#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABL1	25	genome.wustl.edu	37	9	133753945	133753945	+	Missense_Mutation	SNP	A	A	T			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr9:133753945A>T	ENST00000318560.5	+	8	1795	c.1414A>T	c.(1414-1416)Atg>Ttg	p.M472L		NM_005157.4	NP_005148.2	P00519	ABL1_HUMAN	ABL proto-oncogene 1, non-receptor tyrosine kinase	472	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|autophagy (GO:0006914)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to dopamine (GO:1903351)|cellular response to oxidative stress (GO:0034599)|DNA damage induced protein phosphorylation (GO:0006975)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mismatch repair (GO:0006298)|mitochondrial depolarization (GO:0051882)|mitotic nuclear division (GO:0007067)|muscle cell differentiation (GO:0042692)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|regulation of response to DNA damage stimulus (GO:2001020)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)|signal transduction in response to DNA damage (GO:0042770)	actin cytoskeleton (GO:0015629)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase binding (GO:0051019)|nicotinate-nucleotide adenylyltransferase activity (GO:0004515)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|SH3 domain binding (GO:0017124)|syntaxin binding (GO:0019905)			breast(3)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1149)|kidney(3)|large_intestine(7)|lung(15)|ovary(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	1195		all_hematologic(13;0.0361)|Acute lymphoblastic leukemia(5;0.0543)|Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.4e-05)	Adenosine triphosphate(DB00171)|Bosutinib(DB06616)|Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Ponatinib(DB08901)|Regorafenib(DB08896)	CTATGAACTCATGCGAGCATG	0.507			"""T, Mis"""	"""BCR, ETV6, NUP214"""	"""CML, ALL, T-ALL"""																																	dbGAP		Dom	yes		9	9q34.1	25	v-abl Abelson murine leukemia viral oncogene homolog 1		L	0													140.0	137.0	138.0					9																	133753945		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14752	CCDS35165.1, CCDS35166.1	9q34.1	2014-09-17	2014-06-26		ENSG00000097007	ENSG00000097007		"""SH2 domain containing"""	76	protein-coding gene	gene with protein product		189980	"""v-abl Abelson murine leukemia viral oncogene homolog 1"", ""c-abl oncogene 1, receptor tyrosine kinase"", ""c-abl oncogene 1, non-receptor tyrosine kinase"""	ABL		1857987, 12626632	Standard	NM_007313		Approved	JTK7, c-ABL, p150	uc004bzv.3	P00519	OTTHUMG00000020813	ENST00000318560.5:c.1414A>T	9.37:g.133753945A>T	ENSP00000323315:p.Met472Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFJ3|Q13869|Q13870|Q16133|Q17R61|Q45F09	Missense_Mutation	SNP	pfam_F-actin_binding,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.M491L	ENST00000318560.5	37	c.1471	CCDS35166.1	9	.	.	.	.	.	.	.	.	.	.	A	33	5.205584	0.95033	.	.	ENSG00000097007	ENST00000444970;ENST00000372348;ENST00000318560	D;D	0.84589	-1.87;-1.87	4.97	4.97	0.65823	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.080533	0.85682	D	0.000000	D	0.87672	0.6236	L	0.43152	1.355	0.80722	D	1	P;P	0.48407	0.779;0.91	P;P	0.58077	0.738;0.832	D	0.89018	0.3433	10	0.87932	D	0	.	14.1376	0.65297	1.0:0.0:0.0:0.0	.	472;509	P00519;Q59FK4	ABL1_HUMAN;.	L	287;491;472	ENSP00000361423:M491L;ENSP00000323315:M472L	ENSP00000323315:M472L	M	+	1	0	ABL1	132743766	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.287000	0.95975	1.992000	0.58205	0.533000	0.62120	ATG	ABL1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000097007		0.507	ABL1-001	KNOWN	basic|CCDS	protein_coding	ABL1	HGNC	protein_coding	OTTHUMT00000054684.1	36	0.00	0	A	NM_007313		133753945	133753945	+1	no_errors	ENST00000372348	ensembl	human	known	69_37n	missense	44	21.43	12	SNP	1.000	T
ACAN	176	genome.wustl.edu	37	15	89401123	89401123	+	Silent	SNP	A	A	T			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr15:89401123A>T	ENST00000561243.1	+	11	5307	c.5307A>T	c.(5305-5307)gcA>gcT	p.A1769A	ACAN_ENST00000439576.2_Silent_p.A1769A|ACAN_ENST00000559004.1_Silent_p.A1769A|ACAN_ENST00000352105.7_Silent_p.A1769A			P16112	PGCA_HUMAN	aggrecan	1793	CS-2.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|extracellular matrix structural constituent (GO:0005201)|hyaluronic acid binding (GO:0005540)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(4)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(15)|liver(2)|lung(40)|ovary(2)|prostate(5)|skin(5)|stomach(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	93	Lung NSC(78;0.0392)|all_lung(78;0.077)		BRCA - Breast invasive adenocarcinoma(143;0.146)			GTGGAGAAGCATCTGGAGTTC	0.517																																						dbGAP											0													58.0	60.0	59.0					15																	89401123		1904	4120	6024	-	-	-	SO:0001819	synonymous_variant	0			M55172	CCDS53970.1, CCDS53971.1	15q26.1	2013-05-07	2007-02-16	2007-02-16	ENSG00000157766	ENSG00000157766		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	319	protein-coding gene	gene with protein product	"""aggrecan proteoglycan"""	155760	"""chondroitin sulfate proteoglycan 1"", ""aggrecan 1"""	MSK16, CSPG1, AGC1		1985970	Standard	NM_013227		Approved	CSPGCP	uc010upo.1	P16112	OTTHUMG00000171989	ENST00000561243.1:c.5307A>T	15.37:g.89401123A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13650|Q9UCD3|Q9UCP4|Q9UCP5|Q9UDE0	Silent	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EGF-like,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.A1769	ENST00000561243.1	37	c.5307	CCDS53970.1	15																																																																																			ACAN	-	NULL	ENSG00000157766		0.517	ACAN-006	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAN	HGNC	protein_coding	OTTHUMT00000416267.2	65	0.00	0	A	NM_001135		89401123	89401123	+1	no_errors	ENST00000439576	ensembl	human	known	69_37n	silent	99	22.66	29	SNP	0.117	T
ANKZF1	55139	genome.wustl.edu	37	2	220100577	220100577	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr2:220100577G>A	ENST00000323348.5	+	12	2125	c.1951G>A	c.(1951-1953)Gcc>Acc	p.A651T	GLB1L_ENST00000497855.1_5'Flank|ANKZF1_ENST00000409849.1_Missense_Mutation_p.A441T|ANKZF1_ENST00000410034.3_Missense_Mutation_p.A651T	NM_018089.2	NP_060559.2	Q9H8Y5	ANKZ1_HUMAN	ankyrin repeat and zinc finger domain containing 1	651						membrane (GO:0016020)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	23		Renal(207;0.0474)		Epithelial(149;1.2e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GCGATTTGCCGCCCTCAGTGA	0.612																																						dbGAP											0													108.0	122.0	117.0					2																	220100577		2167	4256	6423	-	-	-	SO:0001583	missense	0			AF364318	CCDS42821.1, CCDS63129.1	2q35	2013-01-10			ENSG00000163516	ENSG00000163516		"""Zinc fingers, C2H2-type"", ""Ankyrin repeat domain containing"""	25527	protein-coding gene	gene with protein product						12477932	Standard	NM_018089		Approved	FLJ10415, ZNF744	uc002vkg.3	Q9H8Y5	OTTHUMG00000154533	ENST00000323348.5:c.1951G>A	2.37:g.220100577G>A	ENSP00000321617:p.Ala651Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NVZ4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.A651T	ENST00000323348.5	37	c.1951	CCDS42821.1	2	.	.	.	.	.	.	.	.	.	.	G	13.51	2.259111	0.39896	.	.	ENSG00000163516	ENST00000323348;ENST00000409849;ENST00000410034	D;D;D	0.95001	-3.58;-3.58;-3.58	5.38	3.6	0.41247	.	0.110807	0.64402	D	0.000007	D	0.94377	0.8192	M	0.80847	2.515	0.38888	D	0.95704	D	0.65815	0.995	P	0.48738	0.588	D	0.93121	0.6525	10	0.49607	T	0.09	-11.4375	8.4248	0.32723	0.1389:0.1273:0.7338:0.0	.	651	Q9H8Y5	ANKZ1_HUMAN	T	651;441;651	ENSP00000321617:A651T;ENSP00000386815:A441T;ENSP00000386337:A651T	ENSP00000321617:A651T	A	+	1	0	ANKZF1	219808821	1.000000	0.71417	0.932000	0.37286	0.445000	0.32107	3.426000	0.52778	0.852000	0.35287	-0.123000	0.14984	GCC	ANKZF1	-	NULL	ENSG00000163516		0.612	ANKZF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKZF1	HGNC	protein_coding	OTTHUMT00000335790.1	14	0.00	0	G	NM_018089		220100577	220100577	+1	no_errors	ENST00000323348	ensembl	human	known	69_37n	missense	17	33.33	9	SNP	0.827	A
BRCA1	672	genome.wustl.edu	37	17	41244296	41244296	+	Silent	SNP	A	A	T			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr17:41244296A>T	ENST00000357654.3	-	10	3370	c.3252T>A	c.(3250-3252)ctT>ctA	p.L1084L	BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000346315.3_Silent_p.L1084L|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000493795.1_Silent_p.L1037L|BRCA1_ENST00000354071.3_Silent_p.L1084L|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000471181.2_Silent_p.L1084L|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000309486.4_Silent_p.L788L|BRCA1_ENST00000491747.2_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1084					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CCCCTAATCTAAGCATAGCAT	0.368			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													125.0	126.0	126.0					17																	41244296		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3252T>A	17.37:g.41244296A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.L1084	ENST00000357654.3	37	c.3252	CCDS11453.1	17																																																																																			BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.368	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	33	0.00	0	A	NM_007294		41244296	41244296	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	silent	33	17.50	7	SNP	0.000	T
BTK	695	genome.wustl.edu	37	X	100615095	100615095	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chrX:100615095C>T	ENST00000308731.7	-	9	983	c.820G>A	c.(820-822)Gac>Aac	p.D274N	BTK_ENST00000372880.1_Missense_Mutation_p.D274N	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	274	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.		Missing (in XLA; severe). {ECO:0000269|PubMed:7849721}.		adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						TCTATGGAGTCTTCTGCTTCA	0.398									Agammaglobulinemia, X-linked																													dbGAP											0													182.0	153.0	163.0					X																	100615095		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.820G>A	X.37:g.100615095C>T	ENSP00000308176:p.Asp274Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAW1|Q32ML5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.D274N	ENST00000308731.7	37	c.820	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	C	3.211	-0.161524	0.06502	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	T;T	0.29397	1.57;1.57	5.98	5.12	0.69794	Src homology-3 domain (1);SH2 motif (1);	0.204757	0.51477	D	0.000090	T	0.20659	0.0497	L	0.38175	1.15	0.40686	D	0.982352	B;B;B	0.09022	0.002;0.0;0.0	B;B;B	0.09377	0.004;0.001;0.0	T	0.07462	-1.0771	10	0.02654	T	1	.	11.5432	0.50677	0.0:0.8496:0.0:0.1504	.	274;274;274	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	N	274	ENSP00000361971:D274N;ENSP00000308176:D274N	ENSP00000308176:D274N	D	-	1	0	BTK	100501751	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	1.717000	0.37991	1.287000	0.44583	-0.197000	0.12766	GAC	BTK	-	pfscan_SH3_domain	ENSG00000010671		0.398	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	73	0.00	0	C	NM_000061		100615095	100615095	-1	no_errors	ENST00000308731	ensembl	human	known	69_37n	missense	51	41.38	36	SNP	1.000	T
C21orf37	100505929	genome.wustl.edu	37	21	18814102	18814102	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr21:18814102G>T	ENST00000440664.1	+	2	216	c.4G>T	c.(4-6)Gag>Tag	p.E2*						chromosome 21 open reading frame 37																		TCTAAAGATGGAGAGAGCTCA	0.373																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0					21q21.1	2013-01-15			ENSG00000232560	ENSG00000232560			1277	other	unknown							Standard	NR_037585		Approved		uc002ykg.2	A6NIU2	OTTHUMG00000074397	ENST00000440664.1:c.4G>T	21.37:g.18814102G>T	ENSP00000388953:p.Glu2*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.E2*	ENST00000440664.1	37	c.4		21	.	.	.	.	.	.	.	.	.	.	G	13.31	2.198055	0.38806	.	.	ENSG00000232560	ENST00000440664	.	.	.	0.579	-1.16	0.09678	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999998	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	2	.	ENSP00000388953:E2X	E	+	1	0	C21orf37	17735973	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.144000	0.16135	-1.170000	0.02769	-0.688000	0.03733	GAG	C21orf37	-	NULL	ENSG00000232560		0.373	C21orf37-001	KNOWN	basic|appris_principal	protein_coding	C21orf37	HGNC	protein_coding	OTTHUMT00000158061.1	27	0.00	0	G	NR_037585		18814102	18814102	+1	no_errors	ENST00000440664	ensembl	human	known	69_37n	nonsense	25	13.79	4	SNP	0.000	T
CEACAM18	729767	genome.wustl.edu	37	19	51984799	51984799	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr19:51984799C>A	ENST00000396477.4	+	3	574	c.553C>A	c.(553-555)Cca>Aca	p.P185T	CEACAM18_ENST00000451626.1_Missense_Mutation_p.P246T	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18	185										breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GACAATTTCCCCAGACGGCAA	0.493																																						dbGAP											0													92.0	86.0	88.0					19																	51984799		2017	4179	6196	-	-	-	SO:0001583	missense	0					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.553C>A	19.37:g.51984799C>A	ENSP00000379738:p.Pro185Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JN24	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.P246T	ENST00000396477.4	37	c.736		19	.	.	.	.	.	.	.	.	.	.	.	4.115	0.019415	0.08006	.	.	ENSG00000213822	ENST00000451626;ENST00000451086;ENST00000396477	T	0.76968	-1.06	2.82	1.73	0.24493	Immunoglobulin-like fold (1);	.	.	.	.	T	0.73745	0.3626	M	0.61703	1.905	0.09310	N	1	B	0.28783	0.222	B	0.37091	0.241	T	0.59910	-0.7365	9	0.19590	T	0.45	-10.6175	7.7353	0.28810	0.0:0.7394:0.2606:0.0	.	246	A8MTB9	CEA18_HUMAN	T	246;185;185	ENSP00000402203:P246T	ENSP00000379738:P185T	P	+	1	0	CEACAM18	56676611	0.011000	0.17503	0.002000	0.10522	0.004000	0.04260	1.208000	0.32345	0.734000	0.32515	0.558000	0.71614	CCA	CEACAM18	-	smart_Ig_sub	ENSG00000213822		0.493	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	HGNC	protein_coding	OTTHUMT00000323114.2	72	0.00	0	C			51984799	51984799	+1	no_errors	ENST00000451626	ensembl	human	known	69_37n	missense	57	28.75	23	SNP	0.002	A
COL6A1	1291	genome.wustl.edu	37	21	47423450	47423450	+	Silent	SNP	C	C	T			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr21:47423450C>T	ENST00000361866.3	+	35	2724	c.2610C>T	c.(2608-2610)gaC>gaT	p.D870D	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	870	C-terminal globular domain.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CCGCCCACGACGTGCGGGTGG	0.711																																						dbGAP											0													19.0	22.0	21.0					21																	47423450		2186	4272	6458	-	-	-	SO:0001819	synonymous_variant	0			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2610C>T	21.37:g.47423450C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D870	ENST00000361866.3	37	c.2610	CCDS13727.1	21																																																																																			COL6A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142156		0.711	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	28	0.00	0	C	NM_001848		47423450	47423450	+1	no_errors	ENST00000361866	ensembl	human	known	69_37n	silent	31	32.61	15	SNP	0.001	T
DHRS4	10901	genome.wustl.edu	37	14	24424346	24424346	+	Silent	SNP	G	G	A	rs4981491		TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr14:24424346G>A	ENST00000313250.5	+	2	434	c.231G>A	c.(229-231)caG>caA	p.Q77Q	DHRS4_ENST00000397074.3_Silent_p.Q77Q|DHRS4-AS1_ENST00000556379.1_RNA|DHRS4_ENST00000397073.2_Silent_p.Q59Q|DHRS4_ENST00000558581.1_Silent_p.Q77Q|DHRS4_ENST00000421831.1_Silent_p.Q59Q|DHRS4_ENST00000382761.3_Silent_p.Q59Q|DHRS4_ENST00000397075.3_Silent_p.Q77Q|DHRS4_ENST00000559632.1_Silent_p.Q77Q|DHRS4_ENST00000543741.2_Silent_p.Q77Q|DHRS4_ENST00000308178.8_Silent_p.Q59Q|DHRS4_ENST00000558263.1_Silent_p.Q77Q	NM_021004.2	NP_066284.2	Q9BTZ2	DHRS4_HUMAN	dehydrogenase/reductase (SDR family) member 4	77					alcohol metabolic process (GO:0006066)|cellular ketone metabolic process (GO:0042180)|oxidation-reduction process (GO:0055114)|protein tetramerization (GO:0051262)|steroid metabolic process (GO:0008202)	extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	3-keto sterol reductase activity (GO:0000253)|alcohol dehydrogenase [NAD(P)+] activity (GO:0018455)|carbonyl reductase (NADPH) activity (GO:0004090)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|receptor binding (GO:0005102)			central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14				GBM - Glioblastoma multiforme(265;0.00962)	Vitamin A(DB00162)	CCACGCTGCAGGGGGAGGGGC	0.701																																						dbGAP											0													37.0	42.0	40.0					14																	24424346		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF044127	CCDS9605.1, CCDS61408.1, CCDS61409.1, CCDS61410.1, CCDS61411.1, CCDS61412.1	14q11.2	2013-06-14			ENSG00000157326	ENSG00000157326	1.1.1.184	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16985	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 2"""	611596				10333503, 19027726	Standard	NM_021004		Approved	SCAD-SRL, SDR-SRL, humNRDR, FLJ11008, SDR25C2	uc001wla.3	Q9BTZ2	OTTHUMG00000028777	ENST00000313250.5:c.231G>A	14.37:g.24424346G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB10|B7WNS9|D3YTB8|E2QRL8|O95162|Q20CR0|Q2LC19|Q2LE81|Q58IU4|Q6E0Y1|Q6UWU3|Q71UQ6|Q8TD03|Q9H3N5|Q9NV08	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DHB_DH,prints_DH_sc/Rdtase_SDR,prints_ADH_insect	p.Q77	ENST00000313250.5	37	c.231	CCDS9605.1	14																																																																																			DHRS4	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR	ENSG00000157326		0.701	DHRS4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS4	HGNC	protein_coding	OTTHUMT00000071857.3	45	0.00	0	G			24424346	24424346	+1	no_errors	ENST00000313250	ensembl	human	known	69_37n	silent	71	10.00	8	SNP	0.984	A
NUTM2D	728130	genome.wustl.edu	37	10	89125892	89125892	+	Intron	SNP	G	G	A	rs200286280	byFrequency	TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr10:89125892G>A	ENST00000381697.2	+	7	2233				NUTM2D_ENST00000412718.1_Intron			Q5VT03	NTM2D_HUMAN	NUT family member 2D																		CTTTCCTCCCGCAGCTAGTGG	0.632																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0					10q23.31	2013-03-14	2013-03-14	2013-03-14	ENSG00000214562	ENSG00000214562			23447	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member D"""	FAM22D			Standard	NR_075100		Approved		uc001kes.3	Q5VT03	OTTHUMG00000018672	ENST00000381697.2:c.1636-4G>A	10.37:g.89125892G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGV9	RNA	SNP	-	NULL	ENST00000381697.2	37	NULL		10																																																																																			FAM22D	-	-	ENSG00000214562		0.632	NUTM2D-004	KNOWN	basic|appris_candidate_longest	protein_coding	FAM22D	HGNC	protein_coding	OTTHUMT00000470142.1	17	0.00	0	G	NR_075100		89125892	89125892	+1	no_errors	ENST00000465545	ensembl	human	known	69_37n	rna	23	28.12	9	SNP	0.001	A
GAN	8139	genome.wustl.edu	37	16	81391441	81391441	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr16:81391441G>A	ENST00000568107.2	+	5	1040	c.878G>A	c.(877-879)cGa>cAa	p.R293Q		NM_022041.3	NP_071324.1	Q9H2C0	GAN_HUMAN	gigaxonin	293					cell death (GO:0008219)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)	25		Colorectal(91;0.153)				GCAGCGATGCGATGCATGTGC	0.448																																					GBM(106;1239 1507 7582 9741 33976)	dbGAP											0													190.0	165.0	173.0					16																	81391441		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF291673	CCDS10935.1	16q24.1	2014-09-17	2008-08-01		ENSG00000261609	ENSG00000261609		"""Kelch-like"", ""BTB/POZ domain containing"""	4137	protein-coding gene	gene with protein product	"""kelch-like family member 16"""	605379	"""giant axonal neuropathy (gigaxonin)"""			9450783, 11062483	Standard	NM_022041		Approved	GAN1, KLHL16	uc002fgo.3	Q9H2C0	OTTHUMG00000137627	ENST00000568107.2:c.878G>A	16.37:g.81391441G>A	ENSP00000476795:p.Arg293Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.R293Q	ENST00000568107.2	37	c.878	CCDS10935.1	16	.	.	.	.	.	.	.	.	.	.	G	25.6	4.658974	0.88154	.	.	ENSG00000127688	ENST00000248272	T	0.66280	-0.2	5.94	5.94	0.96194	Galactose oxidase, beta-propeller (1);	0.105066	0.64402	D	0.000002	T	0.43809	0.1264	N	0.24115	0.695	0.80722	D	1	P	0.40398	0.716	B	0.22880	0.042	T	0.42565	-0.9444	10	0.16420	T	0.52	.	20.3552	0.98837	0.0:0.0:1.0:0.0	.	293	Q9H2C0	GAN_HUMAN	Q	293	ENSP00000248272:R293Q	ENSP00000248272:R293Q	R	+	2	0	GAN	79948942	1.000000	0.71417	0.995000	0.50966	0.923000	0.55619	9.610000	0.98337	2.812000	0.96745	0.557000	0.71058	CGA	GAN	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000127688		0.448	GAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAN	HGNC	protein_coding	OTTHUMT00000269050.3	71	0.00	0	G			81391441	81391441	+1	no_errors	ENST00000248272	ensembl	human	known	69_37n	missense	39	43.48	30	SNP	1.000	A
HNRNPF	3185	genome.wustl.edu	37	10	43882627	43882627	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr10:43882627A>G	ENST00000544000.1	-	4	1113	c.706T>C	c.(706-708)Tac>Cac	p.Y236H	HNRNPF_ENST00000356053.3_Missense_Mutation_p.Y236H|HNRNPF_ENST00000498176.1_5'Flank|HNRNPF_ENST00000443950.2_Missense_Mutation_p.Y236H|HNRNPF_ENST00000337970.3_Missense_Mutation_p.Y236H|HNRNPF_ENST00000357065.4_Missense_Mutation_p.Y236H	NM_001098207.1	NP_001091677.1	P52597	HNRPF_HUMAN	heterogeneous nuclear ribonucleoprotein F	236					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|urinary_tract(1)	19						CCTGTGCTGTAGGCACCAGGC	0.632																																						dbGAP											0													66.0	64.0	65.0					10																	43882627		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7204.1	10q11.21	2013-02-12		2008-04-18	ENSG00000169813	ENSG00000169813		"""RNA binding motif (RRM) containing"""	5039	protein-coding gene	gene with protein product		601037		HNRPF		7499401	Standard	NM_001098208		Approved		uc001jas.2	P52597	OTTHUMG00000018029	ENST00000544000.1:c.706T>C	10.37:g.43882627A>G	ENSP00000438061:p.Tyr236His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KM84|Q5T0N2|Q96AU2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CHHC,smart_RRM_dom,pfscan_RRM_dom	p.Y236H	ENST00000544000.1	37	c.706	CCDS7204.1	10	.	.	.	.	.	.	.	.	.	.	A	8.432	0.848848	0.17034	.	.	ENSG00000169813	ENST00000544000;ENST00000443950;ENST00000356053;ENST00000357065;ENST00000337970;ENST00000540544	T;T;T;T;T	0.11495	2.77;2.77;2.77;2.77;2.77	4.38	4.38	0.52667	.	0.000000	0.85682	D	0.000000	T	0.11879	0.0289	L	0.56199	1.76	0.58432	D	0.999997	B	0.29085	0.232	B	0.29598	0.104	T	0.07328	-1.0778	10	0.27082	T	0.32	-29.5549	12.2115	0.54381	1.0:0.0:0.0:0.0	.	236	P52597	HNRPF_HUMAN	H	236;236;236;236;236;159	ENSP00000438061:Y236H;ENSP00000400433:Y236H;ENSP00000348345:Y236H;ENSP00000349573:Y236H;ENSP00000338477:Y236H	ENSP00000338477:Y236H	Y	-	1	0	HNRNPF	43202633	1.000000	0.71417	1.000000	0.80357	0.209000	0.24338	6.888000	0.75622	2.200000	0.70718	0.533000	0.62120	TAC	HNRNPF	-	NULL	ENSG00000169813		0.632	HNRNPF-202	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPF	HGNC	protein_coding	OTTHUMT00000047705.2	56	0.00	0	A			43882627	43882627	-1	no_errors	ENST00000337970	ensembl	human	known	69_37n	missense	60	31.03	27	SNP	1.000	G
IDS	3423	genome.wustl.edu	37	X	148584951	148584951	+	Silent	SNP	G	G	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chrX:148584951G>A	ENST00000340855.6	-	3	518	c.309C>T	c.(307-309)taC>taT	p.Y103Y	IDS_ENST00000541269.1_Intron|IDS_ENST00000428056.2_Silent_p.Y103Y|IDS_ENST00000370441.4_Silent_p.Y103Y|IDS_ENST00000422081.2_Intron|IDS_ENST00000370443.4_Silent_p.Y103Y|IDS_ENST00000427113.2_Intron|IDS_ENST00000490775.1_5'Flank	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	103					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					AGTTGAAGTCGTACAGGCGGG	0.562																																						dbGAP											0			GRCh37	CM981018	IDS	M							18.0	15.0	16.0					X																	148584951		2192	4257	6449	-	-	-	SO:0001819	synonymous_variant	0			M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.309C>T	X.37:g.148584951G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWT4|Q14604|Q9BRM3	Silent	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.Y103	ENST00000340855.6	37	c.309	CCDS14685.1	X																																																																																			IDS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000010404		0.562	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDS	HGNC	protein_coding	OTTHUMT00000058677.3	36	0.00	0	G			148584951	148584951	-1	no_errors	ENST00000340855	ensembl	human	known	69_37n	silent	42	33.33	21	SNP	1.000	A
KLF6	1316	genome.wustl.edu	37	10	3821561	3821561	+	3'UTR	SNP	G	G	A	rs17731	byFrequency	TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr10:3821561G>A	ENST00000497571.1	-	0	1282				KLF6_ENST00000173785.4_5'UTR|KLF6_ENST00000542957.1_3'UTR	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6						B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		GTGCTATGCCGCTTCTTACAG	0.597													G|||	1355	0.270567	0.0265	0.2723	5008	,	,		17930	0.4821		0.3489	False		,,,				2504	0.3006					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.*170C>T	10.37:g.3821561G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	RNA	SNP	-	NULL	ENST00000497571.1	37	NULL	CCDS7060.1	10																																																																																			KLF6	-	-	ENSG00000067082		0.597	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF6	HGNC	protein_coding	OTTHUMT00000046495.1	8	0.00	0	G			3821561	3821561	-1	no_errors	ENST00000173785	ensembl	human	known	69_37n	rna	5	61.54	8	SNP	1.000	A
KRT13	3860	genome.wustl.edu	37	17	39659272	39659272	+	Missense_Mutation	SNP	G	G	A	rs202015813		TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr17:39659272G>A	ENST00000246635.3	-	4	860	c.814C>T	c.(814-816)Cgc>Tgc	p.R272C	KRT13_ENST00000587118.1_5'Flank|AC019349.5_ENST00000411759.1_RNA|KRT13_ENST00000587544.1_Missense_Mutation_p.R272C|KRT13_ENST00000336861.3_Missense_Mutation_p.R272C	NM_153490.2	NP_705694	P13646	K1C13_HUMAN	keratin 13	272	Linker 12.|Rod.				cellular response to retinoic acid (GO:0071300)|cytoskeleton organization (GO:0007010)|response to radiation (GO:0009314)|tongue morphogenesis (GO:0043587)	extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)	p.R272S(1)		NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|urinary_tract(1)	33		Breast(137;0.000286)				GCCAGCACGCGGGTCAGGTCA	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		20628	0.0		0.001	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	lung(1)											222.0	210.0	214.0					17																	39659272		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11396.1, CCDS11397.1	17q21.2	2013-06-20			ENSG00000171401	ENSG00000171401		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6415	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 13"", ""cytokeratin 13"""	148065				16831889	Standard	NM_153490		Approved	K13, CK13, MGC3781, MGC161462	uc002hwu.1	P13646	OTTHUMG00000133434	ENST00000246635.3:c.814C>T	17.37:g.39659272G>A	ENSP00000246635:p.Arg272Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53G54|Q6AZK5|Q8N240	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.R272C	ENST00000246635.3	37	c.814	CCDS11396.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	18.15	3.559685	0.65538	.	.	ENSG00000171401	ENST00000246635;ENST00000336861;ENST00000157775	T;T	0.78595	-1.19;-1.19	4.32	4.32	0.51571	Filament (1);	0.000000	0.47852	D	0.000209	T	0.77260	0.4104	L	0.56124	1.755	0.50813	D	0.999892	B;P;B;P	0.38280	0.397;0.625;0.397;0.625	B;P;B;P	0.45377	0.119;0.478;0.119;0.478	T	0.79633	-0.1722	10	0.87932	D	0	.	10.5407	0.45031	0.0:0.0:0.666:0.334	.	260;272;272;272	P13646-2;A1A4E9;P13646-3;P13646	.;.;.;K1C13_HUMAN	C	272;272;260	ENSP00000246635:R272C;ENSP00000336604:R272C	ENSP00000157775:R260C	R	-	1	0	KRT13	36912798	0.087000	0.21565	0.998000	0.56505	0.884000	0.51177	1.928000	0.40104	2.401000	0.81631	0.561000	0.74099	CGC	KRT13	-	pfam_F,superfamily_Prefoldin,prints_Keratin_I	ENSG00000171401		0.602	KRT13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRT13	HGNC	protein_coding	OTTHUMT00000257297.1	26	0.00	0	G	NM_153490		39659272	39659272	-1	no_errors	ENST00000246635	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	1.000	A
LINC00649	100506334	genome.wustl.edu	37	21	35335100	35335100	+	RNA	SNP	G	G	A	rs7283594	byFrequency	TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr21:35335100G>A	ENST00000427447.1	+	0	669				LINC00649_ENST00000597626.1_RNA|LINC00649_ENST00000594370.1_RNA|LINC00649_ENST00000595747.1_RNA|LINC00649_ENST00000594752.1_RNA|LINC00649_ENST00000596365.1_RNA|LINC00649_ENST00000598119.1_RNA|LINC00649_ENST00000593977.1_RNA|LINC00649_ENST00000400353.2_RNA|LINC00649_ENST00000381181.1_RNA|LINC00649_ENST00000600155.1_RNA	NR_038883.1				long intergenic non-protein coding RNA 649																		tttagccccagtctctttgga	0.408													A|||	3412	0.68131	0.6626	0.7666	5008	,	,		20152	0.6349		0.6382	False		,,,				2504	0.7382					dbGAP											0																																										-	-	-			0			DA374118		21q22.11	2012-10-12			ENSG00000237945	ENSG00000237945		"""Long non-coding RNAs"""	44305	non-coding RNA	RNA, long non-coding							Standard	NR_038883		Approved		uc002ytn.3		OTTHUMG00000065819		21.37:g.35335100G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427447.1	37	NULL		21																																																																																			LINC00650	-	-	ENSG00000205673		0.408	LINC00649-001	KNOWN	basic|exp_conf	antisense	LINC00650	HGNC	antisense	OTTHUMT00000141032.5	34	0.00	0	G	NR_038883		35335100	35335100	+1	no_errors	ENST00000381181	ensembl	human	known	69_37n	rna	36	21.74	10	SNP	0.117	A
LUZP1	7798	genome.wustl.edu	37	1	23418097	23418097	+	Silent	SNP	A	A	G			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr1:23418097A>G	ENST00000302291.4	-	4	3459	c.2658T>C	c.(2656-2658)ccT>ccC	p.P886P	LUZP1_ENST00000418342.1_Silent_p.P886P|LUZP1_ENST00000314174.5_Silent_p.P886P|LUZP1_ENST00000374623.3_Silent_p.P886P			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	886					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		TCCTCTCCACAGGATCCGATG	0.537																																						dbGAP											0													101.0	93.0	96.0					1																	23418097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.2658T>C	1.37:g.23418097A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TH93|Q8N4X3|Q8TEH1	Silent	SNP	NULL	p.P886	ENST00000302291.4	37	c.2658	CCDS30628.1	1																																																																																			LUZP1	-	NULL	ENSG00000169641		0.537	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP1	HGNC	protein_coding	OTTHUMT00000008900.3	56	0.00	0	A	NM_033631		23418097	23418097	-1	no_errors	ENST00000302291	ensembl	human	known	69_37n	silent	57	25.00	19	SNP	0.000	G
LRRC42	115353	genome.wustl.edu	37	1	54417833	54417833	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr1:54417833A>C	ENST00000371370.3	+	3	682	c.161A>C	c.(160-162)gAg>gCg	p.E54A	LRRC42_ENST00000319223.4_Missense_Mutation_p.E54A	NM_001256409.1	NP_001243338.1	Q9Y546	LRC42_HUMAN	leucine rich repeat containing 42	54										breast(2)|kidney(1)|large_intestine(1)|lung(5)	9						TTTTCTGTGGAGCTTTGCATG	0.512																																						dbGAP											0													104.0	102.0	103.0					1																	54417833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075201	CCDS585.1	1p33-p32.1	2014-02-12			ENSG00000116212	ENSG00000116212			28792	protein-coding gene	gene with protein product						12477932	Standard	NM_001256409		Approved	MGC8974	uc001cwj.2	Q9Y546	OTTHUMG00000008436	ENST00000371370.3:c.161A>C	1.37:g.54417833A>C	ENSP00000360421:p.Glu54Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ46|Q8N2Q8	Missense_Mutation	SNP	NULL	p.E54A	ENST00000371370.3	37	c.161	CCDS585.1	1	.	.	.	.	.	.	.	.	.	.	A	21.7	4.181026	0.78677	.	.	ENSG00000116212	ENST00000371370;ENST00000371368;ENST00000319223;ENST00000444987	.	.	.	5.64	5.64	0.86602	.	0.188018	0.46442	D	0.000299	T	0.63920	0.2552	N	0.24115	0.695	0.50313	D	0.999862	D;D;D	0.69078	0.994;0.997;0.989	P;D;P	0.68353	0.888;0.957;0.775	T	0.67624	-0.5623	9	0.59425	D	0.04	-27.4494	16.1717	0.81822	1.0:0.0:0.0:0.0	.	54;54;54	E7EP35;A6NL66;Q9Y546	.;.;LRC42_HUMAN	A	54	.	ENSP00000318185:E54A	E	+	2	0	LRRC42	54190421	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.323000	0.65858	2.285000	0.76669	0.528000	0.53228	GAG	LRRC42	-	NULL	ENSG00000116212		0.512	LRRC42-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRC42	HGNC	protein_coding	OTTHUMT00000023250.1	44	0.00	0	A	NM_052940		54417833	54417833	+1	no_errors	ENST00000319223	ensembl	human	known	69_37n	missense	47	37.33	28	SNP	1.000	C
MAGEE2	139599	genome.wustl.edu	37	X	75004573	75004573	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chrX:75004573G>A	ENST00000373359.2	-	1	506	c.314C>T	c.(313-315)aCg>aTg	p.T105M		NM_138703.4	NP_619648.1	Q8TD90	MAGE2_HUMAN	melanoma antigen family E, 2	105	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.T105M(1)		autonomic_ganglia(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AGACCCCTCCGTCTGGCTTTT	0.537																																						dbGAP											1	Substitution - Missense(1)	pancreas(1)											34.0	31.0	32.0					X																	75004573		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF490509	CCDS14431.1	Xq13	2008-02-05			ENSG00000186675	ENSG00000186675			24935	protein-coding gene	gene with protein product		300760				11454705	Standard	NM_138703		Approved	HCA3	uc004ecj.2	Q8TD90	OTTHUMG00000021870	ENST00000373359.2:c.314C>T	X.37:g.75004573G>A	ENSP00000362457:p.Thr105Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSI5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.T105M	ENST00000373359.2	37	c.314	CCDS14431.1	X	.	.	.	.	.	.	.	.	.	.	T	9.578	1.122695	0.20877	.	.	ENSG00000186675	ENST00000373359	T	0.04603	3.59	3.14	-4.36	0.03645	.	.	.	.	.	T	0.01695	0.0054	N	0.11284	0.12	0.09310	N	1	P	0.38167	0.621	B	0.37833	0.259	T	0.32745	-0.9895	9	0.05351	T	0.99	.	1.0479	0.01573	0.2077:0.1197:0.3:0.3726	.	105	Q8TD90	MAGE2_HUMAN	M	105	ENSP00000362457:T105M	ENSP00000362457:T105M	T	-	2	0	MAGEE2	74921298	0.001000	0.12720	0.000000	0.03702	0.197000	0.23852	-1.042000	0.03539	-2.017000	0.00944	-1.907000	0.00523	ACG	MAGEE2	-	pfam_MAGE,pfscan_MAGE	ENSG00000186675		0.537	MAGEE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE2	HGNC	protein_coding	OTTHUMT00000057288.1	17	0.00	0	G	NM_138703		75004573	75004573	-1	no_errors	ENST00000373359	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.000	A
MBIP	51562	genome.wustl.edu	37	14	36783731	36783732	+	Missense_Mutation	DNP	AA	AA	CG	rs17849938		TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr14:36783731_36783732AA>CG	ENST00000416007.4	-	4	644_645	c.557_558TT>CG	c.(556-558)aTT>aCG	p.I186T	MBIP_ENST00000318473.7_Missense_Mutation_p.I186T|MBIP_ENST00000603913.1_5'Flank|MBIP_ENST00000359527.7_Missense_Mutation_p.I186T	NM_001144891.1|NM_016586.2	NP_001138363.1|NP_057670.2	Q9NS73	MBIP1_HUMAN	MAP3K12 binding inhibitory protein 1	186	Interaction with MAP3K12.				chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|inactivation of MAPK activity involved in osmosensory signaling pathway (GO:0000173)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|protein kinase inhibitor activity (GO:0004860)			breast(2)|large_intestine(1)|lung(5)	8	all_cancers(3;1.55e-52)|all_epithelial(1;2.69e-62)|Breast(36;0.0505)|Hepatocellular(127;0.158)|Esophageal squamous(585;0.164)		Lung(8;1.28e-07)|LUAD - Lung adenocarcinoma(9;3e-07)|Epithelial(34;0.0303)|all cancers(34;0.0781)	GBM - Glioblastoma multiforme(112;0.0191)		GATTACAATCAATAACATTGCA	0.277																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC016821	CCDS9658.1, CCDS45096.1	14q13.2	2005-01-10			ENSG00000151332	ENSG00000151332			20427	protein-coding gene	gene with protein product		609431				10801814	Standard	NM_016586		Approved		uc001wtm.2	Q9NS73	OTTHUMG00000140222	ENST00000416007.4:c.557_558delinsCG	14.37:g.36783731_36783732delinsCG	ENSP00000399718:p.Ile186Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86TZ2|Q96AS5|Q9BS93|Q9NZE1	Missense_Mutation	SNP	NULL	p.I186M|p.I186T	ENST00000416007.4	37	c.558|c.557	CCDS9658.1	14																																																																																			MBIP	-	NULL	ENSG00000151332		0.277	MBIP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MBIP	HGNC	protein_coding	OTTHUMT00000276685.2	30	0.00	0	A	NM_016586		36783731|36783732	36783731|36783732	-1	no_errors	ENST00000416007	ensembl	human	known	69_37n	missense	31	32.61	15	SNP	1.000	C|G
MIR4477B	100616194	genome.wustl.edu	37	9	68415353	68415353	+	RNA	SNP	T	T	G	rs71242635		TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr9:68415353T>G	ENST00000581659.1	+	0	46					NR_039688.1|NR_039689.1				microRNA 4477b																		aatccttaaatgccattaagg	0.378																																						dbGAP											0																																										-	-	-			0					9	2011-09-12						"""ncRNAs / Micro RNAs"""	41898	non-coding RNA	RNA, micro							Standard	NR_039689		Approved	hsa-mir-4477b					9.37:g.68415353T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000581659.1	37	NULL		9																																																																																			MIR4477A	-	-	ENSG00000266017		0.378	MIR4477B-201	KNOWN	basic	miRNA	MIR4477A	HGNC	miRNA		12	0.00	0	T	NR_039689		68415353	68415353	+1	no_errors	ENST00000581659	ensembl	human	known	69_37n	rna	8	38.46	5	SNP	0.189	G
MIR508	574513	genome.wustl.edu	37	X	146318500	146318500	+	RNA	SNP	T	T	C			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chrX:146318500T>C	ENST00000384857.1	-	0	45					NR_030235.1				microRNA 508																		TTAGTTTACATGAGTGACGCC	0.433																																						dbGAP											0													83.0	65.0	70.0					X																	146318500		1567	3582	5149	-	-	-			0					Xq27.3	2011-09-12		2008-12-18	ENSG00000207589	ENSG00000207589		"""ncRNAs / Micro RNAs"""	32145	non-coding RNA	RNA, micro		300874		MIRN508			Standard	NR_030235		Approved	hsa-mir-508	uc022cfw.1				X.37:g.146318500T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000384857.1	37	NULL		X																																																																																			MIR508	-	-	ENSG00000207589		0.433	MIR508-201	KNOWN	basic	miRNA	MIR508	HGNC	miRNA		47	0.00	0	T	NR_030235		146318500	146318500	-1	no_errors	ENST00000384857	ensembl	human	known	69_37n	rna	27	48.08	25	SNP	0.026	C
NACAD	23148	genome.wustl.edu	37	7	45123881	45123881	+	Missense_Mutation	SNP	C	C	T	rs61740891	byFrequency	TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr7:45123881C>T	ENST00000490531.2	-	2	1917	c.1898G>A	c.(1897-1899)gGc>gAc	p.G633D		NM_001146334.1	NP_001139806.1	O15069	NACAD_HUMAN	NAC alpha domain containing	633					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(2)|skin(2)	5						TAAGGTGAGGCCCTCTTCAGC	0.597																																						dbGAP											0													5.0	6.0	6.0					7																	45123881		653	1543	2196	-	-	-	SO:0001583	missense	0			AB002361	CCDS47582.1	7p13	2010-07-14			ENSG00000136274	ENSG00000136274			22196	protein-coding gene	gene with protein product							Standard	NM_001146334		Approved	KIAA0363	uc003tmt.3	O15069	OTTHUMG00000159170	ENST00000490531.2:c.1898G>A	7.37:g.45123881C>T	ENSP00000420477:p.Gly633Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,pfscan_Nas_poly-pep-assoc_cplx	p.G633D	ENST00000490531.2	37	c.1898	CCDS47582.1	7	.	.	.	.	.	.	.	.	.	.	c	0.018	-1.479272	0.01035	.	.	ENSG00000136274	ENST00000490531	T	0.15017	2.46	1.84	-3.68	0.04463	.	0.657660	0.11464	U	0.561462	T	0.07007	0.0178	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35375	-0.9791	10	0.11182	T	0.66	.	0.672	0.00860	0.245:0.2849:0.1227:0.3473	.	633	O15069	NACAD_HUMAN	D	633	ENSP00000420477:G633D	ENSP00000420477:G633D	G	-	2	0	NACAD	45090406	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-4.204000	0.00274	-3.230000	0.00209	-2.620000	0.00156	GGC	NACAD	-	NULL	ENSG00000136274		0.597	NACAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACAD	HGNC	protein_coding	OTTHUMT00000353652.2	38	0.00	0	C	NM_001146334		45123881	45123881	-1	no_errors	ENST00000490531	ensembl	human	known	69_37n	missense	101	16.39	20	SNP	0.000	T
NWD1	284434	genome.wustl.edu	37	19	16908579	16908579	+	Missense_Mutation	SNP	C	C	T	rs548514304		TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr19:16908579C>T	ENST00000552788.1	+	14	3341	c.3341C>T	c.(3340-3342)tCg>tTg	p.S1114L	NWD1_ENST00000339803.6_Missense_Mutation_p.S979L|NWD1_ENST00000379808.3_Missense_Mutation_p.S1114L|NWD1_ENST00000524140.2_Missense_Mutation_p.S1114L|NWD1_ENST00000523826.1_Missense_Mutation_p.S908L|NWD1_ENST00000549814.1_Missense_Mutation_p.S1114L			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1114							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TTGGCGGACTCGAGGGGCTTT	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		18763	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													201.0	189.0	193.0					19																	16908579		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.3341C>T	19.37:g.16908579C>T	ENSP00000447224:p.Ser1114Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1114L	ENST00000552788.1	37	c.3341		19	.	.	.	.	.	.	.	.	.	.	C	4.949	0.176294	0.09443	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.70749	-0.32;-0.51;-0.32;3.37;3.37;3.37	4.62	3.58	0.41010	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.868087	0.09931	N	0.737149	T	0.55289	0.1911	N	0.17082	0.46	0.09310	N	1	P;B;B	0.36483	0.555;0.296;0.196	B;B;B	0.32928	0.038;0.155;0.026	T	0.47636	-0.9102	10	0.54805	T	0.06	-2.8748	12.6278	0.56640	0.0:0.8316:0.1683:0.0	.	1114;1114;979	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	L	979;1114;1114;1114;908;1114;979	ENSP00000428579:S1114L;ENSP00000447548:S1114L;ENSP00000369136:S1114L;ENSP00000428955:S908L;ENSP00000447224:S1114L;ENSP00000340159:S979L	ENSP00000340159:S979L	S	+	2	0	NWD1	16769579	0.261000	0.24063	0.016000	0.15963	0.001000	0.01503	2.916000	0.48813	1.167000	0.42706	-0.218000	0.12543	TCG	NWD1	-	superfamily_WD40_repeat_dom	ENSG00000188039		0.532	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	43	0.00	0	C	NM_001007525		16908579	16908579	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	38	35.59	21	SNP	0.354	T
NYNRIN	57523	genome.wustl.edu	37	14	24878032	24878032	+	Nonsense_Mutation	SNP	C	C	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr14:24878032C>A	ENST00000382554.3	+	4	1350	c.1032C>A	c.(1030-1032)tgC>tgA	p.C344*		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	344					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TGGGTGTGTGCCCACCCTGGA	0.562																																						dbGAP											0													39.0	41.0	40.0					14																	24878032		1954	4163	6117	-	-	-	SO:0001587	stop_gained	0			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.1032C>A	14.37:g.24878032C>A	ENSP00000371994:p.Cys344*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P153|Q86TR3|Q9HAC4	Nonsense_Mutation	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.C344*	ENST00000382554.3	37	c.1032	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	C	37	6.622562	0.97714	.	.	ENSG00000205978	ENST00000382554	.	.	.	4.3	0.494	0.16884	.	0.972870	0.08444	N	0.945022	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.3837	0.21550	0.0:0.5927:0.0:0.4073	.	.	.	.	X	344	.	ENSP00000371994:C344X	C	+	3	2	NYNRIN	23947872	0.912000	0.30974	0.645000	0.29479	0.981000	0.71138	0.297000	0.19101	0.078000	0.16900	0.655000	0.94253	TGC	NYNRIN	-	NULL	ENSG00000205978		0.562	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	31	0.00	0	C			24878032	24878032	+1	no_errors	ENST00000382554	ensembl	human	known	69_37n	nonsense	41	26.79	15	SNP	0.390	A
RBMXL3	139804	genome.wustl.edu	37	X	114426378	114426378	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chrX:114426378G>A	ENST00000424776.3	+	1	2416	c.2374G>A	c.(2374-2376)Gga>Aga	p.G792R	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	792	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						TGCCAACAGCGGAGGCCGCTC	0.672																																						dbGAP											0													33.0	34.0	34.0					X																	114426378		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2374G>A	X.37:g.114426378G>A	ENSP00000417451:p.Gly792Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G792R	ENST00000424776.3	37	c.2374	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	g	8.879	0.951083	0.18431	.	.	ENSG00000175718	ENST00000424776	T	0.07800	3.16	0.92	-0.333	0.12671	.	.	.	.	.	T	0.02494	0.0076	N	0.08118	0	0.09310	N	0.999998	P	0.45011	0.848	B	0.26517	0.07	T	0.41161	-0.9524	9	0.87932	D	0	.	2.1377	0.03766	0.3142:0.348:0.3378:0.0	.	792	Q8N7X1	RMXL3_HUMAN	R	792	ENSP00000417451:G792R	ENSP00000417451:G792R	G	+	1	0	RBMXL3	114332634	0.001000	0.12720	0.005000	0.12908	0.005000	0.04900	0.010000	0.13242	0.179000	0.19938	0.181000	0.17075	GGA	RBMXL3	-	NULL	ENSG00000175718		0.672	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	50	0.00	0	G	NM_001145346		114426378	114426378	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	81	37.21	48	SNP	0.932	A
RCN1	5954	genome.wustl.edu	37	11	32124950	32124950	+	Frame_Shift_Del	DEL	A	A	-			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr11:32124950delA	ENST00000054950.3	+	5	1105	c.812delA	c.(811-813)cacfs	p.H271fs	RCN1_ENST00000532942.1_Frame_Shift_Del_p.H220fs|RP1-65P5.3_ENST00000533009.1_RNA	NM_002901.2	NP_002892.1	Q15293	RCN1_HUMAN	reticulocalbin 1, EF-hand calcium binding domain	271	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				camera-type eye development (GO:0043010)|in utero embryonic development (GO:0001701)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)	17	Lung SC(675;0.225)					GAGATTCGCCACTGGATCCTC	0.463																																						dbGAP											0													77.0	79.0	78.0					11																	32124950		2202	4296	6498	-	-	-	SO:0001589	frameshift_variant	0			D42073	CCDS7876.1	11p13	2013-01-10			ENSG00000049449	ENSG00000049449		"""EF-hand domain containing"""	9934	protein-coding gene	gene with protein product	"""proliferation-inducing gene 20"""	602735		RCN		9192846, 8586628	Standard	NM_002901		Approved	Rcal, PIG20, FLJ37041	uc010reb.2	Q15293		ENST00000054950.3:c.812delA	11.37:g.32124950delA	ENSP00000054950:p.His271fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1M1|D3DR00	Frame_Shift_Del	DEL	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.H271fs	ENST00000054950.3	37	c.812	CCDS7876.1	11																																																																																			RCN1	-	NULL	ENSG00000049449		0.463	RCN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RCN1	HGNC	protein_coding	OTTHUMT00000388510.1	77	0.00	0	A	NM_002901		32124950	32124950	+1	no_errors	ENST00000054950	ensembl	human	known	69_37n	frame_shift_del	78	21.21	21	DEL	1.000	-
RCN1	5954	genome.wustl.edu	37	11	32124952	32124953	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr11:32124952_32124953delTG	ENST00000054950.3	+	5	1107_1108	c.814_815delTG	c.(814-816)tggfs	p.W272fs	RCN1_ENST00000532942.1_Frame_Shift_Del_p.W221fs|RP1-65P5.3_ENST00000533009.1_RNA	NM_002901.2	NP_002892.1	Q15293	RCN1_HUMAN	reticulocalbin 1, EF-hand calcium binding domain	272	EF-hand 5. {ECO:0000255|PROSITE- ProRule:PRU00448}.				camera-type eye development (GO:0043010)|in utero embryonic development (GO:0001701)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	calcium ion binding (GO:0005509)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)	17	Lung SC(675;0.225)					GATTCGCCACTGGATCCTCCCT	0.47																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D42073	CCDS7876.1	11p13	2013-01-10			ENSG00000049449	ENSG00000049449		"""EF-hand domain containing"""	9934	protein-coding gene	gene with protein product	"""proliferation-inducing gene 20"""	602735		RCN		9192846, 8586628	Standard	NM_002901		Approved	Rcal, PIG20, FLJ37041	uc010reb.2	Q15293		ENST00000054950.3:c.814_815delTG	11.37:g.32124952_32124953delTG	ENSP00000054950:p.Trp272fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1M1|D3DR00	Frame_Shift_Del	DEL	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.W272fs	ENST00000054950.3	37	c.814_815	CCDS7876.1	11																																																																																			RCN1	-	NULL	ENSG00000049449		0.470	RCN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RCN1	HGNC	protein_coding	OTTHUMT00000388510.1	82	0.00	0	TG	NM_002901		32124952	32124953	+1	no_errors	ENST00000054950	ensembl	human	known	69_37n	frame_shift_del	78	21.21	21	DEL	1.000:1.000	-
RNF187	149603	genome.wustl.edu	37	1	228681782	228681782	+	3'UTR	SNP	G	G	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr1:228681782G>A	ENST00000305943.7	+	0	1332				RNF187_ENST00000482739.2_3'UTR	NM_001010858.2	NP_001010858.2	Q5TA31	RN187_HUMAN	ring finger protein 187						positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K48-linked ubiquitination (GO:0070936)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			stomach(1)	1						AACACCTCCCGGTAGAGGCTG	0.592																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC008022		1q42.13	2010-07-14		2005-08-09	ENSG00000168159	ENSG00000168159		"""RING-type (C3HC4) zinc fingers"""	27146	protein-coding gene	gene with protein product		613754				12477932	Standard	NM_001010858		Approved		uc001htb.3	Q5TA31	OTTHUMG00000040043	ENST00000305943.7:c.*196G>A	1.37:g.228681782G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL57|Q6P2J7|Q6PJR0	RNA	SNP	-	NULL	ENST00000305943.7	37	NULL		1																																																																																			RNF187	-	-	ENSG00000168159		0.592	RNF187-001	KNOWN	basic|appris_principal	protein_coding	RNF187	HGNC	protein_coding	OTTHUMT00000096590.2	10	0.00	0	G	NM_001010858		228681782	228681782	+1	no_errors	ENST00000482739	ensembl	human	known	69_37n	rna	10	50.00	10	SNP	0.000	A
SPRED2	200734	genome.wustl.edu	37	2	65561392	65561392	+	Intron	SNP	C	C	T	rs4671658	byFrequency	TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr2:65561392C>T	ENST00000356388.4	-	3	563				SPRED2_ENST00000474228.1_5'UTR|SPRED2_ENST00000443619.2_Intron	NM_181784.2	NP_861449.2	Q7Z698	SPRE2_HUMAN	sprouty-related, EVH1 domain containing 2						inactivation of MAPK activity (GO:0000188)|multicellular organismal development (GO:0007275)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|regulation of protein deacetylation (GO:0090311)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein serine/threonine kinase inhibitor activity (GO:0030291)|stem cell factor receptor binding (GO:0005173)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(7)|ovary(2)|upper_aerodigestive_tract(3)	34						AGAATCCATTCTCTACTTCTG	0.507													C|||	1798	0.359026	0.0598	0.3919	5008	,	,		18575	0.6796		0.2982	False		,,,				2504	0.4724					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF052178	CCDS33211.1, CCDS46308.1	2p14	2003-06-02			ENSG00000198369	ENSG00000198369			17722	protein-coding gene	gene with protein product		609292					Standard	NM_181784		Approved	Spred-2, FLJ21897, FLJ31917	uc002sdr.4	Q7Z698	OTTHUMG00000152737	ENST00000356388.4:c.373+346G>A	2.37:g.65561392C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V4|B7Z5K7|D6W5F7|E9PEP0|Q2NKX6	Silent	SNP	pfam_EVH1,pfscan_EVH1	p.E86	ENST00000356388.4	37	c.258	CCDS33211.1	2																																																																																			SPRED2	-	NULL	ENSG00000198369		0.507	SPRED2-001	KNOWN	basic|CCDS	protein_coding	SPRED2	HGNC	protein_coding	OTTHUMT00000327632.1	26	0.00	0	C			65561392	65561392	-1	no_start_codon	ENST00000426832	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	0.254	T
SCN2A	6326	genome.wustl.edu	37	2	166179831	166179831	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr2:166179831G>A	ENST00000375437.2	+	12	2127	c.1837G>A	c.(1837-1839)Gtg>Atg	p.V613M	SCN2A_ENST00000283256.6_Missense_Mutation_p.V613M|SCN2A_ENST00000375427.2_Missense_Mutation_p.V613M|SCN2A_ENST00000357398.3_Missense_Mutation_p.V613M	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	613					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTCTCTGTTCGTGCCGCACAG	0.557																																						dbGAP											0													67.0	58.0	61.0					2																	166179831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.1837G>A	2.37:g.166179831G>A	ENSP00000364586:p.Val613Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.V613M	ENST00000375437.2	37	c.1837	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	G	24.4	4.529648	0.85706	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.92299	-3.01;-3.01;-3.01;-3.01	5.64	5.64	0.86602	Domain of unknown function DUF3451 (1);	0.207217	0.33938	N	0.004401	D	0.96993	0.9018	M	0.90019	3.08	0.45118	D	0.998138	P;D	0.89917	0.76;1.0	B;D	0.97110	0.356;1.0	D	0.97279	0.9916	10	0.72032	D	0.01	.	19.705	0.96069	0.0:0.0:1.0:0.0	.	613;613	Q99250-2;Q99250	.;SCN2A_HUMAN	M	613	ENSP00000364586:V613M;ENSP00000349973:V613M;ENSP00000283256:V613M;ENSP00000364576:V613M	ENSP00000283256:V613M	V	+	1	0	SCN2A	165888077	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	4.414000	0.59802	2.666000	0.90696	0.637000	0.83480	GTG	SCN2A	-	pfam_DUF3451	ENSG00000136531		0.557	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	33	0.00	0	G	NM_021007		166179831	166179831	+1	no_errors	ENST00000283256	ensembl	human	known	69_37n	missense	30	34.78	16	SNP	1.000	A
TGM2	7052	genome.wustl.edu	37	20	36766789	36766789	+	Splice_Site	SNP	T	T	C			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr20:36766789T>C	ENST00000361475.2	-	10	1516		c.e10-2		TGM2_ENST00000536724.1_Splice_Site|TGM2_ENST00000536701.1_Splice_Site	NM_004613.2|NM_198951.1	NP_004604.2|NP_945189.1	P21980	TGM2_HUMAN	transglutaminase 2						apoptotic cell clearance (GO:0043277)|blood vessel remodeling (GO:0001974)|branching involved in salivary gland morphogenesis (GO:0060445)|isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein homooligomerization (GO:0051260)|salivary gland cavitation (GO:0060662)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			endometrium(2)|large_intestine(11)|liver(1)|lung(7)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Myeloproliferative disorder(115;0.00878)			L-Glutamine(DB00130)	CTGAGGACCCTGTAGGGGTTG	0.597																																						dbGAP											0													65.0	65.0	65.0					20																	36766789		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M98478	CCDS13302.1	20q12	2013-05-02	2013-05-02		ENSG00000198959	ENSG00000198959	2.3.2.13	"""Transglutaminases"""	11778	protein-coding gene	gene with protein product	"""C polypeptide, protein-glutamine-gamma-glutamyltransferase"""	190196	"""transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7912692, 11390390	Standard	NM_004613		Approved	TGC	uc002xhr.3	P21980	OTTHUMG00000032437	ENST00000361475.2:c.1343-2A>G	20.37:g.36766789T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5V9|Q16436|Q6B838|Q9BTN7|Q9UH35	Splice_Site	SNP	-	e10-2	ENST00000361475.2	37	c.1343-2	CCDS13302.1	20	.	.	.	.	.	.	.	.	.	.	T	14.81	2.648024	0.47258	.	.	ENSG00000198959	ENST00000361475;ENST00000536701;ENST00000536724	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.6777	0.62465	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	TGM2	36200203	1.000000	0.71417	0.980000	0.43619	0.390000	0.30446	7.567000	0.82357	1.812000	0.52913	0.533000	0.62120	.	TGM2	-	-	ENSG00000198959		0.597	TGM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM2	HGNC	protein_coding	OTTHUMT00000079151.2	38	0.00	0	T	NM_198951	Intron	36766789	36766789	-1	no_errors	ENST00000361475	ensembl	human	known	69_37n	splice_site	45	32.84	22	SNP	1.000	C
TMEM196	256130	genome.wustl.edu	37	7	19765246	19765246	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr7:19765246delC	ENST00000405764.3	-	3	1046	c.350delG	c.(349-351)ggcfs	p.G117fs	TMEM196_ENST00000433641.1_Frame_Shift_Del_p.G49fs|TMEM196_ENST00000422233.1_Frame_Shift_Del_p.G49fs|TMEM196_ENST00000405844.1_Frame_Shift_Del_p.G117fs|TMEM196_ENST00000493519.1_Frame_Shift_Del_p.G49fs	NM_152774.3	NP_689987.3	Q5HYL7	TM196_HUMAN	transmembrane protein 196	123						integral component of membrane (GO:0016021)				breast(1)|large_intestine(1)|lung(4)	6						GAGAGTGCAGCCCCCGATCCC	0.512																																						dbGAP											0													97.0	86.0	90.0					7																	19765246		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS34607.2	7p15.3	2007-11-21			ENSG00000173452	ENSG00000173452			22431	protein-coding gene	gene with protein product							Standard	NM_152774		Approved	MGC42090	uc011jyg.2	Q5HYL7	OTTHUMG00000152504	ENST00000405764.3:c.350delG	7.37:g.19765246delC	ENSP00000384234:p.Gly117fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6I6	Frame_Shift_Del	DEL	NULL	p.G117fs	ENST00000405764.3	37	c.350	CCDS34607.2	7																																																																																			TMEM196	-	NULL	ENSG00000173452		0.512	TMEM196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM196	HGNC	protein_coding	OTTHUMT00000326499.1	59	0.00	0	C	NM_152774		19765246	19765246	-1	no_errors	ENST00000405764	ensembl	human	known	69_37n	frame_shift_del	80	29.20	33	DEL	1.000	-
TRBV7-3	28595	genome.wustl.edu	37	7	142247285	142247285	+	RNA	SNP	G	G	C			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr7:142247285G>C	ENST00000390361.3	-	0	220									T cell receptor beta variable 7-3																		CCTGCCCCAGGCTTTGTCGGT	0.537																																						dbGAP											0													66.0	67.0	67.0					7																	142247285		1910	4114	6024	-	-	-			0			X61440		7q34	2012-02-07			ENSG00000211714	ENSG00000211714		"""T cell receptors / TRB locus"""	12237	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV73, TCRBV6S1A1N1, TCRBV7S3			OTTHUMG00000158528		7.37:g.142247285G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.S57R	ENST00000390361.3	37	c.171		7																																																																																			TRBV7-3	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211714		0.537	TRBV7-3-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV7-3	HGNC	TR_V_gene	OTTHUMT00000351234.2	15	0.00	0	G	NG_001333		142247285	142247285	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390361	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.000	C
TRBV7-3	28595	genome.wustl.edu	37	7	142247288	142247288	+	RNA	SNP	T	T	C			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr7:142247288T>C	ENST00000390361.3	-	0	217									T cell receptor beta variable 7-3																		GCCCCAGGCTTTGTCGGTACC	0.532																																						dbGAP											0													67.0	67.0	67.0					7																	142247288		1909	4116	6025	-	-	-			0			X61440		7q34	2012-02-07			ENSG00000211714	ENSG00000211714		"""T cell receptors / TRB locus"""	12237	other	T cell receptor gene						8650574	Standard	NG_001333		Approved	TRBV73, TCRBV6S1A1N1, TCRBV7S3			OTTHUMG00000158528		7.37:g.142247288T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.Q56	ENST00000390361.3	37	c.168		7																																																																																			TRBV7-3	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211714		0.532	TRBV7-3-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRBV7-3	HGNC	TR_V_gene	OTTHUMT00000351234.2	15	0.00	0	T	NG_001333		142247288	142247288	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390361	ensembl	human	known	69_37n	silent	26	31.58	12	SNP	0.005	C
TTN	7273	genome.wustl.edu	37	2	179439401	179439401	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr2:179439401C>A	ENST00000591111.1	-	276	66759	c.66535G>T	c.(66535-66537)Gcc>Tcc	p.A22179S	TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A14880S|TTN_ENST00000460472.2_Missense_Mutation_p.A14755S|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000592750.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.A14947S|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.A21252S|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A23820S			Q8WZ42	TITIN_HUMAN	titin	22179	Fibronectin type-III 60. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGATAGTTGGCAACTATGCAT	0.458																																						dbGAP											0													122.0	114.0	117.0					2																	179439401		1938	4150	6088	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.66535G>T	2.37:g.179439401C>A	ENSP00000465570:p.Ala22179Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A21252S	ENST00000591111.1	37	c.63754		2	.	.	.	.	.	.	.	.	.	.	C	14.93	2.681193	0.47886	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.49	5.49	0.81192	Fibronectin, type III (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.78362	0.4271	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.78314	0.991;0.991;0.991;0.991	T	0.82398	-0.0477	9	0.87932	D	0	.	19.3676	0.94469	0.0:1.0:0.0:0.0	.	14755;14880;14947;22179	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	S	21252;14755;14947;14880;14753	ENSP00000343764:A21252S;ENSP00000434586:A14755S;ENSP00000340554:A14947S;ENSP00000352154:A14880S	ENSP00000340554:A14947S	A	-	1	0	TTN	179147647	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.770000	0.85390	2.589000	0.87451	0.650000	0.86243	GCC	TTN	-	superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.458	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	53	0.00	0	C	NM_133378		179439401	179439401	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	1.000	A
UCA1	652995	genome.wustl.edu	37	19	15940075	15940075	+	RNA	SNP	T	T	C	rs73003269	byFrequency	TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr19:15940075T>C	ENST00000397381.4	+	0	305				AC004510.3_ENST00000589310.1_lincRNA	NR_015379.3				urothelial cancer associated 1 (non-protein coding)																		ctggccctcattccgtgaaga	0.547													.|||	1192	0.238019	0.2171	0.17	5008	,	,		19313	0.2024		0.2545	False		,,,				2504	0.3344					dbGAP											0																																										-	-	-			0			BC005351		19p13.12	2013-07-02			ENSG00000214049	ENSG00000214049		"""Long non-coding RNAs"", ""-"""	37126	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 178"", ""cancer up-regulated drug resistant"""					18501714, 17416635, 23801869	Standard	NR_015379		Approved	LINC00178, CUDR, UCAT1	uc002nbr.4		OTTHUMG00000182287		19.37:g.15940075T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000397381.4	37	NULL		19																																																																																			UCA1	-	-	ENSG00000214049		0.547	UCA1-001	KNOWN	basic	lincRNA	UCA1	HGNC	processed_transcript	OTTHUMT00000362098.19	18	0.00	0	T	NR_015379		15940075	15940075	+1	no_errors	ENST00000397381	ensembl	human	known	69_37n	rna	15	64.29	27	SNP	0.012	C
USP4	7375	genome.wustl.edu	37	3	49377435	49377435	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr3:49377435C>T	ENST00000265560.4	-	1	69	c.23G>A	c.(22-24)cGt>cAt	p.R8H	USP4_ENST00000351842.4_Missense_Mutation_p.R8H|USP4_ENST00000416417.1_Missense_Mutation_p.R8H|USP4_ENST00000415188.1_Missense_Mutation_p.R8H	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)	8					negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		CGGTCGCTCACGGCAGCCTCC	0.706																																						dbGAP											0													39.0	41.0	41.0					3																	49377435		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.23G>A	3.37:g.49377435C>T	ENSP00000265560:p.Arg8His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.R8H	ENST00000265560.4	37	c.23	CCDS2793.1	3	.	.	.	.	.	.	.	.	.	.	C	10.78	1.446596	0.25987	.	.	ENSG00000114316	ENST00000351842;ENST00000265560;ENST00000416417;ENST00000415188	T;T;T	0.30714	2.03;2.17;1.52	4.83	3.94	0.45596	.	0.732656	0.11760	U	0.532125	T	0.17789	0.0427	N	0.08118	0	0.09310	N	0.999999	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.17592	-1.0364	10	0.45353	T	0.12	2.0E-4	11.2522	0.49032	0.0:0.9097:0.0:0.0903	.	8;8	Q13107-2;Q13107	.;UBP4_HUMAN	H	8	ENSP00000341028:R8H;ENSP00000265560:R8H;ENSP00000400623:R8H	ENSP00000265560:R8H	R	-	2	0	USP4	49352439	0.996000	0.38824	0.449000	0.26957	0.089000	0.18198	0.882000	0.28186	1.230000	0.43646	0.462000	0.41574	CGT	USP4	-	NULL	ENSG00000114316		0.706	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP4	HGNC	protein_coding	OTTHUMT00000346069.1	41	0.00	0	C	NM_199443		49377435	49377435	-1	no_errors	ENST00000265560	ensembl	human	known	69_37n	missense	37	46.38	32	SNP	0.341	T
ZNF334	55713	genome.wustl.edu	37	20	45130701	45130703	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-E9-A54X-01A-11D-A25Q-09	TCGA-E9-A54X-10A-01D-A25Q-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	91e55d7f-2591-42d9-9044-6415471489a4	79fb420d-e3af-4d04-aad6-ee75efd4ab29	g.chr20:45130701_45130703delCTT	ENST00000347606.4	-	5	1457_1459	c.1275_1277delAAG	c.(1273-1278)agaagt>agt	p.R425del	ZNF334_ENST00000593880.1_In_Frame_Del_p.R448del|ZNF334_ENST00000457685.2_In_Frame_Del_p.R387del	NM_018102.4	NP_060572.3	Q9HCZ1	ZN334_HUMAN	zinc finger protein 334	425					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)				TCCTGTATGACTTCTTCGATGCA	0.404																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK001331	CCDS33480.1, CCDS74736.1	20q13.12	2013-09-20			ENSG00000198185	ENSG00000198185		"""Zinc fingers, C2H2-type"", ""-"""	15806	protein-coding gene	gene with protein product							Standard	NM_018102		Approved	bA179N14.1	uc002xsc.4	Q9HCZ1	OTTHUMG00000032654	ENST00000347606.4:c.1275_1277delAAG	20.37:g.45130704_45130706delCTT	ENSP00000255129:p.Arg425del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6U2|Q9NVW4	In_Frame_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R425in_frame_del	ENST00000347606.4	37	c.1277_1275	CCDS33480.1	20																																																																																			ZNF334	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198185		0.404	ZNF334-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF334	HGNC	protein_coding	OTTHUMT00000079575.1	42	0.00	0	CTT			45130701	45130703	-1	no_errors	ENST00000347606	ensembl	human	known	69_37n	in_frame_del	32	34.00	17	DEL	0.886:0.994:0.997	-
