#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AOC1	26	genome.wustl.edu	37	7	150557703	150557703	+	Silent	SNP	C	C	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr7:150557703C>T	ENST00000493429.1	+	6	2555	c.1971C>T	c.(1969-1971)aaC>aaT	p.N657N	AOC1_ENST00000467291.1_Silent_p.N657N|AOC1_ENST00000480582.1_3'UTR|AOC1_ENST00000360937.4_Silent_p.N657N|AOC1_ENST00000416793.2_Silent_p.N676N			P19801	AOC1_HUMAN	amine oxidase, copper containing 1	657					amine metabolic process (GO:0009308)|cellular response to azide (GO:0097185)|cellular response to copper ion (GO:0071280)|cellular response to copper ion starvation (GO:0035874)|cellular response to heparin (GO:0071504)|cellular response to histamine (GO:0071420)|oxidation-reduction process (GO:0055114)|response to antibiotic (GO:0046677)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	calcium ion binding (GO:0005509)|cation channel activity (GO:0005261)|copper ion binding (GO:0005507)|diamine oxidase activity (GO:0052597)|drug binding (GO:0008144)|heparin binding (GO:0008201)|histamine oxidase activity (GO:0052598)|methylputrescine oxidase activity (GO:0052599)|primary amine oxidase activity (GO:0008131)|propane-1,3-diamine oxidase activity (GO:0052600)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|quinone binding (GO:0048038)|receptor activity (GO:0004872)|sodium channel activity (GO:0005272)|zinc ion binding (GO:0008270)									Amiloride(DB00594)	TTCACAACAACGAGAACATTG	0.597																																						dbGAP											0													133.0	145.0	141.0					7																	150557703		2084	4224	6308	-	-	-	SO:0001819	synonymous_variant	0			AK092514	CCDS43679.1, CCDS64797.1	7q36.1	2013-06-19	2013-06-19	2013-06-19	ENSG00000002726	ENSG00000002726	1.4.3.22		80	protein-coding gene	gene with protein product	"""diamine oxidase"""	104610	"""amiloride binding protein 1 (amine oxidase (copper-containing))"""	ABP1		8182053	Standard	NM_001091		Approved	DAO	uc003wia.2	P19801	OTTHUMG00000158306	ENST00000493429.1:c.1971C>T	7.37:g.150557703C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J690|Q16683|Q16684|Q56II4|Q6GU42	Silent	SNP	pfam_Cu_amine_oxidase_C,pfam_Cu_amine_oxidase_N2,pfam_Cu_amine_oxidase_N3,superfamily_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_N-reg,prints_Cu_amine_oxidase	p.N676	ENST00000493429.1	37	c.2028	CCDS43679.1	7	.	.	.	.	.	.	.	.	.	.	C	1.828	-0.470671	0.04445	.	.	ENSG00000002726	ENST00000487631	.	.	.	5.05	-4.46	0.03536	.	.	.	.	.	T	0.68714	0.3031	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73151	-0.4073	5	0.87932	D	0	-28.8975	13.0554	0.58977	0.0:0.5832:0.0:0.4168	.	.	.	.	M	182	.	ENSP00000417051:T182M	T	+	2	0	ABP1	150188636	0.004000	0.15560	0.954000	0.39281	0.324000	0.28378	-1.498000	0.02287	-0.951000	0.03654	-1.424000	0.01105	ACG	ABP1	-	pfam_Cu_amine_oxidase_C,superfamily_Cu_amine_oxidase_C	ENSG00000002726		0.597	AOC1-009	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABP1	HGNC	protein_coding	OTTHUMT00000350628.1	85	0.00	0	C	NM_001091		150557703	150557703	+1	no_errors	ENST00000416793	ensembl	human	known	69_37n	silent	40	21.57	11	SNP	0.986	T
AMN1	196394	genome.wustl.edu	37	12	31862323	31862323	+	Nonsense_Mutation	SNP	A	A	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr12:31862323A>T	ENST00000281471.6	-	2	240	c.75T>A	c.(73-75)taT>taA	p.Y25*	AMN1_ENST00000542781.1_Intron|AMN1_ENST00000536761.1_Nonsense_Mutation_p.Y7*|AMN1_ENST00000541931.1_Intron|AMN1_ENST00000541541.1_5'UTR|AMN1_ENST00000537562.1_Nonsense_Mutation_p.Y7*	NM_001113402.1|NM_001278411.1|NM_001278412.1	NP_001106873.1|NP_001265340.1|NP_001265341.1	Q8IY45	AMN1_HUMAN	antagonist of mitotic exit network 1 homolog (S. cerevisiae)	25										breast(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(1)	7	all_cancers(9;7.41e-12)|all_epithelial(9;1.18e-11)|all_lung(12;1.14e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0336)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.162)		OV - Ovarian serous cystadenocarcinoma(6;0.0014)			TGTCTGTGAGATATCTGGAAA	0.353																																						dbGAP											0													318.0	244.0	266.0					12																	31862323		692	1591	2283	-	-	-	SO:0001587	stop_gained	0				CCDS44858.1, CCDS61089.1	12p11.21	2010-07-19			ENSG00000151743	ENSG00000151743			27281	protein-coding gene	gene with protein product							Standard	NM_001113402		Approved		uc001rkq.4	Q8IY45	OTTHUMG00000169192	ENST00000281471.6:c.75T>A	12.37:g.31862323A>T	ENSP00000281471:p.Tyr25*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7J3|Q6NVU4|Q86X98	Nonsense_Mutation	SNP	smart_Leu-rich_rpt_Cys-con_subtyp	p.Y25*	ENST00000281471.6	37	c.75	CCDS44858.1	12	.	.	.	.	.	.	.	.	.	.	A	21.7	4.192031	0.78902	.	.	ENSG00000151743	ENST00000281471;ENST00000537562;ENST00000536761;ENST00000535408;ENST00000537960;ENST00000506446;ENST00000457428	.	.	.	4.94	-4.2	0.03823	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.2492	0.66009	0.2767:0.0:0.7233:0.0	.	.	.	.	X	25;7;7;7;7;7;7	.	ENSP00000281471:Y25X	Y	-	3	2	AMN1	31753590	0.044000	0.20184	0.979000	0.43373	0.964000	0.63967	-0.724000	0.04947	-0.602000	0.05775	-0.456000	0.05471	TAT	AMN1	-	NULL	ENSG00000151743		0.353	AMN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMN1	HGNC	protein_coding	OTTHUMT00000402807.2	68	0.00	0	A	NR_004854		31862323	31862323	-1	no_errors	ENST00000281471	ensembl	human	known	69_37n	nonsense	15	40.00	10	SNP	0.761	T
APC	324	genome.wustl.edu	37	5	112175450	112175450	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr5:112175450T>A	ENST00000457016.1	+	16	4539	c.4159T>A	c.(4159-4161)Tgt>Agt	p.C1387S	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.C1387S|APC_ENST00000508376.2_Missense_Mutation_p.C1387S			P25054	APC_HUMAN	adenomatous polyposis coli	1387	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.C1387fs*29(1)|p.Y1376fs*41(1)|p.K1192fs*3(1)|p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GTTTAGCAGATGTACTTCTGT	0.463		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	dbGAP	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	4	Deletion - Frameshift(2)|Unknown(1)|Insertion - Frameshift(1)	large_intestine(2)|soft_tissue(1)|skin(1)											104.0	98.0	100.0					5																	112175450		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.4159T>A	5.37:g.112175450T>A	ENSP00000413133:p.Cys1387Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.C1387S	ENST00000457016.1	37	c.4159	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	T	20.3	3.973960	0.74246	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	T;T;T	0.77098	-1.07;-1.07;-1.07	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.84620	0.5512	L	0.46157	1.445	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.83463	0.0055	9	.	.	.	-12.4055	16.4957	0.84242	0.0:0.0:0.0:1.0	.	1389;1387	Q4LE70;P25054	.;APC_HUMAN	S	1387	ENSP00000413133:C1387S;ENSP00000257430:C1387S;ENSP00000427089:C1387S	.	C	+	1	0	APC	112203349	1.000000	0.71417	1.000000	0.80357	0.932000	0.56968	7.698000	0.84413	2.371000	0.80710	0.533000	0.62120	TGT	APC	-	pfam_APC_Cys-rich_rpt	ENSG00000134982		0.463	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	50	0.00	0	T	NM_000038		112175450	112175450	+1	no_errors	ENST00000257430	ensembl	human	known	69_37n	missense	11	42.11	8	SNP	1.000	A
BIRC3	330	genome.wustl.edu	37	11	102195805	102195805	+	Missense_Mutation	SNP	C	C	G			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr11:102195805C>G	ENST00000263464.3	+	2	3315	c.565C>G	c.(565-567)Ctg>Gtg	p.L189V	BIRC3_ENST00000532808.1_Missense_Mutation_p.L189V	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	189					apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		GCCAACAGATCTGGCAAAAGC	0.438			T	MALT1	MALT																																	dbGAP		Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	0													116.0	118.0	117.0					11																	102195805		2203	4299	6502	-	-	-	SO:0001583	missense	0			L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.565C>G	11.37:g.102195805C>G	ENSP00000263464:p.Leu189Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16628|Q9HC27|Q9UP46	Missense_Mutation	SNP	pfam_BIR,pfam_CARD,superfamily_DEATH-like,smart_BIR,smart_CARD,smart_Znf_RING,pfscan_CARD,pfscan_BIR,pfscan_Znf_RING	p.L189V	ENST00000263464.3	37	c.565	CCDS8315.1	11	.	.	.	.	.	.	.	.	.	.	C	14.68	2.607278	0.46527	.	.	ENSG00000023445	ENST00000263464;ENST00000532808;ENST00000532609	D;D	0.84800	-1.9;-1.9	5.4	3.55	0.40652	Baculoviral inhibition of apoptosis protein repeat (5);	0.000000	0.85682	D	0.000000	D	0.91570	0.7337	M	0.93763	3.455	0.58432	D	0.999999	D	0.53462	0.96	P	0.54924	0.764	D	0.91813	0.5461	10	0.72032	D	0.01	.	10.0926	0.42456	0.0:0.7365:0.0:0.2635	.	189	Q13489	BIRC3_HUMAN	V	189;189;38	ENSP00000263464:L189V;ENSP00000432907:L189V	ENSP00000263464:L189V	L	+	1	2	BIRC3	101701015	0.943000	0.32029	0.563000	0.28383	0.602000	0.36980	2.073000	0.41519	0.857000	0.35407	0.591000	0.81541	CTG	BIRC3	-	pfam_BIR,smart_BIR,pfscan_BIR	ENSG00000023445		0.438	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BIRC3	HGNC	protein_coding	OTTHUMT00000394159.1	35	0.00	0	C	NM_001165		102195805	102195805	+1	no_errors	ENST00000263464	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.777	G
SMIM24	284422	genome.wustl.edu	37	19	3478950	3478950	+	Intron	SNP	G	G	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr19:3478950G>A	ENST00000215531.4	-	2	146				C19orf77_ENST00000586804.1_5'UTR|C19orf77_ENST00000587847.1_5'UTR|C19orf77_ENST00000591708.1_5'Flank	NM_001136503.1	NP_001129975.1	O75264	SIM24_HUMAN								extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GGGGAGGTTCGACTCAGAGGA	0.592																																						dbGAP											0													23.0	26.0	25.0					19																	3478950		691	1587	2278	-	-	-	SO:0001627	intron_variant	0																														ENST00000215531.4:c.68-23C>T	19.37:g.3478950G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJF4|Q9P059	RNA	SNP	-	NULL	ENST00000215531.4	37	NULL	CCDS45915.1	19																																																																																			C19orf77	-	-	ENSG00000095932		0.592	C19orf77-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf77	HGNC	protein_coding	OTTHUMT00000452929.1	92	0.00	0	G			3478950	3478950	-1	no_errors	ENST00000586804	ensembl	human	known	69_37n	rna	29	40.82	20	SNP	0.000	A
CADM2	253559	genome.wustl.edu	37	3	86010721	86010721	+	Silent	SNP	G	G	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr3:86010721G>A	ENST00000407528.2	+	7	929	c.867G>A	c.(865-867)acG>acA	p.T289T	CADM2_ENST00000405615.2_Silent_p.T291T|CADM2_ENST00000383699.3_Silent_p.T298T	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	289	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		TGAACAAAACGGATAATGGTA	0.423																																						dbGAP											0													153.0	139.0	144.0					3																	86010721		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.867G>A	3.37:g.86010721G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like	p.T291	ENST00000407528.2	37	c.873	CCDS54614.1	3																																																																																			CADM2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000175161		0.423	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM2	HGNC	protein_coding	OTTHUMT00000352822.1	93	0.00	0	G	NM_153184		86010721	86010721	+1	no_errors	ENST00000405615	ensembl	human	known	69_37n	silent	38	43.28	29	SNP	1.000	A
CBFB	865	genome.wustl.edu	37	16	67070577	67070578	+	Frame_Shift_Ins	INS	-	-	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr16:67070577_67070578insT	ENST00000290858.6	+	3	462_463	c.201_202insT	c.(202-204)tttfs	p.F68fs	CBFB_ENST00000412916.2_Frame_Shift_Ins_p.F68fs|CBFB_ENST00000561924.2_5'UTR	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit	68					cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		TGTCTCTCCAGTTTTTTCCGGC	0.446			T	MYH11	AML																																	dbGAP		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	0																																										-	-	-	SO:0001589	frameshift_variant	0			BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	ENST00000290858.6:c.207dupT	16.37:g.67070583_67070583dupT	ENSP00000290858:p.Phe68fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K347|Q13124|Q9HCT2	Frame_Shift_Ins	INS	pfam_CBF_beta,superfamily_CBF_beta	p.P69fs	ENST00000290858.6	37	c.201_202	CCDS10827.1	16																																																																																			CBFB	-	pfam_CBF_beta,superfamily_CBF_beta	ENSG00000067955		0.446	CBFB-001	KNOWN	basic|CCDS	protein_coding	CBFB	HGNC	protein_coding	OTTHUMT00000268843.2	96	0.00	0	-	NM_001755		67070577	67070578	+1	no_errors	ENST00000290858	ensembl	human	known	69_37n	frame_shift_ins	8	72.41	21	INS	1.000:1.000	T
CCBE1	147372	genome.wustl.edu	37	18	57115243	57115243	+	Silent	SNP	A	A	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr18:57115243A>T	ENST00000439986.4	-	7	784	c.747T>A	c.(745-747)ccT>ccA	p.P249P	CCBE1_ENST00000398179.2_Missense_Mutation_p.L25Q	NM_133459.3	NP_597716.1	Q6UXH8	CCBE1_HUMAN	collagen and calcium binding EGF domains 1	249	Collagen-like 1.				lymphangiogenesis (GO:0001946)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of lymphangiogenesis (GO:1901492)|positive regulation of protein processing (GO:0010954)|positive regulation of vascular endothelial growth factor signaling pathway (GO:1900748)|positive regulation vascular endothelial growth factor production (GO:0010575)|sprouting angiogenesis (GO:0002040)|venous blood vessel morphogenesis (GO:0048845)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|protease binding (GO:0002020)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(3)	24		Colorectal(73;0.175)				CAGGCAGGCCAGGAGGTCCTG	0.582																																					NSCLC(137;1340 1860 15773 39604 51087)|Esophageal Squamous(139;339 1777 2926 19691 38524)	dbGAP											0													106.0	87.0	93.0					18																	57115243		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB075863	CCDS32838.1	18q21.32	2005-01-18				ENSG00000183287			29426	protein-coding gene	gene with protein product		612753				11853319, 12975309	Standard	NM_133459		Approved	FLJ30681, KIAA1983	uc002lib.3	Q6UXH8		ENST00000439986.4:c.747T>A	18.37:g.57115243A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6MZX5|Q86SS2|Q8TF19	Missense_Mutation	SNP	pfam_Collagen	p.L25Q	ENST00000439986.4	37	c.74	CCDS32838.1	18	.	.	.	.	.	.	.	.	.	.	A	17.96	3.514984	0.64634	.	.	ENSG00000183287	ENST00000398179	T	0.29917	1.55	5.62	3.19	0.36642	.	.	.	.	.	T	0.26195	0.0639	.	.	.	0.23162	N	0.998198	B	0.24963	0.115	B	0.31547	0.132	T	0.26573	-1.0099	8	0.51188	T	0.08	-12.1055	8.2017	0.31428	0.8383:0.0:0.1617:0.0	.	25	Q6UXH8-2	.	Q	25	ENSP00000381241:L25Q	ENSP00000381241:L25Q	L	-	2	0	CCBE1	55266223	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.828000	0.27435	0.406000	0.25560	-0.326000	0.08463	CTG	CCBE1	-	NULL	ENSG00000183287		0.582	CCBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCBE1	HGNC	protein_coding	OTTHUMT00000449685.2	84	0.00	0	A	NM_133459		57115243	57115243	-1	no_errors	ENST00000398179	ensembl	human	known	69_37n	missense	39	47.30	35	SNP	1.000	T
CLTC	1213	genome.wustl.edu	37	17	57762432	57762432	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr17:57762432A>G	ENST00000269122.3	+	29	4724	c.4450A>G	c.(4450-4452)Ata>Gta	p.I1484V	CLTC_ENST00000579456.1_Missense_Mutation_p.I421V|CLTC_ENST00000393043.1_Missense_Mutation_p.I1484V	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	1484	Heavy chain arm.|Involved in binding clathrin light chain. {ECO:0000250}.|Proximal segment.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					GCGAACATCAATAGATGCTTA	0.373			T	"""ALK, TFE3"""	"""ALCL, renal """																																	dbGAP		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													103.0	109.0	107.0					17																	57762432		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.4450A>G	17.37:g.57762432A>G	ENSP00000269122:p.Ile1484Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.I1484V	ENST00000269122.3	37	c.4450	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	A	12.99	2.102354	0.37145	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.21191	2.02;2.02	5.28	5.28	0.74379	Tetratricopeptide-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.22936	0.0554	L	0.52206	1.635	0.80722	D	1	B;B	0.11235	0.002;0.004	B;B	0.27796	0.026;0.083	T	0.05225	-1.0898	10	0.16896	T	0.51	.	15.4984	0.75677	1.0:0.0:0.0:0.0	.	1484;1484	Q00610;Q00610-2	CLH1_HUMAN;.	V	1484	ENSP00000269122:I1484V;ENSP00000376763:I1484V	ENSP00000269122:I1484V	I	+	1	0	CLTC	55117214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.287000	0.95975	2.119000	0.64992	0.528000	0.53228	ATA	CLTC	-	pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	ENSG00000141367		0.373	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	56	0.00	0	A	NM_004859		57762432	57762432	+1	no_errors	ENST00000269122	ensembl	human	known	69_37n	missense	53	30.26	23	SNP	1.000	G
DOCK7	85440	genome.wustl.edu	37	1	63090858	63090858	+	Intron	SNP	C	C	T	rs6587980	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr1:63090858C>T	ENST00000340370.5	-	12	1443				DOCK7_ENST00000251157.5_Intron|DOCK7_ENST00000404627.2_Intron	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7						activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						ATAGTACAATCACTACCTTTC	0.289													T|||	2055	0.410343	0.6044	0.379	5008	,	,		14685	0.2321		0.3052	False		,,,				2504	0.4622					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.1425+71G>A	1.37:g.63090858C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	RNA	SNP	-	NULL	ENST00000340370.5	37	NULL	CCDS30734.1	1																																																																																			DOCK7	-	-	ENSG00000116641		0.289	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	34	0.00	0	C	NM_033407		63090858	63090858	-1	no_errors	ENST00000464312	ensembl	human	known	69_37n	rna	16	19.05	4	SNP	0.000	T
EPHA4	2043	genome.wustl.edu	37	2	222284646	222284646	+	3'UTR	SNP	C	C	T	rs3770208	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr2:222284646C>T	ENST00000281821.2	-	0	4448				EPHA4_ENST00000469354.1_5'UTR	NM_004438.3	NP_004429.1	P54764	EPHA4_HUMAN	EPH receptor A4						adult walking behavior (GO:0007628)|cell adhesion (GO:0007155)|corticospinal tract morphogenesis (GO:0021957)|fasciculation of motor neuron axon (GO:0097156)|fasciculation of sensory neuron axon (GO:0097155)|glial cell migration (GO:0008347)|motor neuron axon guidance (GO:0008045)|negative regulation of axon regeneration (GO:0048681)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of Rho guanyl-nucleotide exchange factor activity (GO:2001108)|protein autophosphorylation (GO:0046777)|regulation of astrocyte differentiation (GO:0048710)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rap GTPase activity (GO:0032317)	axon (GO:0030424)|axon terminus (GO:0043679)|axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|mitochondrial outer membrane (GO:0005741)|neuromuscular junction (GO:0031594)|perikaryon (GO:0043204)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|DH domain binding (GO:0097161)|GPI-linked ephrin receptor activity (GO:0005004)|PH domain binding (GO:0042731)|protein kinase activity (GO:0004672)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(9)|liver(1)|lung(21)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Renal(207;0.0183)		Epithelial(121;5.38e-09)|all cancers(144;2.47e-06)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(261;0.0154)		CATGAGGCTacgcacatacac	0.443													C|||	2228	0.444888	0.6362	0.3934	5008	,	,		20808	0.2569		0.4195	False		,,,				2504	0.4427					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L36645	CCDS2447.1	2q36.3	2013-02-11	2004-10-28		ENSG00000116106	ENSG00000116106	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3388	protein-coding gene	gene with protein product		602188	"""EphA4"""	TYRO1		9267020	Standard	NM_004438		Approved	Hek8	uc002vmq.3	P54764	OTTHUMG00000133142	ENST00000281821.2:c.*1446G>A	2.37:g.222284646C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P1|B2R601|B7Z6Q8|Q2M380	RNA	SNP	-	NULL	ENST00000281821.2	37	NULL	CCDS2447.1	2																																																																																			EPHA4	-	-	ENSG00000116106		0.443	EPHA4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA4	HGNC	protein_coding	OTTHUMT00000256836.3	35	0.00	0	C			222284646	222284646	-1	no_errors	ENST00000469354	ensembl	human	putative	69_37n	rna	14	17.65	3	SNP	0.003	T
FAM217A	222826	genome.wustl.edu	37	6	4069855	4069857	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr6:4069855_4069857delTCT	ENST00000274673.3	-	7	1003_1005	c.600_602delAGA	c.(598-603)acagat>act	p.D201del	FAM217A_ENST00000380188.2_5'UTR	NM_173563.2	NP_775834.2	Q8IXS0	F217A_HUMAN	family with sequence similarity 217, member A	201																	ATCACTTTCATCTGTGAAATTTT	0.32																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC039349	CCDS4489.1	6p25.1	2012-02-07	2012-02-07	2012-02-07	ENSG00000145975	ENSG00000145975			21362	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 146"""	C6orf146			Standard	NM_173563		Approved	MGC43581	uc003mvx.3	Q8IXS0	OTTHUMG00000014159	ENST00000274673.3:c.600_602delAGA	6.37:g.4069855_4069857delTCT	ENSP00000274673:p.Asp201del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYK1	In_Frame_Del	DEL	NULL	p.D201in_frame_del	ENST00000274673.3	37	c.602_600	CCDS4489.1	6																																																																																			FAM217A	-	NULL	ENSG00000145975		0.320	FAM217A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM217A	HGNC	protein_coding	OTTHUMT00000352577.2	42	0.00	0	TCT	NM_173563		4069855	4069857	-1	no_errors	ENST00000274673	ensembl	human	known	69_37n	in_frame_del	20	23.08	6	DEL	1.000:1.000:0.998	-
FASTKD5	60493	genome.wustl.edu	37	20	3129595	3129595	+	Missense_Mutation	SNP	T	T	G			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr20:3129595T>G	ENST00000380266.3	-	2	443	c.122A>C	c.(121-123)cAg>cCg	p.Q41P	UBOX5_ENST00000217173.2_Intron|UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Intron	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	41					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						TGGAGGGTCCTGTCCCCCATG	0.478																																						dbGAP											0													120.0	117.0	118.0					20																	3129595		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.122A>C	20.37:g.3129595T>G	ENSP00000369618:p.Gln41Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JN3|Q9H5D1|Q9H8Y3	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.Q41P	ENST00000380266.3	37	c.122	CCDS13048.1	20	.	.	.	.	.	.	.	.	.	.	T	11.37	1.619822	0.28801	.	.	ENSG00000215251	ENST00000380266	T	0.19250	2.16	5.08	1.43	0.22495	.	2.743330	0.01490	N	0.017023	T	0.18635	0.0447	L	0.32530	0.975	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21690	-1.0238	10	0.41790	T	0.15	.	6.7042	0.23242	0.0:0.1447:0.4031:0.4522	.	41	Q7L8L6	FAKD5_HUMAN	P	41	ENSP00000369618:Q41P	ENSP00000369618:Q41P	Q	-	2	0	FASTKD5	3077595	0.000000	0.05858	0.018000	0.16275	0.246000	0.25737	0.075000	0.14686	0.049000	0.15920	-0.689000	0.03729	CAG	FASTKD5	-	NULL	ENSG00000215251		0.478	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD5	HGNC	protein_coding	OTTHUMT00000077701.2	144	0.00	0	T	NM_021826		3129595	3129595	-1	no_errors	ENST00000380266	ensembl	human	known	69_37n	missense	66	56.86	87	SNP	0.001	G
FOXF1	2294	genome.wustl.edu	37	16	86544800	86544800	+	Frame_Shift_Del	DEL	C	C	-			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr16:86544800delC	ENST00000262426.4	+	1	668	c.625delC	c.(625-627)cccfs	p.P209fs	FENDRR_ENST00000595886.1_lincRNA	NM_001451.2	NP_001442.2	Q12946	FOXF1_HUMAN	forkhead box F1	209					blood vessel development (GO:0001568)|branching involved in open tracheal system development (GO:0060446)|cardiac left ventricle morphogenesis (GO:0003214)|cellular response to cytokine stimulus (GO:0071345)|cellular response to organic cyclic compound (GO:0071407)|detection of wounding (GO:0014822)|determination of left/right symmetry (GO:0007368)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic ectodermal digestive tract morphogenesis (GO:0048613)|embryonic foregut morphogenesis (GO:0048617)|endocardial cushion development (GO:0003197)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lateral mesodermal cell differentiation (GO:0048371)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung vasculature development (GO:0060426)|mesenchyme migration (GO:0090131)|midgut development (GO:0007494)|morphogenesis of a branching structure (GO:0001763)|negative regulation of inflammatory response (GO:0050728)|negative regulation of mast cell degranulation (GO:0043305)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|pancreas development (GO:0031016)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of smooth muscle cell differentiation (GO:0051150)|renal system development (GO:0072001)|respiratory tube development (GO:0030323)|right lung morphogenesis (GO:0060461)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|smoothened signaling pathway (GO:0007224)|somitogenesis (GO:0001756)|trachea development (GO:0060438)|ureter development (GO:0072189)|vasculogenesis (GO:0001570)|venous blood vessel development (GO:0060841)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)			autonomic_ganglia(1)|breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|urinary_tract(1)	12						CATGGCCCTGCCCAGCCACTC	0.746																																						dbGAP											0													5.0	4.0	5.0					16																	86544800		1772	3628	5400	-	-	-	SO:0001589	frameshift_variant	0			U13219	CCDS10957.2	16q24	2008-02-05			ENSG00000103241	ENSG00000103241		"""Forkhead boxes"""	3809	protein-coding gene	gene with protein product		601089		FKHL5		8825632, 7957066	Standard	NM_001451		Approved	FREAC1	uc002fjl.3	Q12946	OTTHUMG00000137651	ENST00000262426.4:c.625delC	16.37:g.86544800delC	ENSP00000262426:p.Pro209fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAF4|Q5FWE5	Frame_Shift_Del	DEL	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S210fs	ENST00000262426.4	37	c.625	CCDS10957.2	16																																																																																			FOXF1	-	NULL	ENSG00000103241		0.746	FOXF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	FOXF1	HGNC	protein_coding	OTTHUMT00000269103.2	13	0.00	0	C	NM_001451		86544800	86544800	+1	no_errors	ENST00000262426	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
GOLGA6L2	283685	genome.wustl.edu	37	15	23685316	23685317	+	Frame_Shift_Ins	INS	-	-	T	rs576090491	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr15:23685316_23685317insT	ENST00000567107.1	-	8	2357_2358	c.2305_2306insA	c.(2305-2307)gcafs	p.A769fs	GOLGA6L2_ENST00000345070.5_Intron|GOLGA6L2_ENST00000312015.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						tgctgctcctgcatcttctcct	0.564																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2305_2306insA	15.37:g.23685316_23685317insT	ENSP00000454407:p.Ala769fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	Frame_Shift_Ins	INS	NULL	p.A769fs	ENST00000567107.1	37	c.2306_2305		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.564	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	23	0.00	0	-	NM_182561		23685316	23685317	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	frame_shift_ins	8	27.27	3	INS	0.005:0.010	T
GRIA4	2893	genome.wustl.edu	37	11	105842661	105842661	+	Missense_Mutation	SNP	T	T	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr11:105842661T>A	ENST00000530497.1	+	14	2315	c.2315T>A	c.(2314-2316)gTt>gAt	p.V772D	GRIA4_ENST00000393127.2_Intron|GRIA4_ENST00000282499.5_Missense_Mutation_p.V772D|GRIA4_ENST00000533094.1_Intron|GRIA4_ENST00000525187.1_Intron|RNU6-277P_ENST00000516272.1_RNA			P48058	GRIA4_HUMAN	glutamate receptor, ionotropic, AMPA 4	772					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|vesicle (GO:0031982)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(24)|liver(2)|lung(25)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	82		Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000994)|all_hematologic(158;0.0017)|Breast(348;0.0323)		BRCA - Breast invasive adenocarcinoma(274;0.000147)|Epithelial(105;0.0291)|all cancers(92;0.0899)		AACCTTGCCGTTTTGAAACTC	0.378																																						dbGAP											0													89.0	87.0	88.0					11																	105842661		2201	4299	6500	-	-	-	SO:0001583	missense	0			U16129	CCDS8333.1, CCDS41706.1, CCDS41707.1	11q22	2012-08-29	2012-02-03		ENSG00000152578	ENSG00000152578		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4574	protein-coding gene	gene with protein product		138246	"""glutamate receptor, ionotrophic, AMPA 4"""	GLUR4			Standard	NM_001077244		Approved	GluA4, GLURD	uc001pix.2	P48058	OTTHUMG00000166236	ENST00000530497.1:c.2315T>A	11.37:g.105842661T>A	ENSP00000435775:p.Val772Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XE8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V772D	ENST00000530497.1	37	c.2315	CCDS8333.1	11	.	.	.	.	.	.	.	.	.	.	T	24.5	4.533363	0.85812	.	.	ENSG00000152578	ENST00000282499;ENST00000530497	T;T	0.40476	1.03;1.03	5.55	5.55	0.83447	Ionotropic glutamate receptor (2);	0.000000	0.56097	D	0.000025	T	0.71221	0.3314	M	0.90814	3.15	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.78414	-0.2213	10	0.87932	D	0	.	15.7049	0.77569	0.0:0.0:0.0:1.0	.	772	P48058	GRIA4_HUMAN	D	772	ENSP00000282499:V772D;ENSP00000435775:V772D	ENSP00000282499:V772D	V	+	2	0	GRIA4	105347871	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.013000	0.88655	2.117000	0.64856	0.533000	0.62120	GTT	GRIA4	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000152578		0.378	GRIA4-005	KNOWN	basic|CCDS	protein_coding	GRIA4	HGNC	protein_coding	OTTHUMT00000388593.1	56	0.00	0	T			105842661	105842661	+1	no_errors	ENST00000282499	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	A
HNRNPK	3190	genome.wustl.edu	37	9	86595498	86595498	+	5'UTR	SNP	G	G	A	rs296888	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr9:86595498G>A	ENST00000376264.2	-	0	71				HNRNPK_ENST00000360384.5_5'Flank|RMI1_ENST00000325875.3_5'Flank|HNRNPK_ENST00000376263.3_5'Flank|HNRNPK_ENST00000376281.4_5'UTR|HNRNPK_ENST00000351839.3_5'Flank	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K						gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						GGCGTCTGCAGTGCTGTCGCC	0.592													G|||	1609	0.321286	0.3941	0.2104	5008	,	,		13662	0.2937		0.2793	False		,,,				2504	0.3732					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0				CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.-188C>T	9.37:g.86595498G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	RNA	SNP	-	NULL	ENST00000376264.2	37	NULL	CCDS6667.1	9																																																																																			HNRNPK	-	-	ENSG00000165119		0.592	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	HNRNPK	HGNC	protein_coding	OTTHUMT00000052846.2	52	0.00	0	G			86595498	86595498	-1	no_errors	ENST00000472778	ensembl	human	known	69_37n	rna	19	17.39	4	SNP	0.999	A
IGHV3-9	28451	genome.wustl.edu	37	14	106552589	106552589	+	RNA	SNP	A	A	C	rs587737575		TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr14:106552589A>C	ENST00000390600.2	-	0	129									immunoglobulin heavy variable 3-9																		TTCACACTGGACACCTGCAAA	0.507																																						dbGAP											0																																										-	-	-			0			M99651		14q32.33	2012-02-08			ENSG00000211940			"""Immunoglobulins / IGH locus"""	5628	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152291		14.37:g.106552589A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V17G	ENST00000390600.2	37	c.50		14																																																																																			IGHV3-9	-	NULL	ENSG00000211940		0.507	IGHV3-9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-9	HGNC	IG_V_gene	OTTHUMT00000325679.1	63	0.00	0	A	NG_001019		106552589	106552589	-1	no_stop_codon	ENST00000390600	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	0.880	C
IL33	90865	genome.wustl.edu	37	9	6241782	6241782	+	Missense_Mutation	SNP	G	G	C			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr9:6241782G>C	ENST00000381434.3	+	1	101	c.88G>C	c.(88-90)Gga>Cga	p.G30R	IL33_ENST00000456383.2_Missense_Mutation_p.G30R|IL33_ENST00000417746.2_Missense_Mutation_p.G30R|IL33_ENST00000463336.1_3'UTR	NM_033439.3	NP_254274.1	O95760	IL33_HUMAN	interleukin 33	30	Homeodomain-like HTH domain.				extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of immunoglobulin secretion (GO:0051025)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of T-helper 1 type immune response (GO:0002826)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage activation (GO:0043032)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type 2 immune response (GO:0002830)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)|nucleus (GO:0005634)	cytokine activity (GO:0005125)			breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|stomach(1)|urinary_tract(1)	16		Acute lymphoblastic leukemia(23;0.158)|Prostate(43;0.167)		GBM - Glioblastoma multiforme(50;0.0161)|Lung(218;0.105)		TTTCAAGCTGGGAAGTAAGGA	0.318																																						dbGAP											0													96.0	94.0	94.0					9																	6241782		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB024518	CCDS6468.1, CCDS56563.1, CCDS56564.1	9p24.1	2014-01-28	2006-11-20	2006-11-20	ENSG00000137033	ENSG00000137033		"""Interleukins and interleukin receptors"""	16028	protein-coding gene	gene with protein product	"""DVS27-related protein"", ""nuclear factor for high endothelial venules"", ""interleukin-1 family, member 11"""	608678	"""chromosome 9 open reading frame 26 (NF-HEV)"""	C9orf26		10566975, 12819012	Standard	NM_033439		Approved	DVS27, DKFZp586H0523, NF-HEV, IL1F11	uc003zjt.3	O95760	OTTHUMG00000019516	ENST00000381434.3:c.88G>C	9.37:g.6241782G>C	ENSP00000370842:p.Gly30Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8L1|B4DJ35|B4E1Q9|D3DRI5|E7EAX4|Q2YEJ5	Missense_Mutation	SNP	NULL	p.G30R	ENST00000381434.3	37	c.88	CCDS6468.1	9	.	.	.	.	.	.	.	.	.	.	G	5.641	0.302960	0.10678	.	.	ENSG00000137033	ENST00000417746;ENST00000456383;ENST00000381434	T;T;T	0.53857	0.6;1.29;1.29	4.26	1.92	0.25849	.	0.820850	0.10806	N	0.632122	T	0.16599	0.0399	N	0.00368	-1.59	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.22521	-1.0214	10	0.27785	T	0.31	-7.2569	5.6274	0.17490	0.7733:0.0:0.2267:0.0	.	30;30;30	B4DJ35;B4E1Q9;O95760	.;.;IL33_HUMAN	R	30	ENSP00000394039:G30R;ENSP00000414238:G30R;ENSP00000370842:G30R	ENSP00000370842:G30R	G	+	1	0	IL33	6231782	0.019000	0.18553	0.043000	0.18650	0.002000	0.02628	0.886000	0.28241	0.431000	0.26258	-0.350000	0.07774	GGA	IL33	-	NULL	ENSG00000137033		0.318	IL33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL33	HGNC	protein_coding	OTTHUMT00000051655.1	38	0.00	0	G	NM_033439		6241782	6241782	+1	no_errors	ENST00000381434	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	0.048	C
ITGAM	3684	genome.wustl.edu	37	16	31277441	31277441	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr16:31277441C>T	ENST00000287497.8	+	5	475	c.400C>T	c.(400-402)Ccc>Tcc	p.P134S	RNU7-199P_ENST00000517067.1_RNA|ITGAM_ENST00000544665.3_Missense_Mutation_p.P134S			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	134					activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						ACGGCAGCAGCCCCAGAAGTT	0.602																																						dbGAP											0													53.0	55.0	54.0					16																	31277441		1954	4145	6099	-	-	-	SO:0001583	missense	0			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.400C>T	16.37:g.31277441C>T	ENSP00000287497:p.Pro134Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAK0|Q4VAK1|Q4VAK2	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.P134S	ENST00000287497.8	37	c.400	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873964	0.51695	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	T;T	0.60040	0.23;0.22	5.33	3.23	0.37069	.	.	.	.	.	T	0.40372	0.1114	L	0.34521	1.04	0.09310	N	1	B;B	0.18610	0.029;0.029	B;B	0.14023	0.01;0.01	T	0.24083	-1.0170	9	0.08381	T	0.77	.	8.2887	0.31943	0.1595:0.5712:0.2694:0.0	.	134;134	Q4VAK1;P11215	.;ITAM_HUMAN	S	134	ENSP00000441691:P134S;ENSP00000287497:P134S	ENSP00000287497:P134S	P	+	1	0	ITGAM	31184942	0.009000	0.17119	0.658000	0.29665	0.608000	0.37181	0.740000	0.26188	1.234000	0.43709	0.644000	0.83932	CCC	ITGAM	-	NULL	ENSG00000169896		0.602	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	84	0.00	0	C	NM_000632		31277441	31277441	+1	no_errors	ENST00000544665	ensembl	human	known	69_37n	missense	82	12.77	12	SNP	0.016	T
MCM9	254394	genome.wustl.edu	37	6	119136278	119136278	+	Silent	SNP	G	G	A	rs148762612	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr6:119136278G>A	ENST00000316316.6	-	13	3427	c.3141C>T	c.(3139-3141)agC>agT	p.S1047S		NM_017696.2	NP_060166.2	Q9NXL9	MCM9_HUMAN	minichromosome maintenance complex component 9	1047					cellular response to DNA damage stimulus (GO:0006974)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|female gamete generation (GO:0007292)	MCM8-MCM9 complex (GO:0097362)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		all_cancers(87;0.122)|all_epithelial(87;0.179)		GBM - Glioblastoma multiforme(226;0.0676)|OV - Ovarian serous cystadenocarcinoma(136;0.194)		GAACCTTGCCGCTTTTATTAC	0.468													G|||	3	0.000599042	0.0023	0.0	5008	,	,		20865	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC031658	CCDS5121.1, CCDS56447.1	6q22.31	2009-11-16	2007-04-04	2007-04-04	ENSG00000111877	ENSG00000111877			21484	protein-coding gene	gene with protein product		610098	"""minichromosome maintenance deficient domain containing 1"", ""chromosome 6 open reading frame 61"""	MCMDC1, C6orf61		16226853, 15850810, 16495042	Standard	NM_153255		Approved	MGC35304, dJ329L24.3, FLJ20170	uc021zeh.1	Q9NXL9	OTTHUMG00000015468	ENST00000316316.6:c.3141C>T	6.37:g.119136278G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR30|B9DI77|Q2KHJ0|Q8N5S5|Q9HCV5	Silent	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase	p.S1047	ENST00000316316.6	37	c.3141	CCDS56447.1	6																																																																																			MCM9	-	NULL	ENSG00000111877		0.468	MCM9-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM9	HGNC	protein_coding	OTTHUMT00000042005.4	64	0.00	0	G	NM_153255		119136278	119136278	-1	no_errors	ENST00000316316	ensembl	human	known	69_37n	silent	36	21.74	10	SNP	0.002	A
NDNF	79625	genome.wustl.edu	37	4	121961158	121961158	+	Silent	SNP	C	C	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr4:121961158C>T	ENST00000379692.4	-	3	766	c.240G>A	c.(238-240)acG>acA	p.T80T	NDNF_ENST00000506900.1_5'Flank	NM_024574.3	NP_078850.3	Q8TB73	NDNF_HUMAN	neuron-derived neurotrophic factor	80					cell growth (GO:0016049)|extracellular matrix organization (GO:0030198)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of neuron projection development (GO:0010976)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(3)|skin(1)|urinary_tract(1)	29						CATCACAGGGCGTCACTGTGA	0.507																																						dbGAP											0													100.0	99.0	99.0					4																	121961158		1919	4134	6053	-	-	-	SO:0001819	synonymous_variant	0			BC019351	CCDS3717.2	4q27	2011-07-05	2011-07-05	2011-07-05	ENSG00000173376	ENSG00000173376			26256	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 31"""	C4orf31		12975309, 20969804	Standard	NM_024574		Approved	FLJ23191	uc003idq.1	Q8TB73	OTTHUMG00000132973	ENST00000379692.4:c.240G>A	4.37:g.121961158C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Q0|Q6UWE5|Q9H5P7	Silent	SNP	pfam_DUF2369,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.T80	ENST00000379692.4	37	c.240	CCDS3717.2	4																																																																																			NDNF	-	NULL	ENSG00000173376		0.507	NDNF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDNF	HGNC	protein_coding	OTTHUMT00000256532.2	64	0.00	0	C	NM_024574		121961158	121961158	-1	no_errors	ENST00000379692	ensembl	human	known	69_37n	silent	36	21.74	10	SNP	0.013	T
OR52E8	390079	genome.wustl.edu	37	11	5878438	5878438	+	Silent	SNP	C	C	A	rs187030668		TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr11:5878438C>A	ENST00000537935.1	-	1	526	c.495G>T	c.(493-495)ctG>ctT	p.L165L	TRIM5_ENST00000380027.1_Intron	NM_001005168.1	NP_001005168.1	Q6IFG1	O52E8_HUMAN	olfactory receptor, family 52, subfamily E, member 8	165						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(3)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.114)		Epithelial(150;2.37e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGAGAAACACCAGTGGAACAA	0.517																																						dbGAP											0													124.0	133.0	130.0					11																	5878438		2151	4296	6447	-	-	-	SO:0001819	synonymous_variant	0			BK004301	CCDS31400.1	11p15.4	2012-08-09	2003-12-15		ENSG00000183269	ENSG00000183269		"""GPCR / Class A : Olfactory receptors"""	15217	protein-coding gene	gene with protein product			"""olfactory receptor, family 52, subfamily E, member 8 pseudogene"""				Standard	NM_001005168		Approved		uc010qzr.2	Q6IFG1	OTTHUMG00000168803	ENST00000537935.1:c.495G>T	11.37:g.5878438C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH38	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L165	ENST00000537935.1	37	c.495	CCDS31400.1	11																																																																																			OR52E8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183269		0.517	OR52E8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E8	HGNC	protein_coding	OTTHUMT00000401145.1	54	0.00	0	C	NM_001005168		5878438	5878438	-1	no_errors	ENST00000537935	ensembl	human	known	69_37n	silent	19	54.76	23	SNP	0.000	A
PGF	5228	genome.wustl.edu	37	14	75409429	75409429	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr14:75409429C>T	ENST00000405431.2	-	7	645	c.646G>A	c.(646-648)Gat>Aat	p.D216N	PGF_ENST00000555567.1_Missense_Mutation_p.D165N|PGF_ENST00000238607.6_Missense_Mutation_p.D164N|PGF_ENST00000553716.1_Missense_Mutation_p.D144N			P49763	PLGF_HUMAN	placental growth factor	216					branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|regulation of morphogenesis of a branching structure (GO:0060688)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.00668)	Aflibercept(DB08885)	GGAACAGCATCGCCGCACCTG	0.622																																					GBM(127;389 2301 5452 48547)	dbGAP											0													45.0	43.0	44.0					14																	75409429		2203	4299	6502	-	-	-	SO:0001583	missense	0			S72960	CCDS9835.1, CCDS55932.1, CCDS73664.1	14q24.3	2013-02-18	2008-03-20		ENSG00000119630	ENSG00000119630			8893	protein-coding gene	gene with protein product	"""placenta growth factor"""	601121	"""placental growth factor-like"", ""placental growth factor, vascular endothelial growth factor-related protein"""	PGFL		7681160	Standard	NM_002632		Approved	PLGF, PlGF-2, PlGF, SHGC-10760, D12S1900	uc001xqz.3	P49763	OTTHUMG00000171496	ENST00000405431.2:c.646G>A	14.37:g.75409429C>T	ENSP00000385365:p.Asp216Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q07101|Q9BV78|Q9Y6S8	Missense_Mutation	SNP	pfam_PD_growth_factor,smart_PD_growth_factor,pfscan_PD_growth_factor	p.D216N	ENST00000405431.2	37	c.646	CCDS9835.1	14	.	.	.	.	.	.	.	.	.	.	C	12.10	1.837111	0.32513	.	.	ENSG00000119630	ENST00000555567;ENST00000553716;ENST00000238607;ENST00000405431	.	.	.	5.2	-0.336	0.12658	.	0.782790	0.11644	N	0.543511	T	0.23054	0.0557	N	0.19112	0.55	0.09310	N	1	B;B;B	0.13145	0.001;0.007;0.004	B;B;B	0.06405	0.001;0.002;0.001	T	0.17198	-1.0377	9	0.30854	T	0.27	.	5.5115	0.16884	0.0:0.505:0.2709:0.2241	.	144;164;165	P49763-2;G3XA84;Q53XY6	.;.;.	N	165;144;164;216	.	ENSP00000238607:D165N	D	-	1	0	PGF	74479182	0.000000	0.05858	0.000000	0.03702	0.956000	0.61745	0.033000	0.13754	-0.341000	0.08376	0.655000	0.94253	GAT	PGF	-	NULL	ENSG00000119630		0.622	PGF-008	KNOWN	basic|CCDS	protein_coding	PGF	HGNC	protein_coding	OTTHUMT00000414064.1	42	0.00	0	C	NM_002632		75409429	75409429	-1	no_errors	ENST00000405431	ensembl	human	known	69_37n	missense	10	47.37	9	SNP	0.000	T
PRKCA	5578	genome.wustl.edu	37	17	64800107	64800107	+	Silent	SNP	G	G	A	rs370194549	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr17:64800107G>A	ENST00000413366.3	+	17	1997	c.1971G>A	c.(1969-1971)tcG>tcA	p.S657S		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	657	AGC-kinase C-terminal.				activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	AAGGGTTCTCGTATGTCAACC	0.512													G|||	10	0.00199681	0.0	0.0	5008	,	,		17340	0.0		0.0	False		,,,				2504	0.0102					dbGAP											0													152.0	127.0	136.0					17																	64800107		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.1971G>A	17.37:g.64800107G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5BU22|Q15137|Q32M72|Q96RE4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_C2_dom	p.S657	ENST00000413366.3	37	c.1971	CCDS11664.1	17																																																																																			PRKCA	-	pfam_Pkinase_C,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g	ENSG00000154229		0.512	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCA	HGNC	protein_coding	OTTHUMT00000446976.1	66	0.00	0	G			64800107	64800107	+1	no_errors	ENST00000413366	ensembl	human	known	69_37n	silent	69	10.39	8	SNP	0.667	A
PSORS1C1	170679	genome.wustl.edu	37	6	31083664	31083664	+	Intron	SNP	G	G	A	rs1042134	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr6:31083664G>A	ENST00000259881.9	+	1	61				CDSN_ENST00000376288.2_3'UTR|PSORS1C1_ENST00000467107.1_3'UTR	NM_014068.2	NP_054787.2	Q9UIG5	PS1C1_HUMAN	psoriasis susceptibility 1 candidate 1											kidney(1)|ovary(2)|prostate(1)|skin(1)	5						TTGGGGTAGTGGAGAAAGCAG	0.468													G|||	3240	0.646965	0.7065	0.6138	5008	,	,		20460	0.7113		0.5487	False		,,,				2504	0.6247					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB031479	CCDS34390.1	6p21.3	2014-01-28	2003-06-12		ENSG00000204540	ENSG00000204540			17202	protein-coding gene	gene with protein product		613525	"""chromosome 6 open reading frame 16"""	C6orf16			Standard	NM_014068		Approved	SEEK1	uc003nsl.2	Q9UIG5	OTTHUMG00000031077	ENST00000259881.9:c.-229+996G>A	6.37:g.31083664G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0V083|Q5ST21|Q86WJ8|Q86WJ9|Q96QC3	RNA	SNP	-	NULL	ENST00000259881.9	37	NULL	CCDS34390.1	6																																																																																			PSORS1C1	-	-	ENSG00000204540		0.468	PSORS1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSORS1C1	HGNC	protein_coding	OTTHUMT00000076110.3	87	0.00	0	G	NM_014068		31083664	31083664	+1	no_errors	ENST00000467107	ensembl	human	known	69_37n	rna	40	11.11	5	SNP	0.000	A
RYR2	6262	genome.wustl.edu	37	1	237924277	237924277	+	Nonsense_Mutation	SNP	G	G	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr1:237924277G>T	ENST00000366574.2	+	84	11742	c.11425G>T	c.(11425-11427)Gag>Tag	p.E3809*	RYR2_ENST00000360064.6_Nonsense_Mutation_p.E3815*|RYR2_ENST00000542537.1_Nonsense_Mutation_p.E3793*|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3809					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAATGCATTTGAGCGACAAAA	0.393																																						dbGAP											0													106.0	98.0	100.0					1																	237924277		1862	4102	5964	-	-	-	SO:0001587	stop_gained	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11425G>T	1.37:g.237924277G>T	ENSP00000355533:p.Glu3809*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E3815*	ENST00000366574.2	37	c.11443	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	53	21.523485	0.99941	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	.	.	.	5.84	5.84	0.93424	.	0.000000	0.64402	U	0.000008	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.1336	0.98010	0.0:0.0:1.0:0.0	.	.	.	.	X	3809;3815;3793;783	.	ENSP00000353174:E3815X	E	+	1	0	RYR2	235990900	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.537000	0.98070	2.767000	0.95098	0.591000	0.81541	GAG	RYR2	-	NULL	ENSG00000198626		0.393	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	81	0.00	0	G	NM_001035		237924277	237924277	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	nonsense	83	19.42	20	SNP	1.000	T
SECISBP2L	9728	genome.wustl.edu	37	15	49292062	49292062	+	Missense_Mutation	SNP	C	C	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr15:49292062C>A	ENST00000559471.1	-	16	2634	c.2371G>T	c.(2371-2373)Gta>Tta	p.V791L	SECISBP2L_ENST00000559122.1_5'Flank|SECISBP2L_ENST00000261847.3_Missense_Mutation_p.V746L	NM_001193489.1	NP_001180418.1	Q93073	SBP2L_HUMAN	SECIS binding protein 2-like	791							poly(A) RNA binding (GO:0044822)	p.V746I(1)		breast(1)|endometrium(5)|kidney(8)|large_intestine(12)|lung(11)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|urinary_tract(1)	46						ATTCCCACTACGCTAACAGGA	0.448																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											127.0	104.0	112.0					15																	49292062		2197	4295	6492	-	-	-	SO:0001583	missense	0			BC033001	CCDS32234.1, CCDS53942.1	15q21.1	2014-02-12				ENSG00000138593			28997	protein-coding gene	gene with protein product		615756					Standard	NM_001193489		Approved	KIAA0256	uc001zxe.2	Q93073		ENST00000559471.1:c.2371G>T	15.37:g.49292062C>A	ENSP00000453854:p.Val791Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N767	Missense_Mutation	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.V791L	ENST00000559471.1	37	c.2371	CCDS53942.1	15	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847512	0.91277	.	.	ENSG00000138593	ENST00000261847;ENST00000380927	T	0.58940	0.3	5.06	5.06	0.68205	Ribosomal protein L7Ae/L30e/S12e/Gadd45 (1);	0.000000	0.85682	D	0.000000	T	0.66645	0.2810	L	0.35644	1.08	0.45648	D	0.998571	D;D	0.62365	0.991;0.988	P;P	0.61592	0.891;0.773	T	0.69551	-0.5115	10	0.72032	D	0.01	.	18.6234	0.91328	0.0:1.0:0.0:0.0	.	791;746	Q93073;Q93073-2	SBP2L_HUMAN;.	L	746;791	ENSP00000261847:V746L	ENSP00000261847:V746L	V	-	1	0	SECISBP2L	47079354	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.774000	0.68906	2.629000	0.89072	0.650000	0.86243	GTA	SECISBP2L	-	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	ENSG00000138593		0.448	SECISBP2L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SECISBP2L	HGNC	protein_coding	OTTHUMT00000417277.1	100	0.00	0	C	NM_014701		49292062	49292062	-1	no_errors	ENST00000559471	ensembl	human	known	69_37n	missense	48	29.41	20	SNP	1.000	A
SPSB3	90864	genome.wustl.edu	37	16	1827832	1827832	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr16:1827832G>A	ENST00000566339.1	-	6	967	c.637C>T	c.(637-639)Cgg>Tgg	p.R213W	SPSB3_ENST00000301717.4_Missense_Mutation_p.R213W	NM_080861.3	NP_543137.2	Q6PJ21	SPSB3_HUMAN	splA/ryanodine receptor domain and SOCS box containing 3	213	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					endometrium(1)|kidney(4)|lung(3)|prostate(2)	10						TGGCCGAACCGCGATGAGAAG	0.652																																						dbGAP											0													62.0	59.0	60.0					16																	1827832		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS32365.1	16p13.3	2008-02-05				ENSG00000162032			30629	protein-coding gene	gene with protein product		611659	"""chromosome 16 open reading frame 31"""	C16orf31		12076535	Standard	NM_080861		Approved	SSB-3	uc002cmu.3	Q6PJ21		ENST00000566339.1:c.637C>T	16.37:g.1827832G>A	ENSP00000457206:p.Arg213Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU78|Q49A96|Q86X18|Q8WXK5|Q96IE6|Q96RY2	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,smart_SOCS_C,pfscan_B30.2/SPRY,pfscan_SOCS_C	p.R213W	ENST00000566339.1	37	c.637	CCDS32365.1	16	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217489	0.58560	.	.	ENSG00000162032	ENST00000301717	T	0.69561	-0.41	4.33	-2.89	0.05665	Concanavalin A-like lectin/glucanase (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	T	0.75228	0.3821	L	0.54323	1.7	0.43283	D	0.995253	D	0.89917	1.0	D	0.83275	0.996	T	0.72818	-0.4178	10	0.72032	D	0.01	-44.3351	16.0229	0.80512	0.0:0.0:0.2627:0.7373	.	213	Q6PJ21	SPSB3_HUMAN	W	213	ENSP00000301717:R213W	ENSP00000301717:R213W	R	-	1	2	SPSB3	1767833	0.001000	0.12720	0.000000	0.03702	0.696000	0.40369	-0.351000	0.07711	-1.300000	0.02341	-0.410000	0.06199	CGG	SPSB3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000162032		0.652	SPSB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPSB3	HGNC	protein_coding	OTTHUMT00000433512.1	122	0.00	0	G	NM_080861		1827832	1827832	-1	no_errors	ENST00000301717	ensembl	human	known	69_37n	missense	95	15.18	17	SNP	0.239	A
SLC5A2	6524	genome.wustl.edu	37	16	31498700	31498700	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr16:31498700G>A	ENST00000330498.3	+	6	653	c.634G>A	c.(634-636)Gcc>Acc	p.A212T	AC026471.6_ENST00000565137.1_RNA	NM_003041.3	NP_003032.1	P31639	SC5A2_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 2	212					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	low-affinity glucose:sodium symporter activity (GO:0005362)			endometrium(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|urinary_tract(1)	25					Canagliflozin(DB08907)|Dapagliflozin(DB06292)	TCTGGGGGGCGCCTGCATCCT	0.687																																						dbGAP											0													96.0	106.0	102.0					16																	31498700		2196	4300	6496	-	-	-	SO:0001583	missense	0				CCDS10714.1	16p11.2	2013-05-22			ENSG00000140675	ENSG00000140675		"""Solute carriers"""	11037	protein-coding gene	gene with protein product		182381		SGLT2		8244402	Standard	NM_003041		Approved		uc002ecf.4	P31639	OTTHUMG00000176620	ENST00000330498.3:c.634G>A	16.37:g.31498700G>A	ENSP00000327943:p.Ala212Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRD2	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.A212T	ENST00000330498.3	37	c.634	CCDS10714.1	16	.	.	.	.	.	.	.	.	.	.	G	16.41	3.116679	0.56505	.	.	ENSG00000140675	ENST00000330498;ENST00000419665	D;D	0.87966	-2.32;-2.32	4.24	2.25	0.28309	.	0.292391	0.31519	N	0.007516	D	0.91988	0.7462	M	0.73372	2.23	0.48087	D	0.999582	D	0.89917	1.0	D	0.91635	0.999	D	0.90708	0.4625	10	0.54805	T	0.06	.	13.7404	0.62845	0.0:0.0:0.7731:0.2269	.	212	P31639	SC5A2_HUMAN	T	212	ENSP00000327943:A212T;ENSP00000410601:A212T	ENSP00000327943:A212T	A	+	1	0	SLC5A2	31406201	0.967000	0.33354	0.368000	0.25939	0.287000	0.27160	1.592000	0.36676	0.099000	0.17552	-2.017000	0.00434	GCC	SLC5A2	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000140675		0.687	SLC5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A2	HGNC	protein_coding	OTTHUMT00000255627.2	122	0.00	0	G			31498700	31498700	+1	no_errors	ENST00000330498	ensembl	human	known	69_37n	missense	49	52.43	54	SNP	0.955	A
SRSF11	9295	genome.wustl.edu	37	1	70696867	70696867	+	Intron	DEL	T	T	-			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr1:70696867delT	ENST00000370950.3	+	4	419				SRSF11_ENST00000454435.2_3'UTR|SRSF11_ENST00000484162.1_3'UTR|SRSF11_ENST00000370951.1_Intron|SRSF11_ENST00000436161.2_Intron|SRSF11_ENST00000405432.1_Intron|SRSF11_ENST00000370949.1_5'Flank			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						CCAGTTTCTCTTAAGTGCCCT	0.358																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.338-1084T>-	1.37:g.70696867delT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T758|Q8IWE6	RNA	DEL	-	NULL	ENST00000370950.3	37	NULL	CCDS647.1	1																																																																																			SRSF11	-	-	ENSG00000116754		0.358	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRSF11	HGNC	protein_coding	OTTHUMT00000025889.1	61	0.00	0	T	NM_004768		70696867	70696867	+1	no_errors	ENST00000463116	ensembl	human	known	69_37n	rna	16	11.11	2	DEL	1.000	-
PMS2P4	5382	genome.wustl.edu	37	7	66767682	66767682	+	RNA	SNP	C	C	G			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr7:66767682C>G	ENST00000414507.1	-	0	0				STAG3L4_ENST00000416602.2_RNA					postmeiotic segregation increased 2 pseudogene 4																		TAGCCTCGGACGGTTTCTGAG	0.587																																						dbGAP											0																																										-	-	-			0			D38438		7q11.22	2010-10-26	2010-10-26	2010-10-26	ENSG00000067601	ENSG00000067601			9129	pseudogene	pseudogene	"""PMS2 pseudogene"""		"""postmeiotic segregation increased 2-like 4"", ""postmeiotic segregation increased 2-like 4 pseudogene"""	PMS2L4		8586419	Standard	NR_046297		Approved	PMS6	uc003tvo.3		OTTHUMG00000156923		7.37:g.66767682C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000414507.1	37	NULL		7																																																																																			STAG3L4	-	-	ENSG00000106610		0.587	PMS2P4-002	KNOWN	basic	processed_transcript	STAG3L4	HGNC	pseudogene	OTTHUMT00000346632.1	119	0.00	0	C	NR_022007		66767682	66767682	+1	no_errors	ENST00000416602	ensembl	human	known	69_37n	rna	27	50.91	28	SNP	0.005	G
SSPO	23145	genome.wustl.edu	37	7	149482039	149482039	+	RNA	SNP	G	G	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr7:149482039G>A	ENST00000378016.2	+	0	2827							A2VEC9	SSPO_HUMAN	SCO-spondin						cell adhesion (GO:0007155)	extracellular space (GO:0005615)	peptidase inhibitor activity (GO:0030414)					Melanoma(164;0.165)|Ovarian(565;0.177)		OV - Ovarian serous cystadenocarcinoma(82;0.00625)			CAGCCCCAGCGCCAATCACTC	0.627																																						dbGAP											0													32.0	35.0	34.0					7																	149482039		2026	4190	6216	-	-	-			0			AK093431		7q36.1	2013-08-07	2013-08-06		ENSG00000197558	ENSG00000197558			21998	protein-coding gene	gene with protein product	"""subcommissural organ spondin"", ""SCO protein, thrombospondin domain containing"""		"""SCO-spondin homolog (Bos taurus)"""			8743952, 11008217	Standard	NM_198455		Approved	SCO-spondin, KIAA0543, FLJ36112	uc010lpk.3	A2VEC9	OTTHUMG00000157884		7.37:g.149482039G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76B61	RNA	SNP	-	NULL	ENST00000378016.2	37	NULL		7																																																																																			SSPO	-	-	ENSG00000197558		0.627	SSPO-202	KNOWN	basic	processed_transcript	SSPO	HGNC	processed_transcript		66	0.00	0	G			149482039	149482039	+1	no_errors	ENST00000262089	ensembl	human	known	69_37n	rna	23	23.33	7	SNP	0.001	A
TGM5	9333	genome.wustl.edu	37	15	43525787	43525787	+	Frame_Shift_Del	DEL	T	T	-			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr15:43525787delT	ENST00000220420.5	-	12	1981	c.1974delA	c.(1972-1974)gaafs	p.E658fs	TGM5_ENST00000349114.4_Frame_Shift_Del_p.E576fs	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	658					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GGCCACTTCCTTCCACAGTCA	0.507																																						dbGAP											0													114.0	112.0	113.0					15																	43525787		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1974delA	15.37:g.43525787delT	ENSP00000220420:p.Glu658fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O43549|Q0VF40|Q9UEZ4	Frame_Shift_Del	DEL	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.G659fs	ENST00000220420.5	37	c.1974	CCDS32212.1	15																																																																																			TGM5	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000104055		0.507	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	HGNC	protein_coding	OTTHUMT00000432257.1	59	0.00	0	T	NM_004245		43525787	43525787	-1	no_errors	ENST00000220420	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	1.000	-
TLR10	81793	genome.wustl.edu	37	4	38775165	38775165	+	Missense_Mutation	SNP	C	C	T			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr4:38775165C>T	ENST00000308973.4	-	4	2652	c.2047G>A	c.(2047-2049)Gta>Ata	p.V683I	TLR10_ENST00000508334.1_Missense_Mutation_p.V683I|TLR10_ENST00000506111.1_Missense_Mutation_p.V683I|TLR10_ENST00000361424.2_Missense_Mutation_p.V683I|TLR10_ENST00000507953.1_5'Flank	NM_001017388.2|NM_001195107.1|NM_030956.3	NP_001017388.1|NP_001182036.1|NP_112218.2	Q9BXR5	TLR10_HUMAN	toll-like receptor 10	683	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of inflammatory response (GO:0050729)|regulation of cytokine secretion (GO:0050707)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor signaling pathway (GO:0002224)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(11)|prostate(1)|urinary_tract(2)	25						ATGAAGCTTACAATATTTTCA	0.378																																						dbGAP											0													109.0	110.0	109.0					4																	38775165		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF296673	CCDS3445.1	4p14	2009-11-23			ENSG00000174123	ENSG00000174123		"""CD molecules"""	15634	protein-coding gene	gene with protein product		606270				11267672	Standard	NM_030956		Approved	CD290	uc003gtk.3	Q9BXR5	OTTHUMG00000128578	ENST00000308973.4:c.2047G>A	4.37:g.38775165C>T	ENSP00000308925:p.Val683Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7L1|B3Y668|D1CS21|D1CS22|Q32MI7|Q32MI8|Q5FWG4|Q6UXL3	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.V683I	ENST00000308973.4	37	c.2047	CCDS3445.1	4	.	.	.	.	.	.	.	.	.	.	C	0	-2.718587	0.00093	.	.	ENSG00000174123	ENST00000308973;ENST00000506111;ENST00000361424;ENST00000508334	T;T;T;T	0.08282	3.11;3.11;3.11;3.11	5.56	1.81	0.25067	Toll/interleukin-1 receptor homology (TIR) domain (4);	0.493474	0.16294	N	0.220773	T	0.01730	0.0055	N	0.00510	-1.415	0.24723	N	0.993137	B	0.02656	0.0	B	0.01281	0.0	T	0.45731	-0.9241	10	0.02654	T	1	.	6.3028	0.21121	0.0:0.1417:0.1341:0.7242	.	683	Q9BXR5	TLR10_HUMAN	I	683	ENSP00000308925:V683I;ENSP00000421483:V683I;ENSP00000354459:V683I;ENSP00000424923:V683I	ENSP00000308925:V683I	V	-	1	0	TLR10	38451560	1.000000	0.71417	0.009000	0.14445	0.024000	0.10985	1.297000	0.33400	0.081000	0.16988	-0.312000	0.09012	GTA	TLR10	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom	ENSG00000174123		0.378	TLR10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR10	HGNC	protein_coding	OTTHUMT00000250430.1	91	0.00	0	C			38775165	38775165	-1	no_errors	ENST00000308973	ensembl	human	known	69_37n	missense	56	38.04	35	SNP	0.901	T
LINC00854	100874261	genome.wustl.edu	37	17	41375597	41375597	+	RNA	SNP	A	A	G	rs1133320	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr17:41375597A>G	ENST00000433702.2	-	0	780				LINC00854_ENST00000593624.1_RNA|LINC00854_ENST00000598934.1_RNA|LINC00854_ENST00000595400.1_RNA|LINC00854_ENST00000427995.1_RNA|LINC00854_ENST00000600764.1_RNA|LINC00854_ENST00000598568.1_RNA|LINC00854_ENST00000599491.1_RNA|LINC00854_ENST00000597948.1_RNA|LINC00854_ENST00000608223.1_RNA|LINC00854_ENST00000594691.1_RNA|LINC00854_ENST00000598128.1_RNA	NR_047479.1				long intergenic non-protein coding RNA 854																		GTGAATACCCAGTGTTTCTGA	0.453													A|||	1766	0.352636	0.2133	0.3732	5008	,	,		18551	0.37		0.3608	False		,,,				2504	0.5					dbGAP											0																																										-	-	-			0					17q21.31	2013-02-13	2013-02-13	2013-02-13	ENSG00000236383	ENSG00000236383		"""Long non-coding RNAs"""	43658	non-coding RNA	RNA, long non-coding			"""TMEM106A antisense RNA 1 (non-protein coding)"", ""TMEM106A antisense RNA 1"", ""TMEM106A antisense RNA 1 (tail to tail)"""	TMEM106A-AS1		22196729	Standard	NR_047479		Approved		uc031ras.1		OTTHUMG00000132641		17.37:g.41375597A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000433702.2	37	NULL		17																																																																																			TMEM106A-AS1	-	-	ENSG00000236383		0.453	LINC00854-001	KNOWN	basic	antisense	TMEM106A-AS1	HGNC	processed_transcript	OTTHUMT00000255889.2	42	0.00	0	A			41375597	41375597	-1	no_errors	ENST00000427995	ensembl	human	known	69_37n	rna	35	10.26	4	SNP	0.000	G
TRIO	7204	genome.wustl.edu	37	5	14358426	14358426	+	Missense_Mutation	SNP	A	A	G			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr5:14358426A>G	ENST00000344204.4	+	12	2210	c.2186A>G	c.(2185-2187)aAg>aGg	p.K729R	TRIO_ENST00000537187.1_Missense_Mutation_p.K729R|TRIO_ENST00000509967.2_Missense_Mutation_p.K680R	NM_007118.2	NP_009049.2	O75962	TRIO_HUMAN	trio Rho guanine nucleotide exchange factor	729					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	cytosol (GO:0005829)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(2)|breast(6)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(21)|lung(34)|ovary(4)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	118	Lung NSC(4;0.000742)					AACGTGATCAAGGAAGGGGAG	0.602																																						dbGAP											0													117.0	94.0	102.0					5																	14358426		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091395	CCDS3883.1	5p14-p15.1	2013-01-11	2012-07-12		ENSG00000038382	ENSG00000038382		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"""	12303	protein-coding gene	gene with protein product		601893	"""triple functional domain (PTPRF interacting)"""			8643598	Standard	NM_007118		Approved	ARHGEF23	uc003jff.3	O75962	OTTHUMG00000131057	ENST00000344204.4:c.2186A>G	5.37:g.14358426A>G	ENSP00000339299:p.Lys729Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTD1|Q13458|Q59EQ7|Q6PJC9|Q6ZN05|Q8IWK8	Missense_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,superfamily_Capsid/spike_ssDNA_virus,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.K729R	ENST00000344204.4	37	c.2186	CCDS3883.1	5	.	.	.	.	.	.	.	.	.	.	A	16.99	3.274866	0.59649	.	.	ENSG00000038382	ENST00000344204;ENST00000537187;ENST00000509967;ENST00000513206	T;T;T	0.44083	0.93;0.93;0.93	4.62	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.46852	0.1414	N	0.19112	0.55	0.58432	D	0.999998	P;D;D	0.69078	0.712;0.997;0.993	P;D;D	0.72338	0.493;0.977;0.971	T	0.37888	-0.9686	10	0.25751	T	0.34	.	14.3077	0.66395	1.0:0.0:0.0:0.0	.	680;729;729	F5H228;O75962-5;O75962	.;.;TRIO_HUMAN	R	729;729;680;416	ENSP00000339299:K729R;ENSP00000446348:K729R;ENSP00000445592:K680R	ENSP00000339299:K729R	K	+	2	0	TRIO	14411426	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.172000	0.94808	1.847000	0.53656	0.402000	0.26972	AAG	TRIO	-	smart_Spectrin/alpha-actinin	ENSG00000038382		0.602	TRIO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIO	HGNC	protein_coding	OTTHUMT00000253711.2	100	0.00	0	A	NM_007118		14358426	14358426	+1	no_errors	ENST00000344204	ensembl	human	known	69_37n	missense	48	28.36	19	SNP	1.000	G
ZC3HAV1	56829	genome.wustl.edu	37	7	138764884	138764884	+	Missense_Mutation	SNP	G	G	A			TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr7:138764884G>A	ENST00000242351.5	-	4	1119	c.803C>T	c.(802-804)gCt>gTt	p.A268V	ZC3HAV1_ENST00000464606.1_Missense_Mutation_p.A268V|ZC3HAV1_ENST00000471652.1_Missense_Mutation_p.A268V	NM_020119.3	NP_064504.2	Q7Z2W4	ZCCHV_HUMAN	zinc finger CCCH-type, antiviral 1	268					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral genome replication (GO:0045071)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of mRNA catabolic process (GO:0061014)|positive regulation of RIG-I signaling pathway (GO:1900246)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|prostate(4)|skin(1)	37						GGACCTCTCAGCAGACGCTGA	0.537																																						dbGAP											0													129.0	135.0	133.0					7																	138764884		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX571742	CCDS5851.1, CCDS55171.1	7q34	2012-07-05			ENSG00000105939	ENSG00000105939		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	23721	protein-coding gene	gene with protein product	"""zinc finger antiviral protein"", "" CCCH-type zinc finger antiviral protein"""	607312				12215647, 12851707	Standard	NM_024625		Approved	ZAP, FLB6421, FLJ13288, MGC48898, ZC3HDC2, ZC3H2, PARP13	uc003vun.3	Q7Z2W4	OTTHUMG00000157471	ENST00000242351.5:c.803C>T	7.37:g.138764884G>A	ENSP00000242351:p.Ala268Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1R2|A4D1S4|Q8IW57|Q8TAJ3|Q96N79|Q9H8R9|Q9P0Y7	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.A268V	ENST00000242351.5	37	c.803	CCDS5851.1	7	.	.	.	.	.	.	.	.	.	.	G	10.47	1.357930	0.24598	.	.	ENSG00000105939	ENST00000242351;ENST00000464606;ENST00000471652;ENST00000540247	T;T;T	0.30448	1.53;1.53;1.53	3.78	-0.232	0.13082	.	1.383540	0.04729	N	0.420875	T	0.20861	0.0502	L	0.33485	1.01	0.09310	N	1	B;B	0.31548	0.328;0.028	B;B	0.31101	0.124;0.006	T	0.27938	-1.0059	10	0.59425	D	0.04	.	0.7169	0.00934	0.2293:0.1892:0.3877:0.1938	.	268;268	Q7Z2W4-2;Q7Z2W4	.;ZCCHV_HUMAN	V	268;268;268;28	ENSP00000242351:A268V;ENSP00000418385:A268V;ENSP00000419855:A268V	ENSP00000242351:A268V	A	-	2	0	ZC3HAV1	138415424	0.003000	0.15002	0.000000	0.03702	0.046000	0.14306	1.158000	0.31737	0.047000	0.15862	0.650000	0.86243	GCT	ZC3HAV1	-	NULL	ENSG00000105939		0.537	ZC3HAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3HAV1	HGNC	protein_coding	OTTHUMT00000348915.1	57	0.00	0	G	NM_020119		138764884	138764884	-1	no_errors	ENST00000242351	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.000	A
ZNF469	84627	genome.wustl.edu	37	16	88501034	88501034	+	Missense_Mutation	SNP	G	G	C	rs12598474	byFrequency	TCGA-E9-A5UP-01A-11D-A28B-09	TCGA-E9-A5UP-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0d061284-08ba-40a8-b786-cb5dd38568ae	ea5a960d-e0cb-4371-9ea6-7b93ddfe4275	g.chr16:88501034G>C	ENST00000437464.1	+	2	7072	c.7072G>C	c.(7072-7074)Ggg>Cgg	p.G2358R	ZNF469_ENST00000565624.1_Missense_Mutation_p.G2386R	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	2358			G -> R (in dbSNP:rs12598474). {ECO:0000269|PubMed:11347906}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.G2358R(1)		breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CCCTGAGACCGGGCGCTCTGG	0.662													g|||	1478	0.295128	0.2231	0.2997	5008	,	,		15260	0.377		0.3807	False		,,,				2504	0.2168					dbGAP											1	Substitution - Missense(1)	kidney(1)											27.0	36.0	33.0					16																	88501034		692	1590	2282	-	-	-	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.7072G>C	16.37:g.88501034G>C	ENSP00000402343:p.Gly2358Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G2358R	ENST00000437464.1	37	c.7072	CCDS45544.1	16	682	0.31227106227106227	104	0.21138211382113822	99	0.27348066298342544	195	0.3409090909090909	284	0.37467018469656993	g	7.137	0.581006	0.13686	.	.	ENSG00000225614	ENST00000437464	T	0.05513	3.43	3.66	-2.17	0.07059	.	.	.	.	.	T	0.00012	0.0000	N	0.12182	0.205	0.80722	P	0.0	B	0.32781	0.384	B	0.25884	0.064	T	0.47873	-0.9083	8	0.30078	T	0.28	.	4.2493	0.10686	0.4349:0.1731:0.392:0.0	rs12598474	2358	Q96JG9	ZN469_HUMAN	R	2358	ENSP00000402343:G2358R	ENSP00000402343:G2358R	G	+	1	0	ZNF469	87028535	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.132000	0.03235	-0.239000	0.09710	-0.320000	0.08662	GGG	ZNF469	-	NULL	ENSG00000225614		0.662	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		113	0.88	1	G	NG_012236		88501034	88501034	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	0.000	C
