6I		NM_021258.3	NP_067081.2	Q8N6P7	I22R1_HUMAN	interleukin 22 receptor, alpha 1	6					cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)	integral component of membrane (GO:0016021)	interferon receptor activity (GO:0004904)			breast(2)|endometrium(2)|large_intestine(4)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000992)|all_lung(284;0.00138)|Ovarian(437;0.00348)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;3.84e-24)|Colorectal(126;6.43e-08)|COAD - Colon adenocarcinoma(152;3.51e-06)|GBM - Glioblastoma multiforme(114;5.06e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00104)|KIRC - Kidney renal clear cell carcinoma(1967;0.00371)|STAD - Stomach adenocarcinoma(196;0.00911)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.148)		AGTCAAGATGGTCAGCAGCGT	0.637																																						dbGAP											0													89.0	71.0	77.0					1																	24469556		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF286095	CCDS247.1	1p36.11	2009-10-06	2002-12-02	2002-12-06	ENSG00000142677	ENSG00000142677		"""Interleukins and interleukin receptors"""	13700	protein-coding gene	gene with protein product		605457	"""interleukin 22 receptor"""	IL22R		10875937	Standard	NM_021258		Approved	CRF2-9	uc001biq.2	Q8N6P7	OTTHUMG00000003041	ENST00000270800.1:c.17C>T	1.37:g.24469556G>A	ENSP00000270800:p.Thr6Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K839|B2R9Y9|Q9HB22	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.T6I	ENST00000270800.1	37	c.17	CCDS247.1	1	.	.	.	.	.	.	.	.	.	.	G	11.04	1.521769	0.27211	.	.	ENSG00000142677	ENST00000270800	T	0.08102	3.13	4.34	3.42	0.39159	.	0.833377	0.10848	N	0.627520	T	0.13286	0.0322	L	0.57536	1.79	0.25935	N	0.982942	P	0.48640	0.913	P	0.48141	0.568	T	0.13764	-1.0497	10	0.23302	T	0.38	-0.6504	9.0893	0.36601	0.1065:0.0:0.8935:0.0	.	6	Q8N6P7	I22R1_HUMAN	I	6	ENSP00000270800:T6I	ENSP00000270800:T6I	T	-	2	0	IL22RA1	24342143	1.000000	0.71417	0.999000	0.59377	0.964000	0.63967	1.707000	0.37888	1.136000	0.42199	0.563000	0.77884	ACC	IL22RA1	-	NULL	ENSG00000142677		0.637	IL22RA1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	IL22RA1	HGNC	protein_coding	OTTHUMT00000008412.1	44	0.00	0	G			24469556	24469556	-1	no_errors	ENST00000270800	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	A
IL4R	3566	genome.wustl.edu	37	16	27374149	27374149	+	Silent	SNP	A	A	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr16:27374149A>T	ENST00000395762.2	+	11	1735	c.1476A>T	c.(1474-1476)gcA>gcT	p.A492A	IL4R_ENST00000543915.2_Silent_p.A492A|IL4R_ENST00000170630.2_Silent_p.A492A|IL4R_ENST00000380922.3_Silent_p.A477A	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	492	Required for IRS1 activation and IL4- induced cell growth.		A -> T (in dbSNP:rs35606110).|A -> V (in dbSNP:rs34727572).		defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						TCGTCATCGCAGGCAACCCTG	0.637																																						dbGAP											0													91.0	95.0	93.0					16																	27374149		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.1476A>T	16.37:g.27374149A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Silent	SNP	pfam_IL4Ra_N,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.A492	ENST00000395762.2	37	c.1476	CCDS10629.1	16																																																																																			IL4R	-	NULL	ENSG00000077238		0.637	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	26	0.00	0	A			27374149	27374149	+1	no_errors	ENST00000170630	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	0.001	T
KDM2B	84678	genome.wustl.edu	37	12	121868126	121868126	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr12:121868126G>T	ENST00000377071.4	-	23	4048	c.3976C>A	c.(3976-3978)Caa>Aaa	p.Q1326K	RNF34_ENST00000392464.2_Missense_Mutation_p.L451F|KDM2B_ENST00000377069.4_Intron|KDM2B_ENST00000542973.1_Missense_Mutation_p.Q694K|KDM2B_ENST00000536437.1_3'UTR	NM_032590.4	NP_115979.3	Q8NHM5	KDM2B_HUMAN	lysine (K)-specific demethylase 2B	1326					embryonic camera-type eye morphogenesis (GO:0048596)|forebrain development (GO:0030900)|fourth ventricle development (GO:0021592)|hindbrain development (GO:0030902)|histone demethylation (GO:0016577)|histone H2A monoubiquitination (GO:0035518)|initiation of neural tube closure (GO:0021993)|lateral ventricle development (GO:0021670)|midbrain development (GO:0030901)|midbrain-hindbrain boundary morphogenesis (GO:0021555)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|spermatogenesis (GO:0007283)|third ventricle development (GO:0021678)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (GO:0032452)|histone demethylase activity (H3-K36 specific) (GO:0051864)|rRNA binding (GO:0019843)|zinc ion binding (GO:0008270)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	19						TCTTCTACTTGCCCAAACTGG	0.468																																						dbGAP											0													131.0	123.0	126.0					12																	121868126		1894	4126	6020	-	-	-	SO:0001583	missense	0			AJ459424	CCDS41849.1, CCDS41850.1	12q24.31	2014-02-18	2009-04-06	2009-04-06	ENSG00000089094	ENSG00000089094		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13610	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1B"""	609078	"""F-box and leucine-rich repeat protein 10"""	FBXL10		10799292	Standard	NM_032590		Approved	PCCX2, CXXC2, Fbl10, JHDM1B	uc001uat.3	Q8NHM5	OTTHUMG00000169071	ENST00000377071.4:c.3976C>A	12.37:g.121868126G>T	ENSP00000366271:p.Gln1326Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRS1|Q8NCI2|Q96HC7|Q96SL0|Q96T03|Q9NS96|Q9UF75	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.Q1326K	ENST00000377071.4	37	c.3976	CCDS41850.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.445350|4.445350	0.83993|0.83993	.|.	.|.	ENSG00000170633|ENSG00000089094	ENST00000392464|ENST00000397480;ENST00000542973;ENST00000377071;ENST00000540043	T|T;T	0.38722|0.22539	1.12|2.27;1.95	5.61|5.61	4.71|4.71	0.59529|0.59529	.|.	.|0.000000	.|0.51477	.|D	.|0.000100	T|T	0.16085|0.16085	0.0387|0.0387	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	.|B;B;B	.|0.30741	.|0.032;0.293;0.011	.|B;B;B	.|0.26864	.|0.074;0.039;0.003	T|T	0.03034|0.03034	-1.1080|-1.1080	6|10	.|0.51188	.|T	.|0.08	-11.503|-11.503	15.9194|15.9194	0.79547|0.79547	0.0:0.0:0.8637:0.1363|0.0:0.0:0.8637:0.1363	.|.	.|766;1326;769	.|B7ZB05;Q8NHM5;B4DSN4	.|.;KDM2B_HUMAN;.	F|K	451|1316;694;1326;769	ENSP00000376257:L451F|ENSP00000437821:Q694K;ENSP00000366271:Q1326K	.|ENSP00000366271:Q1326K	L|Q	+|-	3|1	2|0	RNF34|KDM2B	120352509|120352509	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	9.807000|9.807000	0.99171|0.99171	1.354000|1.354000	0.45846|0.45846	0.655000|0.655000	0.94253|0.94253	TTG|CAA	KDM2B	-	NULL	ENSG00000089094		0.468	KDM2B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KDM2B	HGNC	protein_coding	OTTHUMT00000402132.2	45	0.00	0	G	NM_032590		121868126	121868126	-1	no_errors	ENST00000377071	ensembl	human	known	69_37n	missense	26	10.34	3	SNP	1.000	T
KDM6B	23135	genome.wustl.edu	37	17	7752915	7752915	+	Silent	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr17:7752915G>A	ENST00000448097.2	+	11	3640	c.3309G>A	c.(3307-3309)ctG>ctA	p.L1103L	KDM6B_ENST00000254846.5_Silent_p.L1103L			O15054	KDM6B_HUMAN	lysine (K)-specific demethylase 6B	1103					cardiac muscle cell differentiation (GO:0055007)|cellular response to hydrogen peroxide (GO:0070301)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|mesodermal cell differentiation (GO:0048333)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)	p.L1103L(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(3)|lung(18)|ovary(1)|pancreas(1)|skin(5)	37						CCAAGGAGCTGAAGATCCGGC	0.627																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											18.0	22.0	20.0					17																	7752915		2202	4294	6496	-	-	-	SO:0001819	synonymous_variant	0			AB002344	CCDS32552.1	17p13.1	2011-07-01	2009-04-17	2009-04-17		ENSG00000132510		"""Chromatin-modifying enzymes / K-demethylases"""	29012	protein-coding gene	gene with protein product		611577	"""jumonji domain containing 3"", ""jumonji domain containing 3, histone lysine demethylase"""	JMJD3		10662545, 9205841	Standard	NM_001080424		Approved	KIAA0346	uc002giw.1	O15054		ENST00000448097.2:c.3309G>A	17.37:g.7752915G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZ40|Q96G33	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.L1103	ENST00000448097.2	37	c.3309		17																																																																																			KDM6B	-	NULL	ENSG00000132510		0.627	KDM6B-002	KNOWN	basic	protein_coding	KDM6B	HGNC	protein_coding	OTTHUMT00000440248.1	72	0.00	0	G	XM_043272		7752915	7752915	+1	no_errors	ENST00000254846	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	1.000	A
KIAA1524	57650	genome.wustl.edu	37	3	108271220	108271220	+	Splice_Site	SNP	T	T	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr3:108271220T>G	ENST00000295746.8	-	20	2484	c.2408A>C	c.(2407-2409)aAt>aCt	p.N803T	KIAA1524_ENST00000491772.1_Splice_Site_p.N644T	NM_020890.2	NP_065941.2	Q8TCG1	CIP2A_HUMAN	KIAA1524	803					positive regulation of neural precursor cell proliferation (GO:2000179)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(21)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TTGATGCAAATCTTAAAAGAA	0.303																																						dbGAP											0													76.0	72.0	73.0					3																	108271220		2195	4296	6491	-	-	-	SO:0001630	splice_region_variant	0			AB040957	CCDS33812.1	3q13.13	2014-01-14			ENSG00000163507	ENSG00000163507			29302	protein-coding gene	gene with protein product	"""cancerous inhibitor of protein phosphatase 2A"""	610643				10819331, 24214971	Standard	NM_020890		Approved	CIP2A	uc003dxb.4	Q8TCG1	OTTHUMG00000159233	ENST00000295746.8:c.2408-1A>C	3.37:g.108271220T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4J7|B9EGC3|Q6P4G6|Q8WVP8|Q96PI2|Q9H9C6|Q9P204	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.N803T	ENST00000295746.8	37	c.2408	CCDS33812.1	3	.	.	.	.	.	.	.	.	.	.	T	5.314	0.243210	0.10077	.	.	ENSG00000163507	ENST00000491772;ENST00000295746	T;T	0.54071	1.56;0.59	4.91	3.76	0.43208	.	0.245373	0.49305	D	0.000157	T	0.36826	0.0981	L	0.44542	1.39	0.34995	D	0.755417	B	0.19583	0.037	B	0.15484	0.013	T	0.36915	-0.9728	10	0.20519	T	0.43	.	4.345	0.11129	0.0:0.1768:0.184:0.6391	.	803	Q8TCG1	CIP2A_HUMAN	T	644;803	ENSP00000419487:N644T;ENSP00000295746:N803T	ENSP00000295746:N803T	N	-	2	0	KIAA1524	109753910	1.000000	0.71417	0.999000	0.59377	0.856000	0.48823	2.194000	0.42668	1.820000	0.53075	0.455000	0.32223	AAT	KIAA1524	-	NULL	ENSG00000163507		0.303	KIAA1524-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1524	HGNC	protein_coding	OTTHUMT00000353975.2	67	0.00	0	T	NM_020890	Missense_Mutation	108271220	108271220	-1	no_errors	ENST00000295746	ensembl	human	known	69_37n	missense	62	13.89	10	SNP	1.000	G
KTI12	112970	genome.wustl.edu	37	1	52498476	52498476	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:52498476G>A	ENST00000371614.1	-	1	1012	c.958C>T	c.(958-960)Cgc>Tgc	p.R320C	RP11-91A18.4_ENST00000425802.1_RNA|TXNDC12_ENST00000371626.4_Intron	NM_138417.2	NP_612426.1	Q96EK9	KTI12_HUMAN	KTI12 homolog, chromatin associated (S. cerevisiae)	320							ATP binding (GO:0005524)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|stomach(2)|urinary_tract(1)	12						CGACGAAGGCGACTCAGTTCT	0.537																																						dbGAP											0													87.0	86.0	86.0					1																	52498476		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS562.1	1p32.3	2008-02-05			ENSG00000198841	ENSG00000198841			25160	protein-coding gene	gene with protein product						11929532	Standard	NM_138417		Approved	TOT4, MGC20419, SBBI81	uc001ctj.1	Q96EK9	OTTHUMG00000008630	ENST00000371614.1:c.958C>T	1.37:g.52498476G>A	ENSP00000360676:p.Arg320Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Chromatin_KTI12	p.R320C	ENST00000371614.1	37	c.958	CCDS562.1	1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.266656	0.80358	.	.	ENSG00000198841	ENST00000371614	T	0.38560	1.13	4.64	4.64	0.57946	.	0.076262	0.46145	U	0.000309	T	0.69205	0.3085	M	0.90922	3.16	0.58432	D	0.999996	D	0.89917	1.0	D	0.77004	0.989	T	0.76088	-0.3087	10	0.87932	D	0	.	11.8655	0.52490	0.0:0.0:0.8256:0.1744	.	320	Q96EK9	KTI12_HUMAN	C	320	ENSP00000360676:R320C	ENSP00000360676:R320C	R	-	1	0	KTI12	52271064	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.983000	0.49345	2.396000	0.81511	0.557000	0.71058	CGC	KTI12	-	pfam_Chromatin_KTI12	ENSG00000198841		0.537	KTI12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KTI12	HGNC	protein_coding	OTTHUMT00000023821.1	49	0.00	0	G	NM_138417		52498476	52498476	-1	no_errors	ENST00000371614	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	1.000	A
LDHA	3939	genome.wustl.edu	37	11	18418471	18418471	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr11:18418471G>A	ENST00000422447.3	+	2	355	c.82G>A	c.(82-84)Gtt>Att	p.V28I	LDHA_ENST00000540430.1_Missense_Mutation_p.V57I|LDHA_ENST00000379412.5_Missense_Mutation_p.V28I|LDHA_ENST00000396222.2_Missense_Mutation_p.V28I|LDHA_ENST00000430553.2_Missense_Mutation_p.V28I|LDHA_ENST00000542179.1_Missense_Mutation_p.V28I|LDHA_ENST00000227157.4_Missense_Mutation_p.V28I	NM_001135239.1|NM_005566.3	NP_001128711.1|NP_005557.1	P00338	LDHA_HUMAN	lactate dehydrogenase A	28					cellular carbohydrate metabolic process (GO:0044262)|cellular metabolic process (GO:0044237)|cellular response to extracellular stimulus (GO:0031668)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	L-lactate dehydrogenase activity (GO:0004459)			central_nervous_system(3)|endometrium(1)|large_intestine(4)|lung(4)	12						AGTTGTTGGGGTTGGTGCTGT	0.458																																						dbGAP											0													97.0	95.0	96.0					11																	18418471		2199	4293	6492	-	-	-	SO:0001583	missense	0			X02152	CCDS7839.1, CCDS44549.1, CCDS53609.1, CCDS53610.1, CCDS53611.1	11p15.1	2012-10-02			ENSG00000134333	ENSG00000134333	1.1.1.27		6535	protein-coding gene	gene with protein product		150000				3000353	Standard	NM_005566		Approved		uc010rdd.2	P00338	OTTHUMG00000167721	ENST00000422447.3:c.82G>A	11.37:g.18418471G>A	ENSP00000395337:p.Val28Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKQ2|B7Z5E3|D3DQY3|F8W819|Q53G53|Q6IBM7|Q6ZNV1|Q9UDE8|Q9UDE9	Missense_Mutation	SNP	pfam_Lactate/malate_DH_N,pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,prints_L-lactate/malate_DH,tigrfam_L-lactate_DH	p.V57I	ENST00000422447.3	37	c.169	CCDS7839.1	11	.	.	.	.	.	.	.	.	.	.	G	22.3	4.272938	0.80580	.	.	ENSG00000134333	ENST00000422447;ENST00000543445;ENST00000430553;ENST00000396222;ENST00000535451;ENST00000541620;ENST00000445376;ENST00000227157;ENST00000478970;ENST00000495052;ENST00000540430;ENST00000379412;ENST00000542179	D;D;D;D;D;D;D;D;D;D;D	0.91068	-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78;-2.78	5.02	5.02	0.67125	Lactate/malate dehydrogenase, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.94182	0.8133	M	0.75884	2.315	0.80722	D	1	D;B;B;B;B	0.54964	0.969;0.151;0.338;0.105;0.039	P;B;B;B;B	0.58013	0.831;0.232;0.167;0.093;0.086	D	0.93909	0.7195	10	0.51188	T	0.08	-1.7299	18.8997	0.92437	0.0:0.0:1.0:0.0	.	57;28;28;28;28	B7Z5E3;B4DKQ2;B4DJI1;F8W819;P00338	.;.;.;.;LDHA_HUMAN	I	28;28;28;28;28;28;28;28;28;28;57;28;28	ENSP00000395337:V28I;ENSP00000440161:V28I;ENSP00000406172:V28I;ENSP00000379524:V28I;ENSP00000444292:V28I;ENSP00000227157:V28I;ENSP00000441241:V28I;ENSP00000446415:V28I;ENSP00000445175:V57I;ENSP00000368722:V28I;ENSP00000445331:V28I	ENSP00000227157:V28I	V	+	1	0	LDHA	18375047	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.625000	0.98406	2.753000	0.94483	0.655000	0.94253	GTT	LDHA	-	pfam_Lactate/malate_DH_N,pirsf_L-lactate/malate_DH,prints_L-lactate/malate_DH,tigrfam_L-lactate_DH	ENSG00000134333		0.458	LDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDHA	HGNC	protein_coding	OTTHUMT00000258172.2	43	0.00	0	G	NM_005566		18418471	18418471	+1	no_errors	ENST00000540430	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	A
LPIN3	64900	genome.wustl.edu	37	20	39977448	39977448	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr20:39977448G>C	ENST00000373257.3	+	4	569	c.478G>C	c.(478-480)Gat>Cat	p.D160H		NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	160					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				AGTGGCAACTGATTCTAGTCC	0.612																																						dbGAP											0													46.0	44.0	45.0					20																	39977448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.478G>C	20.37:g.39977448G>C	ENSP00000362354:p.Asp160His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.D160H	ENST00000373257.3	37	c.478	CCDS33469.1	20	.	.	.	.	.	.	.	.	.	.	G	9.065	0.995386	0.19043	.	.	ENSG00000132793	ENST00000373257	T	0.81330	-1.48	4.53	0.425	0.16473	.	0.962124	0.08606	N	0.920738	T	0.77170	0.4091	L	0.47716	1.5	0.09310	N	1	P;P	0.39216	0.565;0.664	P;B	0.44647	0.456;0.293	T	0.64347	-0.6429	9	.	.	.	-2.4545	7.8683	0.29549	0.372:0.0:0.628:0.0	.	160;160	Q9BQK8-2;Q9BQK8	.;LPIN3_HUMAN	H	160	ENSP00000362354:D160H	.	D	+	1	0	LPIN3	39410862	0.006000	0.16342	0.008000	0.14137	0.291000	0.27294	0.929000	0.28844	0.259000	0.21709	0.655000	0.94253	GAT	LPIN3	-	NULL	ENSG00000132793		0.612	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LPIN3	HGNC	protein_coding	OTTHUMT00000080393.1	41	0.00	0	G	NM_022896		39977448	39977448	+1	no_errors	ENST00000373257	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.000	C
MARK2	2011	genome.wustl.edu	37	11	63657700	63657700	+	Intron	SNP	G	G	T	rs201209023		TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr11:63657700G>T	ENST00000509502.2	+	1	418				MARK2_ENST00000350490.7_Intron|MARK2_ENST00000413835.2_Intron|MARK2_ENST00000361128.5_Intron|MARK2_ENST00000502399.3_Intron|MARK2_ENST00000508192.1_Intron|MARK2_ENST00000377810.3_Intron|MARK2_ENST00000377809.4_Intron|MARK2_ENST00000402010.2_Intron|MARK2_ENST00000315032.8_Intron	NM_017490.3	NP_059672.2			MAP/microtubule affinity-regulating kinase 2									p.C16F(1)		autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33						CCAGTGGCTTGCCTCCTTACC	0.512																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											18.0	18.0	18.0					11																	63657700		874	1989	2863	-	-	-	SO:0001627	intron_variant	0			BC008771	CCDS8051.1, CCDS41665.1, CCDS8051.2, CCDS53649.1, CCDS53650.1, CCDS53651.1	11q13.1	2013-06-27	2002-07-26	2002-08-01	ENSG00000072518	ENSG00000072518			3332	protein-coding gene	gene with protein product	"""ELKL motif kinase 1"", ""serine/threonine kinase"", ""protein-serine/threonine kinase"", ""Ser/Thr protein kinase PAR-1B"""	600526	"""ELKL motif kinase"""	EMK1		9730619, 10516437	Standard	NM_017490		Approved	PAR-1, Par1b, PAR-1B	uc001nxw.3	Q7KZI7	OTTHUMG00000160504	ENST00000509502.2:c.-46+1264G>T	11.37:g.63657700G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.C16F	ENST00000509502.2	37	c.47	CCDS41665.1	11	.	.	.	.	.	.	.	.	.	.	G	0.077	-1.190453	0.01607	.	.	ENSG00000072518	ENST00000512060;ENST00000535394	.	.	.	1.27	0.117	0.14652	.	.	.	.	.	T	0.27933	0.0688	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27365	-1.0076	7	0.87932	D	0	.	4.1204	0.10103	0.0:0.0:0.4228:0.5772	.	16	Q5DNC5	.	F	16	.	ENSP00000423844:C16F	C	+	2	0	MARK2	63414276	0.000000	0.05858	0.003000	0.11579	0.005000	0.04900	-0.294000	0.08309	0.007000	0.14760	-0.397000	0.06425	TGC	MARK2	-	NULL	ENSG00000072518		0.512	MARK2-003	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	MARK2	HGNC	protein_coding	OTTHUMT00000360862.2	78	0.00	0	G	NM_017490		63657700	63657700	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000512060	ensembl	human	putative	69_37n	missense	23	55.77	29	SNP	0.003	T
MAVS	57506	genome.wustl.edu	37	20	3846420	3846420	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr20:3846420G>C	ENST00000428216.2	+	7	1377	c.1249G>C	c.(1249-1251)Gag>Cag	p.E417Q	MAVS_ENST00000358134.6_3'UTR|MAVS_ENST00000416600.2_Missense_Mutation_p.E276Q	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	417					activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						CCTTGGGTCGGAGCTGAGTAA	0.637																																						dbGAP											0													33.0	34.0	34.0					20																	3846420		2203	4300	6503	-	-	-	SO:0001583	missense	0			DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.1249G>C	20.37:g.3846420G>C	ENSP00000401980:p.Glu417Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Missense_Mutation	SNP	NULL	p.E417Q	ENST00000428216.2	37	c.1249	CCDS33437.1	20	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150672	0.37923	.	.	ENSG00000088888	ENST00000416600;ENST00000428216	T;T	0.51325	0.71;1.58	4.41	3.45	0.39498	.	0.862315	0.10486	N	0.669025	T	0.54127	0.1839	L	0.54323	1.7	0.26619	N	0.97269	D	0.60160	0.987	P	0.53518	0.728	T	0.41088	-0.9528	10	0.40728	T	0.16	-25.746	10.5107	0.44860	0.0:0.1962:0.8038:0.0	.	417	Q7Z434	MAVS_HUMAN	Q	276;417	ENSP00000413749:E276Q;ENSP00000401980:E417Q	ENSP00000413749:E276Q	E	+	1	0	MAVS	3794420	0.997000	0.39634	0.847000	0.33407	0.014000	0.08584	4.089000	0.57685	1.444000	0.47605	-0.175000	0.13238	GAG	MAVS	-	NULL	ENSG00000088888		0.637	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAVS	HGNC	protein_coding	OTTHUMT00000077784.3	67	0.00	0	G	NM_020746		3846420	3846420	+1	no_errors	ENST00000428216	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	0.845	C
MUC19	283463	genome.wustl.edu	37	12	40852535	40852535	+	Missense_Mutation	SNP	A	A	G	rs17128233	byFrequency	TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr12:40852535A>G	ENST00000454784.4	+	37	4043	c.3310A>G	c.(3310-3312)Aca>Gca	p.T1104A				Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	1104	Approximate repeats of G-V-T-G-T-T-G-P-S- A.		T -> A (in dbSNP:rs17128233).		cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						CTTTTTAGGAACAACTCTAGG	0.308													A|||	167	0.0333466	0.025	0.0288	5008	,	,		14806	0.001		0.0616	False		,,,				2504	0.0521					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.3310A>G	12.37:g.40852535A>G	ENSP00000476404:p.Thr1104Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA85	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_VWC_out,smart_Unchr_dom_Cys-rich	p.T1333A	ENST00000454784.4	37	c.3997		12	81	0.03708791208791209	17	0.034552845528455285	14	0.03867403314917127	2	0.0034965034965034965	48	0.0633245382585752	A	10.18	1.278442	0.23307	.	.	ENSG00000205592	ENST00000425730	.	.	.	3.11	0.746	0.18365	.	.	.	.	.	T	0.01320	0.0043	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.21724	-1.0237	6	0.09843	T	0.71	.	4.7853	0.13222	0.7229:0.0:0.2771:0.0	rs17128233;rs52837201;rs17128233	.	.	.	A	1333	.	ENSP00000395253:T1333A	T	+	1	0	MUC19	39138802	0.595000	0.26857	0.048000	0.18961	0.349000	0.29174	0.803000	0.27083	0.141000	0.18875	0.477000	0.44152	ACA	MUC19	-	NULL	ENSG00000205592		0.308	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	21	0.00	0	A	XM_003403524		40852535	40852535	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000425730	ensembl	human	novel	69_37n	missense	13	18.75	3	SNP	0.087	G
MUC6	4588	genome.wustl.edu	37	11	1015812	1015812	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr11:1015812G>T	ENST00000421673.2	-	31	7039	c.6989C>A	c.(6988-6990)cCt>cAt	p.P2330H		NM_005961.2	NP_005952.2	Q6W4X9	MUC6_HUMAN	mucin 6, oligomeric mucus/gel-forming	2330	Thr-rich.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(8)|kidney(10)|large_intestine(6)|lung(43)|ovary(4)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	80		all_cancers(49;3.3e-08)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		all cancers(45;1.24e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00031)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGCAGAAGCAGGGGTGCTTCC	0.617																																						dbGAP											0													82.0	92.0	89.0					11																	1015812		2136	4241	6377	-	-	-	SO:0001583	missense	0			U97698, AY312160	CCDS44513.1	11p15.5	2008-02-05	2006-03-14		ENSG00000184956	ENSG00000184956		"""Mucins"""	7517	protein-coding gene	gene with protein product		158374	"""mucin 6, gastric"""			7680650	Standard	NM_005961		Approved		uc001lsw.2	Q6W4X9	OTTHUMG00000165140	ENST00000421673.2:c.6989C>A	11.37:g.1015812G>T	ENSP00000406861:p.Pro2330His	Somatic		WXS	Illumina GAIIx	Phase_IV	O15329|Q14394|Q2TUQ5|Q4L207|Q8N8I1|Q8NAK1	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.P2330H	ENST00000421673.2	37	c.6989	CCDS44513.1	11	.	.	.	.	.	.	.	.	.	.	G	9.747	1.166427	0.21621	.	.	ENSG00000184956	ENST00000421673	T	0.20738	2.05	3.09	2.14	0.27477	.	.	.	.	.	T	0.09024	0.0223	N	0.14661	0.345	0.09310	N	1	P	0.49253	0.921	B	0.35813	0.211	T	0.14952	-1.0454	9	0.54805	T	0.06	.	3.814	0.08808	0.1469:0.2601:0.593:0.0	.	2330	Q6W4X9	MUC6_HUMAN	H	2330	ENSP00000406861:P2330H	ENSP00000406861:P2330H	P	-	2	0	MUC6	1005812	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	0.516000	0.22817	1.682000	0.51000	0.448000	0.29417	CCT	MUC6	-	NULL	ENSG00000184956		0.617	MUC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC6	HGNC	protein_coding	OTTHUMT00000382120.2	55	0.00	0	G	XM_290540		1015812	1015812	-1	no_errors	ENST00000421673	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	0.000	T
NAV1	89796	genome.wustl.edu	37	1	201751995	201751995	+	Silent	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:201751995C>T	ENST00000367296.4	+	6	2775	c.2355C>T	c.(2353-2355)ctC>ctT	p.L785L	NAV1_ENST00000367297.4_Silent_p.L785L|IPO9-AS1_ENST00000413035.1_RNA|NAV1_ENST00000295624.6_Silent_p.L785L|NAV1_ENST00000367295.1_Silent_p.L394L|NAV1_ENST00000367300.3_Silent_p.L785L|NAV1_ENST00000367302.1_Silent_p.L798L|NAV1_ENST00000469130.1_3'UTR	NM_020443.4	NP_065176.3	Q8NEY1	NAV1_HUMAN	neuron navigator 1	785					microtubule bundle formation (GO:0001578)|neuron migration (GO:0001764)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(5)|central_nervous_system(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(10)|lung(29)|ovary(4)|prostate(3)|skin(1)|stomach(2)	70						CAACCCCTCTCAGGTACCCAA	0.547																																						dbGAP											0													27.0	27.0	27.0					1																	201751995		2198	4293	6491	-	-	-	SO:0001819	synonymous_variant	0			AF086348	CCDS1414.1, CCDS1414.2, CCDS53456.1	1q32.3	2008-07-18			ENSG00000134369	ENSG00000134369			15989	protein-coding gene	gene with protein product	"""neuron navigator-1"", ""pore membrane and/or filament interacting like protein 3"""	611628				12079279, 12062803	Standard	NM_020443		Approved	FLJ12560, FLJ14203, KIAA1151, MGC14961, POMFIL3, steerin-1, DKFZp781D0314	uc001gwu.3	Q8NEY1	OTTHUMG00000035766	ENST00000367296.4:c.2355C>T	1.37:g.201751995C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MS88|Q5SVH1|Q5SVH2|Q5SVH3|Q5SVH7|Q5VUY9|Q8IVL2|Q96II1|Q9H7V9|Q9H9S9|Q9H9T5|Q9UGI1|Q9ULK7|Q9ULR9	Nonsense_Mutation	SNP	NULL	p.Q343*	ENST00000367296.4	37	c.1027	CCDS1414.2	1	.	.	.	.	.	.	.	.	.	.	C	14.00	2.406183	0.42715	.	.	ENSG00000134369	ENST00000430015	.	.	.	5.31	5.31	0.75309	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-20.0198	16.7706	0.85536	0.0:1.0:0.0:0.0	.	.	.	.	X	343	.	.	Q	+	1	0	NAV1	200018618	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.909000	0.48758	2.500000	0.84329	0.591000	0.81541	CAG	NAV1	-	NULL	ENSG00000134369		0.547	NAV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAV1	HGNC	protein_coding	OTTHUMT00000087013.1	17	0.00	0	C	NM_020443		201751995	201751995	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430015	ensembl	human	novel	69_37n	nonsense	12	42.86	9	SNP	1.000	T
NF1	4763	genome.wustl.edu	37	17	29541468	29541468	+	Splice_Site	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr17:29541468G>C	ENST00000358273.4	+	13	1775		c.e13-1		NF1_ENST00000356175.3_Splice_Site|NF1_ENST00000431387.4_Splice_Site	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1						actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(5)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		TTTGTTTTTAGAGTCTTACAT	0.294			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	13	Whole gene deletion(8)|Unknown(5)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(2)|lung(1)											23.0	24.0	24.0					17																	29541468		2161	4255	6416	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1393-1G>C	17.37:g.29541468G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Splice_Site	SNP	-	e13-1	ENST00000358273.4	37	c.1393-1	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	G	21.5	4.165071	0.78339	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0231	0.92922	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NF1	26565594	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	9.216000	0.95154	2.493000	0.84123	0.591000	0.81541	.	NF1	-	-	ENSG00000196712		0.294	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	167	0.00	0	G	NM_000267	Intron	29541468	29541468	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	splice_site	118	12.59	17	SNP	1.000	C
NKX1-2	390010	genome.wustl.edu	37	10	126136239	126136239	+	Missense_Mutation	SNP	A	A	G	rs146495217	byFrequency	TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr10:126136239A>G	ENST00000451024.3	-	2	932	c.692T>C	c.(691-693)gTg>gCg	p.V231A	RP13-238F13.3_ENST00000604581.1_RNA|RP13-238F13.5_ENST00000602332.1_lincRNA|NKX1-2_ENST00000440536.2_Missense_Mutation_p.V253A	NM_001146340.1	NP_001139812.1	Q9UD57	NKX12_HUMAN	NK1 homeobox 2	231	Gly-rich.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)										gccaccccccacctgcgccgc	0.731													A|||	576	0.115016	0.0227	0.1268	5008	,	,		5896	0.1022		0.1918	False		,,,				2504	0.1656					dbGAP											0													13.0	10.0	11.0					10																	126136239		692	1582	2274	-	-	-	SO:0001583	missense	0			CN285329	CCDS59221.1	10q26.13	2012-03-09	2007-07-09	2006-06-29		ENSG00000229544		"""Homeoboxes / ANTP class : NKL subclass"""	31652	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 121"", ""NK1 transcription factor related, locus 2 (Drosophila)"""	C10orf121		10681422	Standard	NM_001146340		Approved	bB238F13.2	uc010quf.2	Q9UD57		ENST00000451024.3:c.692T>C	10.37:g.126136239A>G	ENSP00000451945:p.Val231Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.V253A	ENST00000451024.3	37	c.758	CCDS59221.1	10	254	0.1163003663003663	18	0.036585365853658534	37	0.10220994475138122	68	0.11888111888111888	131	0.17282321899736147	A	0.003	-2.467059	0.00169	.	.	ENSG00000229544	ENST00000451024;ENST00000440536	D;D	0.88509	-2.35;-2.39	3.05	1.07	0.20283	Homeodomain-like (1);	.	.	.	.	T	0.00412	0.0013	N	0.04655	-0.195	0.80722	P	0.0	B	0.02656	0.0	B	0.04013	0.001	T	0.10567	-1.0624	7	.	.	.	.	1.4615	0.02397	0.1346:0.2139:0.4331:0.2183	.	231	Q9UD57	NKX12_HUMAN	A	231;253	ENSP00000451945:V231A;ENSP00000450924:V253A	.	V	-	2	0	NKX1-2	126126229	.	.	0.047000	0.18901	0.034000	0.12701	.	.	0.282000	0.22254	-0.475000	0.04921	GTG	NKX1-2	-	superfamily_Homeodomain-like	ENSG00000229544		0.731	NKX1-2-001	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NKX1-2	HGNC	protein_coding	OTTHUMT00000050861.3	20	0.00	0	A	XM_372331		126136239	126136239	-1	no_errors	ENST00000440536	ensembl	human	known	69_37n	missense	10	23.08	3	SNP	0.285	G
NLRC5	84166	genome.wustl.edu	37	16	57095775	57095775	+	Intron	SNP	C	C	T	rs3751710	byFrequency	TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr16:57095775C>T	ENST00000262510.6	+	32	4379				NLRC5_ENST00000308149.7_Intron|NLRC5_ENST00000436936.1_Intron|NLRC5_ENST00000539144.1_Intron	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GTCCCAGAGACTCCACAAGGC	0.512													C|||	499	0.0996406	0.0719	0.0922	5008	,	,		18391	0.0476		0.1571	False		,,,				2504	0.137					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.4154+162C>T	16.37:g.57095775C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L1138F	ENST00000262510.6	37	c.3412	CCDS10773.1	16	241|241	0.11034798534798534|0.11034798534798534	50|50	0.1016260162601626|0.1016260162601626	40|40	0.11049723756906077|0.11049723756906077	28|28	0.04895104895104895|0.04895104895104895	123|123	0.16226912928759896|0.16226912928759896	c|c	8.691|8.691	0.907468|0.907468	0.17833|0.17833	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000538805|ENST00000399221	.|.	.|.	.|.	2.61|2.61	1.65|1.65	0.23941|0.23941	.|.	.|.	.|.	.|.	.|.	T|T	0.00178|0.00178	0.0005|0.0005	.|.	.|.	.|.	0.58432|0.58432	P|P	2.9999999999752447E-6|2.9999999999752447E-6	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.09796|0.09796	-1.0658|-1.0658	3|3	.|.	.|.	.|.	.|.	5.1471|5.1471	0.14991|0.14991	0.0:0.8352:0.0:0.1648|0.0:0.8352:0.0:0.1648	rs3751710;rs17400583;rs58869278;rs3751710|rs3751710;rs17400583;rs58869278;rs3751710	.|.	.|.	.|.	F|I	1138|137	.|.	.|.	L|T	+|+	1|2	0|0	NLRC5|NLRC5	55653276|55653276	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.060000|0.060000	0.15804|0.15804	0.306000|0.306000	0.19279|0.19279	0.672000|0.672000	0.31204|0.31204	0.436000|0.436000	0.28706|0.28706	CTC|ACT	NLRC5	-	NULL	ENSG00000140853		0.512	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	56	0.00	0	C	NM_032206		57095775	57095775	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000538805	ensembl	human	putative	69_37n	missense	30	11.76	4	SNP	0.001	T
NUP155	9631	genome.wustl.edu	37	5	37358219	37358219	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr5:37358219T>G	ENST00000231498.3	-	4	630	c.427A>C	c.(427-429)Act>Cct	p.T143P	NUP155_ENST00000381843.2_Missense_Mutation_p.T84P|NUP155_ENST00000513532.1_Missense_Mutation_p.T143P	NM_153485.1	NP_705618.1	O75694	NU155_HUMAN	nucleoporin 155kDa	143					atrial cardiac muscle cell action potential (GO:0086014)|carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear envelope organization (GO:0006998)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			endometrium(1)|kidney(16)|large_intestine(5)|lung(29)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	62	all_lung(31;0.000137)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GCAAGAATAGTCTCACTAAGT	0.373																																						dbGAP											0													133.0	140.0	137.0					5																	37358219		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007558	CCDS3921.1, CCDS43310.1, CCDS64142.1	5p13.1	2008-02-05	2002-08-29		ENSG00000113569	ENSG00000113569			8063	protein-coding gene	gene with protein product		606694	"""nucleoporin 155kD"""			10191094	Standard	NM_153485		Approved	KIAA0791, N155	uc003jku.1	O75694	OTTHUMG00000090803	ENST00000231498.3:c.427A>C	5.37:g.37358219T>G	ENSP00000231498:p.Thr143Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UBE9|Q9UFL5	Missense_Mutation	SNP	pfam_Nucleoporin_Nup133/Nup155_C,pfam_Nucleoporin_Nup133/Nup155_N,superfamily_WD40_repeat_dom	p.T143P	ENST00000231498.3	37	c.427	CCDS3921.1	5	.	.	.	.	.	.	.	.	.	.	T	14.91	2.675194	0.47781	.	.	ENSG00000113569	ENST00000231498;ENST00000381843;ENST00000434056;ENST00000513532	T;T;T	0.51574	0.7;0.7;0.7	4.75	4.75	0.60458	Nucleoporin, Nup133/Nup155-like, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	L	0.53249	1.67	0.58432	D	0.999999	B;B	0.13145	0.002;0.007	B;B	0.23419	0.01;0.046	T	0.45571	-0.9252	10	0.52906	T	0.07	.	14.5531	0.68081	0.0:0.0:0.0:1.0	.	143;143	E9PF10;O75694	.;NU155_HUMAN	P	143;84;105;143	ENSP00000231498:T143P;ENSP00000371265:T84P;ENSP00000422019:T143P	ENSP00000231498:T143P	T	-	1	0	NUP155	37393976	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.068000	0.76748	1.914000	0.55421	0.528000	0.53228	ACT	NUP155	-	pfam_Nucleoporin_Nup133/Nup155_N	ENSG00000113569		0.373	NUP155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP155	HGNC	protein_coding	OTTHUMT00000207593.2	34	0.00	0	T	NM_153485, NM_004298		37358219	37358219	-1	no_errors	ENST00000231498	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	1.000	G
NUP214	8021	genome.wustl.edu	37	9	134010374	134010374	+	Silent	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr9:134010374C>T	ENST00000359428.5	+	8	1065	c.921C>T	c.(919-921)ctC>ctT	p.L307L	RP11-544A12.4_ENST00000586290.1_RNA|RP11-544A12.4_ENST00000589667.1_RNA|RP11-544A12.4_ENST00000587264.1_RNA|RP11-544A12.4_ENST00000588378.1_RNA|RP11-544A12.4_ENST00000415391.2_RNA|NUP214_ENST00000411637.2_Silent_p.L307L|NUP214_ENST00000451030.1_Silent_p.L307L|RP11-544A12.4_ENST00000589540.1_RNA|RP11-544A12.4_ENST00000587408.1_RNA|RP11-544A12.4_ENST00000590461.1_RNA			P35658	NU214_HUMAN	nucleoporin 214kDa	307	Seven-bladed beta propeller.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|gene expression (GO:0010467)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|regulation of cell cycle (GO:0051726)|regulation of glucose transport (GO:0010827)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|transporter activity (GO:0005215)			NS(1)|breast(9)|central_nervous_system(3)|endometrium(13)|kidney(2)|large_intestine(9)|liver(2)|lung(29)|ovary(2)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	86	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;3.42e-05)|Epithelial(140;0.000256)		ATTACTACCTCAGTTACATTG	0.448			T	"""DEK, SET, ABL1"""	"""AML, T-ALL"""																																Pancreas(4;24 48 25510 30394 32571)	dbGAP		Dom	yes		9	9q34.1	8021	nucleoporin 214kDa (CAN)		L	0													79.0	71.0	73.0					9																	134010374		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X64228	CCDS6940.1	9q34	2008-07-21	2002-08-29		ENSG00000126883	ENSG00000126883			8064	protein-coding gene	gene with protein product	"""nuclear pore complex protein Nup214"", ""CAN protein, putative oncogene"""	114350	"""nucleoporin 214kD (CAIN)"""			8108440, 2370860	Standard	NM_005085		Approved	CAIN, CAN, D9S46E, N214	uc004cag.3	P35658	OTTHUMG00000020816	ENST00000359428.5:c.921C>T	9.37:g.134010374C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFQ0|Q15010|Q3KQZ0|Q5JUP7|Q75R47|Q86XD3	Silent	SNP	smart_WD40_repeat	p.L307	ENST00000359428.5	37	c.921	CCDS6940.1	9																																																																																			NUP214	-	NULL	ENSG00000126883		0.448	NUP214-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NUP214	HGNC	protein_coding	OTTHUMT00000054694.2	29	0.00	0	C	NM_005085		134010374	134010374	+1	no_errors	ENST00000451030	ensembl	human	known	69_37n	silent	15	16.67	3	SNP	0.994	T
OAT	4942	genome.wustl.edu	37	10	126097424	126097424	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr10:126097424G>C	ENST00000368845.5	-	3	402	c.310C>G	c.(310-312)Caa>Gaa	p.Q104E	OAT_ENST00000467675.1_5'Flank|OAT_ENST00000539214.1_5'UTR	NM_000274.3	NP_000265.1	P04181	OAT_HUMAN	ornithine aminotransferase	104					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-proline biosynthetic process (GO:0055129)|protein hexamerization (GO:0034214)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ornithine-oxo-acid transaminase activity (GO:0004587)|pyridoxal phosphate binding (GO:0030170)			endometrium(2)|large_intestine(1)|lung(2)	5		all_lung(145;0.0271)|Lung NSC(174;0.0436)|Colorectal(57;0.102)|all_neural(114;0.116)			L-Ornithine(DB00129)	TTGTCCACTTGACTCTTCAGA	0.378																																						dbGAP											0													97.0	95.0	96.0					10																	126097424		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016928	CCDS7639.1, CCDS53586.1	10q26	2014-09-17	2010-01-20		ENSG00000065154	ENSG00000065154	2.6.1.13		8091	protein-coding gene	gene with protein product	"""Ornithine aminotransferase"", ""ornithine aminotransferase precursor"", ""gyrate atrophy"""	613349				1682785	Standard	NM_000274		Approved	HOGA	uc001lhp.3	P04181	OTTHUMG00000019213	ENST00000368845.5:c.310C>G	10.37:g.126097424G>C	ENSP00000357838:p.Gln104Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRF0|Q16068|Q16069|Q68CS0|Q6IAV9|Q9UD03	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_Orn_aminotrans	p.Q104E	ENST00000368845.5	37	c.310	CCDS7639.1	10	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102810	0.76983	.	.	ENSG00000065154	ENST00000368845	D	0.99167	-5.51	5.0	5.0	0.66597	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.99600	0.9855	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97732	1.0203	10	0.87932	D	0	-10.9234	19.1997	0.93707	0.0:0.0:1.0:0.0	.	104	P04181	OAT_HUMAN	E	104	ENSP00000357838:Q104E	ENSP00000357838:Q104E	Q	-	1	0	OAT	126087414	1.000000	0.71417	0.184000	0.23157	0.675000	0.39556	9.473000	0.97714	2.719000	0.93026	0.557000	0.71058	CAA	OAT	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_Orn_aminotrans	ENSG00000065154		0.378	OAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAT	HGNC	protein_coding	OTTHUMT00000050863.1	63	0.00	0	G	NM_000274		126097424	126097424	-1	no_errors	ENST00000368845	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	1.000	C
OBSCN	84033	genome.wustl.edu	37	1	228430947	228430947	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:228430947C>G	ENST00000422127.1	+	10	3037	c.2993C>G	c.(2992-2994)gCc>gGc	p.A998G	OBSCN_ENST00000366707.4_5'UTR|OBSCN_ENST00000284548.11_Missense_Mutation_p.A998G|OBSCN_ENST00000570156.2_Missense_Mutation_p.A1090G|OBSCN_ENST00000366709.4_5'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	998	Ig-like 10.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGGCAGGGGCCAGTGCCACG	0.592																																						dbGAP											0													24.0	25.0	25.0					1																	228430947		1997	4166	6163	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.2993C>G	1.37:g.228430947C>G	ENSP00000409493:p.Ala998Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.A998G	ENST00000422127.1	37	c.2993	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	.	2.996	-0.207096	0.06180	.	.	ENSG00000154358	ENST00000284548;ENST00000422127	T;T	0.04275	3.66;3.66	4.99	-1.36	0.09085	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);	2.441030	0.02358	N	0.076594	T	0.02494	0.0076	N	0.04297	-0.235	0.21675	N	0.999593	B;B	0.15473	0.013;0.008	B;B	0.22386	0.039;0.015	T	0.41342	-0.9514	10	0.23302	T	0.38	.	2.6595	0.05023	0.3558:0.2476:0.3066:0.09	.	998;998	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	G	998	ENSP00000284548:A998G;ENSP00000409493:A998G	ENSP00000284548:A998G	A	+	2	0	OBSCN	226497570	0.709000	0.27886	0.093000	0.20910	0.160000	0.22226	-0.229000	0.09098	0.123000	0.18342	0.460000	0.39030	GCC	OBSCN	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000154358		0.592	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		78	0.00	0	C	NM_052843		228430947	228430947	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	25	40.48	17	SNP	0.015	G
PARP15	165631	genome.wustl.edu	37	3	122329393	122329393	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr3:122329393C>A	ENST00000464300.2	+	3	425	c.359C>A	c.(358-360)cCa>cAa	p.P120Q	PARP15_ENST00000465304.1_3'UTR|PARP15_ENST00000483793.1_Missense_Mutation_p.P120Q	NM_001113523.1	NP_001106995.1	Q460N3	PAR15_HUMAN	poly (ADP-ribose) polymerase family, member 15	120	Macro 1. {ECO:0000255|PROSITE- ProRule:PRU00490}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	24				GBM - Glioblastoma multiforme(114;0.0531)		GGAGGAGGACCACTATCTCGG	0.423																																						dbGAP											0													130.0	109.0	116.0					3																	122329393		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097916	CCDS3016.1, CCDS46893.1	3q21	2010-02-16			ENSG00000173200	ENSG00000173200		"""Poly (ADP-ribose) polymerases"""	26876	protein-coding gene	gene with protein product		612066				15273990	Standard	NM_001113523		Approved	FLJ40597, pART7	uc003efm.2	Q460N3	OTTHUMG00000159523	ENST00000464300.2:c.359C>A	3.37:g.122329393C>A	ENSP00000417214:p.Pro120Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KR47|Q8N1K3	Missense_Mutation	SNP	pfam_A1pp,pfam_Poly(ADP-ribose)pol_cat_dom,smart_A1pp,pfscan_A1pp,pfscan_Poly(ADP-ribose)pol_cat_dom	p.P120Q	ENST00000464300.2	37	c.359	CCDS46893.1	3	.	.	.	.	.	.	.	.	.	.	C	8.194	0.796678	0.16327	.	.	ENSG00000173200	ENST00000464300;ENST00000483793	T;T	0.13778	2.77;2.56	4.39	2.51	0.30379	Appr-1-p processing (3);	.	.	.	.	T	0.08758	0.0217	N	0.17838	0.53	0.09310	N	0.999999	B;B	0.20550	0.046;0.046	B;B	0.24848	0.056;0.056	T	0.39761	-0.9598	9	0.08837	T	0.75	.	11.454	0.50169	0.4631:0.5369:0.0:0.0	.	120;98	C9J7L3;Q460N3	.;PAR15_HUMAN	Q	120	ENSP00000417214:P120Q;ENSP00000417785:P120Q	ENSP00000417214:P120Q	P	+	2	0	PARP15	123812083	0.000000	0.05858	0.000000	0.03702	0.097000	0.18754	0.825000	0.27393	0.429000	0.26202	0.655000	0.94253	CCA	PARP15	-	pfam_A1pp,smart_A1pp,pfscan_A1pp	ENSG00000173200		0.423	PARP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP15	HGNC	protein_coding	OTTHUMT00000355964.2	90	0.00	0	C	NM_152615		122329393	122329393	+1	no_errors	ENST00000464300	ensembl	human	known	69_37n	missense	44	29.03	18	SNP	0.000	A
PGAP2	27315	genome.wustl.edu	37	11	3819179	3819179	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr11:3819179G>T	ENST00000300730.6	+	1	131	c.106G>T	c.(106-108)Ggg>Tgg	p.G36W	NUP98_ENST00000359171.4_5'Flank|PGAP2_ENST00000396986.2_Missense_Mutation_p.G36W|NUP98_ENST00000355260.3_5'Flank|NUP98_ENST00000397007.4_5'Flank|NUP98_ENST00000324932.7_5'Flank|NUP98_ENST00000397004.4_5'Flank|PGAP2_ENST00000396991.2_5'UTR|PGAP2_ENST00000396993.4_5'UTR	NM_001145438.2|NM_001256239.1	NP_001138910.1|NP_001243168.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	0					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						GAGGGAGCTCGGGCCAATCAG	0.642																																						dbGAP											0													34.0	42.0	40.0					11																	3819179		692	1591	2283	-	-	-	SO:0001583	missense	0			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000300730.6:c.106G>T	11.37:g.3819179G>T	ENSP00000300730:p.Gly36Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Missense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.G36W	ENST00000300730.6	37	c.106	CCDS44523.1	11	.	.	.	.	.	.	.	.	.	.	G	12.76	2.035634	0.35893	.	.	ENSG00000148985	ENST00000396986;ENST00000300730;ENST00000532535;ENST00000532523;ENST00000464261	.	.	.	4.93	1.57	0.23409	.	.	.	.	.	T	0.31040	0.0784	N	0.08118	0	0.80722	D	1	D	0.57257	0.979	P	0.44990	0.466	T	0.35301	-0.9794	8	0.87932	D	0	.	13.2615	0.60108	0.0:0.6083:0.3917:0.0	.	36	A8MYS5	.	W	36;36;18;13;9	.	ENSP00000300730:G36W	G	+	1	0	PGAP2	3775755	1.000000	0.71417	0.993000	0.49108	0.029000	0.11900	1.051000	0.30417	0.655000	0.30866	-0.182000	0.12963	GGG	PGAP2	-	NULL	ENSG00000148985		0.642	PGAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PGAP2	HGNC	protein_coding	OTTHUMT00000383058.2	83	0.00	0	G			3819179	3819179	+1	no_errors	ENST00000300730	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.847	T
PGM2L1	283209	genome.wustl.edu	37	11	74058248	74058248	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr11:74058248T>C	ENST00000298198.4	-	7	1195	c.884A>G	c.(883-885)gAt>gGt	p.D295G		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	295					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					AAAGTCTGGATCAGGATCTTT	0.348																																						dbGAP											0													75.0	76.0	76.0					11																	74058248		2200	4293	6493	-	-	-	SO:0001583	missense	0			AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.884A>G	11.37:g.74058248T>C	ENSP00000298198:p.Asp295Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MQ7|Q9UIK3	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III	p.D295G	ENST00000298198.4	37	c.884	CCDS8231.1	11	.	.	.	.	.	.	.	.	.	.	T	24.9	4.582551	0.86748	.	.	ENSG00000165434	ENST00000298198	T	0.69561	-0.41	5.45	5.45	0.79879	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);Alpha-D-phosphohexomutase, alpha/beta/alpha domain II (1);	0.000000	0.85682	D	0.000000	D	0.87857	0.6283	H	0.98089	4.145	0.80722	D	1	D	0.64830	0.994	D	0.70016	0.967	D	0.91884	0.5518	10	0.87932	D	0	-21.9469	13.482	0.61340	0.0:0.0:0.0:1.0	.	295	Q6PCE3	PGM2L_HUMAN	G	295	ENSP00000298198:D295G	ENSP00000298198:D295G	D	-	2	0	PGM2L1	73735896	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.040000	0.89188	2.051000	0.60960	0.460000	0.39030	GAT	PGM2L1	-	pfam_A-D-PHexomutase_a/b/a-II,superfamily_A-D-PHexomutase_a/b/a-I/II/III	ENSG00000165434		0.348	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM2L1	HGNC	protein_coding	OTTHUMT00000398324.1	42	0.00	0	T	NM_173582		74058248	74058248	-1	no_errors	ENST00000298198	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	C
PIGT	51604	genome.wustl.edu	37	20	44049193	44049193	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr20:44049193C>T	ENST00000279036.6	+	8	973	c.893C>T	c.(892-894)cCa>cTa	p.P298L	PIGT_ENST00000545755.1_Missense_Mutation_p.P36L|PIGT_ENST00000341555.5_Missense_Mutation_p.P104L|PIGT_ENST00000535404.1_Missense_Mutation_p.P143L|PIGT_ENST00000372689.5_Missense_Mutation_p.P298L|PIGT_ENST00000279035.9_Missense_Mutation_p.P196L|PIGT_ENST00000543458.2_Missense_Mutation_p.P242L	NM_015937.5	NP_057021.2	Q969N2	PIGT_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class T	298					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|post-translational protein modification (GO:0043687)	cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	GPI-anchor transamidase activity (GO:0003923)			breast(1)|endometrium(2)|kidney(5)|large_intestine(4)|lung(7)|pancreas(1)|skin(1)|stomach(1)	22		Myeloproliferative disorder(115;0.0122)				GAGGTGCACCCACCCCCGACC	0.547																																						dbGAP											0													119.0	87.0	98.0					20																	44049193		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13353.1, CCDS54464.1, CCDS54465.1, CCDS54466.1	20q12-q13.12	2013-02-26	2006-06-28		ENSG00000124155	ENSG00000124155		"""Phosphatidylinositol glycan anchor biosynthesis"""	14938	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	610272	"""phosphatidylinositol glycan, class T"""			15713669	Standard	NM_015937		Approved		uc002xoh.3	Q969N2	OTTHUMG00000032574	ENST00000279036.6:c.893C>T	20.37:g.44049193C>T	ENSP00000279036:p.Pro298Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RND5|B7Z3N1|B7Z7I8|E1P622|G8JLF5|Q2NL69|Q7Z3N7|Q9BQY7|Q9BQY8|Q9UJG6|Q9Y2Z5	Missense_Mutation	SNP	pfam_Gpi16	p.P298L	ENST00000279036.6	37	c.893	CCDS13353.1	20	.	.	.	.	.	.	.	.	.	.	C	18.13	3.555102	0.65425	.	.	ENSG00000124155	ENST00000543458;ENST00000372689;ENST00000279035;ENST00000279036;ENST00000455050;ENST00000545755;ENST00000341555;ENST00000535404	T;T;T;T;T;T;T	0.42513	0.97;0.97;0.97;0.97;0.97;0.97;0.97	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.63663	0.2530	M	0.68952	2.095	0.80722	D	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.988;1.0;1.0	D;D;D;D;D;D;P;D;D	0.97110	1.0;0.997;1.0;1.0;0.998;0.989;0.878;0.997;0.994	T	0.60541	-0.7243	10	0.39692	T	0.17	-34.5128	18.0256	0.89268	0.0:1.0:0.0:0.0	.	136;196;143;242;36;104;154;36;298	B7Z3L1;Q969N2-4;F5GWY0;B7Z3N1;B7ZAP3;Q969N2-2;Q969N2-3;B7Z1N3;Q969N2	.;.;.;.;.;.;.;.;PIGT_HUMAN	L	242;298;196;298;196;36;104;143	ENSP00000441577:P242L;ENSP00000361774:P298L;ENSP00000279035:P196L;ENSP00000279036:P298L;ENSP00000443963:P36L;ENSP00000343783:P104L;ENSP00000440528:P143L	ENSP00000279035:P196L	P	+	2	0	PIGT	43482607	1.000000	0.71417	0.751000	0.31187	0.134000	0.20937	6.047000	0.71038	2.724000	0.93272	0.563000	0.77884	CCA	PIGT	-	pfam_Gpi16	ENSG00000124155		0.547	PIGT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGT	HGNC	protein_coding	OTTHUMT00000079434.2	62	0.00	0	C	NM_015937		44049193	44049193	+1	no_errors	ENST00000279036	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	0.999	T
PNLIP	5406	genome.wustl.edu	37	10	118321027	118321027	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr10:118321027T>A	ENST00000369221.2	+	12	1241	c.1213T>A	c.(1213-1215)Tca>Aca	p.S405T		NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	405	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	TGAATTTGACTCAGATGTGGA	0.353																																						dbGAP											0													113.0	110.0	111.0					10																	118321027		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.1213T>A	10.37:g.118321027T>A	ENSP00000358223:p.Ser405Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSQ2	Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,pfscan_LipOase_LH2,prints_Lipase,prints_Lipase_panc	p.S405T	ENST00000369221.2	37	c.1213	CCDS7594.1	10	.	.	.	.	.	.	.	.	.	.	T	12.37	1.917006	0.33815	.	.	ENSG00000175535	ENST00000369221	T	0.64260	-0.09	6.06	3.59	0.41128	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.317042	0.26696	N	0.022971	T	0.52645	0.1747	L	0.60067	1.865	0.32527	N	0.535402	B	0.12630	0.006	B	0.11329	0.006	T	0.53809	-0.8386	10	0.07030	T	0.85	.	12.1343	0.53961	0.0:0.0:0.4731:0.5269	.	405	P16233	LIPP_HUMAN	T	405	ENSP00000358223:S405T	ENSP00000358223:S405T	S	+	1	0	PNLIP	118311017	0.997000	0.39634	0.996000	0.52242	0.771000	0.43674	2.290000	0.43531	1.097000	0.41459	-0.313000	0.08912	TCA	PNLIP	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,pfscan_LipOase_LH2,prints_Lipase	ENSG00000175535		0.353	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIP	HGNC	protein_coding	OTTHUMT00000050524.1	49	0.00	0	T	NM_000936		118321027	118321027	+1	no_errors	ENST00000369221	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	1.000	A
POT1	25913	genome.wustl.edu	37	7	124481138	124481138	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr7:124481138C>T	ENST00000357628.3	-	14	1856	c.1258G>A	c.(1258-1260)Gat>Aat	p.D420N	POT1_ENST00000393329.1_Missense_Mutation_p.D289N	NM_015450.2	NP_056265.2	Q9NUX5	POTE1_HUMAN	protection of telomeres 1	420					DNA duplex unwinding (GO:0032508)|negative regulation of telomerase activity (GO:0051974)|negative regulation of telomere maintenance via telomerase (GO:0032211)|positive regulation of DNA strand elongation (GO:0060383)|positive regulation of helicase activity (GO:0051096)|positive regulation of telomerase activity (GO:0051973)|positive regulation of telomere maintenance via telomerase (GO:0032212)|telomere capping (GO:0016233)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DEAD/H-box RNA helicase binding (GO:0017151)|single-stranded telomeric DNA binding (GO:0043047)|telomerase inhibitor activity (GO:0010521)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|prostate(1)|skin(3)|stomach(1)|urinary_tract(1)	47						ATTTTTGAATCATATAATGAT	0.343																																					Esophageal Squamous(149;1032 1141 16047 36610 40540 42429 44687 51642)	dbGAP											0													139.0	138.0	138.0					7																	124481138		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022580	CCDS5793.1	7q31.33	2013-01-21	2013-01-21		ENSG00000128513	ENSG00000128513			17284	protein-coding gene	gene with protein product		606478	"""protection of telomeres 1 homolog (S. pombe)"""			11349150, 12391173	Standard	NR_003102		Approved	hPot1, DKFZp586D211	uc003vlm.3	Q9NUX5	OTTHUMG00000157194	ENST00000357628.3:c.1258G>A	7.37:g.124481138C>T	ENSP00000350249:p.Asp420Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O95018|Q5MJ36|Q9H662|Q9NW19|Q9UG95	Missense_Mutation	SNP	pfam_Telomer_end-bd,superfamily_NA-bd_OB-fold-like,smart_Telomer_end-bd	p.D420N	ENST00000357628.3	37	c.1258	CCDS5793.1	7	.	.	.	.	.	.	.	.	.	.	C	3.761	-0.049539	0.07407	.	.	ENSG00000128513	ENST00000357628;ENST00000393329;ENST00000451720;ENST00000440969;ENST00000265391	T;T	0.43688	0.94;0.95	5.55	1.62	0.23740	.	0.379368	0.32533	N	0.005972	T	0.21801	0.0525	L	0.27053	0.805	0.27352	N	0.956217	B	0.02656	0.0	B	0.06405	0.002	T	0.10706	-1.0618	10	0.18276	T	0.48	-8.9591	3.1182	0.06382	0.2442:0.4964:0.1189:0.1404	.	420	Q9NUX5	POTE1_HUMAN	N	420;289;420;420;419	ENSP00000350249:D420N;ENSP00000377002:D289N	ENSP00000265391:D419N	D	-	1	0	POT1	124268374	1.000000	0.71417	0.998000	0.56505	0.123000	0.20343	0.839000	0.27586	0.367000	0.24454	-0.181000	0.13052	GAT	POT1	-	NULL	ENSG00000128513		0.343	POT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POT1	HGNC	protein_coding	OTTHUMT00000347861.1	47	0.00	0	C			124481138	124481138	-1	no_errors	ENST00000357628	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.998	T
PRPF40A	55660	genome.wustl.edu	37	2	153520244	153520244	+	Silent	SNP	A	A	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr2:153520244A>G	ENST00000410080.1	-	19	2554	c.2013T>C	c.(2011-2013)gaT>gaC	p.D671D		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	698					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						TCGCCACAAAATCTTCAAAAG	0.279																																						dbGAP											0													105.0	97.0	100.0					2																	153520244		1827	4077	5904	-	-	-	SO:0001819	synonymous_variant	0			AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.2013T>C	2.37:g.153520244A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Silent	SNP	pfam_FF_domain,pfam_WW_Rsp5_WWP,superfamily_FF_domain,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_FF_domain,pfscan_WW_Rsp5_WWP,prints_Antifreeze_1	p.D671	ENST00000410080.1	37	c.2013	CCDS46430.1	2																																																																																			PRPF40A	-	NULL	ENSG00000196504		0.279	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF40A	HGNC	protein_coding	OTTHUMT00000333559.2	40	0.00	0	A	XM_371575		153520244	153520244	-1	no_errors	ENST00000410080	ensembl	human	known	69_37n	silent	19	36.67	11	SNP	0.981	G
PSMD12	5718	genome.wustl.edu	37	17	65353563	65353563	+	Intron	SNP	T	T	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr17:65353563T>C	ENST00000356126.3	-	3	276				PSMD12_ENST00000357146.4_Intron|PSMD12_ENST00000581618.1_5'UTR	NM_002816.3	NP_002807.1	O00232	PSD12_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 12						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|large_intestine(4)|lung(6)|pancreas(1)|urinary_tract(1)	13	all_cancers(12;2.38e-11)|all_epithelial(3;8.27e-13)					AGGGTAAAAATATATTGAAAG	0.378																																						dbGAP											0													106.0	109.0	108.0					17																	65353563		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB003103	CCDS11669.1, CCDS11670.1	17q24.3	2008-05-22			ENSG00000197170	ENSG00000197170		"""Proteasome (prosome, macropain) subunits"""	9557	protein-coding gene	gene with protein product		604450				9426256	Standard	NM_002816		Approved	p55, Rpn5	uc002jfy.3	O00232	OTTHUMG00000140376	ENST00000356126.3:c.169-16A>G	17.37:g.65353563T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP15|Q53HA2|Q6P053	RNA	SNP	-	NULL	ENST00000356126.3	37	NULL	CCDS11669.1	17																																																																																			PSMD12	-	-	ENSG00000197170		0.378	PSMD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD12	HGNC	protein_coding	OTTHUMT00000277103.1	42	0.00	0	T	NM_002816, NM_174871		65353563	65353563	-1	no_errors	ENST00000581618	ensembl	human	known	69_37n	rna	27	15.62	5	SNP	0.001	C
RBM10	8241	genome.wustl.edu	37	X	47028777	47028777	+	Silent	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chrX:47028777G>A	ENST00000377604.3	+	3	823	c.81G>A	c.(79-81)ggG>ggA	p.G27G	RBM10_ENST00000329236.7_Silent_p.G27G|RBM10_ENST00000345781.6_Silent_p.G27G	NM_001204467.1|NM_001204468.1|NM_005676.4	NP_001191396.1|NP_001191397.1|NP_005667.2	P98175	RBM10_HUMAN	RNA binding motif protein 10	27					3'-UTR-mediated mRNA stabilization (GO:0070935)|mRNA processing (GO:0006397)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	48						ATGATGGTGGGGAGAACCGCA	0.587																																					Melanoma(171;120 2705 19495 39241)	dbGAP											0													94.0	65.0	75.0					X																	47028777		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U35373	CCDS14274.1, CCDS56600.1, CCDS75969.1	Xp11.3	2014-06-09			ENSG00000182872	ENSG00000182872		"""Zinc fingers, RAN-binding domain containing"", ""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9896	protein-coding gene	gene with protein product		300080				8590280, 8808293	Standard	NM_005676		Approved	DXS8237E, KIAA0122, GPATC9, ZRANB5, GPATCH9	uc004dhi.3	P98175	OTTHUMG00000021432	ENST00000377604.3:c.81G>A	X.37:g.47028777G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C4AM81|Q14136|Q5JRR2|Q9BTE4|Q9BTX0|Q9NTB1	Silent	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.G27	ENST00000377604.3	37	c.81	CCDS14274.1	X																																																																																			RBM10	-	NULL	ENSG00000182872		0.587	RBM10-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM10	HGNC	protein_coding	OTTHUMT00000056381.1	126	0.00	0	G	NM_005676		47028777	47028777	+1	no_errors	ENST00000377604	ensembl	human	known	69_37n	silent	45	13.46	7	SNP	0.998	A
RNF213	57674	genome.wustl.edu	37	17	78265433	78265433	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr17:78265433G>T	ENST00000582970.1	+	8	1421	c.1278G>T	c.(1276-1278)ttG>ttT	p.L426F	RNF213_ENST00000456466.1_Missense_Mutation_p.L426F|RNF213_ENST00000508628.2_Missense_Mutation_p.L475F|RNF213_ENST00000319921.4_Missense_Mutation_p.L426F	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	426					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			ACAGAGACTTGGGTCATGACC	0.403																																						dbGAP											0													129.0	122.0	124.0					17																	78265433		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.1278G>T	17.37:g.78265433G>T	ENSP00000464087:p.Leu426Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Missense_Mutation	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.L426F	ENST00000582970.1	37	c.1278	CCDS58606.1	17	.	.	.	.	.	.	.	.	.	.	G	7.522	0.656868	0.14580	.	.	ENSG00000173821	ENST00000508628;ENST00000411702;ENST00000456466;ENST00000319921	.	.	.	4.91	-7.56	0.01322	.	0.000000	0.44483	U	0.000460	T	0.62245	0.2412	M	0.69823	2.125	0.21416	N	0.999695	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.69064	-0.5244	9	0.87932	D	0	-19.3644	18.3245	0.90248	0.1342:0.0:0.8658:0.0	.	426;426	Q9HCF4;Q9HCF4-2	ALO17_HUMAN;.	F	426;475;426;426	.	ENSP00000324392:L426F	L	+	3	2	RNF213	75880028	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.154000	0.03166	-2.030000	0.00929	-1.532000	0.00920	TTG	RNF213	-	NULL	ENSG00000173821		0.403	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	60	0.00	0	G	NM_020914		78265433	78265433	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	missense	42	39.13	27	SNP	0.000	T
SH2D4B	387694	genome.wustl.edu	37	10	82406062	82406062	+	3'UTR	SNP	C	C	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr10:82406062C>A	ENST00000470604.2	+	0	3517				SH2D4B_ENST00000339284.2_3'UTR|SH2D4B_ENST00000313455.4_3'UTR|SH2D4B_ENST00000372150.3_3'UTR			Q5SQS7	SH24B_HUMAN	SH2 domain containing 4B											endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)	13			Colorectal(32;0.229)			GACCCTGAATCCCTGGGCTGT	0.443																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS7370.1, CCDS44449.1	10q23.1	2013-02-14			ENSG00000178217	ENSG00000178217		"""SH2 domain containing"""	31440	protein-coding gene	gene with protein product							Standard	NM_207372		Approved		uc001kck.1	Q5SQS7	OTTHUMG00000018617	ENST00000470604.2:c.*2221C>A	10.37:g.82406062C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SQS5|Q6ZVW9|Q6ZVZ3	RNA	SNP	-	NULL	ENST00000470604.2	37	NULL		10																																																																																			SH2D4B	-	-	ENSG00000178217		0.443	SH2D4B-202	KNOWN	basic|appris_principal	protein_coding	SH2D4B	HGNC	protein_coding		28	0.00	0	C	XM_351984		82406062	82406062	+1	no_errors	ENST00000372150	ensembl	human	known	69_37n	rna	26	13.33	4	SNP	0.001	A
SFXN3	81855	genome.wustl.edu	37	10	102794460	102794460	+	Silent	SNP	A	A	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr10:102794460A>G	ENST00000224807.5	+	3	477	c.21A>G	c.(19-21)gaA>gaG	p.E7E	SFXN3_ENST00000393459.1_Silent_p.E3E	NM_030971.3	NP_112233.2	Q9BWM7	SFXN3_HUMAN	sideroflexin 3	7					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	cation transmembrane transporter activity (GO:0008324)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(252;0.234)		Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		AAATGGGTGAATTGCCTTTAG	0.547																																						dbGAP											0													169.0	175.0	173.0					10																	102794460		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074707	CCDS7508.2	10q24.32	2008-09-04			ENSG00000107819	ENSG00000107819		"""Sideroflexins"""	16087	protein-coding gene	gene with protein product		615571					Standard	NM_030971		Approved	SFX3	uc001ksp.3	Q9BWM7	OTTHUMG00000018921	ENST00000224807.5:c.21A>G	10.37:g.102794460A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NCJ0|Q9NTP4	Silent	SNP	pfam_Mtc,tigrfam_Mtc	p.E7	ENST00000224807.5	37	c.21	CCDS7508.2	10																																																																																			SFXN3	-	NULL	ENSG00000107819		0.547	SFXN3-201	KNOWN	basic|CCDS	protein_coding	SFXN3	HGNC	protein_coding		22	0.00	0	A	NM_030971		102794460	102794460	+1	no_errors	ENST00000224807	ensembl	human	known	69_37n	silent	16	23.81	5	SNP	0.110	G
SHISA6	388336	genome.wustl.edu	37	17	11461431	11461431	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr17:11461431G>T	ENST00000409168.3	+	4	1313	c.1313G>T	c.(1312-1314)cGc>cTc	p.R438L	SHISA6_ENST00000432116.3_Missense_Mutation_p.R470L|SHISA6_ENST00000441885.3_Missense_Mutation_p.R489L	NM_001173461.1	NP_001166932.1	Q6ZSJ9	SHSA6_HUMAN	shisa family member 6	438						alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)				breast(1)|endometrium(4)	5						GTGCTGGACCGCTACCGCATG	0.637																																						dbGAP											0													76.0	71.0	73.0					17																	11461431		692	1591	2283	-	-	-	SO:0001583	missense	0			AK127379, AK128003	CCDS45615.1, CCDS54089.1, CCDS54090.1	17p13.1-p12	2013-07-31	2013-07-31		ENSG00000188803	ENSG00000188803		"""Shisa homologs"""	34491	protein-coding gene	gene with protein product			"""shisa homolog 6 (Xenopus laevis)"""				Standard	NM_207386		Approved	FLJ45455	uc002gnc.2	Q6ZSJ9	OTTHUMG00000154121	ENST00000409168.3:c.1313G>T	17.37:g.11461431G>T	ENSP00000387157:p.Arg438Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXV5|Q4PL63	Missense_Mutation	SNP	NULL	p.R489L	ENST00000409168.3	37	c.1466	CCDS54090.1	17	.	.	.	.	.	.	.	.	.	.	G	25.0	4.587341	0.86851	.	.	ENSG00000188803	ENST00000441885;ENST00000432116;ENST00000409168;ENST00000343478	.	.	.	5.58	5.58	0.84498	.	0.058364	0.64402	D	0.000001	T	0.76772	0.4034	L	0.59436	1.845	0.47183	D	0.999344	D;P	0.89917	1.0;0.835	D;B	0.87578	0.998;0.195	T	0.75147	-0.3420	9	0.42905	T	0.14	.	18.1438	0.89648	0.0:0.0:1.0:0.0	.	489;438	Q6ZSJ9-3;Q6ZSJ9	.;SHSA6_HUMAN	L	489;470;438;336	.	ENSP00000340821:R336L	R	+	2	0	SHISA6	11402156	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.470000	0.97683	2.618000	0.88619	0.585000	0.79938	CGC	SHISA6	-	NULL	ENSG00000188803		0.637	SHISA6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHISA6	HGNC	protein_coding	OTTHUMT00000333970.2	36	0.00	0	G	NM_207386		11461431	11461431	+1	no_errors	ENST00000441885	ensembl	human	known	69_37n	missense	6	33.33	3	SNP	1.000	T
SLC26A5	375611	genome.wustl.edu	37	7	103051953	103051953	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr7:103051953C>T	ENST00000306312.3	-	6	745	c.484G>A	c.(484-486)Gta>Ata	p.V162I	SLC26A5_ENST00000432958.2_Missense_Mutation_p.V162I|SLC26A5_ENST00000339444.6_Missense_Mutation_p.V162I|SLC26A5_ENST00000393735.2_Missense_Mutation_p.V162I|SLC26A5_ENST00000393727.1_Missense_Mutation_p.V162I|SLC26A5_ENST00000356767.4_Missense_Mutation_p.V162I|SLC26A5_ENST00000354356.4_5'UTR|SLC26A5_ENST00000393723.1_Missense_Mutation_p.V162I|SLC26A5_ENST00000393730.1_Missense_Mutation_p.V162I|SLC26A5_ENST00000393729.1_Missense_Mutation_p.V125I	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	162					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						GTTGCATTTACTCCTCCTGGA	0.433																																						dbGAP											0													204.0	168.0	180.0					7																	103051953		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.484G>A	7.37:g.103051953C>T	ENSP00000304783:p.Val162Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.V162I	ENST00000306312.3	37	c.484	CCDS5733.1	7	.	.	.	.	.	.	.	.	.	.	C	12.18	1.862097	0.32884	.	.	ENSG00000170615	ENST00000339444;ENST00000356767;ENST00000393735;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D;D;D	0.93604	-3.15;-2.62;-3.25;-3.18;-3.2;-3.2;-3.08;-3.18;-3.2	5.49	4.59	0.56863	.	0.876859	0.10159	N	0.708544	D	0.85146	0.5630	N	0.12746	0.255	0.41835	D	0.99009	B;B;B;B;B	0.28082	0.016;0.126;0.027;0.199;0.2	B;B;B;B;B	0.30572	0.007;0.055;0.026;0.117;0.117	T	0.77648	-0.2509	10	0.21014	T	0.42	.	6.8585	0.24054	0.1663:0.6956:0.0:0.138	.	162;162;162;162;162	P58743;Q496J2;P58743-4;P58743-3;P58743-2	S26A5_HUMAN;.;.;.;.	I	162;162;162;162;162;162;125;162;162	ENSP00000342396:V162I;ENSP00000349210:V162I;ENSP00000377336:V162I;ENSP00000304783:V162I;ENSP00000377331:V162I;ENSP00000389733:V162I;ENSP00000377330:V125I;ENSP00000377328:V162I;ENSP00000377324:V162I	ENSP00000304783:V162I	V	-	1	0	SLC26A5	102839189	0.563000	0.26594	1.000000	0.80357	0.999000	0.98932	0.937000	0.28951	2.746000	0.94184	0.655000	0.94253	GTA	SLC26A5	-	tigrfam_SulP_transpt	ENSG00000170615		0.433	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A5	HGNC	protein_coding	OTTHUMT00000313860.1	86	0.00	0	C	NM_198999		103051953	103051953	-1	no_errors	ENST00000306312	ensembl	human	known	69_37n	missense	43	18.87	10	SNP	0.512	T
SLC35A3	23443	genome.wustl.edu	37	1	100436152	100436152	+	Intron	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:100436152G>T	ENST00000370155.3	+	1	374				SLC35A3_ENST00000465289.1_Intron|RP5-884G6.2_ENST00000454219.1_RNA|SLC35A3_ENST00000370153.1_Silent_p.L20L|SLC35A3_ENST00000427993.2_Intron	NM_012243.1	NP_036375.1	Q9Y2D2	S35A3_HUMAN	solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member A3						transmembrane transport (GO:0055085)|UDP-N-acetylglucosamine metabolic process (GO:0006047)|UDP-N-acetylglucosamine transport (GO:0015788)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	sugar:proton symporter activity (GO:0005351)|UDP-N-acetylglucosamine transmembrane transporter activity (GO:0005462)			biliary_tract(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	11		all_epithelial(167;0.000686)|all_lung(203;0.0154)|Lung NSC(277;0.0155)		Epithelial(280;0.124)|all cancers(265;0.198)|Lung(183;0.199)		ACCAGCACCTGGAGCTCAAGA	0.552																																					Ovarian(7;298 356 944 2149 6911)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB021981	CCDS762.1, CCDS60204.1, CCDS60205.1	1p21	2013-05-22			ENSG00000117620	ENSG00000117620		"""Solute carriers"""	11023	protein-coding gene	gene with protein product		605632	"""solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3"""			10393322	Standard	NM_001271685		Approved		uc001dsr.2	Q9Y2D2	OTTHUMG00000010805	ENST00000370155.3:c.-19+434G>T	1.37:g.100436152G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3F8|D3DT54|Q68CR2|Q9BSB7	Silent	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pfam_DMT,pfam_DUF250,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.L20	ENST00000370155.3	37	c.60	CCDS762.1	1																																																																																			SLC35A3	-	NULL	ENSG00000117620		0.552	SLC35A3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SLC35A3	HGNC	protein_coding	OTTHUMT00000029783.1	55	0.00	0	G	NM_012243		100436152	100436152	+1	no_errors	ENST00000370153	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.000	T
SLC35F2	54733	genome.wustl.edu	37	11	107663400	107663400	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr11:107663400C>T	ENST00000525815.1	-	8	1486	c.1066G>A	c.(1066-1068)Gac>Aac	p.D356N	SLC35F2_ENST00000429869.1_Missense_Mutation_p.D356N|SLC35F2_ENST00000375682.4_Missense_Mutation_p.D309N|SLC35F2_ENST00000265836.7_Missense_Mutation_p.D208N|SLC35F2_ENST00000525071.1_Silent_p.L353L	NM_017515.4	NP_059985.2	Q8IXU6	S35F2_HUMAN	solute carrier family 35, member F2	356					transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|lung(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		all_cancers(61;9.46e-06)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;0.000111)|all_hematologic(158;0.000315)|all_epithelial(67;0.00197)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)|Epithelial(105;0.000105)|all cancers(92;0.00217)		CCCAGGTTGTCAATCCCAATG	0.587																																						dbGAP											0													57.0	61.0	60.0					11																	107663400		1985	4169	6154	-	-	-	SO:0001583	missense	0				CCDS41709.1	11q22.3	2013-05-22			ENSG00000110660	ENSG00000110660		"""Solute carriers"""	23615	protein-coding gene	gene with protein product						9119394	Standard	NM_017515		Approved	FLJ13018	uc001pjq.3	Q8IXU6	OTTHUMG00000166366	ENST00000525815.1:c.1066G>A	11.37:g.107663400C>T	ENSP00000436785:p.Asp356Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14963|Q5JPA8|Q6ZRQ3|Q9H947	Missense_Mutation	SNP	pfam_DUF914_euk,pfam_DMT,pfam_UAA,pfam_DUF250	p.D356N	ENST00000525815.1	37	c.1066	CCDS41709.1	11	.	.	.	.	.	.	.	.	.	.	C	19.33	3.807130	0.70797	.	.	ENSG00000110660	ENST00000525815;ENST00000265836;ENST00000375682;ENST00000429869	.	.	.	5.13	4.21	0.49690	.	0.054782	0.64402	D	0.000001	T	0.67822	0.2934	L	0.49350	1.555	0.36075	D	0.842374	D	0.63880	0.993	D	0.66979	0.948	T	0.72497	-0.4275	9	0.33141	T	0.24	.	14.0387	0.64660	0.0:0.8489:0.1511:0.0	.	356	Q8IXU6	S35F2_HUMAN	N	356;208;309;356	.	ENSP00000265836:D208N	D	-	1	0	SLC35F2	107168610	0.995000	0.38212	0.898000	0.35279	0.966000	0.64601	4.168000	0.58216	1.271000	0.44313	0.655000	0.94253	GAC	SLC35F2	-	pfam_DUF914_euk	ENSG00000110660		0.587	SLC35F2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35F2	HGNC	protein_coding	OTTHUMT00000389417.1	46	0.00	0	C	NM_017515		107663400	107663400	-1	no_errors	ENST00000429869	ensembl	human	known	69_37n	missense	17	15.00	3	SNP	0.970	T
SLC4A1AP	22950	genome.wustl.edu	37	2	27886672	27886672	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr2:27886672C>T	ENST00000326019.6	+	1	335	c.53C>T	c.(52-54)tCg>tTg	p.S18L	SUPT7L_ENST00000337768.5_5'UTR|SUPT7L_ENST00000405491.1_5'Flank|SUPT7L_ENST00000406540.1_5'Flank|SUPT7L_ENST00000464789.2_5'Flank|SUPT7L_ENST00000404798.2_5'Flank	NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	18						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					ACTTCACCATCGCCGCCTACA	0.527																																						dbGAP											0													115.0	118.0	117.0					2																	27886672		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.53C>T	2.37:g.27886672C>T	ENSP00000323837:p.Ser18Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Missense_Mutation	SNP	pfam_FHA_dom,pfam_Ds-RNA-bd,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S18L	ENST00000326019.6	37	c.53	CCDS33166.1	2	.	.	.	.	.	.	.	.	.	.	C	12.46	1.944442	0.34283	.	.	ENSG00000163798	ENST00000326019	T	0.32753	1.44	4.08	0.653	0.17828	.	.	.	.	.	T	0.13670	0.0331	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.22941	-1.0202	9	0.72032	D	0.01	.	3.1209	0.06391	0.0:0.4469:0.2218:0.3313	.	18	Q9BWU0	NADAP_HUMAN	L	18	ENSP00000323837:S18L	ENSP00000323837:S18L	S	+	2	0	SLC4A1AP	27740176	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.005000	0.13129	0.006000	0.14734	-0.300000	0.09419	TCG	SLC4A1AP	-	NULL	ENSG00000163798		0.527	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1AP	HGNC	protein_coding	OTTHUMT00000324550.1	54	0.00	0	C	NM_018158		27886672	27886672	+1	no_errors	ENST00000326019	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	0.000	T
SPATA20	64847	genome.wustl.edu	37	17	48628511	48628511	+	Silent	SNP	C	C	A	rs149572077		TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr17:48628511C>A	ENST00000356488.4	+	11	1571	c.1488C>A	c.(1486-1488)ccC>ccA	p.P496P	SPATA20_ENST00000006658.6_Silent_p.P512P|SPATA20_ENST00000393244.3_Silent_p.P452P|SPATA20_ENST00000511937.1_3'UTR	NM_001258372.1	NP_001245301.1	Q8TB22	SPT20_HUMAN	spermatogenesis associated 20	496					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)	catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	24	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;9.38e-09)			AGCATCGGCCCAAGCCGCACC	0.622											OREG0024568	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													16.0	15.0	15.0					17																	48628511		2176	4270	6446	-	-	-	SO:0001819	synonymous_variant	0				CCDS11571.1, CCDS58563.1, CCDS58564.1	17q21.33	2011-03-17			ENSG00000006282	ENSG00000006282			26125	protein-coding gene	gene with protein product	"""hypothetical protein FLJ21347"""	613939				12477932	Standard	NM_022827		Approved	FLJ21347, SSP411, Tisp78	uc002ird.3	Q8TB22	OTTHUMG00000162162	ENST00000356488.4:c.1488C>A	17.37:g.48628511C>A		Somatic	119	WXS	Illumina GAIIx	Phase_IV	Q2TA99|Q2XUZ6|Q6P0P1|Q8WVW3|Q9H747	Silent	SNP	pfam_DUF255,pfam_AGE/RnBP,superfamily_6-hairpin_glycosidase-like,superfamily_Thioredoxin-like_fold	p.P512	ENST00000356488.4	37	c.1536	CCDS58563.1	17																																																																																			SPATA20	-	superfamily_6-hairpin_glycosidase-like	ENSG00000006282		0.622	SPATA20-004	KNOWN	basic|CCDS	protein_coding	SPATA20	HGNC	protein_coding	OTTHUMT00000367651.1	60	0.00	0	C	NM_022827		48628511	48628511	+1	no_errors	ENST00000006658	ensembl	human	known	69_37n	silent	11	54.17	13	SNP	0.001	A
THEM5	284486	genome.wustl.edu	37	1	151819720	151819721	+	IGR	INS	-	-	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:151819720_151819721insC	ENST00000368817.5	-	0	984				AL450992.2_ENST00000434182.1_RNA	NM_182578.3	NP_872384	Q8N1Q8	ACO15_HUMAN	thioesterase superfamily member 5						cardiolipin acyl-chain remodeling (GO:0035965)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)	mitochondrial matrix (GO:0005759)	palmitoyl-CoA hydrolase activity (GO:0016290)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)	15	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			ggggaggcaggaggcaggaggc	0.703																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK095283	CCDS1005.1	1q21.3	2008-02-05			ENSG00000196407	ENSG00000196407			26755	protein-coding gene	gene with protein product		615653					Standard	NM_182578		Approved	FLJ37964	uc021oyw.1	Q8N1Q8	OTTHUMG00000013070		1.37:g.151819720_151819721insC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1C3	Frame_Shift_Ins	INS	pfam_Thioestr_supf	p.S220fs	ENST00000368817.5	37	c.659_658	CCDS1005.1	1																																																																																			THEM5	-	NULL	ENSG00000196407		0.703	THEM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THEM5	HGNC	protein_coding	OTTHUMT00000036678.2	32	0.00	0	-	NM_182578		151819720	151819721	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453881	ensembl	human	known	69_37n	frame_shift_ins	16	15.79	3	INS	0.672:0.662	C
THNSL2	55258	genome.wustl.edu	37	2	88474771	88474771	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr2:88474771C>T	ENST00000324166.5	+	3	2113	c.422C>T	c.(421-423)aCa>aTa	p.T141I	THNSL2_ENST00000449349.1_Missense_Mutation_p.T109I|THNSL2_ENST00000377254.3_Missense_Mutation_p.T141I|THNSL2_ENST00000496844.1_3'UTR|THNSL2_ENST00000343544.4_Missense_Mutation_p.T141I|THNSL2_ENST00000358591.2_Missense_Mutation_p.T141I|THNSL2_ENST00000402102.1_Missense_Mutation_p.T141I	NM_018271.4	NP_060741.3	Q86YJ6	THNS2_HUMAN	threonine synthase-like 2 (S. cerevisiae)	141					2-oxobutyrate biosynthetic process (GO:0046360)|dephosphorylation (GO:0016311)|serine family amino acid catabolic process (GO:0009071)	extracellular space (GO:0005615)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|serine binding (GO:0070905)			breast(4)|lung(17)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	27						CATCCAGGAACATCTGGGGAC	0.468																																						dbGAP											0													69.0	58.0	62.0					2																	88474771		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2002.2, CCDS58718.1, CCDS74539.1	2p11.2	2007-06-20			ENSG00000144115	ENSG00000144115			25602	protein-coding gene	gene with protein product		611261				17034760	Standard	NM_018271		Approved	FLJ10916	uc021vkr.1	Q86YJ6	OTTHUMG00000130314	ENST00000324166.5:c.422C>T	2.37:g.88474771C>T	ENSP00000327323:p.Thr141Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTB1|B5MDX8|B7WPF8|D9ZZB8|Q6P2M7|Q6PI27|Q9NV54	Missense_Mutation	SNP	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	p.T141I	ENST00000324166.5	37	c.422	CCDS2002.2	2	.	.	.	.	.	.	.	.	.	.	C	22.7	4.324683	0.81580	.	.	ENSG00000144115	ENST00000358591;ENST00000377254;ENST00000402102;ENST00000449349;ENST00000343544;ENST00000324166	T;T;T;T;T;T	0.26223	1.75;1.75;1.75;1.75;1.75;1.75	5.63	5.63	0.86233	Threonine synthase (1);Pyridoxal phosphate-dependent enzyme, beta subunit (2);	0.000000	0.85682	D	0.000000	T	0.68805	0.3041	H	0.97918	4.105	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.79784	0.99;0.993;0.983	T	0.81357	-0.0969	10	0.87932	D	0	.	18.6707	0.91510	0.0:1.0:0.0:0.0	.	141;109;141	Q86YJ6;C9JU10;Q86YJ6-2	THNS2_HUMAN;.;.	I	141;141;141;109;141;141	ENSP00000351402:T141I;ENSP00000366464:T141I;ENSP00000384475:T141I;ENSP00000407553:T109I;ENSP00000339563:T141I;ENSP00000327323:T141I	ENSP00000327323:T141I	T	+	2	0	THNSL2	88255886	1.000000	0.71417	0.997000	0.53966	0.696000	0.40369	6.817000	0.75252	2.659000	0.90383	0.561000	0.74099	ACA	THNSL2	-	pfam_PyrdxlP-dep_enz_bsu,superfamily_PyrdxlP-dep_enz_bsu,tigrfam_Thr_synthase	ENSG00000144115		0.468	THNSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THNSL2	HGNC	protein_coding	OTTHUMT00000252662.1	52	0.00	0	C	NM_018271		88474771	88474771	+1	no_errors	ENST00000324166	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	1.000	T
TLR4	7099	genome.wustl.edu	37	9	120476753	120476753	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr9:120476753G>T	ENST00000355622.6	+	3	2448	c.2347G>T	c.(2347-2349)Gtg>Ttg	p.V783L	TLR4_ENST00000472304.1_3'UTR|TLR4_ENST00000394487.4_Missense_Mutation_p.V743L	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	783	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	CAGGCAGCAGGTGGAGCTGTA	0.547																																						dbGAP											0													69.0	68.0	68.0					9																	120476753		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.2347G>T	9.37:g.120476753G>T	ENSP00000363089:p.Val783Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.V783L	ENST00000355622.6	37	c.2347	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	G	9.454	1.091280	0.20471	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.06449	3.3;3.3	5.91	4.06	0.47325	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.180897	0.38005	N	0.001860	T	0.01765	0.0056	N	0.01048	-1.04	0.30233	N	0.795696	B	0.22146	0.065	B	0.26614	0.071	T	0.43180	-0.9407	10	0.02654	T	1	.	7.4171	0.27050	0.1374:0.2687:0.5939:0.0	.	783	O00206	TLR4_HUMAN	L	743;783	ENSP00000377997:V743L;ENSP00000363089:V783L	ENSP00000363089:V783L	V	+	1	0	TLR4	119516574	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	1.953000	0.40352	2.802000	0.96397	0.655000	0.94253	GTG	TLR4	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000136869		0.547	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	35	0.00	0	G	NM_138554		120476753	120476753	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	1.000	T
TRIAP1	51499	genome.wustl.edu	37	12	120882702	120882702	+	Silent	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr12:120882702G>T	ENST00000546954.1	-	2	243	c.204C>A	c.(202-204)ggC>ggA	p.G68G	AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_5'Flank|TRIAP1_ENST00000302432.3_5'UTR	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1	68					cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCTTTTCTTTGCCATGGCCCA	0.403																																						dbGAP											0													232.0	233.0	233.0					12																	120882702		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787	ENST00000546954.1:c.204C>A	12.37:g.120882702G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4Z7|Q5RKS5|Q6LCA7	Silent	SNP	pfam_MDM35_apoptosis	p.G68	ENST00000546954.1	37	c.204	CCDS9198.1	12																																																																																			TRIAP1	-	pfam_MDM35_apoptosis	ENSG00000170855		0.403	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIAP1	HGNC	protein_coding	OTTHUMT00000108980.3	34	0.00	0	G	NM_016399		120882702	120882702	-1	no_errors	ENST00000546954	ensembl	human	known	69_37n	silent	16	15.79	3	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179464421	179464421	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr2:179464421G>T	ENST00000591111.1	-	239	51508	c.51284C>A	c.(51283-51285)aCc>aAc	p.T17095N	TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.T9796N|TTN_ENST00000460472.2_Missense_Mutation_p.T9671N|TTN_ENST00000589042.1_Missense_Mutation_p.T18736N|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.T9863N|TTN_ENST00000342992.6_Missense_Mutation_p.T16168N			Q8WZ42	TITIN_HUMAN	titin	17095	Ig-like 102.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTGACATGGGTGTCATAGAG	0.423																																						dbGAP											0													178.0	168.0	172.0					2																	179464421		1897	4107	6004	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.51284C>A	2.37:g.179464421G>T	ENSP00000465570:p.Thr17095Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.T16168N	ENST00000591111.1	37	c.48503		2	.	.	.	.	.	.	.	.	.	.	G	12.29	1.894946	0.33442	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.6	4.65	0.58169	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.27524	0.0676	N	0.12527	0.23	0.31519	N	0.662607	B;B;B;B	0.24043	0.096;0.096;0.096;0.096	B;B;B;B	0.25506	0.061;0.061;0.061;0.061	T	0.25257	-1.0137	9	0.87932	D	0	.	11.1737	0.48586	0.0:0.0:0.5954:0.4046	.	9671;9796;9863;17095	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	16168;9671;9863;9796;9669	ENSP00000343764:T16168N;ENSP00000434586:T9671N;ENSP00000340554:T9863N;ENSP00000352154:T9796N	ENSP00000340554:T9863N	T	-	2	0	TTN	179172666	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.543000	0.67225	2.642000	0.89623	0.557000	0.71058	ACC	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.423	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	41	0.00	0	G	NM_133378		179464421	179464421	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	19	13.64	3	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	144772626	144772626	+	Silent	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr6:144772626G>A	ENST00000367545.3	+	17	2193	c.2193G>A	c.(2191-2193)ttG>ttA	p.L731L		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	731	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		AAAAGAAGTTGAAGGTAAAAA	0.353																																						dbGAP											0													77.0	74.0	75.0					6																	144772626		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.2193G>A	6.37:g.144772626G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.L731	ENST00000367545.3	37	c.2193	CCDS34547.1	6																																																																																			UTRN	-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000152818		0.353	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	24	0.00	0	G			144772626	144772626	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	silent	15	21.05	4	SNP	0.981	A
WNK3	65267	genome.wustl.edu	37	X	54337560	54337560	+	Silent	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chrX:54337560G>T	ENST00000375159.2	-	2	701	c.702C>A	c.(700-702)acC>acA	p.T234T	WNK3_ENST00000354646.2_Silent_p.T234T|WNK3_ENST00000375169.3_Silent_p.T234T			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	234	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						ACGTCTTTAAGGTCCCAGATG	0.313																																						dbGAP											0													84.0	74.0	77.0					X																	54337560		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.702C>A	X.37:g.54337560G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T234	ENST00000375159.2	37	c.702	CCDS14357.1	X																																																																																			WNK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196632		0.313	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	113	0.00	0	G	NM_020922		54337560	54337560	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	silent	64	12.33	9	SNP	0.996	T
XPOT	11260	genome.wustl.edu	37	12	64812752	64812752	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr12:64812752A>C	ENST00000332707.5	+	6	896	c.367A>C	c.(367-369)Aag>Cag	p.K123Q		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	123	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		TAAGTGGCCCAAGTTTTTTTT	0.443																																						dbGAP											0													119.0	115.0	116.0					12																	64812752		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.367A>C	12.37:g.64812752A>C	ENSP00000327821:p.Lys123Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.K123Q	ENST00000332707.5	37	c.367	CCDS31852.1	12	.	.	.	.	.	.	.	.	.	.	A	17.52	3.411389	0.62399	.	.	ENSG00000184575	ENST00000332707;ENST00000400935	T;T	0.65916	-0.18;-0.18	5.05	5.05	0.67936	Exportin-1/Importin-beta-like (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.49712	0.1573	N	0.25647	0.755	0.80722	D	1	B	0.23735	0.09	B	0.26693	0.072	T	0.43327	-0.9398	9	.	.	.	.	15.1069	0.72329	1.0:0.0:0.0:0.0	.	123	O43592	XPOT_HUMAN	Q	123	ENSP00000327821:K123Q;ENSP00000383722:K123Q	.	K	+	1	0	XPOT	63099019	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.262000	0.95591	2.036000	0.60181	0.455000	0.32223	AAG	XPOT	-	pfam_Exportin-1/Importin-b-like,superfamily_ARM-type_fold	ENSG00000184575		0.443	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPOT	HGNC	protein_coding	OTTHUMT00000401122.1	50	0.00	0	A	NM_007235		64812752	64812752	+1	no_errors	ENST00000332707	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	1.000	C
YME1L1	10730	genome.wustl.edu	37	10	27425310	27425310	+	Silent	SNP	G	G	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr10:27425310G>A	ENST00000326799.3	-	6	754	c.606C>T	c.(604-606)ttC>ttT	p.F202F	YME1L1_ENST00000463270.1_5'Flank|YME1L1_ENST00000375972.3_Silent_p.F112F|YME1L1_ENST00000376016.3_Silent_p.F145F	NM_139312.2	NP_647473.1	Q96TA2	YMEL1_HUMAN	YME1-like 1 ATPase	202					cell proliferation (GO:0008283)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|mitochondrion organization (GO:0007005)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23						GAGACTGTATGAAAACTAAAT	0.378																																						dbGAP											0													71.0	66.0	68.0					10																	27425310		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ132637	CCDS7151.1, CCDS7152.1, CCDS58072.1	10p14	2013-06-10	2013-06-10		ENSG00000136758	ENSG00000136758		"""ATPases / AAA-type"""	12843	protein-coding gene	gene with protein product		607472	"""YME1 (S.cerevisiae)-like 1"", ""YME1-like 1 (S. cerevisiae)"""			22262461	Standard	NM_139312		Approved		uc001itj.3	Q96TA2	OTTHUMG00000017853	ENST00000326799.3:c.606C>T	10.37:g.27425310G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNM1|D3DRV8|D3DRV9|Q5T8D9|Q9H1Q0|Q9UMR9	Silent	SNP	pfam_Peptidase_M41,pfam_ATPase_AAA_core,smart_AAA+_ATPase,tigrfam_FtsH	p.F202	ENST00000326799.3	37	c.606	CCDS7152.1	10																																																																																			YME1L1	-	NULL	ENSG00000136758		0.378	YME1L1-005	KNOWN	basic|CCDS	protein_coding	YME1L1	HGNC	protein_coding	OTTHUMT00000047306.1	13	0.00	0	G	NM_139312		27425310	27425310	-1	no_errors	ENST00000326799	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	0.997	A
ZCWPW2	152098	genome.wustl.edu	37	3	28533663	28533663	+	Splice_Site	SNP	G	G	T			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr3:28533663G>T	ENST00000383768.2	+	6	844	c.656G>T	c.(655-657)aGg>aTg	p.R219M	ZCWPW2_ENST00000421010.1_Splice_Site_p.R219M			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	219							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						GTCAAGAAAAGGGTAAGATTG	0.279																																						dbGAP											0													44.0	43.0	43.0					3																	28533663		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.657+1G>T	3.37:g.28533663G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP,pfscan_PWWP,pfscan_Znf_CW	p.R219M	ENST00000383768.2	37	c.656	CCDS33723.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.420|8.420	0.846115|0.846115	0.16963|0.16963	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000419130|ENST00000383768;ENST00000421010	T|T;T	0.58652|0.35789	0.32|1.29;1.29	4.72|4.72	2.87|2.87	0.33458|0.33458	.|.	.|1.118660	.|0.06709	.|N	.|0.772749	T|T	0.27697|0.27697	0.0681|0.0681	L|L	0.29908|0.29908	0.895|0.895	0.21861|0.21861	N|N	0.9995|0.9995	.|P	.|0.39131	.|0.661	.|B	.|0.36289	.|0.221	T|T	0.24190|0.24190	-1.0167|-1.0167	7|10	0.72032|0.72032	D|D	0.01|0.01	-0.0016|-0.0016	7.4856|7.4856	0.27429|0.27429	0.2142:0.0:0.7858:0.0|0.2142:0.0:0.7858:0.0	.|.	.|219	.|Q504Y3	.|ZCPW2_HUMAN	N|M	103|219	ENSP00000395687:K103N|ENSP00000373278:R219M;ENSP00000412386:R219M	ENSP00000395687:K103N|ENSP00000373278:R219M	K|R	+|+	3|2	2|0	ZCWPW2|ZCWPW2	28508667|28508667	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.256000|0.256000	0.26092|0.26092	0.404000|0.404000	0.20999|0.20999	1.108000|1.108000	0.41662|0.41662	0.650000|0.650000	0.86243|0.86243	AAG|AGG	ZCWPW2	-	NULL	ENSG00000206559		0.279	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCWPW2	HGNC	protein_coding	OTTHUMT00000341318.1	34	0.00	0	G	XM_087384	Missense_Mutation	28533663	28533663	+1	no_errors	ENST00000383768	ensembl	human	known	69_37n	missense	21	12.50	3	SNP	0.999	T
ZKSCAN1	7586	genome.wustl.edu	37	7	99631563	99631563	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr7:99631563C>A	ENST00000324306.6	+	6	1669	c.1435C>A	c.(1435-1437)Cat>Aat	p.H479N	ZKSCAN1_ENST00000426572.1_Missense_Mutation_p.H443N|ZKSCAN1_ENST00000535170.1_Missense_Mutation_p.H266N	NM_003439.1	NP_003430.1	P17029	ZKSC1_HUMAN	zinc finger with KRAB and SCAN domains 1	479					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|lung(5)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	Lung NSC(181;0.0211)|all_lung(186;0.0323)|Esophageal squamous(72;0.0439)		STAD - Stomach adenocarcinoma(171;0.129)			CCTCACCAAGCATCAGAGAAT	0.473																																						dbGAP											0													91.0	98.0	96.0					7																	99631563		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52349	CCDS34698.1, CCDS69349.1, CCDS75640.1	7q22	2013-01-09	2004-11-16	2004-11-17	ENSG00000106261	ENSG00000106261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13101	protein-coding gene	gene with protein product		601260	"""zinc finger protein 36 (KOX 18)"""	ZNF139, ZNF36			Standard	NM_001287055		Approved	KOX18, PHZ-37, ZSCAN33	uc003usk.1	P17029	OTTHUMG00000156534	ENST00000324306.6:c.1435C>A	7.37:g.99631563C>A	ENSP00000323148:p.His479Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D294|P52745|Q2M1U1|Q8TBW5|Q8TEK7	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.H479N	ENST00000324306.6	37	c.1435	CCDS34698.1	7	.	.	.	.	.	.	.	.	.	.	C	22.6	4.317195	0.81469	.	.	ENSG00000106261	ENST00000324306;ENST00000426572;ENST00000535170	D;D;D	0.86865	-2.18;-2.18;-2.18	5.08	5.08	0.68730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000011	D	0.94945	0.8365	M	0.92367	3.3	0.52099	D	0.999948	D	0.76494	0.999	D	0.91635	0.999	D	0.95653	0.8708	10	0.87932	D	0	.	16.3706	0.83357	0.0:1.0:0.0:0.0	.	479	P17029	ZKSC1_HUMAN	N	479;443;266	ENSP00000323148:H479N;ENSP00000409172:H443N;ENSP00000443508:H266N	ENSP00000323148:H479N	H	+	1	0	ZKSCAN1	99469499	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	7.647000	0.83462	2.802000	0.96397	0.563000	0.77884	CAT	ZKSCAN1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000106261		0.473	ZKSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZKSCAN1	HGNC	protein_coding	OTTHUMT00000344550.2	37	0.00	0	C	NM_003439		99631563	99631563	+1	no_errors	ENST00000324306	ensembl	human	known	69_37n	missense	24	11.11	3	SNP	1.000	A
ZNF326	284695	genome.wustl.edu	37	1	90486421	90486421	+	Silent	SNP	T	T	A			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr1:90486421T>A	ENST00000340281.4	+	10	1388	c.1245T>A	c.(1243-1245)ccT>ccA	p.P415P	ZNF326_ENST00000370447.3_Silent_p.P326P|ZNF326_ENST00000455342.2_Silent_p.P209P	NM_182976.2	NP_892021.1	Q5BKZ1	ZN326_HUMAN	zinc finger protein 326	415					mRNA processing (GO:0006397)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of DNA-templated transcription, elongation (GO:0032784)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	DBIRD complex (GO:0044609)|nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(7)|ovary(1)	25		all_lung(203;0.0116)|Lung NSC(277;0.0417)		all cancers(265;0.00728)|Epithelial(280;0.0265)		TTTATATCCCTGCTTTACATA	0.358																																						dbGAP											0													138.0	135.0	136.0					1																	90486421		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC013102	CCDS727.1, CCDS728.1	1p22	2012-04-19			ENSG00000162664	ENSG00000162664		"""Zinc fingers, C2H2-type"""	14104	protein-coding gene	gene with protein product	"""ZNF-protein interacting with nuclear mRNPs and DBC1"""	614601				22446626	Standard	NM_182976		Approved	Zfp326, ZAN75, FLJ20403, ZIRD	uc001dnq.2	Q5BKZ1	OTTHUMG00000010675	ENST00000340281.4:c.1245T>A	1.37:g.90486421T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYX1|B4DLN0|B4E179|Q5VW93|Q5VW94|Q5VW96|Q5VW97|Q6NSA2|Q7Z638|Q7Z6C2	Silent	SNP	pfam_AKAP95	p.P415	ENST00000340281.4	37	c.1245	CCDS727.1	1																																																																																			ZNF326	-	pfam_AKAP95	ENSG00000162664		0.358	ZNF326-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF326	HGNC	protein_coding	OTTHUMT00000029428.2	39	0.00	0	T	NM_181781		90486421	90486421	+1	no_errors	ENST00000340281	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	1.000	A
ZNF383	163087	genome.wustl.edu	37	19	37726901	37726901	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A3QA-01A-61D-A228-09	TCGA-E9-A3QA-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7dd341c2-d65f-4770-bfdc-eedf3098d9cf	4202b2f2-caf7-46fb-a888-c086c934d7a8	g.chr19:37726901C>G	ENST00000589413.1	+	7	740	c.157C>G	c.(157-159)Caa>Gaa	p.Q53E	ZNF383_ENST00000590503.1_Missense_Mutation_p.Q53E|ZNF383_ENST00000352998.3_Missense_Mutation_p.Q53E			Q8NA42	ZN383_HUMAN	zinc finger protein 383	53	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|skin(1)	15			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCCTAAGCCTCAAGTGATCTC	0.478																																						dbGAP											0													123.0	116.0	118.0					19																	37726901		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY438646	CCDS12501.1	19q13.13	2013-01-08				ENSG00000188283		"""Zinc fingers, C2H2-type"", ""-"""	18609	protein-coding gene	gene with protein product							Standard	NM_152604		Approved	FLJ35863	uc002ofu.1	Q8NA42		ENST00000589413.1:c.157C>G	19.37:g.37726901C>G	ENSP00000464871:p.Gln53Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6X2C7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q53E	ENST00000589413.1	37	c.157	CCDS12501.1	19	.	.	.	.	.	.	.	.	.	.	C	11.70	1.716590	0.30413	.	.	ENSG00000188283	ENST00000352998	T	0.00705	5.81	3.39	2.31	0.28768	Krueppel-associated box (3);	0.000000	0.31020	N	0.008417	T	0.00328	0.0010	N	0.00729	-1.24	0.20307	N	0.999916	B	0.25609	0.13	B	0.23275	0.045	T	0.46569	-0.9182	9	.	.	.	.	9.5028	0.39028	0.0:0.5737:0.4263:0.0	.	53	Q8NA42	ZN383_HUMAN	E	53	ENSP00000340132:Q53E	.	Q	+	1	0	ZNF383	42418741	0.186000	0.23225	1.000000	0.80357	0.833000	0.47200	1.311000	0.33562	0.945000	0.37605	0.563000	0.77884	CAA	ZNF383	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000188283		0.478	ZNF383-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF383	HGNC	protein_coding	OTTHUMT00000458141.1	92	0.00	0	C	NM_152604		37726901	37726901	+1	no_errors	ENST00000352998	ensembl	human	known	69_37n	missense	58	22.37	17	SNP	0.998	G
