#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS2	9509	genome.wustl.edu	37	5	178541264	178541264	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr5:178541264G>C	ENST00000251582.7	-	22	3341	c.3240C>G	c.(3238-3240)tgC>tgG	p.C1080W		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1080	PLAC. {ECO:0000255|PROSITE- ProRule:PRU00233}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CTGGGATGGAGCAATAGCGGG	0.507																																						dbGAP											0													97.0	79.0	85.0					5																	178541264		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3240C>G	5.37:g.178541264G>C	ENSP00000251582:p.Cys1080Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.C1080W	ENST00000251582.7	37	c.3240	CCDS4444.1	5	.	.	.	.	.	.	.	.	.	.	G	18.48	3.632933	0.67015	.	.	ENSG00000087116	ENST00000251582	T	0.79141	-1.24	5.39	3.59	0.41128	PLAC (1);	0.000000	0.64402	D	0.000007	D	0.85771	0.5774	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.86596	0.1863	10	0.87932	D	0	.	10.1972	0.43062	0.2192:0.0:0.7808:0.0	.	1080	O95450	ATS2_HUMAN	W	1080	ENSP00000251582:C1080W	ENSP00000251582:C1080W	C	-	3	2	ADAMTS2	178473870	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.090000	0.41682	1.422000	0.47177	0.561000	0.74099	TGC	ADAMTS2	-	pfscan_PLAC	ENSG00000087116		0.507	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	40	0.00	0	G	NM_014244		178541264	178541264	-1	no_errors	ENST00000251582	ensembl	human	known	69_37n	missense	56	35.23	31	SNP	1.000	C
ADNP	23394	genome.wustl.edu	37	20	49508731	49508731	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr20:49508731A>T	ENST00000396029.3	-	5	3087	c.2520T>A	c.(2518-2520)ttT>ttA	p.F840L	ADNP_ENST00000371602.4_Missense_Mutation_p.F840L|ADNP_ENST00000396032.3_Missense_Mutation_p.F840L|ADNP_ENST00000349014.3_Missense_Mutation_p.F840L	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	840					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						ACTCAGCATCAAAATCCATCT	0.403																																						dbGAP											0													121.0	120.0	120.0					20																	49508731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2520T>A	20.37:g.49508731A>T	ENSP00000379346:p.Phe840Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.F840L	ENST00000396029.3	37	c.2520	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	A	11.00	1.510186	0.27036	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.88	2.47	0.30058	.	0.000000	0.85682	D	0.000000	T	0.53578	0.1805	L	0.27053	0.805	0.43628	D	0.996014	D	0.63880	0.993	D	0.65443	0.935	T	0.49872	-0.8893	9	0.46703	T	0.11	-12.1082	9.1762	0.37114	0.7954:0.0:0.2046:0.0	.	840	Q9H2P0	ADNP_HUMAN	L	840	.	ENSP00000342905:F840L	F	-	3	2	ADNP	48942138	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.903000	0.48711	0.492000	0.27815	0.533000	0.62120	TTT	ADNP	-	NULL	ENSG00000101126		0.403	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	43	0.00	0	A	NM_181442		49508731	49508731	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	missense	134	11.26	17	SNP	1.000	T
ALDH1A1	216	genome.wustl.edu	37	9	75533709	75533709	+	Silent	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr9:75533709C>T	ENST00000297785.3	-	8	831	c.777G>A	c.(775-777)ggG>ggA	p.G259G	ALDH1A1_ENST00000376939.1_Intron	NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	259					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	GATTGCTTTTCCCGGCAGCTT	0.468																																						dbGAP											0													98.0	95.0	96.0					9																	75533709		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.777G>A	9.37:g.75533709C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00768|Q5SYR1	Silent	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	p.G259	ENST00000297785.3	37	c.777	CCDS6644.1	9																																																																																			ALDH1A1	-	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	ENSG00000165092		0.468	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	HGNC	protein_coding	OTTHUMT00000052679.1	30	0.00	0	C			75533709	75533709	-1	no_errors	ENST00000297785	ensembl	human	known	69_37n	silent	47	32.86	23	SNP	1.000	T
ARHGAP15	55843	genome.wustl.edu	37	2	143973974	143973974	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr2:143973974C>G	ENST00000295095.6	+	4	423	c.256C>G	c.(256-258)Ctg>Gtg	p.L86V	ARHGAP15_ENST00000409869.1_Missense_Mutation_p.L86V	NM_018460.3	NP_060930.3	Q53QZ3	RHG15_HUMAN	Rho GTPase activating protein 15	86	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)			endometrium(1)|kidney(5)|large_intestine(8)|liver(2)|lung(15)|ovary(1)|skin(2)	34				BRCA - Breast invasive adenocarcinoma(221;0.151)		AGAAGGTTATCTGCAAAAAGC	0.303																																						dbGAP											0													87.0	91.0	90.0					2																	143973974		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY219338	CCDS2184.1	2q22.2-q22.3	2013-01-10			ENSG00000075884	ENSG00000075884		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	21030	protein-coding gene	gene with protein product		610578				12650940, 11042152	Standard	NM_018460		Approved	BM046	uc002tvm.4	Q53QZ3	OTTHUMG00000131845	ENST00000295095.6:c.256C>G	2.37:g.143973974C>G	ENSP00000295095:p.Leu86Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R36|Q53RD7|Q53RT6|Q53SX9|Q584N9|Q6PJE6|Q86WP1|Q8IXX1|Q9NRL8|Q9NZ77|Q9NZ91	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.L86V	ENST00000295095.6	37	c.256	CCDS2184.1	2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.093089	0.76756	.	.	ENSG00000075884	ENST00000409869;ENST00000295095	D;D	0.92048	-1.59;-2.96	5.82	5.82	0.92795	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000001	D	0.95639	0.8582	M	0.78637	2.42	0.44395	D	0.997301	D;D	0.76494	0.999;0.971	D;D	0.69142	0.962;0.951	D	0.95376	0.8469	10	0.56958	D	0.05	.	15.6144	0.76753	0.0:1.0:0.0:0.0	.	86;86	B4E0R3;Q53QZ3	.;RHG15_HUMAN	V	86	ENSP00000386560:L86V;ENSP00000295095:L86V	ENSP00000295095:L86V	L	+	1	2	ARHGAP15	143690444	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.104000	0.57790	2.765000	0.95021	0.650000	0.86243	CTG	ARHGAP15	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000075884		0.303	ARHGAP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP15	HGNC	protein_coding	OTTHUMT00000254793.2	31	0.00	0	C	NM_018460		143973974	143973974	+1	no_errors	ENST00000295095	ensembl	human	known	69_37n	missense	84	32.26	40	SNP	1.000	G
ASAP3	55616	genome.wustl.edu	37	1	23765288	23765288	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:23765288G>T	ENST00000336689.3	-	12	1098	c.1054C>A	c.(1054-1056)Caa>Aaa	p.Q352K	ASAP3_ENST00000495646.1_5'Flank|ASAP3_ENST00000437606.2_Missense_Mutation_p.Q343K	NM_017707.3	NP_060177.2	Q8TDY4	ASAP3_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 3	352	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cell migration (GO:0016477)|positive regulation of ARF GTPase activity (GO:0032850)|regulation of stress fiber assembly (GO:0051492)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|ruffle (GO:0001726)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(8)|ovary(1)|skin(2)|urinary_tract(1)	24						GGCCTCACTTGGCACGTCAGC	0.582																																						dbGAP											0													105.0	102.0	103.0					1																	23765288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000206	CCDS235.1, CCDS44087.1	1p36.13	2013-01-10	2008-10-09	2008-09-22	ENSG00000088280	ENSG00000088280		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	14987	protein-coding gene	gene with protein product	"""centaurin, beta 6"""		"""development and differentiation enhancing factor-like 1"""	DDEFL1		14654939	Standard	NM_017707		Approved	FLJ20199, UPLC1, CENTB6	uc001bha.2	Q8TDY4	OTTHUMG00000003234	ENST00000336689.3:c.1054C>A	1.37:g.23765288G>T	ENSP00000338769:p.Gln352Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRW0|B4DHH4|Q6P9F4|Q86UY1|Q9NXK2	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,prints_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP	p.Q352K	ENST00000336689.3	37	c.1054	CCDS235.1	1	.	.	.	.	.	.	.	.	.	.	G	25.0	4.593059	0.86953	.	.	ENSG00000088280	ENST00000336689;ENST00000437606	T;T	0.75367	-0.93;-0.93	5.3	5.3	0.74995	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.64402	D	0.000001	D	0.84497	0.5485	L	0.57130	1.785	0.80722	D	1	P;D;P	0.55605	0.482;0.972;0.937	B;D;P	0.75484	0.33;0.986;0.814	D	0.85588	0.1244	10	0.87932	D	0	.	17.8889	0.88865	0.0:0.0:1.0:0.0	.	343;221;352	Q8TDY4-3;B4DRP2;Q8TDY4	.;.;ASAP3_HUMAN	K	352;343	ENSP00000338769:Q352K;ENSP00000408826:Q343K	ENSP00000338769:Q352K	Q	-	1	0	ASAP3	23637875	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.649000	0.89929	0.462000	0.41574	CAA	ASAP3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000088280		0.582	ASAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP3	HGNC	protein_coding	OTTHUMT00000008916.2	42	0.00	0	G	NM_017707		23765288	23765288	-1	no_errors	ENST00000336689	ensembl	human	known	69_37n	missense	67	36.79	39	SNP	1.000	T
ATP6V0A1	535	genome.wustl.edu	37	17	40653307	40653307	+	Silent	SNP	G	G	A	rs151155566		TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr17:40653307G>A	ENST00000343619.4	+	17	2112	c.1989G>A	c.(1987-1989)ttG>ttA	p.L663L	ATP6V0A1_ENST00000544137.1_Silent_p.L309L|ATP6V0A1_ENST00000537728.1_Silent_p.L620L|ATP6V0A1_ENST00000264649.6_Silent_p.L670L|ATP6V0A1_ENST00000585525.1_Silent_p.L620L|ATP6V0A1_ENST00000546249.1_Silent_p.L663L|ATP6V0A1_ENST00000393829.2_Silent_p.L663L	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1	663					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		GTCAGTATTTGAGGAGAAAGC	0.398																																						dbGAP											0													241.0	208.0	219.0					17																	40653307		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1989G>A	17.37:g.40653307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3B7|Q8N5G7|Q9NSX0	Missense_Mutation	SNP	pfam_ATPase_V0/A0_a	p.E79K	ENST00000343619.4	37	c.235	CCDS45684.1	17																																																																																			ATP6V0A1	-	pfam_ATPase_V0/A0_a	ENSG00000033627		0.398	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP6V0A1	HGNC	protein_coding	OTTHUMT00000450364.1	114	0.00	0	G	NM_001130020		40653307	40653307	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000587510	ensembl	human	known	69_37n	missense	238	27.88	92	SNP	1.000	A
CMSS1	84319	genome.wustl.edu	37	3	99886581	99886581	+	Splice_Site	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr3:99886581G>A	ENST00000421999.2	+	6	561		c.e6-1		CMSS1_ENST00000489081.1_Splice_Site	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)								poly(A) RNA binding (GO:0044822)										CTTTTTTCCAGTTTGTCCTAA	0.418																																						dbGAP											0													153.0	158.0	156.0					3																	99886581		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.416-1G>A	3.37:g.99886581G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5S7|B4DUM1|E9PHS3	Splice_Site	SNP	-	e6-1	ENST00000421999.2	37	c.416-1	CCDS2935.1	3	.	.	.	.	.	.	.	.	.	.	G	14.07	2.426622	0.43020	.	.	ENSG00000184220	ENST00000421999;ENST00000489081;ENST00000478909;ENST00000497345	.	.	.	5.62	5.62	0.85841	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2327	0.89939	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C3orf26	101369271	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	8.201000	0.89735	2.642000	0.89623	0.655000	0.94253	.	C3orf26	-	-	ENSG00000184220		0.418	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf26	HGNC	protein_coding	OTTHUMT00000353060.1	86	0.00	0	G	NM_032359	Intron	99886581	99886581	+1	no_errors	ENST00000421999	ensembl	human	known	69_37n	splice_site	165	29.18	68	SNP	1.000	A
CASR	846	genome.wustl.edu	37	3	122003458	122003458	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr3:122003458G>A	ENST00000490131.1	+	7	3029	c.2657G>A	c.(2656-2658)cGg>cAg	p.R886Q	AC068754.1_ENST00000408547.1_RNA|CASR_ENST00000498619.1_Missense_Mutation_p.R896Q|CASR_ENST00000296154.5_Missense_Mutation_p.R886Q	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	886	Interaction with RNF19A.		R -> W (in HHC1). {ECO:0000269|PubMed:17698911}.		anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GTGGCTGCCCGGGCCACGCTG	0.612																																						dbGAP											0			GRCh37	CM021965	CASR	M							32.0	33.0	33.0					3																	122003458		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2657G>A	3.37:g.122003458G>A	ENSP00000418685:p.Arg886Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.R896Q	ENST00000490131.1	37	c.2687	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	G	20.9	4.072699	0.76415	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89050	-2.46;-2.46;-2.46	5.89	5.89	0.94794	.	0.053112	0.64402	D	0.000001	D	0.84056	0.5388	L	0.27053	0.805	0.45129	D	0.99814	D;D	0.54772	0.968;0.968	B;B	0.40782	0.34;0.227	D	0.86101	0.1556	10	0.59425	D	0.04	.	19.2448	0.93898	0.0:0.0:1.0:0.0	.	896;886	E7ENE0;P41180	.;CASR_HUMAN	Q	886;896;886	ENSP00000418685:R886Q;ENSP00000420194:R896Q;ENSP00000296154:R886Q	ENSP00000296154:R886Q	R	+	2	0	CASR	123486148	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.437000	0.80417	2.793000	0.96121	0.561000	0.74099	CGG	CASR	-	NULL	ENSG00000036828		0.612	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	18	0.00	0	G	NM_000388		122003458	122003458	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	A
CBFB	865	genome.wustl.edu	37	16	67070624	67070624	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr16:67070624G>T	ENST00000290858.6	+	3	509	c.248G>T	c.(247-249)cGa>cTa	p.R83L	CBFB_ENST00000412916.2_Missense_Mutation_p.R83L|CBFB_ENST00000561924.2_5'UTR	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit	83					cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		ACACCTAGCCGAGAGTATGTC	0.413			T	MYH11	AML																																	dbGAP		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	0													87.0	87.0	87.0					16																	67070624		2200	4300	6500	-	-	-	SO:0001583	missense	0			BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	ENST00000290858.6:c.248G>T	16.37:g.67070624G>T	ENSP00000290858:p.Arg83Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K347|Q13124|Q9HCT2	Missense_Mutation	SNP	pfam_CBF_beta,superfamily_CBF_beta	p.R83L	ENST00000290858.6	37	c.248	CCDS10827.1	16	.	.	.	.	.	.	.	.	.	.	G	25.1	4.602454	0.87157	.	.	ENSG00000067955	ENST00000290858;ENST00000412916	.	.	.	5.18	5.18	0.71444	.	0.058823	0.64402	D	0.000002	T	0.74504	0.3725	L	0.47716	1.5	0.80722	D	1	P;D	0.53619	0.952;0.961	D;D	0.72338	0.961;0.977	T	0.75789	-0.3194	9	0.62326	D	0.03	-21.1681	17.6259	0.88093	0.0:0.0:1.0:0.0	.	83;83	Q13951-2;Q13951	.;PEBB_HUMAN	L	83	.	ENSP00000290858:R83L	R	+	2	0	CBFB	65628125	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.171000	0.94802	2.568000	0.86640	0.655000	0.94253	CGA	CBFB	-	pfam_CBF_beta,superfamily_CBF_beta	ENSG00000067955		0.413	CBFB-001	KNOWN	basic|CCDS	protein_coding	CBFB	HGNC	protein_coding	OTTHUMT00000268843.2	33	0.00	0	G	NM_001755		67070624	67070624	+1	no_errors	ENST00000290858	ensembl	human	known	69_37n	missense	44	40.54	30	SNP	1.000	T
CCDC88C	440193	genome.wustl.edu	37	14	91770321	91770321	+	Splice_Site	SNP	A	A	C			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr14:91770321A>C	ENST00000389857.6	-	20	3445	c.3359T>G	c.(3358-3360)gTg>gGg	p.V1120G		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1120					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				GGAGTTCTCCACCTGCCGAGA	0.652																																						dbGAP											0													38.0	43.0	41.0					14																	91770321		2113	4243	6356	-	-	-	SO:0001630	splice_region_variant	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.3358-1T>G	14.37:g.91770321A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.V1120G	ENST00000389857.6	37	c.3359	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	A	19.48	3.836128	0.71373	.	.	ENSG00000015133	ENST00000389857	T	0.32988	1.43	5.52	5.52	0.82312	.	0.000000	0.43747	U	0.000539	T	0.60996	0.2312	M	0.85462	2.755	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.67898	-0.5551	10	0.87932	D	0	-39.2654	15.9241	0.79603	1.0:0.0:0.0:0.0	.	1120	Q9P219	DAPLE_HUMAN	G	1120	ENSP00000374507:V1120G	ENSP00000374507:V1120G	V	-	2	0	CCDC88C	90840074	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	9.134000	0.94467	2.224000	0.72417	0.459000	0.35465	GTG	CCDC88C	-	NULL	ENSG00000015133		0.652	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	28	0.00	0	A	XM_029353	Missense_Mutation	91770321	91770321	-1	no_errors	ENST00000389857	ensembl	human	known	69_37n	missense	16	57.89	22	SNP	1.000	C
CDH15	1013	genome.wustl.edu	37	16	89254603	89254603	+	Silent	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr16:89254603C>T	ENST00000289746.2	+	7	953	c.888C>T	c.(886-888)gcC>gcT	p.A296A		NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)	296	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		ACTGGGTGGCCAGGTTCACCA	0.627																																						dbGAP											0													60.0	52.0	54.0					16																	89254603		2196	4300	6496	-	-	-	SO:0001819	synonymous_variant	0			D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.888C>T	16.37:g.89254603C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A296	ENST00000289746.2	37	c.888	CCDS10976.1	16																																																																																			CDH15	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000129910		0.627	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH15	HGNC	protein_coding	OTTHUMT00000269920.1	18	0.00	0	C	NM_004933		89254603	89254603	+1	no_errors	ENST00000289746	ensembl	human	known	69_37n	silent	17	39.29	11	SNP	1.000	T
COL9A3	1299	genome.wustl.edu	37	20	61458599	61458599	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr20:61458599C>T	ENST00000343916.3	+	16	802	c.799C>T	c.(799-801)Cga>Tga	p.R267*		NM_001853.3	NP_001844.3	Q14050	CO9A3_HUMAN	collagen, type IX, alpha 3	267	Triple-helical region 3 (COL3).				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female gonad development (GO:0008585)|male gonad development (GO:0008584)	collagen type IX trimer (GO:0005594)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(1)|endometrium(3)|large_intestine(1)|lung(18)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	28	Breast(26;5.68e-08)					CCAGGGTGACCGAGGCGAGAG	0.627																																						dbGAP											0													56.0	60.0	59.0					20																	61458599		2201	4300	6501	-	-	-	SO:0001587	stop_gained	0			AK075240	CCDS13505.1	20q13.3	2013-01-16			ENSG00000092758	ENSG00000092758		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2219	protein-coding gene	gene with protein product	"""collagen type IX proteoglycan"""	120270				8586434, 1429648	Standard	NM_001853		Approved	IDD, MED, EDM3, FLJ90759, DJ885L7.4.1	uc002ydm.3	Q14050	OTTHUMG00000032938	ENST00000343916.3:c.799C>T	20.37:g.61458599C>T	ENSP00000341640:p.Arg267*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13681|Q9H4G9|Q9UPE2	Nonsense_Mutation	SNP	pfam_Collagen	p.R267*	ENST00000343916.3	37	c.799	CCDS13505.1	20	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652426	0.47362	.	.	ENSG00000092758	ENST00000343916	.	.	.	3.93	-0.294	0.12831	.	0.590632	0.17732	N	0.163841	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14656	T	0.56	.	9.7727	0.40601	0.4567:0.5433:0.0:0.0	.	.	.	.	X	267	.	ENSP00000341640:R267X	R	+	1	2	COL9A3	60929044	0.000000	0.05858	0.987000	0.45799	0.189000	0.23516	0.310000	0.19356	0.058000	0.16222	-0.521000	0.04368	CGA	COL9A3	-	NULL	ENSG00000092758		0.627	COL9A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL9A3	HGNC	protein_coding	OTTHUMT00000080071.2	33	0.00	0	C	NM_001853		61458599	61458599	+1	no_errors	ENST00000343916	ensembl	human	known	69_37n	nonsense	54	25.68	19	SNP	0.970	T
CPS1	1373	genome.wustl.edu	37	2	211465381	211465381	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr2:211465381C>T	ENST00000233072.5	+	15	1848	c.1652C>T	c.(1651-1653)tCa>tTa	p.S551L	CPS1_ENST00000430249.2_Missense_Mutation_p.S557L|CPS1_ENST00000451903.2_Missense_Mutation_p.S100L	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	551	ATP-grasp 1.				anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	CAGCTGTTTTCAGATAAACTA	0.408																																						dbGAP											0													113.0	115.0	114.0					2																	211465381		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.1652C>T	2.37:g.211465381C>T	ENSP00000233072:p.Ser551Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE_1,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,smart_MGS-like_dom,prints_CbamoylP_synth_lsu_CPSase_dom,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.S557L	ENST00000233072.5	37	c.1670	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	16.09	3.023081	0.54683	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97114	-4.25;-4.25;-4.25	5.09	5.09	0.68999	ATP-grasp fold (1);Carbamoyl-phosphate synthetase, large subunit, ATP-binding (1);	0.191956	0.46145	D	0.000306	D	0.96987	0.9016	M	0.86028	2.79	0.54753	D	0.999989	B;B	0.33171	0.4;0.155	B;B	0.33254	0.16;0.16	D	0.97371	0.9976	10	0.87932	D	0	-26.2779	18.8711	0.92315	0.0:1.0:0.0:0.0	.	561;551	Q59HF8;P31327	.;CPSM_HUMAN	L	557;559;551;100	ENSP00000402608:S557L;ENSP00000233072:S551L;ENSP00000406136:S100L	ENSP00000233072:S551L	S	+	2	0	CPS1	211173626	1.000000	0.71417	1.000000	0.80357	0.297000	0.27493	4.562000	0.60816	2.519000	0.84933	0.460000	0.39030	TCA	CPS1	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.408	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	37	0.00	0	C			211465381	211465381	+1	no_errors	ENST00000430249	ensembl	human	known	69_37n	missense	58	35.56	32	SNP	1.000	T
DBNDD2	55861	genome.wustl.edu	37	20	44037466	44037466	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr20:44037466delG	ENST00000372720.3	+	3	690	c.459delG	c.(457-459)atgfs	p.M153fs	SYS1-DBNDD2_ENST00000475242.1_3'UTR|DBNDD2_ENST00000372717.1_Frame_Shift_Del_p.M55fs|TP53TG5_ENST00000494455.1_5'Flank|SYS1-DBNDD2_ENST00000452133.1_3'UTR|DBNDD2_ENST00000372722.3_Frame_Shift_Del_p.M55fs|DBNDD2_ENST00000372723.3_Frame_Shift_Del_p.M55fs|DBNDD2_ENST00000357275.2_Frame_Shift_Del_p.M55fs|DBNDD2_ENST00000372712.2_Frame_Shift_Del_p.M55fs|DBNDD2_ENST00000372710.3_Frame_Shift_Del_p.M157fs|DBNDD2_ENST00000360981.4_Frame_Shift_Del_p.M55fs	NM_018478.3	NP_060948.3	Q9BQY9	DBND2_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 2	153					negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)				breast(1)|lung(2)	3		Myeloproliferative disorder(115;0.0122)				TCTCATCCATGGAAGTGAATG	0.532																																						dbGAP											0													73.0	76.0	75.0					20																	44037466		2016	4193	6209	-	-	-	SO:0001589	frameshift_variant	0			AF220191	CCDS42880.1, CCDS42881.1, CCDS56193.1, CCDS56194.1	20q13.12	2007-07-23	2006-04-04	2006-04-04	ENSG00000244274	ENSG00000244274			15881	protein-coding gene	gene with protein product		611453	"""chromosome 20 open reading frame 35"""	C20orf35			Standard	NM_001048225		Approved	HSMNP1	uc002xof.3	Q9BQY9	OTTHUMG00000032576	ENST00000372720.3:c.459delG	20.37:g.44037466delG	ENSP00000361805:p.Met153fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q331S6|Q5QPV4|Q5QPV6|Q9BQZ0|Q9BVL1|Q9H1F6|Q9NWZ0|Q9NY07|Q9NZ31	Frame_Shift_Del	DEL	pfam_Dysbindin	p.E154fs	ENST00000372720.3	37	c.459	CCDS56193.1	20																																																																																			DBNDD2	-	pfam_Dysbindin	ENSG00000244274		0.532	DBNDD2-001	KNOWN	basic|CCDS	protein_coding	DBNDD2	HGNC	protein_coding	OTTHUMT00000079438.1	24	0.00	0	G	NM_018478		44037466	44037466	+1	no_errors	ENST00000372720	ensembl	human	known	69_37n	frame_shift_del	75	20.62	20	DEL	1.000	-
DNAH9	1770	genome.wustl.edu	37	17	11726132	11726132	+	Silent	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr17:11726132G>A	ENST00000262442.4	+	48	9095	c.9027G>A	c.(9025-9027)caG>caA	p.Q3009Q	DNAH9_ENST00000454412.2_Silent_p.Q3009Q	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	3009	AAA 4. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CAGTAAAGCAGTCGATTAGCA	0.448																																						dbGAP											0													124.0	110.0	115.0					17																	11726132		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.9027G>A	17.37:g.11726132G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.Q3009	ENST00000262442.4	37	c.9027	CCDS11160.1	17																																																																																			DNAH9	-	NULL	ENSG00000007174		0.448	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	60	0.00	0	G	NM_001372		11726132	11726132	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	silent	43	40.28	29	SNP	1.000	A
DOLK	22845	genome.wustl.edu	37	9	131709581	131709582	+	Start_Codon_Ins	INS	-	-	T	rs531969689	byFrequency	TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr9:131709581_131709582insT	ENST00000372586.3	-	0	316_317				RP11-101E3.5_ENST00000482796.1_Intron|NUP188_ENST00000372577.2_5'Flank	NM_014908.3	NP_055723.1	Q9UPQ8	DOLK_HUMAN	dolichol kinase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|dolichyl diphosphate biosynthetic process (GO:0006489)|dolichyl monophosphate biosynthetic process (GO:0043048)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	dolichol kinase activity (GO:0004168)			breast(1)|large_intestine(5)|lung(3)|ovary(1)|urinary_tract(1)	11						CTCTCGGGTCATATCTCTAGAC	0.668													T|T|TT|insertion	13	0.00259585	0.0	0.0	5008	,	,		16230	0.0		0.0129	False		,,,				2504	0.0					dbGAP											0										8,4238		0,8,2115						3.9	1.0			25	76,8158		0,76,4041	no	frameshift	DOLK	NM_014908.3		0,84,6156	A1A1,A1R,RR		0.923,0.1884,0.6731				84,12396				-	-	-	SO:0001582	initiator_codon_variant	0			AB029017	CCDS6915.1	9q34.13	2014-09-17	2007-02-09	2007-02-09	ENSG00000175283	ENSG00000175283			23406	protein-coding gene	gene with protein product	"""dolichol kinase 1"""	610746	"""transmembrane protein 15"""	TMEM15		12975309, 16923818	Standard	NM_014908		Approved	KIAA1094, DK1	uc004bwr.3	Q9UPQ8	OTTHUMG00000020765	ENST00000372586.3:c.2dupA	9.37:g.131709582_131709582dupT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SRE6	Frame_Shift_Ins	INS	NULL	p.M1fs	ENST00000372586.3	37	c.2_1	CCDS6915.1	9																																																																																			DOLK	-	NULL	ENSG00000175283		0.668	DOLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOLK	HGNC	protein_coding	OTTHUMT00000054515.1	10	0.00	0	-	NM_014908		131709581	131709582	-1	no_errors	ENST00000372586	ensembl	human	known	69_37n	frame_shift_ins	7	36.36	4	INS	0.954:0.711	T
DST	667	genome.wustl.edu	37	6	56358848	56358848	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr6:56358848T>A	ENST00000361203.3	-	78	19401	c.19394A>T	c.(19393-19395)gAa>gTa	p.E6465V	DST_ENST00000370754.5_Missense_Mutation_p.E6754V|DST_ENST00000370788.2_Missense_Mutation_p.E4379V|DST_ENST00000370769.4_Missense_Mutation_p.E6576V|DST_ENST00000340834.4_5'Flank|DST_ENST00000244364.6_Missense_Mutation_p.E4162V|DST_ENST00000421834.2_Missense_Mutation_p.E4488V|DST_ENST00000312431.6_3'UTR|DST_ENST00000446842.2_Missense_Mutation_p.E6250V			Q03001	DYST_HUMAN	dystonin	6465					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			TTCCCATTTTTCTTTCAAGTT	0.358																																						dbGAP											0													162.0	141.0	148.0					6																	56358848		1820	4088	5908	-	-	-	SO:0001583	missense	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.19394A>T	6.37:g.56358848T>A	ENSP00000354508:p.Glu6465Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E6754V	ENST00000361203.3	37	c.20261		6	.	.	.	.	.	.	.	.	.	.	T	20.2	3.943678	0.73672	.	.	ENSG00000151914	ENST00000244364;ENST00000370754;ENST00000370769;ENST00000421834;ENST00000446842;ENST00000370788;ENST00000361203	T;T;T;T;T;T;T	0.38240	1.15;1.15;1.15;1.15;1.15;1.15;1.15	5.87	5.87	0.94306	.	0.000000	0.56097	D	0.000031	T	0.51210	0.1661	M	0.65975	2.015	0.34762	D	0.732858	D;D;D;D;P	0.89917	1.0;1.0;0.999;0.999;0.579	D;D;D;D;B	0.91635	0.999;0.992;0.978;0.958;0.235	T	0.53933	-0.8368	9	0.52906	T	0.07	.	16.2806	0.82678	0.0:0.0:0.0:1.0	.	4488;6576;6754;6574;4162	Q5TBT1;E7ERU2;E9PEB9;Q03001;Q03001-8	.;.;.;DYST_HUMAN;.	V	4162;6754;6576;4488;6250;4379;6465	ENSP00000244364:E4162V;ENSP00000359790:E6754V;ENSP00000359805:E6576V;ENSP00000400883:E4488V;ENSP00000393645:E6250V;ENSP00000359824:E4379V;ENSP00000354508:E6465V	ENSP00000244364:E4162V	E	-	2	0	DST	56466807	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.542000	0.67218	2.248000	0.74166	0.533000	0.62120	GAA	DST	-	pfam_Spectrin_repeat,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000151914		0.358	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	110	0.00	0	T	NM_001723		56358848	56358848	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	missense	307	11.78	41	SNP	1.000	A
EEF2	1938	genome.wustl.edu	37	19	3978146	3978146	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr19:3978146G>A	ENST00000309311.6	-	12	1826	c.1738C>T	c.(1738-1740)Cgc>Tgc	p.R580C		NM_001961.3	NP_001952.1	P13639	EF2_HUMAN	eukaryotic translation elongation factor 2	580					cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|positive regulation of gene expression (GO:0010628)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation activator activity (GO:0008494)|translation elongation factor activity (GO:0003746)			endometrium(4)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00461)|GBM - Glioblastoma multiforme(1328;0.0223)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCGTCTCGCGGTACGAGACG	0.557																																					Colon(165;1804 1908 4071 6587 18799)	dbGAP											0													25.0	20.0	22.0					19																	3978146		2187	4264	6451	-	-	-	SO:0001583	missense	0			Z11692	CCDS12117.1	19p13.3	2012-09-20			ENSG00000167658	ENSG00000167658			3214	protein-coding gene	gene with protein product	"""polypeptidyl-tRNA translocase"""	130610		EF2		2610926, 6427766	Standard	NM_001961		Approved	EEF-2	uc002lze.3	P13639		ENST00000309311.6:c.1738C>T	19.37:g.3978146G>A	ENSP00000307940:p.Arg580Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMP5|D6W618|Q58J86	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.R580C	ENST00000309311.6	37	c.1738	CCDS12117.1	19	.	.	.	.	.	.	.	.	.	.	G	10.36	1.329266	0.24167	.	.	ENSG00000167658	ENST00000309311	T	0.49139	0.79	5.61	4.54	0.55810	Ribosomal protein S5 domain 2-type fold (1);	0.117336	0.56097	D	0.000029	T	0.66426	0.2788	M	0.84219	2.685	0.80722	D	1	D	0.89917	1.0	P	0.60117	0.869	T	0.69453	-0.5141	10	0.39692	T	0.17	-19.9333	14.2043	0.65725	0.0:0.0:0.8492:0.1508	.	580	P13639	EF2_HUMAN	C	580	ENSP00000307940:R580C	ENSP00000307940:R580C	R	-	1	0	EEF2	3929146	1.000000	0.71417	0.041000	0.18516	0.171000	0.22731	3.842000	0.55858	1.299000	0.44798	0.491000	0.48974	CGC	EEF2	-	superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000167658		0.557	EEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF2	HGNC	protein_coding	OTTHUMT00000457615.2	21	0.00	0	G	NM_001961		3978146	3978146	-1	no_errors	ENST00000309311	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	0.998	A
EPOR	2057	genome.wustl.edu	37	19	11488689	11488689	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr19:11488689G>T	ENST00000222139.6	-	8	1602	c.1498C>A	c.(1498-1500)Ctg>Atg	p.L500M	EPOR_ENST00000592375.2_3'UTR	NM_000121.3	NP_000112.1	P19235	EPOR_HUMAN	erythropoietin receptor	500					brain development (GO:0007420)|decidualization (GO:0046697)|erythropoietin-mediated signaling pathway (GO:0038162)|heart development (GO:0007507)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	erythropoietin receptor activity (GO:0004900)|identical protein binding (GO:0042802)			endometrium(1)|lung(2)|ovary(1)|urinary_tract(1)	5					Darbepoetin alfa(DB00012)|Epoetin alfa(DB00016)|Epoetin Zeta(DB08923)|Peginesatide(DB08894)	CTGGGGGGCAGAGGCTCAGCG	0.557											OREG0025254	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													170.0	183.0	178.0					19																	11488689		2203	4299	6502	-	-	-	SO:0001583	missense	0			M34986	CCDS12260.1	19p13.3-p13.2	2013-02-11				ENSG00000187266		"""Fibronectin type III domain containing"""	3416	protein-coding gene	gene with protein product		133171					Standard	NM_000121		Approved		uc002mrj.2	P19235		ENST00000222139.6:c.1498C>A	19.37:g.11488689G>T	ENSP00000222139:p.Leu500Met	Somatic	672	WXS	Illumina GAIIx	Phase_IV	B2RCG4|Q15443|Q2M205	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pirsf_Erythropoietin_rcpt,pfscan_Fibronectin_type3	p.L500M	ENST00000222139.6	37	c.1498	CCDS12260.1	19	.	.	.	.	.	.	.	.	.	.	G	4.016	0.000436	0.07819	.	.	ENSG00000187266	ENST00000222139	T	0.45668	0.89	4.69	-0.242	0.13039	.	1.098360	0.06873	N	0.801203	T	0.21227	0.0511	L	0.27053	0.805	0.09310	N	1	P	0.39576	0.679	B	0.31614	0.133	T	0.14868	-1.0457	10	0.34782	T	0.22	-29.1811	0.3569	0.00358	0.3261:0.1878:0.2952:0.191	.	500	P19235	EPOR_HUMAN	M	500	ENSP00000222139:L500M	ENSP00000222139:L500M	L	-	1	2	EPOR	11349689	0.000000	0.05858	0.010000	0.14722	0.106000	0.19336	-0.241000	0.08940	-0.015000	0.14150	0.455000	0.32223	CTG	EPOR	-	pirsf_Erythropoietin_rcpt	ENSG00000187266		0.557	EPOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPOR	HGNC	protein_coding	OTTHUMT00000458791.1	12	0.00	0	G			11488689	11488689	-1	no_errors	ENST00000222139	ensembl	human	known	69_37n	missense	18	41.94	13	SNP	0.000	T
EPS15	2060	genome.wustl.edu	37	1	51910583	51910583	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:51910583G>C	ENST00000371733.3	-	11	1028	c.932C>G	c.(931-933)tCa>tGa	p.S311*	EPS15_ENST00000371730.2_Nonsense_Mutation_p.S311*	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	311	EH 3. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						GGCCCTGTCTGATGGTGGAAT	0.373			T	MLL	ALL																																	dbGAP		Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	1	Whole gene deletion(1)	central_nervous_system(1)											174.0	164.0	167.0					1																	51910583		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.932C>G	1.37:g.51910583G>C	ENSP00000360798:p.Ser311*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8J7|D3DPJ2|Q5SRH4	Nonsense_Mutation	SNP	smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.S311*	ENST00000371733.3	37	c.932	CCDS557.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.732495	0.96856	.	.	ENSG00000085832	ENST00000371730;ENST00000371733	.	.	.	5.39	5.39	0.77823	.	0.000000	0.27518	N	0.019017	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	13.7967	0.63175	0.0736:0.0:0.9264:0.0	.	.	.	.	X	311	.	ENSP00000360795:S311X	S	-	2	0	EPS15	51683171	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.029000	0.88807	2.689000	0.91719	0.655000	0.94253	TCA	EPS15	-	smart_EPS15_homology,pfscan_EPS15_homology	ENSG00000085832		0.373	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1	62	0.00	0	G	NM_001981		51910583	51910583	-1	no_errors	ENST00000371733	ensembl	human	known	69_37n	nonsense	137	10.46	16	SNP	1.000	C
ESPL1	9700	genome.wustl.edu	37	12	53679978	53679978	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr12:53679978G>A	ENST00000257934.4	+	18	3549	c.3458G>A	c.(3457-3459)aGc>aAc	p.S1153N	ESPL1_ENST00000552462.1_Missense_Mutation_p.S1153N	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	1153					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						CTCTGCGCCAGCCCTGTCCTC	0.612																																					Colon(53;1069 1201 2587 5382)	dbGAP											0													111.0	108.0	109.0					12																	53679978		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.3458G>A	12.37:g.53679978G>A	ENSP00000257934:p.Ser1153Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C50	p.S1153N	ENST00000257934.4	37	c.3458	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	G	10.43	1.349104	0.24426	.	.	ENSG00000135476	ENST00000257934;ENST00000552671;ENST00000552462	T;T	0.11930	2.73;2.73	5.65	2.69	0.31865	.	0.229522	0.51477	N	0.000089	T	0.10252	0.0251	L	0.41027	1.25	0.23198	N	0.998132	B	0.12013	0.005	B	0.06405	0.002	T	0.19712	-1.0297	10	0.41790	T	0.15	.	6.4961	0.22144	0.2934:0.0:0.7066:0.0	.	1153	Q14674	ESPL1_HUMAN	N	1153;828;1153	ENSP00000257934:S1153N;ENSP00000449831:S1153N	ENSP00000257934:S1153N	S	+	2	0	ESPL1	51966245	0.999000	0.42202	1.000000	0.80357	0.995000	0.86356	2.137000	0.42130	0.956000	0.37904	0.655000	0.94253	AGC	ESPL1	-	NULL	ENSG00000135476		0.612	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	33	0.00	0	G	NM_012291		53679978	53679978	+1	no_errors	ENST00000257934	ensembl	human	known	69_37n	missense	113	19.01	27	SNP	1.000	A
FAM169A	26049	genome.wustl.edu	37	5	74096761	74096761	+	Silent	SNP	A	A	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr5:74096761A>G	ENST00000389156.4	-	10	1137	c.1047T>C	c.(1045-1047)agT>agC	p.S349S	FAM169A_ENST00000510496.1_Silent_p.S289S|FAM169A_ENST00000380515.3_3'UTR	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	349						membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						CACCTTGAGAACTGCTAAATT	0.358																																						dbGAP											0													117.0	110.0	112.0					5																	74096761		1816	4077	5893	-	-	-	SO:0001819	synonymous_variant	0				CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.1047T>C	5.37:g.74096761A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T9|Q6MZT0|Q9H989	Silent	SNP	NULL	p.S349	ENST00000389156.4	37	c.1047	CCDS43330.1	5																																																																																			FAM169A	-	NULL	ENSG00000198780		0.358	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM169A	HGNC	protein_coding	OTTHUMT00000371092.2	50	0.00	0	A			74096761	74096761	-1	no_errors	ENST00000389156	ensembl	human	known	69_37n	silent	90	18.18	20	SNP	0.636	G
FBN1	2200	genome.wustl.edu	37	15	48796053	48796053	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr15:48796053C>T	ENST00000316623.5	-	17	2499	c.2044G>A	c.(2044-2046)Gaa>Aaa	p.E682K		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	682	TB 3.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CAACAGCATTCAGATTTAGTG	0.488																																						dbGAP											0													178.0	149.0	159.0					15																	48796053		2197	4296	6493	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.2044G>A	15.37:g.48796053C>T	ENSP00000325527:p.Glu682Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.E682K	ENST00000316623.5	37	c.2044	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	C	27.8	4.868445	0.91587	.	.	ENSG00000166147	ENST00000316623	D	0.94046	-3.34	6.06	5.14	0.70334	Matrix fibril-associated (3);TGF-beta binding (1);	0.144113	0.64402	D	0.000009	D	0.93465	0.7915	M	0.85197	2.74	0.80722	D	1	B	0.33345	0.409	B	0.37550	0.253	D	0.90794	0.4689	10	0.23891	T	0.37	.	13.5195	0.61559	0.0:0.9252:0.0:0.0748	.	682	P35555	FBN1_HUMAN	K	682	ENSP00000325527:E682K	ENSP00000325527:E682K	E	-	1	0	FBN1	46583345	0.999000	0.42202	1.000000	0.80357	0.794000	0.44872	3.989000	0.56958	2.882000	0.98803	0.655000	0.94253	GAA	FBN1	-	pfam_TB_dom,superfamily_TB_dom,pirsf_Fibrillin	ENSG00000166147		0.488	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	39	0.00	0	C			48796053	48796053	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	84	29.17	35	SNP	0.998	T
FDXR	2232	genome.wustl.edu	37	17	72863106	72863106	+	Intron	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr17:72863106G>A	ENST00000293195.5	-	3	256				FDXR_ENST00000581530.1_Intron|FDXR_ENST00000582944.1_Intron|FDXR_ENST00000420580.2_Intron|FDXR_ENST00000442102.2_Nonsense_Mutation_p.Q67*|FDXR_ENST00000455107.2_Intron|FDXR_ENST00000544854.1_Intron|FDXR_ENST00000413947.2_Intron|FDXR_ENST00000581969.1_Intron|FDXR_ENST00000583917.1_Intron	NM_001258014.1|NM_004110.3|NM_024417.2	NP_001244943.1|NP_004101.2|NP_077728.2	P22570	ADRO_HUMAN	ferredoxin reductase						cholesterol metabolic process (GO:0008203)|generation of precursor metabolites and energy (GO:0006091)|NADPH oxidation (GO:0070995)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ferredoxin-NADP+ reductase activity (GO:0004324)|NADPH binding (GO:0070402)|NADPH-adrenodoxin reductase activity (GO:0015039)			central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16	all_lung(278;0.172)|Lung NSC(278;0.207)				Flavin adenine dinucleotide(DB03147)	ACCCTGGGCTGAGAACACAAG	0.632																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			J03826	CCDS11707.1, CCDS58591.1, CCDS58592.1, CCDS58593.1, CCDS58594.1, CCDS58595.1, CCDS58596.1	17q25.1	2013-06-18			ENSG00000161513	ENSG00000161513	1.18.1.6		3642	protein-coding gene	gene with protein product	"""adrenodoxin-NADP(+) reductase"", ""adrenodoxin reductase"""	103270		ADXR		2969697	Standard	NM_001258014		Approved		uc010wrl.2	P22570	OTTHUMG00000179026	ENST00000293195.5:c.178-108C>T	17.37:g.72863106G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDI7|B4DHX5|B4DQQ4|B4DX24|B7Z7G2|E7EQC1|Q13716|Q4PJI0|Q9BU12	Nonsense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,prints_FAD_pyr_nucl-diS_OxRdtase	p.Q67*	ENST00000293195.5	37	c.199	CCDS58593.1	17	.	.	.	.	.	.	.	.	.	.	G	9.793	1.178539	0.21787	.	.	ENSG00000161513	ENST00000442102	.	.	.	2.76	-3.35	0.04928	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.8117	0.08799	0.4481:0.0:0.3843:0.1676	.	.	.	.	X	67	.	.	Q	-	1	0	FDXR	70374701	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-0.054000	0.11826	-0.764000	0.04651	-0.350000	0.07774	CAG	FDXR	-	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	ENSG00000161513		0.632	FDXR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FDXR	HGNC	protein_coding	OTTHUMT00000444449.1	13	0.00	0	G	NM_004110		72863106	72863106	-1	no_errors	ENST00000442102	ensembl	human	novel	69_37n	nonsense	18	20.83	5	SNP	0.000	A
FLT3	2322	genome.wustl.edu	37	13	28644705	28644705	+	Silent	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr13:28644705G>A	ENST00000241453.7	-	2	169	c.88C>T	c.(88-90)Ctg>Ttg	p.L30L	FLT3_ENST00000380982.4_Silent_p.L30L|FLT3_ENST00000537084.1_Silent_p.L30L	NM_004119.2	NP_004110.2	P36888	FLT3_HUMAN	fms-related tyrosine kinase 3	30					B cell differentiation (GO:0030183)|cellular response to cytokine stimulus (GO:0071345)|common myeloid progenitor cell proliferation (GO:0035726)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell differentiation (GO:0097028)|hemopoiesis (GO:0030097)|leukocyte homeostasis (GO:0001776)|lymphocyte proliferation (GO:0046651)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|pro-B cell differentiation (GO:0002328)|pro-T cell differentiation (GO:0002572)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor signaling pathway (GO:0038084)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|cytokine receptor activity (GO:0004896)|protein homodimerization activity (GO:0042803)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(12329)|kidney(2)|large_intestine(8)|lung(30)|ovary(4)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12390	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0156)|Ovarian(182;0.0392)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.00154)|all cancers(112;0.00459)|GBM - Glioblastoma multiforme(144;0.00562)|Epithelial(112;0.0959)|Lung(94;0.212)	Ponatinib(DB08901)|Sorafenib(DB00398)|Sunitinib(DB01268)	ATCACAGGCAGATCTTGATTT	0.299			"""Mis, O"""		"""AML, ALL"""																																	dbGAP		Dom	yes		13	13q12	2322	fms-related tyrosine kinase 3		L	0													81.0	74.0	76.0					13																	28644705		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U02687	CCDS31953.1	13q12	2014-09-17			ENSG00000122025	ENSG00000122025	2.7.10.1	"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3765	protein-coding gene	gene with protein product		136351				8394751	Standard	NM_004119		Approved	STK1, FLK2, CD135	uc001urw.3	P36888	OTTHUMG00000016646	ENST00000241453.7:c.88C>T	13.37:g.28644705G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVG9|B7ZLT7|B7ZLT8|F5H0A0|Q13414	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L30	ENST00000241453.7	37	c.88	CCDS31953.1	13																																																																																			FLT3	-	NULL	ENSG00000122025		0.299	FLT3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FLT3	HGNC	protein_coding	OTTHUMT00000044319.2	21	0.00	0	G			28644705	28644705	-1	no_errors	ENST00000380982	ensembl	human	known	69_37n	silent	50	23.08	15	SNP	0.965	A
FMN2	56776	genome.wustl.edu	37	1	240370290	240370290	+	Silent	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:240370290C>G	ENST00000319653.9	+	5	2408	c.2178C>G	c.(2176-2178)ctC>ctG	p.L726L		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	726					cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TCGAAGCTCTCAGGTTAGAAG	0.542																																						dbGAP											0													64.0	62.0	63.0					1																	240370290		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2178C>G	1.37:g.240370290C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.L726	ENST00000319653.9	37	c.2178	CCDS31069.2	1																																																																																			FMN2	-	NULL	ENSG00000155816		0.542	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	41	0.00	0	C	XM_371352		240370290	240370290	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	silent	43	35.82	24	SNP	0.364	G
FOXA1	3169	genome.wustl.edu	37	14	38061193	38061193	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr14:38061193A>T	ENST00000250448.2	-	2	857	c.796T>A	c.(796-798)Ttc>Atc	p.F266I	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.F233I	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	266					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		TCGCACTTGAAGCGCTTCTGG	0.721																																						dbGAP											0													10.0	11.0	11.0					14																	38061193		2194	4283	6477	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.796T>A	14.37:g.38061193A>T	ENSP00000250448:p.Phe266Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.F266I	ENST00000250448.2	37	c.796	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	A	29.3	4.993470	0.93167	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.93659	-3.25;-3.26	3.92	3.92	0.45320	.	0.000000	0.85682	D	0.000000	D	0.93615	0.7961	L	0.29908	0.895	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.94012	0.7285	10	0.87932	D	0	.	11.8486	0.52399	1.0:0.0:0.0:0.0	.	266	P55317	FOXA1_HUMAN	I	266;233	ENSP00000250448:F266I;ENSP00000440178:F233I	ENSP00000250448:F266I	F	-	1	0	FOXA1	37130944	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.885000	0.92439	1.648000	0.50643	0.329000	0.21502	TTC	FOXA1	-	NULL	ENSG00000129514		0.721	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	16	0.00	0	A			38061193	38061193	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	1.000	T
FOXI1	2299	genome.wustl.edu	37	5	169535450	169535450	+	Silent	SNP	G	G	A	rs56128152	byFrequency	TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr5:169535450G>A	ENST00000306268.6	+	2	1033	c.972G>A	c.(970-972)ccG>ccA	p.P324P	FOXI1_ENST00000449804.2_Silent_p.P229P			Q12951	FOXI1_HUMAN	forkhead box I1	324					embryo development (GO:0009790)|inner ear morphogenesis (GO:0042472)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.P324P(1)		breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	Renal(175;0.000159)|Lung NSC(126;0.0267)|all_lung(126;0.04)	Medulloblastoma(196;0.0109)|all_neural(177;0.0298)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCTTCTCCCCGCTCACCAACC	0.622									Pendred syndrome																													dbGAP											1	Substitution - coding silent(1)	lung(1)											103.0	78.0	86.0					5																	169535450		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Goiter-Deafness syndrome	BC029778	CCDS4372.1, CCDS47337.1	5q34	2008-02-05			ENSG00000168269	ENSG00000168269		"""Forkhead boxes"""	3815	protein-coding gene	gene with protein product		601093		FKHL10		7957066, 8825632	Standard	NM_144769		Approved	FREAC6	uc003mai.4	Q12951	OTTHUMG00000130436	ENST00000306268.6:c.972G>A	5.37:g.169535450G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14518|Q66SR7|Q8N6L8	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.P324	ENST00000306268.6	37	c.972	CCDS4372.1	5																																																																																			FOXI1	-	NULL	ENSG00000168269		0.622	FOXI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXI1	HGNC	protein_coding	OTTHUMT00000252827.2	17	0.00	0	G	NM_144769, NM_012188		169535450	169535450	+1	no_errors	ENST00000306268	ensembl	human	known	69_37n	silent	21	32.26	10	SNP	0.002	A
FXR1	8087	genome.wustl.edu	37	3	180685879	180685879	+	Silent	SNP	T	T	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr3:180685879T>G	ENST00000357559.4	+	14	1623	c.1239T>G	c.(1237-1239)tcT>tcG	p.S413S	FXR1_ENST00000468861.1_Silent_p.S328S|FXR1_ENST00000305586.7_Silent_p.S328S|FXR1_ENST00000480918.1_Silent_p.S400S|FXR1_ENST00000445140.2_Silent_p.S413S|FXR1_ENST00000491062.1_Silent_p.S364S	NM_001013438.2|NM_005087.3	NP_001013456.1|NP_005078.2	P51114	FXR1_HUMAN	fragile X mental retardation, autosomal homolog 1	413					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of translation (GO:0017148)	costamere (GO:0043034)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysome (GO:0005844)	G-quadruplex RNA binding (GO:0002151)|mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|endometrium(4)|large_intestine(5)|lung(12)|skin(2)	26	all_cancers(143;6.07e-14)|Ovarian(172;0.0212)		Epithelial(37;3.05e-35)|OV - Ovarian serous cystadenocarcinoma(80;2.4e-22)			AAACGGAATCTGAGCGTAAAG	0.448																																						dbGAP											0													103.0	102.0	102.0					3																	180685879		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M67468	CCDS3238.1, CCDS33894.1, CCDS46965.1	3q28	2014-01-28			ENSG00000114416	ENSG00000114416			4023	protein-coding gene	gene with protein product		600819				7781595, 9642279	Standard	NM_005087		Approved		uc003fkq.3	P51114	OTTHUMG00000158138	ENST00000357559.4:c.1239T>G	3.37:g.180685879T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9B8|Q7Z450|Q8N6R8	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam	p.L14R	ENST00000357559.4	37	c.41	CCDS3238.1	3	.	.	.	.	.	.	.	.	.	.	T	10.97	1.500242	0.26861	.	.	ENSG00000114416	ENST00000482125	.	.	.	5.51	0.365	0.16131	.	.	.	.	.	T	0.43500	0.1250	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28138	-1.0053	4	.	.	.	-17.3707	2.9664	0.05909	0.1971:0.0706:0.3625:0.3697	.	.	.	.	R	14	.	.	L	+	2	0	FXR1	182168573	0.905000	0.30787	1.000000	0.80357	0.998000	0.95712	-0.099000	0.11007	0.475000	0.27415	0.482000	0.46254	CTG	FXR1	-	pfam_Frag_X_MRP_fam	ENSG00000114416		0.448	FXR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR1	HGNC	protein_coding	OTTHUMT00000350265.5	50	0.00	0	T			180685879	180685879	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000482125	ensembl	human	novel	69_37n	missense	112	27.27	42	SNP	0.935	G
GIMAP8	155038	genome.wustl.edu	37	7	150171570	150171570	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr7:150171570C>G	ENST00000307271.3	+	4	1727	c.1153C>G	c.(1153-1155)Ctc>Gtc	p.L385V		NM_175571.2	NP_783161.1	Q8ND71	GIMA8_HUMAN	GTPase, IMAP family member 8	385	AIG1-type G 2.					cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(26)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	62			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.17)		CAATAAAGCTCTCTATGGTCT	0.418																																						dbGAP											0													139.0	150.0	146.0					7																	150171570		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834361	CCDS34777.1	7q36.1	2014-04-04			ENSG00000171115	ENSG00000171115		"""GTPases, IMAP"""	21792	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 9"""					15474311	Standard	XM_005249951		Approved	DKFZp667I133, hIAN6, IAN9	uc003whj.3	Q8ND71	OTTHUMG00000158327	ENST00000307271.3:c.1153C>G	7.37:g.150171570C>G	ENSP00000305107:p.Leu385Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AIG1	p.L385V	ENST00000307271.3	37	c.1153	CCDS34777.1	7	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650409	0.67472	.	.	ENSG00000171115	ENST00000307271	T	0.15952	2.38	4.47	4.47	0.54385	AIG1 (1);	0.000000	0.42548	D	0.000684	T	0.41743	0.1172	M	0.78049	2.395	0.36866	D	0.888688	D	0.89917	1.0	D	0.87578	0.998	T	0.52823	-0.8524	10	0.87932	D	0	.	12.4944	0.55918	0.0:1.0:0.0:0.0	.	385	Q8ND71	GIMA8_HUMAN	V	385	ENSP00000305107:L385V	ENSP00000305107:L385V	L	+	1	0	GIMAP8	149802503	0.552000	0.26505	0.211000	0.23655	0.011000	0.07611	1.666000	0.37460	2.338000	0.79540	0.650000	0.86243	CTC	GIMAP8	-	pfam_AIG1	ENSG00000171115		0.418	GIMAP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP8	HGNC	protein_coding	OTTHUMT00000350701.1	20	0.00	0	C	NM_175571		150171570	150171570	+1	no_errors	ENST00000307271	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	0.990	G
GNL3L	54552	genome.wustl.edu	37	X	54577449	54577449	+	Missense_Mutation	SNP	G	G	T	rs142203245		TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chrX:54577449G>T	ENST00000336470.4	+	10	968	c.829G>T	c.(829-831)Gca>Tca	p.A277S	GNL3L_ENST00000360845.2_Missense_Mutation_p.A277S	NM_019067.5	NP_061940.1	Q9NVN8	GNL3L_HUMAN	guanine nucleotide binding protein-like 3 (nucleolar)-like	277	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				GTP catabolic process (GO:0006184)|ribosome biogenesis (GO:0042254)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|skin(1)|urinary_tract(1)	30						GCGCAGCCGCGCATGCAGCGT	0.552																																						dbGAP											0													99.0	79.0	85.0					X																	54577449		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001475	CCDS14360.1	Xp11.22	2010-03-17			ENSG00000130119	ENSG00000130119			25553	protein-coding gene	gene with protein product		300873				12477932	Standard	NM_019067		Approved	FLJ10613	uc004dth.2	Q9NVN8	OTTHUMG00000021629	ENST00000336470.4:c.829G>T	X.37:g.54577449G>T	ENSP00000338573:p.Ala277Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,prints_GTP_binding_domain	p.A277S	ENST00000336470.4	37	c.829	CCDS14360.1	X	.	.	.	.	.	.	.	.	.	.	G	19.25	3.792195	0.70452	.	.	ENSG00000130119	ENST00000336470;ENST00000360845	T;T	0.14266	2.52;2.52	4.63	3.74	0.42951	GTP-binding domain, HSR1-related (1);	0.051792	0.85682	N	0.000000	T	0.17238	0.0414	L	0.31371	0.925	0.80722	D	1	P	0.38582	0.638	P	0.49252	0.604	T	0.03534	-1.1027	10	0.36615	T	0.2	-9.1355	12.5137	0.56019	0.0:0.0:0.8309:0.1691	.	277	Q9NVN8	GNL3L_HUMAN	S	277	ENSP00000338573:A277S;ENSP00000354091:A277S	ENSP00000338573:A277S	A	+	1	0	GNL3L	54594174	1.000000	0.71417	0.727000	0.30756	0.787000	0.44495	5.854000	0.69503	0.983000	0.38602	0.436000	0.28706	GCA	GNL3L	-	pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N	ENSG00000130119		0.552	GNL3L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GNL3L	HGNC	protein_coding	OTTHUMT00000056805.1	24	0.00	0	G	NM_019067		54577449	54577449	+1	no_errors	ENST00000336470	ensembl	human	known	69_37n	missense	67	23.86	21	SNP	1.000	T
GREB1	9687	genome.wustl.edu	37	2	11727547	11727547	+	Intron	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr2:11727547C>T	ENST00000381486.2	+	10	1459				GREB1_ENST00000234142.5_Intron|GREB1_ENST00000263834.5_Missense_Mutation_p.P400L|RN7SL674P_ENST00000463397.2_RNA|GREB1_ENST00000381483.2_Intron	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1							integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		gcccttggtccggcagaacct	0.507																																					Ovarian(39;850 945 2785 23371 33093)	dbGAP											0													94.0	92.0	93.0					2																	11727547		2202	4299	6501	-	-	-	SO:0001627	intron_variant	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.1160-1325C>T	2.37:g.11727547C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Missense_Mutation	SNP	NULL	p.P400L	ENST00000381486.2	37	c.1199	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	C	0.455	-0.891710	0.02491	.	.	ENSG00000196208	ENST00000263834	T	0.17370	2.28	2.02	2.02	0.26589	.	.	.	.	.	T	0.10252	0.0251	.	.	.	0.21020	N	0.999809	B	0.34061	0.436	B	0.18263	0.021	T	0.19679	-1.0298	8	0.87932	D	0	.	7.555	0.27819	0.0:1.0:0.0:0.0	.	400	Q4ZG55-3	.	L	400	ENSP00000263834:P400L	ENSP00000263834:P400L	P	+	2	0	GREB1	11644998	0.000000	0.05858	0.059000	0.19551	0.003000	0.03518	-1.091000	0.03369	1.438000	0.47492	0.555000	0.69702	CCG	GREB1	-	NULL	ENSG00000196208		0.507	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	26	0.00	0	C	NM_014668		11727547	11727547	+1	no_errors	ENST00000263834	ensembl	human	known	69_37n	missense	77	28.70	31	SNP	0.066	T
GYG1	2992	genome.wustl.edu	37	3	148714088	148714088	+	Splice_Site	SNP	G	G	C			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr3:148714088G>C	ENST00000345003.4	+	3	443		c.e3-1		GYG1_ENST00000483267.1_Splice_Site|GYG1_ENST00000296048.6_Splice_Site|GYG1_ENST00000484197.1_Splice_Site	NM_004130.3	NP_004121.2	P46976	GLYG_HUMAN	glycogenin 1						carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogenin glucosyltransferase activity (GO:0008466)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|lung(3)|ovary(1)	8			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TATTTTGACAGAAAAGTTTTA	0.393																																						dbGAP											0													98.0	102.0	101.0					3																	148714088		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF087942	CCDS3139.1, CCDS54654.1, CCDS54655.1	3q24-q25.1	2013-02-22	2005-11-04	2005-11-04	ENSG00000163754	ENSG00000163754	2.4.1.186	"""Glycosyltransferase family 8 domain containing"""	4699	protein-coding gene	gene with protein product	"""glycogenin glucosyltransferase"""	603942	"""glycogenin"""	GYG		8602861	Standard	NM_004130		Approved		uc003ewn.3	P46976	OTTHUMG00000159533	ENST00000345003.4:c.144-1G>C	3.37:g.148714088G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNH0|D3DNH1|D3DNH2|Q6FHZ1|Q9UNV0	Splice_Site	SNP	-	e3-1	ENST00000345003.4	37	c.144-1	CCDS3139.1	3	.	.	.	.	.	.	.	.	.	.	G	19.75	3.885563	0.72410	.	.	ENSG00000163754	ENST00000345003;ENST00000296048;ENST00000483267;ENST00000484197;ENST00000492285;ENST00000461191;ENST00000473005	.	.	.	5.76	5.76	0.90799	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.9759	0.97304	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GYG1	150196778	1.000000	0.71417	0.978000	0.43139	0.853000	0.48598	8.528000	0.90598	2.713000	0.92767	0.655000	0.94253	.	GYG1	-	-	ENSG00000163754		0.393	GYG1-001	KNOWN	basic|CCDS	protein_coding	GYG1	HGNC	protein_coding	OTTHUMT00000356046.1	35	0.00	0	G	NM_004130	Intron	148714088	148714088	+1	no_errors	ENST00000345003	ensembl	human	known	69_37n	splice_site	60	25.00	20	SNP	1.000	C
HABP4	22927	genome.wustl.edu	37	9	99252296	99252296	+	Silent	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr9:99252296G>A	ENST00000375249.4	+	8	1293	c.1218G>A	c.(1216-1218)ccG>ccA	p.P406P	HABP4_ENST00000375251.3_Silent_p.P301P|HABP4_ENST00000466976.1_3'UTR	NM_014282.2	NP_055097.2			hyaluronan binding protein 4											NS(1)|cervix(2)|endometrium(1)|large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	13		Acute lymphoblastic leukemia(62;0.0169)|all_hematologic(171;0.214)				CAGATGACCCGGAAGATTTCC	0.522																																						dbGAP											0													91.0	89.0	90.0					9																	99252296		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF241831	CCDS6719.1	9q22.3-q31	2008-02-05			ENSG00000130956	ENSG00000130956			17062	protein-coding gene	gene with protein product						9523163, 10887182	Standard	XM_005251812		Approved	IHABP4, SERBP1L	uc010msg.3	Q5JVS0	OTTHUMG00000020298	ENST00000375249.4:c.1218G>A	9.37:g.99252296G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_HABP4_PAIRBP1-bd	p.P406	ENST00000375249.4	37	c.1218	CCDS6719.1	9																																																																																			HABP4	-	NULL	ENSG00000130956		0.522	HABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HABP4	HGNC	protein_coding	OTTHUMT00000053269.1	63	0.00	0	G	NM_014282		99252296	99252296	+1	no_errors	ENST00000375249	ensembl	human	known	69_37n	silent	96	11.11	12	SNP	0.976	A
IL1RL2	8808	genome.wustl.edu	37	2	102835485	102835485	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr2:102835485A>G	ENST00000264257.2	+	7	923	c.797A>G	c.(796-798)aAt>aGt	p.N266S	IL1RL2_ENST00000481806.1_3'UTR|IL1RL2_ENST00000441515.2_Missense_Mutation_p.N148S|IL1RL2_ENST00000539491.1_Missense_Mutation_p.N266S	NM_003854.2	NP_003845.2	Q9HB29	ILRL2_HUMAN	interleukin 1 receptor-like 2	266	Ig-like C2-type 3.				cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of T cell differentiation (GO:0045582)|regulation of inflammatory response (GO:0050727)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type I, activating receptor activity (GO:0004909)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|liver(2)|lung(8)|ovary(2)|prostate(1)	26						TGGAGAGTCAATAACACTTTG	0.383																																						dbGAP											0													182.0	163.0	169.0					2																	102835485		2203	4300	6503	-	-	-	SO:0001583	missense	0			U49065	CCDS2056.1	2q12	2013-01-14			ENSG00000115598	ENSG00000115598		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5999	protein-coding gene	gene with protein product		604512				8898719, 10191101, 11466363	Standard	NM_003854		Approved	IL1R-rp2, IL1RRP2	uc002tbs.3	Q9HB29	OTTHUMG00000130776	ENST00000264257.2:c.797A>G	2.37:g.102835485A>G	ENSP00000264257:p.Asn266Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU63|Q13525|Q45H74|Q53TU8|Q587I8	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II,prints_IL1R_rcpt	p.N266S	ENST00000264257.2	37	c.797	CCDS2056.1	2	.	.	.	.	.	.	.	.	.	.	A	13.05	2.121336	0.37436	.	.	ENSG00000115598	ENST00000264257;ENST00000441515;ENST00000539491	T;T;T	0.16597	2.33;2.33;2.33	4.8	2.41	0.29592	.	0.686268	0.14750	N	0.300641	T	0.31327	0.0793	M	0.66939	2.045	0.19575	N	0.999967	P;D	0.56035	0.931;0.974	P;P	0.61722	0.688;0.893	T	0.06534	-1.0821	10	0.45353	T	0.12	.	6.4067	0.21668	0.8049:0.0:0.1951:0.0	.	148;266	A4FU63;Q9HB29	.;ILRL2_HUMAN	S	266;148;266	ENSP00000264257:N266S;ENSP00000413348:N148S;ENSP00000442184:N266S	ENSP00000264257:N266S	N	+	2	0	IL1RL2	102201917	0.901000	0.30685	0.019000	0.16419	0.487000	0.33371	2.088000	0.41663	0.420000	0.25954	-0.256000	0.11100	AAT	IL1RL2	-	smart_Ig_sub	ENSG00000115598		0.383	IL1RL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RL2	HGNC	protein_coding	OTTHUMT00000253290.1	58	0.00	0	A	NM_003854		102835485	102835485	+1	no_errors	ENST00000264257	ensembl	human	known	69_37n	missense	123	25.90	43	SNP	0.178	G
IL4R	3566	genome.wustl.edu	37	16	27375082	27375082	+	Silent	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr16:27375082G>A	ENST00000395762.2	+	11	2668	c.2409G>A	c.(2407-2409)caG>caA	p.Q803Q	IL4R_ENST00000543915.2_Silent_p.Q803Q|IL4R_ENST00000170630.2_Silent_p.Q803Q|IL4R_ENST00000380922.3_Silent_p.Q788Q	NM_000418.3	NP_000409.1	P24394	IL4RA_HUMAN	interleukin 4 receptor	803					defense response to protozoan (GO:0042832)|immune response (GO:0006955)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|ovulation (GO:0030728)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of macrophage activation (GO:0043032)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|production of molecular mediator involved in inflammatory response (GO:0002532)|regulation of cell proliferation (GO:0042127)|response to estrogen (GO:0043627)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	interleukin-4 receptor activity (GO:0004913)|receptor signaling protein activity (GO:0005057)			breast(3)|endometrium(2)|kidney(2)|large_intestine(2)|lung(15)|ovary(2)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	33						GCAATGCTCAGAGCTCAAGCC	0.557																																						dbGAP											0													103.0	102.0	102.0					16																	27375082		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			X52425	CCDS10629.1, CCDS58441.1	16p12.1-p11.2	2008-05-14			ENSG00000077238	ENSG00000077238		"""Interleukins and interleukin receptors"", ""CD molecules"""	6015	protein-coding gene	gene with protein product		147781				1679753	Standard	NM_000418		Approved	CD124	uc010bxy.4	P24394	OTTHUMG00000097015	ENST00000395762.2:c.2409G>A	16.37:g.27375082G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E076|B9EKU8|H3BSY5|Q96P01|Q9H181|Q9H182|Q9H183|Q9H184|Q9H185|Q9H186|Q9H187|Q9H188	Silent	SNP	pfam_IL4Ra_N,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q803	ENST00000395762.2	37	c.2409	CCDS10629.1	16																																																																																			IL4R	-	NULL	ENSG00000077238		0.557	IL4R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL4R	HGNC	protein_coding	OTTHUMT00000214104.4	25	0.00	0	G			27375082	27375082	+1	no_errors	ENST00000170630	ensembl	human	known	69_37n	silent	44	36.23	25	SNP	0.002	A
IQCA1	79781	genome.wustl.edu	37	2	237405937	237405937	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr2:237405937G>A	ENST00000409907.3	-	2	479	c.205C>T	c.(205-207)Cga>Tga	p.R69*	IQCA1_ENST00000309507.5_Nonsense_Mutation_p.R65*|IQCA1_ENST00000431676.2_Nonsense_Mutation_p.R69*	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	69							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						ATCAGTATTCGTTTCTGGGGG	0.478																																						dbGAP											0													68.0	69.0	69.0					2																	237405937		1929	4126	6055	-	-	-	SO:0001587	stop_gained	0			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.205C>T	2.37:g.237405937G>A	ENSP00000387347:p.Arg69*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Nonsense_Mutation	SNP	pfam_ATPase_AAA_core,pfscan_IQ_motif_EF-hand-BS	p.R69*	ENST00000409907.3	37	c.205	CCDS46549.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	7.931159|7.931159	0.98568|0.98568	.|.	.|.	ENSG00000132321|ENSG00000132321	ENST00000409907;ENST00000457693;ENST00000309507;ENST00000431676;ENST00000412437|ENST00000418802	.|.	.|.	.|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	0.000000|.	0.52532|.	D|.	0.000062|.	.|T	.|0.76579	.|0.4007	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.75068	.|-0.3448	.|3	0.02654|.	T|.	1|.	.|.	19.4741|19.4741	0.94979|0.94979	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|M	69;76;65;69;65|87	.|.	ENSP00000254653:R69X|.	R|T	-|-	1|2	2|0	IQCA1|IQCA1	237070676|237070676	1.000000|1.000000	0.71417|0.71417	0.860000|0.860000	0.33809|0.33809	0.739000|0.739000	0.42172|0.42172	7.162000|7.162000	0.77515|0.77515	2.595000|2.595000	0.87683|0.87683	0.655000|0.655000	0.94253|0.94253	CGA|ACG	IQCA1	-	NULL	ENSG00000132321		0.478	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	HGNC	protein_coding	OTTHUMT00000329266.1	39	0.00	0	G	NM_024726		237405937	237405937	-1	no_errors	ENST00000409907	ensembl	human	known	69_37n	nonsense	54	23.94	17	SNP	1.000	A
IRAK2	3656	genome.wustl.edu	37	3	10254979	10254979	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr3:10254979C>T	ENST00000256458.4	+	5	707	c.617C>T	c.(616-618)gCa>gTa	p.A206V		NM_001570.3	NP_001561.3	O43187	IRAK2_HUMAN	interleukin-1 receptor-associated kinase 2	206					activation of MAPK activity (GO:0000187)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1-mediated signaling pathway (GO:0070498)|JNK cascade (GO:0007254)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein phosphorylation (GO:0006468)|regulation of cytokine-mediated signaling pathway (GO:0001959)|response to interleukin-1 (GO:0070555)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)			breast(4)|large_intestine(8)|lung(11)|prostate(1)|stomach(1)	25						GTGGTCCAGGCAACCGATGAC	0.532																																						dbGAP											0													82.0	77.0	79.0					3																	10254979		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026273	CCDS33697.1	3p25.2	2008-08-18			ENSG00000134070	ENSG00000134070			6113	protein-coding gene	gene with protein product		603304				9374458	Standard	XR_245126		Approved		uc003bve.1	O43187	OTTHUMG00000155358	ENST00000256458.4:c.617C>T	3.37:g.10254979C>T	ENSP00000256458:p.Ala206Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQZ6|Q08AG6|Q5K546	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A206V	ENST00000256458.4	37	c.617	CCDS33697.1	3	.	.	.	.	.	.	.	.	.	.	C	25.7	4.670093	0.88348	.	.	ENSG00000134070	ENST00000256458	T	0.35605	1.3	5.48	5.48	0.80851	Protein kinase-like domain (1);	0.000000	0.64402	D	0.000017	T	0.40448	0.1117	N	0.08118	0	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.46569	-0.9182	10	0.51188	T	0.08	-18.682	15.214	0.73250	0.0:1.0:0.0:0.0	.	206	O43187	IRAK2_HUMAN	V	206	ENSP00000256458:A206V	ENSP00000256458:A206V	A	+	2	0	IRAK2	10229979	0.995000	0.38212	0.997000	0.53966	0.822000	0.46500	2.828000	0.48120	2.730000	0.93505	0.655000	0.94253	GCA	IRAK2	-	superfamily_Kinase-like_dom	ENSG00000134070		0.532	IRAK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRAK2	HGNC	protein_coding	OTTHUMT00000339623.1	44	0.00	0	C			10254979	10254979	+1	no_errors	ENST00000256458	ensembl	human	known	69_37n	missense	59	31.03	27	SNP	1.000	T
KIAA2018	205717	genome.wustl.edu	37	3	113374108	113374108	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr3:113374108C>T	ENST00000478658.1	-	5	6438	c.6421G>A	c.(6421-6423)Gag>Aag	p.E2141K	KIAA2018_ENST00000316407.4_Missense_Mutation_p.E2141K|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	2141						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTTACCTTCTCTGTGCTAGGA	0.423																																						dbGAP											0													149.0	139.0	143.0					3																	113374108		1914	4114	6028	-	-	-	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.6421G>A	3.37:g.113374108C>T	ENSP00000420721:p.Glu2141Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.E2141K	ENST00000478658.1	37	c.6421	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241939	0.79912	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.19394	2.15;2.15	5.36	5.36	0.76844	.	0.059181	0.64402	D	0.000002	T	0.30823	0.0777	N	0.19112	0.55	0.80722	D	1	D	0.67145	0.996	P	0.60415	0.874	T	0.11446	-1.0587	10	0.72032	D	0.01	-12.4873	19.0841	0.93196	0.0:1.0:0.0:0.0	.	2141	Q68DE3	K2018_HUMAN	K	2141	ENSP00000320794:E2141K;ENSP00000420721:E2141K	ENSP00000320794:E2141K	E	-	1	0	KIAA2018	114856798	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.504000	0.84457	0.462000	0.41574	GAG	KIAA2018	-	NULL	ENSG00000176542		0.423	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	69	0.00	0	C	NM_001009899		113374108	113374108	-1	no_errors	ENST00000316407	ensembl	human	known	69_37n	missense	126	26.32	45	SNP	1.000	T
KALRN	8997	genome.wustl.edu	37	3	124415017	124415017	+	Silent	SNP	G	G	C	rs150310200		TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr3:124415017G>C	ENST00000291478.5	+	21	2686	c.2523G>C	c.(2521-2523)ctG>ctC	p.L841L	AC080008.1_ENST00000584173.1_RNA|KALRN_ENST00000360013.3_Silent_p.L2538L|KALRN_ENST00000428018.2_Silent_p.L809L	NM_007064.3	NP_008995.2	O60229	KALRN_HUMAN	kalirin, RhoGEF kinase	2537					apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						TCTGTAATCTGATGCCCCAAG	0.458																																						dbGAP											0													168.0	162.0	164.0					3																	124415017		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000291478.5:c.2523G>C	3.37:g.124415017G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	Nonstop_Mutation	SNP	pfam_DH-domain,pfam_Prot_kinase_cat_dom,pfam_Spectrin_repeat,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_CRAL-TRIO_dom,pfscan_Fibronectin_type3,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.*2507S	ENST00000291478.5	37	c.7520	CCDS3028.1	3	.	.	.	.	.	.	.	.	.	.	G	9.563	1.118908	0.20877	.	.	ENSG00000160145	ENST00000354186	.	.	.	5.62	3.69	0.42338	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.7584	0.51888	0.0:0.1446:0.7232:0.1321	.	.	.	.	S	2507	.	.	X	+	2	2	KALRN	125897707	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.810000	0.47979	1.356000	0.45884	0.655000	0.94253	TGA	KALRN	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000160145		0.458	KALRN-001	KNOWN	basic|CCDS	protein_coding	KALRN	HGNC	protein_coding	OTTHUMT00000246891.5	41	0.00	0	G	NM_003947		124415017	124415017	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000354186	ensembl	human	novel	69_37n	nonstop	93	13.89	15	SNP	1.000	C
KIF26B	55083	genome.wustl.edu	37	1	245704136	245704136	+	Nonsense_Mutation	SNP	G	G	T	rs369365294		TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:245704136G>T	ENST00000407071.2	+	5	1674	c.1234G>T	c.(1234-1236)Gaa>Taa	p.E412*	KIF26B_ENST00000366518.4_Nonsense_Mutation_p.E31*	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	412					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			TTCCGCTGCCGAACCACCGCT	0.527																																						dbGAP											0													86.0	87.0	87.0					1																	245704136		1876	4099	5975	-	-	-	SO:0001587	stop_gained	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.1234G>T	1.37:g.245704136G>T	ENSP00000385545:p.Glu412*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Nonsense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E412*	ENST00000407071.2	37	c.1234	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.113495	0.98659	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	.	.	.	5.44	4.51	0.55191	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	16.1009	0.81169	0.0:0.1341:0.8659:0.0	.	.	.	.	X	412;31;28	.	ENSP00000355475:E31X	E	+	1	0	KIF26B	243770759	1.000000	0.71417	0.083000	0.20561	0.003000	0.03518	7.610000	0.82949	1.241000	0.43820	0.655000	0.94253	GAA	KIF26B	-	NULL	ENSG00000162849		0.527	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	32	0.00	0	G	XM_371354		245704136	245704136	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	nonsense	76	26.92	28	SNP	0.998	T
KRT24	192666	genome.wustl.edu	37	17	38855709	38855709	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr17:38855709C>G	ENST00000264651.2	-	6	1404	c.1348G>C	c.(1348-1350)Gat>Cat	p.D450H		NM_019016.2	NP_061889.2	Q2M2I5	K1C24_HUMAN	keratin 24	450	Coil 2.|Rod.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29		Breast(137;0.00526)				CCCTCTCCATCGAGCAGGCGG	0.463																																					GBM(61;380 1051 14702 23642 31441)	dbGAP											0													135.0	134.0	135.0					17																	38855709		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11372.1	17q21.2	2013-06-25			ENSG00000167916	ENSG00000167916		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	18527	protein-coding gene	gene with protein product		607742				16831889	Standard	NM_019016		Approved	FLJ20261, MGC138169, MGC138173	uc002hvd.3	Q2M2I5	OTTHUMG00000133372	ENST00000264651.2:c.1348G>C	17.37:g.38855709C>G	ENSP00000264651:p.Asp450His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NXG7	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.D450H	ENST00000264651.2	37	c.1348	CCDS11372.1	17	.	.	.	.	.	.	.	.	.	.	C	17.91	3.505412	0.64410	.	.	ENSG00000167916	ENST00000264651	D	0.89681	-2.55	5.62	2.42	0.29668	Filament (1);Intermediate filament protein, conserved site (1);	.	.	.	.	D	0.91147	0.7212	H	0.94771	3.58	0.37409	D	0.913163	B	0.26902	0.163	B	0.29598	0.104	D	0.89062	0.3463	9	0.87932	D	0	.	9.4282	0.38592	0.0:0.7495:0.1184:0.1321	.	450	Q2M2I5	K1C24_HUMAN	H	450	ENSP00000264651:D450H	ENSP00000264651:D450H	D	-	1	0	KRT24	36109235	0.842000	0.29525	0.204000	0.23530	0.870000	0.49936	1.719000	0.38011	0.279000	0.22186	0.591000	0.81541	GAT	KRT24	-	pfam_F	ENSG00000167916		0.463	KRT24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT24	HGNC	protein_coding	OTTHUMT00000257217.1	35	0.00	0	C	NM_019016		38855709	38855709	-1	no_errors	ENST00000264651	ensembl	human	known	69_37n	missense	93	20.51	24	SNP	0.988	G
LDLRAD3	143458	genome.wustl.edu	37	11	36119974	36119974	+	Silent	SNP	A	A	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr11:36119974A>G	ENST00000315571.5	+	4	438	c.417A>G	c.(415-417)caA>caG	p.Q139Q	LDLRAD3_ENST00000528989.1_Silent_p.Q90Q|LDLRAD3_ENST00000524419.1_Silent_p.Q90Q	NM_174902.2	NP_777562.1	Q86YD5	LRAD3_HUMAN	low density lipoprotein receptor class A domain containing 3	139	LDL-receptor class A 3. {ECO:0000255|PROSITE-ProRule:PRU00124}.				receptor-mediated endocytosis (GO:0006898)|regulation of protein processing (GO:0070613)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|prostate(7)|skin(1)	28	all_lung(20;0.089)|Lung NSC(22;0.175)|all_epithelial(35;0.177)	all_hematologic(20;0.124)				ATAACTGTCAAGACAACAGTG	0.473																																						dbGAP											0													101.0	86.0	91.0					11																	36119974		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AK075546	CCDS31462.1	11p13	2014-06-05			ENSG00000179241	ENSG00000179241			27046	protein-coding gene	gene with protein product						21795536	Standard	NM_174902		Approved	LRAD3	uc001mwk.1	Q86YD5	OTTHUMG00000166313	ENST00000315571.5:c.417A>G	11.37:g.36119974A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1U3|B9EG81|Q8NBJ0	Silent	SNP	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	p.Q139	ENST00000315571.5	37	c.417	CCDS31462.1	11																																																																																			LDLRAD3	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000179241		0.473	LDLRAD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDLRAD3	HGNC	protein_coding	OTTHUMT00000389085.1	25	0.00	0	A	NM_174902		36119974	36119974	+1	no_errors	ENST00000315571	ensembl	human	known	69_37n	silent	27	46.15	24	SNP	0.496	G
MARCH8	220972	genome.wustl.edu	37	10	45956754	45956754	+	Silent	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr10:45956754C>T	ENST00000319836.3	-	5	1097	c.348G>A	c.(346-348)aaG>aaA	p.K116K	MARCH8_ENST00000395771.3_Silent_p.K116K|MARCH8_ENST00000453424.2_Silent_p.K398K|MARCH8_ENST00000395769.2_Silent_p.K116K|MARCH8_ENST00000476962.1_5'UTR	NM_145021.4	NP_659458.2	Q5T0T0	MARH8_HUMAN	membrane-associated ring finger (C3HC4) 8, E3 ubiquitin protein ligase	116					immune system process (GO:0002376)|protein polyubiquitination (GO:0000209)	cytoplasmic vesicle (GO:0031410)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)|lung(4)	12						TGTCGGAGCTCTTGATCCACT	0.577																																					NSCLC(102;658 1594 2173 16344 34808)	dbGAP											0													72.0	68.0	70.0					10																	45956754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL833316	CCDS7213.1, CCDS60519.1	10q11.22	2013-01-09	2012-02-23	2005-01-27	ENSG00000165406	ENSG00000165406		"""MARCH membrane-associated ring fingers"", ""RING-type (C3HC4) zinc fingers"""	23356	protein-coding gene	gene with protein product		613335	"""c-mir, cellular modulator of immune recognition"", ""membrane-associated ring finger (C3HC4) 8"""	MIR		12582153, 14722266	Standard	XM_005271804		Approved	c-MIR, MARCH-VIII, RNF178	uc001jch.2	Q5T0T0	OTTHUMG00000019345	ENST00000319836.3:c.348G>A	10.37:g.45956754C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8E7|H0Y7C6|Q5T0S8|Q8TC72	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	p.E281K	ENST00000319836.3	37	c.841	CCDS7213.1	10	.	.	.	.	.	.	.	.	.	.	C	10.59	1.393828	0.25205	.	.	ENSG00000165406	ENST00000453424	.	.	.	5.72	4.8	0.61643	.	.	.	.	.	T	0.64853	0.2636	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61073	-0.7136	4	.	.	.	-35.9266	13.2914	0.60272	0.0:0.919:0.0:0.081	.	.	.	.	K	281	.	.	E	-	1	0	MARCH8	45276760	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.677000	0.61634	2.865000	0.98341	0.655000	0.94253	GAG	MARCH8	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,pfscan_Znf_RING	ENSG00000165406		0.577	MARCH8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCH8	HGNC	protein_coding	OTTHUMT00000051217.1	20	0.00	0	C	NM_145021		45956754	45956754	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453424	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	T
MAST3	23031	genome.wustl.edu	37	19	18234421	18234421	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr19:18234421G>A	ENST00000262811.6	+	7	502	c.502G>A	c.(502-504)Gag>Aag	p.E168K	MAST3_ENST00000608648.1_3'UTR	NM_015016.1	NP_055831.1	O60307	MAST3_HUMAN	microtubule associated serine/threonine kinase 3	168							ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(8)|lung(6)|ovary(4)|pancreas(1)|stomach(1)	31						CTTCGACAATGAGATTGTCAT	0.597																																						dbGAP											0													42.0	43.0	43.0					19																	18234421		1942	4124	6066	-	-	-	SO:0001583	missense	0			AB011133	CCDS46014.1	19p13	2008-02-05				ENSG00000099308			19036	protein-coding gene	gene with protein product		612258					Standard	NM_015016		Approved	KIAA0561	uc002nhz.4	O60307		ENST00000262811.6:c.502G>A	19.37:g.18234421G>A	ENSP00000262811:p.Glu168Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7LDZ8|Q9UPI0	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.E168K	ENST00000262811.6	37	c.502	CCDS46014.1	19	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359014	0.82353	.	.	ENSG00000099308	ENST00000262811	T	0.43294	0.95	4.69	4.69	0.59074	Microtubule-associated serine/threonine-protein kinase, domain (1);	.	.	.	.	T	0.57080	0.2029	M	0.86268	2.805	0.54753	D	0.999981	P	0.35656	0.514	B	0.42625	0.393	T	0.66296	-0.5959	9	0.87932	D	0	-21.304	16.9486	0.86237	0.0:0.0:1.0:0.0	.	168	O60307	MAST3_HUMAN	K	168	ENSP00000262811:E168K	ENSP00000262811:E168K	E	+	1	0	MAST3	18095421	1.000000	0.71417	0.999000	0.59377	0.413000	0.31143	7.877000	0.87225	2.324000	0.78689	0.484000	0.47621	GAG	MAST3	-	pfam_MA_Ser/Thr_Kinase_dom	ENSG00000099308		0.597	MAST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST3	HGNC	protein_coding	OTTHUMT00000466526.2	26	0.00	0	G	XM_038150		18234421	18234421	+1	no_errors	ENST00000262811	ensembl	human	known	69_37n	missense	50	27.54	19	SNP	1.000	A
MDH1B	130752	genome.wustl.edu	37	2	207610374	207610374	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr2:207610374G>T	ENST00000374412.3	-	9	1655	c.1380C>A	c.(1378-1380)gaC>gaA	p.D460E	MDH1B_ENST00000392214.2_Missense_Mutation_p.D247E|MDH1B_ENST00000449792.1_Missense_Mutation_p.D362E|MDH1B_ENST00000454776.2_Missense_Mutation_p.D460E	NM_001039845.1|NM_001282940.1	NP_001034934.1|NP_001269869.1	Q5I0G3	MDH1B_HUMAN	malate dehydrogenase 1B, NAD (soluble)	460					carbohydrate metabolic process (GO:0005975)|malate metabolic process (GO:0006108)|tricarboxylic acid cycle (GO:0006099)		malate dehydrogenase activity (GO:0016615)|oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor (GO:0016616)			NS(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(14)|ovary(4)|stomach(1)	34				LUSC - Lung squamous cell carcinoma(261;0.0763)|Epithelial(149;0.131)|Lung(261;0.145)		AATGTATCTTGTCTCCAAGTG	0.279																																					Pancreas(76;29 1355 28675 37177 51207)	dbGAP											0													84.0	83.0	83.0					2																	207610374		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33365.1, CCDS63102.1	2q33.3	2008-05-27			ENSG00000138400	ENSG00000138400			17836	protein-coding gene	gene with protein product							Standard	NM_001039845		Approved	FLJ25341, RP11-95H11	uc002vbs.3	Q5I0G3	OTTHUMG00000132918	ENST00000374412.3:c.1380C>A	2.37:g.207610374G>T	ENSP00000363533:p.Asp460Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8M1|Q53TK9|Q8IV51	Missense_Mutation	SNP	pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C	p.D460E	ENST00000374412.3	37	c.1380	CCDS33365.1	2	.	.	.	.	.	.	.	.	.	.	G	3.652	-0.071380	0.07228	.	.	ENSG00000138400	ENST00000374412;ENST00000449792;ENST00000454776;ENST00000392214	T;T;T	0.29142	1.59;1.58;1.59	5.14	-4.05	0.03998	.	0.616320	0.17044	N	0.189211	T	0.08133	0.0203	N	0.05124	-0.11	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.002	T	0.27468	-1.0073	10	0.09084	T	0.74	-11.692	0.8715	0.01215	0.2372:0.139:0.1657:0.4581	.	460;460	Q5I0G3-2;Q5I0G3	.;MDH1B_HUMAN	E	460;362;460;247	ENSP00000363533:D460E;ENSP00000416577:D362E;ENSP00000389916:D460E	ENSP00000363533:D460E	D	-	3	2	MDH1B	207318619	0.016000	0.18221	0.025000	0.17156	0.520000	0.34377	-0.868000	0.04236	-0.376000	0.07943	0.455000	0.32223	GAC	MDH1B	-	NULL	ENSG00000138400		0.279	MDH1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDH1B	HGNC	protein_coding	OTTHUMT00000256429.2	48	0.00	0	G	NM_001039845		207610374	207610374	-1	no_errors	ENST00000374412	ensembl	human	known	69_37n	missense	102	24.44	33	SNP	0.014	T
MST1L	11223	genome.wustl.edu	37	1	17085614	17085614	+	RNA	SNP	G	G	A	rs3891100	byFrequency	TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:17085614G>A	ENST00000455405.2	-	0	0							Q2TV78	MST1L_HUMAN	macrophage stimulating 1-like							extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)										CACCCTTGCGGGTCTTGCTGA	0.736																																						dbGAP											0																																										-	-	-			0			U28055, AF083416		1p36.33	2013-03-27	2012-11-09	2012-11-09	ENSG00000186715	ENSG00000186715			7390	other	unknown			"""macrophage stimulating, pseudogene 7"", ""macrophage stimulating, pseudogene 9"", ""macrophage stimulating 1 (hepatocyte growth factor-like) pseudogene 9"""	MSTP7, MSTP9, MST1P9		10728827	Standard	NM_001271733		Approved	D1F15S1A, MSPL7, MSPL-7	uc010ock.3	Q2TV78	OTTHUMG00000002578		1.37:g.17085614G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPB1|Q13209	Silent	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_PAN-1_domain,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Pan_app,smart_Kringle,smart_Peptidase_S1_S6,pfscan_Pan_app,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.T369	ENST00000455405.2	37	c.1107		1																																																																																			MST1P9	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000186715		0.736	MST1L-002	KNOWN	basic	processed_transcript	MST1P9	HGNC	pseudogene	OTTHUMT00000400328.1	18	0.00	0	G	NM_001271733		17085614	17085614	-1	no_errors	ENST00000334998	ensembl	human	known	69_37n	silent	18	25.00	6	SNP	1.000	A
MUC5B	727897	genome.wustl.edu	37	11	1272374	1272374	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr11:1272374C>G	ENST00000529681.1	+	31	14322	c.14264C>G	c.(14263-14265)tCc>tGc	p.S4755C	MUC5B_ENST00000447027.1_Missense_Mutation_p.S4758C|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4755	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCCATCCCCTCCTCCACCCTG	0.577																																						dbGAP											0													171.0	194.0	186.0					11																	1272374		2168	4251	6419	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14264C>G	11.37:g.1272374C>G	ENSP00000436812:p.Ser4755Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.S4758C	ENST00000529681.1	37	c.14273	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	2.753	-0.259548	0.05791	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000535652	T;T	0.18657	2.2;2.39	1.83	-3.67	0.04476	.	.	.	.	.	T	0.21801	0.0525	M	0.68952	2.095	0.09310	N	1	B	0.09022	0.002	B	0.11329	0.006	T	0.38394	-0.9663	9	0.87932	D	0	.	10.3654	0.44021	0.0:0.7053:0.2947:0.0	.	4758	E9PBJ0	.	C	4755;4758;4699;528	ENSP00000436812:S4755C;ENSP00000415793:S4758C	ENSP00000343037:S4699C	S	+	2	0	MUC5B	1228950	0.000000	0.05858	0.002000	0.10522	0.020000	0.10135	-0.736000	0.04882	-0.701000	0.05063	0.194000	0.17425	TCC	MUC5B	-	NULL	ENSG00000117983		0.577	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	140	0.00	0	C	XM_001126093		1272374	1272374	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	324	26.97	120	SNP	0.004	G
MYH9	4627	genome.wustl.edu	37	22	36737526	36737526	+	Silent	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr22:36737526G>A	ENST00000216181.5	-	3	609	c.379C>T	c.(379-381)Ctg>Ttg	p.L127L	MYH9_ENST00000401701.1_Silent_p.L127L	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	127	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TAGATGGGCAGGTTCTTGTAA	0.478			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													145.0	119.0	128.0					22																	36737526		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.379C>T	22.37:g.36737526G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.L127	ENST00000216181.5	37	c.379	CCDS13927.1	22																																																																																			MYH9	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000100345		0.478	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	64	0.00	0	G	NM_002473		36737526	36737526	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	silent	104	24.64	34	SNP	1.000	A
MROH6	642475	genome.wustl.edu	37	8	144657482	144657482	+	5'Flank	SNP	T	T	C			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr8:144657482T>C	ENST00000398882.3	-	0	0				NAPRT1_ENST00000460623.1_5'UTR|NAPRT1_ENST00000435154.3_Missense_Mutation_p.E442G|NAPRT1_ENST00000426292.3_Missense_Mutation_p.E442G|RP11-661A12.9_ENST00000531730.1_RNA|NAPRT1_ENST00000449291.2_Missense_Mutation_p.E442G|NAPRT1_ENST00000276844.7_Missense_Mutation_p.E442G	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6																		CACTGGCTCTTCTGCTAACTG	0.657																																						dbGAP											0													50.0	53.0	52.0					8																	144657482		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164		8.37:g.144657482T>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWB1	Missense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nic_PRibTrfase-rel,tigrfam_Nic_PRibTrfase_put	p.E442G	ENST00000398882.3	37	c.1325	CCDS47928.1	8	.	.	.	.	.	.	.	.	.	.	T	8.140	0.784997	0.16189	.	.	ENSG00000147813	ENST00000435154;ENST00000449291;ENST00000340490;ENST00000426292;ENST00000276844	T;T;T;T;T	0.47177	0.86;0.86;0.85;0.85;0.86	4.67	4.67	0.58626	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.404849	0.27768	N	0.017927	T	0.34077	0.0885	L	0.38175	1.15	0.27898	N	0.939067	P;B;P;P	0.47910	0.842;0.01;0.902;0.842	B;B;B;B	0.37601	0.13;0.023;0.254;0.13	T	0.25745	-1.0123	10	0.30854	T	0.27	-15.7903	12.0315	0.53399	0.0:0.0:0.0:1.0	.	442;442;442;442	C9J8U2;G5E977;Q6XQN6-3;Q6XQN6	.;.;.;PNCB_HUMAN	G	442	ENSP00000405670:E442G;ENSP00000401508:E442G;ENSP00000341136:E442G;ENSP00000390949:E442G;ENSP00000276844:E442G	ENSP00000276844:E442G	E	-	2	0	NAPRT1	144728625	0.002000	0.14202	0.995000	0.50966	0.065000	0.16274	0.907000	0.28531	1.968000	0.57251	0.529000	0.55759	GAA	NAPRT1	-	superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nic_PRibTrfase-rel,tigrfam_Nic_PRibTrfase_put	ENSG00000147813		0.657	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAPRT1	HGNC	protein_coding	OTTHUMT00000382330.3	27	0.00	0	T	NM_001100878		144657482	144657482	-1	no_errors	ENST00000276844	ensembl	human	known	69_37n	missense	33	31.25	15	SNP	0.993	C
NES	10763	genome.wustl.edu	37	1	156640448	156640448	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:156640448C>T	ENST00000368223.3	-	4	3664	c.3532G>A	c.(3532-3534)Gag>Aag	p.E1178K		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1178	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTGGGGGCCTCAGCCTCTGAC	0.647																																						dbGAP											0													67.0	72.0	70.0					1																	156640448		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3532G>A	1.37:g.156640448C>T	ENSP00000357206:p.Glu1178Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_F	p.E1178K	ENST00000368223.3	37	c.3532	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431445	0.62844	.	.	ENSG00000132688	ENST00000368223	D	0.86562	-2.14	4.31	1.2	0.21068	.	0.810055	0.10080	N	0.718534	T	0.70334	0.3212	L	0.53249	1.67	0.09310	N	1	B	0.18461	0.028	B	0.11329	0.006	T	0.63620	-0.6596	10	0.59425	D	0.04	.	6.3141	0.21180	0.0:0.6692:0.1502:0.1805	.	1178	P48681	NEST_HUMAN	K	1178	ENSP00000357206:E1178K	ENSP00000357206:E1178K	E	-	1	0	NES	154907072	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.544000	0.23253	0.240000	0.21263	0.455000	0.32223	GAG	NES	-	NULL	ENSG00000132688		0.647	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	13	0.00	0	C	NM_006617		156640448	156640448	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	missense	34	17.07	7	SNP	0.000	T
NLN	57486	genome.wustl.edu	37	5	65084087	65084087	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr5:65084087G>C	ENST00000380985.5	+	8	1279	c.1101G>C	c.(1099-1101)caG>caC	p.Q367H	NLN_ENST00000502464.1_Missense_Mutation_p.Q263H	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	367						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		ACATGACTCAGACAGAGGAAC	0.403																																						dbGAP											0													126.0	131.0	129.0					5																	65084087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.1101G>C	5.37:g.65084087G>C	ENSP00000370372:p.Gln367His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULJ4	Missense_Mutation	SNP	pfam_Pept_M3A_M3B	p.Q367H	ENST00000380985.5	37	c.1101	CCDS3989.1	5	.	.	.	.	.	.	.	.	.	.	G	16.60	3.169029	0.57584	.	.	ENSG00000123213	ENST00000380985;ENST00000502464;ENST00000340159;ENST00000511299	T;T;T	0.08370	3.1;3.1;3.1	6.07	2.28	0.28536	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.331465	0.36932	N	0.002329	T	0.26955	0.0660	M	0.89095	3.005	0.39524	D	0.968556	D;D;P	0.65815	0.995;0.958;0.948	P;P;P	0.59761	0.831;0.863;0.635	T	0.05338	-1.0891	10	0.72032	D	0.01	-0.3538	10.0406	0.42155	0.3631:0.0:0.6369:0.0	.	62;367;367	Q96K48;Q9BYT8;Q9BQD0	.;NEUL_HUMAN;.	H	367;263;367;95	ENSP00000370372:Q367H;ENSP00000423214:Q263H;ENSP00000427417:Q95H	ENSP00000339283:Q367H	Q	+	3	2	NLN	65119843	1.000000	0.71417	0.926000	0.36857	0.984000	0.73092	1.216000	0.32443	0.134000	0.18681	-0.126000	0.14955	CAG	NLN	-	pfam_Pept_M3A_M3B	ENSG00000123213		0.403	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLN	HGNC	protein_coding	OTTHUMT00000215060.1	24	0.00	0	G			65084087	65084087	+1	no_errors	ENST00000380985	ensembl	human	known	69_37n	missense	67	33.00	33	SNP	0.960	C
NRIP1	8204	genome.wustl.edu	37	21	16339570	16339570	+	Frame_Shift_Del	DEL	T	T	-	rs2228507	byFrequency	TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr21:16339570delT	ENST00000400202.1	-	3	1656	c.944delA	c.(943-945)tacfs	p.Y315fs	NRIP1_ENST00000318948.4_Frame_Shift_Del_p.Y315fs|NRIP1_ENST00000400199.1_Frame_Shift_Del_p.Y315fs			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	315	Interaction with ZNF366.|Repression domain 1.		Y -> F (in dbSNP:rs2228507).		androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		TGGGAGCTGGTAACTGCCAAC	0.423																																						dbGAP											0													61.0	58.0	59.0					21																	16339570		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.944delA	21.37:g.16339570delT	ENSP00000383063:p.Tyr315fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWE8	Frame_Shift_Del	DEL	NULL	p.Y315fs	ENST00000400202.1	37	c.944	CCDS13568.1	21																																																																																			NRIP1	-	NULL	ENSG00000180530		0.423	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	34	0.00	0	T	NM_003489		16339570	16339570	-1	no_errors	ENST00000318948	ensembl	human	known	69_37n	frame_shift_del	57	14.93	10	DEL	0.379	-
OR4N5	390437	genome.wustl.edu	37	14	20612762	20612762	+	Missense_Mutation	SNP	C	C	T	rs199690567		TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr14:20612762C>T	ENST00000333629.1	+	1	868	c.868C>T	c.(868-870)Cgc>Tgc	p.R290C	RNA5SP381_ENST00000516076.1_RNA	NM_001004724.1	NP_001004724.1	Q8IXE1	OR4N5_HUMAN	olfactory receptor, family 4, subfamily N, member 5	290			R -> H (in dbSNP:rs10141025).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R290C(1)		endometrium(2)|lung(23)|ovary(1)|skin(2)|urinary_tract(1)	29	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.84e-06)	GBM - Glioblastoma multiforme(265;0.0143)		TTATACGCTTCGCAACCAGGA	0.423																																						dbGAP											1	Substitution - Missense(1)	lung(1)											95.0	95.0	95.0					14																	20612762		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32031.1	14q11.2	2013-09-23			ENSG00000184394	ENSG00000184394		"""GPCR / Class A : Olfactory receptors"""	15358	protein-coding gene	gene with protein product							Standard	NM_001004724		Approved		uc010tla.2	Q8IXE1	OTTHUMG00000170784	ENST00000333629.1:c.868C>T	14.37:g.20612762C>T	ENSP00000332110:p.Arg290Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF11	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R290C	ENST00000333629.1	37	c.868	CCDS32031.1	14	.	.	.	.	.	.	.	.	.	.	C	11.74	1.730109	0.30684	.	.	ENSG00000184394	ENST00000333629	T	0.40476	1.03	4.0	3.02	0.34903	.	0.000000	0.40302	N	0.001137	T	0.49830	0.1580	M	0.93106	3.38	0.41506	D	0.98831	B	0.15719	0.014	B	0.11329	0.006	T	0.61845	-0.6979	10	0.87932	D	0	.	8.5915	0.33690	0.3423:0.6577:0.0:0.0	.	290	Q8IXE1	OR4N5_HUMAN	C	290	ENSP00000332110:R290C	ENSP00000332110:R290C	R	+	1	0	OR4N5	19682602	0.998000	0.40836	0.999000	0.59377	0.934000	0.57294	1.183000	0.32041	2.219000	0.72066	0.655000	0.94253	CGC	OR4N5	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000184394		0.423	OR4N5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N5	HGNC	protein_coding	OTTHUMT00000410347.1	30	0.00	0	C			20612762	20612762	+1	no_errors	ENST00000333629	ensembl	human	known	69_37n	missense	47	39.74	31	SNP	0.999	T
OR7C1	26664	genome.wustl.edu	37	19	14910316	14910316	+	Silent	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr19:14910316G>A	ENST00000248073.2	-	1	707	c.633C>T	c.(631-633)ttC>ttT	p.F211F	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	211					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						ATATTCCAGTGAAGGAAATCA	0.423																																						dbGAP											0													56.0	57.0	57.0					19																	14910316		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.633C>T	19.37:g.14910316G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15621|Q6IFP2|Q96R94	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F211	ENST00000248073.2	37	c.633	CCDS12317.1	19																																																																																			OR7C1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000127530		0.423	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	HGNC	protein_coding	OTTHUMT00000466519.1	31	0.00	0	G			14910316	14910316	-1	no_errors	ENST00000248073	ensembl	human	known	69_37n	silent	37	32.73	18	SNP	0.000	A
PCDHB4	56131	genome.wustl.edu	37	5	140502124	140502124	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr5:140502124C>G	ENST00000194152.1	+	1	544	c.544C>G	c.(544-546)Cga>Gga	p.R182G	AC005754.8_ENST00000606030.1_lincRNA	NM_018938.2	NP_061761.1	Q9Y5E5	PCDB4_HUMAN	protocadherin beta 4	182	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(12)|lung(35)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	67			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CATTCTCACTCGAAATCATAG	0.463																																						dbGAP											0													61.0	61.0	61.0					5																	140502124		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152497	CCDS4246.1	5q31	2010-01-26			ENSG00000081818	ENSG00000081818		"""Cadherins / Protocadherins : Clustered"""	8689	other	protocadherin		606330				10380929	Standard	NM_018938		Approved	PCDH-BETA4	uc003lip.1	Q9Y5E5	OTTHUMG00000129617	ENST00000194152.1:c.544C>G	5.37:g.140502124C>G	ENSP00000194152:p.Arg182Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4V761	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R182G	ENST00000194152.1	37	c.544	CCDS4246.1	5	.	.	.	.	.	.	.	.	.	.	C	9.030	0.987028	0.18889	.	.	ENSG00000081818	ENST00000194152	T	0.18174	2.23	4.56	1.51	0.23008	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.32941	0.0846	M	0.72479	2.2	0.09310	N	1	P	0.42993	0.797	P	0.56648	0.803	T	0.11036	-1.0604	9	0.66056	D	0.02	.	7.9681	0.30111	0.4986:0.3121:0.1893:0.0	.	182	Q9Y5E5	PCDB4_HUMAN	G	182	ENSP00000194152:R182G	ENSP00000194152:R182G	R	+	1	2	PCDHB4	140482308	0.000000	0.05858	0.939000	0.37840	0.952000	0.60782	-0.314000	0.08092	0.175000	0.19841	0.655000	0.94253	CGA	PCDHB4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000081818		0.463	PCDHB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB4	HGNC	protein_coding	OTTHUMT00000251812.2	29	0.00	0	C	NM_018938		140502124	140502124	+1	no_errors	ENST00000194152	ensembl	human	known	69_37n	missense	42	44.00	33	SNP	0.000	G
PCM1	5108	genome.wustl.edu	37	8	17819588	17819588	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr8:17819588delC	ENST00000519253.1	+	16	2619	c.2368delC	c.(2368-2370)ccafs	p.P790fs	PCM1_ENST00000325083.8_Frame_Shift_Del_p.P790fs|PCM1_ENST00000524226.1_Frame_Shift_Del_p.P791fs			Q15154	PCM1_HUMAN	pericentriolar material 1	790					centrosome organization (GO:0051297)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|interkinetic nuclear migration (GO:0022027)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|microtubule anchoring (GO:0034453)|microtubule anchoring at centrosome (GO:0034454)|mitotic cell cycle (GO:0000278)|negative regulation of neurogenesis (GO:0050768)|neuronal stem cell maintenance (GO:0097150)|positive regulation of intracellular protein transport (GO:0090316)|protein localization to centrosome (GO:0071539)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|pericentriolar material (GO:0000242)|protein complex (GO:0043234)	identical protein binding (GO:0042802)		PCM1/JAK2(30)	breast(4)|endometrium(8)|kidney(5)|large_intestine(16)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	48				Colorectal(111;0.0789)		AAAATATATGCCAGCTGTTAC	0.353			T	"""RET, JAK2"""	"""papillary thyroid, CML, MPD"""																																	dbGAP		Dom	yes		8	8p22-p21.3	5108	pericentriolar material 1  (PTC4)		"""E, L"""	0													84.0	76.0	78.0					8																	17819588		1840	4104	5944	-	-	-	SO:0001589	frameshift_variant	0				CCDS47812.1	8p22-p21.3	2008-08-08			ENSG00000078674	ENSG00000078674			8727	protein-coding gene	gene with protein product		600299				8120099, 15659651	Standard	NM_006197		Approved	PTC4	uc003wyi.4	Q15154	OTTHUMG00000163699	ENST00000519253.1:c.2368delC	8.37:g.17819588delC	ENSP00000431099:p.Pro790fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q58F13|Q6P1K7|Q8NB85|Q9BWC1|Q9H4A2	Frame_Shift_Del	DEL	NULL	p.P790fs	ENST00000519253.1	37	c.2368		8																																																																																			PCM1	-	NULL	ENSG00000078674		0.353	PCM1-003	NOVEL	basic|exp_conf	protein_coding	PCM1	HGNC	protein_coding	OTTHUMT00000374800.1	46	0.00	0	C	NM_006197		17819588	17819588	+1	no_errors	ENST00000325083	ensembl	human	known	69_37n	frame_shift_del	143	11.66	19	DEL	0.897	-
PIK3CA	5290	genome.wustl.edu	37	3	178936095	178936095	+	Missense_Mutation	SNP	A	A	G	rs397517201		TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr3:178936095A>G	ENST00000263967.3	+	10	1794	c.1637A>G	c.(1636-1638)cAg>cGg	p.Q546R		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	546	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		Q -> E (in BC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> K (in OC; unknown pathological significance). {ECO:0000269|PubMed:15520168}.|Q -> P (found in an anaplastic astrocytoma sample; unknown pathological significance). {ECO:0000269|PubMed:15289301}.|Q -> R (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.Q546R(30)|p.Q546P(18)|p.Q546L(5)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	ATCACTGAGCAGGAGAAAGAT	0.363		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	53	Substitution - Missense(53)	endometrium(18)|breast(17)|large_intestine(10)|central_nervous_system(3)|prostate(2)|upper_aerodigestive_tract(1)|stomach(1)|ovary(1)											61.0	61.0	61.0					3																	178936095		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1637A>G	3.37:g.178936095A>G	ENSP00000263967:p.Gln546Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.Q546R	ENST00000263967.3	37	c.1637	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	22.8	4.332178	0.81801	.	.	ENSG00000121879	ENST00000263967	T	0.63417	-0.04	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75657	0.3879	M	0.64404	1.975	0.80722	D	1	D	0.63046	0.992	D	0.65323	0.934	T	0.76782	-0.2832	10	0.52906	T	0.07	-14.2064	16.1026	0.81194	1.0:0.0:0.0:0.0	.	546	P42336	PK3CA_HUMAN	R	546	ENSP00000263967:Q546R	ENSP00000263967:Q546R	Q	+	2	0	PIK3CA	180418789	1.000000	0.71417	1.000000	0.80357	0.881000	0.50899	8.962000	0.93254	2.198000	0.70561	0.383000	0.25322	CAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.363	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	48	0.00	0	A			178936095	178936095	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	92	22.03	26	SNP	1.000	G
PPP1R3B	79660	genome.wustl.edu	37	8	8998783	8998783	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr8:8998783G>A	ENST00000310455.3	-	2	529	c.379C>T	c.(379-381)Cga>Tga	p.R127*	RP11-10A14.3_ENST00000522057.1_RNA|PPP1R3B_ENST00000519699.1_Nonsense_Mutation_p.R127*|RP11-10A14.3_ENST00000520017.1_RNA	NM_001201329.1|NM_024607.3	NP_001188258.1|NP_078883.2	Q86XI6	PPR3B_HUMAN	protein phosphatase 1, regulatory subunit 3B	127	CBM21. {ECO:0000255|PROSITE- ProRule:PRU00491}.				glycogen metabolic process (GO:0005977)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of glycogen catabolic process (GO:0005981)	glycogen granule (GO:0042587)|intracellular membrane-bounded organelle (GO:0043231)|protein phosphatase type 1 complex (GO:0000164)	protein phosphatase regulator activity (GO:0019888)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	12				COAD - Colon adenocarcinoma(149;0.0717)|READ - Rectum adenocarcinoma(644;0.241)		GCCTGAAGTCGATTTCTAAAG	0.502																																						dbGAP											0													76.0	73.0	74.0					8																	8998783		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK024067	CCDS5973.1	8p23.1	2012-04-17	2011-10-04		ENSG00000173281	ENSG00000173281		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14942	protein-coding gene	gene with protein product	"""PP1 subunit R4"", ""hepatic glycogen-targeting subunit, G(L)"""	610541	"""protein phosphatase 1, regulatory (inhibitor) subunit 3B"""			11948623, 17555403	Standard	NM_024607		Approved	GL, FLJ14005, PPP1R4	uc003wsn.4	Q86XI6	OTTHUMG00000129329	ENST00000310455.3:c.379C>T	8.37:g.8998783G>A	ENSP00000308318:p.Arg127*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTV3|Q9H812	Nonsense_Mutation	SNP	pfam_CBM_21,pirsf_Pase-1_Glycogen_target-su_met,pfscan_CBM_21	p.R127*	ENST00000310455.3	37	c.379	CCDS5973.1	8	.	.	.	.	.	.	.	.	.	.	G	38	7.077363	0.98048	.	.	ENSG00000173281	ENST00000310455;ENST00000519699	.	.	.	5.87	5.87	0.94306	.	0.165638	0.53938	D	0.000045	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-17.3304	19.1829	0.93630	0.0:0.0:1.0:0.0	.	.	.	.	X	127	.	ENSP00000308318:R127X	R	-	1	2	PPP1R3B	9036193	1.000000	0.71417	0.185000	0.23176	0.934000	0.57294	4.562000	0.60816	2.780000	0.95670	0.561000	0.74099	CGA	PPP1R3B	-	pirsf_Pase-1_Glycogen_target-su_met,pfscan_CBM_21	ENSG00000173281		0.502	PPP1R3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3B	HGNC	protein_coding	OTTHUMT00000251472.1	27	0.00	0	G	NM_024607		8998783	8998783	-1	no_errors	ENST00000310455	ensembl	human	known	69_37n	nonsense	51	21.54	14	SNP	0.992	A
PTCHD3	374308	genome.wustl.edu	37	10	27702459	27702459	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr10:27702459C>T	ENST00000438700.3	-	1	838	c.721G>A	c.(721-723)Gtg>Atg	p.V241M		NM_001034842.3	NP_001030014.2	Q3KNS1	PTHD3_HUMAN	patched domain containing 3	241					spermatid development (GO:0007286)	integral component of membrane (GO:0016021)|sperm midpiece (GO:0097225)	hedgehog receptor activity (GO:0008158)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(17)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	55						TCCCGCGCCACGCGCAGATCC	0.627																																						dbGAP											0													39.0	40.0	40.0					10																	27702459		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK126025	CCDS31173.1	10p12.1	2006-05-26			ENSG00000182077	ENSG00000182077			24776	protein-coding gene	gene with protein product		611791					Standard	NM_001034842		Approved	FLJ44037, PTR	uc001itu.2	Q3KNS1	OTTHUMG00000017860	ENST00000438700.3:c.721G>A	10.37:g.27702459C>T	ENSP00000417658:p.Val241Met	Somatic		WXS	Illumina GAIIx	Phase_IV	I3L499|Q6ZU28	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.V241M	ENST00000438700.3	37	c.721	CCDS31173.1	10	.	.	.	.	.	.	.	.	.	.	C	13.82	2.352201	0.41700	.	.	ENSG00000182077	ENST00000438700	D	0.87103	-2.21	3.81	0.587	0.17439	.	0.994946	0.08151	N	0.990061	D	0.91168	0.7218	M	0.77103	2.36	0.09310	N	1	D	0.71674	0.998	D	0.72625	0.978	T	0.77259	-0.2654	10	0.72032	D	0.01	-10.8819	2.3479	0.04276	0.1939:0.5025:0.1892:0.1144	.	241	Q3KNS1	PTHD3_HUMAN	M	241	ENSP00000417658:V241M	ENSP00000417658:V241M	V	-	1	0	PTCHD3	27742465	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.004000	0.12878	0.241000	0.21283	-0.304000	0.09214	GTG	PTCHD3	-	pfam_Patched	ENSG00000182077		0.627	PTCHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTCHD3	HGNC	protein_coding	OTTHUMT00000047325.3	34	0.00	0	C	XM_370541		27702459	27702459	-1	no_errors	ENST00000438700	ensembl	human	known	69_37n	missense	40	36.51	23	SNP	0.000	T
RBMXL3	139804	genome.wustl.edu	37	X	114425884	114425884	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chrX:114425884G>A	ENST00000424776.3	+	1	1922	c.1880G>A	c.(1879-1881)gGa>gAa	p.G627E	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	627	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						TACGGAGGAGGAGGCCGCTAC	0.672																																						dbGAP											0													46.0	49.0	48.0					X																	114425884		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.1880G>A	X.37:g.114425884G>A	ENSP00000417451:p.Gly627Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G627E	ENST00000424776.3	37	c.1880	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	G	11.94	1.789467	0.31685	.	.	ENSG00000175718	ENST00000424776	T	0.07567	3.18	0.853	0.853	0.19001	.	.	.	.	.	T	0.09335	0.0230	N	0.08118	0	0.09310	N	1	D	0.64830	0.994	D	0.65010	0.931	T	0.29027	-1.0025	9	0.87932	D	0	.	5.1181	0.14847	0.0:0.3732:0.6268:0.0	.	627	Q8N7X1	RMXL3_HUMAN	E	627	ENSP00000417451:G627E	ENSP00000417451:G627E	G	+	2	0	RBMXL3	114332140	0.000000	0.05858	0.074000	0.20217	0.074000	0.17049	-0.421000	0.07053	0.108000	0.17862	0.110000	0.15639	GGA	RBMXL3	-	NULL	ENSG00000175718		0.672	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	40	0.00	0	G	NM_001145346		114425884	114425884	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	65	16.67	13	SNP	0.021	A
RGPD3	653489	genome.wustl.edu	37	2	107050797	107050797	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr2:107050797C>T	ENST00000409886.3	-	15	2179	c.2092G>A	c.(2092-2094)Gat>Aat	p.D698N	RGPD3_ENST00000304514.7_Missense_Mutation_p.D698N	NM_001144013.1	NP_001137485.1	A6NKT7	RGPD3_HUMAN	RANBP2-like and GRIP domain containing 3	698					protein targeting to Golgi (GO:0000042)					breast(2)|central_nervous_system(1)|endometrium(50)|kidney(4)|lung(11)|ovary(1)|urinary_tract(2)	71						GAAAGGGCATCATTTGCAATG	0.348																																						dbGAP											0													47.0	39.0	42.0					2																	107050797		692	1590	2282	-	-	-	SO:0001583	missense	0				CCDS46379.1	2q12.2	2013-01-10			ENSG00000153165	ENSG00000153165		"""Tetratricopeptide (TTC) repeat domain containing"""	32416	protein-coding gene	gene with protein product		612706				15710750, 15815621	Standard	NM_001144013		Approved	RGP3	uc010ywi.1	A6NKT7	OTTHUMG00000153182	ENST00000409886.3:c.2092G>A	2.37:g.107050797C>T	ENSP00000386588:p.Asp698Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZM4	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.D698N	ENST00000409886.3	37	c.2092	CCDS46379.1	2	.	.	.	.	.	.	.	.	.	.	.	12.88	2.069453	0.36470	.	.	ENSG00000153165	ENST00000409886;ENST00000452099;ENST00000304514	T;T	0.22743	1.94;1.94	2.53	2.53	0.30540	.	.	.	.	.	T	0.31104	0.0786	M	0.62723	1.935	0.31797	N	0.628846	P	0.48911	0.917	P	0.51297	0.665	T	0.35051	-0.9804	9	0.44086	T	0.13	-19.0313	10.8073	0.46524	0.0:1.0:0.0:0.0	.	698	A6NKT7	RGPD3_HUMAN	N	698;456;698	ENSP00000386588:D698N;ENSP00000303659:D698N	ENSP00000303659:D698N	D	-	1	0	RGPD3	106417229	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	5.881000	0.69706	1.434000	0.47414	0.194000	0.17425	GAT	RGPD3	-	NULL	ENSG00000153165		0.348	RGPD3-002	KNOWN	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD3	HGNC	protein_coding	OTTHUMT00000329975.1	177	0.00	0	C	XM_929931		107050797	107050797	-1	no_errors	ENST00000304514	ensembl	human	known	69_37n	missense	293	26.01	103	SNP	1.000	T
RPL8	6132	genome.wustl.edu	37	8	146017435	146017435	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr8:146017435G>A	ENST00000262584.3	-	2	312	c.80C>T	c.(79-81)gCg>gTg	p.A27V	RPL8_ENST00000394920.2_Missense_Mutation_p.A27V|RPL8_ENST00000528957.1_Missense_Mutation_p.A27V|RPL8_ENST00000527914.1_Missense_Mutation_p.A27V|RPL8_ENST00000529163.1_Intron	NM_000973.3	NP_000964.1	P62917	RL8_HUMAN	ribosomal protein L8	27					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			kidney(12)|lung(7)|prostate(1)	20	all_cancers(97;1.03e-11)|all_epithelial(106;6.69e-11)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		Epithelial(56;5.47e-39)|OV - Ovarian serous cystadenocarcinoma(54;6.38e-39)|all cancers(56;5.47e-34)|BRCA - Breast invasive adenocarcinoma(115;0.0355)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.191)		GCGCAGGCGCGCAGCGCCTTT	0.706																																						dbGAP											0													20.0	24.0	23.0					8																	146017435		2195	4287	6482	-	-	-	SO:0001583	missense	0			Z28407	CCDS6433.1	8q24.3	2011-04-06			ENSG00000161016	ENSG00000161016		"""L ribosomal proteins"""	10368	protein-coding gene	gene with protein product		604177				7506540, 9582194	Standard	NM_033301		Approved	L8	uc003zec.3	P62917	OTTHUMG00000165249	ENST00000262584.3:c.80C>T	8.37:g.146017435G>A	ENSP00000262584:p.Ala27Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K094|D3DWN2|P25120|Q567Q7|Q969V7|Q9BWQ9	Missense_Mutation	SNP	pfam_Ribosomal_L2_C,pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_Translation_prot_SH3-like,superfamily_NA-bd_OB-fold-like,pirsf_Ribosomal_L2	p.A27V	ENST00000262584.3	37	c.80	CCDS6433.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.274021	0.95459	.	.	ENSG00000161016	ENST00000394920;ENST00000527914;ENST00000262584;ENST00000528957;ENST00000534813;ENST00000533397;ENST00000532702	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.9;0.89	4.95	4.95	0.65309	Nucleic acid-binding, OB-fold-like (1);Ribosomal Proteins L2, RNA binding domain (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	T	0.38799	0.1054	L	0.35414	1.06	0.80722	D	1	B;P;B	0.42620	0.046;0.785;0.316	B;P;B	0.44860	0.024;0.462;0.011	T	0.06588	-1.0818	10	0.30078	T	0.28	-12.0845	16.1504	0.81618	0.0:0.0:1.0:0.0	.	27;27;27	B4DVG7;P62917;E9PIZ3	.;RL8_HUMAN;.	V	27	ENSP00000378378:A27V;ENSP00000262584:A27V;ENSP00000433464:A27V;ENSP00000435313:A27V;ENSP00000434535:A27V	ENSP00000262584:A27V	A	-	2	0	RPL8	145988239	1.000000	0.71417	0.983000	0.44433	0.926000	0.56050	8.165000	0.89663	2.765000	0.95021	0.555000	0.69702	GCG	RPL8	-	pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,pirsf_Ribosomal_L2	ENSG00000161016		0.706	RPL8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL8	HGNC	protein_coding	OTTHUMT00000382948.1	9	0.00	0	G	NM_000973		146017435	146017435	-1	no_errors	ENST00000262584	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	1.000	A
RPRD1B	58490	genome.wustl.edu	37	20	36668886	36668886	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr20:36668886C>G	ENST00000373433.4	+	2	603	c.201C>G	c.(199-201)atC>atG	p.I67M		NM_021215.3	NP_067038.1	Q9NQG5	RPR1B_HUMAN	regulation of nuclear pre-mRNA domain containing 1B	67	CID. {ECO:0000255|PROSITE- ProRule:PRU00724}.				dephosphorylation of RNA polymerase II C-terminal domain (GO:0070940)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle process (GO:0010564)|transcription, DNA-templated (GO:0006351)	DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nucleus (GO:0005634)	RNA polymerase II core binding (GO:0000993)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)	12						ATGATGTCATCCAAAACAGTA	0.328																																						dbGAP											0													183.0	175.0	178.0					20																	36668886		2202	4300	6502	-	-	-	SO:0001583	missense	0			AL109823	CCDS13301.1	20q11.21-q12	2012-02-09	2008-08-15	2008-07-28	ENSG00000101413	ENSG00000101413			16209	protein-coding gene	gene with protein product		614694	"""chromosome 20 open reading frame 77"""	C20orf77		22231121	Standard	NM_021215		Approved	dJ1057B20.2, DKFZp434P0735, CREPT, FLJ44520, NET60	uc002xho.4	Q9NQG5	OTTHUMG00000032434	ENST00000373433.4:c.201C>G	20.37:g.36668886C>G	ENSP00000362532:p.Ile67Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1WDE7|Q6PKF4	Missense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.I67M	ENST00000373433.4	37	c.201	CCDS13301.1	20	.	.	.	.	.	.	.	.	.	.	C	16.34	3.094370	0.56075	.	.	ENSG00000101413	ENST00000373433	T	0.45668	0.89	5.41	-0.0983	0.13629	ENTH/VHS (2);RNA polymerase II, large subunit, CTD (2);Domain of unknown function DUF618 (1);	0.043827	0.85682	D	0.000000	T	0.55162	0.1903	M	0.79258	2.445	0.80722	D	1	D	0.71674	0.998	D	0.75020	0.985	T	0.52510	-0.8566	10	0.87932	D	0	-10.0508	3.4907	0.07637	0.2967:0.389:0.0:0.3143	.	67	Q9NQG5	RPR1B_HUMAN	M	67	ENSP00000362532:I67M	ENSP00000362532:I67M	I	+	3	3	RPRD1B	36102300	1.000000	0.71417	0.995000	0.50966	0.990000	0.78478	1.042000	0.30303	-0.135000	0.11495	0.557000	0.71058	ATC	RPRD1B	-	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	ENSG00000101413		0.328	RPRD1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPRD1B	HGNC	protein_coding	OTTHUMT00000079142.2	112	0.00	0	C	NM_021215		36668886	36668886	+1	no_errors	ENST00000373433	ensembl	human	known	69_37n	missense	298	25.13	100	SNP	1.000	G
RYR2	6262	genome.wustl.edu	37	1	237802483	237802483	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:237802483G>T	ENST00000366574.2	+	46	7414	c.7097G>T	c.(7096-7098)aGc>aTc	p.S2366I	RYR2_ENST00000542537.1_Missense_Mutation_p.S2350I|RYR2_ENST00000360064.6_Missense_Mutation_p.S2364I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2366	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TCACCAAATAGCGGATCCAGT	0.438																																						dbGAP											0													74.0	73.0	73.0					1																	237802483		1907	4117	6024	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7097G>T	1.37:g.237802483G>T	ENSP00000355533:p.Ser2366Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.S2364I	ENST00000366574.2	37	c.7091	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	5.820	0.335623	0.11013	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.97959	-4.63;-4.63;-4.63	5.35	3.21	0.36854	.	0.280344	0.29602	N	0.011696	D	0.90679	0.7076	N	0.08118	0	0.22066	N	0.999385	B	0.17465	0.022	B	0.17722	0.019	T	0.81545	-0.0884	10	0.22109	T	0.4	.	4.7287	0.12954	0.1755:0.2375:0.587:0.0	.	2366	Q92736	RYR2_HUMAN	I	2366;2364;2350	ENSP00000355533:S2366I;ENSP00000353174:S2364I;ENSP00000443798:S2350I	ENSP00000353174:S2364I	S	+	2	0	RYR2	235869106	0.998000	0.40836	0.247000	0.24249	0.329000	0.28539	2.569000	0.45973	1.235000	0.43724	0.561000	0.74099	AGC	RYR2	-	NULL	ENSG00000198626		0.438	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	34	0.00	0	G	NM_001035		237802483	237802483	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	129	19.88	32	SNP	0.162	T
SIK1	150094	genome.wustl.edu	37	21	44838354	44838354	+	Silent	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr21:44838354G>A	ENST00000270162.6	-	12	1662	c.1530C>T	c.(1528-1530)acC>acT	p.T510T		NM_173354.3	NP_775490.2	P57059	SIK1_HUMAN	salt-inducible kinase 1	510					cardiac muscle cell differentiation (GO:0055007)|cell cycle (GO:0007049)|entrainment of circadian clock by photoperiod (GO:0043153)|intracellular signal transduction (GO:0035556)|negative regulation of CREB transcription factor activity (GO:0032792)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of triglyceride biosynthetic process (GO:0010868)|positive regulation of anoikis (GO:2000210)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell differentiation (GO:0045595)|regulation of mitotic cell cycle (GO:0007346)|regulation of myotube differentiation (GO:0010830)|regulation of sodium ion transport (GO:0002028)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|cAMP response element binding protein binding (GO:0008140)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|skin(2)|testis(2)|urinary_tract(1)	21					Dabrafenib(DB08912)	TCGCAGAGAAGGTCAGACAAC	0.662																																						dbGAP											0													34.0	36.0	36.0					21																	44838354		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC038504	CCDS33575.1	21q22.3	2008-12-23	2008-12-23	2008-12-23	ENSG00000142178	ENSG00000142178			11142	protein-coding gene	gene with protein product	"""myocardial SNF1-like kinase"""	605705	"""SNF1-like kinase"""	SNF1LK		7893599	Standard	NM_173354		Approved	msk	uc002zdf.2	P57059	OTTHUMG00000086874	ENST00000270162.6:c.1530C>T	21.37:g.44838354G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC84|Q5R2V5|Q6ZNL8|Q86YJ2	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kinase_SIK1/2,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.T510	ENST00000270162.6	37	c.1530	CCDS33575.1	21																																																																																			SIK1	-	pirsf_Ser/Thr_kinase_SIK1/2	ENSG00000142178		0.662	SIK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIK1	HGNC	protein_coding	OTTHUMT00000195654.1	20	0.00	0	G	NM_173354		44838354	44838354	-1	no_errors	ENST00000270162	ensembl	human	known	69_37n	silent	19	44.12	15	SNP	1.000	A
SIPA1L1	26037	genome.wustl.edu	37	14	72139139	72139139	+	Silent	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr14:72139139C>T	ENST00000555818.1	+	9	3252	c.2904C>T	c.(2902-2904)gtC>gtT	p.V968V	SIPA1L1_ENST00000381232.3_Silent_p.V968V|SIPA1L1_ENST00000358550.2_Silent_p.V968V|SIPA1L1_ENST00000537413.1_Silent_p.V443V	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	968	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GCTTCCATGTCAACTATGAGG	0.532																																						dbGAP											0													123.0	95.0	105.0					14																	72139139		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.2904C>T	14.37:g.72139139C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.V968	ENST00000555818.1	37	c.2904	CCDS9807.1	14																																																																																			SIPA1L1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000197555		0.532	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	42	0.00	0	C	NM_015556		72139139	72139139	+1	no_errors	ENST00000555818	ensembl	human	known	69_37n	silent	69	21.59	19	SNP	1.000	T
SMG5	23381	genome.wustl.edu	37	1	156238081	156238081	+	Splice_Site	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:156238081C>T	ENST00000361813.5	-	8	983	c.839G>A	c.(838-840)cGa>cAa	p.R280Q	SMG5_ENST00000368267.5_Splice_Site_p.R280Q|SMG5_ENST00000489907.2_5'Flank	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	280					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					CCCCACTCACCGCTTTTTGCC	0.527																																						dbGAP											0													269.0	266.0	267.0					1																	156238081		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.839+1G>A	1.37:g.156238081C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Missense_Mutation	SNP	pfam_EST1,smart_PINc_nuc-bd	p.R280Q	ENST00000361813.5	37	c.839	CCDS1137.1	1	.	.	.	.	.	.	.	.	.	.	C	16.29	3.081648	0.55753	.	.	ENSG00000198952	ENST00000361813;ENST00000368267	T;T	0.16743	2.32;2.32	6.02	5.11	0.69529	.	0.000000	0.85682	D	0.000000	T	0.04543	0.0124	N	0.17800	0.525	0.58432	D	0.999997	P	0.37663	0.604	B	0.30855	0.121	T	0.39187	-0.9626	9	.	.	.	-12.8467	13.4621	0.61233	0.0:0.9249:0.0:0.0751	.	280	Q9UPR3	SMG5_HUMAN	Q	280	ENSP00000355261:R280Q;ENSP00000357250:R280Q	.	R	-	2	0	SMG5	154504705	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.461000	0.66699	2.865000	0.98341	0.655000	0.94253	CGA	SMG5	-	NULL	ENSG00000198952		0.527	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1	94	0.00	0	C	NM_015327	Missense_Mutation	156238081	156238081	-1	no_errors	ENST00000361813	ensembl	human	known	69_37n	missense	253	25.37	86	SNP	1.000	T
SNAP91	9892	genome.wustl.edu	37	6	84372142	84372142	+	Splice_Site	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr6:84372142C>G	ENST00000439399.2	-	4	590		c.e4-1		SNAP91_ENST00000520213.1_Splice_Site|SNAP91_ENST00000369694.2_Splice_Site|SNAP91_ENST00000521743.1_Splice_Site|SNAP91_ENST00000195649.6_Splice_Site|SNAP91_ENST00000520302.1_Splice_Site|SNAP91_ENST00000428679.2_Splice_Site|SNAP91_ENST00000521485.1_Splice_Site|SNAP91_ENST00000437520.1_Splice_Site	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa						clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GAATAAATCTCTGAAAAACAA	0.254																																						dbGAP											0													19.0	17.0	18.0					6																	84372142		1766	4009	5775	-	-	-	SO:0001630	splice_region_variant	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.274-1G>C	6.37:g.84372142C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Splice_Site	SNP	-	e3-1	ENST00000439399.2	37	c.274-1	CCDS47455.1	6	.	.	.	.	.	.	.	.	.	.	C	23.5	4.422619	0.83559	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000519779;ENST00000518309;ENST00000369690;ENST00000523484	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.4014	0.94630	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SNAP91	84428861	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.497000	0.81536	2.651000	0.90000	0.591000	0.81541	.	SNAP91	-	-	ENSG00000065609		0.254	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	25	0.00	0	C		Intron	84372142	84372142	-1	no_errors	ENST00000369694	ensembl	human	known	69_37n	splice_site	45	32.84	22	SNP	1.000	G
SPAG17	200162	genome.wustl.edu	37	1	118598416	118598416	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr1:118598416A>T	ENST00000336338.5	-	19	2727	c.2662T>A	c.(2662-2664)Tct>Act	p.S888T		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	888						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)				NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		TTAGCAGAAGATTTCAATTCC	0.303																																						dbGAP											0													119.0	121.0	120.0					1																	118598416		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.2662T>A	1.37:g.118598416A>T	ENSP00000337804:p.Ser888Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.S888T	ENST00000336338.5	37	c.2662	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	A	4.845	0.157145	0.09236	.	.	ENSG00000155761	ENST00000336338	T	0.28895	1.59	4.28	-6.9	0.01655	.	1.701790	0.02497	N	0.090098	T	0.08626	0.0214	L	0.53249	1.67	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.32188	-0.9916	10	0.35671	T	0.21	.	2.4486	0.04512	0.1482:0.1108:0.1843:0.5567	.	888	Q6Q759	SPG17_HUMAN	T	888	ENSP00000337804:S888T	ENSP00000337804:S888T	S	-	1	0	SPAG17	118399939	0.000000	0.05858	0.022000	0.16811	0.017000	0.09413	-1.534000	0.02212	-0.603000	0.05767	-0.480000	0.04831	TCT	SPAG17	-	NULL	ENSG00000155761		0.303	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	89	0.00	0	A	NM_206996		118598416	118598416	-1	no_errors	ENST00000336338	ensembl	human	known	69_37n	missense	152	32.46	74	SNP	0.001	T
ST5	6764	genome.wustl.edu	37	11	8737243	8737243	+	Silent	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr11:8737243C>T	ENST00000534127.1	-	9	2137	c.1752G>A	c.(1750-1752)ctG>ctA	p.L584L	ST5_ENST00000530438.1_Silent_p.L164L|ST5_ENST00000530991.1_Silent_p.L56L|ST5_ENST00000357665.1_Silent_p.L584L|ST5_ENST00000313726.6_Silent_p.L584L|ST5_ENST00000526757.1_Silent_p.L164L|ST5_ENST00000526099.1_Silent_p.L97L	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5	584					positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		ACGGCAGACTCAGCTGAGCCA	0.632																																						dbGAP											0													92.0	80.0	84.0					11																	8737243		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.1752G>A	11.37:g.8737243C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.L584	ENST00000534127.1	37	c.1752	CCDS7791.1	11																																																																																			ST5	-	NULL	ENSG00000166444		0.632	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ST5	HGNC	protein_coding	OTTHUMT00000386518.1	35	0.00	0	C	NM_005418		8737243	8737243	-1	no_errors	ENST00000313726	ensembl	human	known	69_37n	silent	28	45.10	23	SNP	1.000	T
ST6GALNAC1	55808	genome.wustl.edu	37	17	74623304	74623304	+	Silent	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr17:74623304C>T	ENST00000156626.7	-	4	1216	c.1017G>A	c.(1015-1017)gtG>gtA	p.V339V	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	339					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						GGAAGCGTGTCACGACCTTCT	0.657																																						dbGAP											0													45.0	39.0	41.0					17																	74623304		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.1017G>A	17.37:g.74623304C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW90|Q9NSC6	Silent	SNP	pfam_Glyco_trans_29	p.V339	ENST00000156626.7	37	c.1017	CCDS11748.1	17																																																																																			ST6GALNAC1	-	pfam_Glyco_trans_29	ENSG00000070526		0.657	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC1	HGNC	protein_coding	OTTHUMT00000450974.1	17	0.00	0	C	NM_018414		74623304	74623304	-1	no_errors	ENST00000156626	ensembl	human	known	69_37n	silent	22	35.29	12	SNP	0.059	T
STARD9	57519	genome.wustl.edu	37	15	42977291	42977291	+	Missense_Mutation	SNP	G	G	A	rs190051162	byFrequency	TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr15:42977291G>A	ENST00000290607.7	+	23	3572	c.3515G>A	c.(3514-3516)cGt>cAt	p.R1172H		NM_020759.2	NP_065810.2	Q9P2P6	STAR9_HUMAN	StAR-related lipid transfer (START) domain containing 9	1172			R -> C (in dbSNP:rs12594837).		ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spindle assembly (GO:0051225)	centriole (GO:0005814)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|lipid binding (GO:0008289)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						ACCAACAACCGTGGCCAACCC	0.527													G|||	2	0.000399361	0.0	0.0	5008	,	,		19167	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													46.0	47.0	47.0					15																	42977291		692	1590	2282	-	-	-	SO:0001583	missense	0			AB037721	CCDS53935.1	15q15.2	2013-10-16	2007-08-16		ENSG00000159433	ENSG00000159433		"""StAR-related lipid transfer (START) domain containing"""	19162	protein-coding gene	gene with protein product		614642	"""START domain containing 9"""			10718198	Standard	NM_020759		Approved	KIAA1300	uc010udj.2	Q9P2P6	OTTHUMG00000175799	ENST00000290607.7:c.3515G>A	15.37:g.42977291G>A	ENSP00000290607:p.Arg1172His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DG2|Q6AI01|Q6ZWK0|Q9UF70	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_START_lipid-bd,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_START_lipid-bd,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R1172H	ENST00000290607.7	37	c.3515	CCDS53935.1	15	3	0.0013736263736263737	0	0.0	0	0.0	3	0.005244755244755245	0	0.0	G	8.151	0.787327	0.16258	.	.	ENSG00000159433	ENST00000290607	T	0.63255	-0.03	5.61	-11.2	0.00127	.	.	.	.	.	T	0.12944	0.0314	N	0.01576	-0.805	0.09310	N	1	.	.	.	.	.	.	T	0.09975	-1.0650	7	0.02654	T	1	6.4052	1.7439	0.02958	0.2401:0.2852:0.3019:0.1728	.	.	.	.	H	1172	ENSP00000290607:R1172H	ENSP00000290607:R1172H	R	+	2	0	STARD9	40764583	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-2.830000	0.00744	-1.664000	0.01479	-1.247000	0.01520	CGT	STARD9	-	NULL	ENSG00000159433		0.527	STARD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD9	HGNC	protein_coding	OTTHUMT00000431094.1	17	0.00	0	G			42977291	42977291	+1	no_errors	ENST00000290607	ensembl	human	known	69_37n	missense	56	22.22	16	SNP	0.000	A
SYNE1	23345	genome.wustl.edu	37	6	152570399	152570399	+	Splice_Site	SNP	T	T	C			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr6:152570399T>C	ENST00000367255.5	-	105	20072		c.e105-2		SYNE1_ENST00000356820.4_Splice_Site|SYNE1_ENST00000341594.5_Splice_Site|SYNE1_ENST00000448038.1_Splice_Site|SYNE1_ENST00000265368.4_Splice_Site|SYNE1_ENST00000423061.1_Splice_Site	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1						cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CAGATCATTCTAAGGAGGAAA	0.358										HNSCC(10;0.0054)																												dbGAP											0													87.0	84.0	85.0					6																	152570399		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.19471-2A>G	6.37:g.152570399T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Splice_Site	SNP	-	e103-2	ENST00000367255.5	37	c.19471-2	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	T	18.20	3.570535	0.65765	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	.	.	.	5.73	5.73	0.89815	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3123	0.82883	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	SYNE1	152612092	1.000000	0.71417	0.941000	0.38009	0.666000	0.39218	6.820000	0.75267	2.308000	0.77769	0.533000	0.62120	.	SYNE1	-	-	ENSG00000131018		0.358	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	65	0.00	0	T	NM_182961	Intron	152570399	152570399	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	splice_site	140	10.83	17	SNP	0.997	C
TAF1	6872	genome.wustl.edu	37	X	70617194	70617194	+	Silent	SNP	C	C	T	rs371657850		TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chrX:70617194C>T	ENST00000373790.4	+	23	3546	c.3495C>T	c.(3493-3495)ctC>ctT	p.L1165L	TAF1_ENST00000276072.3_Silent_p.L1186L|TAF1_ENST00000449580.1_Silent_p.L1165L|TAF1_ENST00000423759.1_Silent_p.L1186L	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	1165					cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				GACGCTGTCTCAAGATTTATC	0.502																																						dbGAP											0													168.0	113.0	131.0					X																	70617194		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.3495C>T	X.37:g.70617194C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	NULL	p.S76L	ENST00000373790.4	37	c.227	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	9.647	1.140439	0.21205	.	.	ENSG00000147133	ENST00000483985	.	.	.	4.91	2.05	0.26809	.	.	.	.	.	T	0.66327	0.2778	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61342	-0.7082	4	.	.	.	.	12.5596	0.56273	0.1137:0.3559:0.5304:0.0	.	.	.	.	L	76	.	.	S	+	2	0	TAF1	70533919	0.929000	0.31497	1.000000	0.80357	0.994000	0.84299	-0.047000	0.11963	0.131000	0.18576	0.449000	0.29647	TCA	TAF1	-	NULL	ENSG00000147133		0.502	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	50	0.00	0	C	NM_004606		70617194	70617194	+1	no_start_codon:pseudogene:bad_bp_length_for_coding_region	ENST00000483985	ensembl	human	putative	69_37n	missense	147	19.67	36	SNP	0.999	T
TBCK	93627	genome.wustl.edu	37	4	107170104	107170104	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr4:107170104C>G	ENST00000273980.5	-	9	1141	c.694G>C	c.(694-696)Gag>Cag	p.E232Q	TBCK_ENST00000394706.3_Missense_Mutation_p.E193Q|TBCK_ENST00000432496.2_Missense_Mutation_p.E232Q|TBCK_ENST00000361687.4_Missense_Mutation_p.E169Q|TBCK_ENST00000394708.2_Missense_Mutation_p.E232Q					TBC1 domain containing kinase											NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)	25						CAACCATGCTCTTCAGCCAGA	0.313																																						dbGAP											0													83.0	82.0	82.0					4																	107170104		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS3673.1, CCDS54788.1, CCDS54789.1	4q24	2014-09-17			ENSG00000145348	ENSG00000145348			28261	protein-coding gene	gene with protein product						12471243	Standard	XR_427553		Approved	MGC16169, HSPC302	uc010ilv.2	Q8TEA7	OTTHUMG00000131214	ENST00000273980.5:c.694G>C	4.37:g.107170104C>G	ENSP00000273980:p.Glu232Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Rhodanese-like_dom,superfamily_Kinase-like_dom,superfamily_Rab-GTPase-TBC_dom,superfamily_Rhodanese-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Rab-GTPase-TBC_dom,smart_Rhodanese-like_dom,pfscan_Rab-GTPase-TBC_dom,pfscan_Prot_kinase_cat_dom,pfscan_Rhodanese-like_dom	p.E232Q	ENST00000273980.5	37	c.694	CCDS54788.1	4	.	.	.	.	.	.	.	.	.	.	C	28.3	4.904483	0.92035	.	.	ENSG00000145348	ENST00000273980;ENST00000432496;ENST00000361687;ENST00000394706;ENST00000394708	T;T;T;T;T	0.08807	3.05;3.05;3.05;3.05;3.05	5.45	5.45	0.79879	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.24044	0.0582	L	0.43923	1.385	0.80722	D	1	P;D;P	0.89917	0.898;1.0;0.926	P;D;P	0.76575	0.733;0.988;0.835	T	0.00238	-1.1889	10	0.54805	T	0.06	.	19.2746	0.94026	0.0:1.0:0.0:0.0	.	232;193;169	Q8TEA7;Q8TEA7-2;Q8TEA7-3	TBCK_HUMAN;.;.	Q	232;232;169;193;232	ENSP00000273980:E232Q;ENSP00000405847:E232Q;ENSP00000355338:E169Q;ENSP00000378196:E193Q;ENSP00000378198:E232Q	ENSP00000273980:E232Q	E	-	1	0	TBCK	107389553	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.216000	0.77974	2.547000	0.85894	0.650000	0.86243	GAG	TBCK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000145348		0.313	TBCK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCK	HGNC	protein_coding	OTTHUMT00000253953.4	30	0.00	0	C	NM_033115		107170104	107170104	-1	no_errors	ENST00000273980	ensembl	human	known	69_37n	missense	62	21.52	17	SNP	1.000	G
TRA2A	29896	genome.wustl.edu	37	7	23545770	23545770	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr7:23545770C>T	ENST00000297071.4	-	6	973	c.757G>A	c.(757-759)Gat>Aat	p.D253N	TRA2A_ENST00000392502.4_Missense_Mutation_p.D152N|TRA2A_ENST00000474586.1_5'Flank|TRA2A_ENST00000538367.1_Missense_Mutation_p.D152N	NM_013293.3	NP_037425.1	Q13595	TRA2A_HUMAN	transformer 2 alpha homolog (Drosophila)	253	Arg/Ser-rich (RS2 domain).				mRNA splicing, via spliceosome (GO:0000398)	intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	10						TATCGGTAATCATAGTCTTCA	0.408																																					Pancreas(121;2137 2973 46590)	dbGAP											0													108.0	114.0	112.0					7																	23545770		2203	4300	6503	-	-	-	SO:0001583	missense	0			U53209	CCDS5383.1, CCDS64609.1, CCDS75569.1	7p15.3	2014-02-12			ENSG00000164548	ENSG00000164548		"""RNA binding motif (RRM) containing"""	16645	protein-coding gene	gene with protein product		602718				8799144, 9546399	Standard	XM_005249725		Approved	htra-2-alpha, tra2a, AWMS1	uc003swi.3	Q13595	OTTHUMG00000128459	ENST00000297071.4:c.757G>A	7.37:g.23545770C>T	ENSP00000297071:p.Asp253Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUA9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D253N	ENST00000297071.4	37	c.757	CCDS5383.1	7	.	.	.	.	.	.	.	.	.	.	C	21.4	4.137933	0.77775	.	.	ENSG00000164548	ENST00000297071;ENST00000392502;ENST00000538367	T;T;T	0.27557	1.66;1.83;1.78	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.54775	0.1879	M	0.65498	2.005	0.80722	D	1	D	0.57571	0.98	D	0.68192	0.956	T	0.50558	-0.8814	10	0.41790	T	0.15	-12.1556	18.9064	0.92464	0.0:1.0:0.0:0.0	.	253	Q13595	TRA2A_HUMAN	N	253;152;152	ENSP00000297071:D253N;ENSP00000376290:D152N;ENSP00000441116:D152N	ENSP00000297071:D253N	D	-	1	0	TRA2A	23512295	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.293000	0.65680	2.547000	0.85894	0.650000	0.86243	GAT	TRA2A	-	NULL	ENSG00000164548		0.408	TRA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRA2A	HGNC	protein_coding	OTTHUMT00000250257.1	36	0.00	0	C	NM_013293		23545770	23545770	-1	no_errors	ENST00000297071	ensembl	human	known	69_37n	missense	68	20.93	18	SNP	1.000	T
TTLL5	23093	genome.wustl.edu	37	14	76349121	76349121	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr14:76349121C>T	ENST00000298832.9	+	30	3821	c.3616C>T	c.(3616-3618)Cag>Tag	p.Q1206*	TTLL5_ENST00000556893.1_Nonsense_Mutation_p.Q757*|TTLL5_ENST00000554510.1_Nonsense_Mutation_p.Q715*|TTLL5_ENST00000557636.1_Nonsense_Mutation_p.Q1221*	NM_015072.4	NP_055887.3	Q6EMB2	TTLL5_HUMAN	tubulin tyrosine ligase-like family, member 5	1206					fertilization (GO:0009566)|protein polyglutamylation (GO:0018095)|sperm axoneme assembly (GO:0007288)|sperm motility (GO:0030317)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)			NS(2)|breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(3)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(2)	50				BRCA - Breast invasive adenocarcinoma(234;0.029)		AGCTAGTGGCCAGAAGCCAAC	0.498																																						dbGAP											0													106.0	110.0	108.0					14																	76349121		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF107885	CCDS32124.1	14q24.3	2014-09-09	2005-07-29	2005-07-29	ENSG00000119685	ENSG00000119685		"""Tubulin tyrosine ligase-like family"""	19963	protein-coding gene	gene with protein product		612268	"""KIAA0998"""	KIAA0998		15890843	Standard	NM_015072		Approved		uc001xrx.3	Q6EMB2	OTTHUMG00000171611	ENST00000298832.9:c.3616C>T	14.37:g.76349121C>T	ENSP00000298832:p.Gln1206*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGH8|B9EGH9|Q9BUB0|Q9H0G4|Q9H7W2|Q9P1V5|Q9UPZ4	Nonsense_Mutation	SNP	pfam_Tub_tyr_ligase	p.Q1206*	ENST00000298832.9	37	c.3616	CCDS32124.1	14	.	.	.	.	.	.	.	.	.	.	C	46	12.159116	0.99642	.	.	ENSG00000119685	ENST00000286653;ENST00000557636;ENST00000298832;ENST00000393826;ENST00000556893;ENST00000554510	.	.	.	5.9	5.9	0.94986	.	0.425256	0.21577	N	0.072319	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	.	18.4627	0.90745	0.0:1.0:0.0:0.0	.	.	.	.	X	280;1221;1206;757;757;715	.	ENSP00000286653:Q280X	Q	+	1	0	TTLL5	75418874	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.708000	0.61859	2.806000	0.96561	0.655000	0.94253	CAG	TTLL5	-	NULL	ENSG00000119685		0.498	TTLL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL5	HGNC	protein_coding	OTTHUMT00000414453.1	52	0.00	0	C	NM_015072		76349121	76349121	+1	no_errors	ENST00000298832	ensembl	human	known	69_37n	nonsense	83	23.15	25	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179425385	179425385	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr2:179425385C>T	ENST00000591111.1	-	276	80775	c.80551G>A	c.(80551-80553)Gaa>Aaa	p.E26851K	TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E19552K|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E25924K|TTN_ENST00000460472.2_Missense_Mutation_p.E19427K|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E19619K|TTN-AS1_ENST00000590807.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E28492K			Q8WZ42	TITIN_HUMAN	titin	26851	Fibronectin type-III 95. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E19427K(1)|p.E25922K(1)|p.E19552K(1)|p.E25924K(1)|p.E19619K(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGGCTTGTTTCACGTTTTTCT	0.408																																						dbGAP											5	Substitution - Missense(5)	lung(5)											57.0	57.0	57.0					2																	179425385		1962	4149	6111	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80551G>A	2.37:g.179425385C>T	ENSP00000465570:p.Glu26851Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E25924K	ENST00000591111.1	37	c.77770		2	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453807	0.63290	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57595	0.39;0.39;0.39;0.39	5.97	5.97	0.96955	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.68137	0.2968	M	0.68593	2.085	0.80722	D	1	D;D;D;D	0.56746	0.977;0.977;0.977;0.958	P;P;P;P	0.55011	0.766;0.766;0.766;0.689	T	0.69472	-0.5136	9	0.87932	D	0	.	20.4388	0.99107	0.0:1.0:0.0:0.0	.	19427;19552;19619;26851	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	25924;19427;19619;19552;19424	ENSP00000343764:E25924K;ENSP00000434586:E19427K;ENSP00000340554:E19619K;ENSP00000352154:E19552K	ENSP00000340554:E19619K	E	-	1	0	TTN	179133631	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.836000	0.97738	0.655000	0.94253	GAA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	15	0.00	0	C	NM_133378		179425385	179425385	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	20	47.37	18	SNP	1.000	T
UBQLN3	50613	genome.wustl.edu	37	11	5529922	5529922	+	Silent	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr11:5529922G>A	ENST00000311659.4	-	2	1014	c.867C>T	c.(865-867)acC>acT	p.T289T	HBG2_ENST00000380259.2_Intron	NM_017481.2	NP_059509.1	Q9H347	UBQL3_HUMAN	ubiquilin 3	289										NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|prostate(1)|skin(2)	39		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GTTGGCTGGTGGTGGTGGTGG	0.542																																					Ovarian(72;684 1260 12332 41642 52180)	dbGAP											0													130.0	106.0	114.0					11																	5529922		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AF230481	CCDS7758.1	11p15	2013-02-12			ENSG00000175520	ENSG00000175520		"""Ubiquilin family"""	12510	protein-coding gene	gene with protein product		605473				10831842	Standard	NM_017481		Approved	TUP-1	uc001may.1	Q9H347	OTTHUMG00000066886	ENST00000311659.4:c.867C>T	11.37:g.5529922G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NRE0	Silent	SNP	pfam_Ubiquitin,pfam_SUMO,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,superfamily_ARM-type_fold,smart_Ubiquitin,smart_STI1_HS-bd,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Ubiquitin_supergroup	p.T289	ENST00000311659.4	37	c.867	CCDS7758.1	11																																																																																			UBQLN3	-	NULL	ENSG00000175520		0.542	UBQLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBQLN3	HGNC	protein_coding	OTTHUMT00000143348.1	28	0.00	0	G	NM_017481		5529922	5529922	-1	no_errors	ENST00000311659	ensembl	human	known	69_37n	silent	53	19.70	13	SNP	0.004	A
WWC3	55841	genome.wustl.edu	37	X	10058871	10058871	+	Silent	SNP	C	C	T			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chrX:10058871C>T	ENST00000380861.4	+	6	829	c.438C>T	c.(436-438)atC>atT	p.I146I	WWC3_ENST00000454666.1_Silent_p.I146I	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	146					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						CGCAGGCTATCATGAGTGAGC	0.468																																						dbGAP											0													111.0	91.0	98.0					X																	10058871		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.438C>T	X.37:g.10058871C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA96|Q659C1|Q9BTQ1	Silent	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.I146	ENST00000380861.4	37	c.438	CCDS14136.1	X																																																																																			WWC3	-	NULL	ENSG00000047644		0.468	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	HGNC	protein_coding	OTTHUMT00000055725.1	58	0.00	0	C	NM_015691		10058871	10058871	+1	no_errors	ENST00000380861	ensembl	human	known	69_37n	silent	90	28.57	36	SNP	1.000	T
ZBED5	58486	genome.wustl.edu	37	11	10874686	10874686	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr11:10874686G>A	ENST00000432999.2	-	3	2305	c.1807C>T	c.(1807-1809)Caa>Taa	p.Q603*	ZBED5_ENST00000413761.2_Nonsense_Mutation_p.Q603*|ZBED5_ENST00000525350.1_Intron	NM_001143667.1|NM_021211.3	NP_001137139.1|NP_067034.2	Q49AG3	ZBED5_HUMAN	zinc finger, BED-type containing 5	603							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)	4						tgcttcacttgagaatcagat	0.383																																						dbGAP											0													73.0	66.0	68.0					11																	10874686		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AF205601		11p15.3	2013-05-03			ENSG00000236287	ENSG00000236287		"""Zinc fingers, BED-type"""	30803	protein-coding gene	gene with protein product		615251				10607616, 23533661	Standard	NM_021211		Approved	Buster1	uc009ygh.3	Q49AG3	OTTHUMG00000150341	ENST00000432999.2:c.1807C>T	11.37:g.10874686G>A	ENSP00000398106:p.Gln603*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCC1|Q05D82|Q86WW3|Q9NT24|Q9UBJ4	Nonsense_Mutation	SNP	superfamily_RNaseH-like_dom,pfscan_Znf_BED_prd	p.Q603*	ENST00000432999.2	37	c.1807		11	.	.	.	.	.	.	.	.	.	.	G	38	7.198990	0.98129	.	.	ENSG00000236287	ENST00000432999;ENST00000413761	.	.	.	4.0	4.0	0.46444	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	.	11.9047	0.52703	0.0:0.0:1.0:0.0	.	.	.	.	X	603	.	ENSP00000415939:Q603X	Q	-	1	0	ZBED5	10831262	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.508000	0.53378	2.519000	0.84933	0.585000	0.79938	CAA	ZBED5	-	superfamily_RNaseH-like_dom	ENSG00000236287		0.383	ZBED5-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ZBED5	HGNC	protein_coding	OTTHUMT00000317691.1	26	0.00	0	G	NM_021211		10874686	10874686	-1	no_errors	ENST00000413761	ensembl	human	putative	69_37n	nonsense	68	21.59	19	SNP	1.000	A
ZBTB44	29068	genome.wustl.edu	37	11	130109788	130109788	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1IW-01A-11D-A13L-09	TCGA-EW-A1IW-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8b8732c3-78b1-409b-bc8c-c482575361bb	853ff819-807d-4569-b4e9-16f7f4cb59b3	g.chr11:130109788G>A	ENST00000357899.4	-	3	1294	c.1022C>T	c.(1021-1023)tCa>tTa	p.S341L	ZBTB44_ENST00000525842.1_Missense_Mutation_p.S341L|ZBTB44_ENST00000530205.1_Missense_Mutation_p.S341L|ZBTB44_ENST00000397753.1_Missense_Mutation_p.S341L			Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		TTCATCTACTGAGCCTGTGAA	0.418																																						dbGAP											0													105.0	100.0	102.0					11																	130109788		1914	4140	6054	-	-	-	SO:0001583	missense	0			AK024659	CCDS44776.1, CCDS73414.1, CCDS73415.1	11q24.3	2013-01-08	2006-09-19	2006-09-19		ENSG00000196323		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	25001	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 15"""	BTBD15		11042152	Standard	NM_014155		Approved	HSPC063, ZNF851	uc001qgb.4	Q8NCP5		ENST00000357899.4:c.1022C>T	11.37:g.130109788G>A	ENSP00000350574:p.Ser341Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPT8|Q86VJ7|Q86XX5	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q195*	ENST00000357899.4	37	c.583		11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.8|21.8	4.204362|4.204362	0.79127|0.79127	.|.	.|.	ENSG00000196323|ENSG00000196323	ENST00000529982|ENST00000525842;ENST00000397753;ENST00000445008;ENST00000357899;ENST00000530205	.|T;T;T;T;T	.|0.13538	.|2.59;2.9;2.64;2.9;2.58	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.058692	.|0.64402	.|D	.|0.000001	.|T	.|0.25344	.|0.0616	L|L	0.27053|0.27053	0.805|0.805	0.80722|0.80722	D|D	1|1	.|P;P;D;P	.|0.54601	.|0.844;0.728;0.967;0.844	.|P;P;P;P	.|0.60789	.|0.503;0.503;0.879;0.503	.|T	.|0.01266	.|-1.1401	.|10	.|0.72032	.|D	.|0.01	.|.	19.4961|19.4961	0.95073|0.95073	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|341;341;341;341	.|Q8NCP5-4;Q8NCP5-3;Q8NCP5;Q8NCP5-2	.|.;.;ZBT44_HUMAN;.	X|L	195|341	.|ENSP00000433457:S341L;ENSP00000380861:S341L;ENSP00000408079:S341L;ENSP00000350574:S341L;ENSP00000434177:S341L	.|ENSP00000350574:S341L	Q|S	-|-	1|2	0|0	ZBTB44|ZBTB44	129614998|129614998	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.520000|0.520000	0.34377|0.34377	8.872000|8.872000	0.92352|0.92352	2.601000|2.601000	0.87937|0.87937	0.557000|0.557000	0.71058|0.71058	CAG|TCA	ZBTB44	-	NULL	ENSG00000196323		0.418	ZBTB44-003	KNOWN	basic|appris_principal	protein_coding	ZBTB44	HGNC	protein_coding	OTTHUMT00000386126.1	41	0.00	0	G	NM_014155		130109788	130109788	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000529982	ensembl	human	putative	69_37n	nonsense	70	15.66	13	SNP	1.000	A
