#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
C2orf42	54980	genome.wustl.edu	37	2	70377626	70377626	+	Silent	SNP	T	T	C			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr2:70377626T>C	ENST00000264434.2	-	10	1966	c.1587A>G	c.(1585-1587)caA>caG	p.Q529Q	C2orf42_ENST00000420306.1_Silent_p.Q529Q	NM_017880.1	NP_060350.1	Q9NWW7	CB042_HUMAN	chromosome 2 open reading frame 42	529										endometrium(2)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	12						CAATCTTAGATTGGGGAAGGA	0.517																																						dbGAP											0													125.0	113.0	117.0					2																	70377626		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000565	CCDS1899.1	2p14	2011-03-08			ENSG00000115998	ENSG00000115998			26056	protein-coding gene	gene with protein product						12477932	Standard	XM_005264389		Approved	FLJ20558	uc002sgh.3	Q9NWW7	OTTHUMG00000129642	ENST00000264434.2:c.1587A>G	2.37:g.70377626T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5G3|Q9H629	Silent	SNP	NULL	p.Q529	ENST00000264434.2	37	c.1587	CCDS1899.1	2																																																																																			C2orf42	-	NULL	ENSG00000115998		0.517	C2orf42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf42	HGNC	protein_coding	OTTHUMT00000251840.1	27	0.00	0	T	NM_017880		70377626	70377626	-1	no_errors	ENST00000264434	ensembl	human	known	69_37n	silent	16	15.79	3	SNP	0.062	C
CACNA1A	773	genome.wustl.edu	37	19	13563741	13563741	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr19:13563741G>T	ENST00000360228.5	-	3	487	c.488C>A	c.(487-489)tCc>tAc	p.S163Y	CACNA1A_ENST00000573710.2_Missense_Mutation_p.S163Y	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	163					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTCAAGTAGGAGCCTTTGTG	0.458																																						dbGAP											0													184.0	178.0	180.0					19																	13563741		2001	4173	6174	-	-	-	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.488C>A	19.37:g.13563741G>T	ENSP00000353362:p.Ser163Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.S163Y	ENST00000360228.5	37	c.488	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275109	0.80580	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	D	0.97114	-4.25	5.74	5.74	0.90152	Ion transport (1);	0.097974	0.49305	D	0.000141	D	0.98270	0.9427	M	0.73372	2.23	0.54753	D	0.999989	D;D	0.89917	0.999;1.0	D;D	0.91635	0.998;0.999	D	0.99177	1.0866	10	0.87932	D	0	.	18.6833	0.91554	0.0:0.0:1.0:0.0	.	163;163	O00555;Q9NS88	CAC1A_HUMAN;.	Y	163	ENSP00000353362:S163Y	ENSP00000317661:S163Y	S	-	2	0	CACNA1A	13424741	1.000000	0.71417	1.000000	0.80357	0.637000	0.38172	9.671000	0.98627	2.710000	0.92621	0.643000	0.83706	TCC	CACNA1A	-	pfam_Ion_trans_dom	ENSG00000141837		0.458	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	51	0.00	0	G	NM_000068		13563741	13563741	-1	no_errors	ENST00000360228	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	1.000	T
CCDC170	80129	genome.wustl.edu	37	6	151857489	151857489	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr6:151857489C>T	ENST00000239374.7	+	2	193	c.94C>T	c.(94-96)Cgg>Tgg	p.R32W	CCDC170_ENST00000544131.1_3'UTR|CCDC170_ENST00000367290.5_Missense_Mutation_p.R32W	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	32																	CCCGGTCACGCGGGAGCAGTT	0.428																																						dbGAP											0													103.0	97.0	99.0					6																	151857489		1859	4093	5952	-	-	-	SO:0001583	missense	0			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.94C>T	6.37:g.151857489C>T	ENSP00000239374:p.Arg32Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.R32W	ENST00000239374.7	37	c.94	CCDS43515.1	6	.	.	.	.	.	.	.	.	.	.	C	8.454	0.853705	0.17106	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	T;T	0.09817	2.94;2.94	5.95	4.16	0.48862	.	0.297969	0.31660	N	0.007263	T	0.03651	0.0104	L	0.49350	1.555	0.28265	N	0.924649	B	0.25007	0.116	B	0.19391	0.025	T	0.31364	-0.9946	10	0.56958	D	0.05	-1.5472	7.0289	0.24956	0.2249:0.636:0.0:0.1391	.	32	Q8IYT3	CF097_HUMAN	W	32	ENSP00000239374:R32W;ENSP00000356259:R32W	ENSP00000239374:R32W	R	+	1	2	C6orf97	151899182	0.586000	0.26782	0.605000	0.28930	0.003000	0.03518	0.291000	0.18994	0.834000	0.34852	0.650000	0.86243	CGG	CCDC170	-	NULL	ENSG00000120262		0.428	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2	29	0.00	0	C	NM_025059		151857489	151857489	+1	no_errors	ENST00000367290	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.794	T
PSG9	5678	genome.wustl.edu	37	19	43719516	43719517	+	Intron	INS	-	-	C			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr19:43719516_43719517insC	ENST00000418820.2	-	5	1063				CEACAMP10_ENST00000489959.1_RNA			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 9						female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Prostate(69;0.00682)				CAGGAGTACTTCTTGTACTGAA	0.446																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M34481	CCDS12618.1	19q13.2	2013-01-29			ENSG00000183668	ENSG00000183668		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9526	protein-coding gene	gene with protein product		176398		PSG11		7806221	Standard	XM_005259076		Approved	PSGII	uc002owd.4	Q00887	OTTHUMG00000182826	ENST00000418820.2:c.965-2889->G	19.37:g.43719517_43719517dupC		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	RNA	INS	-	NULL	ENST00000418820.2	37	NULL		19																																																																																			CEACAMP10	-	-	ENSG00000241104		0.446	PSG9-011	PUTATIVE	basic	protein_coding	CEACAMP10	HGNC	protein_coding	OTTHUMT00000463916.1	13	0.00	0	-	NM_002784		43719516	43719517	-1	no_errors	ENST00000489959	ensembl	human	known	69_37n	rna	6	45.45	5	INS	0.001:0.002	C
DNAJC13	23317	genome.wustl.edu	37	3	132192020	132192020	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr3:132192020A>G	ENST00000260818.6	+	21	2488	c.2240A>G	c.(2239-2241)aAg>aGg	p.K747R		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	747					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						GTTCTTCGAAAGAGAAGACAA	0.333																																						dbGAP											0													56.0	63.0	61.0					3																	132192020		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.2240A>G	3.37:g.132192020A>G	ENSP00000260818:p.Lys747Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_N,pfscan_DnaJ_N	p.K747R	ENST00000260818.6	37	c.2240	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	A	13.10	2.136801	0.37728	.	.	ENSG00000138246	ENST00000260818	T	0.49720	0.77	5.71	3.34	0.38264	Armadillo-type fold (1);	0.267971	0.35235	N	0.003349	T	0.34106	0.0886	L	0.35593	1.075	0.47308	D	0.999388	B	0.09022	0.002	B	0.06405	0.002	T	0.06991	-1.0796	10	0.30078	T	0.28	.	9.9846	0.41835	0.8631:0.0:0.1369:0.0	.	747	O75165	DJC13_HUMAN	R	747	ENSP00000260818:K747R	ENSP00000260818:K747R	K	+	2	0	DNAJC13	133674710	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.076000	0.89503	0.449000	0.26747	0.455000	0.32223	AAG	DNAJC13	-	superfamily_ARM-type_fold	ENSG00000138246		0.333	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	70	0.00	0	A	NM_015268		132192020	132192020	+1	no_errors	ENST00000260818	ensembl	human	known	69_37n	missense	58	14.49	10	SNP	1.000	G
SPATA31A7	26165	genome.wustl.edu	37	9	65506508	65506508	+	Missense_Mutation	SNP	G	G	T			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr9:65506508G>T	ENST00000355045.2	-	4	1080	c.1052C>A	c.(1051-1053)aCa>aAa	p.T351K	SPATA31A7_ENST00000491812.2_5'Flank	NM_015667.2	NP_056482.2	Q8IWB4	S31A7_HUMAN	SPATA31 subfamily A, member 7	351					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CATTCGATTTGTAAATGATCC	0.418																																						dbGAP											0													27.0	31.0	30.0					9																	65506508		809	2039	2848	-	-	-	SO:0001583	missense	0				CCDS75838.1	9q12	2014-04-11	2012-10-12	2012-10-12	ENSG00000234734	ENSG00000276040			32007	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A7"""	FAM75A7		20850414	Standard	NM_015667		Approved	OTTHUMG00000013196		Q8IWB4	OTTHUMG00000188536	ENST00000355045.2:c.1052C>A	9.37:g.65506508G>T	ENSP00000347153:p.Thr351Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZK4|Q9Y4Q5	Missense_Mutation	SNP	NULL	p.T351K	ENST00000355045.2	37	c.1052	CCDS43825.1	9	.	.	.	.	.	.	.	.	.	.	G	0.003	-2.405372	0.00195	.	.	ENSG00000234734	ENST00000355045	T	0.03951	3.75	1.13	-1.04	0.10068	.	1.480440	0.04182	N	0.326727	T	0.02494	0.0076	N	0.08118	0	0.09310	N	1	B	0.14438	0.01	B	0.15484	0.013	T	0.43343	-0.9397	10	0.09843	T	0.71	0.9354	4.8419	0.13494	0.4064:0.0:0.5936:0.0	.	351	Q8IWB4	F75A7_HUMAN	K	351	ENSP00000347153:T351K	ENSP00000347153:T351K	T	-	2	0	FAM75A7	65246328	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.141000	0.16076	-0.584000	0.05913	-1.252000	0.01501	ACA	FAM75A7	-	NULL	ENSG00000234734		0.418	SPATA31A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A7	HGNC	protein_coding	OTTHUMT00000036952.1	74	0.00	0	G	NM_015667		65506508	65506508	-1	no_errors	ENST00000355045	ensembl	human	known	69_37n	missense	81	15.62	15	SNP	0.000	T
FBXO2	26232	genome.wustl.edu	37	1	11708829	11708829	+	Silent	SNP	G	G	A			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr1:11708829G>A	ENST00000354287.4	-	6	1154	c.813C>T	c.(811-813)caC>caT	p.H271H	FBXO2_ENST00000475961.1_5'Flank	NM_012168.5	NP_036300.2	Q9UK22	FBX2_HUMAN	F-box protein 2	271	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				cellular protein modification process (GO:0006464)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|proteolysis (GO:0006508)|regulation of protein ubiquitination (GO:0031396)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|SCF ubiquitin ligase complex (GO:0019005)	beta-amyloid binding (GO:0001540)|carbohydrate binding (GO:0030246)|ubiquitin-protein transferase activity (GO:0004842)			kidney(1)|large_intestine(1)|lung(4)	6	Ovarian(185;0.249)	Lung NSC(185;9.37e-06)|all_lung(284;1.39e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|BRCA - Breast invasive adenocarcinoma(304;1.88e-06)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|Lung(427;0.0146)|LUSC - Lung squamous cell carcinoma(448;0.0228)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGCCCCCCGTGCTCGAAGC	0.667																																						dbGAP											0													52.0	60.0	57.0					1																	11708829		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF174594	CCDS130.1	1p36.21	2010-04-21	2004-06-15		ENSG00000116661	ENSG00000116661		"""F-boxes /  ""other"""""	13581	protein-coding gene	gene with protein product		607112	"""F-box only protein 2"", ""organ of Corti protein 1"""	OCP1		10531035, 10531037	Standard	NM_012168		Approved	FBX2, Nfb42, Fbs1, Fbg1	uc001asj.3	Q9UK22	OTTHUMG00000002072	ENST00000354287.4:c.813C>T	1.37:g.11708829G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7K7|Q5TGY0|Q6FGJ7|Q8TB29|Q9UKC6	Silent	SNP	pfam_F-box-assoc_dom,pfam_F-box_dom_cyclin-like,superfamily_Galactose-bd-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like,pfscan_F-box-assoc_dom	p.H271	ENST00000354287.4	37	c.813	CCDS130.1	1																																																																																			FBXO2	-	pfam_F-box-assoc_dom,superfamily_Galactose-bd-like,pfscan_F-box-assoc_dom	ENSG00000116661		0.667	FBXO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO2	HGNC	protein_coding	OTTHUMT00000005764.1	118	0.84	1	G	NM_012168		11708829	11708829	-1	no_errors	ENST00000354287	ensembl	human	known	69_37n	silent	91	12.50	13	SNP	0.999	A
GLT6D1	360203	genome.wustl.edu	37	9	138517918	138517918	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr9:138517918C>T	ENST00000371763.1	-	4	507	c.254G>A	c.(253-255)gGc>gAc	p.G85D		NM_182974.2	NP_892019.2	Q7Z4J2	GL6D1_HUMAN	glycosyltransferase 6 domain containing 1	85					carbohydrate metabolic process (GO:0005975)	integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			endometrium(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	15		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;4.3e-07)|Epithelial(140;1.58e-06)|all cancers(34;5.36e-05)		CACCTACCTGCCAGTAGCAAA	0.493																																						dbGAP											0													61.0	68.0	65.0					9																	138517918		1897	4103	6000	-	-	-	SO:0001583	missense	0			AY336054	CCDS43900.1	9q34.3	2013-02-22	2004-09-16	2004-09-17	ENSG00000204007	ENSG00000204007		"""Glycosyltransferase family 6 domain containing"""	23671	protein-coding gene	gene with protein product		613699	"""galactosyltransferase family 6 domain containing 1"""	GLTDC1			Standard	NM_182974		Approved		uc010nbd.1	Q7Z4J2	OTTHUMG00000020911	ENST00000371763.1:c.254G>A	9.37:g.138517918C>T	ENSP00000360829:p.Gly85Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Glyco_trans_6	p.G85D	ENST00000371763.1	37	c.254	CCDS43900.1	9	.	.	.	.	.	.	.	.	.	.	C	14.96	2.690702	0.48097	.	.	ENSG00000204007	ENST00000371763	T	0.01388	4.95	4.11	1.21	0.21127	.	0.494272	0.18841	N	0.129687	T	0.07279	0.0184	M	0.87097	2.86	0.09310	N	1	D	0.76494	0.999	D	0.75020	0.985	T	0.08086	-1.0739	10	0.87932	D	0	.	6.1821	0.20478	0.0:0.5618:0.0:0.4381	.	85	Q7Z4J2	GL6D1_HUMAN	D	85	ENSP00000360829:G85D	ENSP00000360829:G85D	G	-	2	0	GLT6D1	137657739	0.784000	0.28713	0.000000	0.03702	0.007000	0.05969	1.179000	0.31993	0.158000	0.19367	0.609000	0.83330	GGC	GLT6D1	-	pfam_Glyco_trans_6	ENSG00000204007		0.493	GLT6D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT6D1	HGNC	protein_coding	OTTHUMT00000055005.2	63	0.00	0	C	NM_182974		138517918	138517918	-1	no_errors	ENST00000371763	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	0.000	T
HTT	3064	genome.wustl.edu	37	4	3156030	3156030	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr4:3156030C>G	ENST00000355072.5	+	27	3654	c.3509C>G	c.(3508-3510)cCt>cGt	p.P1170R		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1170					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		GCAGCCTTGCCTTCTCTAACA	0.383																																						dbGAP											0													35.0	31.0	32.0					4																	3156030		1867	4123	5990	-	-	-	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.3509C>G	4.37:g.3156030C>G	ENSP00000347184:p.Pro1170Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.P1170R	ENST00000355072.5	37	c.3509	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677211	0.88445	.	.	ENSG00000197386	ENST00000355072	T	0.06608	3.28	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.19604	0.0471	M	0.61703	1.905	0.80722	D	1	D	0.59357	0.985	P	0.58266	0.836	T	0.00189	-1.1939	10	0.87932	D	0	.	16.6269	0.84974	0.0:1.0:0.0:0.0	.	1170	P42858	HD_HUMAN	R	1170	ENSP00000347184:P1170R	ENSP00000347184:P1170R	P	+	2	0	HTT	3125828	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.755000	0.85180	2.347000	0.79759	0.563000	0.77884	CCT	HTT	-	NULL	ENSG00000197386		0.383	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	21	0.00	0	C	NM_002111		3156030	3156030	+1	no_errors	ENST00000355072	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	1.000	G
IFT122	55764	genome.wustl.edu	37	3	129225273	129225274	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr3:129225273_129225274delAG	ENST00000348417.2	+	22	2749_2750	c.2672_2673delAG	c.(2671-2673)cagfs	p.Q891fs	IFT122_ENST00000440957.2_Frame_Shift_Del_p.Q682fs|IFT122_ENST00000296266.3_Frame_Shift_Del_p.Q942fs|IFT122_ENST00000431818.2_Frame_Shift_Del_p.Q741fs|IFT122_ENST00000349441.2_Frame_Shift_Del_p.Q780fs|IFT122_ENST00000507564.1_Frame_Shift_Del_p.Q883fs|IFT122_ENST00000504021.1_Frame_Shift_Del_p.Q767fs|IFT122_ENST00000347300.2_Frame_Shift_Del_p.Q832fs	NM_052989.1	NP_443715.1	Q9HBG6	IF122_HUMAN	intraflagellar transport 122	891					camera-type eye morphogenesis (GO:0048593)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic heart tube left/right pattern formation (GO:0060971)|establishment of protein localization to organelle (GO:0072594)|intraciliary anterograde transport (GO:0035720)|intraciliary retrograde transport (GO:0035721)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|protein localization to cilium (GO:0061512)|signal transduction downstream of smoothened (GO:0007227)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|intraciliary transport particle A (GO:0030991)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|primary cilium (GO:0072372)				breast(3)|cervix(1)|endometrium(9)|large_intestine(10)|lung(21)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	52						GCTGGGCGACAGAGAGAAGCGG	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF244930	CCDS3059.1, CCDS3060.1, CCDS3061.1, CCDS3062.1, CCDS63770.1, CCDS63772.1, CCDS63773.1	3q21	2014-07-03	2014-07-03	2005-11-02	ENSG00000163913	ENSG00000163913		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	13556	protein-coding gene	gene with protein product		606045	"""WD repeat domain 10"", ""intraflagellar transport 122 homolog (Chlamydomonas)"""	WDR10		11242542	Standard	NM_052985		Approved	WDR140, WDR10p, SPG	uc003emm.3	Q9HBG6	OTTHUMG00000159516	ENST00000348417.2:c.2672_2673delAG	3.37:g.129225277_129225278delAG	ENSP00000324005:p.Gln891fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW53|B4DEY9|B4DPW7|E7EQF4|E9PDG2|E9PDX2|G3XAB1|H7C3C0|Q53G36|Q8TC06|Q9BTB9|Q9BTY4|Q9HAT9|Q9HBG5|Q9NV68|Q9UF80	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E944fs	ENST00000348417.2	37	c.2825_2826	CCDS3061.1	3																																																																																			IFT122	-	NULL	ENSG00000163913		0.540	IFT122-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IFT122	HGNC	protein_coding	OTTHUMT00000355852.1	79	0.00	0	AG	NM_018262		129225273	129225274	+1	no_errors	ENST00000296266	ensembl	human	known	69_37n	frame_shift_del	101	12.93	15	DEL	1.000:0.995	-
LRRC66	339977	genome.wustl.edu	37	4	52883636	52883636	+	Missense_Mutation	SNP	A	A	C			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr4:52883636A>C	ENST00000343457.3	-	1	150	c.144T>G	c.(142-144)ttT>ttG	p.F48L		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	48						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						ACTTTCCGGTAAAAGAACAAT	0.328																																						dbGAP											0													57.0	56.0	56.0					4																	52883636		1830	4072	5902	-	-	-	SO:0001583	missense	0			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.144T>G	4.37:g.52883636A>C	ENSP00000341944:p.Phe48Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.F48L	ENST00000343457.3	37	c.144	CCDS43229.1	4	.	.	.	.	.	.	.	.	.	.	A	9.018	0.984113	0.18889	.	.	ENSG00000188993	ENST00000343457	T	0.38887	1.11	4.23	0.485	0.16830	.	0.323663	0.22784	N	0.055696	T	0.30324	0.0761	L	0.29908	0.895	0.09310	N	1	D	0.52996	0.957	P	0.47981	0.563	T	0.26258	-1.0108	10	0.19147	T	0.46	-4.4279	7.689	0.28557	0.6167:0.0:0.3833:0.0	.	48	Q68CR7	LRC66_HUMAN	L	48	ENSP00000341944:F48L	ENSP00000341944:F48L	F	-	3	2	LRRC66	52578393	0.441000	0.25626	0.000000	0.03702	0.254000	0.26022	0.512000	0.22755	-0.048000	0.13401	0.454000	0.30748	TTT	LRRC66	-	NULL	ENSG00000188993		0.328	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1	16	0.00	0	A	NM_001024611		52883636	52883636	-1	no_errors	ENST00000343457	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	0.037	C
NELL1	4745	genome.wustl.edu	37	11	21305884	21305884	+	Intron	SNP	A	A	G			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr11:21305884A>G	ENST00000357134.5	+	14	1701				NELL1_ENST00000529218.1_3'UTR|NELL1_ENST00000325319.5_Intron|NELL1_ENST00000298925.5_Intron|NELL1_ENST00000532434.1_Intron	NM_006157.3|NM_201551.1	NP_006148.2|NP_963845.1	Q92832	NELL1_HUMAN	NEL-like 1 (chicken)						cell differentiation (GO:0030154)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of osteoblast proliferation (GO:0033689)|nervous system development (GO:0007399)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of gene expression (GO:0010468)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(5)|kidney(3)|large_intestine(15)|lung(36)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	70						GTGTGAAAGGAGTGACAGAGA	0.468																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK127805	CCDS7855.1, CCDS44555.1, CCDS73267.1, CCDS73268.1	11p15.1	2008-02-01	2001-11-28		ENSG00000165973	ENSG00000165973			7750	protein-coding gene	gene with protein product		602319	"""nel (chicken)-like 1"""			8975702	Standard	NM_006157		Approved	IDH3GL, FLJ45906	uc001mqe.3	Q92832	OTTHUMG00000166042	ENST00000357134.5:c.1549+54884A>G	11.37:g.21305884A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2CKC1|Q4VB90|Q4VB91|Q6NSY8|Q9Y472	RNA	SNP	-	NULL	ENST00000357134.5	37	NULL	CCDS7855.1	11																																																																																			NELL1	-	-	ENSG00000165973		0.468	NELL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL1	HGNC	protein_coding	OTTHUMT00000387588.1	50	0.00	0	A	NM_006157		21305884	21305884	+1	no_errors	ENST00000529218	ensembl	human	known	69_37n	rna	60	16.67	12	SNP	0.202	G
PKLR	5313	genome.wustl.edu	37	1	155265263	155265263	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr1:155265263T>G	ENST00000342741.4	-	4	510	c.472A>C	c.(472-474)Aag>Cag	p.K158Q	PKLR_ENST00000392414.3_Missense_Mutation_p.K127Q	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	158					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TCCGGTCCCTTGGTGTCCAGG	0.687																																						dbGAP											0													20.0	21.0	21.0					1																	155265263		2200	4300	6500	-	-	-	SO:0001583	missense	0			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.472A>C	1.37:g.155265263T>G	ENSP00000339933:p.Lys158Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O75758|P11973	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.K158Q	ENST00000342741.4	37	c.472	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	T	28.5	4.925135	0.92319	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99552	-6.15;-6.15	4.14	4.14	0.48551	Pyruvate/Phosphoenolpyruvate kinase (2);Pyruvate kinase, barrel (1);	0.058238	0.64402	D	0.000003	D	0.98830	0.9605	L	0.59912	1.85	0.58432	D	0.999996	P;P	0.47910	0.902;0.902	P;P	0.50440	0.641;0.641	D	0.99376	1.0921	10	0.87932	D	0	-17.9974	11.4158	0.49951	0.0:0.0:0.0:1.0	.	158;149	P30613;B1AVT1	KPYR_HUMAN;.	Q	183;127;158;72	ENSP00000376214:K127Q;ENSP00000339933:K158Q	ENSP00000271946:K72Q	K	-	1	0	PKLR	153531887	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	7.643000	0.83403	1.861000	0.53984	0.467000	0.42956	AAG	PKLR	-	pfam_Pyrv_Knase_brl,superfamily_Pyrv/PenolPyrv_Kinase,prints_Pyr_Knase,tigrfam_Pyr_Knase	ENSG00000143627		0.687	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	81	0.00	0	T	NM_000298		155265263	155265263	-1	no_errors	ENST00000342741	ensembl	human	known	69_37n	missense	70	22.22	20	SNP	1.000	G
PPIF	10105	genome.wustl.edu	37	10	81113525	81113527	+	In_Frame_Del	DEL	TAG	TAG	-			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	TAG	TAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr10:81113525_81113527delTAG	ENST00000225174.3	+	6	622_624	c.551_553delTAG	c.(550-555)atagaa>aaa	p.184_185IE>K	PPIF_ENST00000394579.3_3'UTR	NM_005729.3	NP_005720.1	P30405	PPIF_HUMAN	peptidylprolyl isomerase F	184	PPIase cyclophilin-type. {ECO:0000255|PROSITE-ProRule:PRU00156}.				apoptotic mitochondrial changes (GO:0008637)|cellular response to arsenic-containing substance (GO:0071243)|cellular response to calcium ion (GO:0071277)|cellular response to hydrogen peroxide (GO:0070301)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ATPase activity (GO:0032780)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of oxidative phosphorylation (GO:0090324)|negative regulation of oxidative phosphorylation uncoupler activity (GO:2000276)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein folding (GO:0006457)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in programmed necrotic cell death (GO:1902445)|regulation of necrotic cell death (GO:0010939)|regulation of proton-transporting ATPase activity, rotational mechanism (GO:0010849)|response to ischemia (GO:0002931)	membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)	cyclosporin A binding (GO:0016018)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			endometrium(2)|lung(2)|skin(2)	6	all_cancers(46;0.0893)|Breast(12;8.52e-05)|all_epithelial(25;0.00449)|Prostate(51;0.00985)		Epithelial(14;0.00242)|all cancers(16;0.0069)|Colorectal(32;0.229)		Cyclosporine(DB00091)|L-Proline(DB00172)	GTGAAGAAAATAGAATCTTTCGG	0.532																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			M80254	CCDS7358.1	10q22-q23	2008-10-24	2008-10-24		ENSG00000108179	ENSG00000108179	5.2.1.8		9259	protein-coding gene	gene with protein product	"""cyclophilin D"""	604486	"""peptidylprolyl isomerase F (cyclophilin F)"""			1744118	Standard	NM_005729		Approved	hCyP3, Cyp-D	uc001kai.3	P30405	OTTHUMG00000018562	ENST00000225174.3:c.551_553delTAG	10.37:g.81113525_81113527delTAG	ENSP00000225174:p.Ile184_Glu185delinsLys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YDB7|Q5W131	In_Frame_Del	DEL	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.IE184in_frame_delK	ENST00000225174.3	37	c.551_553	CCDS7358.1	10																																																																																			PPIF	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom	ENSG00000108179		0.532	PPIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIF	HGNC	protein_coding	OTTHUMT00000048949.1	41	0.00	0	TAG	NM_005729		81113525	81113527	+1	no_errors	ENST00000225174	ensembl	human	known	69_37n	in_frame_del	25	10.71	3	DEL	1.000:0.902:1.000	-
SAFB2	9667	genome.wustl.edu	37	19	5621373	5621373	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr19:5621373A>G	ENST00000252542.4	-	2	485	c.221T>C	c.(220-222)aTt>aCt	p.I74T	SAFB_ENST00000592224.1_5'Flank|SAFB_ENST00000588852.1_5'Flank|SAFB_ENST00000292123.5_5'Flank|SAFB_ENST00000538656.1_5'Flank|SAFB_ENST00000454510.1_5'Flank|SAFB_ENST00000433404.1_5'Flank	NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	74					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		CTCGATGCCAATTTCATCAGG	0.438																																					Ovarian(127;888 1728 23957 44128 52668)	dbGAP											0													331.0	303.0	313.0					19																	5621373		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.221T>C	19.37:g.5621373A>G	ENSP00000252542:p.Ile74Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKG3|Q8TB13	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.I74T	ENST00000252542.4	37	c.221	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	A	28.0	4.883922	0.91814	.	.	ENSG00000130254	ENST00000434962;ENST00000415313;ENST00000394625;ENST00000252542;ENST00000536849	T	0.12039	2.72	4.44	4.44	0.53790	DNA-binding SAP (1);	0.624763	0.13707	N	0.368361	T	0.23410	0.0566	M	0.68593	2.085	0.30643	N	0.756205	P;P	0.40660	0.726;0.665	P;B	0.45428	0.48;0.119	T	0.05886	-1.0858	10	0.38643	T	0.18	-0.7676	13.7233	0.62743	1.0:0.0:0.0:0.0	.	74;74	A0PJ47;Q14151	.;SAFB2_HUMAN	T	74;74;74;74;53	ENSP00000252542:I74T	ENSP00000252542:I74T	I	-	2	0	SAFB2	5572373	0.753000	0.28349	0.004000	0.12327	0.854000	0.48673	5.700000	0.68318	1.643000	0.50594	0.379000	0.24179	ATT	SAFB2	-	NULL	ENSG00000130254		0.438	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	41	0.00	0	A	NM_014649		5621373	5621373	-1	no_errors	ENST00000252542	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	0.579	G
TNS1	7145	genome.wustl.edu	37	2	218712887	218712889	+	In_Frame_Del	DEL	GCT	GCT	-	rs375721540|rs574153391		TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	GCT	GCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr2:218712887_218712889delGCT	ENST00000171887.4	-	17	2428_2430	c.1976_1978delAGC	c.(1975-1980)cagcct>cct	p.Q659del	TNS1_ENST00000419504.1_In_Frame_Del_p.Q659del|TNS1_ENST00000430930.1_In_Frame_Del_p.Q659del|TNS1_ENST00000480665.1_5'Flank	NM_022648.4	NP_072174.3	Q9HBL0	TENS1_HUMAN	tensin 1	659	Gln-rich.				cell-substrate junction assembly (GO:0007044)|fibroblast migration (GO:0010761)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(23)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	79		Renal(207;0.0483)|Lung NSC(271;0.213)		Epithelial(149;4.43e-06)|all cancers(144;0.000653)|LUSC - Lung squamous cell carcinoma(224;0.0091)|Lung(261;0.013)		GGTGGGCGAGgctgctgctgctg	0.66																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB209238	CCDS2407.1	2q35-q36	2014-06-13	2005-05-13	2005-05-13	ENSG00000079308	ENSG00000079308		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	11973	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 155"""	600076	"""tensin"", ""matrix-remodelling associated 6"""	TNS, MXRA6			Standard	NM_022648		Approved	DKFZp586K0617, PPP1R155	uc002vgt.2	Q9HBL0	OTTHUMG00000133056	ENST00000171887.4:c.1976_1978delAGC	2.37:g.218712896_218712898delGCT	ENSP00000171887:p.Gln659del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG71|Q6IPI5	In_Frame_Del	DEL	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.Q659in_frame_del	ENST00000171887.4	37	c.1978_1976	CCDS2407.1	2																																																																																			TNS1	-	NULL	ENSG00000079308		0.660	TNS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNS1	HGNC	protein_coding	OTTHUMT00000256672.2	32	0.00	0	GCT	NM_022648		218712887	218712889	-1	no_errors	ENST00000171887	ensembl	human	known	69_37n	in_frame_del	27	12.90	4	DEL	1.000:1.000:0.994	-
XRN2	22803	genome.wustl.edu	37	20	21314341	21314341	+	Splice_Site	SNP	G	G	A			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr20:21314341G>A	ENST00000377191.3	+	11	1028		c.e11-1		XRN2_ENST00000430571.2_Splice_Site|XRN2_ENST00000539513.1_Splice_Site	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2						cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TTTGGTTGTAGTATTTGGAAA	0.408																																						dbGAP											0													212.0	204.0	206.0					20																	21314341		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.934-1G>A	20.37:g.21314341G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Splice_Site	SNP	-	e11-1	ENST00000377191.3	37	c.934-1	CCDS13144.1	20	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428153	0.83667	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9002	0.96983	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	XRN2	21262341	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	9.837000	0.99465	2.709000	0.92574	0.655000	0.94253	.	XRN2	-	-	ENSG00000088930		0.408	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRN2	HGNC	protein_coding	OTTHUMT00000078273.2	49	0.00	0	G	NM_012255	Intron	21314341	21314341	+1	no_errors	ENST00000377191	ensembl	human	known	69_37n	splice_site	70	16.67	14	SNP	1.000	A
ZNF687	57592	genome.wustl.edu	37	1	151259169	151259169	+	Silent	SNP	C	C	T			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr1:151259169C>T	ENST00000368879.2	+	2	500	c.402C>T	c.(400-402)ctC>ctT	p.L134L		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	134	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			AACCTTCCCTCCCAGGAACTC	0.582																																						dbGAP											0													76.0	80.0	79.0					1																	151259169		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.402C>T	1.37:g.151259169C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L134	ENST00000368879.2	37	c.402		1																																																																																			ZNF687	-	NULL	ENSG00000143373		0.582	ZNF687-201	KNOWN	basic	protein_coding	ZNF687	HGNC	protein_coding		49	0.00	0	C	NM_020832		151259169	151259169	+1	no_errors	ENST00000324048	ensembl	human	known	69_37n	silent	42	10.64	5	SNP	0.548	T
ZBTB41	360023	genome.wustl.edu	37	1	197144179	197144179	+	Missense_Mutation	SNP	T	T	C			TCGA-E9-A5FK-01A-11D-A27P-09	TCGA-E9-A5FK-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	d5fb5ae8-cfb8-406c-a960-0507b27db129	3cd5ee75-fb7f-4adf-af2b-08064e99a220	g.chr1:197144179T>C	ENST00000367405.4	-	8	2014	c.1946A>G	c.(1945-1947)cAt>cGt	p.H649R	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	649					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H649P(1)		NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						GCTTTTGTAATGAACAGTGAG	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											191.0	181.0	184.0					1																	197144179		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.1946A>G	1.37:g.197144179T>C	ENSP00000356375:p.His649Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.H649R	ENST00000367405.4	37	c.1946	CCDS30960.1	1	.	.	.	.	.	.	.	.	.	.	T	16.87	3.242523	0.58995	.	.	ENSG00000177888	ENST00000367405	D	0.96200	-3.94	5.49	5.49	0.81192	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42821	U	0.000642	D	0.95040	0.8394	N	0.14661	0.345	0.80722	D	1	D	0.71674	0.998	D	0.76071	0.987	D	0.96416	0.9308	10	0.87932	D	0	.	15.5387	0.76024	0.0:0.0:0.0:1.0	.	649	Q5SVQ8	ZBT41_HUMAN	R	649	ENSP00000356375:H649R	ENSP00000356375:H649R	H	-	2	0	ZBTB41	195410802	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.673000	0.83973	2.213000	0.71641	0.482000	0.46254	CAT	ZBTB41	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000177888		0.348	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	HGNC	protein_coding	OTTHUMT00000088249.2	45	0.00	0	T	NM_194314		197144179	197144179	-1	no_errors	ENST00000367405	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	1.000	C
