#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCG4	64137	genome.wustl.edu	37	11	119027364	119027364	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr11:119027364A>C	ENST00000449422.2	+	8	1089	c.901A>C	c.(901-903)Acc>Ccc	p.T301P	ABCG4_ENST00000307417.3_Missense_Mutation_p.T301P|ABCG4_ENST00000531739.1_Missense_Mutation_p.T301P	NM_001142505.1	NP_001135977.1	Q9H172	ABCG4_HUMAN	ATP-binding cassette, sub-family G (WHITE), member 4	301	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|cholesterol transporter activity (GO:0017127)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(28)|ovary(2)|prostate(1)|skin(1)	44	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.7e-05)		GCATTGCCCCACCTACCACAA	0.587																																						dbGAP											0													91.0	86.0	88.0					11																	119027364		2200	4295	6495	-	-	-	SO:0001583	missense	0			AJ300465	CCDS8415.1	11q23	2012-03-14			ENSG00000172350	ENSG00000172350		"""ATP binding cassette transporters / subfamily G"""	13884	protein-coding gene	gene with protein product	"""putative ABC transporter"", ""ATP-binding cassette, subfamily G, member 4"""	607784				11435397	Standard	NM_022169		Approved	WHITE2	uc001pvs.3	Q9H172	OTTHUMG00000166169	ENST00000449422.2:c.901A>C	11.37:g.119027364A>C	ENSP00000406874:p.Thr301Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1B5|Q8WWH0|Q8WWH1|Q8WWH2	Missense_Mutation	SNP	pfam_ABC_2_trans,pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.T301P	ENST00000449422.2	37	c.901	CCDS8415.1	11	.	.	.	.	.	.	.	.	.	.	A	25.8	4.674439	0.88445	.	.	ENSG00000172350	ENST00000307417;ENST00000449422;ENST00000531739	T;T;T	0.42900	0.96;0.96;0.96	5.74	5.74	0.90152	ABC transporter-like (1);	0.043509	0.85682	D	0.000000	T	0.25195	0.0612	N	0.02539	-0.55	0.80722	D	1	D	0.56035	0.974	P	0.45913	0.497	T	0.27468	-1.0073	10	0.30854	T	0.27	-33.9224	16.0441	0.80707	1.0:0.0:0.0:0.0	.	301	Q9H172	ABCG4_HUMAN	P	301	ENSP00000304111:T301P;ENSP00000406874:T301P;ENSP00000434318:T301P	ENSP00000304111:T301P	T	+	1	0	ABCG4	118532574	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.954000	0.93051	2.177000	0.69029	0.533000	0.62120	ACC	ABCG4	-	pfscan_ABC_transporter-like	ENSG00000172350		0.587	ABCG4-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ABCG4	HGNC	protein_coding	OTTHUMT00000388215.1	45	0.00	0	A	NM_022169		119027364	119027364	+1	no_errors	ENST00000307417	ensembl	human	known	69_37n	missense	59	15.49	11	SNP	1.000	C
ATP8B2	57198	genome.wustl.edu	37	1	154303923	154303923	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr1:154303923C>T	ENST00000368489.3	+	6	406	c.406C>T	c.(406-408)Cgc>Tgc	p.R136C	ATP8B2_ENST00000341822.2_Missense_Mutation_p.R122C|ATP8B2_ENST00000426445.1_3'UTR|ATP8B2_ENST00000368487.3_Missense_Mutation_p.R103C	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	122					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTTTCAGTTCCGCCACAAGAG	0.507																																						dbGAP											0													89.0	90.0	89.0					1																	154303923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.406C>T	1.37:g.154303923C>T	ENSP00000357475:p.Arg136Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.R136C	ENST00000368489.3	37	c.406	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541407	0.85917	.	.	ENSG00000143515	ENST00000368487;ENST00000368489;ENST00000341822	D;D;D	0.85861	-2.04;-2.04;-2.04	5.49	5.49	0.81192	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.95617	0.8575	H	0.98388	4.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.85130	0.995;0.997;0.971	D	0.97255	0.9900	10	0.87932	D	0	.	18.3569	0.90361	0.0:1.0:0.0:0.0	.	122;136;103	P98198;P98198-3;P98198-4	AT8B2_HUMAN;.;.	C	103;136;122	ENSP00000357472:R103C;ENSP00000357475:R136C;ENSP00000340448:R122C	ENSP00000340448:R122C	R	+	1	0	ATP8B2	152570547	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.775000	0.85489	2.573000	0.86826	0.561000	0.74099	CGC	ATP8B2	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000143515		0.507	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	56	0.00	0	C	NM_020452		154303923	154303923	+1	no_errors	ENST00000368489	ensembl	human	known	69_37n	missense	133	13.07	20	SNP	1.000	T
BRS3	680	genome.wustl.edu	37	X	135570652	135570652	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chrX:135570652C>T	ENST00000370648.3	+	1	607	c.379C>T	c.(379-381)Cgg>Tgg	p.R127W	Z97632.1_ENST00000580943.1_RNA	NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	127					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					CTCTTTCATCCGGCTCACTTC	0.443																																						dbGAP											0													143.0	131.0	135.0					X																	135570652		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.379C>T	X.37:g.135570652C>T	ENSP00000359682:p.Arg127Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Bombesin_rcpt_3,prints_Bombsn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	p.R127W	ENST00000370648.3	37	c.379	CCDS14656.1	X	.	.	.	.	.	.	.	.	.	.	C	25.8	4.678215	0.88542	.	.	ENSG00000102239	ENST00000370648	T	0.37235	1.21	5.92	5.92	0.95590	GPCR, rhodopsin-like superfamily (1);	0.250562	0.33712	N	0.004640	T	0.50701	0.1631	L	0.36672	1.1	0.54753	D	0.999986	D	0.69078	0.997	P	0.62382	0.901	T	0.50800	-0.8785	10	0.87932	D	0	-5.8038	19.2416	0.93887	0.0:1.0:0.0:0.0	.	127	P32247	BRS3_HUMAN	W	127	ENSP00000359682:R127W	ENSP00000359682:R127W	R	+	1	2	BRS3	135398318	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.496000	0.84212	0.594000	0.82650	CGG	BRS3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Bombsn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt	ENSG00000102239		0.443	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRS3	HGNC	protein_coding	OTTHUMT00000059005.1	97	0.00	0	C	NM_001727		135570652	135570652	+1	no_errors	ENST00000370648	ensembl	human	known	69_37n	missense	106	22.63	31	SNP	1.000	T
C10orf120	399814	genome.wustl.edu	37	10	124459255	124459255	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr10:124459255T>C	ENST00000329446.4	-	1	83	c.52A>G	c.(52-54)Agt>Ggt	p.S18G		NM_001010912.1	NP_001010912.1	Q5SQS8	CJ120_HUMAN	chromosome 10 open reading frame 120	18										endometrium(1)|kidney(1)|large_intestine(6)|lung(9)|skin(2)|stomach(1)|urinary_tract(1)	21		all_neural(114;0.169)|Glioma(114;0.222)				ATTGTGTCACTAGCCCTCTGT	0.438																																						dbGAP											0													159.0	147.0	151.0					10																	124459255		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31302.1	10q26.13	2012-06-12			ENSG00000183559	ENSG00000183559			25707	protein-coding gene	gene with protein product							Standard	NM_001010912		Approved	bA318C4.1	uc001lgn.3	Q5SQS8	OTTHUMG00000019187	ENST00000329446.4:c.52A>G	10.37:g.124459255T>C	ENSP00000331012:p.Ser18Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU17	Missense_Mutation	SNP	NULL	p.S18G	ENST00000329446.4	37	c.52	CCDS31302.1	10	.	.	.	.	.	.	.	.	.	.	T	4.048	0.006496	0.07866	.	.	ENSG00000183559	ENST00000329446	T	0.28895	1.59	3.36	-0.469	0.12142	.	2.136030	0.02196	N	0.061869	T	0.15522	0.0374	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.13282	-1.0515	10	0.28530	T	0.3	0.1709	3.6728	0.08280	0.0:0.1775:0.4732:0.3493	.	18	Q5SQS8	CJ120_HUMAN	G	18	ENSP00000331012:S18G	ENSP00000331012:S18G	S	-	1	0	C10orf120	124449245	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.176000	0.09811	-0.077000	0.12752	-0.264000	0.10439	AGT	C10orf120	-	NULL	ENSG00000183559		0.438	C10orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf120	HGNC	protein_coding	OTTHUMT00000050803.1	149	0.00	0	T	NM_001010912		124459255	124459255	-1	no_errors	ENST00000329446	ensembl	human	known	69_37n	missense	231	10.12	26	SNP	0.000	C
CBFB	865	genome.wustl.edu	37	16	67100607	67100607	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr16:67100607T>A	ENST00000290858.6	+	4	566	c.305T>A	c.(304-306)aTt>aAt	p.I102N	CBFB_ENST00000412916.2_Missense_Mutation_p.I102N|CBFB_ENST00000561924.2_Missense_Mutation_p.I2N	NM_001755.2|NM_022845.2	NP_001746.1|NP_074036.1	Q13951	PEBB_HUMAN	core-binding factor, beta subunit	102					cell maturation (GO:0048469)|definitive hemopoiesis (GO:0060216)|lymphocyte differentiation (GO:0030098)|myeloid cell differentiation (GO:0030099)|osteoblast differentiation (GO:0001649)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|large_intestine(1)	4		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.00189)|Epithelial(162;0.00755)|all cancers(182;0.066)		GCTCCCATGATTCTGAATGGA	0.393			T	MYH11	AML																																	dbGAP		Dom	yes		16	16q22	865	"""core-binding factor, beta subunit"""		L	0													149.0	135.0	140.0					16																	67100607		2200	4300	6500	-	-	-	SO:0001583	missense	0			BC018509	CCDS10827.1, CCDS45508.1	16q22.1	2008-02-05			ENSG00000067955	ENSG00000067955			1539	protein-coding gene	gene with protein product		121360				8351518, 7587111	Standard	NM_001755		Approved	PEBP2B	uc002erb.3	Q13951	OTTHUMG00000137520	ENST00000290858.6:c.305T>A	16.37:g.67100607T>A	ENSP00000290858:p.Ile102Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K347|Q13124|Q9HCT2	Missense_Mutation	SNP	pfam_CBF_beta,superfamily_CBF_beta	p.I102N	ENST00000290858.6	37	c.305	CCDS10827.1	16	.	.	.	.	.	.	.	.	.	.	T	15.12	2.738722	0.49045	.	.	ENSG00000067955	ENST00000290858;ENST00000412916	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.79828	0.4513	M	0.80332	2.49	0.80722	D	1	D;D	0.61697	0.99;0.975	D;D	0.80764	0.994;0.992	T	0.82808	-0.0274	9	0.87932	D	0	-10.4475	14.5986	0.68424	0.0:0.0:0.0:1.0	.	102;102	Q13951-2;Q13951	.;PEBB_HUMAN	N	102	.	ENSP00000290858:I102N	I	+	2	0	CBFB	65658108	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.813000	0.86123	2.140000	0.66376	0.459000	0.35465	ATT	CBFB	-	pfam_CBF_beta,superfamily_CBF_beta	ENSG00000067955		0.393	CBFB-001	KNOWN	basic|CCDS	protein_coding	CBFB	HGNC	protein_coding	OTTHUMT00000268843.2	214	0.00	0	T	NM_001755		67100607	67100607	+1	no_errors	ENST00000290858	ensembl	human	known	69_37n	missense	169	33.73	86	SNP	1.000	A
CDH1	999	genome.wustl.edu	37	16	68857367	68857367	+	Nonsense_Mutation	SNP	A	A	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr16:68857367A>T	ENST00000261769.5	+	13	2193	c.2002A>T	c.(2002-2004)Aag>Tag	p.K668*	RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Nonsense_Mutation_p.K607*|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	668	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		AATCAATCTCAAGCTCATGGA	0.468			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													111.0	110.0	110.0					16																	68857367		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2002A>T	16.37:g.68857367A>T	ENSP00000261769:p.Lys668*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.K668*	ENST00000261769.5	37	c.2002	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	A	34	5.327776	0.95733	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000422392	.	.	.	6.17	6.17	0.99709	.	0.235844	0.29508	N	0.011947	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.12766	T	0.61	.	10.7754	0.46346	0.9294:0.0:0.0706:0.0	.	.	.	.	X	668;686;607	.	ENSP00000261769:K668X	K	+	1	0	CDH1	67414868	1.000000	0.71417	0.881000	0.34555	0.014000	0.08584	1.917000	0.39996	2.371000	0.80710	0.533000	0.62120	AAG	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000039068		0.468	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	69	0.00	0	A	NM_004360		68857367	68857367	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	49	30.99	22	SNP	1.000	T
CLDN12	9069	genome.wustl.edu	37	7	90042451	90042451	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr7:90042451T>A	ENST00000287916.4	+	3	748	c.461T>A	c.(460-462)gTc>gAc	p.V154D	CLDN12_ENST00000535571.1_Missense_Mutation_p.V154D|CLDN12_ENST00000394605.2_Missense_Mutation_p.V154D|CTB-13L3.1_ENST00000480135.1_RNA	NM_001185073.2|NM_012129.4	NP_001172002.1|NP_036261.1	P56749	CLD12_HUMAN	claudin 12	154					calcium-independent cell-cell adhesion (GO:0016338)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|tight junction assembly (GO:0070830)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			breast(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)	15						TCTATCTGGGTCATCTTTTAT	0.473																																						dbGAP											0													171.0	162.0	165.0					7																	90042451		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ250713	CCDS5618.1	7q21	2008-07-18			ENSG00000157224	ENSG00000157224		"""Claudins"""	2034	protein-coding gene	gene with protein product		611232					Standard	NM_001185072		Approved		uc003ukr.3	P56749	OTTHUMG00000156612	ENST00000287916.4:c.461T>A	7.37:g.90042451T>A	ENSP00000287916:p.Val154Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5Q4|Q7LDZ0	Missense_Mutation	SNP	prints_Claudin12	p.V154D	ENST00000287916.4	37	c.461	CCDS5618.1	7	.	.	.	.	.	.	.	.	.	.	T	12.58	1.980710	0.34942	.	.	ENSG00000157224	ENST00000422604;ENST00000416322;ENST00000496677;ENST00000287916;ENST00000535571;ENST00000394604;ENST00000394605	T;T;T;T;T;T	0.74632	-0.62;-0.86;-0.86;-0.86;-0.59;-0.86	5.45	4.31	0.51392	.	0.166025	0.52532	D	0.000062	T	0.58206	0.2106	N	0.19112	0.55	0.52501	D	0.999958	B	0.16603	0.018	B	0.20955	0.032	T	0.54430	-0.8295	10	0.51188	T	0.08	-17.796	8.0306	0.30463	0.0:0.1572:0.0:0.8428	.	154	P56749	CLD12_HUMAN	D	154	ENSP00000411399:V154D;ENSP00000419053:V154D;ENSP00000287916:V154D;ENSP00000443476:V154D;ENSP00000378102:V154D;ENSP00000378103:V154D	ENSP00000287916:V154D	V	+	2	0	CLDN12	89880387	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.547000	0.60712	1.099000	0.41499	0.533000	0.62120	GTC	CLDN12	-	prints_Claudin12	ENSG00000157224		0.473	CLDN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN12	HGNC	protein_coding	OTTHUMT00000059221.1	107	0.00	0	T	NM_012129		90042451	90042451	+1	no_errors	ENST00000287916	ensembl	human	known	69_37n	missense	141	18.99	34	SNP	1.000	A
CRISPLD1	83690	genome.wustl.edu	37	8	75927084	75927084	+	Missense_Mutation	SNP	C	C	T	rs566911502		TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr8:75927084C>T	ENST00000262207.4	+	6	1132	c.664C>T	c.(664-666)Cgg>Tgg	p.R222W	CRISPLD1_ENST00000523524.1_Missense_Mutation_p.R34W|CRISPLD1_ENST00000517786.1_Missense_Mutation_p.R36W	NM_031461.5	NP_113649.1	Q9H336	CRLD1_HUMAN	cysteine-rich secretory protein LCCL domain containing 1	222					face morphogenesis (GO:0060325)	extracellular vesicular exosome (GO:0070062)		p.R222W(2)		biliary_tract(1)|central_nervous_system(1)|endometrium(3)|kidney(7)|large_intestine(10)|lung(16)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(64;0.0799)		Epithelial(68;0.155)|BRCA - Breast invasive adenocarcinoma(89;0.161)			CAAACATGGGCGGCCCTGTTC	0.423																																						dbGAP											2	Substitution - Missense(2)	large_intestine(1)|kidney(1)											52.0	48.0	50.0					8																	75927084		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834301	CCDS6219.1, CCDS69497.1, CCDS75754.1	8q21.13	2005-09-23	2005-02-16	2005-02-16	ENSG00000121005	ENSG00000121005			18206	protein-coding gene	gene with protein product			"""LCCL domain containing cysteine-rich secretory protein 1"""	LCRISP1			Standard	NM_031461		Approved	Cocoacrisp, DKFZp762F133	uc003yan.3	Q9H336	OTTHUMG00000164529	ENST00000262207.4:c.664C>T	8.37:g.75927084C>T	ENSP00000262207:p.Arg222Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA60|B7Z929	Missense_Mutation	SNP	pfam_LCCL,pfam_CAP_domain,superfamily_CAP_domain,superfamily_LCCL,smart_Allrgn_V5/Tpx1,smart_LCCL,pfscan_LCCL,prints_Allrgn_V5/Tpx1	p.R222W	ENST00000262207.4	37	c.664	CCDS6219.1	8	.	.	.	.	.	.	.	.	.	.	C	18.81	3.702661	0.68501	.	.	ENSG00000121005	ENST00000262207;ENST00000523524;ENST00000517786	T;T;D	0.83250	0.2;-1.34;-1.7	4.6	3.69	0.42338	.	0.171361	0.46442	D	0.000284	T	0.79747	0.4499	L	0.49126	1.545	0.38547	D	0.949369	D;P	0.56968	0.978;0.903	B;B	0.43623	0.425;0.2	T	0.83052	-0.0152	10	0.72032	D	0.01	.	13.595	0.61984	0.1616:0.8384:0.0:0.0	.	36;222	B7Z929;Q9H336	.;CRLD1_HUMAN	W	222;34;36	ENSP00000262207:R222W;ENSP00000430105:R34W;ENSP00000429746:R36W	ENSP00000262207:R222W	R	+	1	2	CRISPLD1	76089639	0.107000	0.21998	0.873000	0.34254	0.895000	0.52256	1.508000	0.35769	1.085000	0.41206	0.460000	0.39030	CGG	CRISPLD1	-	NULL	ENSG00000121005		0.423	CRISPLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRISPLD1	HGNC	protein_coding	OTTHUMT00000379117.1	32	0.00	0	C	NM_031461		75927084	75927084	+1	no_errors	ENST00000262207	ensembl	human	known	69_37n	missense	46	13.21	7	SNP	0.873	T
CROCCP2	84809	genome.wustl.edu	37	1	16950889	16950889	+	lincRNA	SNP	G	G	A	rs12045375	byFrequency	TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr1:16950889G>A	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											TTGCCCCAGCGTCTCCACCTG	0.697													.|||	1177	0.235024	0.0174	0.2738	5008	,	,		56460	0.4712		0.2495	False		,,,				2504	0.2434					dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950889G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.697	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	20	0.00	0	G	NR_026752.1		16950889	16950889	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	17	26.09	6	SNP	0.470	A
DND1	373863	genome.wustl.edu	37	5	140052285	140052285	+	Frame_Shift_Del	DEL	T	T	-	rs375722663	byFrequency	TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr5:140052285delT	ENST00000542735.1	-	3	392	c.349delA	c.(349-351)acgfs	p.T117fs		NM_194249.2	NP_919225.1	Q8IYX4	DND1_HUMAN	DND microRNA-mediated repression inhibitor 1	117	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|negative regulation of gene silencing by miRNA (GO:0060965)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)	p.T117fs*24(1)		central_nervous_system(1)|prostate(4)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTGTGCAGCGTGGCGATGGCG	0.682													T|T|-|deletion	29	0.00579073	0.0	0.0173	5008	,	,		10844	0.002		0.0139	False		,,,				2504	0.001					dbGAP											1	Deletion - Frameshift(1)	central_nervous_system(1)											6.0	7.0	6.0					5																	140052285		2084	4099	6183	-	-	-	SO:0001589	frameshift_variant	0			AY321065	CCDS4236.1	5q31.3	2013-07-31	2013-07-31		ENSG00000256453	ENSG00000256453		"""RNA binding motif (RRM) containing"""	23799	protein-coding gene	gene with protein product		609385	"""dead end homolog 1 (zebrafish)"""			12932328	Standard	NM_194249		Approved	MGC34750, RBMS4	uc003lgt.3	Q8IYX4	OTTHUMG00000129499	ENST00000542735.1:c.349delA	5.37:g.140052285delT	ENSP00000445366:p.Thr117fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T117fs	ENST00000542735.1	37	c.349	CCDS4236.1	5																																																																																			DND1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000256453		0.682	DND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DND1	HGNC	protein_coding	OTTHUMT00000251669.2	8	0.00	0	T	NM_194249		140052285	140052285	-1	no_errors	ENST00000542735	ensembl	human	known	69_37n	frame_shift_del	4	42.86	3	DEL	0.986	-
EIF2S2	8894	genome.wustl.edu	37	20	32678367	32678367	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr20:32678367C>T	ENST00000374980.2	-	8	1003	c.782G>A	c.(781-783)aGa>aAa	p.R261K		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	261					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						CTGTTGGAATCTTCCTTTGAT	0.308																																						dbGAP											0													114.0	97.0	103.0					20																	32678367		2170	4262	6432	-	-	-	SO:0001583	missense	0			M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.782G>A	20.37:g.32678367C>T	ENSP00000364119:p.Arg261Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BVU0|Q9UJE4	Missense_Mutation	SNP	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N,superfamily_Transl_init_fac_IF2/IF5_Zn-bd,smart_Transl_init_fac_IF2/IF5	p.R261K	ENST00000374980.2	37	c.782	CCDS13231.1	20	.	.	.	.	.	.	.	.	.	.	C	34	5.404877	0.96051	.	.	ENSG00000125977	ENST00000374980	T	0.39787	1.06	5.96	5.96	0.96718	Translation initiation factor IF2/IF5, N-terminal (2);Translation initiation factor IF2/IF5 (2);	0.000000	0.85682	D	0.000000	T	0.55257	0.1909	L	0.28274	0.84	0.80722	D	1	B;P;P	0.49185	0.379;0.92;0.92	B;D;D	0.66716	0.444;0.946;0.946	T	0.55976	-0.8055	10	0.87932	D	0	-37.5836	20.422	0.99049	0.0:1.0:0.0:0.0	.	261;261;261	B5BU01;Q6IBR8;P20042	.;.;IF2B_HUMAN	K	261	ENSP00000364119:R261K	ENSP00000364119:R261K	R	-	2	0	EIF2S2	32142028	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.832000	0.97577	0.655000	0.94253	AGA	EIF2S2	-	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N,smart_Transl_init_fac_IF2/IF5	ENSG00000125977		0.308	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S2	HGNC	protein_coding	OTTHUMT00000078765.2	160	0.00	0	C	NM_003908		32678367	32678367	-1	no_errors	ENST00000374980	ensembl	human	known	69_37n	missense	258	17.04	53	SNP	1.000	T
IRGC	56269	genome.wustl.edu	37	19	44223936	44223936	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr19:44223936C>T	ENST00000244314.5	+	2	1425	c.1226C>T	c.(1225-1227)cCg>cTg	p.P409L		NM_019612.3	NP_062558.1	Q6NXR0	IIGP5_HUMAN	immunity-related GTPase family, cinema	409						membrane (GO:0016020)	GTP binding (GO:0005525)|hydrolase activity, acting on acid anhydrides (GO:0016817)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)|skin(2)	25		Prostate(69;0.0435)				GATGACGAGCCGCAGCCGGAG	0.642																																					Colon(189;350 2037 11447 13433 38914)	dbGAP											0													31.0	31.0	31.0					19																	44223936		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC066939	CCDS12629.1	19q13.32	2008-02-05	2005-10-31	2005-10-31	ENSG00000124449	ENSG00000124449			28835	protein-coding gene	gene with protein product			"""immunity-related GTPase family, cinema 1"""	IRGC1		12477932	Standard	NM_019612		Approved	Iigp5, CINEMA	uc002oxh.3	Q6NXR0	OTTHUMG00000154587	ENST00000244314.5:c.1226C>T	19.37:g.44223936C>T	ENSP00000244314:p.Pro409Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BR8	Missense_Mutation	SNP	pfam_Interferon-induced_GTPase	p.P409L	ENST00000244314.5	37	c.1226	CCDS12629.1	19	.	.	.	.	.	.	.	.	.	.	C	6.354	0.433397	0.12045	.	.	ENSG00000124449	ENST00000244314	T	0.24151	1.87	4.77	4.77	0.60923	.	1.763870	0.03508	N	0.219101	T	0.21427	0.0516	N	0.24115	0.695	0.09310	N	0.999998	B	0.20261	0.043	B	0.17098	0.017	T	0.20605	-1.0270	10	0.10902	T	0.67	.	13.303	0.60336	0.0:1.0:0.0:0.0	.	409	Q6NXR0	IIGP5_HUMAN	L	409	ENSP00000244314:P409L	ENSP00000244314:P409L	P	+	2	0	IRGC	48915776	0.125000	0.22332	0.090000	0.20809	0.039000	0.13416	2.046000	0.41260	2.219000	0.72066	0.650000	0.86243	CCG	IRGC	-	NULL	ENSG00000124449		0.642	IRGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRGC	HGNC	protein_coding	OTTHUMT00000336191.1	13	0.00	0	C	NM_019612		44223936	44223936	+1	no_errors	ENST00000244314	ensembl	human	known	69_37n	missense	27	17.65	6	SNP	0.059	T
KCNMB3	27094	genome.wustl.edu	37	3	178984451	178984451	+	Silent	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr3:178984451C>T	ENST00000349697.2	-	1	308	c.48G>A	c.(46-48)cgG>cgA	p.R16R	KCNMB3_ENST00000497599.1_Silent_p.R16R	NM_171828.1	NP_741979.1	Q9NPA1	KCMB3_HUMAN	potassium large conductance calcium-activated channel, subfamily M beta member 3	0					action potential (GO:0001508)|blood coagulation (GO:0007596)|detection of calcium ion (GO:0005513)|neuronal action potential (GO:0019228)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			NS(1)|large_intestine(1)|lung(2)|stomach(1)	5	all_cancers(143;5.6e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;2.41e-27)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.03)		Miconazole(DB01110)|Procaine(DB00721)	CCTGGCGCCTCCGGCTGCCCT	0.592																																						dbGAP											0													52.0	51.0	52.0					3																	178984451		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF139471	CCDS3225.1, CCDS3226.1, CCDS43172.1, CCDS43173.1, CCDS54683.1	3q26.3-q27	2010-09-30			ENSG00000171121	ENSG00000171121		"""Potassium channels"""	6287	protein-coding gene	gene with protein product		605222		KCNMB2, KCNMBL		10585773	Standard	NM_001163677		Approved		uc003fjm.3	Q9NPA1	OTTHUMG00000157337	ENST00000349697.2:c.48G>A	3.37:g.178984451C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9C9|D3DNR2|E9PER5|Q9NPG7|Q9NRM9|Q9UHN3	Silent	SNP	pfam_K_chnl_Ca-activ_BK_bsu	p.R16	ENST00000349697.2	37	c.48	CCDS3225.1	3																																																																																			KCNMB3	-	NULL	ENSG00000171121		0.592	KCNMB3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNMB3	HGNC	protein_coding	OTTHUMT00000358530.1	57	0.00	0	C			178984451	178984451	-1	no_errors	ENST00000349697	ensembl	human	known	69_37n	silent	53	36.90	31	SNP	0.988	T
KIF2B	84643	genome.wustl.edu	37	17	51901204	51901204	+	Silent	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr17:51901204C>T	ENST00000268919.4	+	1	966	c.810C>T	c.(808-810)ttC>ttT	p.F270F		NM_032559.4	NP_115948.4	Q8N4N8	KIF2B_HUMAN	kinesin family member 2B	270	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(15)|lung(58)|ovary(5)|prostate(4)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						ACCATGCCTTCGATGACAAAG	0.572																																						dbGAP											0													129.0	106.0	114.0					17																	51901204		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF333335	CCDS32685.1	17q22	2014-08-12			ENSG00000141200	ENSG00000141200		"""Kinesins"""	29443	protein-coding gene	gene with protein product		615142				11416179	Standard	NM_032559		Approved		uc002iua.2	Q8N4N8	OTTHUMG00000177756	ENST00000268919.4:c.810C>T	17.37:g.51901204C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MA2|Q9BXG6	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.F270	ENST00000268919.4	37	c.810	CCDS32685.1	17																																																																																			KIF2B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000141200		0.572	KIF2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2B	HGNC	protein_coding	OTTHUMT00000438854.1	93	0.00	0	C	NM_032559		51901204	51901204	+1	no_errors	ENST00000268919	ensembl	human	known	69_37n	silent	97	23.02	29	SNP	0.978	T
KIF19	124602	genome.wustl.edu	37	17	72341085	72341085	+	Silent	SNP	C	C	T	rs527755806		TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr17:72341085C>T	ENST00000389916.4	+	7	906	c.768C>T	c.(766-768)cgC>cgT	p.R256R		NM_153209.3	NP_694941.2	Q2TAC6	KIF19_HUMAN	kinesin family member 19	256	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|axonemal microtubule depolymerization (GO:0060404)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|plus-end specific microtubule depolymerization (GO:0070462)	cilium (GO:0005929)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|plus-end-directed microtubule motor activity (GO:0008574)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(16)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	41						GCTCAGAGCGCGCCTCGCAGG	0.662													T|||	1	0.000199681	0.0	0.0	5008	,	,		14818	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													17.0	17.0	17.0					17																	72341085		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			AK094619	CCDS32718.2	17q25	2007-02-13			ENSG00000196169	ENSG00000196169		"""Kinesins"""	26735	protein-coding gene	gene with protein product						11416179	Standard	NM_153209		Approved	FLJ37300, KIF19A	uc031rei.1	Q2TAC6	OTTHUMG00000150694	ENST00000389916.4:c.768C>T	17.37:g.72341085C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLG2|B7ZKR1|Q52M87|Q8N1X8|Q8TAB6	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R256	ENST00000389916.4	37	c.768	CCDS32718.2	17																																																																																			KIF19	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	ENSG00000196169		0.662	KIF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF19	HGNC	protein_coding	OTTHUMT00000319644.2	13	0.00	0	C	NM_153209		72341085	72341085	+1	no_errors	ENST00000389916	ensembl	human	known	69_37n	silent	16	36.00	9	SNP	0.038	T
LCT	3938	genome.wustl.edu	37	2	136548358	136548358	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr2:136548358C>T	ENST00000264162.2	-	15	5215	c.5205G>A	c.(5203-5205)tgG>tgA	p.W1735*		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1735	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	CCTCCTTTAACCAGTTCAGGA	0.502																																						dbGAP											0													122.0	112.0	115.0					2																	136548358		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.5205G>A	2.37:g.136548358C>T	ENSP00000264162:p.Trp1735*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG58	Nonsense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.W1735*	ENST00000264162.2	37	c.5205	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	C	44	10.797811	0.99469	.	.	ENSG00000115850	ENST00000264162	.	.	.	6.06	6.06	0.98353	.	0.106827	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.7394	20.6208	0.99490	0.0:1.0:0.0:0.0	.	.	.	.	X	1735	.	ENSP00000264162:W1735X	W	-	3	0	LCT	136264828	1.000000	0.71417	0.975000	0.42487	0.964000	0.63967	3.588000	0.53964	2.882000	0.98803	0.655000	0.94253	TGG	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.502	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	122	0.00	0	C	NM_002299		136548358	136548358	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	nonsense	99	18.18	22	SNP	0.998	T
MUC4	4585	genome.wustl.edu	37	3	195511668	195511668	+	Silent	SNP	G	G	A	rs71291861|rs3107748	byFrequency	TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr3:195511668G>A	ENST00000463781.3	-	2	7242	c.6783C>T	c.(6781-6783)gaC>gaT	p.D2261D	MUC4_ENST00000475231.1_Silent_p.D2261D|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		CTGAGGAAGCGTCGGTGACAG	0.582													.|||	2203	0.439896	0.236	0.4352	5008	,	,		10401	0.7054		0.4602	False		,,,				2504	0.4243					dbGAP											0													34.0	33.0	33.0					3																	195511668		679	1584	2263	-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6783C>T	3.37:g.195511668G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.D2261	ENST00000463781.3	37	c.6783	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.582	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	10	0.00	0	G	NM_018406		195511668	195511668	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	724	17.78	157	SNP	0.004	A
OR4D10	390197	genome.wustl.edu	37	11	59245266	59245266	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr11:59245266C>T	ENST00000530162.1	+	1	421	c.364C>T	c.(364-366)Cga>Tga	p.R122*		NM_001004705.1	NP_001004705.1	Q8NGI6	OR4DA_HUMAN	olfactory receptor, family 4, subfamily D, member 10	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGCATTGGATCGATATGTGGC	0.483																																						dbGAP											0													86.0	87.0	87.0					11																	59245266		2190	4292	6482	-	-	-	SO:0001587	stop_gained	0			AB065808	CCDS53636.1	11q12.1	2012-10-03		2004-03-10	ENSG00000254466	ENSG00000254466		"""GPCR / Class A : Olfactory receptors"""	15173	protein-coding gene	gene with protein product				OR4D10P			Standard	NM_001004705		Approved	OST711	uc001nnz.1	Q8NGI6	OTTHUMG00000167341	ENST00000530162.1:c.364C>T	11.37:g.59245266C>T	ENSP00000436424:p.Arg122*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNH6	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R122*	ENST00000530162.1	37	c.364	CCDS53636.1	11	.	.	.	.	.	.	.	.	.	.	C	10.93	1.490552	0.26686	.	.	ENSG00000254466	ENST00000530162	.	.	.	4.71	0.431	0.16523	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.9804	0.09492	0.2595:0.4115:0.253:0.076	.	.	.	.	X	122	.	ENSP00000436424:R122X	R	+	1	2	OR4D10	59001842	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.143000	0.10296	-0.114000	0.11936	-0.182000	0.12963	CGA	OR4D10	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000254466		0.483	OR4D10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D10	HGNC	protein_coding	OTTHUMT00000394235.1	78	0.00	0	C	NM_001004705		59245266	59245266	+1	no_errors	ENST00000530162	ensembl	human	known	69_37n	nonsense	80	36.00	45	SNP	0.463	T
OR5K2	402135	genome.wustl.edu	37	3	98217148	98217148	+	Silent	SNP	C	C	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr3:98217148C>T	ENST00000427338.1	+	1	701	c.624C>T	c.(622-624)gtC>gtT	p.V208V	CLDND1_ENST00000502288.1_Intron	NM_001004737.1	NP_001004737.1	Q8NHB8	OR5K2_HUMAN	olfactory receptor, family 5, subfamily K, member 2	208						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V208V(1)		endometrium(2)|large_intestine(1)|lung(10)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						CAGTTCAAGTCTTTACCATAG	0.378																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											184.0	180.0	181.0					3																	98217148		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AC021660	CCDS33804.1	3q11.2	2013-09-23			ENSG00000231861	ENSG00000231861		"""GPCR / Class A : Olfactory receptors"""	14774	protein-coding gene	gene with protein product							Standard	NM_001004737		Approved		uc011bgx.2	Q8NHB8	OTTHUMG00000160049	ENST00000427338.1:c.624C>T	3.37:g.98217148C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN70|Q6IF47	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V208	ENST00000427338.1	37	c.624	CCDS33804.1	3																																																																																			OR5K2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000231861		0.378	OR5K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5K2	HGNC	protein_coding	OTTHUMT00000359020.2	127	0.78	1	C			98217148	98217148	+1	no_errors	ENST00000427338	ensembl	human	known	69_37n	silent	177	20.89	47	SNP	0.477	T
PEG10	23089	genome.wustl.edu	37	7	94293359	94293359	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr7:94293359G>A	ENST00000482108.1	+	2	970	c.491G>A	c.(490-492)cGa>cAa	p.R164Q	PEG10_ENST00000488574.1_Missense_Mutation_p.R164Q	NM_001040152.1|NM_001172438.1|NM_001184962.1	NP_001035242.1|NP_001165909.1|NP_001171891.1	Q86TG7	PEG10_HUMAN	paternally expressed 10	164	Necessary for interaction with ALK1.				apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|placenta development (GO:0001890)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(9)|prostate(3)|skin(1)	21	all_cancers(62;8.26e-10)|all_epithelial(64;5.59e-09)|Lung NSC(181;0.188)|all_lung(186;0.215)		STAD - Stomach adenocarcinoma(171;0.0031)			CCTCAGAGGCGAGAGGTTGCC	0.542																																						dbGAP											0													139.0	145.0	143.0					7																	94293359		2012	4166	6178	-	-	-	SO:0001583	missense	0			AB049834	CCDS55126.1, CCDS75636.1, CCDS75637.1	7q21	2007-12-07			ENSG00000242265	ENSG00000242265			14005	protein-coding gene	gene with protein product		609810				11318613, 15716091, 16093683	Standard	NM_001172437		Approved	KIAA1051, HB-1, MEF3L, RGAG3, Mar2, Mart2	uc011kie.2	Q86TG7	OTTHUMG00000155578	ENST00000482108.1:c.491G>A	7.37:g.94293359G>A	ENSP00000417587:p.Arg164Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96A68|Q9UPV1	Missense_Mutation	SNP	pfam_Retrotrans_gag,superfamily_Znf_CCHC,pfscan_Znf_CCHC	p.R164Q	ENST00000482108.1	37	c.491	CCDS55126.1	7	.	.	.	.	.	.	.	.	.	.	G	9.328	1.059889	0.19987	.	.	ENSG00000242265	ENST00000482108;ENST00000488574	T;T	0.11385	2.78;2.78	4.05	3.15	0.36227	Retrotransposon gag protein (1);	.	.	.	.	T	0.08846	0.0219	N	0.22421	0.69	0.09310	N	1	D;D	0.61697	0.99;0.979	P;B	0.49192	0.602;0.42	T	0.15867	-1.0422	9	0.13470	T	0.59	.	7.0365	0.24996	0.1238:0.0:0.8762:0.0	.	240;164	B4DSP0;Q86TG7	.;PEG10_HUMAN	Q	164	ENSP00000417587:R164Q;ENSP00000418944:R164Q	ENSP00000417587:R164Q	R	+	2	0	PEG10	94131295	0.022000	0.18835	0.928000	0.36995	0.983000	0.72400	1.431000	0.34925	2.276000	0.75962	0.555000	0.69702	CGA	PEG10	-	pfam_Retrotrans_gag	ENSG00000242265		0.542	PEG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG10	HGNC	protein_coding	OTTHUMT00000340751.1	28	0.00	0	G	NM_015068		94293359	94293359	+1	no_errors	ENST00000482108	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	0.162	A
PIGN	23556	genome.wustl.edu	37	18	59749915	59749915	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr18:59749915G>A	ENST00000357637.5	-	28	2982	c.2567C>T	c.(2566-2568)tCg>tTg	p.S856L	PIGN_ENST00000400334.3_Missense_Mutation_p.S856L	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	856					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				CCTTTTTGACGATAACTGAGT	0.308																																						dbGAP											0													60.0	52.0	55.0					18																	59749915		1805	4054	5859	-	-	-	SO:0001583	missense	0			AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.2567C>T	18.37:g.59749915G>A	ENSP00000350263:p.Ser856Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.S856L	ENST00000357637.5	37	c.2567	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735460	0.89482	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.56103	0.48;0.48	5.68	5.68	0.88126	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.070670	0.64402	D	0.000014	T	0.74291	0.3697	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72625	0.978;0.972	T	0.70124	-0.4958	10	0.24483	T	0.36	-7.8756	18.9257	0.92544	0.0:0.0:1.0:0.0	.	856;856	B2RCI8;O95427	.;PIGN_HUMAN	L	856	ENSP00000350263:S856L;ENSP00000383188:S856L	ENSP00000350263:S856L	S	-	2	0	PIGN	57900895	1.000000	0.71417	0.951000	0.38953	0.974000	0.67602	7.878000	0.87231	2.838000	0.97847	0.591000	0.81541	TCG	PIGN	-	pfam_GPI_EtnP_transferase_1_C	ENSG00000197563		0.308	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	HGNC	protein_coding	OTTHUMT00000449757.2	47	0.00	0	G	NM_176787		59749915	59749915	-1	no_errors	ENST00000357637	ensembl	human	known	69_37n	missense	85	26.09	30	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	84	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	55	31.25	25	SNP	1.000	G
POLG	5428	genome.wustl.edu	37	15	89866675	89866676	+	Frame_Shift_Ins	INS	-	-	T	rs147827654	byFrequency	TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr15:89866675_89866676insT	ENST00000268124.5	-	13	2557_2558	c.2224_2225insA	c.(2224-2226)gtgfs	p.V742fs	POLG_ENST00000442287.2_Frame_Shift_Ins_p.V742fs	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	742					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			AGGGATGTCCACGTCGTTGTAA	0.584								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.2224_2225insA	15.37:g.89866675_89866676insT	ENSP00000268124:p.Val742fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFM2|Q92515	Frame_Shift_Ins	INS	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.V742fs	ENST00000268124.5	37	c.2225_2224	CCDS10350.1	15																																																																																			POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom	ENSG00000140521		0.584	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2	45	0.00	0	-	NM_002693		89866675	89866676	-1	no_errors	ENST00000268124	ensembl	human	known	69_37n	frame_shift_ins	117	10.69	14	INS	1.000:1.000	T
RANBP3	8498	genome.wustl.edu	37	19	5921287	5921287	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr19:5921287C>A	ENST00000340578.6	-	14	1312	c.1255G>T	c.(1255-1257)Gtg>Ttg	p.V419L	RANBP3_ENST00000541471.1_Missense_Mutation_p.V291L|RANBP3_ENST00000439268.2_Missense_Mutation_p.V414L|RANBP3_ENST00000591092.1_Missense_Mutation_p.V346L|RANBP3_ENST00000034275.8_Missense_Mutation_p.V351L	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	419	RanBD1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CCTCTCTCCACCCAGGACTGT	0.622																																						dbGAP											0													57.0	65.0	62.0					19																	5921287		2011	4176	6187	-	-	-	SO:0001583	missense	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.1255G>T	19.37:g.5921287C>A	ENSP00000341483:p.Val419Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.V419L	ENST00000340578.6	37	c.1255	CCDS42478.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.013094|4.013094	0.75161|0.75161	.|.	.|.	ENSG00000031823|ENSG00000031823	ENST00000324807|ENST00000340578;ENST00000439268;ENST00000034275;ENST00000541471	.|T;T;T;T	.|0.41400	.|1.0;1.0;1.0;1.0	5.28|5.28	5.28|5.28	0.74379|0.74379	.|Pleckstrin homology-type (1);Ran binding protein 1 (3);	.|0.055561	.|0.64402	.|D	.|0.000001	.|T	.|0.42131	.|0.1189	N|N	0.19112|0.19112	0.55|0.55	0.58432|0.58432	D|D	0.999996|0.999996	.|B;P;P;P;P;P;P	.|0.43578	.|0.437;0.811;0.679;0.679;0.629;0.774;0.811	.|B;P;P;B;B;P;P	.|0.50934	.|0.197;0.654;0.451;0.375;0.258;0.523;0.654	.|T	.|0.35276	.|-0.9795	.|10	.|0.49607	.|T	.|0.09	.|-24.8802	16.4424|16.4424	0.83906|0.83906	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|291;414;291;346;351;414;419	.|F5H4C2;Q53GE1;B7Z5P4;B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.|.;.;.;.;.;.;RANB3_HUMAN	.|L	-1|419;414;351;291	.|ENSP00000341483:V419L;ENSP00000404837:V414L;ENSP00000034275:V351L;ENSP00000445071:V291L	.|ENSP00000034275:V351L	.|V	-|-	.|1	.|0	RANBP3|RANBP3	5872287|5872287	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	3.615000|3.615000	0.54167|0.54167	2.479000|2.479000	0.83701|0.83701	0.655000|0.655000	0.94253|0.94253	.|GTG	RANBP3	-	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	ENSG00000031823		0.622	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	35	0.00	0	C	NM_007322		5921287	5921287	-1	no_errors	ENST00000340578	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	1.000	A
TESK1	7016	genome.wustl.edu	37	9	35608979	35608979	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr9:35608979A>G	ENST00000336395.5	+	10	1371	c.1121A>G	c.(1120-1122)aAt>aGt	p.N374S	MIR4667_ENST00000578933.1_RNA|TESK1_ENST00000498522.1_3'UTR|CD72_ENST00000490239.1_5'Flank	NM_006285.2	NP_006276.2	Q15569	TESK1_HUMAN	testis-specific kinase 1	374					cell junction assembly (GO:0034329)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	27			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TGGGGGGACAATCTGACTCGA	0.607																																						dbGAP											0													74.0	78.0	77.0					9																	35608979		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50863	CCDS6580.1	9p13	2010-04-27			ENSG00000107140	ENSG00000107140	2.7.12.1		11731	protein-coding gene	gene with protein product	"""testis-specific kinase-1"", ""testis specific kinase-1"""	601782				8537404	Standard	NM_006285		Approved		uc003zxa.3	Q15569	OTTHUMG00000019863	ENST00000336395.5:c.1121A>G	9.37:g.35608979A>G	ENSP00000338127:p.Asn374Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.N374S	ENST00000336395.5	37	c.1121	CCDS6580.1	9	.	.	.	.	.	.	.	.	.	.	A	7.100	0.573850	0.13623	.	.	ENSG00000107140	ENST00000336395	T	0.58797	0.31	5.55	-9.86	0.00473	.	0.574594	0.15682	N	0.249869	T	0.18759	0.0450	N	0.01352	-0.895	0.32191	N	0.579126	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.40869	-0.9540	10	0.08179	T	0.78	0.356	14.2613	0.66088	0.1691:0.1777:0.6532:0.0	.	292;374	B4DQQ3;Q15569	.;TESK1_HUMAN	S	374	ENSP00000338127:N374S	ENSP00000338127:N374S	N	+	2	0	TESK1	35598979	0.017000	0.18338	0.900000	0.35374	0.986000	0.74619	-0.366000	0.07563	-1.153000	0.02829	-0.379000	0.06801	AAT	TESK1	-	NULL	ENSG00000107140		0.607	TESK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK1	HGNC	protein_coding	OTTHUMT00000052314.1	49	0.00	0	A	NM_006285		35608979	35608979	+1	no_errors	ENST00000336395	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.737	G
TLE3	7090	genome.wustl.edu	37	15	70345629	70345629	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr15:70345629G>T	ENST00000558939.1	-	17	3297	c.1920C>A	c.(1918-1920)aaC>aaA	p.N640K	TLE3_ENST00000560589.1_Missense_Mutation_p.N584K|TLE3_ENST00000557907.1_Missense_Mutation_p.N632K|TLE3_ENST00000558379.1_Missense_Mutation_p.N635K|TLE3_ENST00000442299.2_Missense_Mutation_p.N632K|TLE3_ENST00000558201.1_Missense_Mutation_p.N646K|TLE3_ENST00000559048.1_Missense_Mutation_p.N640K|TLE3_ENST00000539550.1_Missense_Mutation_p.N567K|TLE3_ENST00000440567.3_Missense_Mutation_p.N630K|TLE3_ENST00000451782.2_Missense_Mutation_p.N637K|TLE3_ENST00000557997.1_Missense_Mutation_p.N632K|TLE3_ENST00000317509.8_Missense_Mutation_p.N628K|TLE3_ENST00000559929.1_Missense_Mutation_p.N650K|TLE3_ENST00000559191.1_Missense_Mutation_p.N221K|TLE3_ENST00000560939.1_Missense_Mutation_p.N642K	NM_001282979.1|NM_001282980.1|NM_001282981.1	NP_001269908.1|NP_001269909.1|NP_001269910.1	Q04726	TLE3_HUMAN	transducin-like enhancer of split 3	640					Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(16)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGCGCACCGTGTTGTCCAGGC	0.612																																						dbGAP											0													63.0	68.0	66.0					15																	70345629		2151	4270	6421	-	-	-	SO:0001583	missense	0			M99438	CCDS45293.1, CCDS45294.1, CCDS58375.1, CCDS61689.1, CCDS61691.1, CCDS61692.1, CCDS73747.1	15q22	2014-03-07	2014-03-07			ENSG00000140332		"""WD repeat domain containing"""	11839	protein-coding gene	gene with protein product		600190	"""transducin-like enhancer of split 3, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 3 (E(sp1) homolog, Drosophila)"""			8365415	Standard	XM_005254623		Approved	ESG, ESG3, KIAA1547, HsT18976, GRG3	uc002asm.2	Q04726		ENST00000558939.1:c.1920C>A	15.37:g.70345629G>T	ENSP00000452871:p.Asn640Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPT0|E9PD64|F8W964|Q6PI57|Q8IVV6|Q8WVR2|Q9HCM5	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.N640K	ENST00000558939.1	37	c.1920	CCDS45293.1	15	.	.	.	.	.	.	.	.	.	.	G	24.3	4.517689	0.85495	.	.	ENSG00000140332	ENST00000442299;ENST00000451782;ENST00000317509;ENST00000440567;ENST00000539550	T;T;T;T	0.59638	0.25;0.25;0.25;0.25	5.03	4.09	0.47781	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58278	0.2111	N	0.11927	0.2	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	1.0;0.998;0.999;1.0;1.0;1.0;1.0;1.0	D;D;P;D;D;D;D;D	0.97110	1.0;0.949;0.887;0.998;1.0;0.996;0.99;0.99	T	0.63283	-0.6672	10	0.54805	T	0.06	0.4182	13.553	0.61743	0.0776:0.0:0.9224:0.0	.	630;637;632;635;628;640;640;567	F8W964;E9PD64;Q04726-3;Q6PI57;Q04726-2;Q04726;Q04726-4;F5H7D6	.;.;.;.;.;TLE3_HUMAN;.;.	K	632;637;640;630;567	ENSP00000390007:N632K;ENSP00000394717:N637K;ENSP00000415057:N630K;ENSP00000442594:N567K	ENSP00000319233:N640K	N	-	3	2	TLE3	68132683	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	4.642000	0.61383	2.615000	0.88500	0.561000	0.74099	AAC	TLE3	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000140332		0.612	TLE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TLE3	HGNC	protein_coding	OTTHUMT00000416913.1	130	0.00	0	G	NM_005078		70345629	70345629	-1	no_errors	ENST00000558939	ensembl	human	known	69_37n	missense	145	14.20	24	SNP	1.000	T
TMEM63A	9725	genome.wustl.edu	37	1	226034840	226034840	+	Silent	SNP	C	C	T	rs193031527		TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr1:226034840C>T	ENST00000366835.3	-	24	2595	c.2325G>A	c.(2323-2325)caG>caA	p.Q775Q	RP11-285F7.2_ENST00000424332.1_RNA	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A	775					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)	p.Q775delQ(1)		breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					CACCATAGGTCTGCTGCTGCT	0.622																																						dbGAP											1	Deletion - In frame(1)	breast(1)											84.0	77.0	80.0					1																	226034840		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.2325G>A	1.37:g.226034840C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GI7|Q5TE96|Q8N2U2	Silent	SNP	pfam_DUF221	p.Q775	ENST00000366835.3	37	c.2325	CCDS31042.1	1																																																																																			TMEM63A	-	NULL	ENSG00000196187		0.622	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	HGNC	protein_coding	OTTHUMT00000091154.2	23	0.00	0	C	NM_014698		226034840	226034840	-1	no_errors	ENST00000366835	ensembl	human	known	69_37n	silent	18	28.00	7	SNP	1.000	T
TP53TG5	27296	genome.wustl.edu	37	20	44003687	44003687	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr20:44003687G>C	ENST00000372726.3	-	4	916	c.760C>G	c.(760-762)Cca>Gca	p.P254A	SYS1-DBNDD2_ENST00000475242.1_Intron|TP53TG5_ENST00000494455.1_5'Flank|TP53TG5_ENST00000537995.1_Missense_Mutation_p.P238A|SYS1_ENST00000426004.1_3'UTR|SYS1-DBNDD2_ENST00000452133.1_Intron	NM_014477.2	NP_055292.1	Q9Y2B4	T53G5_HUMAN	TP53 target 5	254					intracellular signal transduction (GO:0035556)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|upper_aerodigestive_tract(1)	12						ACCTTGTATGGATGCCACATA	0.617																																						dbGAP											0													70.0	66.0	68.0					20																	44003687		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB017802	CCDS13352.1	20q13.12	2008-09-18	2008-09-18	2008-09-18	ENSG00000124251	ENSG00000124251			15856	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 10"""	C20orf10			Standard	NM_014477		Approved	CLG01, dJ453C12.5	uc002xny.3	Q9Y2B4	OTTHUMG00000032582	ENST00000372726.3:c.760C>G	20.37:g.44003687G>C	ENSP00000361811:p.Pro254Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P254A	ENST00000372726.3	37	c.760	CCDS13352.1	20	.	.	.	.	.	.	.	.	.	.	G	11.66	1.703412	0.30232	.	.	ENSG00000124251	ENST00000372726;ENST00000537995	T;T	0.10477	2.87;2.87	5.46	0.219	0.15274	.	0.780298	0.11627	N	0.545147	T	0.10380	0.0254	L	0.42245	1.32	0.09310	N	1	P	0.48294	0.908	P	0.45753	0.492	T	0.22277	-1.0221	10	0.38643	T	0.18	0.3387	4.7522	0.13066	0.293:0.0:0.5658:0.1411	.	254	Q9Y2B4	T53G5_HUMAN	A	254;238	ENSP00000361811:P254A;ENSP00000438374:P238A	ENSP00000361811:P254A	P	-	1	0	TP53TG5	43437101	0.005000	0.15991	0.001000	0.08648	0.208000	0.24298	0.412000	0.21131	-0.062000	0.13088	-0.140000	0.14226	CCA	TP53TG5	-	NULL	ENSG00000124251		0.617	TP53TG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53TG5	HGNC	protein_coding	OTTHUMT00000079460.1	45	0.00	0	G	NM_014477		44003687	44003687	-1	no_errors	ENST00000372726	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	0.000	C
VASH1	22846	genome.wustl.edu	37	14	77237561	77237561	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr14:77237561G>C	ENST00000167106.4	+	3	1060	c.427G>C	c.(427-429)Gaa>Caa	p.E143Q	VASH1_ENST00000554237.1_Missense_Mutation_p.E143Q|VASH1_ENST00000556038.1_3'UTR	NM_014909.4	NP_055724.1	Q7L8A9	VASH1_HUMAN	vasohibin 1	143					angiogenesis (GO:0001525)|cell cycle arrest (GO:0007050)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of lymphangiogenesis (GO:1901491)|regulation of cellular senescence (GO:2000772)|response to wounding (GO:0009611)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)				breast(2)|endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|stomach(1)|urinary_tract(3)	10			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0283)		ACAGTTCTTTGAAATTAAGAA	0.532																																						dbGAP											0													110.0	99.0	103.0					14																	77237561		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028959	CCDS9851.1	14q24.3	2006-09-25	2005-08-16	2005-08-16		ENSG00000071246			19964	protein-coding gene	gene with protein product		609011	"""KIAA1036"""	KIAA1036			Standard	NM_014909		Approved		uc001xst.2	Q7L8A9		ENST00000167106.4:c.427G>C	14.37:g.77237561G>C	ENSP00000167106:p.Glu143Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H02|Q9UBF4|Q9Y629	Missense_Mutation	SNP	NULL	p.E143Q	ENST00000167106.4	37	c.427	CCDS9851.1	14	.	.	.	.	.	.	.	.	.	.	G	25.9	4.680583	0.88542	.	.	ENSG00000071246	ENST00000167106;ENST00000554237	.	.	.	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.75561	0.3866	L	0.56199	1.76	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.85130	0.991;0.997	T	0.76195	-0.3048	9	0.45353	T	0.12	-8.0762	17.6692	0.88212	0.0:0.0:1.0:0.0	.	143;143	Q7L8A9;Q7L8A9-2	VASH1_HUMAN;.	Q	143	.	ENSP00000167106:E143Q	E	+	1	0	VASH1	76307314	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.172000	0.68678	0.561000	0.74099	GAA	VASH1	-	NULL	ENSG00000071246		0.532	VASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VASH1	HGNC	protein_coding	OTTHUMT00000413706.1	28	0.00	0	G	NM_014909		77237561	77237561	+1	no_errors	ENST00000167106	ensembl	human	known	69_37n	missense	81	10.99	10	SNP	1.000	C
ZMIZ1	57178	genome.wustl.edu	37	10	81063837	81063837	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1J2-01A-21D-A13L-09	TCGA-EW-A1J2-10A-01W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c906931e-dc1a-434c-96cd-58088762f1e7	97b9c0f4-a0c8-4237-ba88-cf1dc993b3ae	g.chr10:81063837G>T	ENST00000334512.5	+	19	2763	c.2191G>T	c.(2191-2193)Gtg>Ttg	p.V731L	ZMIZ1_ENST00000446377.2_5'Flank	NM_020338.3	NP_065071.1	Q9ULJ6	ZMIZ1_HUMAN	zinc finger, MIZ-type containing 1	731					artery morphogenesis (GO:0048844)|cell aging (GO:0007569)|developmental growth (GO:0048589)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)|vitellogenesis (GO:0007296)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(2)|prostate(3)|skin(1)	30	all_cancers(46;0.0292)|Breast(12;8.52e-05)|all_epithelial(25;0.000854)|Prostate(51;0.00985)		Epithelial(14;0.00256)|all cancers(16;0.00726)|Colorectal(32;0.229)			GGAGGATGGGGTGGAGCAGAC	0.622																																						dbGAP											0													82.0	61.0	68.0					10																	81063837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033050	CCDS7357.1	10q22.3	2012-11-30	2006-10-24	2006-10-24	ENSG00000108175	ENSG00000108175		"""Zinc fingers, MIZ-type"""	16493	protein-coding gene	gene with protein product		607159	"""retinoic acid induced 17"""	RAI17		15626329	Standard	NM_020338		Approved	RP11-519K18.1, KIAA1224, FLJ13541, hZIMP10, Zimp10, MIZ	uc001kaf.2	Q9ULJ6	OTTHUMG00000018560	ENST00000334512.5:c.2191G>T	10.37:g.81063837G>T	ENSP00000334474:p.Val731Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSH9|Q7Z7E6	Missense_Mutation	SNP	pfam_Znf_MIZ,pfscan_Znf_MIZ	p.V731L	ENST00000334512.5	37	c.2191	CCDS7357.1	10	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428484	0.83667	.	.	ENSG00000108175	ENST00000334512;ENST00000360331;ENST00000372347	T	0.37915	1.17	5.4	5.4	0.78164	Zinc finger, MIZ-type (1);	0.000000	0.37393	N	0.002105	T	0.43055	0.1230	M	0.66939	2.045	0.80722	D	1	B	0.24618	0.107	B	0.25987	0.065	T	0.35748	-0.9776	10	0.52906	T	0.07	-17.0744	19.1798	0.93619	0.0:0.0:1.0:0.0	.	731	Q9ULJ6	ZMIZ1_HUMAN	L	731;661;635	ENSP00000334474:V731L	ENSP00000334474:V731L	V	+	1	0	ZMIZ1	80733843	1.000000	0.71417	0.992000	0.48379	0.991000	0.79684	9.441000	0.97557	2.537000	0.85549	0.561000	0.74099	GTG	ZMIZ1	-	pfscan_Znf_MIZ	ENSG00000108175		0.622	ZMIZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMIZ1	HGNC	protein_coding	OTTHUMT00000048944.2	44	0.00	0	G	NM_020338		81063837	81063837	+1	no_errors	ENST00000334512	ensembl	human	known	69_37n	missense	48	14.29	8	SNP	1.000	T
