#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCE1	6059	genome.wustl.edu	37	4	146038513	146038513	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr4:146038513A>G	ENST00000296577.4	+	10	1384	c.869A>G	c.(868-870)tAt>tGt	p.Y290C	OTUD4_ENST00000455611.2_Intron|ABCE1_ENST00000502803.1_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	290	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					TGCTGTTTATATGGTGTACCA	0.353																																						dbGAP											0													131.0	118.0	123.0					4																	146038513		2203	4296	6499	-	-	-	SO:0001583	missense	0			X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.869A>G	4.37:g.146038513A>G	ENSP00000296577:p.Tyr290Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Missense_Mutation	SNP	pfam_ABC_transporter-like,pfam_RNaseL-inhib_metal-bd_dom,pfam_4Fe4S-bd_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,prints_ABC_E	p.Y290C	ENST00000296577.4	37	c.869	CCDS34071.1	4	.	.	.	.	.	.	.	.	.	.	A	25.4	4.636753	0.87760	.	.	ENSG00000164163	ENST00000296577	D	0.93659	-3.26	5.54	5.54	0.83059	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.85682	D	0.000000	D	0.95456	0.8524	L	0.50993	1.605	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.95973	0.8971	10	0.87932	D	0	-57.6994	15.9616	0.79933	1.0:0.0:0.0:0.0	.	290	P61221	ABCE1_HUMAN	C	290	ENSP00000296577:Y290C	ENSP00000296577:Y290C	Y	+	2	0	ABCE1	146257963	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.287000	0.95975	2.231000	0.72958	0.397000	0.26171	TAT	ABCE1	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000164163		0.353	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCE1	HGNC	protein_coding	OTTHUMT00000365104.1	130	0.00	0	A	NM_002940		146038513	146038513	+1	no_errors	ENST00000296577	ensembl	human	known	69_37n	missense	140	35.78	78	SNP	1.000	G
BIVM	54841	genome.wustl.edu	37	13	103490993	103490993	+	Splice_Site	SNP	A	A	G			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr13:103490993A>G	ENST00000257336.1	+	10	1801	c.1122A>G	c.(1120-1122)aaA>aaG	p.K374K	BIVM_ENST00000419638.1_3'UTR|BIVM-ERCC5_ENST00000602836.1_Splice_Site_p.M346V|BIVM_ENST00000448849.2_Splice_Site_p.K145K	NM_017693.3	NP_060163.2	Q86UB2	BIVM_HUMAN	basic, immunoglobulin-like variable motif containing	374						cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|skin(2)|urinary_tract(1)	25	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TTAACTATAGATGGGCAGATA	0.358																																						dbGAP											0													83.0	84.0	83.0					13																	103490993		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF411385	CCDS9505.1, CCDS53879.1	13q33.1	2008-05-14			ENSG00000134897	ENSG00000134897			16034	protein-coding gene	gene with protein product						12036287	Standard	NM_017693		Approved	FLJ20159		Q86UB2	OTTHUMG00000017309	ENST00000257336.1:c.1122-1A>G	13.37:g.103490993A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1J2|Q9NXM4	Silent	SNP	NULL	p.K374	ENST00000257336.1	37	c.1122	CCDS9505.1	13																																																																																			BIVM	-	NULL	ENSG00000134897		0.358	BIVM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BIVM	HGNC	protein_coding	OTTHUMT00000045704.2	63	0.00	0	A		Silent	103490993	103490993	+1	no_errors	ENST00000257336	ensembl	human	known	69_37n	silent	59	39.80	39	SNP	0.998	G
CCDC6	8030	genome.wustl.edu	37	10	61552827	61552827	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr10:61552827G>A	ENST00000263102.6	-	9	1504	c.1273C>T	c.(1273-1275)Cgg>Tgg	p.R425W		NM_005436.4	NP_005427.2	Q16204	CCDC6_HUMAN	coiled-coil domain containing 6	425						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	structural constituent of cytoskeleton (GO:0005200)		CCDC6/RET(4)	breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(3)|stomach(1)	18				Kidney(211;0.0597)		GGCGTGGGCCGTTTGAATTTG	0.607			T	RET	NSCLC																																	dbGAP		Dom	yes		10	10q21	8030	coiled-coil domain containing 6		E	0													160.0	151.0	154.0					10																	61552827		2203	4300	6503	-	-	-	SO:0001583	missense	0			S72869	CCDS7257.1	10q21.2	2006-11-09	2004-01-20		ENSG00000108091	ENSG00000108091			18782	protein-coding gene	gene with protein product	"""DNA segment, single copy, probe pH4 (transforming sequence, thyroid-1"""	601985	"""DNA segment on chromosome 10 (unique) 170"""	TST1, D10S170		8058316, 6745938	Standard	NM_005436		Approved	PTC, TPC, H4	uc001jks.4	Q16204	OTTHUMG00000018284	ENST00000263102.6:c.1273C>T	10.37:g.61552827G>A	ENSP00000263102:p.Arg425Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15250|Q6GSG7	Missense_Mutation	SNP	pfam_DUF2046	p.R425W	ENST00000263102.6	37	c.1273	CCDS7257.1	10	.	.	.	.	.	.	.	.	.	.	G	23.8	4.458462	0.84317	.	.	ENSG00000108091	ENST00000263102	T	0.52526	0.66	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.65749	0.2721	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.66260	-0.5968	10	0.87932	D	0	-19.1962	19.9854	0.97342	0.0:0.0:1.0:0.0	.	425	Q16204	CCDC6_HUMAN	W	425	ENSP00000263102:R425W	ENSP00000263102:R425W	R	-	1	2	CCDC6	61222833	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.527000	0.81931	2.786000	0.95864	0.563000	0.77884	CGG	CCDC6	-	NULL	ENSG00000108091		0.607	CCDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC6	HGNC	protein_coding	OTTHUMT00000048176.2	198	0.00	0	G	NM_005436		61552827	61552827	-1	no_errors	ENST00000263102	ensembl	human	known	69_37n	missense	186	35.74	104	SNP	1.000	A
CROCCP2	84809	genome.wustl.edu	37	1	16950687	16950687	+	lincRNA	SNP	G	G	T	rs1762940		TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr1:16950687G>T	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											GCCCCTGGGGGCCCGTGCCTG	0.667																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950687G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.667	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	8	0.00	0	G	NR_026752.1		16950687	16950687	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	10	28.57	4	SNP	0.003	T
EFCAB5	374786	genome.wustl.edu	37	17	28378166	28378166	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr17:28378166G>C	ENST00000394835.3	+	9	1423	c.1231G>C	c.(1231-1233)Gcc>Ccc	p.A411P	EFCAB5_ENST00000320856.5_Missense_Mutation_p.A411P|EFCAB5_ENST00000541045.1_Missense_Mutation_p.A68P|EFCAB5_ENST00000378738.3_Missense_Mutation_p.A411P|EFCAB5_ENST00000536908.2_Missense_Mutation_p.A355P|EFCAB5_ENST00000394832.2_Missense_Mutation_p.A411P	NM_198529.3	NP_940931	A4FU69	EFCB5_HUMAN	EF-hand calcium binding domain 5	411							calcium ion binding (GO:0005509)			breast(7)|endometrium(2)|kidney(4)|large_intestine(11)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	43						GAGGACATTGGCCCTGCTGGA	0.423																																						dbGAP											0													110.0	98.0	102.0					17																	28378166		1890	4110	6000	-	-	-	SO:0001583	missense	0			AL833911	CCDS11254.2, CCDS54103.1	17q11.2	2013-01-10			ENSG00000176927	ENSG00000176927		"""EF-hand domain containing"""	24801	protein-coding gene	gene with protein product							Standard	NM_198529		Approved	FLJ46247	uc002het.3	A4FU69	OTTHUMG00000132753	ENST00000394835.3:c.1231G>C	17.37:g.28378166G>C	ENSP00000378312:p.Ala411Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPN0|B4DS75|B4DZR5|F5GYL2|Q0VD68|Q6ZRM6|Q8NDG9	Missense_Mutation	SNP	pfscan_EF_HAND_2	p.A411P	ENST00000394835.3	37	c.1231	CCDS11254.2	17	.	.	.	.	.	.	.	.	.	.	G	17.10	3.302746	0.60195	.	.	ENSG00000176927	ENST00000536908;ENST00000534836;ENST00000541045;ENST00000394835;ENST00000320856;ENST00000394832;ENST00000378738;ENST00000423598;ENST00000419434	T;T;T;T;T;T;T	0.53206	0.63;0.63;0.63;0.63;0.63;0.63;0.63	5.48	1.66	0.24008	.	0.125473	0.35320	N	0.003297	T	0.59197	0.2176	M	0.72894	2.215	0.31672	N	0.644198	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;0.989;0.999	D;D;D;D;P;D	0.74674	0.963;0.984;0.974;0.974;0.885;0.974	T	0.61033	-0.7144	10	0.48119	T	0.1	-5.8554	5.627	0.17488	0.1945:0.0:0.647:0.1584	.	355;355;411;411;411;411	B4DS75;F5GYL2;A8MSY9;B5MEA3;E7EVS9;A4FU69	.;.;.;.;.;EFCB5_HUMAN	P	355;154;68;411;411;411;411;355;217	ENSP00000440619:A355P;ENSP00000445575:A68P;ENSP00000378312:A411P;ENSP00000322003:A411P;ENSP00000378309:A411P;ENSP00000368012:A411P;ENSP00000417009:A217P	ENSP00000322003:A411P	A	+	1	0	EFCAB5	25402292	1.000000	0.71417	0.996000	0.52242	0.845000	0.48019	0.598000	0.24074	1.137000	0.42214	0.655000	0.94253	GCC	EFCAB5	-	NULL	ENSG00000176927		0.423	EFCAB5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB5	HGNC	protein_coding	OTTHUMT00000256120.4	62	0.00	0	G	NM_198529		28378166	28378166	+1	no_errors	ENST00000394835	ensembl	human	known	69_37n	missense	66	60.82	104	SNP	0.989	C
FLT4	2324	genome.wustl.edu	37	5	180056385	180056385	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr5:180056385T>C	ENST00000261937.6	-	7	937	c.859A>G	c.(859-861)Acc>Gcc	p.T287A	FLT4_ENST00000502649.1_Missense_Mutation_p.T287A|FLT4_ENST00000424276.2_5'UTR|FLT4_ENST00000393347.3_Missense_Mutation_p.T287A	NM_182925.4	NP_891555.2	P35916	VGFR3_HUMAN	fms-related tyrosine kinase 4	287	Ig-like C2-type 3.				blood vessel morphogenesis (GO:0048514)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|lymph vessel development (GO:0001945)|lymphangiogenesis (GO:0001946)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of JNK cascade (GO:0046330)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation vascular endothelial growth factor production (GO:0010575)|protein autophosphorylation (GO:0046777)|regulation of blood vessel remodeling (GO:0060312)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor signaling pathway (GO:0038084)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(1)|kidney(6)|large_intestine(5)|liver(2)|lung(37)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_cancers(89;2.21e-05)|all_epithelial(37;5.29e-06)|Renal(175;0.000159)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.114)	all_cancers(40;0.00245)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	all cancers(165;0.134)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TCTGTGTGGGTCTGCTGGGAG	0.652																																					Colon(97;1075 1466 27033 27547 35871)	dbGAP											0													160.0	137.0	145.0					5																	180056385		2201	4299	6500	-	-	-	SO:0001583	missense	0			X68203	CCDS4457.1, CCDS43412.1	5q34-q35	2013-01-29			ENSG00000037280	ENSG00000037280	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3767	protein-coding gene	gene with protein product		136352				1319394	Standard	NM_002020		Approved	VEGFR3, PCL	uc003mlz.4	P35916	OTTHUMG00000130931	ENST00000261937.6:c.859A>G	5.37:g.180056385T>C	ENSP00000261937:p.Thr287Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L4|B5A926|Q16067|Q86W07|Q86W08	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR3_rcpt_N,prints_Tyr_kinase_VEGFR_rcpt_N	p.T287A	ENST00000261937.6	37	c.859	CCDS4457.1	5	.	.	.	.	.	.	.	.	.	.	T	17.20	3.329479	0.60743	.	.	ENSG00000037280	ENST00000261937;ENST00000393347;ENST00000502649;ENST00000376868	T;T;T	0.68025	-0.3;-0.3;-0.3	4.91	4.91	0.64330	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Tyrosine-protein kinase, vascular endothelial growth factor receptor 3 (VEGFR3), N-terminal (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.67031	0.2850	L	0.48877	1.53	0.41015	D	0.985031	D;B;B	0.56746	0.977;0.071;0.153	P;B;B	0.53224	0.721;0.115;0.179	T	0.63242	-0.6681	9	0.14656	T	0.56	.	13.4212	0.60998	0.0:0.0:0.0:1.0	.	287;287;287	P35916-3;E9PD35;P35916	.;.;VGFR3_HUMAN	A	287;287;287;97	ENSP00000261937:T287A;ENSP00000377016:T287A;ENSP00000426057:T287A	ENSP00000261937:T287A	T	-	1	0	FLT4	179988991	1.000000	0.71417	0.995000	0.50966	0.925000	0.55904	2.735000	0.47377	1.976000	0.57569	0.459000	0.35465	ACC	FLT4	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like,prints_Tyr_kinase_VEGFR3_rcpt_N	ENSG00000037280		0.652	FLT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT4	HGNC	protein_coding	OTTHUMT00000253527.4	60	0.00	0	T			180056385	180056385	-1	no_errors	ENST00000261937	ensembl	human	known	69_37n	missense	96	21.43	27	SNP	1.000	C
MARCO	8685	genome.wustl.edu	37	2	119750834	119750834	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr2:119750834C>A	ENST00000327097.4	+	16	1522	c.1387C>A	c.(1387-1389)Ctg>Atg	p.L463M	MARCO_ENST00000541757.1_Missense_Mutation_p.L385M	NM_006770.3	NP_006761.1	Q9UEW3	MARCO_HUMAN	macrophage receptor with collagenous structure	463	SRCR. {ECO:0000255|PROSITE- ProRule:PRU00196}.				apoptotic cell clearance (GO:0043277)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)	collagen trimer (GO:0005581)|endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)	p.L463L(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(12)|lung(37)|ovary(4)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	70						CTGCCGCATGCTGGGTTACTC	0.542																																					GBM(8;18 374 7467 11269 32796)	dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											145.0	142.0	143.0					2																	119750834		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035819	CCDS2124.1	2q14.2	2011-10-11			ENSG00000019169	ENSG00000019169			6895	protein-coding gene	gene with protein product	"""scavenger receptor class A, member 2"""	604870				9468508, 7867067, 10331948	Standard	NM_006770		Approved	SCARA2	uc002tln.1	Q9UEW3	OTTHUMG00000131400	ENST00000327097.4:c.1387C>A	2.37:g.119750834C>A	ENSP00000318916:p.Leu463Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DW79|Q9Y5S3	Missense_Mutation	SNP	pfam_Collagen,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.L463M	ENST00000327097.4	37	c.1387	CCDS2124.1	2	.	.	.	.	.	.	.	.	.	.	C	13.93	2.385182	0.42308	.	.	ENSG00000019169	ENST00000327097;ENST00000541757	T;T	0.56941	0.43;0.43	6.07	4.23	0.50019	Speract/scavenger receptor (4);Speract/scavenger receptor-related (2);	0.113265	0.38326	N	0.001734	T	0.70605	0.3243	M	0.83012	2.62	0.41054	D	0.985327	D	0.89917	1.0	D	0.81914	0.995	T	0.73395	-0.3996	9	.	.	.	.	8.9196	0.35604	0.0:0.7734:0.1472:0.0795	.	463	Q9UEW3	MARCO_HUMAN	M	463;385	ENSP00000318916:L463M;ENSP00000441769:L385M	.	L	+	1	2	MARCO	119467304	0.980000	0.34600	1.000000	0.80357	0.789000	0.44602	-0.012000	0.12699	1.584000	0.49913	-0.137000	0.14449	CTG	MARCO	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	ENSG00000019169		0.542	MARCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCO	HGNC	protein_coding	OTTHUMT00000254190.2	68	0.00	0	C	NM_006770		119750834	119750834	+1	no_errors	ENST00000327097	ensembl	human	known	69_37n	missense	74	40.32	50	SNP	1.000	A
MAVS	57506	genome.wustl.edu	37	20	3835301	3835301	+	Silent	SNP	G	G	A			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr20:3835301G>A	ENST00000428216.2	+	2	158	c.30G>A	c.(28-30)aaG>aaA	p.K10K	MAVS_ENST00000358134.6_Silent_p.K10K|MAVS_ENST00000416600.2_5'UTR	NM_020746.4	NP_065797.2	Q7Z434	MAVS_HUMAN	mitochondrial antiviral signaling protein	10	CARD.|Required for interaction with NLRX1.				activation of innate immune response (GO:0002218)|cellular response to exogenous dsRNA (GO:0071360)|defense response to bacterium (GO:0042742)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral genome replication (GO:0045071)|positive regulation of chemokine (C-C motif) ligand 5 production (GO:0071651)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of IP-10 production (GO:0071660)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of peroxisome organization (GO:1900063)|RIG-I signaling pathway (GO:0039529)|signal transduction (GO:0007165)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	CARD domain binding (GO:0050700)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			autonomic_ganglia(1)|breast(3)|endometrium(1)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						AGACCTATAAGTATATCTGCC	0.502																																						dbGAP											0													159.0	139.0	146.0					20																	3835301		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			DQ174270	CCDS33437.1, CCDS56176.1	20p13	2009-04-02			ENSG00000088888	ENSG00000088888			29233	protein-coding gene	gene with protein product	"""virus-induced signaling adaptor"", ""IFN-B promoter stimulator 1"", ""CARD adaptor inducing IFN-beta"""	609676				16125763, 16153868	Standard	NM_020746		Approved	VISA, KIAA1271, IPS-1, Cardif	uc002wjw.4	Q7Z434	OTTHUMG00000031765	ENST00000428216.2:c.30G>A	20.37:g.3835301G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6X0|B2BD33|B2BD34|F5H6C8|Q2HWT5|Q3I0Y2|Q5T7I6|Q86VY7|Q9H1H3|Q9H4Y1|Q9H8D3|Q9ULE9	Silent	SNP	NULL	p.K10	ENST00000428216.2	37	c.30	CCDS33437.1	20																																																																																			MAVS	-	NULL	ENSG00000088888		0.502	MAVS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAVS	HGNC	protein_coding	OTTHUMT00000077784.3	104	0.95	1	G	NM_020746		3835301	3835301	+1	no_errors	ENST00000428216	ensembl	human	known	69_37n	silent	116	28.22	46	SNP	0.286	A
MED24	9862	genome.wustl.edu	37	17	38189359	38189359	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr17:38189359C>T	ENST00000394128.2	-	8	853	c.772G>A	c.(772-774)Ggc>Agc	p.G258S	MED24_ENST00000501516.3_Missense_Mutation_p.G277S|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000356271.3_Missense_Mutation_p.G245S|MED24_ENST00000394126.1_Missense_Mutation_p.G283S|MED24_ENST00000394127.2_Missense_Mutation_p.G245S	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	258					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TGCGTCTCGCCTGTCAGGTTC	0.637																																						dbGAP											0													61.0	51.0	55.0					17																	38189359		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.772G>A	17.37:g.38189359C>T	ENSP00000377686:p.Gly258Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	pfam_Mediator_Med24_N	p.G258S	ENST00000394128.2	37	c.772	CCDS11359.1	17	.	.	.	.	.	.	.	.	.	.	C	18.40	3.614698	0.66672	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000543759;ENST00000535508;ENST00000431269;ENST00000428757	T;T;T	0.44881	0.91;0.91;0.91	5.68	5.68	0.88126	Mediator complex, subunit Med24, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.48840	0.1522	N	0.21448	0.665	0.80722	D	1	D;B;D;B;D;P;D;D	0.89917	1.0;0.449;1.0;0.394;0.999;0.95;0.959;0.999	D;B;D;B;D;P;P;D	0.97110	0.976;0.333;1.0;0.224;0.959;0.752;0.839;0.959	T	0.22661	-1.0210	10	0.06099	T	0.92	-24.9058	19.807	0.96535	0.0:1.0:0.0:0.0	.	245;208;187;208;168;245;258;200	B9TX65;B4DV99;B4DDR8;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;.;.;MED24_HUMAN;.	S	258;258;258;208;245;200;232;232;168;277	ENSP00000377686:G258S;ENSP00000443344:G208S;ENSP00000377685:G245S	ENSP00000348610:G258S	G	-	1	0	MED24	35442885	1.000000	0.71417	0.923000	0.36655	0.657000	0.38888	6.070000	0.71220	2.690000	0.91761	0.655000	0.94253	GGC	MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.637	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	30	0.00	0	C	NM_014815		38189359	38189359	-1	no_errors	ENST00000394128	ensembl	human	known	69_37n	missense	289	15.00	51	SNP	1.000	T
MED24	9862	genome.wustl.edu	37	17	38189431	38189431	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr17:38189431C>G	ENST00000394128.2	-	8	781	c.700G>C	c.(700-702)Gag>Cag	p.E234Q	MED24_ENST00000501516.3_Missense_Mutation_p.E253Q|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000356271.3_Missense_Mutation_p.E221Q|MED24_ENST00000394126.1_Missense_Mutation_p.E259Q|MED24_ENST00000394127.2_Missense_Mutation_p.E221Q	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	234					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					TGCATCTGCTCCGCATGCACA	0.632																																						dbGAP											0													61.0	54.0	57.0					17																	38189431		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.700G>C	17.37:g.38189431C>G	ENSP00000377686:p.Glu234Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	pfam_Mediator_Med24_N	p.E234Q	ENST00000394128.2	37	c.700	CCDS11359.1	17	.	.	.	.	.	.	.	.	.	.	C	13.65	2.299064	0.40694	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000543759;ENST00000535508;ENST00000431269;ENST00000428757	T;T;T	0.45668	0.89;0.89;0.89	5.48	5.48	0.80851	Mediator complex, subunit Med24, N-terminal (1);	0.112759	0.64402	D	0.000007	T	0.53932	0.1827	L	0.38175	1.15	0.58432	D	0.99999	P;D;P;D;P;D;P;P;D	0.62365	0.927;0.991;0.784;0.989;0.744;0.961;0.906;0.924;0.961	P;P;P;P;B;P;P;P;P	0.62089	0.816;0.898;0.575;0.893;0.439;0.756;0.602;0.723;0.691	T	0.48525	-0.9028	10	0.39692	T	0.17	-27.8981	19.3713	0.94488	0.0:1.0:0.0:0.0	.	208;221;184;163;184;144;221;234;176	B9TX63;B9TX65;B4DV99;B4DDR8;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;.;.;.;MED24_HUMAN;.	Q	234;234;234;184;221;176;208;208;144;253	ENSP00000377686:E234Q;ENSP00000443344:E184Q;ENSP00000377685:E221Q	ENSP00000348610:E234Q	E	-	1	0	MED24	35442957	1.000000	0.71417	0.955000	0.39395	0.241000	0.25554	4.721000	0.61951	2.575000	0.86900	0.655000	0.94253	GAG	MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.632	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	27	0.00	0	C	NM_014815		38189431	38189431	-1	no_errors	ENST00000394128	ensembl	human	known	69_37n	missense	364	12.92	54	SNP	1.000	G
MED24	9862	genome.wustl.edu	37	17	38189690	38189690	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr17:38189690C>G	ENST00000394128.2	-	7	660	c.579G>C	c.(577-579)gaG>gaC	p.E193D	MED24_ENST00000501516.3_Missense_Mutation_p.E212D|MED24_ENST00000479829.1_5'Flank|MED24_ENST00000356271.3_Missense_Mutation_p.E180D|MED24_ENST00000394126.1_Missense_Mutation_p.E218D|MED24_ENST00000394127.2_Missense_Mutation_p.E180D	NM_014815.3	NP_055630.2	O75448	MED24_HUMAN	mediator complex subunit 24	193					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			autonomic_ganglia(1)|breast(2)|endometrium(9)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	41	Colorectal(19;0.000442)					AGAGAGAATGCTCGATGGCAG	0.557																																						dbGAP											0													35.0	30.0	32.0					17																	38189690		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055995	CCDS11359.1, CCDS42315.1	17q21.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000008838	ENSG00000008838			22963	protein-coding gene	gene with protein product		607000	"""thyroid hormone receptor associated protein 4"", ""cofactor required for Sp1 transcriptional activation, subunit 4, 100kDa"""	THRAP4, CRSP4			Standard	NM_001079518		Approved	TRAP100, KIAA0130, DRIP100, CRSP100	uc002htt.3	O75448	OTTHUMG00000133329	ENST00000394128.2:c.579G>C	17.37:g.38189690C>G	ENSP00000377686:p.Glu193Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S5|B3KMR9|Q14143|Q9NNY5	Missense_Mutation	SNP	pfam_Mediator_Med24_N	p.E193D	ENST00000394128.2	37	c.579	CCDS11359.1	17	.	.	.	.	.	.	.	.	.	.	C	10.21	1.287334	0.23478	.	.	ENSG00000008838	ENST00000394126;ENST00000356271;ENST00000394128;ENST00000535071;ENST00000394127;ENST00000536318;ENST00000543759;ENST00000535508;ENST00000431269;ENST00000428757	T;T;T;T	0.50001	0.84;0.84;0.84;0.76	5.67	1.5	0.22942	Mediator complex, subunit Med24, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.60274	0.2256	M	0.62723	1.935	0.46609	D	0.999121	D;D;D;D;D;P;D;D;D	0.89917	1.0;0.994;0.997;1.0;0.99;0.663;0.99;0.992;0.99	D;D;D;D;P;B;P;P;D	0.91635	0.999;0.949;0.925;0.997;0.829;0.343;0.717;0.893;0.979	T	0.55679	-0.8103	10	0.48119	T	0.1	-27.6415	9.074	0.36511	0.0:0.5828:0.0:0.4172	.	167;180;143;122;143;103;180;193;135	B9TX63;B9TX65;B4DV99;B4DDR8;F5H5K2;F8W9R9;O75448-2;O75448;F5H0K1	.;.;.;.;.;.;.;MED24_HUMAN;.	D	193;193;193;143;180;135;167;167;103;212	ENSP00000377686:E193D;ENSP00000443344:E143D;ENSP00000377685:E180D;ENSP00000438630:E167D	ENSP00000348610:E193D	E	-	3	2	MED24	35443216	0.364000	0.24997	0.909000	0.35828	0.612000	0.37316	-0.547000	0.06055	0.079000	0.16929	-0.140000	0.14226	GAG	MED24	-	pfam_Mediator_Med24_N	ENSG00000008838		0.557	MED24-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MED24	HGNC	protein_coding	OTTHUMT00000257147.2	23	0.00	0	C	NM_014815		38189690	38189690	-1	no_errors	ENST00000394128	ensembl	human	known	69_37n	missense	291	14.41	49	SNP	0.980	G
MUC16	94025	genome.wustl.edu	37	19	9038120	9038120	+	Silent	SNP	T	T	A			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr19:9038120T>A	ENST00000397910.4	-	8	36359	c.36156A>T	c.(36154-36156)acA>acT	p.T12052T		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12054	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGGGGAGAATGTAGAAGTCA	0.463																																						dbGAP											0													59.0	59.0	59.0					19																	9038120		1915	4121	6036	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36156A>T	19.37:g.9038120T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T12052	ENST00000397910.4	37	c.36156	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	54	0.00	0	T	NM_024690		9038120	9038120	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	70	36.36	40	SNP	0.021	A
NES	10763	genome.wustl.edu	37	1	156639358	156639358	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr1:156639358T>C	ENST00000368223.3	-	4	4754	c.4622A>G	c.(4621-4623)aAc>aGc	p.N1541S		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1541	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CCCCTCCAAGTTGGGACCCTG	0.587																																						dbGAP											0													104.0	87.0	93.0					1																	156639358		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.4622A>G	1.37:g.156639358T>C	ENSP00000357206:p.Asn1541Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_F	p.N1541S	ENST00000368223.3	37	c.4622	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	T	0.008	-1.891814	0.00522	.	.	ENSG00000132688	ENST00000368223	D	0.84873	-1.91	4.03	-2.3	0.06785	.	.	.	.	.	T	0.34803	0.0910	N	0.04018	-0.295	0.09310	N	0.999998	B	0.02656	0.0	B	0.04013	0.001	T	0.30060	-0.9991	9	0.10111	T	0.7	.	1.8642	0.03195	0.1381:0.2222:0.1372:0.5024	.	1541	P48681	NEST_HUMAN	S	1541	ENSP00000357206:N1541S	ENSP00000357206:N1541S	N	-	2	0	NES	154905982	0.113000	0.22115	0.196000	0.23383	0.582000	0.36321	-0.110000	0.10824	-0.164000	0.10927	-0.736000	0.03550	AAC	NES	-	NULL	ENSG00000132688		0.587	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	35	0.00	0	T	NM_006617		156639358	156639358	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	0.263	C
NQO2	4835	genome.wustl.edu	37	6	3019762	3019762	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr6:3019762G>C	ENST00000338130.2	+	10	1281	c.569G>C	c.(568-570)aGc>aCc	p.S190T	RP1-90J20.12_ENST00000603222.1_lincRNA|NQO2_ENST00000380455.4_Missense_Mutation_p.S190T|NQO2_ENST00000380454.4_Missense_Mutation_p.S152T|NQO2_ENST00000380441.1_Missense_Mutation_p.S152T|NQO2_ENST00000380430.1_Missense_Mutation_p.S190T			P16083	NQO2_HUMAN	NAD(P)H dehydrogenase, quinone 2	190					memory (GO:0007613)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	dihydronicotinamide riboside quinone reductase activity (GO:0001512)|electron carrier activity (GO:0009055)|metal ion binding (GO:0046872)|NADPH dehydrogenase (quinone) activity (GO:0008753)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)|skin(1)	7	Ovarian(93;0.0412)	all_hematologic(90;0.0895)			Dabigatran etexilate(DB06695)|Flavin adenine dinucleotide(DB03147)|Melatonin(DB01065)|Menadione(DB00170)|Primaquine(DB01087)	CCTCAGATCAGCTTTGCTCCT	0.493																																						dbGAP											0													159.0	156.0	157.0					6																	3019762		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07736	CCDS4481.1, CCDS75388.1	6p25.2	2012-09-20	2001-11-30	2001-12-07	ENSG00000124588	ENSG00000124588	1.6.5.2		7856	protein-coding gene	gene with protein product		160998	"""NAD(P)H menadione oxidoreductase 2, dioxin-inducible"""	NMOR2		1691923	Standard	XM_005249152		Approved	QR2, DHQV, DIA6	uc003mus.2	P16083	OTTHUMG00000014130	ENST00000338130.2:c.569G>C	6.37:g.3019762G>C	ENSP00000337773:p.Ser190Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R492|Q5TD04	Missense_Mutation	SNP	pfam_Flavodoxin_fold,pfam_FMN_red	p.S190T	ENST00000338130.2	37	c.569	CCDS4481.1	6	.	.	.	.	.	.	.	.	.	.	G	3.793	-0.043279	0.07452	.	.	ENSG00000124588	ENST00000338130;ENST00000380441;ENST00000380455;ENST00000380454;ENST00000380430	T;T;T;T;T	0.09073	3.02;3.15;3.02;3.15;3.02	5.39	0.218	0.15270	Flavodoxin-like fold (1);	0.304013	0.40908	D	0.000988	T	0.01320	0.0043	N	0.21617	0.685	0.24853	N	0.992393	B	0.02656	0.0	B	0.06405	0.002	T	0.47923	-0.9079	10	0.21014	T	0.42	-10.8217	6.0361	0.19708	0.2803:0.1232:0.5965:0.0	.	190	P16083	NQO2_HUMAN	T	190;152;190;152;190	ENSP00000337773:S190T;ENSP00000369806:S152T;ENSP00000369822:S190T;ENSP00000369821:S152T;ENSP00000369795:S190T	ENSP00000337773:S190T	S	+	2	0	NQO2	2964761	0.203000	0.23435	0.998000	0.56505	0.266000	0.26442	-0.197000	0.09518	0.276000	0.22118	-1.078000	0.02229	AGC	NQO2	-	pfam_Flavodoxin_fold	ENSG00000124588		0.493	NQO2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NQO2	HGNC	protein_coding	OTTHUMT00000039651.1	116	0.00	0	G			3019762	3019762	+1	no_errors	ENST00000338130	ensembl	human	known	69_37n	missense	105	30.92	47	SNP	0.918	C
OTOF	9381	genome.wustl.edu	37	2	26697524	26697524	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr2:26697524C>T	ENST00000272371.2	-	26	3271	c.3145G>A	c.(3145-3147)Ggc>Agc	p.G1049S	OTOF_ENST00000403946.3_Missense_Mutation_p.G1049S|OTOF_ENST00000338581.6_Missense_Mutation_p.G302S|OTOF_ENST00000402415.3_Missense_Mutation_p.G359S|OTOF_ENST00000339598.3_Missense_Mutation_p.G302S	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1049	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AAGGTCCGGCCCATGAAGTCA	0.582																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													97.0	86.0	89.0					2																	26697524		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3145G>A	2.37:g.26697524C>T	ENSP00000272371:p.Gly1049Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.G1049S	ENST00000272371.2	37	c.3145	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	c	36	5.664483	0.96745	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	D;D;D;D;D	0.90004	-2.6;-2.6;-2.6;-2.6;-2.6	5.58	5.58	0.84498	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.97504	0.9183	H	0.99705	4.715	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.99239	1.0884	10	0.87932	D	0	-36.1806	19.1746	0.93599	0.0:1.0:0.0:0.0	.	1049;302;359;302	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	S	302;302;359;1049;1049	ENSP00000345137:G302S;ENSP00000344521:G302S;ENSP00000383906:G359S;ENSP00000272371:G1049S;ENSP00000385255:G1049S	ENSP00000272371:G1049S	G	-	1	0	OTOF	26551028	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.768000	0.85345	2.638000	0.89438	0.556000	0.70494	GGC	OTOF	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000115155		0.582	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	40	0.00	0	C			26697524	26697524	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	missense	39	31.58	18	SNP	1.000	T
LRRC7	57554	genome.wustl.edu	37	1	70385302	70385302	+	Intron	SNP	G	G	A			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr1:70385302G>A	ENST00000035383.5	+	6	563				LRRC7_ENST00000415775.2_Intron|PIN1P1_ENST00000412108.1_RNA|LRRC7_ENST00000310961.5_Intron	NM_020794.2	NP_065845.1	Q96NW7	LRRC7_HUMAN	leucine rich repeat containing 7							cell junction (GO:0030054)|cytoplasm (GO:0005737)|postsynaptic membrane (GO:0045211)				breast(11)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(3)|lung(81)|ovary(9)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	162						GCTGATCAGCGGCTACATCCA	0.632																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS645.1	1p31.1	2008-02-05			ENSG00000033122	ENSG00000033122			18531	protein-coding gene	gene with protein product		614453				12525888	Standard	NM_020794		Approved	KIAA1365, densin-180	uc001dep.3	Q96NW7	OTTHUMG00000059194	ENST00000035383.5:c.534-11888G>A	1.37:g.70385302G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXC2|Q5VXC3|Q68D07|Q86VE8|Q8WX20|Q9P2I2	RNA	SNP	-	NULL	ENST00000035383.5	37	NULL	CCDS645.1	1																																																																																			PIN1P1	-	-	ENSG00000229359		0.632	LRRC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIN1P1	HGNC	protein_coding	OTTHUMT00000131261.1	15	0.00	0	G	NM_020794		70385302	70385302	+1	no_errors	ENST00000412108	ensembl	human	known	69_37n	rna	14	26.32	5	SNP	0.733	A
PIWIL3	440822	genome.wustl.edu	37	22	25158416	25158416	+	Silent	SNP	C	C	T			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr22:25158416C>T	ENST00000332271.5	-	2	467	c.51G>A	c.(49-51)gaG>gaA	p.E17E	PIWIL3_ENST00000527701.1_5'UTR|PIWIL3_ENST00000532537.2_5'UTR|PIWIL3_ENST00000533313.1_5'UTR	NM_001008496.3|NM_001255975.1	NP_001008496.2|NP_001242904.1	Q7Z3Z3	PIWL3_HUMAN	piwi-like RNA-mediated gene silencing 3	17					cell differentiation (GO:0030154)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	RNA binding (GO:0003723)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(14)|lung(15)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						GTTGGTAGCTCTCCCTGCGGC	0.547																																						dbGAP											0													96.0	87.0	90.0					22																	25158416		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB079368	CCDS33623.1	22q11.23	2013-02-15	2013-02-15		ENSG00000184571	ENSG00000184571		"""Argonaute/PIWI family"""	18443	protein-coding gene	gene with protein product		610314	"""piwi-like 3 (Drosophila)"""			12906857	Standard	NM_001008496		Approved	HIWI3	uc003abd.2	Q7Z3Z3	OTTHUMG00000150788	ENST00000332271.5:c.51G>A	22.37:g.25158416C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Piwi,pfam_PAZ,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.E17	ENST00000332271.5	37	c.51	CCDS33623.1	22																																																																																			PIWIL3	-	NULL	ENSG00000184571		0.547	PIWIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL3	HGNC	protein_coding	OTTHUMT00000320084.2	27	0.00	0	C	NM_001008496		25158416	25158416	-1	no_errors	ENST00000332271	ensembl	human	known	69_37n	silent	31	35.42	17	SNP	0.000	T
PRDM1	639	genome.wustl.edu	37	6	106536124	106536124	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr6:106536124G>A	ENST00000369096.4	+	2	325	c.91G>A	c.(91-93)Gag>Aag	p.E31K	PRDM1_ENST00000369091.2_5'UTR	NM_001198.3	NP_001189.2	O75626	PRDM1_HUMAN	PR domain containing 1, with ZNF domain	31					cell fate commitment (GO:0045165)|eye photoreceptor cell development (GO:0042462)|germ cell development (GO:0007281)|intestinal epithelial cell development (GO:0060576)|maternal placenta development (GO:0001893)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gene expression (GO:0010628)|post-embryonic development (GO:0009791)|transcription, DNA-templated (GO:0006351)|trophoblast giant cell differentiation (GO:0060707)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(59)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(5)|urinary_tract(2)	94	Breast(9;0.022)	all_cancers(87;2.2e-31)|all_epithelial(87;2.03e-21)|Acute lymphoblastic leukemia(125;4.99e-11)|all_lung(197;7.55e-09)|all_hematologic(75;5.82e-08)|Lung NSC(302;1.28e-06)|Colorectal(196;0.0112)|Ovarian(999;0.0365)		all cancers(137;1.83e-46)|Epithelial(106;5.59e-35)|OV - Ovarian serous cystadenocarcinoma(136;1.99e-20)|GBM - Glioblastoma multiforme(226;3.72e-11)|BRCA - Breast invasive adenocarcinoma(108;1.38e-05)		GGGATTGGCAGAGGGGACCAA	0.517			"""D, N, Mis, F, S"""		DLBCL																																	dbGAP		Rec	yes		6	6q21	639	"""PR domain containing 1, with ZNF domain"""		L	0													98.0	86.0	90.0					6																	106536124		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5054.2, CCDS34505.1	6q21	2013-01-08			ENSG00000057657	ENSG00000057657		"""Zinc fingers, C2H2-type"""	9346	protein-coding gene	gene with protein product		603423		BLIMP1		1851123	Standard	NM_001198		Approved	PRDI-BF1	uc003prd.2	O75626	OTTHUMG00000015299	ENST00000369096.4:c.91G>A	6.37:g.106536124G>A	ENSP00000358092:p.Glu31Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2REA6|E1P5E0|Q86WM7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_Znf_PRDM1,pfscan_SET_dom,pfscan_Znf_C2H2	p.E31K	ENST00000369096.4	37	c.91	CCDS5054.2	6	.	.	.	.	.	.	.	.	.	.	G	9.847	1.192617	0.21954	.	.	ENSG00000057657	ENST00000369096	T	0.06142	3.34	5.68	3.88	0.44766	.	.	.	.	.	T	0.01254	0.0041	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42310	-0.9459	9	0.12766	T	0.61	-6.0783	6.4653	0.21977	0.194:0.1488:0.6572:0.0	.	31	O75626	PRDM1_HUMAN	K	31	ENSP00000358092:E31K	ENSP00000358092:E31K	E	+	1	0	PRDM1	106642817	0.916000	0.31088	0.996000	0.52242	0.593000	0.36681	1.028000	0.30128	0.730000	0.32425	0.655000	0.94253	GAG	PRDM1	-	pirsf_Znf_PRDM1	ENSG00000057657		0.517	PRDM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM1	HGNC	protein_coding	OTTHUMT00000041661.3	78	0.00	0	G			106536124	106536124	+1	no_errors	ENST00000369096	ensembl	human	known	69_37n	missense	67	38.53	42	SNP	0.998	A
RAP1GDS1	5910	genome.wustl.edu	37	4	99355161	99355161	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr4:99355161A>G	ENST00000408927.3	+	13	1628	c.1515A>G	c.(1513-1515)atA>atG	p.I505M	RAP1GDS1_ENST00000453712.2_Missense_Mutation_p.I505M|RAP1GDS1_ENST00000380158.4_Missense_Mutation_p.I457M|RAP1GDS1_ENST00000339360.5_Missense_Mutation_p.I506M|RAP1GDS1_ENST00000264572.7_Missense_Mutation_p.I414M|RAP1GDS1_ENST00000408900.3_Missense_Mutation_p.I456M	NM_001100426.1|NM_001100427.1|NM_021159.4	NP_001093896.1|NP_001093897.1|NP_066982.3	P52306	GDS1_HUMAN	RAP1, GTP-GDP dissociation stimulator 1	505					myosin filament assembly (GO:0031034)|negative regulation of endoplasmic reticulum calcium ion concentration (GO:0032471)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|positive regulation of Rho GTPase activity (GO:0032321)|vascular smooth muscle contraction (GO:0014829)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)	28				OV - Ovarian serous cystadenocarcinoma(123;2.9e-07)|LUSC - Lung squamous cell carcinoma(1;0.0253)|Lung(1;0.0576)		AACATGTAATAATGCAGAATG	0.343			T	NUP98	T-ALL																																	dbGAP		Dom	yes		4	4q21-q25	5910	"""RAP1, GTP-GDP dissociation stimulator 1"""		L	0													118.0	114.0	115.0					4																	99355161		1914	4128	6042	-	-	-	SO:0001583	missense	0				CCDS43253.1, CCDS43254.1, CCDS47105.1, CCDS47106.1, CCDS47107.1, CCDS47108.1	4q23-q25	2013-02-14			ENSG00000138698	ENSG00000138698		"""Armadillo repeat containing"""	9859	protein-coding gene	gene with protein product		179502				8262526, 17951244	Standard	NM_001100426		Approved	SmgGDS	uc003htw.4	P52306	OTTHUMG00000160987	ENST00000408927.3:c.1515A>G	4.37:g.99355161A>G	ENSP00000386153:p.Ile505Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PH06|G5E9P9|Q499L7|Q4KMV2|Q4QQI8|Q9BUW9|Q9BUX6|Q9NYM2|Q9NZA8	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.I506M	ENST00000408927.3	37	c.1518	CCDS43253.1	4	.	.	.	.	.	.	.	.	.	.	A	18.01	3.527574	0.64860	.	.	ENSG00000138698	ENST00000380158;ENST00000264572;ENST00000408927;ENST00000453712;ENST00000408900;ENST00000339360	T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.92	3.31	0.37934	Armadillo-like helical (1);	0.000000	0.85682	D	0.000000	T	0.73705	0.3621	L	0.43152	1.355	0.48901	D	0.999727	D;D;D;B;P;D	0.76494	0.999;0.988;0.991;0.321;0.692;0.995	D;D;D;B;B;D	0.75484	0.94;0.977;0.986;0.13;0.352;0.932	T	0.73430	-0.3985	10	0.46703	T	0.11	-17.6871	12.7461	0.57281	0.7427:0.2573:0.0:0.0	.	414;456;457;505;506;505	E9PH06;P52306-2;Q499L7;P52306;Q4QQI8;G5E9P9	.;.;.;GDS1_HUMAN;.;.	M	457;414;505;505;456;506	ENSP00000369503:I457M;ENSP00000264572:I414M;ENSP00000386153:I505M;ENSP00000407157:I505M;ENSP00000386223:I456M;ENSP00000340454:I506M	ENSP00000264572:I414M	I	+	3	3	RAP1GDS1	99574184	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	1.932000	0.40143	1.023000	0.39654	0.454000	0.30748	ATA	RAP1GDS1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000138698		0.343	RAP1GDS1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GDS1	HGNC	protein_coding	OTTHUMT00000363273.2	60	0.00	0	A	NM_001100426		99355161	99355161	+1	no_errors	ENST00000339360	ensembl	human	known	69_37n	missense	105	21.05	28	SNP	1.000	G
SHISA9	729993	genome.wustl.edu	37	16	13010598	13010598	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr16:13010598A>G	ENST00000424107.3	+	2	1062	c.617A>G	c.(616-618)gAg>gGg	p.E206G	SHISA9_ENST00000558583.1_Missense_Mutation_p.E247G			B4DS77	SHSA9_HUMAN	shisa family member 9	206					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						GATCACATGGAGAGAGACCTA	0.438																																						dbGAP											0													124.0	96.0	104.0					16																	13010598		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.617A>G	16.37:g.13010598A>G	ENSP00000407958:p.Glu206Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J314|C9JCE9	Missense_Mutation	SNP	NULL	p.E247G	ENST00000424107.3	37	c.740	CCDS45417.2	16	.	.	.	.	.	.	.	.	.	.	A	21.0	4.080363	0.76528	.	.	ENSG00000237515	ENST00000424107	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	T	0.67468	0.2896	L	0.40543	1.245	0.80722	D	1	D	0.62365	0.991	D	0.76575	0.988	T	0.67952	-0.5537	8	0.48119	T	0.1	.	13.6838	0.62504	1.0:0.0:0.0:0.0	.	206	B4DS77	SHSA9_HUMAN	G	247	.	ENSP00000407958:E247G	E	+	2	0	SHISA9	12918099	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.972000	0.70448	2.125000	0.65367	0.533000	0.62120	GAG	SHISA9	-	NULL	ENSG00000237515		0.438	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	39	0.00	0	A	NM_001145204		13010598	13010598	+1	no_errors	ENST00000558583	ensembl	human	known	69_37n	missense	78	13.33	12	SNP	1.000	G
SLC6A19	340024	genome.wustl.edu	37	5	1216682	1216682	+	Silent	SNP	C	C	T	rs201851669		TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr5:1216682C>T	ENST00000304460.10	+	7	953	c.897C>T	c.(895-897)tgC>tgT	p.C299C		NM_001003841.2	NP_001003841.1	Q695T7	S6A19_HUMAN	solute carrier family 6 (neutral amino acid transporter), member 19	299					amino acid transport (GO:0006865)|ion transport (GO:0006811)|response to nutrient (GO:0007584)|transmembrane transport (GO:0055085)	brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|neutral amino acid transmembrane transporter activity (GO:0015175)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|lung(25)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	all_cancers(3;3.55e-15)|Lung NSC(6;2.89e-14)|all_lung(6;2.2e-13)|all_epithelial(6;3.75e-10)		Epithelial(17;0.000356)|all cancers(22;0.00137)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)			GCAACAACTGCGAGAAGGACT	0.612													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22858	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													266.0	190.0	216.0					5																	1216682		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096054	CCDS34130.1	5p15	2013-07-19			ENSG00000174358	ENSG00000174358		"""Solute carriers"""	27960	protein-coding gene	gene with protein product	"""Hartnup disease"""	608893					Standard	NM_001003841		Approved		uc003jbw.4	Q695T7	OTTHUMG00000161636	ENST00000304460.10:c.897C>T	5.37:g.1216682C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K446	Nonsense_Mutation	SNP	pfam_Na/ntran_symport,prints_Na/ntran_symport,pfscan_Na/ntran_symport	p.R269*	ENST00000304460.10	37	c.805	CCDS34130.1	5																																																																																			SLC6A19	-	NULL	ENSG00000174358		0.612	SLC6A19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A19	HGNC	protein_coding	OTTHUMT00000365557.1	72	0.00	0	C	XM_291120		1216682	1216682	+1	no_errors	ENST00000515652	ensembl	human	known	69_37n	nonsense	99	28.57	40	SNP	0.955	T
TANK	10010	genome.wustl.edu	37	2	162087536	162087536	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr2:162087536C>T	ENST00000392749.2	+	7	814	c.575C>T	c.(574-576)gCg>gTg	p.A192V	AC009299.2_ENST00000445372.1_RNA|TANK_ENST00000406287.1_Intron|AC009299.2_ENST00000421122.2_RNA|TANK_ENST00000405852.1_Missense_Mutation_p.A192V|TANK_ENST00000259075.2_Missense_Mutation_p.A192V|TANK_ENST00000402568.1_Intron	NM_001199135.1	NP_001186064.1	Q92844	TANK_HUMAN	TRAF family member-associated NFKB activator	192					I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)	p.A192V(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)	21						AAACAAGAAGCGCTGTTTAAG	0.438																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											64.0	61.0	62.0					2																	162087536		2203	4300	6503	-	-	-	SO:0001583	missense	0			U59863	CCDS2215.1, CCDS46436.1	2q24-q31	2008-02-05			ENSG00000136560	ENSG00000136560			11562	protein-coding gene	gene with protein product		603893		TRAF2		8710854, 8855313	Standard	NM_004180		Approved	I-TRAF	uc002ubr.2	Q92844	OTTHUMG00000132037	ENST00000392749.2:c.575C>T	2.37:g.162087536C>T	ENSP00000376505:p.Ala192Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPB5|Q7Z4J6|Q92885	Missense_Mutation	SNP	NULL	p.A192V	ENST00000392749.2	37	c.575	CCDS2215.1	2	.	.	.	.	.	.	.	.	.	.	C	5.480	0.273540	0.10403	.	.	ENSG00000136560	ENST00000259075;ENST00000392749;ENST00000405852;ENST00000437623	T;T;T;T	0.32753	1.88;1.88;1.44;1.46	5.78	-1.47	0.08772	.	0.499035	0.23123	N	0.051672	T	0.10508	0.0257	N	0.08118	0	0.31671	N	0.644309	B	0.12013	0.005	B	0.06405	0.002	T	0.21793	-1.0235	10	0.15952	T	0.53	-0.0219	4.2335	0.10615	0.3811:0.2845:0.0:0.3344	.	192	Q92844	TANK_HUMAN	V	192;192;192;83	ENSP00000259075:A192V;ENSP00000376505:A192V;ENSP00000385487:A192V;ENSP00000412556:A83V	ENSP00000259075:A192V	A	+	2	0	TANK	161795782	0.507000	0.26146	0.460000	0.27093	0.174000	0.22865	0.196000	0.17176	-0.052000	0.13311	-0.186000	0.12905	GCG	TANK	-	NULL	ENSG00000136560		0.438	TANK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TANK	HGNC	protein_coding	OTTHUMT00000324232.1	24	0.00	0	C	NM_133484		162087536	162087536	+1	no_errors	ENST00000259075	ensembl	human	known	69_37n	missense	31	35.42	17	SNP	0.131	T
SPHKAP	80309	genome.wustl.edu	37	2	228884249	228884249	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr2:228884249A>C	ENST00000392056.3	-	7	1367	c.1321T>G	c.(1321-1323)Tct>Gct	p.S441A	SPHKAP_ENST00000344657.5_Missense_Mutation_p.S441A	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	441						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		CATGACCGAGAAACCACTGTA	0.502																																						dbGAP											0													108.0	106.0	106.0					2																	228884249		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.1321T>G	2.37:g.228884249A>C	ENSP00000375909:p.Ser441Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.S441A	ENST00000392056.3	37	c.1321	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	A	5.044	0.193706	0.09599	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.12147	2.71;2.72	6.03	-0.104	0.13605	.	0.335174	0.37053	N	0.002269	T	0.07773	0.0195	L	0.38175	1.15	0.20638	N	0.999879	B;B	0.12013	0.001;0.005	B;B	0.11329	0.001;0.006	T	0.38757	-0.9646	10	0.13470	T	0.59	.	4.895	0.13746	0.4338:0.2843:0.2818:0.0	.	441;441	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	A	441	ENSP00000375909:S441A;ENSP00000339886:S441A	ENSP00000339886:S441A	S	-	1	0	SPHKAP	228592493	0.922000	0.31269	0.029000	0.17559	0.298000	0.27526	1.702000	0.37836	-0.080000	0.12685	-0.912000	0.02778	TCT	SPHKAP	-	NULL	ENSG00000153820		0.502	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	56	0.00	0	A	NM_030623		228884249	228884249	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	51	26.09	18	SNP	0.080	C
TRIM49C	642612	genome.wustl.edu	37	11	89774252	89774252	+	Missense_Mutation	SNP	G	G	A	rs201409537		TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr11:89774252G>A	ENST00000448984.1	+	8	1222	c.893G>A	c.(892-894)aGt>aAt	p.S298N	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	298	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.S298N(4)		endometrium(3)|kidney(1)|lung(4)	8						GAAGCCAACAGTGATATCTTT	0.323																																						dbGAP											4	Substitution - Missense(4)	endometrium(2)|kidney(2)																																								-	-	-	SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.893G>A	11.37:g.89774252G>A	ENSP00000388299:p.Ser298Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.S298N	ENST00000448984.1	37	c.893	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	g	0.625	-0.819420	0.02776	.	.	ENSG00000204449	ENST00000448984	T	0.04809	3.55	0.823	-0.634	0.11516	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);	.	.	.	.	T	0.04452	0.0122	L	0.52206	1.635	0.09310	N	1	B	0.12013	0.005	B	0.14023	0.01	T	0.43605	-0.9381	8	.	.	.	.	3.2016	0.06651	0.4432:0.0:0.5568:0.0	rs672762;rs9666958;rs16912727;rs672762	298	P0CI26	T49L2_HUMAN	N	298	ENSP00000388299:S298N	.	S	+	2	0	TRIM49L2	89413900	0.000000	0.05858	0.001000	0.08648	0.034000	0.12701	-1.058000	0.03482	-0.239000	0.09710	0.305000	0.20034	AGT	TRIM49C	-	superfamily_ConA-like_lec_gl,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000204449		0.323	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	8	0.00	0	G	NM_001195234		89774252	89774252	+1	no_errors	ENST00000448984	ensembl	human	known	69_37n	missense	6	53.85	7	SNP	0.001	A
VAV1	7409	genome.wustl.edu	37	19	6850694	6850694	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr19:6850694G>A	ENST00000602142.1	+	24	2225	c.2143G>A	c.(2143-2145)Gtc>Atc	p.V715I	VAV1_ENST00000596764.1_Missense_Mutation_p.V683I|VAV1_ENST00000539284.1_Missense_Mutation_p.V618I|VAV1_ENST00000304076.2_Missense_Mutation_p.V693I|VAV1_ENST00000599806.1_Missense_Mutation_p.V660I	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	715	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						TAACGTCGAGGTCAAGCACAT	0.542																																						dbGAP											0													99.0	87.0	91.0					19																	6850694		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.2143G>A	19.37:g.6850694G>A	ENSP00000472929:p.Val715Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.V715I	ENST00000602142.1	37	c.2143	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	G	14.67	2.603777	0.46423	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	D	0.91011	-2.77	3.92	2.88	0.33553	SH2 motif (5);	0.148125	0.45126	D	0.000382	D	0.88815	0.6539	L	0.43646	1.37	0.42323	D	0.992266	B;B;B;B	0.27068	0.167;0.03;0.091;0.068	B;B;B;B	0.42462	0.118;0.068;0.388;0.195	D	0.86146	0.1584	10	0.66056	D	0.02	.	7.5389	0.27727	0.1185:0.0:0.8815:0.0	.	618;715;660;715	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	I	715;618	ENSP00000443242:V618I	ENSP00000302269:V715I	V	+	1	0	VAV1	6801694	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.006000	0.40874	1.001000	0.39076	0.561000	0.74099	GTC	VAV1	-	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000141968		0.542	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	HGNC	protein_coding	OTTHUMT00000458475.1	54	0.00	0	G			6850694	6850694	+1	no_errors	ENST00000304076	ensembl	human	known	69_37n	missense	33	44.07	26	SNP	1.000	A
VPS13B	157680	genome.wustl.edu	37	8	100789055	100789055	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr8:100789055A>G	ENST00000358544.2	+	41	7486	c.7375A>G	c.(7375-7377)Aca>Gca	p.T2459A	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.T2434A	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2459					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			TGTGACTCCAACAGCCCTGGC	0.458																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													209.0	169.0	183.0					8																	100789055		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.7375A>G	8.37:g.100789055A>G	ENSP00000351346:p.Thr2459Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.T2459A	ENST00000358544.2	37	c.7375	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	A	20.8	4.045806	0.75846	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.69435	-0.4;-0.4	5.52	4.35	0.52113	.	0.054595	0.64402	D	0.000001	T	0.69984	0.3172	L	0.44542	1.39	0.80722	D	1	D;B	0.57257	0.979;0.307	P;B	0.56563	0.801;0.079	T	0.69139	-0.5224	10	0.45353	T	0.12	.	12.7151	0.57111	0.8623:0.1377:0.0:0.0	.	2434;2459	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	A	2434;2459	ENSP00000349685:T2434A;ENSP00000351346:T2459A	ENSP00000349685:T2434A	T	+	1	0	VPS13B	100858231	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.324000	0.96373	0.904000	0.36572	0.528000	0.53228	ACA	VPS13B	-	NULL	ENSG00000132549		0.458	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	109	0.00	0	A	NM_184042		100789055	100789055	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	110	30.38	48	SNP	1.000	G
WDR66	144406	genome.wustl.edu	37	12	122359385	122359385	+	Frame_Shift_Del	DEL	C	C	-	rs370060195		TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr12:122359385delC	ENST00000288912.4	+	2	1028	c.174delC	c.(172-174)ggcfs	p.G58fs	WDR66_ENST00000397454.2_Frame_Shift_Del_p.G58fs	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	58	Glu-rich.						calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ggaaaacgggcgaggaggaag	0.463																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													44.0	45.0	45.0					12																	122359385		1915	4116	6031	-	-	-	SO:0001589	frameshift_variant	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.174delC	12.37:g.122359385delC	ENSP00000288912:p.Gly58fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E59fs	ENST00000288912.4	37	c.174	CCDS41853.1	12																																																																																			WDR66	-	NULL	ENSG00000158023		0.463	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	27	0.00	0	C	NM_144668		122359385	122359385	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	frame_shift_del	46	14.04	8	DEL	0.000	-
ZFR	51663	genome.wustl.edu	37	5	32364331	32364331	+	Silent	SNP	C	C	T			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr5:32364331C>T	ENST00000265069.8	-	18	2988	c.2886G>A	c.(2884-2886)caG>caA	p.Q962Q	ZFR_ENST00000510369.1_5'UTR	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	962	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		CCCCAGGGCTCTGAGGGCTAG	0.353																																						dbGAP											0													82.0	85.0	84.0					5																	32364331		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2886G>A	5.37:g.32364331C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Silent	SNP	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.Q962	ENST00000265069.8	37	c.2886	CCDS34139.1	5																																																																																			ZFR	-	pfam_DZF,smart_DZF	ENSG00000056097		0.353	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	32	0.00	0	C			32364331	32364331	-1	no_errors	ENST00000265069	ensembl	human	known	69_37n	silent	38	60.42	58	SNP	1.000	T
ZPBP2	124626	genome.wustl.edu	37	17	38031506	38031506	+	Splice_Site	SNP	G	G	A			TCGA-EW-A1J3-01A-11D-A13L-09	TCGA-EW-A1J3-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ac13b81a-ca05-432c-918a-0c9c8170bf46	3e0f2e32-d64a-416a-be72-eb34ff190ed6	g.chr17:38031506G>A	ENST00000348931.4	+	7	899		c.e7-1		ZPBP2_ENST00000377940.3_Splice_Site|ZPBP2_ENST00000584588.1_Splice_Site	NM_199321.2	NP_955353.1	Q6X784	ZPBP2_HUMAN	zona pellucida binding protein 2						acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	15	Colorectal(19;0.000442)		Lung(15;0.00849)|LUSC - Lung squamous cell carcinoma(15;0.171)			TTCAACCTTAGGCAAGAGATC	0.358																																						dbGAP											0													69.0	70.0	70.0					17																	38031506		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC043152	CCDS11352.1, CCDS11353.2	17q21.1	2013-01-11			ENSG00000186075	ENSG00000186075		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	20678	protein-coding gene	gene with protein product		608499					Standard	XM_005257031		Approved	ZPBPL, MGC41930	uc002hte.3	Q6X784	OTTHUMG00000133022	ENST00000348931.4:c.709-1G>A	17.37:g.38031506G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8L8|Q6X783|Q86XL5	Splice_Site	SNP	-	e7-1	ENST00000348931.4	37	c.709-1	CCDS11352.1	17	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791620	0.70452	.	.	ENSG00000186075	ENST00000348931;ENST00000377940	.	.	.	5.35	5.35	0.76521	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.8419	0.85971	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ZPBP2	35285032	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	5.699000	0.68310	2.502000	0.84385	0.460000	0.39030	.	ZPBP2	-	-	ENSG00000186075		0.358	ZPBP2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZPBP2	HGNC	protein_coding	OTTHUMT00000256609.2	52	0.00	0	G	NM_198844	Intron	38031506	38031506	+1	no_errors	ENST00000348931	ensembl	human	known	69_37n	splice_site	788	16.61	157	SNP	1.000	A
