#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA1	19	genome.wustl.edu	37	9	107562237	107562237	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:107562237G>A	ENST00000374736.3	-	36	5200	c.4806C>T	c.(4804-4806)atC>atT	p.I1602I		NM_005502.3	NP_005493.2	O95477	ABCA1_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 1	1602					apolipoprotein A-I-mediated signaling pathway (GO:0038027)|cellular lipid metabolic process (GO:0044255)|cellular response to cholesterol (GO:0071397)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to retinoic acid (GO:0071300)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|endosomal transport (GO:0016197)|G-protein coupled receptor signaling pathway (GO:0007186)|high-density lipoprotein particle assembly (GO:0034380)|interleukin-1 beta secretion (GO:0050702)|intracellular cholesterol transport (GO:0032367)|lipoprotein metabolic process (GO:0042157)|lysosome organization (GO:0007040)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|peptide secretion (GO:0002790)|phagocytosis, engulfment (GO:0006911)|phospholipid efflux (GO:0033700)|phospholipid homeostasis (GO:0055091)|phospholipid translocation (GO:0045332)|platelet dense granule organization (GO:0060155)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cholesterol efflux (GO:0010875)|protein lipidation (GO:0006497)|regulation of Cdc42 protein signal transduction (GO:0032489)|response to drug (GO:0042493)|response to laminar fluid shear stress (GO:0034616)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)	endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein A-I receptor activity (GO:0034188)|apolipoprotein binding (GO:0034185)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase binding (GO:0051117)|cholesterol binding (GO:0015485)|cholesterol transporter activity (GO:0017127)|phospholipid binding (GO:0005543)|phospholipid transporter activity (GO:0005548)|receptor binding (GO:0005102)|small GTPase binding (GO:0031267)|syntaxin binding (GO:0019905)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(31)|liver(1)|lung(40)|ovary(5)|pancreas(2)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	115				OV - Ovarian serous cystadenocarcinoma(323;0.023)	Adenosine triphosphate(DB00171)|Glyburide(DB01016)|Probucol(DB01599)	GGAAAGAGCTGATTGCATGCC	0.498																																						dbGAP											0													120.0	112.0	115.0					9																	107562237		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ012376	CCDS6762.1	9q31	2014-03-14			ENSG00000165029	ENSG00000165029		"""ATP binding cassette transporters / subfamily A"""	29	protein-coding gene	gene with protein product	"""Tangier disease"""	600046		ABC1, HDLDT1		8088782, 10431236, 10431237, 10431238	Standard	NM_005502		Approved	TGD	uc004bcl.3	O95477	OTTHUMG00000020417	ENST00000374736.3:c.4806C>T	9.37:g.107562237G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VX33|Q96S56|Q96T85|Q9NQV4|Q9UN06|Q9UN07|Q9UN08|Q9UN09	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.I1602	ENST00000374736.3	37	c.4806	CCDS6762.1	9																																																																																			ABCA1	-	NULL	ENSG00000165029		0.498	ABCA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA1	HGNC	protein_coding	OTTHUMT00000053491.1	61	0.00	0	G	NM_005502		107562237	107562237	-1	no_errors	ENST00000374736	ensembl	human	known	69_37n	silent	63	30.00	27	SNP	1.000	A
ABCA8	10351	genome.wustl.edu	37	17	66924181	66924181	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:66924181C>G	ENST00000269080.2	-	9	1286	c.1149G>C	c.(1147-1149)ttG>ttC	p.L383F	ABCA8_ENST00000430352.2_Missense_Mutation_p.L383F|ABCA8_ENST00000586539.1_Missense_Mutation_p.L383F	NM_007168.2	NP_009099.1	O94911	ABCA8_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 8	383					transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			breast(3)|central_nervous_system(2)|endometrium(9)|kidney(5)|large_intestine(19)|liver(1)|lung(30)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|urinary_tract(4)	83	Breast(10;4.56e-13)					CATTAGAATTCAAATCATAGT	0.333																																						dbGAP											0													63.0	63.0	63.0					17																	66924181		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020629	CCDS11680.1, CCDS74138.1, CCDS74139.1	17q24	2012-03-14			ENSG00000141338	ENSG00000141338		"""ATP binding cassette transporters / subfamily A"""	38	protein-coding gene	gene with protein product		612505					Standard	XM_005256938		Approved	KIAA0822	uc002jhp.3	O94911		ENST00000269080.2:c.1149G>C	17.37:g.66924181C>G	ENSP00000269080:p.Leu383Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U3|C9JQE6|Q86WW0	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.L383F	ENST00000269080.2	37	c.1149	CCDS11680.1	17	.	.	.	.	.	.	.	.	.	.	C	12.45	1.942518	0.34283	.	.	ENSG00000141338	ENST00000269080;ENST00000430352;ENST00000541225;ENST00000542396	D;D	0.87650	-2.24;-2.28	4.5	3.52	0.40303	.	0.582786	0.14199	N	0.334835	D	0.89301	0.6676	M	0.65975	2.015	0.34163	D	0.668882	P;D;B;B;D	0.53151	0.948;0.958;0.068;0.312;0.958	P;P;B;B;P	0.58210	0.8;0.835;0.145;0.268;0.835	D	0.87645	0.2524	10	0.20046	T	0.44	.	9.0994	0.36658	0.0:0.8942:0.0:0.1058	.	322;383;383;383;383	F5H6Z4;A1L3U3;B4DJ11;C9JQE6;O94911	.;.;.;.;ABCA8_HUMAN	F	383;383;322;14	ENSP00000269080:L383F;ENSP00000402814:L383F	ENSP00000269080:L383F	L	-	3	2	ABCA8	64435776	0.002000	0.14202	0.996000	0.52242	0.972000	0.66771	-0.201000	0.09464	1.221000	0.43506	0.650000	0.86243	TTG	ABCA8	-	NULL	ENSG00000141338		0.333	ABCA8-001	KNOWN	basic|CCDS	protein_coding	ABCA8	HGNC	protein_coding	OTTHUMT00000450172.1	66	0.00	0	C	NM_007168		66924181	66924181	-1	no_errors	ENST00000430352	ensembl	human	known	69_37n	missense	52	26.76	19	SNP	0.998	G
ABCB10	23456	genome.wustl.edu	37	1	229683381	229683381	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:229683381G>C	ENST00000344517.4	-	3	828	c.786C>G	c.(784-786)ttC>ttG	p.F262L	RNA5SP78_ENST00000364622.1_RNA	NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	262	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TCTTGTCAAAGAAAGCAACCT	0.507																																						dbGAP											0													64.0	68.0	67.0					1																	229683381		2203	4300	6503	-	-	-	SO:0001583	missense	0			U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.786C>G	1.37:g.229683381G>C	ENSP00000355637:p.Phe262Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13040|Q6P1Q8|Q9H3V0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.F262L	ENST00000344517.4	37	c.786	CCDS1580.1	1	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914093	0.92178	.	.	ENSG00000135776	ENST00000344517	D	0.83755	-1.76	5.37	4.44	0.53790	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.92567	0.7639	H	0.94222	3.51	0.58432	D	0.999999	D	0.60575	0.988	D	0.63283	0.913	D	0.94233	0.7478	10	0.87932	D	0	-27.8713	14.9726	0.71246	0.0724:0.0:0.9276:0.0	.	262	Q9NRK6	ABCBA_HUMAN	L	262	ENSP00000355637:F262L	ENSP00000355637:F262L	F	-	3	2	ABCB10	227750004	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.171000	0.42453	2.676000	0.91093	0.561000	0.74099	TTC	ABCB10	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000135776		0.507	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	HGNC	protein_coding	OTTHUMT00000095240.1	60	0.00	0	G	NM_012089		229683381	229683381	-1	no_errors	ENST00000344517	ensembl	human	known	69_37n	missense	119	13.77	19	SNP	1.000	C
ABCC12	94160	genome.wustl.edu	37	16	48162479	48162479	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:48162479G>A	ENST00000311303.3	-	9	1751	c.1406C>T	c.(1405-1407)tCa>tTa	p.S469L	ABCC12_ENST00000416054.1_Missense_Mutation_p.S469L|ABCC12_ENST00000448542.1_Missense_Mutation_p.S469L	NM_033226.2	NP_150229.2	Q96J65	MRP9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 12	469	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.					integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)			NS(1)|breast(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|liver(1)|lung(43)|ovary(2)|prostate(3)|skin(7)|urinary_tract(1)	90		all_cancers(37;0.0474)|all_lung(18;0.047)				GTATGCCTCTGACCTCTGTTT	0.498																																						dbGAP											0													234.0	187.0	203.0					16																	48162479		2201	4300	6501	-	-	-	SO:0001583	missense	0			AY040220	CCDS10730.1	16q12.1	2012-03-14			ENSG00000140798	ENSG00000140798		"""ATP binding cassette transporters / subfamily C"""	14640	protein-coding gene	gene with protein product		607041				11435397, 11483364	Standard	NM_033226		Approved	MRP9	uc002efc.1	Q96J65	OTTHUMG00000133143	ENST00000311303.3:c.1406C>T	16.37:g.48162479G>A	ENSP00000311030:p.Ser469Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AL2|Q8TAF0|Q8TEY2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S469L	ENST00000311303.3	37	c.1406	CCDS10730.1	16	.	.	.	.	.	.	.	.	.	.	G	9.904	1.207703	0.22205	.	.	ENSG00000140798	ENST00000311303;ENST00000448542;ENST00000449939;ENST00000416054	D;D;D	0.93307	-2.89;-3.11;-3.2	5.45	-1.36	0.09085	ABC transporter-like (1);	1.881000	0.02205	N	0.062644	D	0.83912	0.5357	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.74163	-0.3754	10	0.27785	T	0.31	.	5.0835	0.14668	0.4004:0.0:0.4648:0.1349	.	469;469	Q96J65-2;Q96J65	.;MRP9_HUMAN	L	469;469;411;469	ENSP00000311030:S469L;ENSP00000401855:S469L;ENSP00000413046:S469L	ENSP00000311030:S469L	S	-	2	0	ABCC12	46719980	0.000000	0.05858	0.002000	0.10522	0.035000	0.12851	-0.092000	0.11129	-0.012000	0.14223	0.561000	0.74099	TCA	ABCC12	-	pfscan_ABC_transporter-like	ENSG00000140798		0.498	ABCC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC12	HGNC	protein_coding	OTTHUMT00000256837.1	149	0.67	1	G	NM_033226		48162479	48162479	-1	no_errors	ENST00000311303	ensembl	human	known	69_37n	missense	505	10.60	60	SNP	0.000	A
ADAMTS18	170692	genome.wustl.edu	37	16	77327078	77327078	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:77327078C>T	ENST00000282849.5	-	20	3502	c.3084G>A	c.(3082-3084)gaG>gaA	p.E1028E	RP11-538I12.3_ENST00000561672.1_RNA	NM_199355.2	NP_955387.1	Q8TE60	ATS18_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 18	1028	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.				eye development (GO:0001654)|negative regulation of platelet aggregation (GO:0090331)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(9)|large_intestine(26)|lung(44)|ovary(2)|pancreas(1)|prostate(1)|skin(19)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	118						TACACTGGCTCTCGGGGAGGG	0.577																																						dbGAP											0													85.0	82.0	83.0					16																	77327078		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AJ311903	CCDS10926.1	16q23	2008-07-29	2005-08-19		ENSG00000140873	ENSG00000140873		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17110	protein-coding gene	gene with protein product		607512	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 18"""	ADAMTS21		11867212, 17546048	Standard	NM_199355		Approved		uc002ffc.4	Q8TE60	OTTHUMG00000137619	ENST00000282849.5:c.3084G>A	16.37:g.77327078C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4R5|Q6ZWJ9	Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.E1028	ENST00000282849.5	37	c.3084	CCDS10926.1	16																																																																																			ADAMTS18	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000140873		0.577	ADAMTS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS18	HGNC	protein_coding	OTTHUMT00000269037.1	32	0.00	0	C			77327078	77327078	-1	no_errors	ENST00000282849	ensembl	human	known	69_37n	silent	9	50.00	10	SNP	1.000	T
ADAMTS4	9507	genome.wustl.edu	37	1	161166344	161166344	+	Intron	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:161166344C>A	ENST00000367996.5	-	2	1386				NDUFS2_ENST00000367993.3_5'Flank|ADAMTS4_ENST00000367995.3_Silent_p.V320V|ADAMTS4_ENST00000478394.1_5'Flank	NM_005099.4	NP_005090.3	O75173	ATS4_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 4						defense response to bacterium (GO:0042742)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(20)|ovary(4)|prostate(3)|skin(1)|urinary_tract(1)	43	all_cancers(52;3.73e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00275)		Tinzaparin(DB06822)	ACTGGGGCCTCACCTGACGGG	0.562																																						dbGAP											0													98.0	104.0	102.0					1																	161166344		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB014588	CCDS1223.1	1q31-q32	2008-02-05	2005-08-19		ENSG00000158859	ENSG00000158859		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	220	protein-coding gene	gene with protein product		603876	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 4"""			10094461	Standard	NM_005099		Approved	KIAA0688, ADAMTS-2, ADMP-1	uc001fyt.4	O75173	OTTHUMG00000034349	ENST00000367996.5:c.957+2G>T	1.37:g.161166344C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTW2|Q6P4Q8|Q6UWA8|Q9UN83	Silent	SNP	pfam_Peptidase_M12B_N	p.V320	ENST00000367996.5	37	c.960	CCDS1223.1	1																																																																																			ADAMTS4	-	NULL	ENSG00000158859		0.562	ADAMTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS4	HGNC	protein_coding	OTTHUMT00000083066.2	57	0.00	0	C	NM_005099		161166344	161166344	-1	no_errors	ENST00000367995	ensembl	human	known	69_37n	silent	50	38.27	31	SNP	1.000	A
ADNP	23394	genome.wustl.edu	37	20	49510991	49510991	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:49510991G>C	ENST00000396029.3	-	5	827	c.260C>G	c.(259-261)tCt>tGt	p.S87C	ADNP_ENST00000396032.3_Missense_Mutation_p.S87C|ADNP_ENST00000371602.4_Missense_Mutation_p.S87C|ADNP_ENST00000349014.3_Missense_Mutation_p.S87C	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	87					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						TTTGTAGGCAGAGAAGAATTT	0.388																																						dbGAP											0													72.0	74.0	73.0					20																	49510991		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.260C>G	20.37:g.49510991G>C	ENSP00000379346:p.Ser87Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S87C	ENST00000396029.3	37	c.260	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	G	17.42	3.386334	0.61956	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032;ENST00000534467	T;T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02;-1.02	5.42	5.42	0.78866	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	D	0.86961	0.6059	M	0.62723	1.935	0.58432	D	0.999999	D	0.76494	0.999	D	0.77557	0.99	D	0.85997	0.1492	10	0.46703	T	0.11	-10.2517	19.5864	0.95492	0.0:0.0:1.0:0.0	.	87	Q9H2P0	ADNP_HUMAN	C	87	ENSP00000360662:S87C;ENSP00000342905:S87C;ENSP00000379346:S87C;ENSP00000379349:S87C;ENSP00000436181:S87C	ENSP00000342905:S87C	S	-	2	0	ADNP	48944398	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.602000	0.82796	2.705000	0.92388	0.655000	0.94253	TCT	ADNP	-	smart_Znf_C2H2-like	ENSG00000101126		0.388	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	55	0.00	0	G	NM_181442		49510991	49510991	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	C
AFTPH	54812	genome.wustl.edu	37	2	64780084	64780084	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:64780084G>C	ENST00000422803.1	+	2	1790	c.1476G>C	c.(1474-1476)gaG>gaC	p.E492D	AFTPH_ENST00000238856.4_Missense_Mutation_p.E492D|AFTPH_ENST00000409933.1_Missense_Mutation_p.E492D|AFTPH_ENST00000487769.1_3'UTR|AFTPH_ENST00000238855.7_Missense_Mutation_p.E492D|AFTPH_ENST00000409183.1_Missense_Mutation_p.E123D			Q6ULP2	AFTIN_HUMAN	aftiphilin	492					protein transport (GO:0015031)	AP-1 adaptor complex (GO:0030121)|cytosol (GO:0005829)	clathrin binding (GO:0030276)			breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	35						GCCAAGAGGAGACAATATTAA	0.383																																						dbGAP											0													97.0	98.0	98.0					2																	64780084		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB073356	CCDS1878.1, CCDS46303.1	2p14	2008-02-05			ENSG00000119844	ENSG00000119844			25951	protein-coding gene	gene with protein product						14665628, 15758025, 15811338	Standard	NM_017657		Approved	MGC33965, FLJ20080, FLJ23793, Nbla10388	uc002scz.3	Q6ULP2	OTTHUMG00000129539	ENST00000422803.1:c.1476G>C	2.37:g.64780084G>C	ENSP00000397726:p.Glu492Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5E9|Q6ZM66|Q86VW3|Q8TCF3|Q9H7E3|Q9HAB9|Q9NXS4	Missense_Mutation	SNP	NULL	p.E492D	ENST00000422803.1	37	c.1476		2	.	.	.	.	.	.	.	.	.	.	G	8.473	0.858066	0.17178	.	.	ENSG00000119844	ENST00000238856;ENST00000422803;ENST00000238855;ENST00000409933;ENST00000409183	T;T;T;T;T	0.49432	1.76;1.76;1.77;1.77;0.78	5.3	4.16	0.48862	.	0.286793	0.30575	N	0.009322	T	0.60907	0.2305	M	0.64997	1.995	0.24497	N	0.994279	P;P;D;D	0.67145	0.763;0.873;0.996;0.996	B;P;D;D	0.76071	0.288;0.461;0.987;0.987	T	0.52193	-0.8608	10	0.49607	T	0.09	-8.2737	7.9597	0.30064	0.8406:0.0:0.1594:0.0	.	492;492;492;492	Q6ULP2;Q6ULP2-2;Q6ULP2-5;Q6ULP2-4	AFTIN_HUMAN;.;.;.	D	492;492;492;492;123	ENSP00000238856:E492D;ENSP00000397726:E492D;ENSP00000238855:E492D;ENSP00000387071:E492D;ENSP00000386913:E123D	ENSP00000238855:E492D	E	+	3	2	AFTPH	64633588	0.638000	0.27225	0.885000	0.34714	0.212000	0.24457	1.327000	0.33746	1.049000	0.40321	-0.312000	0.09012	GAG	AFTPH	-	NULL	ENSG00000119844		0.383	AFTPH-202	KNOWN	basic	protein_coding	AFTPH	HGNC	protein_coding		123	0.00	0	G	NM_017657		64780084	64780084	+1	no_errors	ENST00000422803	ensembl	human	known	69_37n	missense	72	30.77	32	SNP	0.898	C
AHNAK2	113146	genome.wustl.edu	37	14	105406830	105406830	+	Silent	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:105406830G>C	ENST00000333244.5	-	7	15077	c.14958C>G	c.(14956-14958)ctC>ctG	p.L4986L	AHNAK2_ENST00000557457.1_5'UTR	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4986						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			AAACCAGGCTGAGTTTTGAGT	0.527																																						dbGAP											0													53.0	53.0	53.0					14																	105406830		2025	4186	6211	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.14958C>G	14.37:g.105406830G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L4986	ENST00000333244.5	37	c.14958	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.527	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	74	0.00	0	G	NM_138420		105406830	105406830	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	46	28.12	18	SNP	0.000	C
AHNAK2	113146	genome.wustl.edu	37	14	105413693	105413693	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:105413693G>C	ENST00000333244.5	-	7	8214	c.8095C>G	c.(8095-8097)Cag>Gag	p.Q2699E	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2699						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GAGGGGGGCTGAATGCTGATG	0.622																																						dbGAP											0													148.0	163.0	158.0					14																	105413693		1990	4166	6156	-	-	-	SO:0001583	missense	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.8095C>G	14.37:g.105413693G>C	ENSP00000353114:p.Gln2699Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.Q2699E	ENST00000333244.5	37	c.8095	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	g	0.016	-1.517560	0.00975	.	.	ENSG00000185567	ENST00000333244	T	0.01527	4.8	3.48	-0.0358	0.13891	.	.	.	.	.	T	0.02304	0.0071	N	0.11651	0.15	0.09310	N	1	D	0.58268	0.982	D	0.70227	0.968	T	0.51973	-0.8637	9	0.16420	T	0.52	-16.6091	4.9137	0.13835	0.1455:0.4765:0.3779:0.0	.	2699	Q8IVF2	AHNK2_HUMAN	E	2699	ENSP00000353114:Q2699E	ENSP00000353114:Q2699E	Q	-	1	0	AHNAK2	104484738	0.001000	0.12720	0.001000	0.08648	0.015000	0.08874	-0.797000	0.04570	0.410000	0.25675	0.313000	0.20887	CAG	AHNAK2	-	NULL	ENSG00000185567		0.622	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	94	0.00	0	G	NM_138420		105413693	105413693	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	missense	59	29.76	25	SNP	0.000	C
AIM1	202	genome.wustl.edu	37	6	106967799	106967799	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:106967799G>C	ENST00000369066.3	+	2	1979	c.1492G>C	c.(1492-1494)Gaa>Caa	p.E498Q		NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		AAAAGTGTCAGAAAACCATAA	0.448																																						dbGAP											0													77.0	85.0	82.0					6																	106967799		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.1492G>C	6.37:g.106967799G>C	ENSP00000358062:p.Glu498Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.E498Q	ENST00000369066.3	37	c.1492	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155975	0.57259	.	.	ENSG00000112297	ENST00000285105;ENST00000369066	T	0.72167	-0.63	6.17	5.26	0.73747	.	0.965114	0.08497	N	0.936984	T	0.61451	0.2348	L	0.59436	1.845	0.80722	D	1	P	0.44578	0.838	B	0.41813	0.367	T	0.61337	-0.7083	10	0.51188	T	0.08	.	12.7316	0.57201	0.0:0.1643:0.8357:0.0	.	498	Q9Y4K1	AIM1_HUMAN	Q	906;498	ENSP00000358062:E498Q	ENSP00000285105:E906Q	E	+	1	0	AIM1	107074492	0.069000	0.21087	0.896000	0.35187	0.084000	0.17831	2.027000	0.41078	2.941000	0.99782	0.655000	0.94253	GAA	AIM1	-	NULL	ENSG00000112297		0.448	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	26	0.00	0	G			106967799	106967799	+1	no_errors	ENST00000369066	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.556	C
AMOT	154796	genome.wustl.edu	37	X	112058819	112058819	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:112058819G>C	ENST00000524145.1	-	3	1233	c.1159C>G	c.(1159-1161)Cat>Gat	p.H387D	AMOT_ENST00000371962.1_Missense_Mutation_p.H155D|AMOT_ENST00000304758.1_De_novo_Start_OutOfFrame|AMOT_ENST00000371958.1_Missense_Mutation_p.H155D|AMOT_ENST00000371959.3_Missense_Mutation_p.H387D			Q4VCS5	AMOT_HUMAN	angiomotin	387					actin cytoskeleton organization (GO:0030036)|blood vessel endothelial cell migration (GO:0043534)|cell migration involved in gastrulation (GO:0042074)|cell-cell junction assembly (GO:0007043)|cellular protein localization (GO:0034613)|chemotaxis (GO:0006935)|establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|gastrulation with mouth forming second (GO:0001702)|hippo signaling (GO:0035329)|in utero embryonic development (GO:0001701)|negative regulation of angiogenesis (GO:0016525)|negative regulation of GTPase activity (GO:0034260)|negative regulation of vascular permeability (GO:0043116)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell size (GO:0045793)|positive regulation of embryonic development (GO:0040019)|positive regulation of stress fiber assembly (GO:0051496)|regulation of cell migration (GO:0030334)|regulation of small GTPase mediated signal transduction (GO:0051056)|vasculogenesis (GO:0001570)	actin filament (GO:0005884)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|ruffle (GO:0001726)|stress fiber (GO:0001725)|tight junction (GO:0005923)	angiostatin binding (GO:0043532)|receptor activity (GO:0004872)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	43						tgatggtgatgatggtgctgc	0.567																																						dbGAP											0													40.0	38.0	39.0					X																	112058819		692	1591	2283	-	-	-	SO:0001583	missense	0			AB028994	CCDS14563.1, CCDS48154.1	Xq23	2006-02-08			ENSG00000126016	ENSG00000126016			17810	protein-coding gene	gene with protein product		300410				11257124, 16043488, 12406577	Standard	NM_001113490		Approved	KIAA1071	uc004epr.3	Q4VCS5	OTTHUMG00000022216	ENST00000524145.1:c.1159C>G	X.37:g.112058819G>C	ENSP00000429013:p.His387Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504X5|Q9HD27|Q9UPT1	Missense_Mutation	SNP	pfam_Angiomotin_C,superfamily_Prefoldin,prints_Angiomotin	p.H387D	ENST00000524145.1	37	c.1159	CCDS48154.1	X	.	.	.	.	.	.	.	.	.	.	G	6.917	0.538792	0.13250	.	.	ENSG00000126016	ENST00000371959;ENST00000371962;ENST00000524145;ENST00000371958	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	3.55	3.55	0.40652	.	0.173837	0.34025	N	0.004338	T	0.06096	0.0158	N	0.08118	0	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.38045	-0.9679	10	0.13853	T	0.58	-2.369	9.7768	0.40623	0.0:0.0:1.0:0.0	.	387	Q4VCS5	AMOT_HUMAN	D	387;155;387;155	ENSP00000361027:H387D;ENSP00000361030:H155D;ENSP00000429013:H387D;ENSP00000361026:H155D	ENSP00000361026:H155D	H	-	1	0	AMOT	111945475	0.398000	0.25279	0.013000	0.15412	0.073000	0.16967	3.865000	0.56033	2.055000	0.61198	0.422000	0.28245	CAT	AMOT	-	NULL	ENSG00000126016		0.567	AMOT-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMOT	HGNC	protein_coding	OTTHUMT00000378570.1	46	0.00	0	G	NM_133265		112058819	112058819	-1	no_errors	ENST00000371959	ensembl	human	known	69_37n	missense	63	30.00	27	SNP	0.212	C
ANP32E	81611	genome.wustl.edu	37	1	150199026	150199026	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:150199026C>G	ENST00000314136.8	-	5	964	c.595G>C	c.(595-597)Gat>Cat	p.D199H	ANP32E_ENST00000369116.4_Missense_Mutation_p.D67H|ANP32E_ENST00000369115.2_Missense_Mutation_p.D67H|ANP32E_ENST00000533654.1_Missense_Mutation_p.R143S|ANP32E_ENST00000369114.5_Intron|ANP32E_ENST00000369119.3_Missense_Mutation_p.D151H|ANP32E_ENST00000436748.2_Missense_Mutation_p.D158H	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	199	Asp/Glu-rich (highly acidic).				histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			tcatcttcatcctcatcctca	0.463																																						dbGAP											0													321.0	278.0	293.0					1																	150199026		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.595G>C	1.37:g.150199026C>G	ENSP00000324074:p.Asp199His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.D199H	ENST00000314136.8	37	c.595	CCDS946.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.009|9.009	0.981985|0.981985	0.18812|0.18812	.|.	.|.	ENSG00000143401|ENSG00000143401	ENST00000314136;ENST00000369119;ENST00000369116;ENST00000436748;ENST00000534437;ENST00000369115;ENST00000534220|ENST00000533654	T;T;T|T	0.00314|0.00318	8.14;8.14;8.14|8.12	4.14|4.14	3.21|3.21	0.36854|0.36854	.|.	0.976515|.	0.08357|.	N|.	0.958318|.	T|T	0.00039|0.00039	0.0001|0.0001	N|N	0.14661|0.14661	0.345|0.345	0.45427|0.45427	D|D	0.998401|0.998401	P;P;P|B	0.45176|0.09022	0.852;0.769;0.567|0.002	P;B;B|B	0.47915|0.06405	0.561;0.358;0.358|0.002	T|T	0.45585|0.45585	-0.9251|-0.9251	10|9	0.56958|0.41790	D|T	0.05|0.15	.|.	10.0827|10.0827	0.42399|0.42399	0.0:0.8944:0.0:0.1056|0.0:0.8944:0.0:0.1056	.|.	158;199;151|143	E9PEA6;Q9BTT0;Q5TB20|E9PLC4	.;AN32E_HUMAN;.|.	H|S	199;151;67;158;13;67;77|143	ENSP00000324074:D199H;ENSP00000358115:D151H;ENSP00000393718:D158H|ENSP00000435215:R143S	ENSP00000324074:D199H|ENSP00000435215:R143S	D|R	-|-	1|3	0|2	ANP32E|ANP32E	148465650|148465650	0.989000|0.989000	0.36119|0.36119	0.224000|0.224000	0.23877|0.23877	0.018000|0.018000	0.09664|0.09664	5.136000|5.136000	0.64783|0.64783	1.037000|1.037000	0.40024|0.40024	0.313000|0.313000	0.20887|0.20887	GAT|AGG	ANP32E	-	NULL	ENSG00000143401		0.463	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32E	HGNC	protein_coding	OTTHUMT00000035056.1	326	0.00	0	C	NM_030920		150199026	150199026	-1	no_errors	ENST00000314136	ensembl	human	known	69_37n	missense	549	26.80	201	SNP	0.992	G
ANXA9	8416	genome.wustl.edu	37	1	150967079	150967079	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:150967079G>A	ENST00000368947.4	+	13	1355	c.879G>A	c.(877-879)ctG>ctA	p.L293L		NM_003568.2	NP_003559.2	O76027	ANXA9_HUMAN	annexin A9	293					single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	acetylcholine receptor activity (GO:0015464)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylserine binding (GO:0001786)|phospholipid binding (GO:0005543)|protein homodimerization activity (GO:0042803)			endometrium(1)|large_intestine(1)|lung(4)|skin(2)	8	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACCAAGTCCTGATTCGCATCC	0.483																																						dbGAP											0													206.0	190.0	196.0					1																	150967079		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ009985	CCDS975.2	1q21.2	2008-02-05			ENSG00000143412	ENSG00000143412		"""Annexins"""	547	protein-coding gene	gene with protein product		603319		ANX31		9742942, 9931420	Standard	NM_003568		Approved		uc001ewa.2	O76027	OTTHUMG00000035063	ENST00000368947.4:c.879G>A	1.37:g.150967079G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZF1|Q6FI55|Q9BS00|Q9HBJ6	Silent	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinXXXI	p.L293	ENST00000368947.4	37	c.879	CCDS975.2	1																																																																																			ANXA9	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin	ENSG00000143412		0.483	ANXA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA9	HGNC	protein_coding	OTTHUMT00000084895.2	123	0.00	0	G	NM_003568		150967079	150967079	+1	no_errors	ENST00000368947	ensembl	human	known	69_37n	silent	188	16.07	36	SNP	0.987	A
AP2A1	160	genome.wustl.edu	37	19	50303369	50303369	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:50303369G>A	ENST00000359032.5	+	11	1417	c.1417G>A	c.(1417-1419)Gat>Aat	p.D473N	AP2A1_ENST00000354293.5_Missense_Mutation_p.D473N	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	473					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		CACCAACCGTGATGACGTCCA	0.587																																						dbGAP											0													78.0	88.0	85.0					19																	50303369		2162	4242	6404	-	-	-	SO:0001583	missense	0			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.1417G>A	19.37:g.50303369G>A	ENSP00000351926:p.Asp473Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96CI7|Q96PP6|Q96PP7|Q9H070	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.D473N	ENST00000359032.5	37	c.1417	CCDS46148.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.067018	0.93898	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	T;T	0.37584	1.19;1.19	4.65	4.65	0.58169	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.45836	0.1362	L	0.54323	1.7	0.80722	D	1	P;P	0.47841	0.559;0.901	B;P	0.50049	0.397;0.629	T	0.46775	-0.9167	10	0.56958	D	0.05	.	16.4522	0.83994	0.0:0.0:1.0:0.0	.	473;473	O95782-2;O95782	.;AP2A1_HUMAN	N	473	ENSP00000346246:D473N;ENSP00000351926:D473N	ENSP00000346246:D473N	D	+	1	0	AP2A1	54995181	1.000000	0.71417	0.701000	0.30321	0.984000	0.73092	9.575000	0.98187	2.400000	0.81607	0.462000	0.41574	GAT	AP2A1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu	ENSG00000196961		0.587	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1	33	0.00	0	G			50303369	50303369	+1	no_errors	ENST00000359032	ensembl	human	known	69_37n	missense	40	35.48	22	SNP	1.000	A
APBA2	321	genome.wustl.edu	37	15	29346361	29346361	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:29346361G>A	ENST00000558402.1	+	5	873	c.274G>A	c.(274-276)Gag>Aag	p.E92K	APBA2_ENST00000411764.1_Missense_Mutation_p.E92K|APBA2_ENST00000561069.1_Missense_Mutation_p.E92K|APBA2_ENST00000558259.1_Missense_Mutation_p.E92K|APBA2_ENST00000558330.1_Missense_Mutation_p.E92K			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	92	Poly-Glu.				in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		GGGCCTCCCTGAGGAGGAGGA	0.602																																						dbGAP											0													142.0	131.0	135.0					15																	29346361		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.274G>A	15.37:g.29346361G>A	ENSP00000453293:p.Glu92Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.E92K	ENST00000558402.1	37	c.274	CCDS10022.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.125981	0.94429	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.46451	0.87	5.06	5.06	0.68205	.	0.181870	0.45126	D	0.000399	T	0.53753	0.1816	M	0.66939	2.045	0.58432	D	0.999998	D;P;P	0.58268	0.982;0.9;0.9	P;B;B	0.50405	0.64;0.438;0.416	T	0.61058	-0.7139	10	0.87932	D	0	.	17.4303	0.87537	0.0:0.0:1.0:0.0	.	92;92;92	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	K	92	ENSP00000409312:E92K	ENSP00000219865:E92K	E	+	1	0	APBA2	27133653	1.000000	0.71417	0.899000	0.35326	0.943000	0.58893	8.886000	0.92447	2.320000	0.78422	0.650000	0.86243	GAG	APBA2	-	NULL	ENSG00000034053		0.602	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3	27	0.00	0	G	NM_005503		29346361	29346361	+1	no_errors	ENST00000558259	ensembl	human	known	69_37n	missense	11	45.00	9	SNP	1.000	A
APOB	338	genome.wustl.edu	37	2	21231201	21231201	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:21231201C>G	ENST00000233242.1	-	26	8666	c.8539G>C	c.(8539-8541)Gga>Cga	p.G2847R		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2847					artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATAGCATTTCCAAAAAACAGC	0.408																																						dbGAP											0													145.0	151.0	149.0					2																	21231201		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.8539G>C	2.37:g.21231201C>G	ENSP00000233242:p.Gly2847Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.G2847R	ENST00000233242.1	37	c.8539	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	10.82	1.458733	0.26248	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00776	5.71	5.36	2.58	0.30949	.	0.992451	0.08179	N	0.985808	T	0.01156	0.0038	L	0.46885	1.475	0.21915	N	0.999476	B	0.24533	0.105	B	0.22880	0.042	T	0.48547	-0.9026	10	0.41790	T	0.15	.	9.5104	0.39074	0.0:0.7069:0.0:0.2931	.	2847	P04114	APOB_HUMAN	R	2847	ENSP00000233242:G2847R	ENSP00000233242:G2847R	G	-	1	0	APOB	21084706	0.000000	0.05858	0.001000	0.08648	0.763000	0.43281	0.673000	0.25203	0.251000	0.21505	0.555000	0.69702	GGA	APOB	-	NULL	ENSG00000084674		0.408	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	82	0.00	0	C			21231201	21231201	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	44	40.00	30	SNP	0.003	G
ARFGEF2	10564	genome.wustl.edu	37	20	47621682	47621682	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:47621682G>A	ENST00000371917.4	+	26	3508	c.3508G>A	c.(3508-3510)Gag>Aag	p.E1170K		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	1170					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			GAAGTTTCTTGAGAAGGGTGA	0.423																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)	dbGAP											0													189.0	184.0	186.0					20																	47621682		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.3508G>A	20.37:g.47621682G>A	ENSP00000360985:p.Glu1170Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.E1170K	ENST00000371917.4	37	c.3508	CCDS13411.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.791782	0.96945	.	.	ENSG00000124198	ENST00000371917	T	0.28895	1.59	5.86	5.86	0.93980	Domain of unknown function DUF1981, SEC7 associated (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.67859	0.2938	M	0.92880	3.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75001	-0.3471	10	0.87932	D	0	.	20.1722	0.98160	0.0:0.0:1.0:0.0	.	1170	Q9Y6D5	BIG2_HUMAN	K	1170	ENSP00000360985:E1170K	ENSP00000360985:E1170K	E	+	1	0	ARFGEF2	47055089	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.852000	0.99516	2.774000	0.95407	0.609000	0.83330	GAG	ARFGEF2	-	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	ENSG00000124198		0.423	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	123	0.00	0	G	NM_006420		47621682	47621682	+1	no_errors	ENST00000371917	ensembl	human	known	69_37n	missense	96	23.81	30	SNP	1.000	A
ARMC3	219681	genome.wustl.edu	37	10	23250863	23250863	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:23250863C>G	ENST00000298032.5	+	7	672	c.588C>G	c.(586-588)atC>atG	p.I196M	ARMC3_ENST00000409049.3_Missense_Mutation_p.I196M|ARMC3_ENST00000409983.3_Missense_Mutation_p.I196M|ARMC3_ENST00000376528.4_Intron	NM_173081.3	NP_775104.2	Q5W041	ARMC3_HUMAN	armadillo repeat containing 3	196						extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(24)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						TACCTCCTATCTTAGATCTCT	0.353																																						dbGAP											0													102.0	99.0	100.0					10																	23250863		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057389	CCDS7142.1, CCDS60499.1, CCDS60500.1, CCDS73073.1	10p12.31	2013-02-14			ENSG00000165309	ENSG00000165309		"""Armadillo repeat containing"""	30964	protein-coding gene	gene with protein product	"""cancer/testis antigen 81"""	611226					Standard	XM_005252380		Approved	FLJ32827, CT81	uc001irm.4	Q5W041	OTTHUMG00000017811	ENST00000298032.5:c.588C>G	10.37:g.23250863C>G	ENSP00000298032:p.Ile196Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PG76|A6NH64|B4DZL3|B7ZBN6|B7ZBN7|Q8IXS5|Q8N7B0|Q96M49	Missense_Mutation	SNP	pfam_Armadillo,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.I196M	ENST00000298032.5	37	c.588	CCDS7142.1	10	.	.	.	.	.	.	.	.	.	.	C	5.781	0.328394	0.10956	.	.	ENSG00000165309	ENST00000298032;ENST00000409983;ENST00000409049;ENST00000447081	T;T;T;T	0.52983	0.64;0.64;2.12;0.65	5.73	-5.69	0.02428	Armadillo-like helical (1);Armadillo-type fold (1);	0.414587	0.26662	N	0.023159	T	0.35008	0.0917	L	0.51422	1.61	0.35839	D	0.825918	B;B	0.28055	0.056;0.199	B;B	0.30782	0.097;0.12	T	0.05616	-1.0874	10	0.33940	T	0.23	-5.7271	10.734	0.46113	0.2189:0.2204:0.5607:0.0	.	196;196	Q5W041-4;Q5W041	.;ARMC3_HUMAN	M	196;196;196;108	ENSP00000298032:I196M;ENSP00000386943:I196M;ENSP00000387288:I196M;ENSP00000396629:I108M	ENSP00000298032:I196M	I	+	3	3	ARMC3	23290869	0.988000	0.35896	0.000000	0.03702	0.056000	0.15407	0.192000	0.17096	-1.471000	0.01886	-0.969000	0.02612	ATC	ARMC3	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000165309		0.353	ARMC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARMC3	HGNC	protein_coding	OTTHUMT00000047197.2	91	0.00	0	C	NM_173081		23250863	23250863	+1	no_errors	ENST00000298032	ensembl	human	known	69_37n	missense	67	28.72	27	SNP	0.011	G
ASPRV1	151516	genome.wustl.edu	37	2	70187836	70187836	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:70187836C>T	ENST00000320256.4	-	1	1561	c.985G>A	c.(985-987)Gag>Aag	p.E329K	PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						GGGTCCTCCTCTATGAGCTCC	0.547																																						dbGAP											0													93.0	97.0	96.0					2																	70187836		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.985G>A	2.37:g.70187836C>T	ENSP00000315383:p.Glu329Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_aspartic_euk-pred,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic,pfscan_Peptidase_A2_cat	p.E329K	ENST00000320256.4	37	c.985	CCDS1897.1	2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.500455	0.85176	.	.	ENSG00000244617	ENST00000320256	T	0.63580	-0.05	5.38	5.38	0.77491	.	0.000000	0.36628	N	0.002494	T	0.67202	0.2868	N	0.24115	0.695	0.36318	D	0.858067	D	0.76494	0.999	D	0.78314	0.991	T	0.73455	-0.3977	10	0.49607	T	0.09	-22.5573	14.6246	0.68611	0.0:1.0:0.0:0.0	.	329	Q53RT3	APRV1_HUMAN	K	329	ENSP00000315383:E329K	ENSP00000315383:E329K	E	-	1	0	ASPRV1	70041340	1.000000	0.71417	0.998000	0.56505	0.976000	0.68499	3.645000	0.54389	2.530000	0.85305	0.655000	0.94253	GAG	ASPRV1	-	NULL	ENSG00000244617		0.547	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPRV1	HGNC	protein_coding	OTTHUMT00000334161.1	55	0.00	0	C	NM_152792		70187836	70187836	-1	no_errors	ENST00000320256	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	0.996	T
ASPRV1	151516	genome.wustl.edu	37	2	70188183	70188183	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:70188183G>A	ENST00000320256.4	-	1	1214	c.638C>T	c.(637-639)tCt>tTt	p.S213F	PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						CTGGGCCCCAGAGTCCACCAG	0.567																																						dbGAP											0													83.0	85.0	84.0					2																	70188183		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647	ENST00000320256.4:c.638C>T	2.37:g.70188183G>A	ENSP00000315383:p.Ser213Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_aspartic_euk-pred,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic,pfscan_Peptidase_A2_cat	p.S213F	ENST00000320256.4	37	c.638	CCDS1897.1	2	.	.	.	.	.	.	.	.	.	.	G	17.32	3.360848	0.61403	.	.	ENSG00000244617	ENST00000320256	T	0.60548	0.18	5.69	4.82	0.62117	Peptidase aspartic (1);Peptidase A2A, retrovirus, catalytic (1);Peptidase aspartic, eukaryotic predicted (1);	0.153093	0.30134	N	0.010340	T	0.40815	0.1132	N	0.14661	0.345	0.37020	D	0.896157	B	0.28552	0.215	B	0.29598	0.104	T	0.49969	-0.8882	10	0.87932	D	0	-12.7275	10.6118	0.45425	0.088:0.0:0.912:0.0	.	213	Q53RT3	APRV1_HUMAN	F	213	ENSP00000315383:S213F	ENSP00000315383:S213F	S	-	2	0	ASPRV1	70041687	1.000000	0.71417	0.887000	0.34795	0.891000	0.51852	5.082000	0.64450	1.409000	0.46915	-0.136000	0.14681	TCT	ASPRV1	-	pfam_Peptidase_aspartic_euk-pred,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic,pfscan_Peptidase_A2_cat	ENSG00000244617		0.567	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPRV1	HGNC	protein_coding	OTTHUMT00000334161.1	65	0.00	0	G	NM_152792		70188183	70188183	-1	no_errors	ENST00000320256	ensembl	human	known	69_37n	missense	27	38.64	17	SNP	0.954	A
ASTN2	23245	genome.wustl.edu	37	9	119625984	119625984	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:119625984C>G	ENST00000313400.4	-	11	2018	c.1918G>C	c.(1918-1920)Gaa>Caa	p.E640Q	ASTN2_ENST00000361209.2_Missense_Mutation_p.E589Q|ASTN2_ENST00000373996.3_Missense_Mutation_p.E636Q|ASTN2_ENST00000361477.3_5'UTR			O75129	ASTN2_HUMAN	astrotactin 2	640					negative regulation of protein localization to cell surface (GO:2000009)	cell pole (GO:0060187)|endosome (GO:0005768)|integral component of membrane (GO:0016021)				breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(21)|lung(45)|ovary(4)|pancreas(2)|prostate(2)|skin(9)|stomach(1)|urinary_tract(1)	102						TTGATGGTTTCAAAGTATGTG	0.468																																						dbGAP											0													111.0	88.0	96.0					9																	119625984		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116574	CCDS6814.1, CCDS6815.1, CCDS48009.1, CCDS48009.2, CCDS55334.1	9q33	2008-02-05			ENSG00000148219	ENSG00000148219			17021	protein-coding gene	gene with protein product		612856				9734811	Standard	NM_014010		Approved	KIAA0634	uc004bjt.2	O75129	OTTHUMG00000021013	ENST00000313400.4:c.1918G>C	9.37:g.119625984C>G	ENSP00000314038:p.Glu640Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2T7|A2A2T9|Q52LQ2|Q5JVX8|Q5JVX9|Q5JVY1|Q5VXG8|Q5VZX6|Q8N6P8|Q8WV47|Q96FL4|Q9UHW6	Missense_Mutation	SNP	pfam_MACPF,superfamily_Fibronectin_type3,smart_MACPF	p.E640Q	ENST00000313400.4	37	c.1918		9	.	.	.	.	.	.	.	.	.	.	C	22.2	4.263733	0.80358	.	.	ENSG00000148219	ENST00000313400;ENST00000373996;ENST00000373986;ENST00000361209	T;T;T;T	0.13538	2.75;2.75;2.58;2.78	5.71	5.71	0.89125	.	0.210329	0.42172	D	0.000749	T	0.22399	0.0540	N	0.19112	0.55	0.80722	D	1	P;P;D	0.61697	0.949;0.457;0.99	P;B;P	0.61201	0.6;0.287;0.885	T	0.02574	-1.1139	9	.	.	.	-15.7794	19.8381	0.96666	0.0:1.0:0.0:0.0	.	589;640;636	O75129-2;O75129;O75129-3	.;ASTN2_HUMAN;.	Q	640;636;363;589	ENSP00000314038:E640Q;ENSP00000363108:E636Q;ENSP00000363098:E363Q;ENSP00000354504:E589Q	.	E	-	1	0	ASTN2	118665805	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.452000	0.80683	2.690000	0.91761	0.655000	0.94253	GAA	ASTN2	-	NULL	ENSG00000148219		0.468	ASTN2-201	KNOWN	basic	protein_coding	ASTN2	HGNC	protein_coding		66	0.00	0	C	NM_014010		119625984	119625984	-1	no_errors	ENST00000313400	ensembl	human	known	69_37n	missense	44	33.33	22	SNP	1.000	G
ATG14	22863	genome.wustl.edu	37	14	55848870	55848870	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:55848870C>T	ENST00000247178.5	-	6	722	c.687G>A	c.(685-687)atG>atA	p.M229I		NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14	229					autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						TGCTGGAGGTCATGGCACTGT	0.507																																						dbGAP											0													128.0	111.0	117.0					14																	55848870		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.687G>A	14.37:g.55848870C>T	ENSP00000247178:p.Met229Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Missense_Mutation	SNP	pfam_UV_resistance/autophagy_Atg14	p.M229I	ENST00000247178.5	37	c.687	CCDS32087.1	14	.	.	.	.	.	.	.	.	.	.	c	14.76	2.632107	0.46944	.	.	ENSG00000126775	ENST00000247178	T	0.30448	1.53	5.63	5.63	0.86233	.	0.044345	0.85682	D	0.000000	T	0.20129	0.0484	N	0.08118	0	0.58432	D	0.999997	P	0.35033	0.481	B	0.36244	0.22	T	0.08310	-1.0728	10	0.19147	T	0.46	-24.5616	19.6815	0.95965	0.0:1.0:0.0:0.0	.	229	Q6ZNE5	BAKOR_HUMAN	I	229	ENSP00000247178:M229I	ENSP00000247178:M229I	M	-	3	0	ATG14	54918623	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.010000	0.49559	2.649000	0.89929	0.650000	0.86243	ATG	ATG14	-	pfam_UV_resistance/autophagy_Atg14	ENSG00000126775		0.507	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG14	HGNC	protein_coding	OTTHUMT00000416992.1	93	0.00	0	C	NM_014924		55848870	55848870	-1	no_errors	ENST00000247178	ensembl	human	known	69_37n	missense	59	23.38	18	SNP	1.000	T
ATN1	1822	genome.wustl.edu	37	12	7046168	7046168	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:7046168C>G	ENST00000356654.4	+	5	1975	c.1738C>G	c.(1738-1740)Caa>Gaa	p.Q580E	ATN1_ENST00000396684.2_Missense_Mutation_p.Q580E	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	580					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						TTCCACTTCTCAAGGGTCCTA	0.622																																						dbGAP											0													150.0	133.0	139.0					12																	7046168		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.1738C>G	12.37:g.7046168C>G	ENSP00000349076:p.Gln580Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.Q580E	ENST00000356654.4	37	c.1738	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	c	3.658	-0.070036	0.07228	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.56275	0.47;0.47;0.47	3.65	3.65	0.41850	.	0.256725	0.20247	U	0.096175	T	0.32041	0.0816	L	0.36672	1.1	0.35722	D	0.817259	P	0.38280	0.625	B	0.30782	0.12	T	0.28299	-1.0048	10	0.11485	T	0.65	.	6.9894	0.24748	0.1711:0.7355:0.0:0.0934	.	580	P54259	ATN1_HUMAN	E	580;580;580;165	ENSP00000349076:Q580E;ENSP00000379915:Q580E;ENSP00000441744:Q580E	ENSP00000229279:Q165E	Q	+	1	0	ATN1	6916429	0.704000	0.27836	1.000000	0.80357	0.158000	0.22134	1.422000	0.34826	2.039000	0.60335	0.586000	0.80456	CAA	ATN1	-	pfam_Atrophin-like	ENSG00000111676		0.622	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	38	0.00	0	C	NM_001940		7046168	7046168	+1	no_errors	ENST00000356654	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.996	G
ATP13A5	344905	genome.wustl.edu	37	3	193032846	193032846	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:193032846G>A	ENST00000342358.4	-	18	2190	c.2073C>T	c.(2071-2073)ctC>ctT	p.L691L	ATP13A5_ENST00000495496.1_5'Flank|ATP13A5-AS1_ENST00000414634.1_RNA	NM_198505.2	NP_940907.2	Q4VNC0	AT135_HUMAN	ATPase type 13A5	691						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(2)|breast(1)|endometrium(6)|kidney(4)|large_intestine(15)|liver(2)|lung(26)|ovary(5)|prostate(1)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76	all_cancers(143;1.08e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;5.56e-18)|LUSC - Lung squamous cell carcinoma(58;6.08e-06)|Lung(62;6.49e-06)	GBM - Glioblastoma multiforme(46;0.000307)		TCTCCATGATGAGAAGTCCCA	0.373																																						dbGAP											0													111.0	107.0	108.0					3																	193032846		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK122613	CCDS33914.1	3q29	2010-04-20			ENSG00000187527	ENSG00000187527		"""ATPases / P-type"""	31789	protein-coding gene	gene with protein product							Standard	NM_198505		Approved	FLJ16025	uc011bsq.2	Q4VNC0	OTTHUMG00000156101	ENST00000342358.4:c.2073C>T	3.37:g.193032846G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWS4|Q6ZWL0	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.L691	ENST00000342358.4	37	c.2073	CCDS33914.1	3																																																																																			ATP13A5	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_unknown-pump-sp	ENSG00000187527		0.373	ATP13A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A5	HGNC	protein_coding	OTTHUMT00000343012.1	70	0.00	0	G	NM_198505		193032846	193032846	-1	no_errors	ENST00000342358	ensembl	human	known	69_37n	silent	38	28.30	15	SNP	0.947	A
ATP2B3	492	genome.wustl.edu	37	X	152845591	152845591	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:152845591G>C	ENST00000349466.2	+	21	3824	c.3498G>C	c.(3496-3498)gaG>gaC	p.E1166D	ATP2B3_ENST00000359149.3_3'UTR|ATP2B3_ENST00000263519.4_Missense_Mutation_p.E1166D|ATP2B3_ENST00000370186.1_3'UTR|ATP2B3_ENST00000370181.2_3'UTR			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	1166					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					ACGTGGACGAGAACGAGGAGC	0.587																																						dbGAP											0													122.0	113.0	116.0					X																	152845591		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3498G>C	X.37:g.152845591G>C	ENSP00000343886:p.Glu1166Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.E1166D	ENST00000349466.2	37	c.3498	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	g	5.954	0.360062	0.11296	.	.	ENSG00000067842	ENST00000349466;ENST00000263519	D;D	0.93811	-3.29;-3.29	5.34	4.48	0.54585	.	0.194634	0.42548	D	0.000682	D	0.83207	0.5204	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.10450	0.005;0.002	T	0.74836	-0.3529	10	0.24483	T	0.36	-37.9383	8.0227	0.30419	0.0891:0.1563:0.7546:0.0	.	1152;1166	Q16720-4;Q16720	.;AT2B3_HUMAN	D	1166	ENSP00000343886:E1166D;ENSP00000263519:E1166D	ENSP00000263519:E1166D	E	+	3	2	ATP2B3	152498785	0.004000	0.15560	0.998000	0.56505	0.292000	0.27327	-0.617000	0.05584	1.020000	0.39573	-0.303000	0.09236	GAG	ATP2B3	-	NULL	ENSG00000067842		0.587	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1	24	0.00	0	G	NM_021949		152845591	152845591	+1	no_errors	ENST00000263519	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	C
ATP4B	496	genome.wustl.edu	37	13	114309253	114309253	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:114309253C>G	ENST00000335288.4	-	2	158	c.117G>C	c.(115-117)tgG>tgC	p.W39C		NM_000705.3	NP_000696.1	P51164	ATP4B_HUMAN	ATPase, H+/K+ exchanging, beta polypeptide	39					cell adhesion (GO:0007155)|hydrogen ion transmembrane transport (GO:1902600)|ion transmembrane transport (GO:0034220)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	hydrogen:potassium-exchanging ATPase activity (GO:0008900)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)			ACAGGCTGATCCACACTGCGA	0.557																																						dbGAP											0													172.0	122.0	139.0					13																	114309253		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9539.1	13q34	2011-08-01			ENSG00000186009	ENSG00000186009	3.6.3.10	"""ATPases / P-type"""	820	protein-coding gene	gene with protein product		137217				1330887, 15057823	Standard	NM_000705		Approved	ATP6B	uc001vtz.3	P51164	OTTHUMG00000140234	ENST00000335288.4:c.117G>C	13.37:g.114309253C>G	ENSP00000334216:p.Trp39Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0N8	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	p.W39C	ENST00000335288.4	37	c.117	CCDS9539.1	13	.	.	.	.	.	.	.	.	.	.	C	15.71	2.915005	0.52546	.	.	ENSG00000186009	ENST00000335288	T	0.29655	1.56	4.02	4.02	0.46733	.	0.232671	0.34603	N	0.003828	T	0.51363	0.1670	M	0.75447	2.3	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.49707	-0.8911	10	0.38643	T	0.18	-0.6757	11.478	0.50310	0.0:0.8172:0.1828:0.0	.	39	P51164	ATP4B_HUMAN	C	39	ENSP00000334216:W39C	ENSP00000334216:W39C	W	-	3	0	ATP4B	113357254	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.805000	0.47939	2.244000	0.73946	0.491000	0.48974	TGG	ATP4B	-	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	ENSG00000186009		0.557	ATP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4B	HGNC	protein_coding	OTTHUMT00000276703.2	32	0.00	0	C	NM_000705		114309253	114309253	-1	no_errors	ENST00000335288	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	G
ATP4B	496	genome.wustl.edu	37	13	114312444	114312444	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:114312444C>G	ENST00000335288.4	-	1	57	c.16G>C	c.(16-18)Gag>Cag	p.E6Q		NM_000705.3	NP_000696.1	P51164	ATP4B_HUMAN	ATPase, H+/K+ exchanging, beta polypeptide	6					cell adhesion (GO:0007155)|hydrogen ion transmembrane transport (GO:1902600)|ion transmembrane transport (GO:0034220)|response to lipopolysaccharide (GO:0032496)|response to organonitrogen compound (GO:0010243)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	hydrogen:potassium-exchanging ATPase activity (GO:0008900)			breast(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.171)			GTCTTCTTCTCCTGCAGAGCC	0.642																																						dbGAP											0													40.0	38.0	39.0					13																	114312444		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS9539.1	13q34	2011-08-01			ENSG00000186009	ENSG00000186009	3.6.3.10	"""ATPases / P-type"""	820	protein-coding gene	gene with protein product		137217				1330887, 15057823	Standard	NM_000705		Approved	ATP6B	uc001vtz.3	P51164	OTTHUMG00000140234	ENST00000335288.4:c.16G>C	13.37:g.114312444C>G	ENSP00000334216:p.Glu6Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0N8	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	p.E6Q	ENST00000335288.4	37	c.16	CCDS9539.1	13	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700336	0.48307	.	.	ENSG00000186009	ENST00000335288	T	0.32023	1.47	4.41	4.41	0.53225	.	0.066683	0.56097	D	0.000034	T	0.57858	0.2082	M	0.82323	2.585	0.43879	D	0.996493	D	0.89917	1.0	D	0.72075	0.976	T	0.62572	-0.6826	10	0.45353	T	0.12	-48.4716	15.954	0.79865	0.0:1.0:0.0:0.0	.	6	P51164	ATP4B_HUMAN	Q	6	ENSP00000334216:E6Q	ENSP00000334216:E6Q	E	-	1	0	ATP4B	113360445	1.000000	0.71417	1.000000	0.80357	0.150000	0.21749	5.897000	0.69831	2.265000	0.75225	0.555000	0.69702	GAG	ATP4B	-	pfam_ATPase_P-typ_cation-exchng_bsu,tigrfam_ATPase_P-typ_cation-exchng_bsu	ENSG00000186009		0.642	ATP4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP4B	HGNC	protein_coding	OTTHUMT00000276703.2	15	0.00	0	C	NM_000705		114312444	114312444	-1	no_errors	ENST00000335288	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	1.000	G
B3GNTL1	146712	genome.wustl.edu	37	17	80915078	80915078	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:80915078G>A	ENST00000320865.3	-	10	922	c.909C>T	c.(907-909)ttC>ttT	p.F303F	B3GNTL1_ENST00000576599.1_Silent_p.F192F	NM_001009905.1	NP_001009905.1	Q67FW5	B3GNL_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase-like 1	303							transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	8	Breast(20;0.000443)|all_neural(118;0.0779)	all_cancers(8;0.0396)|all_epithelial(8;0.0556)	BRCA - Breast invasive adenocarcinoma(99;0.0517)|OV - Ovarian serous cystadenocarcinoma(97;0.0868)			CGTGGCAATAGAAGCCTTTCC	0.632																																						dbGAP											0													183.0	166.0	172.0					17																	80915078		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY634364	CCDS32778.1	17q25.3	2013-02-22	2004-01-13	2004-01-14	ENSG00000175711	ENSG00000175711		"""Glycosyltransferase family 2 domain containing"""	21727	protein-coding gene	gene with protein product		615337					Standard	NM_001009905		Approved	B3GNT8	uc002kgg.1	Q67FW5	OTTHUMG00000177788	ENST00000320865.3:c.909C>T	17.37:g.80915078G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GV30|Q8WUT3	Silent	SNP	pfam_Glyco_trans_2	p.F303	ENST00000320865.3	37	c.909	CCDS32778.1	17																																																																																			B3GNTL1	-	NULL	ENSG00000175711		0.632	B3GNTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNTL1	HGNC	protein_coding	OTTHUMT00000438949.1	81	0.00	0	G	NM_001009905		80915078	80915078	-1	no_errors	ENST00000320865	ensembl	human	known	69_37n	silent	117	19.31	28	SNP	1.000	A
B4GALT5	9334	genome.wustl.edu	37	20	48256231	48256231	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:48256231C>G	ENST00000371711.4	-	7	1088	c.901G>C	c.(901-903)Gac>Cac	p.D301H		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	301	N-acetyl-D-glucosamine binding. {ECO:0000250}.				carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			CAGAGGTCGTCATCTTCTCCA	0.453																																						dbGAP											0													168.0	153.0	158.0					20																	48256231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.901G>C	20.37:g.48256231C>G	ENSP00000360776:p.Asp301His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P625|Q2M394|Q9UJQ8	Missense_Mutation	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.D301H	ENST00000371711.4	37	c.901	CCDS13420.1	20	.	.	.	.	.	.	.	.	.	.	C	27.0	4.794548	0.90453	.	.	ENSG00000158470	ENST00000371711	D	0.85702	-2.02	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.93825	0.8025	M	0.88704	2.975	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94447	0.7664	10	0.66056	D	0.02	-32.4262	19.2143	0.93770	0.0:1.0:0.0:0.0	.	301	O43286	B4GT5_HUMAN	H	301	ENSP00000360776:D301H	ENSP00000360776:D301H	D	-	1	0	B4GALT5	47689638	1.000000	0.71417	0.985000	0.45067	0.933000	0.57130	7.818000	0.86416	2.549000	0.85964	0.561000	0.74099	GAC	B4GALT5	-	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	ENSG00000158470		0.453	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT5	HGNC	protein_coding	OTTHUMT00000080543.3	61	0.00	0	C	NM_004776		48256231	48256231	-1	no_errors	ENST00000371711	ensembl	human	known	69_37n	missense	84	20.00	21	SNP	1.000	G
BAZ2B	29994	genome.wustl.edu	37	2	160176856	160176856	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:160176856C>T	ENST00000392783.2	-	37	6922	c.6427G>A	c.(6427-6429)Gat>Aat	p.D2143N	BAZ2B_ENST00000392782.1_Missense_Mutation_p.D2107N|BAZ2B_ENST00000355831.2_Missense_Mutation_p.D2109N|BAZ2B_ENST00000343439.5_Missense_Mutation_p.D2043N	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	2143	Bromo. {ECO:0000255|PROSITE- ProRule:PRU00035}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						ATATCAGAATCATCTTCATTA	0.328																																						dbGAP											0													79.0	71.0	73.0					2																	160176856		1822	4084	5906	-	-	-	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.6427G>A	2.37:g.160176856C>T	ENSP00000376534:p.Asp2143Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.D2143N	ENST00000392783.2	37	c.6427	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	C	10.22	1.291079	0.23564	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.20332	2.08;2.08;2.08;2.08	5.58	5.58	0.84498	Bromodomain (6);	0.000000	0.38164	U	0.001791	T	0.29256	0.0728	M	0.63169	1.94	0.44073	D	0.996825	B;B	0.23806	0.009;0.091	B;B	0.28139	0.022;0.086	T	0.03240	-1.1057	10	0.40728	T	0.16	-14.6658	19.5584	0.95363	0.0:1.0:0.0:0.0	.	2107;2143	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	N	2107;2143;2109;2043	ENSP00000376533:D2107N;ENSP00000376534:D2143N;ENSP00000348087:D2109N;ENSP00000339670:D2043N	ENSP00000339670:D2043N	D	-	1	0	BAZ2B	159885102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.888000	0.48594	2.618000	0.88619	0.655000	0.94253	GAT	BAZ2B	-	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	ENSG00000123636		0.328	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	112	0.00	0	C			160176856	160176856	-1	no_errors	ENST00000392783	ensembl	human	known	69_37n	missense	76	28.97	31	SNP	1.000	T
BTN3A2	11118	genome.wustl.edu	37	6	26368441	26368441	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:26368441C>T	ENST00000356386.2	+	3	219	c.31C>T	c.(31-33)Ctg>Ttg	p.L11L	BTN3A2_ENST00000377708.2_Silent_p.L11L|BTN3A2_ENST00000527422.1_Silent_p.L11L|BTN3A2_ENST00000396934.3_Intron|BTN3A2_ENST00000396948.1_Silent_p.L11L|BTN3A2_ENST00000508906.2_Intron|AL021917.1_ENST00000401160.1_RNA|BTN3A2_ENST00000532994.1_Intron	NM_001197246.2|NM_001197247.1|NM_007047.3	NP_001184175.1|NP_001184176.1|NP_008978.2	P78410	BT3A2_HUMAN	butyrophilin, subfamily 3, member A2	11					interferon-gamma secretion (GO:0072643)|T cell mediated immunity (GO:0002456)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(5)	10						GGCTTTCCTTCTGCTCAACTT	0.463																																						dbGAP											0													258.0	206.0	224.0					6																	26368441		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U90546	CCDS4605.1, CCDS56399.1, CCDS56400.1	6p22.1	2014-01-14			ENSG00000186470	ENSG00000186470		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1139	protein-coding gene	gene with protein product		613594				9149941	Standard	NM_007047		Approved	BTN3.2	uc010jqi.2	P78410	OTTHUMG00000014450	ENST00000356386.2:c.31C>T	6.37:g.26368441C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRT7|B4E103|F5H791|F8W6E0|O00477|O15338|O75658|Q76PA0|Q9BU81|Q9NR44	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L11	ENST00000356386.2	37	c.31	CCDS4605.1	6																																																																																			BTN3A2	-	NULL	ENSG00000186470		0.463	BTN3A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN3A2	HGNC	protein_coding	OTTHUMT00000040113.2	284	0.00	0	C			26368441	26368441	+1	no_errors	ENST00000356386	ensembl	human	known	69_37n	silent	324	30.02	139	SNP	0.000	T
BTNL9	153579	genome.wustl.edu	37	5	180477193	180477193	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:180477193G>C	ENST00000327705.9	+	4	791	c.560G>C	c.(559-561)aGa>aCa	p.R187T	BTNL9_ENST00000376842.3_Missense_Mutation_p.R187T|BTNL9_ENST00000376841.2_Missense_Mutation_p.R187T|BTNL9_ENST00000515271.1_Missense_Mutation_p.R118T	NM_152547.4	NP_689760.2	Q6UXG8	BTNL9_HUMAN	butyrophilin-like 9	187						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|kidney(4)|large_intestine(1)|lung(10)|ovary(1)	19	all_cancers(89;2.45e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTCAGTGGAGAGACCACCAG	0.582																																						dbGAP											0													101.0	98.0	99.0					5																	180477193		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057097	CCDS4460.2	5q35.3	2014-01-14			ENSG00000165810	ENSG00000165810		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	24176	protein-coding gene	gene with protein product							Standard	NM_152547		Approved	FLJ32535, BTN8	uc003mmt.3	Q6UXG8	OTTHUMG00000133152	ENST00000327705.9:c.560G>C	5.37:g.180477193G>C	ENSP00000330200:p.Arg187Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL42|Q6P660|Q96DM5	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.R187T	ENST00000327705.9	37	c.560	CCDS4460.2	5	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708613	0.48517	.	.	ENSG00000165810	ENST00000376841;ENST00000327705;ENST00000376842;ENST00000376850;ENST00000515271	T;T;T;T	0.05996	3.36;3.36;3.36;3.36	4.58	-3.56	0.04626	.	0.323849	0.22480	N	0.059506	T	0.08088	0.0202	M	0.69823	2.125	0.09310	N	1	P;P	0.40066	0.494;0.701	B;B	0.42959	0.224;0.403	T	0.08722	-1.0708	10	0.51188	T	0.08	.	5.8919	0.18917	0.5053:0.2618:0.2329:0.0	.	118;187	B7Z4Y8;Q6UXG8	.;BTNL9_HUMAN	T	187;187;187;187;118	ENSP00000366037:R187T;ENSP00000330200:R187T;ENSP00000366038:R187T;ENSP00000427345:R118T	ENSP00000330200:R187T	R	+	2	0	BTNL9	180409799	0.025000	0.19082	0.028000	0.17463	0.994000	0.84299	-0.419000	0.07071	-0.597000	0.05813	0.650000	0.86243	AGA	BTNL9	-	NULL	ENSG00000165810		0.582	BTNL9-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BTNL9	HGNC	protein_coding	OTTHUMT00000157342.3	36	0.00	0	G	NM_152547		180477193	180477193	+1	no_errors	ENST00000376842	ensembl	human	known	69_37n	missense	30	30.23	13	SNP	0.020	C
C15orf26	161502	genome.wustl.edu	37	15	81436030	81436030	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:81436030C>G	ENST00000286732.4	+	5	588	c.505C>G	c.(505-507)Ctc>Gtc	p.L169V		NM_173528.2	NP_775799.2	Q6P656	CO026_HUMAN	chromosome 15 open reading frame 26	169										endometrium(1)|kidney(4)|large_intestine(5)|lung(6)|skin(1)	17						CCACAGGACCCTCCTGAAATC	0.483																																						dbGAP											0													288.0	273.0	278.0					15																	81436030		1969	4154	6123	-	-	-	SO:0001583	missense	0			AK095934	CCDS42068.1	15q25.1	2012-09-10			ENSG00000156206	ENSG00000156206			26782	protein-coding gene	gene with protein product						14702039	Standard	NM_173528		Approved	FLJ38615	uc002bgb.3	Q6P656	OTTHUMG00000172263	ENST00000286732.4:c.505C>G	15.37:g.81436030C>G	ENSP00000286732:p.Leu169Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N906	Missense_Mutation	SNP	NULL	p.L169V	ENST00000286732.4	37	c.505	CCDS42068.1	15	.	.	.	.	.	.	.	.	.	.	C	10.28	1.306572	0.23736	.	.	ENSG00000156206	ENST00000286732;ENST00000398681	T	0.44881	0.91	4.79	1.69	0.24217	.	0.214939	0.43919	D	0.000514	T	0.40398	0.1115	M	0.77103	2.36	0.28472	N	0.915371	P	0.42941	0.794	B	0.43052	0.406	T	0.37842	-0.9688	10	0.49607	T	0.09	-0.1466	2.9558	0.05876	0.1912:0.468:0.0:0.3408	.	169	Q6P656	CO026_HUMAN	V	169;144	ENSP00000286732:L169V	ENSP00000286732:L169V	L	+	1	0	C15orf26	79223085	1.000000	0.71417	0.961000	0.40146	0.371000	0.29859	2.515000	0.45512	1.019000	0.39547	-0.156000	0.13503	CTC	C15orf26	-	NULL	ENSG00000156206		0.483	C15orf26-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	C15orf26	HGNC	protein_coding	OTTHUMT00000417587.1	101	0.00	0	C	NM_173528		81436030	81436030	+1	no_errors	ENST00000286732	ensembl	human	known	69_37n	missense	69	28.87	28	SNP	0.924	G
CACNA1F	778	genome.wustl.edu	37	X	49071937	49071937	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:49071937C>T	ENST00000376265.2	-	28	3397	c.3336G>A	c.(3334-3336)gaG>gaA	p.E1112E	CACNA1F_ENST00000376251.1_Silent_p.E1047E|CACNA1F_ENST00000323022.5_Silent_p.E1101E	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1112	Dihydropyridine binding. {ECO:0000250}.				axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	ACACTGAGATCTCCACACGGT	0.522																																						dbGAP											0													115.0	89.0	98.0					X																	49071937		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.3336G>A	X.37:g.49071937C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.E1112	ENST00000376265.2	37	c.3336	CCDS35253.1	X																																																																																			CACNA1F	-	pfam_Ion_trans_dom	ENSG00000102001		0.522	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	97	0.00	0	C	NM_005183		49071937	49071937	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	silent	91	32.59	44	SNP	0.997	T
CAMK4	814	genome.wustl.edu	37	5	110712636	110712636	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:110712636G>C	ENST00000282356.4	+	4	780	c.382G>C	c.(382-384)Gat>Cat	p.D128H	CAMK4_ENST00000512453.1_Missense_Mutation_p.D128H	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	128	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AGAACTGTTTGATAGGTGAGT	0.348																																						dbGAP											0													86.0	95.0	92.0					5																	110712636		2202	4300	6502	-	-	-	SO:0001583	missense	0			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.382G>C	5.37:g.110712636G>C	ENSP00000282356:p.Asp128His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSZ7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D128H	ENST00000282356.4	37	c.382	CCDS4103.1	5	.	.	.	.	.	.	.	.	.	.	G	24.5	4.535310	0.85812	.	.	ENSG00000152495	ENST00000508074;ENST00000512453;ENST00000282356	T;T;T	0.54866	0.86;0.55;0.55	5.97	5.97	0.96955	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.097493	0.64402	D	0.000002	T	0.73218	0.3559	M	0.77103	2.36	0.58432	D	0.999999	D	0.65815	0.995	D	0.63033	0.91	T	0.74990	-0.3475	10	0.87932	D	0	.	19.2729	0.94018	0.0:0.0:1.0:0.0	.	128	Q16566	KCC4_HUMAN	H	128	ENSP00000426940:D128H;ENSP00000422634:D128H;ENSP00000282356:D128H	ENSP00000282356:D128H	D	+	1	0	CAMK4	110740535	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.887000	0.87295	2.856000	0.98102	0.644000	0.83932	GAT	CAMK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000152495		0.348	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK4	HGNC	protein_coding	OTTHUMT00000250719.2	98	0.00	0	G	NM_001744		110712636	110712636	+1	no_errors	ENST00000282356	ensembl	human	known	69_37n	missense	36	34.55	19	SNP	1.000	C
CAMK4	814	genome.wustl.edu	37	5	110814119	110814119	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:110814119C>T	ENST00000282356.4	+	9	1140	c.742C>T	c.(742-744)Cag>Tag	p.Q248*	CAMK4_ENST00000512453.1_Nonsense_Mutation_p.Q248*	NM_001744.4	NP_001735.1	Q16566	KCC4_HUMAN	calcium/calmodulin-dependent protein kinase IV	248	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|long-term memory (GO:0007616)|myeloid dendritic cell differentiation (GO:0043011)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleocytoplasmic transport (GO:0006913)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of osteoclast differentiation (GO:0045670)|regulation of T cell differentiation in thymus (GO:0033081)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(13)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	30		all_cancers(142;1.49e-05)|all_epithelial(76;1.82e-07)|Prostate(80;0.00964)|all_lung(232;0.0181)|Lung NSC(167;0.0298)|Ovarian(225;0.0446)|Colorectal(57;0.0478)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;3.79e-08)|Epithelial(69;5.29e-08)|all cancers(49;1.1e-05)|COAD - Colon adenocarcinoma(37;0.109)		AAGAGGCGATCAGTTCATGTT	0.348																																						dbGAP											0													102.0	108.0	106.0					5																	110814119		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			D30742	CCDS4103.1	5q22.1	2012-09-20			ENSG00000152495	ENSG00000152495	2.7.11.17		1464	protein-coding gene	gene with protein product	"""brain Ca++-calmodulin-dependent protein kinase type IV"", ""calcium/calmodulin-dependent protein kinase type IV catalytic chain"", ""CAM kinase IV"", ""CAM kinase- GR"""	114080				2536634	Standard	NM_001744		Approved	CaMK-GR	uc003kpf.3	Q16566	OTTHUMG00000128792	ENST00000282356.4:c.742C>T	5.37:g.110814119C>T	ENSP00000282356:p.Gln248*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSZ7	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q248*	ENST00000282356.4	37	c.742	CCDS4103.1	5	.	.	.	.	.	.	.	.	.	.	C	40	8.395431	0.98791	.	.	ENSG00000152495	ENST00000512453;ENST00000282356	.	.	.	5.9	5.9	0.94986	.	0.057871	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	20.2704	0.98474	0.0:1.0:0.0:0.0	.	.	.	.	X	248	.	ENSP00000282356:Q248X	Q	+	1	0	CAMK4	110842018	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	7.411000	0.80078	2.793000	0.96121	0.591000	0.81541	CAG	CAMK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000152495		0.348	CAMK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK4	HGNC	protein_coding	OTTHUMT00000250719.2	76	0.00	0	C	NM_001744		110814119	110814119	+1	no_errors	ENST00000282356	ensembl	human	known	69_37n	nonsense	46	23.33	14	SNP	1.000	T
CAMKK2	10645	genome.wustl.edu	37	12	121693401	121693401	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:121693401C>T	ENST00000324774.5	-	9	1687	c.859G>A	c.(859-861)Gac>Aac	p.D287N	CAMKK2_ENST00000545538.1_Missense_Mutation_p.D74N|CAMKK2_ENST00000535524.1_Intron|CAMKK2_ENST00000538733.1_Missense_Mutation_p.D287N|CAMKK2_ENST00000337174.3_Missense_Mutation_p.D287N|CAMKK2_ENST00000404169.3_Missense_Mutation_p.D287N|CAMKK2_ENST00000392473.2_Missense_Mutation_p.D287N|CAMKK2_ENST00000347034.2_Missense_Mutation_p.D287N|CAMKK2_ENST00000402834.4_Missense_Mutation_p.D287N|CAMKK2_ENST00000446440.2_Missense_Mutation_p.D287N|CAMKK2_ENST00000392474.2_Missense_Mutation_p.D287N|CAMKK2_ENST00000412367.2_Missense_Mutation_p.D287N	NM_006549.3	NP_006540.3	Q96RR4	KKCC2_HUMAN	calcium/calmodulin-dependent protein kinase kinase 2, beta	287	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				calcium-mediated signaling (GO:0019722)|MAPK cascade (GO:0000165)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|protein tyrosine kinase activity (GO:0004713)			endometrium(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					CGGGCCTGGTCTTCAGAGAGT	0.562																																						dbGAP											0													75.0	70.0	72.0					12																	121693401		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF101264	CCDS9216.1, CCDS9217.1, CCDS9218.1, CCDS9219.1, CCDS44999.1, CCDS53837.1, CCDS58283.1	12q24.2	2002-08-13				ENSG00000110931			1470	protein-coding gene	gene with protein product		615002				9662074	Standard	NM_172226		Approved	CAMKK, KIAA0787, CAMKKB, MGC15254	uc001tzu.3	Q96RR4		ENST00000324774.5:c.859G>A	12.37:g.121693401C>T	ENSP00000312741:p.Asp287Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Q7|O94883|Q8IUG2|Q8IUG3|Q8N3I4|Q8WY03|Q8WY04|Q8WY05|Q8WY06|Q96RP1|Q96RP2|Q96RR3|Q9BWE9|Q9UER3|Q9UES2|Q9Y5N2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D287N	ENST00000324774.5	37	c.859	CCDS9216.1	12	.	.	.	.	.	.	.	.	.	.	C	21.3	4.131696	0.77662	.	.	ENSG00000110931	ENST00000392474;ENST00000347034;ENST00000538733;ENST00000337174;ENST00000324774;ENST00000545538;ENST00000412367;ENST00000404169;ENST00000360452;ENST00000446440;ENST00000392473	T;T;T;T;T;T;T;T;T;T	0.65549	-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16;-0.16	5.11	5.11	0.69529	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.50905	0.1643	N	0.10809	0.05	0.80722	D	1	B;B;P;B;B;P;P;P	0.37548	0.34;0.34;0.544;0.144;0.057;0.544;0.599;0.544	B;B;B;B;B;B;B;B	0.42062	0.17;0.108;0.17;0.054;0.07;0.343;0.374;0.17	T	0.60994	-0.7152	10	0.87932	D	0	5.92	17.5254	0.87799	0.0:1.0:0.0:0.0	.	287;287;287;74;287;287;287;287	Q96RR4-6;Q96RR4-2;Q96RR4-7;F5GZ00;Q96RR4-5;Q96RR4-4;Q96RR4;Q96RR4-3	.;.;.;.;.;.;KKCC2_HUMAN;.	N	287;287;287;287;287;74;287;287;270;287;287	ENSP00000376266:D287N;ENSP00000321230:D287N;ENSP00000445944:D287N;ENSP00000336634:D287N;ENSP00000312741:D287N;ENSP00000441352:D74N;ENSP00000388368:D287N;ENSP00000384600:D287N;ENSP00000388273:D287N;ENSP00000376265:D287N	ENSP00000312741:D287N	D	-	1	0	CAMKK2	120177784	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.294000	0.78760	2.368000	0.80403	0.655000	0.94253	GAC	CAMKK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000110931		0.562	CAMKK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMKK2	HGNC	protein_coding	OTTHUMT00000402563.1	58	0.00	0	C	NM_172226		121693401	121693401	-1	no_errors	ENST00000324774	ensembl	human	known	69_37n	missense	18	40.00	12	SNP	1.000	T
CAMSAP2	23271	genome.wustl.edu	37	1	200801337	200801337	+	Missense_Mutation	SNP	C	C	T	rs74466658	byFrequency	TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:200801337C>T	ENST00000236925.4	+	6	737	c.688C>T	c.(688-690)Cgg>Tgg	p.R230W	CAMSAP2_ENST00000413307.2_Missense_Mutation_p.R219W|CAMSAP2_ENST00000358823.2_Missense_Mutation_p.R219W			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	230	CH.				microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										GGCTCGTTATCGGAAAGAGCA	0.348																																						dbGAP											0													143.0	133.0	137.0					1																	200801337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.688C>T	1.37:g.200801337C>T	ENSP00000236925:p.Arg230Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.R230W	ENST00000236925.4	37	c.688		1	.	.	.	.	.	.	.	.	.	.	A	36	5.796955	0.96952	.	.	ENSG00000118200	ENST00000358823;ENST00000413307;ENST00000236925	T;T;T	0.26373	1.99;2.05;1.74	5.38	4.23	0.50019	Calponin homology domain (2);	0.000000	0.85682	D	0.000000	T	0.52549	0.1741	M	0.79693	2.465	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.995;0.987	T	0.55431	-0.8142	10	0.87932	D	0	-23.9516	13.268	0.60146	0.6246:0.3754:0.0:0.0	.	219;230;219	Q08AD1-2;Q08AD1;Q08AD1-3	.;CAMP2_HUMAN;.	W	219;219;230	ENSP00000351684:R219W;ENSP00000416800:R219W;ENSP00000236925:R230W	ENSP00000236925:R230W	R	+	1	2	CAMSAP1L1	199067960	1.000000	0.71417	0.998000	0.56505	0.973000	0.67179	3.223000	0.51231	0.471000	0.27319	-0.335000	0.08231	CGG	CAMSAP2	-	pfam_CH-domain,superfamily_CH-domain	ENSG00000118200		0.348	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	HGNC	protein_coding	OTTHUMT00000086956.2	115	0.00	0	C	NM_203459		200801337	200801337	+1	no_errors	ENST00000236925	ensembl	human	known	69_37n	missense	216	15.62	40	SNP	1.000	T
CAMTA2	23125	genome.wustl.edu	37	17	4872102	4872102	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:4872102C>T	ENST00000348066.3	-	23	3681	c.3558G>A	c.(3556-3558)ctG>ctA	p.L1186L	CAMTA2_ENST00000358183.4_Silent_p.L1179L|CAMTA2_ENST00000572543.1_Silent_p.L1191L|RP5-1050D4.3_ENST00000576752.1_RNA|SPAG7_ENST00000573366.1_5'Flank|CAMTA2_ENST00000381311.5_Silent_p.L1181L|SPAG7_ENST00000571023.1_5'Flank|CAMTA2_ENST00000414043.3_Missense_Mutation_p.E1209K|CAMTA2_ENST00000361571.5_Silent_p.L1185L|SPAG7_ENST00000206020.3_5'Flank|SPAG7_ENST00000575142.1_5'Flank	NM_015099.3	NP_055914.2	O94983	CMTA2_HUMAN	calmodulin binding transcription activator 2	1186					cardiac muscle hypertrophy in response to stress (GO:0014898)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	31						GGTTCTGCTTCAGTTCCCTCA	0.612																																						dbGAP											0													64.0	67.0	66.0					17																	4872102		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020716	CCDS11063.1, CCDS54071.1, CCDS54072.1, CCDS54073.1	17p13.3	2004-09-01			ENSG00000108509	ENSG00000108509			18807	protein-coding gene	gene with protein product		611508				11925432	Standard	NM_015099		Approved	KIAA0909	uc010cku.2	O94983	OTTHUMG00000099417	ENST00000348066.3:c.3558G>A	17.37:g.4872102C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGL0|D3DTL5|E7EWU5|Q7Z6M8|Q8N3V0|Q8NDG4|Q96G17	Missense_Mutation	SNP	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.E1209K	ENST00000348066.3	37	c.3625	CCDS11063.1	17	.	.	.	.	.	.	.	.	.	.	C	14.48	2.546911	0.45383	.	.	ENSG00000108509	ENST00000414043	T	0.12569	2.67	4.7	1.27	0.21489	.	.	.	.	.	T	0.08670	0.0215	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.16988	-1.0384	8	0.32370	T	0.25	1.0996	6.2993	0.21103	0.0:0.6614:0.1536:0.185	.	1209	E7EWU5	.	K	1209	ENSP00000412886:E1209K	ENSP00000412886:E1209K	E	-	1	0	CAMTA2	4812826	0.998000	0.40836	0.975000	0.42487	0.566000	0.35808	0.461000	0.21940	0.961000	0.38030	0.563000	0.77884	GAA	CAMTA2	-	NULL	ENSG00000108509		0.612	CAMTA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA2	HGNC	protein_coding	OTTHUMT00000216876.1	30	0.00	0	C	NM_015099		4872102	4872102	-1	no_errors	ENST00000414043	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	0.990	T
CAPN8	388743	genome.wustl.edu	37	1	223718144	223718144	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:223718144G>A	ENST00000366872.5	-	17	1835	c.1836C>T	c.(1834-1836)ctC>ctT	p.L612L				A6NHC0	CAN8_HUMAN	calpain 8	634	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						CTGCCTTCCTGAGGGCTGTCC	0.453																																						dbGAP											0													109.0	96.0	100.0					1																	223718144		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366872.5:c.1836C>T	1.37:g.223718144G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXL2	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.L612	ENST00000366872.5	37	c.1836		1																																																																																			CAPN8	-	NULL	ENSG00000203697		0.453	CAPN8-201	KNOWN	basic|appris_principal	protein_coding	CAPN8	HGNC	protein_coding		71	0.00	0	G	NM_001143962		223718144	223718144	-1	no_errors	ENST00000366872	ensembl	human	known	69_37n	silent	97	15.65	18	SNP	0.995	A
CATSPER2	117155	genome.wustl.edu	37	15	43939258	43939258	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:43939258C>T	ENST00000321596.5	-	4	577	c.378G>A	c.(376-378)atG>atA	p.M126I	CATSPER2_ENST00000354127.4_Missense_Mutation_p.M126I|CATSPER2_ENST00000464721.1_5'Flank|STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000396879.1_Missense_Mutation_p.M126I|CATSPER2_ENST00000355438.2_Missense_Mutation_p.M126I|CATSPER2_ENST00000381761.1_Missense_Mutation_p.M132I			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	126					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		CTATTTCAACCATCAATATGA	0.468																																						dbGAP											0													99.0	93.0	95.0					15																	43939258		2199	4296	6495	-	-	-	SO:0001583	missense	0			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.378G>A	15.37:g.43939258C>T	ENSP00000321463:p.Met126Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHT9|Q96P54|Q96P55	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.M126I	ENST00000321596.5	37	c.378	CCDS10099.1	15	.	.	.	.	.	.	.	.	.	.	C	11.00	1.510617	0.27036	.	.	ENSG00000166762	ENST00000396879;ENST00000299989;ENST00000381761;ENST00000321596;ENST00000354127;ENST00000355438	D;D;D;D;D	0.97186	-4.28;-4.28;-4.28;-4.28;-4.28	3.29	3.29	0.37713	.	1.003210	0.08037	U	0.994457	D	0.96962	0.9008	L	0.57536	1.79	0.30747	N	0.745505	D;P;B	0.60575	0.988;0.48;0.349	P;B;B	0.56216	0.794;0.132;0.062	D	0.93008	0.6429	10	0.27785	T	0.31	.	10.2911	0.43596	0.0:1.0:0.0:0.0	.	126;132;126	Q96P56-4;F8W9H2;Q96P56	.;.;CTSR2_HUMAN	I	126;126;132;126;126;126	ENSP00000380088:M126I;ENSP00000371180:M132I;ENSP00000321463:M126I;ENSP00000339137:M126I;ENSP00000347613:M126I	ENSP00000299989:M126I	M	-	3	0	CATSPER2	41726550	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	2.017000	0.40981	1.831000	0.53308	0.398000	0.26397	ATG	CATSPER2	-	NULL	ENSG00000166762		0.468	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	108	0.00	0	C	NM_054020		43939258	43939258	-1	no_errors	ENST00000299989	ensembl	human	known	69_37n	missense	79	27.52	30	SNP	1.000	T
CCDC132	55610	genome.wustl.edu	37	7	92979256	92979256	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:92979256G>T	ENST00000305866.5	+	25	2502	c.2374G>T	c.(2374-2376)Gaa>Taa	p.E792*	CCDC132_ENST00000541136.1_3'UTR|CCDC132_ENST00000535481.1_Nonsense_Mutation_p.E512*|CCDC132_ENST00000544910.1_Nonsense_Mutation_p.E762*|CCDC132_ENST00000474412.1_3'UTR	NM_017667.3	NP_060137.2	Q96JG6	CC132_HUMAN	coiled-coil domain containing 132	792						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				endometrium(1)|large_intestine(2)|lung(5)	8	all_cancers(62;2.64e-11)|all_epithelial(64;1.4e-10)|Breast(17;0.000675)|Lung NSC(181;0.0618)|all_lung(186;0.0837)		STAD - Stomach adenocarcinoma(171;0.000302)			CCTTGATTATGAACAGATGCT	0.363																																						dbGAP											0													105.0	101.0	102.0					7																	92979256		1893	4118	6011	-	-	-	SO:0001587	stop_gained	0			AL833112, AK055965, AL832393	CCDS5630.1, CCDS43617.1, CCDS59065.1	7q21.3	2007-07-23			ENSG00000004766	ENSG00000004766			25956	protein-coding gene	gene with protein product						11347906	Standard	NM_024553		Approved	KIAA1861, FLJ20097, DKFZp313I2429	uc003umo.4	Q96JG6	OTTHUMG00000131733	ENST00000305866.5:c.2374G>T	7.37:g.92979256G>T	ENSP00000307666:p.Glu792*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX22|D1MQ00|F5H5U7|Q75N07|Q8WVK3|Q9H5C6	Nonsense_Mutation	SNP	pfam_Vacuolar_sorting-assoc_54,pfam_DUF2451_C	p.E792*	ENST00000305866.5	37	c.2374	CCDS43617.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.728929|9.728929	0.99249|0.99249	.|.	.|.	ENSG00000004766|ENSG00000004766	ENST00000305866;ENST00000544910;ENST00000535481|ENST00000443443	.|.	.|.	.|.	5.37|5.37	5.37|5.37	0.77165|0.77165	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.39692|.	T|.	0.17|.	-13.7472|-13.7472	19.4953|19.4953	0.95070|0.95070	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	792;762;512|16	.|.	ENSP00000307666:E792X|.	E|X	+|+	1|2	0|2	CCDC132|CCDC132	92817192|92817192	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.837000|0.837000	0.47467|0.47467	9.738000|9.738000	0.98835|0.98835	2.697000|2.697000	0.92050|0.92050	0.585000|0.585000	0.79938|0.79938	GAA|TGA	CCDC132	-	pfam_DUF2451_C	ENSG00000004766		0.363	CCDC132-019	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC132	HGNC	protein_coding	OTTHUMT00000341687.1	104	0.00	0	G	NM_017667		92979256	92979256	+1	no_errors	ENST00000305866	ensembl	human	known	69_37n	nonsense	52	27.78	20	SNP	1.000	T
CCDC144CP	348254	genome.wustl.edu	37	17	18528419	18528419	+	IGR	SNP	C	C	G	rs376330472		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:18528419C>G								CCDC144B (18715 upstream) : TBC1D28 (9899 downstream)																							GCCATTACCTCTTCTTCCTAT	0.652																																						dbGAP											0													76.0	78.0	77.0					17																	18528419		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0																															17.37:g.18528419C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		17																																																																																			CCDC144B	-	-	ENSG00000154874	0	0.652					CCDC144B	HGNC			22	0.00	0	C			18528419	18528419	-1	no_errors	ENST00000450277	ensembl	human	known	69_37n	rna	18	25.00	6	SNP	0.009	G
CCDC169	728591	genome.wustl.edu	37	13	36805331	36805331	+	Nonstop_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:36805331C>G	ENST00000239859.7	-	8	675	c.644G>C	c.(643-645)tGa>tCa	p.*215S	CCDC169_ENST00000503173.1_Intron|CCDC169_ENST00000379862.2_Nonstop_Mutation_p.*113S|CCDC169_ENST00000491049.2_Intron|SOHLH2_ENST00000554962.1_Intron|CCDC169_ENST00000379864.2_Intron|CCDC169-SOHLH2_ENST00000511166.1_Intron|CCDC169_ENST00000239860.6_Intron|CCDC169_ENST00000510088.1_Nonstop_Mutation_p.*113S			A6NNP5	CC169_HUMAN	coiled-coil domain containing 169	0										breast(1)|endometrium(1)	2						GTTCTGGAATCATGGATGGAG	0.353																																						dbGAP											0													425.0	345.0	369.0					13																	36805331		692	1591	2283	-	-	-	SO:0001578	stop_lost	0				CCDS45027.1, CCDS45028.1, CCDS45029.1, CCDS53863.1, CCDS55897.1	13q13.3	2011-08-09	2011-08-09	2011-08-09	ENSG00000242715	ENSG00000242715			34361	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 38"""	C13orf38			Standard	NM_001144981		Approved	RP11-251J8.1, LOC728591		A6NNP5	OTTHUMG00000016731	ENST00000239859.7:c.644G>C	13.37:g.36805331C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC13|A6NCT2|B7ZW45|B7ZW49|B9EJF2|Q9H1T4|Q9H1T5	Nonstop_Mutation	SNP	NULL	p.*215S	ENST00000239859.7	37	c.644	CCDS45028.1	13	.	.	.	.	.	.	.	.	.	.	C	15.38	2.816665	0.50633	.	.	ENSG00000242715	ENST00000510088;ENST00000379862;ENST00000239859	.	.	.	4.94	2.19	0.27852	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.734	0.23399	0.0:0.6985:0.0:0.3015	.	.	.	.	S	113;113;215	.	.	X	-	2	2	CCDC169	35703331	0.948000	0.32251	0.876000	0.34364	0.977000	0.68977	0.576000	0.23744	0.342000	0.23796	0.650000	0.86243	TGA	CCDC169	-	NULL	ENSG00000242715		0.353	CCDC169-014	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC169	HGNC	protein_coding	OTTHUMT00000368255.1	193	0.00	0	C	NM_001144981		36805331	36805331	-1	no_errors	ENST00000239859	ensembl	human	known	69_37n	nonstop	130	29.73	55	SNP	0.944	G
CCDC60	160777	genome.wustl.edu	37	12	119960749	119960749	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:119960749G>A	ENST00000327554.2	+	10	1511	c.1046G>A	c.(1045-1047)aGa>aAa	p.R349K	RP11-768F21.1_ENST00000509470.2_lincRNA	NM_178499.3	NP_848594.2	Q8IWA6	CCD60_HUMAN	coiled-coil domain containing 60	349										endometrium(4)|kidney(3)|large_intestine(8)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.207)		TTCAGTGAGAGATCCAGCAGT	0.488																																						dbGAP											0													268.0	251.0	257.0					12																	119960749		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040553	CCDS9190.1	12q24.23	2006-02-03			ENSG00000183273	ENSG00000183273			28610	protein-coding gene	gene with protein product						12477932	Standard	NM_178499		Approved	MGC39827	uc001txe.3	Q8IWA6	OTTHUMG00000168943	ENST00000327554.2:c.1046G>A	12.37:g.119960749G>A	ENSP00000333374:p.Arg349Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R349K	ENST00000327554.2	37	c.1046	CCDS9190.1	12	.	.	.	.	.	.	.	.	.	.	G	3.634	-0.074953	0.07184	.	.	ENSG00000183273	ENST00000327554	T	0.20881	2.04	3.41	0.381	0.16228	.	0.504040	0.16922	N	0.194039	T	0.14227	0.0344	L	0.44542	1.39	0.09310	N	1	B	0.11235	0.004	B	0.13407	0.009	T	0.25117	-1.0141	9	.	.	.	-13.1479	5.2725	0.15632	0.4367:0.0:0.5633:0.0	.	349	Q8IWA6	CCD60_HUMAN	K	349	ENSP00000333374:R349K	.	R	+	2	0	CCDC60	118445132	0.020000	0.18652	0.024000	0.17045	0.787000	0.44495	0.614000	0.24314	0.074000	0.16767	0.563000	0.77884	AGA	CCDC60	-	NULL	ENSG00000183273		0.488	CCDC60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC60	HGNC	protein_coding	OTTHUMT00000401680.1	86	0.00	0	G	NM_178499		119960749	119960749	+1	no_errors	ENST00000327554	ensembl	human	known	69_37n	missense	69	29.59	29	SNP	0.030	A
CCDC88A	55704	genome.wustl.edu	37	2	55573390	55573390	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:55573390C>G	ENST00000436346.1	-	10	1803	c.962G>C	c.(961-963)aGa>aCa	p.R321T	CCDC88A_ENST00000263630.8_Missense_Mutation_p.R321T|CCDC88A_ENST00000413716.2_Missense_Mutation_p.R321T|CCDC88A_ENST00000336838.6_Missense_Mutation_p.R321T|AC012358.8_ENST00000594078.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	321					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						CTTATCGACTCTGACTGCTTT	0.353																																						dbGAP											0													163.0	155.0	158.0					2																	55573390		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.962G>C	2.37:g.55573390C>G	ENSP00000410608:p.Arg321Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_t-SNARE	p.R321T	ENST00000436346.1	37	c.962		2	.	.	.	.	.	.	.	.	.	.	C	27.6	4.847543	0.91277	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	5.26	5.26	0.73747	.	0.000000	0.50627	U	0.000111	T	0.78149	0.4238	M	0.81497	2.545	0.80722	D	1	D;D;D	0.76494	0.998;0.997;0.999	D;D;D	0.72625	0.978;0.928;0.948	T	0.81197	-0.1042	10	0.72032	D	0.01	-9.3304	18.8752	0.92332	0.0:1.0:0.0:0.0	.	321;321;321	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	T	321	ENSP00000338728:R321T;ENSP00000263630:R321T;ENSP00000410608:R321T;ENSP00000404431:R321T	ENSP00000263630:R321T	R	-	2	0	CCDC88A	55426894	1.000000	0.71417	0.993000	0.49108	0.979000	0.70002	7.420000	0.80191	2.453000	0.82957	0.655000	0.94253	AGA	CCDC88A	-	pfam_HOOK	ENSG00000115355		0.353	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		172	0.00	0	C	NM_017571		55573390	55573390	-1	no_errors	ENST00000436346	ensembl	human	known	69_37n	missense	106	27.89	41	SNP	1.000	G
CCDC88C	440193	genome.wustl.edu	37	14	91757388	91757388	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:91757388C>T	ENST00000389857.6	-	24	4239	c.4153G>A	c.(4153-4155)Gaa>Aaa	p.E1385K		NM_001080414.3	NP_001073883.2	Q9P219	DAPLE_HUMAN	coiled-coil domain containing 88C	1385					protein destabilization (GO:0031648)|protein homooligomerization (GO:0051260)|regulation of protein phosphorylation (GO:0001932)|Wnt signaling pathway (GO:0016055)		PDZ domain binding (GO:0030165)|protein self-association (GO:0043621)			central_nervous_system(3)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(6)|pancreas(1)|urinary_tract(1)	24		all_cancers(154;0.0468)				ATTTTTTCTTCCAGCTTTTCC	0.328																																						dbGAP											0													151.0	132.0	138.0					14																	91757388		1849	4083	5932	-	-	-	SO:0001583	missense	0				CCDS45151.1	14q32.12	2014-07-30	2007-05-31	2007-05-31		ENSG00000015133			19967	protein-coding gene	gene with protein product	"""Dvl-associating protein with a high frequency of leucine residues"", ""spinocerebellar ataxia 40"""	611204	"""KIAA1509"""	KIAA1509		17185515, 25062847	Standard	NM_001080414		Approved	DAPLE, HkRP2, SCA40	uc010aty.3	Q9P219		ENST00000389857.6:c.4153G>A	14.37:g.91757388C>T	ENSP00000374507:p.Glu1385Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK1|Q7L1M2|Q86SX7|Q8IYG8	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_Fum_Rdtase/Succ_DH_flav-like_C	p.E1385K	ENST00000389857.6	37	c.4153	CCDS45151.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.631611	0.96682	.	.	ENSG00000015133	ENST00000389857	T	0.60797	0.16	6.06	6.06	0.98353	.	0.127540	0.34628	U	0.003808	T	0.80116	0.4564	M	0.83118	2.625	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80804	-0.1219	10	0.72032	D	0.01	-22.2931	20.6244	0.99512	0.0:1.0:0.0:0.0	.	1385	Q9P219	DAPLE_HUMAN	K	1385	ENSP00000374507:E1385K	ENSP00000374507:E1385K	E	-	1	0	CCDC88C	90827141	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.800000	0.85949	2.879000	0.98667	0.650000	0.86243	GAA	CCDC88C	-	NULL	ENSG00000015133		0.328	CCDC88C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC88C	HGNC	protein_coding	OTTHUMT00000411650.1	203	0.00	0	C	XM_029353		91757388	91757388	-1	no_errors	ENST00000389857	ensembl	human	known	69_37n	missense	137	29.02	56	SNP	1.000	T
MCUR1	63933	genome.wustl.edu	37	6	13801535	13801535	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:13801535G>A	ENST00000379170.4	-	4	864	c.726C>T	c.(724-726)ctC>ctT	p.L242L		NM_001031713.3	NP_001026883.1	Q96AQ8	MCUR1_HUMAN	mitochondrial calcium uniporter regulator 1	242					calcium ion import (GO:0070509)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)	integral component of mitochondrial inner membrane (GO:0031305)											TTTCTGCTCTGAGGGCTGAAA	0.328																																						dbGAP											0													133.0	142.0	139.0					6																	13801535		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC016850	CCDS35495.1	6p23	2013-03-13	2013-03-13	2013-03-13	ENSG00000050393	ENSG00000050393			21097	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 79"", ""coiled-coil domain containing 90A"""	C6orf79, CCDC90A		23178883	Standard	NM_001031713		Approved	FLJ20958	uc003nbc.2	Q96AQ8	OTTHUMG00000014279	ENST00000379170.4:c.726C>T	6.37:g.13801535G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JS7|Q9H7F8	Silent	SNP	pfam_DUF1640	p.L242	ENST00000379170.4	37	c.726	CCDS35495.1	6																																																																																			CCDC90A	-	pfam_DUF1640	ENSG00000050393		0.328	MCUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC90A	HGNC	protein_coding	OTTHUMT00000039909.3	95	0.00	0	G	NM_022102		13801535	13801535	-1	no_errors	ENST00000379170	ensembl	human	known	69_37n	silent	80	25.93	28	SNP	0.998	A
CCNL2	81669	genome.wustl.edu	37	1	1328173	1328173	+	Intron	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:1328173C>T	ENST00000400809.3	-	5	665				CCNL2_ENST00000408952.5_5'UTR|CCNL2_ENST00000505849.1_5'Flank|CCNL2_ENST00000408918.4_Missense_Mutation_p.E224K	NM_030937.4	NP_112199.2	Q96S94	CCNL2_HUMAN	cyclin L2						regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)|ovary(2)|prostate(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;2.03e-36)|OV - Ovarian serous cystadenocarcinoma(86;4.17e-22)|Colorectal(212;0.000159)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.0023)|BRCA - Breast invasive adenocarcinoma(365;0.00465)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0342)|Lung(427;0.146)		CACTTACCCTCAGAGGCTACC	0.458																																						dbGAP											0													64.0	61.0	62.0					1																	1328173		2203	4296	6499	-	-	-	SO:0001627	intron_variant	0			AF251294	CCDS30557.1, CCDS30558.1	1p36.33	2014-07-03			ENSG00000221978	ENSG00000221978			20570	protein-coding gene	gene with protein product	"""cyclin S"""	613482	"""cyclin M"""	CCNM		14725631	Standard	NM_030937		Approved	ania-6b, PCEE, SB138, HLA-ISO, CCNS	uc001afi.2	Q96S94	OTTHUMG00000002917	ENST00000400809.3:c.659+602G>A	1.37:g.1328173C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8A3|B1B152|Q5T2N5|Q5T2N6|Q6IQ12|Q7Z4Z8|Q8N3C9|Q8N3D5|Q8NHE3|Q8TEL0|Q96B00	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_L	p.E224K	ENST00000400809.3	37	c.670	CCDS30557.1	1	.	.	.	.	.	.	.	.	.	.	C	17.50	3.404627	0.62288	.	.	ENSG00000221978	ENST00000408918	T	0.44482	0.92	5.78	5.78	0.91487	.	.	.	.	.	T	0.35566	0.0936	N	0.08118	0	0.80722	D	1	B;D	0.55605	0.012;0.972	B;P	0.49597	0.001;0.616	T	0.25398	-1.0133	9	0.39692	T	0.17	.	19.0006	0.92832	0.0:1.0:0.0:0.0	.	224;224	F2Z3J5;Q96S94-2	.;.	K	224	ENSP00000386158:E224K	ENSP00000386158:E224K	E	-	1	0	CCNL2	1318036	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.245000	0.72398	2.749000	0.94314	0.655000	0.94253	GAG	CCNL2	-	pirsf_Cyclin_L	ENSG00000221978		0.458	CCNL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNL2	HGNC	protein_coding	OTTHUMT00000008146.2	64	0.00	0	C	NM_030937		1328173	1328173	-1	no_errors	ENST00000481223	ensembl	human	known	69_37n	missense	16	66.67	32	SNP	1.000	T
CCT3	7203	genome.wustl.edu	37	1	156303431	156303431	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:156303431G>A	ENST00000295688.3	-	5	491	c.211C>T	c.(211-213)Caa>Taa	p.Q71*	CCT3_ENST00000368259.2_Nonsense_Mutation_p.Q33*|CCT3_ENST00000368261.3_Nonsense_Mutation_p.Q26*|CCT3_ENST00000472765.2_Nonsense_Mutation_p.Q26*|CCT3_ENST00000368256.3_5'UTR	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	71					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					TGCTGGACTTGAATCTAAAAA	0.448																																						dbGAP											0													97.0	96.0	96.0					1																	156303431		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.211C>T	1.37:g.156303431G>A	ENSP00000295688:p.Gln71*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE14|Q5SZY1|Q9BR64	Nonsense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_gamma	p.Q71*	ENST00000295688.3	37	c.211	CCDS1140.2	1	.	.	.	.	.	.	.	.	.	.	G	38	7.156683	0.98103	.	.	ENSG00000163468	ENST00000295688;ENST00000368259;ENST00000368261;ENST00000472765;ENST00000413555;ENST00000496684;ENST00000446905;ENST00000478640;ENST00000415548	.	.	.	5.62	4.69	0.59074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-11.2598	12.4564	0.55706	0.0:0.1684:0.8316:0.0	.	.	.	.	X	71;33;26;26;95;71;57;50;71	.	ENSP00000295688:Q71X	Q	-	1	0	CCT3	154570055	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	9.081000	0.94049	1.338000	0.45544	0.650000	0.86243	CAA	CCT3	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_gamma	ENSG00000163468		0.448	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	84	0.00	0	G	NM_005998		156303431	156303431	-1	no_errors	ENST00000295688	ensembl	human	known	69_37n	nonsense	140	16.17	27	SNP	1.000	A
CCT6P1	643253	genome.wustl.edu	37	7	65220808	65220808	+	RNA	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:65220808G>A	ENST00000442266.1	+	0	324				SNORA22_ENST00000383907.1_RNA					chaperonin containing TCP1, subunit 6 (zeta) pseudogene 1																		TTGAAGCTGTGAAGGAAAAGC	0.388																																						dbGAP											0																																										-	-	-			0			BC052238, BC073761		7q11.21	2010-06-29	2008-09-22	2008-09-22	ENSG00000228409	ENSG00000228409			33094	pseudogene	pseudogene			"""chaperonin containing TCP1, subunit 6A (zeta 1) pseudogene 1"""	CCT6AP1			Standard	NR_003110		Approved		uc003tug.3		OTTHUMG00000156733		7.37:g.65220808G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000442266.1	37	NULL		7																																																																																			CCT6P1	-	-	ENSG00000228409		0.388	CCT6P1-003	KNOWN	basic	processed_transcript	CCT6P1	HGNC	pseudogene	OTTHUMT00000345507.1	59	0.00	0	G	NR_003110		65220808	65220808	+1	no_errors	ENST00000442266	ensembl	human	known	69_37n	rna	41	37.88	25	SNP	0.973	A
CD3E	916	genome.wustl.edu	37	11	118179150	118179150	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:118179150G>A	ENST00000361763.4	+	4	370	c.79G>A	c.(79-81)Gaa>Aaa	p.E27K	CD3E_ENST00000528600.1_Missense_Mutation_p.E27K	NM_000733.3	NP_000724.1	P07766	CD3E_HUMAN	CD3e molecule, epsilon (CD3-TCR complex)	27					apoptotic signaling pathway (GO:0097190)|cell surface receptor signaling pathway (GO:0007166)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|negative regulation of smoothened signaling pathway (GO:0045879)|negative thymic T cell selection (GO:0045060)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of T cell anergy (GO:0002669)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|regulation of apoptotic process (GO:0042981)|regulation of immune response (GO:0050776)|response to nutrient (GO:0007584)|signal complex assembly (GO:0007172)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	alpha-beta T cell receptor complex (GO:0042105)|cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)|SH3 domain binding (GO:0017124)|T cell receptor binding (GO:0042608)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|ovary(2)|stomach(1)	8	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.09e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0251)	Muromonab(DB00075)	AGGTAATGAAGAAATGGGTAA	0.393																																						dbGAP											0													80.0	66.0	71.0					11																	118179150		2192	4293	6485	-	-	-	SO:0001583	missense	0			X03884	CCDS31685.1	11q23	2014-09-17	2006-03-28		ENSG00000198851	ENSG00000198851		"""CD molecules"""	1674	protein-coding gene	gene with protein product		186830	"""CD3e antigen, epsilon polypeptide (TiT3 complex)"""				Standard	NM_000733		Approved		uc001psq.4	P07766	OTTHUMG00000166968	ENST00000361763.4:c.79G>A	11.37:g.118179150G>A	ENSP00000354566:p.Glu27Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K997	Missense_Mutation	SNP	pfam_Phos_immunorcpt_sig_ITAM,smart_Ig_sub2,smart_Phos_immunorcpt_sig_ITAM,pfscan_Phos_immunorcpt_sig_ITAM	p.E27K	ENST00000361763.4	37	c.79	CCDS31685.1	11	.	.	.	.	.	.	.	.	.	.	G	11.28	1.591499	0.28357	.	.	ENSG00000198851	ENST00000361763;ENST00000528600	T;T	0.54675	0.56;0.59	4.19	0.081	0.14423	Immunoglobulin-like fold (1);	3.197390	0.00919	N	0.002561	T	0.34308	0.0893	N	0.17474	0.49	0.09310	N	1	P;B	0.37101	0.582;0.061	B;B	0.34722	0.188;0.026	T	0.15809	-1.0424	10	0.30078	T	0.28	.	4.1578	0.10270	0.2967:0.1715:0.5318:0.0	.	27;27	B4DVW0;P07766	.;CD3E_HUMAN	K	27	ENSP00000354566:E27K;ENSP00000433975:E27K	ENSP00000354566:E27K	E	+	1	0	CD3E	117684360	0.000000	0.05858	0.000000	0.03702	0.415000	0.31203	-1.268000	0.02836	0.027000	0.15297	0.561000	0.74099	GAA	CD3E	-	NULL	ENSG00000198851		0.393	CD3E-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD3E	HGNC	protein_coding	OTTHUMT00000392120.1	91	0.00	0	G	NM_000733		118179150	118179150	+1	no_errors	ENST00000361763	ensembl	human	known	69_37n	missense	25	41.86	18	SNP	0.000	A
CDC42BPB	9578	genome.wustl.edu	37	14	103466003	103466003	+	Silent	SNP	G	G	A	rs530983613		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:103466003G>A	ENST00000361246.2	-	5	783	c.495C>T	c.(493-495)ctC>ctT	p.L165L		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		CAAATTTGCTGAGCAGGGTCA	0.438													G|||	1	0.000199681	0.0	0.0	5008	,	,		20287	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													127.0	109.0	115.0					14																	103466003		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.495C>T	14.37:g.103466003G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.L165	ENST00000361246.2	37	c.495	CCDS9978.1	14																																																																																			CDC42BPB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198752		0.438	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	100	0.00	0	G	NM_006035		103466003	103466003	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	silent	76	19.15	18	SNP	1.000	A
CDH1	999	genome.wustl.edu	37	16	68849593	68849594	+	Frame_Shift_Ins	INS	-	-	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:68849593_68849594insG	ENST00000261769.5	+	10	1687_1688	c.1496_1497insG	c.(1495-1500)tttggcfs	p.FG499fs	CDH1_ENST00000422392.2_Frame_Shift_Ins_p.FG438fs|CDH1_ENST00000562836.1_3'UTR|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	499	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TCCGAGGACTTTGGCGTGGGCC	0.51			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	1	Unknown(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	Exception_encountered	16.37:g.68849593_68849594insG	ENSP00000261769:p.Phe499fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F499fs	ENST00000261769.5	37	c.1496_1497	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000039068		0.510	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	90	0.00	0	-	NM_004360		68849593	68849594	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	41	43.06	31	INS	0.962:0.001	G
CELSR2	1952	genome.wustl.edu	37	1	109813147	109813147	+	Nonsense_Mutation	SNP	G	G	T	rs532600168		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:109813147G>T	ENST00000271332.3	+	24	7469	c.7408G>T	c.(7408-7410)Gag>Tag	p.E2470*		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2470					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GGCACTCACTGAGGTGCGCGA	0.597																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													144.0	116.0	125.0					1																	109813147		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7408G>T	1.37:g.109813147G>T	ENSP00000271332:p.Glu2470*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E2470*	ENST00000271332.3	37	c.7408	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	49	15.746057	0.99844	.	.	ENSG00000143126	ENST00000271332	.	.	.	4.22	4.22	0.49857	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.186	0.86867	0.0:0.0:1.0:0.0	.	.	.	.	X	2470	.	ENSP00000271332:E2470X	E	+	1	0	CELSR2	109614670	1.000000	0.71417	0.990000	0.47175	0.993000	0.82548	6.494000	0.73661	2.350000	0.79820	0.555000	0.69702	GAG	CELSR2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000143126		0.597	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	68	0.00	0	G	NM_001408		109813147	109813147	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	nonsense	29	61.33	46	SNP	1.000	T
CELSR2	1952	genome.wustl.edu	37	1	109813628	109813628	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:109813628G>C	ENST00000271332.3	+	25	7624	c.7563G>C	c.(7561-7563)tgG>tgC	p.W2521C	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2521					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CGCTCATCTGGAGTTTTGCTG	0.637																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													151.0	140.0	144.0					1																	109813628		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7563G>C	1.37:g.109813628G>C	ENSP00000271332:p.Trp2521Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.W2521C	ENST00000271332.3	37	c.7563	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276165	0.80580	.	.	ENSG00000143126	ENST00000271332	T	0.58060	0.36	4.5	4.5	0.54988	GPCR, family 2-like (1);	.	.	.	.	T	0.80954	0.4723	H	0.97806	4.08	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88649	0.3181	9	0.87932	D	0	.	17.3855	0.87414	0.0:0.0:1.0:0.0	.	2521	Q9HCU4	CELR2_HUMAN	C	2521	ENSP00000271332:W2521C	ENSP00000271332:W2521C	W	+	3	0	CELSR2	109615151	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.584000	0.98220	2.329000	0.79093	0.491000	0.48974	TGG	CELSR2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000143126		0.637	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	56	0.00	0	G	NM_001408		109813628	109813628	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	22	58.49	31	SNP	1.000	C
CELSR2	1952	genome.wustl.edu	37	1	109813902	109813902	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:109813902G>C	ENST00000271332.3	+	26	7721	c.7660G>C	c.(7660-7662)Gag>Cag	p.E2554Q	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2554					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GCAGGGCTTTGAGAAGAAAGG	0.637																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													82.0	92.0	89.0					1																	109813902		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7660G>C	1.37:g.109813902G>C	ENSP00000271332:p.Glu2554Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E2554Q	ENST00000271332.3	37	c.7660	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.113938	0.77210	.	.	ENSG00000143126	ENST00000271332	T	0.44482	0.92	4.69	4.69	0.59074	GPCR, family 2-like (1);	.	.	.	.	T	0.53834	0.1821	M	0.69185	2.1	0.46279	D	0.998967	D	0.71674	0.998	D	0.74674	0.984	T	0.49153	-0.8969	9	0.32370	T	0.25	.	17.4056	0.87472	0.0:0.0:1.0:0.0	.	2554	Q9HCU4	CELR2_HUMAN	Q	2554	ENSP00000271332:E2554Q	ENSP00000271332:E2554Q	E	+	1	0	CELSR2	109615425	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.091000	0.50199	2.434000	0.82447	0.561000	0.74099	GAG	CELSR2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000143126		0.637	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	44	0.00	0	G	NM_001408		109813902	109813902	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	11	67.65	23	SNP	1.000	C
CELSR3	1951	genome.wustl.edu	37	3	48694738	48694738	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:48694738G>A	ENST00000164024.4	-	2	4072	c.3792C>T	c.(3790-3792)gtC>gtT	p.V1264V	CELSR3_ENST00000544264.1_Silent_p.V1264V	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1264	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		CCGTGATGATGACCACGCGCA	0.672																																						dbGAP											0													31.0	26.0	28.0					3																	48694738		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3792C>T	3.37:g.48694738G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75092	Silent	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V1264	ENST00000164024.4	37	c.3792	CCDS2775.1	3																																																																																			CELSR3	-	superfamily_Cadherin-like,smart_Cadherin	ENSG00000008300		0.672	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	13	0.00	0	G	NM_001407		48694738	48694738	-1	no_errors	ENST00000544264	ensembl	human	known	69_37n	silent	12	36.84	7	SNP	1.000	A
CEP350	9857	genome.wustl.edu	37	1	179989616	179989616	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:179989616C>T	ENST00000367607.3	+	12	3125	c.2707C>T	c.(2707-2709)Cat>Tat	p.H903Y		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	903					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						CTGTGTATCTCATGCAACTTT	0.413																																						dbGAP											0													88.0	87.0	87.0					1																	179989616		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.2707C>T	1.37:g.179989616C>T	ENSP00000356579:p.His903Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.H903Y	ENST00000367607.3	37	c.2707	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	C	15.97	2.989164	0.53934	.	.	ENSG00000135837	ENST00000367607	T	0.22539	1.95	6.02	6.02	0.97574	.	0.000000	0.50627	D	0.000111	T	0.33556	0.0867	N	0.20986	0.625	0.58432	D	0.999997	D;D	0.89917	1.0;0.981	D;B	0.66716	0.946;0.439	T	0.01587	-1.1318	9	.	.	.	.	20.1358	0.98028	0.0:1.0:0.0:0.0	.	903;903	E7EU22;Q5VT06	.;CE350_HUMAN	Y	903	ENSP00000356579:H903Y	.	H	+	1	0	CEP350	178256239	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.838000	0.48199	2.865000	0.98341	0.655000	0.94253	CAT	CEP350	-	NULL	ENSG00000135837		0.413	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	62	0.00	0	C	NM_014810		179989616	179989616	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	89	13.59	14	SNP	1.000	T
CEP63	80254	genome.wustl.edu	37	3	134266255	134266255	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:134266255G>A	ENST00000337090.3	+	9	1181	c.1008G>A	c.(1006-1008)ttG>ttA	p.L336L	CEP63_ENST00000383229.3_Silent_p.L336L|CEP63_ENST00000332047.5_Intron|CEP63_ENST00000513612.2_Silent_p.L336L|CEP63_ENST00000606977.1_Silent_p.L336L|CEP63_ENST00000354446.3_Intron			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	336					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						TCTCCCAGTTGAATTTTACCC	0.438																																						dbGAP											0													135.0	125.0	129.0					3																	134266255		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.1008G>A	3.37:g.134266255G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Silent	SNP	NULL	p.L336	ENST00000337090.3	37	c.1008	CCDS3086.1	3																																																																																			CEP63	-	NULL	ENSG00000182923		0.438	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP63	HGNC	protein_coding	OTTHUMT00000470139.1	84	0.00	0	G	NM_025180		134266255	134266255	+1	no_errors	ENST00000337090	ensembl	human	known	69_37n	silent	55	24.66	18	SNP	0.998	A
CFTR	1080	genome.wustl.edu	37	7	117227866	117227866	+	Missense_Mutation	SNP	G	G	C	rs121909044		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:117227866G>C	ENST00000003084.6	+	12	1790	c.1658G>C	c.(1657-1659)cGa>cCa	p.R553P	CFTR_ENST00000454343.1_Missense_Mutation_p.R492P	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	553	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.		R -> Q (in CF).		cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	GGAGGTCAACGAGCAAGAATT	0.338									Cystic Fibrosis																													dbGAP											0			GRCh37	CM920161	CFTR	M	rs121909044						96.0	97.0	97.0					7																	117227866		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.1658G>C	7.37:g.117227866G>C	ENSP00000003084:p.Arg553Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.R553P	ENST00000003084.6	37	c.1658	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	G	22.2	4.263610	0.80358	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.94793	-3.52;-3.52;-3.52	5.27	4.39	0.52855	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.053253	0.64402	D	0.000001	D	0.98302	0.9437	H	0.97918	4.105	0.54753	D	0.999987	D	0.89917	1.0	D	0.87578	0.998	D	0.99364	1.0918	10	0.87932	D	0	-6.1718	14.4525	0.67394	0.0714:0.0:0.9286:0.0	.	553	P13569	CFTR_HUMAN	P	553;492;523	ENSP00000003084:R553P;ENSP00000403677:R492P;ENSP00000389119:R523P	ENSP00000003084:R553P	R	+	2	0	CFTR	117015102	1.000000	0.71417	0.987000	0.45799	0.991000	0.79684	4.487000	0.60293	1.358000	0.45922	0.655000	0.94253	CGA	CFTR	-	pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_cAMP_cl_channel	ENSG00000001626		0.338	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	98	0.00	0	G	NM_000492		117227866	117227866	+1	no_errors	ENST00000003084	ensembl	human	known	69_37n	missense	50	32.43	24	SNP	1.000	C
CFTR	1080	genome.wustl.edu	37	7	117251828	117251828	+	Missense_Mutation	SNP	C	C	G	rs144135742		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:117251828C>G	ENST00000003084.6	+	20	3465	c.3333C>G	c.(3331-3333)ttC>ttG	p.F1111L	CFTR_ENST00000454343.1_Missense_Mutation_p.F1050L|AC000111.6_ENST00000456270.1_RNA	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	1111	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TCATCTTCTTCATTGCTGTTA	0.338									Cystic Fibrosis																													dbGAP											0													101.0	88.0	93.0					7																	117251828		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.3333C>G	7.37:g.117251828C>G	ENSP00000003084:p.Phe1111Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Nonsense_Mutation	SNP	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,prints_CysFib_conduc_TM,pfscan_ABC_transporter_type1	p.S53*	ENST00000003084.6	37	c.158	CCDS5773.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.2|22.2	4.252337|4.252337	0.80135|0.80135	.|.	.|.	ENSG00000001626|ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809|ENST00000468795	D;D;D|.	0.88818|.	-2.43;-2.43;-2.43|.	5.38|5.38	4.51|4.51	0.55191|0.55191	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.55970|.	0.1954|.	L|L	0.45422|0.45422	1.42|1.42	0.80722|0.80722	D|D	1|1	D|.	0.76494|.	0.999|.	D|.	0.83275|.	0.996|.	T|.	0.52845|.	-0.8521|.	10|.	0.22109|.	T|.	0.4|.	-19.7735|-19.7735	9.8107|9.8107	0.40822|0.40822	0.0:0.7844:0.0:0.2156|0.0:0.7844:0.0:0.2156	.|.	1111|.	P13569|.	CFTR_HUMAN|.	L|X	1111;1050;1081|53	ENSP00000003084:F1111L;ENSP00000403677:F1050L;ENSP00000389119:F1081L|.	ENSP00000003084:F1111L|.	F|S	+|+	3|2	2|0	CFTR|CFTR	117039064|117039064	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.621000|2.621000	0.46418|0.46418	1.416000|1.416000	0.47057|0.47057	0.650000|0.650000	0.86243|0.86243	TTC|TCA	CFTR	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,prints_CysFib_conduc_TM,pfscan_ABC_transporter_type1	ENSG00000001626		0.338	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	88	0.00	0	C	NM_000492		117251828	117251828	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000468795	ensembl	human	putative	69_37n	nonsense	60	29.41	25	SNP	1.000	G
CHIC1	53344	genome.wustl.edu	37	X	72783181	72783181	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:72783181G>A	ENST00000373502.5	+	1	138	c.61G>A	c.(61-63)Gag>Aag	p.E21K	CHIC1_ENST00000373504.6_Missense_Mutation_p.E21K|MAP2K4P1_ENST00000602584.1_RNA	NM_001039840.2	NP_001034929.2	Q5VXU3	CHIC1_HUMAN	cysteine-rich hydrophobic domain 1	21	Poly-Glu.					cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(1)|lung(2)	4	Renal(35;0.156)					GGAGGAGGAGGAGGAAGAAGA	0.622																																						dbGAP											0													29.0	14.0	19.0					X																	72783181		2065	4003	6068	-	-	-	SO:0001583	missense	0			Y11897	CCDS35335.2, CCDS75993.1	Xq13.2	2008-05-14			ENSG00000204116	ENSG00000204116			1934	protein-coding gene	gene with protein product		300922				9321471, 11257495	Standard	NM_001039840		Approved	BRX	uc004ebk.4	Q5VXU3	OTTHUMG00000021835	ENST00000373502.5:c.61G>A	X.37:g.72783181G>A	ENSP00000362601:p.Glu21Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJZ2|B0QZ87|B9EGS5|Q5CZ84	Missense_Mutation	SNP	pfam_Golgin_A_7/ERF4	p.E21K	ENST00000373502.5	37	c.61	CCDS35335.2	X	.	.	.	.	.	.	.	.	.	.	G	19.60	3.857595	0.71834	.	.	ENSG00000204116	ENST00000373502;ENST00000373504	.	.	.	4.4	4.4	0.53042	.	0.000000	0.85682	D	0.000000	T	0.33527	0.0866	N	0.08118	0	0.34476	D	0.703346	D;D;P	0.58268	0.982;0.969;0.948	B;P;B	0.46975	0.424;0.533;0.332	T	0.51911	-0.8645	9	0.45353	T	0.12	-22.6938	13.9177	0.63911	0.0:0.0:1.0:0.0	.	21;21;21	B7Z3I1;Q5VXU3-2;Q5VXU3	.;.;CHIC1_HUMAN	K	21	.	ENSP00000362601:E21K	E	+	1	0	CHIC1	72699906	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.129000	0.57957	1.943000	0.56356	0.422000	0.28245	GAG	CHIC1	-	NULL	ENSG00000204116		0.622	CHIC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIC1	HGNC	protein_coding	OTTHUMT00000057233.3	11	0.00	0	G			72783181	72783181	+1	no_errors	ENST00000373502	ensembl	human	known	69_37n	missense	12	27.78	5	SNP	1.000	A
CHRNA6	8973	genome.wustl.edu	37	8	42620327	42620327	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:42620327C>T	ENST00000276410.2	-	2	455	c.100G>A	c.(100-102)Gag>Aag	p.E34K	CHRNA6_ENST00000530869.1_5'UTR|CHRNA6_ENST00000534622.1_Missense_Mutation_p.E34K	NM_004198.3	NP_004189.1	Q15825	ACHA6_HUMAN	cholinergic receptor, nicotinic, alpha 6 (neuronal)	34					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|membrane depolarization (GO:0051899)|regulation of dopamine secretion (GO:0014059)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)			endometrium(2)|large_intestine(3)|liver(1)|lung(15)|ovary(1)	22	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00439)|Lung NSC(58;0.0124)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	Lung(22;0.0252)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)|Varenicline(DB01273)	AGCCTCTCCTCAGTTGCACAG	0.542																																						dbGAP											0													143.0	131.0	135.0					8																	42620327		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62435	CCDS6135.1, CCDS56536.1	8p22	2012-02-11	2012-02-07					"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	15963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 6 (neuronal)"""	606888	"""cholinergic receptor, nicotinic, alpha polypeptide 6"""			8906617	Standard	NM_004198		Approved		uc003xpj.3	Q15825		ENST00000276410.2:c.100G>A	8.37:g.42620327C>T	ENSP00000276410:p.Glu34Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V4|B4DQH1	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.E34K	ENST00000276410.2	37	c.100	CCDS6135.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.412960	0.96072	.	.	ENSG00000147434	ENST00000276410;ENST00000534622	T;T	0.80123	-1.34;-1.34	5.31	5.31	0.75309	Neurotransmitter-gated ion-channel ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.91848	0.7420	M	0.90705	3.14	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.997	D	0.92502	0.6009	10	0.54805	T	0.06	.	19.3428	0.94350	0.0:1.0:0.0:0.0	.	34;34	B4DQH1;Q15825	.;ACHA6_HUMAN	K	34	ENSP00000276410:E34K;ENSP00000433871:E34K	ENSP00000276410:E34K	E	-	1	0	CHRNA6	42739484	1.000000	0.71417	0.158000	0.22627	0.036000	0.12997	7.276000	0.78559	2.637000	0.89404	0.655000	0.94253	GAG	CHRNA6	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000147434		0.542	CHRNA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA6	HGNC	protein_coding	OTTHUMT00000383156.1	47	0.00	0	C			42620327	42620327	-1	no_errors	ENST00000276410	ensembl	human	known	69_37n	missense	36	29.41	15	SNP	0.998	T
CHTOP	26097	genome.wustl.edu	37	1	153617600	153617600	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:153617600G>A	ENST00000368694.3	+	6	914	c.602G>A	c.(601-603)cGa>cAa	p.R201Q	CHTOP_ENST00000368687.1_Missense_Mutation_p.R176Q|CHTOP_ENST00000403433.1_Missense_Mutation_p.R155Q|CHTOP_ENST00000495554.1_3'UTR|CHTOP_ENST00000368690.3_Missense_Mutation_p.R155Q	NM_001206612.1|NM_015607.3	NP_001193541.1|NP_056422.2	Q9Y3Y2	CHTOP_HUMAN	chromatin target of PRMT1	201	Arg/Gly-rich.|Interaction with PRMT1. {ECO:0000250}.				mRNA export from nucleus (GO:0006406)|positive regulation of ATPase activity (GO:0032781)|positive regulation of helicase activity (GO:0051096)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)|transcription export complex (GO:0000346)	poly(A) RNA binding (GO:0044822)	p.R201L(1)		endometrium(1)|kidney(2)|large_intestine(3)|liver(1)|lung(6)	13						GGCCGTGGACGAGGGAGAGGT	0.537																																						dbGAP											1	Substitution - Missense(1)	kidney(1)											95.0	99.0	98.0					1																	153617600		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1048.1, CCDS72917.1, CCDS72918.1	1q21.3	2011-03-24	2011-03-24	2011-03-24	ENSG00000160679	ENSG00000160679			24511	protein-coding gene	gene with protein product	"""small protein rich in arginine and glycine"", ""Friend of Prmt1"""	614206	"""chromosome 1 open reading frame 77"""	C1orf77		19254951	Standard	NM_015607		Approved	DKFZP547E1010, SRAG, FOP	uc001fcn.2	Q9Y3Y2	OTTHUMG00000037052	ENST00000368694.3:c.602G>A	1.37:g.153617600G>A	ENSP00000357683:p.Arg201Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV55|Q0VAQ8|Q2VPI9|Q5T7Y8|Q5T7Y9|Q5T7Z0|Q6NSM4|Q6PB28|Q8WYT9|Q9BUC5|Q9H034|Q9H2L0	Missense_Mutation	SNP	NULL	p.R201Q	ENST00000368694.3	37	c.602	CCDS1048.1	1	.	.	.	.	.	.	.	.	.	.	G	18.18	3.565704	0.65651	.	.	ENSG00000160679	ENST00000368694;ENST00000403433;ENST00000368690;ENST00000368687	D;D;D;D	0.95137	-2.35;-3.62;-3.62;-2.35	5.85	3.98	0.46160	.	0.057217	0.64402	D	0.000002	D	0.86351	0.5912	L	0.49513	1.565	0.53005	D	0.999969	P;P	0.38078	0.563;0.617	B;B	0.34536	0.116;0.185	D	0.84414	0.0567	10	0.38643	T	0.18	-12.1679	10.2799	0.43532	0.0743:0.1359:0.7898:0.0	.	202;201	Q9Y3Y2-3;Q9Y3Y2	.;CHTOP_HUMAN	Q	201;155;155;176	ENSP00000357683:R201Q;ENSP00000385228:R155Q;ENSP00000357679:R155Q;ENSP00000357676:R176Q	ENSP00000357676:R176Q	R	+	2	0	CHTOP	151884224	1.000000	0.71417	0.995000	0.50966	0.988000	0.76386	6.422000	0.73357	0.923000	0.37045	-0.149000	0.13747	CGA	CHTOP	-	NULL	ENSG00000160679		0.537	CHTOP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHTOP	HGNC	protein_coding	OTTHUMT00000089967.1	59	0.00	0	G	NM_015607		153617600	153617600	+1	no_errors	ENST00000368694	ensembl	human	known	69_37n	missense	95	13.64	15	SNP	1.000	A
CIRBP	1153	genome.wustl.edu	37	19	1271007	1271007	+	Silent	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:1271007C>G	ENST00000588030.1	+	2	335	c.75C>G	c.(73-75)gtC>gtG	p.V25V	CIRBP_ENST00000586472.1_Silent_p.V25V|CIRBP_ENST00000589235.1_Silent_p.V25V|CIRBP_ENST00000320936.5_Silent_p.V25V|CIRBP_ENST00000587896.1_Silent_p.V25V|CIRBP_ENST00000588230.1_Silent_p.V25V|CIRBP_ENST00000587323.1_Silent_p.V25V|CIRBP_ENST00000588090.1_Silent_p.V25V|CIRBP_ENST00000444172.2_Missense_Mutation_p.S8C|CIRBP_ENST00000586773.1_Silent_p.V25V|CIRBP_ENST00000585630.1_Silent_p.V25V|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000589710.1_Silent_p.V25V|CIRBP_ENST00000589686.1_Silent_p.V25V|CIRBP_ENST00000413636.2_Silent_p.V25V|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000589660.1_Silent_p.V25V|CIRBP_ENST00000591935.1_Silent_p.V25V			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein	25	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGGAGCAGGTCTTCTCAAAGT	0.582																																						dbGAP											0													152.0	156.0	155.0					19																	1271007		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.75C>G	19.37:g.1271007C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT17|B4E2X2	Missense_Mutation	SNP	NULL	p.S8C	ENST00000588030.1	37	c.23	CCDS12059.1	19	.	.	.	.	.	.	.	.	.	.	C	4.632	0.117516	0.08881	.	.	ENSG00000099622	ENST00000444172	.	.	.	4.6	-0.583	0.11706	.	.	.	.	.	T	0.43567	0.1253	.	.	.	0.23023	N	0.998419	.	.	.	.	.	.	T	0.46830	-0.9163	5	0.87932	D	0	-20.925	10.1863	0.43000	0.0:0.386:0.5318:0.0822	.	.	.	.	C	8	.	ENSP00000407512:S8C	S	+	2	0	CIRBP	1222007	0.002000	0.14202	0.483000	0.27378	0.006000	0.05464	-1.711000	0.01886	0.038000	0.15604	0.563000	0.77884	TCT	CIRBP	-	NULL	ENSG00000099622		0.582	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP	HGNC	protein_coding	OTTHUMT00000449969.1	110	0.00	0	C	NM_001280		1271007	1271007	+1	no_errors	ENST00000444172	ensembl	human	known	69_37n	missense	79	21.78	22	SNP	0.996	G
CLEC2A	387836	genome.wustl.edu	37	12	10066206	10066206	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:10066206C>G	ENST00000455827.1	-	5	535	c.484G>C	c.(484-486)Gat>Cat	p.D162H	CLEC2A_ENST00000339766.4_Intron	NM_001130711.1	NP_001124183.1	Q6UVW9	CLC2A_HUMAN	C-type lectin domain family 2, member A	162	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				natural killer cell mediated cytotoxicity (GO:0042267)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	4						CACTTGATATCAATAAATCCT	0.333																																						dbGAP											0													123.0	105.0	111.0					12																	10066206		692	1591	2283	-	-	-	SO:0001583	missense	0			AY359126	CCDS44829.1, CCDS8606.1	12p13.31	2010-06-30			ENSG00000188393	ENSG00000188393		"""C-type lectin domain containing"""	24191	protein-coding gene	gene with protein product	"""keratinocyte-associated C-type lectin"", ""proliferation-induced lymphocyte-associated receptor"""	612087				12975309	Standard	NM_001130711		Approved	UNQ5792, INPE5792, KACL, PILAR	uc009zhc.2	Q6UVW9	OTTHUMG00000140393	ENST00000455827.1:c.484G>C	12.37:g.10066206C>G	ENSP00000396163:p.Asp162His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5Y4G5|A9QKS2|A9QKS3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.D162H	ENST00000455827.1	37	c.484	CCDS44829.1	12	.	.	.	.	.	.	.	.	.	.	C	6.490	0.458630	0.12342	.	.	ENSG00000188393	ENST00000455827	T	0.16897	2.31	2.51	2.51	0.30379	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	.	.	.	.	T	0.12433	0.0302	L	0.41906	1.305	0.23809	N	0.996783	B	0.33345	0.409	B	0.27715	0.082	T	0.13710	-1.0499	9	0.33141	T	0.24	.	8.6312	0.33919	0.0:1.0:0.0:0.0	.	162	Q6UVW9	CLC2A_HUMAN	H	162	ENSP00000396163:D162H	ENSP00000396163:D162H	D	-	1	0	CLEC2A	9957473	0.001000	0.12720	0.907000	0.35723	0.745000	0.42441	0.431000	0.21444	1.719000	0.51432	0.313000	0.20887	GAT	CLEC2A	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000188393		0.333	CLEC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC2A	HGNC	protein_coding	OTTHUMT00000399919.1	115	0.00	0	C	NM_207375		10066206	10066206	-1	no_errors	ENST00000455827	ensembl	human	known	69_37n	missense	64	31.91	30	SNP	0.930	G
CLIP2	7461	genome.wustl.edu	37	7	73771716	73771716	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:73771716G>A	ENST00000395060.1	+	5	1124	c.1124G>A	c.(1123-1125)cGa>cAa	p.R375Q	CLIP2_ENST00000223398.6_Missense_Mutation_p.R375Q|CLIP2_ENST00000361545.5_Missense_Mutation_p.R375Q			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	375						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CTGGCTGAACGAGACCTGGAA	0.612																																						dbGAP											0													50.0	34.0	39.0					7																	73771716		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.1124G>A	7.37:g.73771716G>A	ENSP00000378500:p.Arg375Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O14527|O43611	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.R375Q	ENST00000395060.1	37	c.1124	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	G	32	5.164236	0.94727	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.65549	-0.08;-0.16;-0.08	4.83	4.83	0.62350	.	0.000000	0.85682	D	0.000000	T	0.81327	0.4799	M	0.85945	2.785	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.992	D	0.84709	0.0733	10	0.87932	D	0	-26.979	16.6549	0.85225	0.0:0.0:1.0:0.0	.	375;375	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	Q	375	ENSP00000223398:R375Q;ENSP00000355151:R375Q;ENSP00000378500:R375Q	ENSP00000223398:R375Q	R	+	2	0	CLIP2	73409652	1.000000	0.71417	0.953000	0.39169	0.875000	0.50365	9.337000	0.96545	2.507000	0.84556	0.561000	0.74099	CGA	CLIP2	-	NULL	ENSG00000106665		0.612	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	HGNC	protein_coding	OTTHUMT00000252556.1	10	0.00	0	G	NM_003388		73771716	73771716	+1	no_errors	ENST00000223398	ensembl	human	known	69_37n	missense	3	57.14	4	SNP	1.000	A
CLU	1191	genome.wustl.edu	37	8	27457503	27457503	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:27457503G>A	ENST00000316403.10	-	7	1363	c.958C>T	c.(958-960)Cag>Tag	p.Q320*	CLU_ENST00000560366.1_Nonsense_Mutation_p.Q372*|CLU_ENST00000523500.1_Nonsense_Mutation_p.Q320*|CLU_ENST00000405140.3_Nonsense_Mutation_p.Q320*|CLU_ENST00000546343.1_Nonsense_Mutation_p.Q331*			P10909	CLUS_HUMAN	clusterin	320					blood coagulation (GO:0007596)|cell morphogenesis (GO:0000902)|central nervous system myelin maintenance (GO:0032286)|chaperone-mediated protein complex assembly (GO:0051131)|chaperone-mediated protein folding (GO:0061077)|complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|lipid metabolic process (GO:0006629)|microglial cell activation (GO:0001774)|microglial cell proliferation (GO:0061518)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of protein homooligomerization (GO:0032463)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of apoptotic process (GO:0043065)|positive regulation of beta-amyloid formation (GO:1902004)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of neurofibrillary tangle assembly (GO:1902998)|positive regulation of neuron death (GO:1901216)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of tau-protein kinase activity (GO:1902949)|positive regulation of tumor necrosis factor production (GO:0032760)|protein import (GO:0017038)|protein stabilization (GO:0050821)|regulation of beta-amyloid clearance (GO:1900221)|regulation of neuron death (GO:1901214)|regulation of neuronal signal transduction (GO:1902847)|release of cytochrome c from mitochondria (GO:0001836)|response to misfolded protein (GO:0051788)|response to virus (GO:0009615)|reverse cholesterol transport (GO:0043691)	apical dendrite (GO:0097440)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|neurofibrillary tangle (GO:0097418)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|spherical high-density lipoprotein particle (GO:0034366)	misfolded protein binding (GO:0051787)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)	21		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0204)|Colorectal(74;0.132)		AGCTTAGCCTGGGAGGGGTTG	0.527																																						dbGAP											0													57.0	54.0	55.0					8																	27457503		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M64722	CCDS47832.1	8p21-p12	2012-11-30	2006-02-10		ENSG00000120885	ENSG00000120885			2095	protein-coding gene	gene with protein product	"""complement lysis inhibitor"", ""sulfated glycoprotein 2"", ""testosterone-repressed prostate message 2"", ""apolipoprotein J"""	185430	"""clusterin (complement lysis inhibitor, SP-40,40, sulfated glycoprotein 2, testosterone-repressed prostate message 2, apolipoprotein J)"""	CLI, APOJ		1585460	Standard	NR_038335		Approved	SGP-2, SP-40, TRPM-2, KUB1, CLU1, CLU2	uc003xfz.2	P10909	OTTHUMG00000102114	ENST00000316403.10:c.958C>T	8.37:g.27457503G>A	ENSP00000315130:p.Gln320*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Q1|B3KSE6|P11380|P11381|Q2TU75|Q5HYC1|Q7Z5B9	Nonsense_Mutation	SNP	pfam_Clusterin-like,smart_Clusterin_N,smart_Clusterin_C	p.Q372*	ENST00000316403.10	37	c.1114	CCDS47832.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	44|44	11.250651|11.250651	0.99537|0.99537	.|.	.|.	ENSG00000120885|ENSG00000120885	ENST00000522098|ENST00000316403;ENST00000546343;ENST00000405140;ENST00000523500;ENST00000380446;ENST00000520012	.|.	.|.	.|.	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.106695	.|0.64402	.|D	.|0.000005	T|.	0.70422|.	0.3222|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.67891|.	-0.5553|.	3|.	.|0.29301	.|T	.|0.29	-30.6587|-30.6587	17.1549|17.1549	0.86788|0.86788	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	182|372;331;320;320;145;185	.|.	.|ENSP00000315130:Q372X	P|Q	-|-	2|1	0|0	CLU|CLU	27513420|27513420	1.000000|1.000000	0.71417|0.71417	0.351000|0.351000	0.25721|0.25721	0.007000|0.007000	0.05969|0.05969	6.254000|6.254000	0.72460|0.72460	2.643000|2.643000	0.89663|0.89663	0.655000|0.655000	0.94253|0.94253	CCA|CAG	CLU	-	pfam_Clusterin-like,smart_Clusterin_C	ENSG00000120885		0.527	CLU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLU	HGNC	protein_coding	OTTHUMT00000219953.3	70	0.00	0	G	NM_001831		27457503	27457503	-1	no_errors	ENST00000560366	ensembl	human	known	69_37n	nonsense	45	37.50	27	SNP	0.981	A
CNIH2	254263	genome.wustl.edu	37	11	66050245	66050245	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:66050245G>A	ENST00000311445.6	+	3	450	c.192G>A	c.(190-192)ctG>ctA	p.L64L	CNIH2_ENST00000528852.1_Silent_p.L64L|YIF1A_ENST00000526497.1_5'Flank|CNIH2_ENST00000530519.1_3'UTR	NM_182553.2	NP_872359.1	Q6PI25	CNIH2_HUMAN	cornichon family AMPA receptor auxiliary protein 2	64					intracellular signal transduction (GO:0035556)|localization within membrane (GO:0051668)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of membrane potential (GO:0042391)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)				endometrium(1)|large_intestine(1)|lung(2)|prostate(1)	5						GCTGCCTCCTGAGGAAGGTCA	0.627											OREG0021100	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													24.0	22.0	23.0					11																	66050245		2199	4295	6494	-	-	-	SO:0001819	synonymous_variant	0			BC047953	CCDS8131.1	11q13.2	2013-08-28	2013-08-28		ENSG00000174871	ENSG00000174871			28744	protein-coding gene	gene with protein product		611288	"""cornichon homolog 2 (Drosophila)"""			12477932	Standard	NM_182553		Approved	MGC50896, Cnil, CNIH-2	uc001ohi.2	Q6PI25	OTTHUMG00000166919	ENST00000311445.6:c.192G>A	11.37:g.66050245G>A		Somatic	1088	WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Cornichon	p.L64	ENST00000311445.6	37	c.192	CCDS8131.1	11																																																																																			CNIH2	-	pfam_Cornichon	ENSG00000174871		0.627	CNIH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNIH2	HGNC	protein_coding	OTTHUMT00000391892.1	37	0.00	0	G	NM_182553		66050245	66050245	+1	no_errors	ENST00000311445	ensembl	human	known	69_37n	silent	16	20.00	4	SNP	0.998	A
CNTNAP2	26047	genome.wustl.edu	37	7	148080896	148080896	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:148080896G>A	ENST00000361727.3	+	22	4147	c.3631G>A	c.(3631-3633)Gag>Aag	p.E1211K	CNTNAP2_ENST00000463592.2_3'UTR|CNTNAP2_ENST00000538075.1_Missense_Mutation_p.E270K	NM_014141.5	NP_054860.1	Q9UHC6	CNTP2_HUMAN	contactin associated protein-like 2	1211	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|cerebral cortex development (GO:0021987)|clustering of voltage-gated potassium channels (GO:0045163)|learning (GO:0007612)|limbic system development (GO:0021761)|neuron projection development (GO:0031175)|neuron recognition (GO:0008038)|protein localization to juxtaparanode region of axon (GO:0071205)|social behavior (GO:0035176)|striatum development (GO:0021756)|superior temporal gyrus development (GO:0071109)|thalamus development (GO:0021794)|transmission of nerve impulse (GO:0019226)|vocalization behavior (GO:0071625)	axolemma (GO:0030673)|axon (GO:0030424)|cell surface (GO:0009986)|dendrite (GO:0030425)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|voltage-gated potassium channel complex (GO:0008076)	enzyme binding (GO:0019899)			NS(3)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(105)|ovary(9)|pancreas(2)|prostate(5)|skin(7)|stomach(3)|upper_aerodigestive_tract(6)|urinary_tract(3)	188	Melanoma(164;0.153)	all_cancers(3;3.51e-10)|all_epithelial(3;1.4e-05)|Myeloproliferative disorder(3;0.00452)|Lung NSC(3;0.0067)|all_lung(3;0.00794)	OV - Ovarian serous cystadenocarcinoma(82;0.0319)			CGAGCTGGTGGAGTCCAACTG	0.627										HNSCC(39;0.1)																												dbGAP											0													33.0	35.0	34.0					7																	148080896		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF193613	CCDS5889.1	7q35	2008-02-04			ENSG00000174469	ENSG00000174469			13830	protein-coding gene	gene with protein product		604569				10624965, 10048485	Standard	NM_014141		Approved	Caspr2, KIAA0868, NRXN4	uc003weu.2	Q9UHC6	OTTHUMG00000152743	ENST00000361727.3:c.3631G>A	7.37:g.148080896G>A	ENSP00000354778:p.Glu1211Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWG2|Q14DG2|Q52LV1|Q5H9Q7|Q9UQ12	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,pfam_EGF-like_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E1211K	ENST00000361727.3	37	c.3631	CCDS5889.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.749286	0.96882	.	.	ENSG00000174469	ENST00000361727;ENST00000538075	D;T	0.89939	-2.59;2.62	6.07	6.07	0.98685	Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.85682	D	0.000000	D	0.94052	0.8094	M	0.87269	2.87	0.80722	D	1	D	0.59357	0.985	P	0.55923	0.787	D	0.92750	0.6215	10	0.35671	T	0.21	.	19.2374	0.93866	0.0:0.0:1.0:0.0	.	1211	Q9UHC6	CNTP2_HUMAN	K	1211;270	ENSP00000354778:E1211K;ENSP00000440732:E270K	ENSP00000354778:E1211K	E	+	1	0	CNTNAP2	147711829	1.000000	0.71417	1.000000	0.80357	0.799000	0.45148	7.677000	0.84024	2.885000	0.99019	0.655000	0.94253	GAG	CNTNAP2	-	pfscan_Laminin_G	ENSG00000174469		0.627	CNTNAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP2	HGNC	protein_coding	OTTHUMT00000327668.1	33	0.00	0	G			148080896	148080896	+1	no_errors	ENST00000361727	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43876087	43876087	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:43876087G>A	ENST00000377564.3	+	14	2572	c.2179G>A	c.(2179-2181)Gag>Aag	p.E727K		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	727	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						TTGTGGATTAGAGGGGAACTG	0.453																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.2179G>A	9.37:g.43876087G>A	ENSP00000366787:p.Glu727Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E727K	ENST00000377564.3	37	c.2179	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	G	9.520	1.108080	0.20714	.	.	ENSG00000154529	ENST00000377564;ENST00000341990	T	0.13778	2.56	2.5	1.54	0.23209	.	.	.	.	.	T	0.25827	0.0629	M	0.80183	2.485	0.27840	N	0.941159	.	.	.	.	.	.	T	0.08554	-1.0716	7	0.33940	T	0.23	.	9.9678	0.41734	0.0:0.3979:0.6021:0.0	.	.	.	.	K	727	ENSP00000366787:E727K	ENSP00000340890:E727K	E	+	1	0	CNTNAP3B	43816083	1.000000	0.71417	0.993000	0.49108	0.592000	0.36648	0.899000	0.28417	0.376000	0.24707	0.121000	0.15741	GAG	CNTNAP3B	-	NULL	ENSG00000154529		0.453	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	26	0.00	0	G			43876087	43876087	+1	no_errors	ENST00000377564	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.965	A
CNTRL	11064	genome.wustl.edu	37	9	123904482	123904482	+	Silent	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:123904482C>G	ENST00000373855.1	+	19	3065	c.2805C>G	c.(2803-2805)ctC>ctG	p.L935L	CNTRL_ENST00000373847.1_Silent_p.L383L|CNTRL_ENST00000373850.1_Silent_p.L383L|CNTRL_ENST00000238341.5_Silent_p.L935L			Q7Z7A1	CNTRL_HUMAN	centriolin	935					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TTACAGATCTCCAACTTCAGG	0.403																																						dbGAP											0													54.0	53.0	53.0					9																	123904482		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.2805C>G	9.37:g.123904482C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Silent	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.L935	ENST00000373855.1	37	c.2805	CCDS35118.1	9																																																																																			CNTRL	-	NULL	ENSG00000119397		0.403	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	55	0.00	0	C	NM_007018		123904482	123904482	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	silent	33	35.29	18	SNP	0.999	G
CNTRL	11064	genome.wustl.edu	37	9	123914776	123914776	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:123914776C>G	ENST00000373855.1	+	26	4237	c.3977C>G	c.(3976-3978)tCt>tGt	p.S1326C	CNTRL_ENST00000373847.1_Missense_Mutation_p.S774C|CNTRL_ENST00000373850.1_Missense_Mutation_p.S774C|CNTRL_ENST00000238341.5_Missense_Mutation_p.S1326C|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	1326					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						AATGAAGTTTCTAGATTAGAA	0.413																																						dbGAP											0													73.0	78.0	76.0					9																	123914776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.3977C>G	9.37:g.123914776C>G	ENSP00000362962:p.Ser1326Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.S1326C	ENST00000373855.1	37	c.3977	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	C	17.80	3.477217	0.63849	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000373847	T;T;T;T	0.32515	1.45;1.45;1.45;1.51	5.49	4.58	0.56647	.	.	.	.	.	T	0.52125	0.1715	M	0.64997	1.995	0.35142	D	0.768994	D	0.89917	1.0	D	0.68192	0.956	T	0.67264	-0.5714	9	0.72032	D	0.01	.	15.6893	0.77436	0.0:0.8627:0.1373:0.0	.	1326	Q7Z7A1	CNTRL_HUMAN	C	1326;1326;1326;82;774;774	ENSP00000362962:S1326C;ENSP00000238341:S1326C;ENSP00000362956:S774C;ENSP00000362953:S774C	ENSP00000238341:S1326C	S	+	2	0	CNTRL	122954597	1.000000	0.71417	0.999000	0.59377	0.971000	0.66376	3.579000	0.53900	1.432000	0.47375	-0.175000	0.13238	TCT	CNTRL	-	NULL	ENSG00000119397		0.413	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	75	0.00	0	C	NM_007018		123914776	123914776	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	57	26.92	21	SNP	1.000	G
CNTRL	11064	genome.wustl.edu	37	9	123919814	123919814	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:123919814G>A	ENST00000373855.1	+	28	4692	c.4432G>A	c.(4432-4434)Gag>Aag	p.E1478K	CNTRL_ENST00000373847.1_Missense_Mutation_p.E926K|CNTRL_ENST00000373850.1_Missense_Mutation_p.E926K|CNTRL_ENST00000373844.1_5'Flank|CNTRL_ENST00000238341.5_Missense_Mutation_p.E1478K|CNTRL_ENST00000373845.2_3'UTR			Q7Z7A1	CNTRL_HUMAN	centriolin	1478					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						GTCAGATGCTGAGGAATTAGA	0.403																																						dbGAP											0													106.0	104.0	105.0					9																	123919814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.4432G>A	9.37:g.123919814G>A	ENSP00000362962:p.Glu1478Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.E1478K	ENST00000373855.1	37	c.4432	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	G	18.03	3.531763	0.64972	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000373847;ENST00000431571;ENST00000373845	T;T;T;T;T	0.80566	1.59;1.59;1.59;2.59;-1.39	5.61	4.69	0.59074	.	.	.	.	.	T	0.70824	0.3268	L	0.47716	1.5	0.42137	D	0.991491	B	0.33857	0.429	B	0.27608	0.081	T	0.67063	-0.5765	9	0.12430	T	0.62	.	14.2147	0.65786	0.0765:0.0:0.9235:0.0	.	1478	Q7Z7A1	CNTRL_HUMAN	K	1478;1478;1478;234;926;926;147;160	ENSP00000362962:E1478K;ENSP00000238341:E1478K;ENSP00000362956:E926K;ENSP00000362953:E926K;ENSP00000413014:E147K	ENSP00000238341:E1478K	E	+	1	0	CNTRL	122959635	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.698000	0.54771	2.793000	0.96121	0.655000	0.94253	GAG	CNTRL	-	NULL	ENSG00000119397		0.403	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	89	0.00	0	G	NM_007018		123919814	123919814	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	71	30.39	31	SNP	0.999	A
COL25A1	84570	genome.wustl.edu	37	4	110222887	110222887	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:110222887G>C	ENST00000399132.1	-	2	819	c.289C>G	c.(289-291)Ctg>Gtg	p.L97V	AC004051.2_ENST00000500526.1_lincRNA|COL25A1_ENST00000399127.1_Missense_Mutation_p.L97V|COL25A1_ENST00000399126.1_Missense_Mutation_p.L97V	NM_198721.2	NP_942014.1			collagen, type XXV, alpha 1											NS(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	49		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000173)		ACCTGAGCCAGAAGTCGCTCC	0.542																																						dbGAP											0													138.0	146.0	143.0					4																	110222887		2067	4212	6279	-	-	-	SO:0001583	missense	0			AF293340	CCDS43258.1, CCDS43259.1, CCDS58922.1	4q25	2013-01-16			ENSG00000188517	ENSG00000188517		"""Collagens"""	18603	protein-coding gene	gene with protein product		610004				11927537	Standard	NM_001256074		Approved		uc003hze.2	Q9BXS0	OTTHUMG00000150039	ENST00000399132.1:c.289C>G	4.37:g.110222887G>C	ENSP00000382083:p.Leu97Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Collagen	p.L97V	ENST00000399132.1	37	c.289	CCDS43258.1	4	.	.	.	.	.	.	.	.	.	.	G	13.33	2.203788	0.38905	.	.	ENSG00000188517	ENST00000399132;ENST00000333642;ENST00000401873;ENST00000399127;ENST00000399126;ENST00000443653	D;T;D	0.91686	-2.68;0.89;-2.89	5.62	4.77	0.60923	.	0.000000	0.37095	N	0.002257	D	0.91389	0.7283	N	0.24115	0.695	0.30919	N	0.728226	D;D;D	0.76494	0.999;0.996;0.993	D;D;D	0.80764	0.994;0.986;0.967	D	0.88334	0.2970	9	.	.	.	-3.6822	9.3559	0.38166	0.1682:0.0:0.8318:0.0	.	97;97;97	A8MWQ5;Q9BXS0-2;Q9BXS0	.;.;COPA1_HUMAN	V	97	ENSP00000382083:L97V;ENSP00000382078:L97V;ENSP00000382077:L97V	.	L	-	1	2	COL25A1	110442336	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.772000	0.55325	1.488000	0.48433	0.561000	0.74099	CTG	COL25A1	-	NULL	ENSG00000188517		0.542	COL25A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL25A1	HGNC	protein_coding	OTTHUMT00000315938.2	81	0.00	0	G	NM_032518		110222887	110222887	-1	no_errors	ENST00000399132	ensembl	human	known	69_37n	missense	74	30.84	33	SNP	1.000	C
COL6A2	1292	genome.wustl.edu	37	21	47552403	47552403	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr21:47552403G>A	ENST00000300527.4	+	28	3101	c.2997G>A	c.(2995-2997)gaG>gaA	p.E999E		NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	999	Nonhelical region.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TGTTCCACGAGAAGGACTATG	0.677																																						dbGAP											0													53.0	45.0	48.0					21																	47552403		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2997G>A	21.37:g.47552403G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.E999	ENST00000300527.4	37	c.2997	CCDS13728.1	21																																																																																			COL6A2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000142173		0.677	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	20	0.00	0	G			47552403	47552403	+1	no_errors	ENST00000300527	ensembl	human	known	69_37n	silent	12	36.84	7	SNP	1.000	A
COX8A	1351	genome.wustl.edu	37	11	63742177	63742177	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:63742177C>T	ENST00000314133.3	+	1	99	c.25C>T	c.(25-27)Ctg>Ttg	p.L9L	AP000721.4_ENST00000535431.1_Silent_p.L9L	NM_004074.2	NP_004065.1	P10176	COX8A_HUMAN	cytochrome c oxidase subunit VIIIA (ubiquitous)	9					cellular metabolic process (GO:0044237)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	cytochrome-c oxidase activity (GO:0004129)										GCCGCTGCTGCTGCGGGGCTT	0.652																																						dbGAP											0													24.0	25.0	24.0					11																	63742177		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			J04823	CCDS8054.1	11q12-q13	2011-07-04	2010-04-27	2004-03-24	ENSG00000176340	ENSG00000176340	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2294	protein-coding gene	gene with protein product		123870	"""cytochrome c oxidase subunit VIII"", ""cytochrome c oxidase subunit 8A (ubiquitous)"""	COX8		2543673, 2847943	Standard	NM_004074		Approved	COX8-2, COX8L, VIII-L, COX, VIII	uc001nye.3	P10176	OTTHUMG00000167785	ENST00000314133.3:c.25C>T	11.37:g.63742177C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P15955	Silent	SNP	pfam_Cyt_c_oxidase_su8,superfamily_Cyt_c_oxidase_su8	p.L9	ENST00000314133.3	37	c.25	CCDS8054.1	11																																																																																			COX8A	-	NULL	ENSG00000176340		0.652	COX8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX8A	HGNC	protein_coding	OTTHUMT00000396273.1	21	0.00	0	C	NM_004074		63742177	63742177	+1	no_errors	ENST00000314133	ensembl	human	known	69_37n	silent	5	64.29	9	SNP	1.000	T
CPSF1	29894	genome.wustl.edu	37	8	145621563	145621563	+	Splice_Site	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:145621563C>T	ENST00000349769.3	-	26	3073	c.2979G>A	c.(2977-2979)caG>caA	p.Q993Q	MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'Flank	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	993					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CGGACCCCACCTGTCTGTTGA	0.647																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													11.0	12.0	12.0					8																	145621563		2191	4281	6472	-	-	-	SO:0001630	splice_region_variant	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.2979+1G>A	8.37:g.145621563C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AF0	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.Q993	ENST00000349769.3	37	c.2979	CCDS34966.1	8																																																																																			CPSF1	-	NULL	ENSG00000071894		0.647	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	10	0.00	0	C	NM_013291	Silent	145621563	145621563	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	silent	9	35.71	5	SNP	1.000	T
CRMP1	1400	genome.wustl.edu	37	4	5830269	5830269	+	Missense_Mutation	SNP	G	G	A	rs201976585	byFrequency	TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:5830269G>A	ENST00000397890.2	-	12	1622	c.1408C>T	c.(1408-1410)Ccg>Tcg	p.P470S	EVC_ENST00000382674.2_3'UTR|CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000324989.7_Missense_Mutation_p.P584S|CRMP1_ENST00000512574.1_Missense_Mutation_p.P468S	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	470					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)	p.P584S(1)		NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		GCCTTCCGCGGAATGAAGCGG	0.597													G|||	2	0.000399361	0.0	0.0014	5008	,	,		19384	0.0		0.001	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	prostate(1)											143.0	104.0	117.0					4																	5830269		2203	4300	6503	-	-	-	SO:0001583	missense	0			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1408C>T	4.37:g.5830269G>A	ENSP00000380987:p.Pro470Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0EJG6|Q13024|Q4W5F1|Q96TC8	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.P584S	ENST00000397890.2	37	c.1750	CCDS43207.1	4	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	12.67	2.006649	0.35415	.	.	ENSG00000072832	ENST00000324989;ENST00000397890;ENST00000534845;ENST00000512574	T;T;T	0.73258	-0.73;-0.73;-0.73	4.33	3.48	0.39840	Metal-dependent hydrolase, composite domain (1);	0.119068	0.64402	N	0.000017	T	0.59810	0.2221	L	0.44542	1.39	0.58432	D	0.999995	B;B;B;B	0.28713	0.047;0.22;0.052;0.049	B;B;B;B	0.19148	0.012;0.024;0.012;0.01	T	0.60571	-0.7237	10	0.59425	D	0.04	-30.94	11.3265	0.49452	0.0882:0.0:0.9118:0.0	.	584;468;470;407	A0EJG6;E9PD68;Q14194;B3KT07	.;.;DPYL1_HUMAN;.	S	584;470;470;468	ENSP00000321606:P584S;ENSP00000380987:P470S;ENSP00000425742:P468S	ENSP00000321606:P584S	P	-	1	0	CRMP1	5881170	1.000000	0.71417	0.988000	0.46212	0.327000	0.28475	7.257000	0.78362	1.041000	0.40125	0.561000	0.74099	CCG	CRMP1	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000072832		0.597	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	44	0.00	0	G	NM_001313		5830269	5830269	-1	no_errors	ENST00000324989	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	A
CTDSPL	10217	genome.wustl.edu	37	3	37988634	37988634	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:37988634G>C	ENST00000273179.5	+	2	192	c.166G>C	c.(166-168)Gag>Cag	p.E56Q	CTDSPL_ENST00000443503.2_Missense_Mutation_p.E56Q	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	56						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		TTACAATGTGGAGGCCCCTCC	0.562																																						dbGAP											0													82.0	78.0	79.0					3																	37988634		2203	4300	6503	-	-	-	SO:0001583	missense	0			D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.166G>C	3.37:g.37988634G>C	ENSP00000273179:p.Glu56Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZTU0|Q70KI4|Q7Z5Q2	Missense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.E56Q	ENST00000273179.5	37	c.166	CCDS33734.1	3	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860686	0.71834	.	.	ENSG00000144677	ENST00000443503;ENST00000273179	T;T	0.14893	2.48;2.47	5.34	5.34	0.76211	.	0.793989	0.12033	N	0.505759	T	0.25865	0.0630	M	0.68317	2.08	0.80722	D	1	B;B	0.22211	0.018;0.066	B;B	0.23018	0.038;0.043	T	0.07462	-1.0771	10	0.31617	T	0.26	-7.5475	19.4405	0.94817	0.0:0.0:1.0:0.0	.	56;56	O15194-2;O15194	.;CTDSL_HUMAN	Q	56	ENSP00000398288:E56Q;ENSP00000273179:E56Q	ENSP00000273179:E56Q	E	+	1	0	CTDSPL	37963638	1.000000	0.71417	0.999000	0.59377	0.978000	0.69477	9.271000	0.95698	2.687000	0.91594	0.655000	0.94253	GAG	CTDSPL	-	NULL	ENSG00000144677		0.562	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL	HGNC	protein_coding	OTTHUMT00000342392.1	30	0.00	0	G	NM_005808		37988634	37988634	+1	no_errors	ENST00000273179	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	C
CTSZ	1522	genome.wustl.edu	37	20	57571764	57571764	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:57571764G>A	ENST00000217131.5	-	5	849	c.731C>T	c.(730-732)tCt>tTt	p.S244F		NM_001336.3	NP_001327.2	Q9UBR2	CATZ_HUMAN	cathepsin Z	244					angiotensin maturation (GO:0002003)|cellular protein metabolic process (GO:0044267)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	cysteine-type peptidase activity (GO:0008234)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	10	all_lung(29;0.00711)		Colorectal(105;0.109)			CCCAGCCACAGAAACGACATG	0.468																																						dbGAP											0													132.0	119.0	123.0					20																	57571764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF032906	CCDS13474.1	20q13.32	2012-02-10			ENSG00000101160	ENSG00000101160		"""Cathepsins"""	2547	protein-coding gene	gene with protein product	"""cathepsin X"", ""carboxypeptidase LB"", ""cathepsin IV"", ""cathepsin B2"", ""cathepsin Y"", ""cathepsin Z1"", ""cysteine-type carboxypeptidase"", ""lysosomal carboxypeptidase B"""	603169				9642240	Standard	NM_001336		Approved	CTSX	uc002yai.2	Q9UBR2	OTTHUMG00000032858	ENST00000217131.5:c.731C>T	20.37:g.57571764G>A	ENSP00000217131:p.Ser244Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC40|O75331|Q9UQV5|Q9UQV6	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.S244F	ENST00000217131.5	37	c.731	CCDS13474.1	20	.	.	.	.	.	.	.	.	.	.	G	14.60	2.582347	0.46006	.	.	ENSG00000101160	ENST00000217131	T	0.42900	0.96	5.57	4.62	0.57501	Peptidase C1A, papain C-terminal (3);	0.000000	0.85682	D	0.000000	T	0.68302	0.2986	M	0.88181	2.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.996	T	0.74583	-0.3617	10	0.87932	D	0	.	12.1669	0.54135	0.0:0.1302:0.7345:0.1354	.	244;244	Q5U000;Q9UBR2	.;CATZ_HUMAN	F	244	ENSP00000217131:S244F	ENSP00000217131:S244F	S	-	2	0	CTSZ	57005159	1.000000	0.71417	0.038000	0.18304	0.009000	0.06853	7.677000	0.84024	1.344000	0.45657	0.655000	0.94253	TCT	CTSZ	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	ENSG00000101160		0.468	CTSZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSZ	HGNC	protein_coding	OTTHUMT00000079899.1	84	0.00	0	G	NM_001336		57571764	57571764	-1	no_errors	ENST00000217131	ensembl	human	known	69_37n	missense	67	27.17	25	SNP	0.942	A
CXorf36	79742	genome.wustl.edu	37	X	45013388	45013388	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:45013388C>T	ENST00000398000.2	-	4	802	c.728G>A	c.(727-729)aGa>aAa	p.R243K	CXorf36_ENST00000477281.1_Intron	NM_176819.3	NP_789789.2	Q9H7Y0	DIA1R_HUMAN	chromosome X open reading frame 36	243						extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(4)	7						GACGAGGAATCTGCCACAGGA	0.592																																						dbGAP											0													33.0	29.0	30.0					X																	45013388		1568	3582	5150	-	-	-	SO:0001583	missense	0			AF289581	CCDS14266.1, CCDS48096.1	Xp11.3-p11.23	2012-08-03			ENSG00000147113	ENSG00000147113			25866	protein-coding gene	gene with protein product						11944989, 21283809	Standard	NM_176819		Approved	FLJ14103, DIA1R	uc004dgg.2	Q9H7Y0	OTTHUMG00000021403	ENST00000398000.2:c.728G>A	X.37:g.45013388C>T	ENSP00000381086:p.Arg243Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUU5|B2RPN7|Q6UWJ5	Missense_Mutation	SNP	NULL	p.R243K	ENST00000398000.2	37	c.728	CCDS48096.1	X	.	.	.	.	.	.	.	.	.	.	C	22.9	4.349779	0.82132	.	.	ENSG00000147113	ENST00000398000	T	0.41758	0.99	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	T	0.61999	0.2392	M	0.81341	2.54	0.80722	D	1	D	0.61697	0.99	P	0.55999	0.789	T	0.67542	-0.5644	10	0.66056	D	0.02	.	16.91	0.86138	0.0:1.0:0.0:0.0	.	243	Q9H7Y0	CX036_HUMAN	K	243	ENSP00000381086:R243K	ENSP00000381086:R243K	R	-	2	0	CXorf36	44898332	0.995000	0.38212	0.739000	0.30968	0.793000	0.44817	6.497000	0.73674	2.457000	0.83068	0.529000	0.55759	AGA	CXorf36	-	NULL	ENSG00000147113		0.592	CXorf36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf36	HGNC	protein_coding	OTTHUMT00000056333.2	12	0.00	0	C	NM_024689		45013388	45013388	-1	no_errors	ENST00000398000	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.950	T
CYP7B1	9420	genome.wustl.edu	37	8	65527649	65527649	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:65527649G>A	ENST00000310193.3	-	4	1164	c.991C>T	c.(991-993)Caa>Taa	p.Q331*	CYP7B1_ENST00000523954.1_5'UTR	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	331					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				CCTTTCTTTTGACCTGTTGAC	0.433																																						dbGAP											0													124.0	119.0	121.0					8																	65527649		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.991C>T	8.37:g.65527649G>A	ENSP00000310721:p.Gln331*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN07|Q9UNF5	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.Q331*	ENST00000310193.3	37	c.991	CCDS6180.1	8	.	.	.	.	.	.	.	.	.	.	G	38	6.767440	0.97825	.	.	ENSG00000172817	ENST00000310193	.	.	.	5.84	4.97	0.65823	.	0.321794	0.38326	N	0.001731	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-7.585	14.6815	0.69020	0.0692:0.0:0.9308:0.0	.	.	.	.	X	331	.	ENSP00000310721:Q331X	Q	-	1	0	CYP7B1	65690203	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.440000	0.73435	1.481000	0.48307	0.591000	0.81541	CAA	CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000172817		0.433	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	85	0.00	0	G			65527649	65527649	-1	no_errors	ENST00000310193	ensembl	human	known	69_37n	nonsense	79	26.85	29	SNP	1.000	A
KDELR3	11015	genome.wustl.edu	37	22	38882173	38882173	+	IGR	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:38882173G>C	ENST00000216014.4	+	0	1728				DDX17_ENST00000444597.1_Missense_Mutation_p.Q105E|DDX17_ENST00000381633.3_Missense_Mutation_p.Q576E|DDX17_ENST00000396821.3_Missense_Mutation_p.Q655E	NM_006855.2	NP_006846.1	O43731	ERD23_HUMAN	KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|protein retention in ER lumen (GO:0006621)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ER retention sequence binding (GO:0046923)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)	13	Melanoma(58;0.0286)					CCATATTCTTGAGCTGTATAG	0.517																																					Ovarian(11;103 529 24120 28493 32980)	dbGAP											0													94.0	85.0	88.0					22																	38882173		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AL035081	CCDS13972.1, CCDS46705.1	22q13	2008-05-02			ENSG00000100196	ENSG00000100196			6306	protein-coding gene	gene with protein product							Standard	NM_006855		Approved		uc003avu.3	O43731	OTTHUMG00000153520		22.37:g.38882173G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7T7|B8ZZ26|O95557|Q4V750|Q4V767|Q53FP4|Q53GK1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q655E	ENST00000216014.4	37	c.1963	CCDS13972.1	22	.	.	.	.	.	.	.	.	.	.	G	8.658	0.899871	0.17686	.	.	ENSG00000100201	ENST00000396821;ENST00000381633;ENST00000415748;ENST00000444597;ENST00000403230;ENST00000404499	T;T;T	0.26518	1.73;1.75;1.73	5.53	5.53	0.82687	.	0.000000	0.47455	D	0.000229	T	0.15782	0.0380	N	0.14661	0.345	0.27834	N	0.94135	B;B;B	0.21452	0.018;0.031;0.056	B;B;B	0.17979	0.004;0.01;0.02	T	0.11084	-1.0602	10	0.26408	T	0.33	-8.9135	13.3741	0.60728	0.0:0.2057:0.7943:0.0	.	657;653;107	Q59F66;Q92841-4;Q9UQL5	.;.;.	E	655;576;107;105;653;657	ENSP00000380033:Q655E;ENSP00000371046:Q576E;ENSP00000385536:Q653E	ENSP00000371046:Q576E	Q	-	1	0	DDX17	37212119	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.350000	0.66016	2.583000	0.87209	0.655000	0.94253	CAA	DDX17	-	NULL	ENSG00000100201		0.517	KDELR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX17	HGNC	protein_coding	OTTHUMT00000331474.1	84	0.00	0	G			38882173	38882173	-1	no_errors	ENST00000396821	ensembl	human	known	69_37n	missense	61	35.79	34	SNP	0.790	C
DDX46	9879	genome.wustl.edu	37	5	134164380	134164380	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:134164380G>A	ENST00000354283.4	+	23	3215	c.3080G>A	c.(3079-3081)aGa>aAa	p.R1027K	DDX46_ENST00000452510.2_Missense_Mutation_p.R1028K			Q7L014	DDX46_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 46	1027					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AATAAAGGAAGATACAAAGTC	0.313																																					Colon(13;391 453 4901 21675 24897)	dbGAP											0													67.0	67.0	67.0					5																	134164380		2203	4298	6501	-	-	-	SO:0001583	missense	0				CCDS34240.1, CCDS75306.1	5q31.1	2010-01-25			ENSG00000145833	ENSG00000145833		"""DEAD-boxes"""	18681	protein-coding gene	gene with protein product							Standard	XM_005272142		Approved	KIAA0801, FLJ25329, PRPF5, Prp5	uc003kzw.3	Q7L014	OTTHUMG00000163072	ENST00000354283.4:c.3080G>A	5.37:g.134164380G>A	ENSP00000346236:p.Arg1027Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94894|Q96EI0|Q9Y658	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.R1028K	ENST00000354283.4	37	c.3083	CCDS34240.1	5	.	.	.	.	.	.	.	.	.	.	G	21.3	4.122765	0.77436	.	.	ENSG00000145833	ENST00000452510;ENST00000354283	T;T	0.37915	1.18;1.17	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.41396	0.1157	L	0.48877	1.53	0.80722	D	1	P	0.36990	0.577	B	0.41135	0.348	T	0.09228	-1.0684	10	0.40728	T	0.16	-21.4748	19.9686	0.97276	0.0:0.0:1.0:0.0	.	1027	Q7L014	DDX46_HUMAN	K	1028;1027	ENSP00000416534:R1028K;ENSP00000346236:R1027K	ENSP00000346236:R1027K	R	+	2	0	DDX46	134192279	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.468000	0.97676	2.820000	0.97059	0.650000	0.86243	AGA	DDX46	-	NULL	ENSG00000145833		0.313	DDX46-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX46	HGNC	protein_coding	OTTHUMT00000371584.1	104	0.00	0	G	NM_014829		134164380	134164380	+1	no_errors	ENST00000452510	ensembl	human	known	69_37n	missense	56	17.65	12	SNP	1.000	A
DIP2C	22982	genome.wustl.edu	37	10	323392	323392	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:323392C>G	ENST00000280886.6	-	37	4631	c.4544G>C	c.(4543-4545)gGa>gCa	p.G1515A	AL603831.1_ENST00000579524.1_RNA	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1515						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GACCACCACTCCGACGATCAG	0.592																																						dbGAP											0													143.0	115.0	124.0					10																	323392		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.4544G>C	10.37:g.323392C>G	ENSP00000280886:p.Gly1515Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPI5|Q5SS78	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.G1515A	ENST00000280886.6	37	c.4544	CCDS7054.1	10	.	.	.	.	.	.	.	.	.	.	C	18.56	3.650938	0.67472	.	.	ENSG00000151240	ENST00000280886;ENST00000535541	T	0.09630	2.96	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.24774	0.0601	L	0.37750	1.13	0.80722	D	1	D	0.59767	0.986	D	0.63113	0.911	T	0.00051	-1.2193	10	0.42905	T	0.14	-34.2134	20.5792	0.99380	0.0:1.0:0.0:0.0	.	1515	Q9Y2E4	DIP2C_HUMAN	A	1515;440	ENSP00000280886:G1515A	ENSP00000280886:G1515A	G	-	2	0	DIP2C	313392	1.000000	0.71417	0.967000	0.41034	0.308000	0.27856	7.818000	0.86416	2.873000	0.98535	0.561000	0.74099	GGA	DIP2C	-	NULL	ENSG00000151240		0.592	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	HGNC	protein_coding	OTTHUMT00000046389.1	76	0.00	0	C	NM_014974		323392	323392	-1	no_errors	ENST00000280886	ensembl	human	known	69_37n	missense	81	23.58	25	SNP	1.000	G
DISP1	84976	genome.wustl.edu	37	1	223177316	223177316	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:223177316G>C	ENST00000284476.6	+	8	2741	c.2577G>C	c.(2575-2577)tgG>tgC	p.W859C		NM_032890.3	NP_116279.2	Q96F81	DISP1_HUMAN	dispatched homolog 1 (Drosophila)	859					determination of left/right symmetry (GO:0007368)|diaphragm development (GO:0060539)|dorsal/ventral pattern formation (GO:0009953)|embryonic pattern specification (GO:0009880)|patched ligand maturation (GO:0007225)|peptide transport (GO:0015833)|protein homotrimerization (GO:0070207)|regulation of protein secretion (GO:0050708)|smoothened signaling pathway (GO:0007224)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	hedgehog receptor activity (GO:0008158)|peptide transporter activity (GO:0015197)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(20)|lung(25)|prostate(4)|skin(1)|stomach(1)|urinary_tract(5)	69				GBM - Glioblastoma multiforme(131;0.102)		TCAAACAGTGGATGGAAAACC	0.458																																						dbGAP											0													65.0	69.0	67.0					1																	223177316		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056569	CCDS1536.1	1q42.12	2008-02-05			ENSG00000154309	ENSG00000154309			19711	protein-coding gene	gene with protein product		607502				10619433	Standard	NM_032890		Approved	DISPA, MGC13130, DKFZP434I0428, MGC16796	uc001hnu.2	Q96F81	OTTHUMG00000037893	ENST00000284476.6:c.2577G>C	1.37:g.223177316G>C	ENSP00000284476:p.Trp859Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7C2|Q96I92|Q9H698|Q9H8H9|Q9UFA2	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.W859C	ENST00000284476.6	37	c.2577	CCDS1536.1	1	.	.	.	.	.	.	.	.	.	.	G	14.74	2.624596	0.46840	.	.	ENSG00000154309	ENST00000284476	D	0.95622	-3.76	5.17	4.25	0.50352	.	0.000000	0.85682	D	0.000000	D	0.97312	0.9121	M	0.75085	2.285	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	D	0.97914	1.0310	10	0.87932	D	0	-7.0998	15.3186	0.74102	0.0:0.0:0.8588:0.1412	.	859	Q96F81	DISP1_HUMAN	C	859	ENSP00000284476:W859C	ENSP00000284476:W859C	W	+	3	0	DISP1	221243939	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	9.751000	0.98889	1.293000	0.44690	-0.181000	0.13052	TGG	DISP1	-	NULL	ENSG00000154309		0.458	DISP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DISP1	HGNC	protein_coding	OTTHUMT00000092512.1	56	0.00	0	G	NM_032890		223177316	223177316	+1	no_errors	ENST00000284476	ensembl	human	known	69_37n	missense	75	14.77	13	SNP	1.000	C
DMGDH	29958	genome.wustl.edu	37	5	78350099	78350099	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:78350099G>A	ENST00000255189.3	-	4	476	c.448C>T	c.(448-450)Caa>Taa	p.Q150*	DMGDH_ENST00000380311.4_Intron|DMGDH_ENST00000540686.1_Intron|DMGDH_ENST00000520388.1_5'Flank	NM_013391.2	NP_037523.2	Q9UI17	M2GD_HUMAN	dimethylglycine dehydrogenase	150					amino-acid betaine catabolic process (GO:0006579)|choline metabolic process (GO:0019695)|glycine catabolic process (GO:0006546)|glycine metabolic process (GO:0006544)	mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|dimethylglycine dehydrogenase activity (GO:0047865)|electron carrier activity (GO:0009055)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(2)|kidney(2)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	34		all_lung(232;0.000638)|Lung NSC(167;0.00173)|Ovarian(174;0.0262)|Prostate(461;0.192)		OV - Ovarian serous cystadenocarcinoma(54;6.52e-45)|Epithelial(54;5.96e-40)|all cancers(79;3.56e-35)		CGAGTCATTTGATATTTAAAT	0.403																																						dbGAP											0													92.0	87.0	89.0					5																	78350099		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF111858	CCDS4044.1	5q14.1	2008-02-05			ENSG00000132837	ENSG00000132837	1.5.99.2		24475	protein-coding gene	gene with protein product		605849				10767172, 11231903	Standard	NM_013391		Approved		uc003kfs.3	Q9UI17	OTTHUMG00000108159	ENST00000255189.3:c.448C>T	5.37:g.78350099G>A	ENSP00000255189:p.Gln150*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBN0|B4E1J9	Nonsense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_SoxG	p.Q150*	ENST00000255189.3	37	c.448	CCDS4044.1	5	.	.	.	.	.	.	.	.	.	.	G	38	7.033555	0.98017	.	.	ENSG00000132837	ENST00000255189	.	.	.	5.55	5.55	0.83447	.	0.056481	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.28530	T	0.3	.	19.5026	0.95103	0.0:0.0:1.0:0.0	.	.	.	.	X	150	.	ENSP00000255189:Q150X	Q	-	1	0	DMGDH	78385855	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.745000	0.98856	2.587000	0.87381	0.655000	0.94253	CAA	DMGDH	-	pfam_FAD-dep_OxRdtase	ENSG00000132837		0.403	DMGDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMGDH	HGNC	protein_coding	OTTHUMT00000226963.3	114	0.00	0	G	NM_013391		78350099	78350099	-1	no_errors	ENST00000255189	ensembl	human	known	69_37n	nonsense	58	31.76	27	SNP	1.000	A
DNAH10	196385	genome.wustl.edu	37	12	124397850	124397850	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:124397850C>T	ENST00000409039.3	+	59	10011	c.9986C>T	c.(9985-9987)tCa>tTa	p.S3329L		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3329					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGTCTGGGGTCAGAAAACATC	0.532																																						dbGAP											0													33.0	35.0	34.0					12																	124397850		1949	4121	6070	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.9986C>T	12.37:g.124397850C>T	ENSP00000386770:p.Ser3329Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	NULL	p.Q257*	ENST00000409039.3	37	c.769	CCDS9255.2	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.35|19.35	3.811320|3.811320	0.70797|0.70797	.|.	.|.	ENSG00000197653|ENSG00000197653	ENST00000540041|ENST00000409039	.|T	.|0.80033	.|-1.33	5.43|5.43	5.43|5.43	0.79202|0.79202	.|Dynein heavy chain, coiled coil stalk (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|D	.|0.93197	.|0.7833	H|H	0.95114|0.95114	3.625|3.625	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|D	.|0.94926	.|0.8078	.|10	.|0.87932	.|D	.|0	.|.	19.2307|19.2307	0.93839|0.93839	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|3329	.|Q8IVF4	.|DYH10_HUMAN	X|L	257|3329	.|ENSP00000386770:S3329L	.|ENSP00000386770:S3329L	Q|S	+|+	1|2	0|0	DNAH10|DNAH10	122963803|122963803	1.000000|1.000000	0.71417|0.71417	0.057000|0.057000	0.19452|0.19452	0.025000|0.025000	0.11179|0.11179	4.859000|4.859000	0.62954|0.62954	2.534000|2.534000	0.85438|0.85438	0.655000|0.655000	0.94253|0.94253	CAG|TCA	DNAH10	-	NULL	ENSG00000197653		0.532	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	45	0.00	0	C			124397850	124397850	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000540041	ensembl	human	putative	69_37n	nonsense	24	38.46	15	SNP	0.998	T
DNAH10	196385	genome.wustl.edu	37	12	124408387	124408387	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:124408387C>G	ENST00000409039.3	+	65	11255	c.11230C>G	c.(11230-11232)Caa>Gaa	p.Q3744E	CCDC92_ENST00000544798.1_5'Flank|RP11-380L11.4_ENST00000602952.1_RNA	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	3744					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GAGAGTCCCTCAAGAAGAACT	0.398																																						dbGAP											0													58.0	56.0	57.0					12																	124408387		1838	4085	5923	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.11230C>G	12.37:g.124408387C>G	ENSP00000386770:p.Gln3744Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.Q3744E	ENST00000409039.3	37	c.11230	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	18.99	3.740864	0.69304	.	.	ENSG00000197653	ENST00000409039	T	0.56275	0.47	5.49	5.49	0.81192	.	0.258229	0.23702	U	0.045413	T	0.43188	0.1236	L	0.42744	1.35	0.80722	D	1	B	0.30584	0.286	B	0.26094	0.066	T	0.42310	-0.9459	10	0.05351	T	0.99	.	19.3767	0.94512	0.0:1.0:0.0:0.0	.	3744	Q8IVF4	DYH10_HUMAN	E	3744	ENSP00000386770:Q3744E	ENSP00000386770:Q3744E	Q	+	1	0	DNAH10	122974340	1.000000	0.71417	0.996000	0.52242	0.934000	0.57294	7.811000	0.86092	2.556000	0.86216	0.591000	0.81541	CAA	DNAH10	-	NULL	ENSG00000197653		0.398	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	48	0.00	0	C			124408387	124408387	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	G
DNAH11	8701	genome.wustl.edu	37	7	21784183	21784183	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:21784183G>A	ENST00000409508.3	+	50	8313	c.8282G>A	c.(8281-8283)aGa>aAa	p.R2761K	DNAH11_ENST00000328843.6_Missense_Mutation_p.R2768K	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2768					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						TTGTTTCAGAGAAGAATGCTG	0.363									Kartagener syndrome																													dbGAP											0													97.0	94.0	95.0					7																	21784183		1855	4105	5960	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.8282G>A	7.37:g.21784183G>A	ENSP00000475939:p.Arg2761Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R2768K	ENST00000409508.3	37	c.8303		7	.	.	.	.	.	.	.	.	.	.	G	4.567	0.105266	0.08731	.	.	ENSG00000105877	ENST00000328843	T	0.37235	1.21	5.91	2.33	0.28932	.	0.185323	0.56097	N	0.000031	T	0.14056	0.0340	.	.	.	0.25953	N	0.98273	B	0.02656	0.0	B	0.01281	0.0	T	0.34601	-0.9822	9	0.02654	T	1	.	8.229	0.31587	0.7064:0.0:0.2936:0.0	.	2768	Q96DT5	DYH11_HUMAN	K	2768	ENSP00000330671:R2768K	ENSP00000330671:R2768K	R	+	2	0	DNAH11	21750708	0.976000	0.34144	0.810000	0.32431	0.962000	0.63368	1.683000	0.37638	0.174000	0.19809	-0.238000	0.12139	AGA	DNAH11	-	NULL	ENSG00000105877		0.363	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	92	0.00	0	G	NM_003777		21784183	21784183	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	45	45.78	38	SNP	0.989	A
DNM1L	10059	genome.wustl.edu	37	12	32895575	32895575	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:32895575C>T	ENST00000549701.1	+	19	2121	c.2047C>T	c.(2047-2049)Cag>Tag	p.Q683*	YARS2_ENST00000551673.1_Intron|DNM1L_ENST00000547312.1_Nonsense_Mutation_p.Q672*|DNM1L_ENST00000414834.2_Nonsense_Mutation_p.Q480*|DNM1L_ENST00000452533.2_Nonsense_Mutation_p.Q657*|DNM1L_ENST00000553257.1_Nonsense_Mutation_p.Q696*|DNM1L_ENST00000358214.5_Nonsense_Mutation_p.Q659*|DNM1L_ENST00000266481.6_Nonsense_Mutation_p.Q646*|DNM1L_ENST00000381000.4_Nonsense_Mutation_p.Q685*			O00429	DNM1L_HUMAN	dynamin 1-like	683	GED. {ECO:0000255|PROSITE- ProRule:PRU00720}.|Interaction with GSK3B.				apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|dynamin polymerization involved in mitochondrial fission (GO:0003374)|endocytosis (GO:0006897)|GTP catabolic process (GO:0006184)|membrane fission involved in mitochondrial fission (GO:0090149)|membrane fusion (GO:0061025)|mitochondrial fission (GO:0000266)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrion morphogenesis (GO:0070584)|necroptotic process (GO:0070266)|peroxisome fission (GO:0016559)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial fission (GO:0090141)|positive regulation of protein secretion (GO:0050714)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|protein homotetramerization (GO:0051289)|protein localization to mitochondrion (GO:0070585)|regulation of mitochondrion organization (GO:0010821)|regulation of peroxisome organization (GO:1900063)|regulation of protein oligomerization (GO:0032459)|release of cytochrome c from mitochondria (GO:0001836)	cell junction (GO:0030054)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisome (GO:0005777)|protein complex (GO:0043234)|synapse (GO:0045202)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|lipid binding (GO:0008289)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	23	Lung NSC(5;2.15e-06)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					AGACACTCTTCAGAGTGAGCT	0.393																																						dbGAP											0													140.0	135.0	137.0					12																	32895575		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF000430	CCDS8728.1, CCDS8729.1, CCDS8730.1, CCDS61095.1, CCDS61096.1, CCDS61098.1, CCDS61099.1	12p11.21	2012-10-02			ENSG00000087470	ENSG00000087470			2973	protein-coding gene	gene with protein product		603850				9348079, 9731200	Standard	NM_012062		Approved	DRP1, DVLP, HDYNIV, DYMPLE, VPS1	uc001rld.2	O00429	OTTHUMG00000169451	ENST00000549701.1:c.2047C>T	12.37:g.32895575C>T	ENSP00000450399:p.Gln683*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X9|B4DGC9|B4DSU8|J3KPI2|O14541|O60709|Q59GN9|Q7L6B3|Q8TBT7|Q9BWM1|Q9Y5J2	Nonsense_Mutation	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,smart_Dynamin_GTPase,smart_GED,prints_Dynamin	p.Q696*	ENST00000549701.1	37	c.2086	CCDS8729.1	12	.	.	.	.	.	.	.	.	.	.	C	38	7.014400	0.98002	.	.	ENSG00000087470	ENST00000452533;ENST00000411996;ENST00000553257;ENST00000549701;ENST00000358214;ENST00000266481;ENST00000547312;ENST00000414834;ENST00000381000	.	.	.	5.52	5.52	0.82312	.	0.059793	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.6304	0.88104	0.0:1.0:0.0:0.0	.	.	.	.	X	657;738;696;683;659;646;672;480;685	.	ENSP00000266481:Q646X	Q	+	1	0	DNM1L	32786842	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.615000	0.83006	2.582000	0.87167	0.585000	0.79938	CAG	DNM1L	-	pfam_GED,smart_GED	ENSG00000087470		0.393	DNM1L-003	KNOWN	basic|CCDS	protein_coding	DNM1L	HGNC	protein_coding	OTTHUMT00000404124.1	120	0.00	0	C	NM_012062		32895575	32895575	+1	no_errors	ENST00000553257	ensembl	human	known	69_37n	nonsense	61	37.76	37	SNP	1.000	T
DNPEP	23549	genome.wustl.edu	37	2	220247855	220247855	+	Missense_Mutation	SNP	C	C	G	rs372008920		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:220247855C>G	ENST00000273075.4	-	10	1154	c.934G>C	c.(934-936)Gag>Cag	p.E312Q	DNPEP_ENST00000373972.1_Missense_Mutation_p.E237Q|DNPEP_ENST00000523282.1_Missense_Mutation_p.E320Q|DNPEP_ENST00000490371.1_5'Flank	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	302					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCACGTACCTCTTCGTTGTCA	0.597																																						dbGAP											0													74.0	78.0	77.0					2																	220247855		2053	4185	6238	-	-	-	SO:0001583	missense	0				CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.934G>C	2.37:g.220247855C>G	ENSP00000273075:p.Glu312Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BW44|Q9NUV5	Missense_Mutation	SNP	pfam_Peptidase_M18,pfam_Peptidase_M42,prints_Peptidase_M18	p.E312Q	ENST00000273075.4	37	c.934	CCDS42823.1	2	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522699	0.85600	.	.	ENSG00000123992	ENST00000273075;ENST00000337010;ENST00000373972;ENST00000523282;ENST00000535056;ENST00000457935	.	.	.	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.91432	0.7296	H	0.99454	4.575	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.992;0.999	D;D;P;D	0.72625	0.978;0.978;0.839;0.978	D	0.95237	0.8348	9	0.87932	D	0	-25.1892	18.3468	0.90325	0.0:1.0:0.0:0.0	.	320;320;302;312	E7ETB3;B7Z7F0;Q9ULA0;Q53SB6	.;.;DNPEP_HUMAN;.	Q	312;312;237;320;205;284	.	ENSP00000273075:E312Q	E	-	1	0	DNPEP	219956099	1.000000	0.71417	1.000000	0.80357	0.654000	0.38779	7.111000	0.77077	2.553000	0.86117	0.462000	0.41574	GAG	DNPEP	-	pfam_Peptidase_M18,prints_Peptidase_M18	ENSG00000123992		0.597	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DNPEP	HGNC	protein_coding	OTTHUMT00000130212.1	53	0.00	0	C	NM_012100		220247855	220247855	-1	no_errors	ENST00000273075	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	1.000	G
DOCK6	57572	genome.wustl.edu	37	19	11361688	11361688	+	Silent	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:11361688C>G	ENST00000294618.7	-	6	593	c.582G>C	c.(580-582)ctG>ctC	p.L194L		NM_020812.3	NP_065863.2	Q96HP0	DOCK6_HUMAN	dedicator of cytokinesis 6	194					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(1)|endometrium(11)|large_intestine(8)|liver(2)|lung(9)|ovary(4)|prostate(1)|skin(1)|urinary_tract(1)	39						CCAGGTTCCTCAGGTCGAAGA	0.627																																						dbGAP											0													29.0	34.0	32.0					19																	11361688		1966	4152	6118	-	-	-	SO:0001819	synonymous_variant	0				CCDS45975.1	19p13.2	2011-08-04			ENSG00000130158	ENSG00000130158			19189	protein-coding gene	gene with protein product		614194				12432077	Standard	NM_020812		Approved	KIAA1395, ZIR1	uc002mqs.5	Q96HP0		ENST00000294618.7:c.582G>C	19.37:g.11361688C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X5|Q7Z7P4|Q9P2F2	Silent	SNP	pfam_DOCK,pfam_DUF3398	p.L194	ENST00000294618.7	37	c.582	CCDS45975.1	19																																																																																			DOCK6	-	NULL	ENSG00000130158		0.627	DOCK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK6	HGNC	protein_coding	OTTHUMT00000453155.1	19	0.00	0	C	NM_020812		11361688	11361688	-1	no_errors	ENST00000294618	ensembl	human	known	69_37n	silent	10	47.37	9	SNP	1.000	G
DONSON	29980	genome.wustl.edu	37	21	34951791	34951791	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr21:34951791G>C	ENST00000303071.5	-	9	1494	c.1428C>G	c.(1426-1428)atC>atG	p.I476M	DONSON_ENST00000303113.6_Missense_Mutation_p.I462M|DONSON_ENST00000432378.1_Intron|DONSON_ENST00000453626.1_Intron	NM_017613.3	NP_060083.1	Q9NYP3	DONS_HUMAN	downstream neighbor of SON	476					multicellular organismal development (GO:0007275)	nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|ovary(1)	11						AATGAGGCATGATAGGACCTG	0.423																																						dbGAP											0													155.0	139.0	144.0					21																	34951791		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000002	CCDS13632.1	21q22.1	2008-07-31			ENSG00000159147	ENSG00000159147			2993	protein-coding gene	gene with protein product		611428		C21orf60		10773462, 10950926	Standard	NM_017613		Approved	B17, C2TA, DKFZP434M035	uc002ysk.4	Q9NYP3	OTTHUMG00000065904	ENST00000303071.5:c.1428C>G	21.37:g.34951791G>C	ENSP00000307143:p.Ile476Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC53|Q9NSR9|Q9NVZ5|Q9NYP1|Q9NYP2	Nonsense_Mutation	SNP	NULL	p.S447*	ENST00000303071.5	37	c.1340	CCDS13632.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.40|18.40	3.615946|3.615946	0.66672|0.66672	.|.	.|.	ENSG00000159147|ENSG00000159147	ENST00000303113;ENST00000303071|ENST00000437395	.|.	.|.	.|.	5.82|5.82	3.01|3.01	0.34805|0.34805	.|.	0.624360|.	0.17374|.	N|.	0.176550|.	T|.	0.61813|.	0.2377|.	M|M	0.72894|0.72894	2.215|2.215	0.80722|0.80722	D|D	1|1	P;P|.	0.52463|.	0.953;0.953|.	P;P|.	0.57057|.	0.812;0.812|.	T|.	0.56792|.	-0.7920|.	9|.	0.72032|.	D|.	0.01|.	-1.7334|-1.7334	6.2719|6.2719	0.20959|0.20959	0.2131:0.1337:0.6532:0.0|0.2131:0.1337:0.6532:0.0	.|.	462;476|.	F8W8A5;Q9NYP3|.	.;DONS_HUMAN|.	M|X	462;476|447	.|.	ENSP00000307143:I476M|.	I|S	-|-	3|2	3|0	DONSON|DONSON	33873661|33873661	1.000000|1.000000	0.71417|0.71417	0.830000|0.830000	0.32933|0.32933	0.950000|0.950000	0.60333|0.60333	1.972000|1.972000	0.40540|0.40540	0.367000|0.367000	0.24454|0.24454	0.467000|0.467000	0.42956|0.42956	ATC|TCA	DONSON	-	NULL	ENSG00000159147		0.423	DONSON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DONSON	HGNC	protein_coding	OTTHUMT00000141184.1	73	0.00	0	G	NM_017613		34951791	34951791	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000437395	ensembl	human	novel	69_37n	nonsense	76	26.21	27	SNP	0.995	C
DSN1	79980	genome.wustl.edu	37	20	35381196	35381196	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:35381196G>A	ENST00000426836.1	-	11	1438	c.1066C>T	c.(1066-1068)Cag>Tag	p.Q356*	DSN1_ENST00000373734.4_Nonsense_Mutation_p.Q249*|DSN1_ENST00000473615.1_5'UTR|DSN1_ENST00000448110.2_Nonsense_Mutation_p.Q340*|DSN1_ENST00000373740.3_Nonsense_Mutation_p.Q284*|DSN1_ENST00000373750.4_Nonsense_Mutation_p.Q356*|DSN1_ENST00000373745.3_Nonsense_Mutation_p.Q356*	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	356					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				TAAAGTCACTGACAAGATCCA	0.502																																						dbGAP											0													175.0	149.0	158.0					20																	35381196		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.1066C>T	20.37:g.35381196G>A	ENSP00000389810:p.Gln356*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Nonsense_Mutation	SNP	pfam_Mtw1_DSN1	p.Q356*	ENST00000426836.1	37	c.1066	CCDS13286.1	20	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415409	0.83449	.	.	ENSG00000149636	ENST00000426836;ENST00000373745;ENST00000448110;ENST00000373733;ENST00000373750;ENST00000373740;ENST00000373734	.	.	.	4.78	1.8	0.24995	.	0.379936	0.19507	N	0.112599	.	.	.	.	.	.	0.18873	N	0.999981	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.669	6.0414	0.19736	0.3115:0.0:0.6885:0.0	.	.	.	.	X	356;356;340;289;356;284;249	.	ENSP00000362838:Q289X	Q	-	1	0	DSN1	34814610	0.601000	0.26907	0.864000	0.33941	0.017000	0.09413	1.394000	0.34509	0.746000	0.32786	-0.157000	0.13467	CAG	DSN1	-	NULL	ENSG00000149636		0.502	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSN1	HGNC	protein_coding	OTTHUMT00000079043.2	97	0.00	0	G	NM_024918		35381196	35381196	-1	no_errors	ENST00000373745	ensembl	human	known	69_37n	nonsense	114	28.75	46	SNP	0.532	A
DUOX2	50506	genome.wustl.edu	37	15	45389584	45389584	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:45389584G>A	ENST00000603300.1	-	29	3901	c.3699C>T	c.(3697-3699)atC>atT	p.I1233I	DUOX2_ENST00000389039.6_Silent_p.I1233I	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1233	Ferric oxidoreductase.|Interaction with TXNDC11. {ECO:0000250}.				adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		TGCCATGGATGATGAGCTGGA	0.602																																						dbGAP											0													93.0	88.0	90.0					15																	45389584		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.3699C>T	15.37:g.45389584G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.I1233	ENST00000603300.1	37	c.3699	CCDS10117.1	15																																																																																			DUOX2	-	pfam_Fe3_Rdtase_TM_dom	ENSG00000140279		0.602	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	HGNC	protein_coding		82	0.00	0	G	NM_014080		45389584	45389584	-1	no_errors	ENST00000389039	ensembl	human	known	69_37n	silent	86	23.21	26	SNP	1.000	A
EBF1	1879	genome.wustl.edu	37	5	158139314	158139314	+	Missense_Mutation	SNP	G	G	A	rs556574598		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:158139314G>A	ENST00000313708.6	-	14	1679	c.1397C>T	c.(1396-1398)tCa>tTa	p.S466L	EBF1_ENST00000517373.1_Intron|EBF1_ENST00000518836.1_5'UTR|EBF1_ENST00000380654.4_Missense_Mutation_p.S435L	NM_024007.3	NP_076870.1	Q9UH73	COE1_HUMAN	early B-cell factor 1	466	Pro/Ser/Thr-rich.				multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)		HMGA2/EBF1(2)	breast(3)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(18)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	42	Renal(175;0.00196)	Acute lymphoblastic leukemia(3;2.99e-06)|all_hematologic(3;0.000772)|Medulloblastoma(196;0.037)|all_neural(177;0.143)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCGTGTGGTGATACGCTGCT	0.582			T	HMGA2	lipoma								G|||	1	0.000199681	0.0	0.0	5008	,	,		18987	0.0		0.001	False		,,,				2504	0.0					dbGAP		Dom	yes		5	5q34	1879	early B-cell factor 1		M	0													100.0	77.0	85.0					5																	158139314		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF208502	CCDS4343.1	5q34	2008-02-05	2006-09-26	2006-09-26	ENSG00000164330	ENSG00000164330			3126	protein-coding gene	gene with protein product		164343	"""early B-cell factor"""	EBF		8012110	Standard	NM_024007		Approved	OLF1	uc010jip.3	Q9UH73	OTTHUMG00000130304	ENST00000313708.6:c.1397C>T	5.37:g.158139314G>A	ENSP00000322898:p.Ser466Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW11	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,superfamily_HLH_DNA-bd,smart_IPT_TIG_rcpt	p.S466L	ENST00000313708.6	37	c.1397	CCDS4343.1	5	.	.	.	.	.	.	.	.	.	.	G	28.4	4.912678	0.92178	.	.	ENSG00000164330	ENST00000318060;ENST00000313708;ENST00000380654	T;T	0.52754	0.65;0.65	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	T	0.66742	0.2820	M	0.67700	2.07	0.80722	D	1	D;D;P;D	0.60160	0.975;0.987;0.914;0.986	P;D;P;D	0.66196	0.776;0.942;0.52;0.913	T	0.70676	-0.4806	10	0.66056	D	0.02	-2.828	18.1731	0.89753	0.0:0.0:1.0:0.0	.	466;453;466;435	A8K0Z7;B4E2U8;Q9UH73;Q9UH73-2	.;.;COE1_HUMAN;.	L	466;466;435	ENSP00000322898:S466L;ENSP00000370029:S435L	ENSP00000322898:S466L	S	-	2	0	EBF1	158071892	1.000000	0.71417	0.981000	0.43875	0.929000	0.56500	9.804000	0.99143	2.357000	0.79964	0.650000	0.86243	TCA	EBF1	-	NULL	ENSG00000164330		0.582	EBF1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EBF1	HGNC	protein_coding	OTTHUMT00000252649.1	76	0.00	0	G	NM_024007		158139314	158139314	-1	no_errors	ENST00000313708	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	1.000	A
ECM1	1893	genome.wustl.edu	37	1	150482631	150482631	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:150482631C>G	ENST00000369047.4	+	5	483	c.358C>G	c.(358-360)Ctc>Gtc	p.L120V	ECM1_ENST00000470432.1_3'UTR|ECM1_ENST00000346569.6_Missense_Mutation_p.L120V|ECM1_ENST00000369049.4_Missense_Mutation_p.L147V	NM_004425.3	NP_004416.2	Q16610	ECM1_HUMAN	extracellular matrix protein 1	120					angiogenesis (GO:0001525)|biomineral tissue development (GO:0031214)|inflammatory response (GO:0006954)|negative regulation of bone mineralization (GO:0030502)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of peptidase activity (GO:0010466)|ossification (GO:0001503)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of T cell migration (GO:2000404)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type 2 immune response (GO:0002828)|signal transduction (GO:0007165)	extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	enzyme binding (GO:0019899)|laminin binding (GO:0043236)|protease binding (GO:0002020)|protein C-terminus binding (GO:0008022)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|urinary_tract(1)	22	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0757)|all cancers(9;1.29e-21)|BRCA - Breast invasive adenocarcinoma(12;0.000734)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GCTGCCCTCTCTCCAGCACCC	0.592																																					Melanoma(156;1696 2560 11093 19685)	dbGAP											0													142.0	143.0	143.0					1																	150482631		2203	4300	6503	-	-	-	SO:0001583	missense	0			U68186	CCDS953.1, CCDS954.1, CCDS55632.1	1q21	2008-02-05			ENSG00000143369	ENSG00000143369			3153	protein-coding gene	gene with protein product		602201				9367673, 9501329	Standard	NM_004425		Approved		uc001eus.3	Q16610	OTTHUMG00000012806	ENST00000369047.4:c.358C>G	1.37:g.150482631C>G	ENSP00000358043:p.Leu120Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8S0|B4DW49|B4DY60|O43266|Q5T5G4|Q5T5G5|Q5T5G6|Q8IZ60	Missense_Mutation	SNP	pfam_ECM1,superfamily_Serum_albumin-like	p.L147V	ENST00000369047.4	37	c.439	CCDS953.1	1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.580128	0.00879	.	.	ENSG00000143369	ENST00000369049;ENST00000369047;ENST00000346569	T;T;T	0.75821	-0.97;-0.97;-0.97	4.52	2.54	0.30619	.	0.443007	0.21657	N	0.071083	T	0.35393	0.0930	N	0.22421	0.69	0.09310	N	1	P;P;P;P;B;P	0.46656	0.771;0.729;0.882;0.698;0.318;0.698	B;B;B;B;B;B	0.41691	0.315;0.269;0.364;0.302;0.069;0.302	T	0.16719	-1.0393	10	0.15952	T	0.53	-2.2813	6.2866	0.21037	0.0:0.7107:0.186:0.1032	.	42;49;147;120;120;120	B7ZAS5;Q16610-3;Q16610-4;C8CHS3;Q16610-2;Q16610	.;.;.;.;.;ECM1_HUMAN	V	147;120;120	ENSP00000358045:L147V;ENSP00000358043:L120V;ENSP00000271630:L120V	ENSP00000271630:L120V	L	+	1	0	ECM1	148749255	0.000000	0.05858	0.909000	0.35828	0.011000	0.07611	0.223000	0.17719	1.130000	0.42092	0.462000	0.41574	CTC	ECM1	-	pfam_ECM1	ENSG00000143369		0.592	ECM1-011	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM1	HGNC	protein_coding	OTTHUMT00000035832.2	72	0.00	0	C	NM_004425		150482631	150482631	+1	no_errors	ENST00000369049	ensembl	human	known	69_37n	missense	86	15.69	16	SNP	0.030	G
EFCAB6	64800	genome.wustl.edu	37	22	44178059	44178059	+	Splice_Site	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:44178059C>T	ENST00000262726.7	-	3	393		c.e3+1		EFCAB6_ENST00000356087.4_Splice_Site|EFCAB6_ENST00000358439.4_Splice_Site|EFCAB6_ENST00000396231.2_Intron	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				TGAATACTTACTTGAAGAAGA	0.338																																						dbGAP											0													173.0	162.0	166.0					22																	44178059		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.139+1G>A	22.37:g.44178059C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Splice_Site	SNP	-	e1+1	ENST00000262726.7	37	c.139+1	CCDS14049.1	22	.	.	.	.	.	.	.	.	.	.	C	10.88	1.474130	0.26423	.	.	ENSG00000186976	ENST00000262726;ENST00000358439;ENST00000356087	.	.	.	4.47	4.47	0.54385	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8407	0.57800	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	EFCAB6	42509392	0.984000	0.35163	0.996000	0.52242	0.197000	0.23852	2.921000	0.48852	2.485000	0.83878	0.655000	0.94253	.	EFCAB6	-	-	ENSG00000186976		0.338	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB6	HGNC	protein_coding	OTTHUMT00000353176.1	104	0.00	0	C	NM_022785	Intron	44178059	44178059	-1	no_errors	ENST00000262726	ensembl	human	known	69_37n	splice_site	80	33.33	40	SNP	0.995	T
EIF2AK3	9451	genome.wustl.edu	37	2	88857341	88857341	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:88857341G>A	ENST00000303236.3	-	17	3565	c.3264C>T	c.(3262-3264)ctC>ctT	p.L1088L	AC104134.2_ENST00000413234.1_RNA|EIF2AK3_ENST00000419748.1_Silent_p.L937L	NM_004836.5	NP_004827.4	Q9NZJ5	E2AK3_HUMAN	eukaryotic translation initiation factor 2-alpha kinase 3	1088					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|bone mineralization (GO:0030282)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|chondrocyte development (GO:0002063)|endocrine pancreas development (GO:0031018)|endoplasmic reticulum organization (GO:0007029)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|fat cell differentiation (GO:0045444)|insulin secretion (GO:0030073)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|lactation (GO:0007595)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of myelination (GO:0031642)|negative regulation of translation (GO:0017148)|negative regulation of translational initiation in response to stress (GO:0032057)|ossification (GO:0001503)|positive regulation of protein binding (GO:0032092)|positive regulation of signal transduction (GO:0009967)|protein autophosphorylation (GO:0046777)|protein homooligomerization (GO:0051260)|protein phosphorylation (GO:0006468)|regulation of fatty acid metabolic process (GO:0019217)|response to endoplasmic reticulum stress (GO:0034976)|skeletal system development (GO:0001501)|SREBP signaling pathway (GO:0032933)|translation (GO:0006412)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|eukaryotic translation initiation factor 2alpha kinase activity (GO:0004694)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activity (GO:0004674)			ovary(3)	3						ACCTCTGTCTGAGCACTGTTT	0.453																																					GBM(138;671 1851 16235 39058 45249)	dbGAP											0													257.0	243.0	248.0					2																	88857341		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF110146	CCDS33241.1	2p12	2008-05-21			ENSG00000172071	ENSG00000172071			3255	protein-coding gene	gene with protein product		604032				10026192, 10575235	Standard	NM_004836		Approved	PEK, PERK	uc002stc.4	Q9NZJ5	OTTHUMG00000155046	ENST00000303236.3:c.3264C>T	2.37:g.88857341G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVH1|A0AVH2|B2RCU9|O95846|Q53QY0|Q53SB1	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L1088	ENST00000303236.3	37	c.3264	CCDS33241.1	2																																																																																			EIF2AK3	-	superfamily_Kinase-like_dom	ENSG00000172071		0.453	EIF2AK3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	EIF2AK3	HGNC	protein_coding	OTTHUMT00000338233.2	171	0.00	0	G	NM_004836		88857341	88857341	-1	no_errors	ENST00000303236	ensembl	human	known	69_37n	silent	138	30.65	61	SNP	1.000	A
EIF3D	8664	genome.wustl.edu	37	22	36907562	36907562	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:36907562C>G	ENST00000216190.8	-	14	1991	c.1621G>C	c.(1621-1623)Gag>Cag	p.E541Q	EIF3D_ENST00000478547.1_5'UTR|EIF3D_ENST00000541106.1_Missense_Mutation_p.E492Q|EIF3D_ENST00000405442.1_Missense_Mutation_p.E541Q	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D											cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						tcttcttcctcttcttcctcc	0.522											OREG0026522	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													67.0	58.0	61.0					22																	36907562		2203	4300	6503	-	-	-	SO:0001583	missense	0			U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.1621G>C	22.37:g.36907562C>G	ENSP00000216190:p.Glu541Gln	Somatic	866	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EIF-3_zeta,pirsf_EIF-3_zeta	p.E541Q	ENST00000216190.8	37	c.1621	CCDS13930.1	22	.	.	.	.	.	.	.	.	.	.	C	9.146	1.015146	0.19355	.	.	ENSG00000100353	ENST00000216190;ENST00000397177;ENST00000541106;ENST00000405442	.	.	.	5.83	5.83	0.93111	.	0.154837	0.56097	D	0.000026	T	0.50188	0.1601	N	0.08118	0	0.80722	D	1	D;D	0.57899	0.981;0.981	D;D	0.65140	0.932;0.932	T	0.40590	-0.9555	9	0.06891	T	0.86	-17.5414	19.7245	0.96157	0.0:1.0:0.0:0.0	.	492;541	B4DVY1;O15371	.;EIF3D_HUMAN	Q	541;526;492;541	.	ENSP00000216190:E541Q	E	-	1	0	EIF3D	35237508	1.000000	0.71417	0.994000	0.49952	0.747000	0.42532	7.093000	0.76937	2.757000	0.94681	0.591000	0.81541	GAG	EIF3D	-	pirsf_EIF-3_zeta	ENSG00000100353		0.522	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3D	HGNC	protein_coding	OTTHUMT00000319026.1	49	0.00	0	C			36907562	36907562	-1	no_errors	ENST00000216190	ensembl	human	known	69_37n	missense	57	29.63	24	SNP	0.982	G
ENPP7	339221	genome.wustl.edu	37	17	77710899	77710899	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:77710899G>A	ENST00000328313.5	+	4	1307	c.1086G>A	c.(1084-1086)atG>atA	p.M362I		NM_178543.3	NP_848638.3			ectonucleotide pyrophosphatase/phosphodiesterase 7											breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(12)|ovary(2)|prostate(6)|skin(3)	34			OV - Ovarian serous cystadenocarcinoma(97;0.016)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			ACATGGACATGAAGACCATCT	0.612																																						dbGAP											0													107.0	91.0	96.0					17																	77710899		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY230663	CCDS11763.1	17q25.3	2014-04-09			ENSG00000182156	ENSG00000182156			23764	protein-coding gene	gene with protein product	"""alkaline sphingomyelinase"""					12885774	Standard	NM_178543		Approved	alk-SMase, NPP7	uc002jxa.3	Q6UWV6	OTTHUMG00000177462	ENST00000328313.5:c.1086G>A	17.37:g.77710899G>A	ENSP00000332656:p.Met362Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Metalloenzyme,superfamily_Alkaline_phosphatase_core	p.M362I	ENST00000328313.5	37	c.1086	CCDS11763.1	17	.	.	.	.	.	.	.	.	.	.	G	23.3	4.401992	0.83120	.	.	ENSG00000182156	ENST00000328313	T	0.77620	-1.11	3.14	3.14	0.36123	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.88738	0.6518	M	0.90145	3.09	0.58432	D	0.999999	D	0.56521	0.976	D	0.65233	0.933	D	0.91678	0.5356	10	0.87932	D	0	-45.1127	14.774	0.69703	0.0:0.0:1.0:0.0	.	362	Q6UWV6	ENPP7_HUMAN	I	362	ENSP00000332656:M362I	ENSP00000332656:M362I	M	+	3	0	ENPP7	75325494	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	9.436000	0.97532	1.762000	0.52044	0.561000	0.74099	ATG	ENPP7	-	superfamily_Alkaline_phosphatase_core	ENSG00000182156		0.612	ENPP7-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	ENPP7	HGNC	protein_coding	OTTHUMT00000437038.1	35	0.00	0	G	NM_178543		77710899	77710899	+1	no_errors	ENST00000328313	ensembl	human	known	69_37n	missense	24	52.94	27	SNP	1.000	A
EIF4A3	9775	genome.wustl.edu	37	17	78110058	78110058	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:78110058G>A	ENST00000269349.3	-	10	1281	c.1060C>T	c.(1060-1062)Ctc>Ttc	p.L354F		NM_014740.3	NP_055555.1	P38919	IF4A3_HUMAN	eukaryotic translation initiation factor 4A3	354	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|cytokine-mediated signaling pathway (GO:0019221)|embryonic cranial skeleton morphogenesis (GO:0048701)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|mRNA binding (GO:0003729)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	10	all_neural(118;0.117)		OV - Ovarian serous cystadenocarcinoma(97;0.0292)|BRCA - Breast invasive adenocarcinoma(99;0.139)			TTATTAGGGAGATCATAGTTA	0.413																																						dbGAP											0													107.0	104.0	105.0					17																	78110058		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004386	CCDS11767.1	17q25.3	2010-02-10	2010-02-10	2006-11-27		ENSG00000141543		"""DEAD-boxes"""	18683	protein-coding gene	gene with protein product		608546	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 48"", ""eukaryotic translation initiation factor 4A, isoform 3"""	DDX48		10623621, 14730019	Standard	NM_014740		Approved	KIAA0111, EIF4AIII	uc002jxs.3	P38919		ENST00000269349.3:c.1060C>T	17.37:g.78110058G>A	ENSP00000269349:p.Leu354Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15033|Q6IBQ2|Q96A18	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.L354F	ENST00000269349.3	37	c.1060	CCDS11767.1	17	.	.	.	.	.	.	.	.	.	.	G	14.05	2.418372	0.42918	.	.	ENSG00000141543	ENST00000269349	T	0.77489	-1.1	4.03	2.97	0.34412	Helicase, C-terminal (3);	0.000000	0.64402	D	0.000003	T	0.80369	0.4610	L	0.41079	1.255	0.80722	D	1	D	0.69078	0.997	D	0.79108	0.992	T	0.80688	-0.1271	10	0.87932	D	0	-22.1918	8.5012	0.33159	0.13:0.0:0.87:0.0	.	354	P38919	IF4A3_HUMAN	F	354	ENSP00000269349:L354F	ENSP00000269349:L354F	L	-	1	0	EIF4A3	75724653	1.000000	0.71417	1.000000	0.80357	0.119000	0.20118	2.496000	0.45346	2.110000	0.64415	0.561000	0.74099	CTC	EIF4A3	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000141543		0.413	EIF4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF4A3	HGNC	protein_coding	OTTHUMT00000437446.1	103	0.00	0	G	NM_014740		78110058	78110058	-1	no_errors	ENST00000269349	ensembl	human	known	69_37n	missense	116	14.71	20	SNP	1.000	A
EPB41	2035	genome.wustl.edu	37	1	29314172	29314172	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:29314172G>C	ENST00000343067.4	+	2	350	c.223G>C	c.(223-225)Gaa>Caa	p.E75Q	EPB41_ENST00000347529.3_Missense_Mutation_p.E75Q|EPB41_ENST00000398863.2_Missense_Mutation_p.E75Q|EPB41_ENST00000349460.4_5'UTR|Y_RNA_ENST00000383977.1_RNA|EPB41_ENST00000373798.1_Missense_Mutation_p.E75Q|EPB41_ENST00000373797.1_Missense_Mutation_p.E75Q|EPB41_ENST00000373800.3_5'UTR|EPB41_ENST00000356093.2_Missense_Mutation_p.E75Q	NM_001166005.1	NP_001159477.1	P11171	41_HUMAN	erythrocyte membrane protein band 4.1	75					actin cytoskeleton organization (GO:0030036)|blood circulation (GO:0008015)|cortical actin cytoskeleton organization (GO:0030866)|positive regulation of protein binding (GO:0032092)	cortical cytoskeleton (GO:0030863)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	1-phosphatidylinositol binding (GO:0005545)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|urinary_tract(1)	14		Colorectal(325;3.46e-05)|Prostate(1639;0.000244)|Lung NSC(340;0.00328)|all_lung(284;0.00412)|Breast(348;0.00765)|all_neural(195;0.0199)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)|Medulloblastoma(700;0.123)		Colorectal(126;3.12e-07)|COAD - Colon adenocarcinoma(152;1.21e-05)|STAD - Stomach adenocarcinoma(196;0.00395)|KIRC - Kidney renal clear cell carcinoma(1967;0.0249)|BRCA - Breast invasive adenocarcinoma(304;0.0289)|READ - Rectum adenocarcinoma(331;0.0757)		GCGGACATCAGAAAGCAGAGG	0.443																																						dbGAP											0													158.0	150.0	153.0					1																	29314172		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039079	CCDS330.1, CCDS331.1, CCDS332.1, CCDS53288.1, CCDS53289.1	1p33-p32	2014-05-09	2014-05-09		ENSG00000159023	ENSG00000159023			3377	protein-coding gene	gene with protein product		130500	"""elliptocytosis 1, RH-linked"""	EL1			Standard	NM_001166005		Approved	4.1R	uc001brm.2	P11171	OTTHUMG00000003644	ENST00000343067.4:c.223G>C	1.37:g.29314172G>C	ENSP00000345259:p.Glu75Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALH8|B1ALH9|D3DPM9|D3DPN0|P11176|Q14245|Q5TB35|Q5VXN8|Q8IXV9|Q9Y578|Q9Y579	Missense_Mutation	SNP	pirsf_Band_41_protein,pfam_Band_4.1_C,pfam_SAB,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.E75Q	ENST00000343067.4	37	c.223	CCDS53288.1	1	.	.	.	.	.	.	.	.	.	.	G	18.84	3.709652	0.68730	.	.	ENSG00000159023	ENST00000358989;ENST00000343067;ENST00000356093;ENST00000398863;ENST00000398861;ENST00000398865;ENST00000347529;ENST00000373798;ENST00000373797	D;D;D;D;D;D	0.86562	-2.14;-2.1;-1.99;-2.0;-2.14;-2.11	5.6	5.6	0.85130	.	0.244807	0.36482	N	0.002561	D	0.84492	0.5484	L	0.27053	0.805	0.43226	D	0.995117	B;B;B;B;B	0.33748	0.298;0.206;0.204;0.423;0.313	B;B;B;B;B	0.40534	0.178;0.077;0.221;0.332;0.133	D	0.84211	0.0456	10	0.54805	T	0.06	.	18.6548	0.91448	0.0:0.0:1.0:0.0	.	75;75;75;75;75	C9JTS2;P11171;P11171-2;P11171-7;P11171-5	.;41_HUMAN;.;.;.	Q	92;75;75;75;75;75;75;75;75	ENSP00000345259:E75Q;ENSP00000348397:E75Q;ENSP00000381839:E75Q;ENSP00000290100:E75Q;ENSP00000362904:E75Q;ENSP00000362903:E75Q	ENSP00000345259:E75Q	E	+	1	0	EPB41	29186759	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	6.507000	0.73717	2.633000	0.89246	0.650000	0.86243	GAA	EPB41	-	pirsf_Band_41_protein	ENSG00000159023		0.443	EPB41-201	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41	HGNC	protein_coding	OTTHUMT00000010312.1	70	0.00	0	G	NM_203342		29314172	29314172	+1	no_errors	ENST00000343067	ensembl	human	known	69_37n	missense	23	48.89	22	SNP	1.000	C
EPB41L4A	64097	genome.wustl.edu	37	5	111531377	111531377	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:111531377C>G	ENST00000261486.5	-	16	1681	c.1405G>C	c.(1405-1407)Gat>Cat	p.D469H	EPB41L4A_ENST00000507810.1_5'UTR|CTC-459M5.2_ENST00000515563.1_RNA|CTC-459M5.2_ENST00000506875.1_RNA	NM_022140.3	NP_071423	Q9HCS5	E41LA_HUMAN	erythrocyte membrane protein band 4.1 like 4A	469						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(2)|skin(1)	34		all_cancers(142;4.93e-06)|all_epithelial(76;2.28e-08)|Prostate(80;0.000244)|Colorectal(10;0.000788)|Ovarian(225;0.0448)|Lung NSC(167;0.126)|all_lung(232;0.135)		OV - Ovarian serous cystadenocarcinoma(64;6.24e-09)|Epithelial(69;1.43e-07)|all cancers(49;2.78e-05)|COAD - Colon adenocarcinoma(37;0.0467)|Colorectal(14;0.0791)		TGCTTAAGATCTGAATCTTCA	0.383																																						dbGAP											0													123.0	110.0	114.0					5																	111531377		1830	4084	5914	-	-	-	SO:0001583	missense	0			AB030240	CCDS43350.1	5q21.3	2008-02-05			ENSG00000129595	ENSG00000129595			13278	protein-coding gene	gene with protein product		612141				10874211	Standard	XM_005272043		Approved	NBL4	uc003kpv.1	Q9HCS5	OTTHUMG00000162902	ENST00000261486.5:c.1405G>C	5.37:g.111531377C>G	ENSP00000261486:p.Asp469His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FUI6	Missense_Mutation	SNP	pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_FERM-adjacent,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.D469H	ENST00000261486.5	37	c.1405	CCDS43350.1	5	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093100	0.56075	.	.	ENSG00000129595	ENST00000261486	D	0.83419	-1.72	4.84	4.84	0.62591	.	0.280184	0.36815	N	0.002398	D	0.85287	0.5662	L	0.35414	1.06	0.38975	D	0.958835	P;D	0.89917	0.93;1.0	P;D	0.87578	0.459;0.998	D	0.83716	0.0190	10	0.30854	T	0.27	.	13.6396	0.62241	0.0:1.0:0.0:0.0	.	469;96	Q9HCS5;Q8N8X1	E41LA_HUMAN;.	H	469	ENSP00000261486:D469H	ENSP00000261486:D469H	D	-	1	0	EPB41L4A	111559276	0.997000	0.39634	0.992000	0.48379	0.944000	0.59088	3.842000	0.55858	2.680000	0.91292	0.591000	0.81541	GAT	EPB41L4A	-	NULL	ENSG00000129595		0.383	EPB41L4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPB41L4A	HGNC	protein_coding	OTTHUMT00000370969.1	206	0.00	0	C			111531377	111531377	-1	no_errors	ENST00000261486	ensembl	human	known	69_37n	missense	209	29.39	87	SNP	0.997	G
EPN1	29924	genome.wustl.edu	37	19	56189070	56189070	+	Intron	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:56189070C>G	ENST00000270460.6	+	2	210				EPN1_ENST00000085079.7_Intron|EPN1_ENST00000411543.2_Missense_Mutation_p.L68V|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.12_ENST00000585940.1_RNA	NM_001130072.1	NP_001123544.1	Q9Y6I3	EPN1_HUMAN	epsin 1						embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|female pregnancy (GO:0007565)|in utero embryonic development (GO:0001701)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|Notch signaling pathway (GO:0007219)	coated pit (GO:0005905)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	17		Colorectal(82;0.00244)|Ovarian(87;0.133)		GBM - Glioblastoma multiforme(193;0.112)		GTCTGGTCTTCTGGCTTCCCC	0.577																																						dbGAP											0													113.0	109.0	110.0					19																	56189070		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF073727	CCDS46198.1, CCDS46199.1, CCDS46200.1	19q13.42	2014-08-12			ENSG00000063245	ENSG00000063245			21604	protein-coding gene	gene with protein product		607262				9723620, 10557078	Standard	NM_001130072		Approved		uc002qlx.3	Q9Y6I3	OTTHUMG00000180911	ENST00000270460.6:c.-101-823C>G	19.37:g.56189070C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86ST3|Q9HA18	Missense_Mutation	SNP	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.L68V	ENST00000270460.6	37	c.202	CCDS46199.1	19	.	.	.	.	.	.	.	.	.	.	C	8.757	0.922591	0.18056	.	.	ENSG00000063245	ENST00000411543	T	0.17370	2.28	2.5	0.0381	0.14199	.	.	.	.	.	T	0.10723	0.0262	.	.	.	0.09310	N	1	B	0.24092	0.097	B	0.16722	0.016	T	0.32640	-0.9899	8	0.87932	D	0	.	2.3314	0.04237	0.0:0.3884:0.3216:0.29	.	68	Q9Y6I3-1	.	V	68	ENSP00000406209:L68V	ENSP00000406209:L68V	L	+	1	2	EPN1	60880882	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.297000	0.19101	0.021000	0.15133	0.467000	0.42956	CTG	EPN1	-	NULL	ENSG00000063245		0.577	EPN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EPN1	HGNC	protein_coding	OTTHUMT00000453610.1	104	0.00	0	C	NM_013333		56189070	56189070	+1	no_errors	ENST00000411543	ensembl	human	known	69_37n	missense	84	29.41	35	SNP	0.000	G
EPN2	22905	genome.wustl.edu	37	17	19215401	19215401	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:19215401C>T	ENST00000314728.5	+	6	1400	c.916C>T	c.(916-918)Cag>Tag	p.Q306*	EPN2_ENST00000395618.3_Nonsense_Mutation_p.Q21*|EPN2_ENST00000571254.1_Nonsense_Mutation_p.Q249*|EPN2_ENST00000347697.2_Nonsense_Mutation_p.Q249*|EPN2_ENST00000395626.1_Nonsense_Mutation_p.Q306*|EPN2_ENST00000575595.1_Nonsense_Mutation_p.Q21*|EPN2_ENST00000395620.2_Nonsense_Mutation_p.Q249*	NM_014964.4	NP_055779.2	O95208	EPN2_HUMAN	epsin 2	306					embryonic organ development (GO:0048568)|endocytosis (GO:0006897)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)	clathrin coat of endocytic vesicle (GO:0030128)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	lipid binding (GO:0008289)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	19	all_cancers(12;3.11e-05)|all_epithelial(12;0.00121)|Hepatocellular(7;0.00345)|Breast(13;0.143)					CCTCAGATTACAGATGGCCCT	0.468																																						dbGAP											0													143.0	148.0	146.0					17																	19215401		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB028988	CCDS11203.1, CCDS11204.1, CCDS42277.1	17p11.2	2012-11-19			ENSG00000072134	ENSG00000072134			18639	protein-coding gene	gene with protein product	"""Eps15 binding protein"""	607263				10567358	Standard	NM_014964		Approved	KIAA1065, EHB21	uc002gvd.4	O95208	OTTHUMG00000178447	ENST00000314728.5:c.916C>T	17.37:g.19215401C>T	ENSP00000320543:p.Gln306*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTV8|B3KRX8|E9PBC2|O95207|Q52LD0|Q9H7Z2|Q9UPT7	Nonsense_Mutation	SNP	pfam_Epsin_dom_N,pfam_ANTH,superfamily_ENTH_VHS,smart_Epsin-like_N,smart_Ubiquitin-int_motif,pfscan_Epsin-like_N,pfscan_Ubiquitin-int_motif	p.Q306*	ENST00000314728.5	37	c.916	CCDS11203.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.594399	0.97692	.	.	ENSG00000072134	ENST00000347697;ENST00000395618;ENST00000314728;ENST00000395628;ENST00000395620;ENST00000395626	.	.	.	5.39	5.39	0.77823	.	0.105871	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-19.8361	19.1533	0.93499	0.0:1.0:0.0:0.0	.	.	.	.	X	249;21;306;249;249;306	.	ENSP00000320543:Q306X	Q	+	1	0	EPN2	19155994	1.000000	0.71417	0.951000	0.38953	0.996000	0.88848	7.273000	0.78527	2.537000	0.85549	0.655000	0.94253	CAG	EPN2	-	smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	ENSG00000072134		0.468	EPN2-001	KNOWN	basic|CCDS	protein_coding	EPN2	HGNC	protein_coding	OTTHUMT00000132283.3	76	0.00	0	C	NM_014964		19215401	19215401	+1	no_errors	ENST00000314728	ensembl	human	known	69_37n	nonsense	51	43.96	40	SNP	1.000	T
ERCC6	2074	genome.wustl.edu	37	10	50678569	50678569	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:50678569C>G	ENST00000355832.5	-	18	3515	c.3437G>C	c.(3436-3438)aGc>aCc	p.S1146T	ERCC6_ENST00000465653.1_5'Flank|ERCC6_ENST00000542458.1_Missense_Mutation_p.S516T|RP11-123B3.2_ENST00000423283.1_RNA	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	1146					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						TTCATCAATGCTTTCATCACC	0.378								Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													99.0	92.0	94.0					10																	50678569		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.3437G>C	10.37:g.50678569C>G	ENSP00000348089:p.Ser1146Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.S1146T	ENST00000355832.5	37	c.3437	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	C	6.344	0.431490	0.12045	.	.	ENSG00000225830	ENST00000355832;ENST00000374129;ENST00000542458	D;T	0.82619	-1.63;-1.36	5.65	2.24	0.28232	.	.	.	.	.	T	0.73156	0.3551	L	0.55481	1.735	0.09310	N	1	B;B	0.26672	0.094;0.156	B;B	0.19666	0.016;0.026	T	0.55623	-0.8112	9	0.15952	T	0.53	-3.7733	4.5623	0.12166	0.0:0.5396:0.1876:0.2728	.	1146;523	Q03468;Q59FF6	ERCC6_HUMAN;.	T	1146;523;516	ENSP00000348089:S1146T;ENSP00000445134:S516T	ENSP00000348089:S1146T	S	-	2	0	ERCC6	50348575	0.000000	0.05858	0.002000	0.10522	0.028000	0.11728	-0.037000	0.12164	0.823000	0.34589	0.655000	0.94253	AGC	ERCC6	-	NULL	ENSG00000225830		0.378	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	115	0.00	0	C	NM_000124		50678569	50678569	-1	no_errors	ENST00000355832	ensembl	human	known	69_37n	missense	35	28.57	14	SNP	0.001	G
EVPL	2125	genome.wustl.edu	37	17	74013937	74013937	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:74013937C>T	ENST00000301607.3	-	14	1846	c.1593G>A	c.(1591-1593)atG>atA	p.M531I	EVPL_ENST00000586740.1_Missense_Mutation_p.M553I	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	531	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CCAGCCGGGTCATCTGTGTCA	0.677																																						dbGAP											0													47.0	50.0	49.0					17																	74013937		2203	4300	6503	-	-	-	SO:0001583	missense	0			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.1593G>A	17.37:g.74013937C>T	ENSP00000301607:p.Met531Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUV5	Missense_Mutation	SNP	pfam_Plectin_repeat,superfamily_Ferritin/RR-like,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.M531I	ENST00000301607.3	37	c.1593	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	C	17.20	3.327818	0.60743	.	.	ENSG00000167880	ENST00000301607	T	0.62105	0.05	4.88	4.88	0.63580	.	0.059131	0.64402	D	0.000001	T	0.56992	0.2023	L	0.54323	1.7	0.41890	D	0.990366	B;B	0.22480	0.036;0.07	B;B	0.21546	0.005;0.035	T	0.59710	-0.7403	10	0.66056	D	0.02	-59.3393	11.539	0.50655	0.0:0.9164:0.0:0.0836	.	553;531	B7ZLH8;Q92817	.;EVPL_HUMAN	I	531	ENSP00000301607:M531I	ENSP00000301607:M531I	M	-	3	0	EVPL	71525532	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.195000	0.51013	2.445000	0.82738	0.561000	0.74099	ATG	EVPL	-	NULL	ENSG00000167880		0.677	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	38	0.00	0	C	NM_001988		74013937	74013937	-1	no_errors	ENST00000301607	ensembl	human	known	69_37n	missense	13	51.85	14	SNP	1.000	T
F5	2153	genome.wustl.edu	37	1	169510871	169510871	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:169510871G>C	ENST00000367797.3	-	13	3658	c.3457C>G	c.(3457-3459)Ctc>Gtc	p.L1153V	F5_ENST00000367796.3_Missense_Mutation_p.L1158V	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1153	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	ATTTCACTGAGCTCTGGAGAA	0.478																																						dbGAP											0													200.0	206.0	204.0					1																	169510871		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.3457C>G	1.37:g.169510871G>C	ENSP00000356771:p.Leu1153Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.L1158V	ENST00000367797.3	37	c.3472	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	G	12.07	1.827056	0.32329	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	T;T	0.20881	2.04;2.04	4.83	-0.912	0.10504	.	1.010830	0.07949	N	0.980622	T	0.03053	0.0090	L	0.40543	1.245	0.23611	N	0.9973	P	0.41673	0.759	B	0.32211	0.142	T	0.32640	-0.9899	9	0.16420	T	0.52	0.3794	0.7551	0.00997	0.1903:0.1588:0.325:0.3259	.	1153	P12259	FA5_HUMAN	V	1153;1158	ENSP00000356771:L1153V;ENSP00000356770:L1158V	ENSP00000356770:L1158V	L	-	1	0	F5	167777495	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.143000	0.16115	0.172000	0.19760	0.638000	0.83543	CTC	F5	-	NULL	ENSG00000198734		0.478	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	123	0.00	0	G	NM_000130		169510871	169510871	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	102	22.14	29	SNP	0.000	C
FAM105A	54491	genome.wustl.edu	37	5	14601228	14601228	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:14601228G>A	ENST00000274217.3	+	2	339	c.219G>A	c.(217-219)ctG>ctA	p.L73L		NM_019018.2	NP_061891.1	Q9NUU6	F105A_HUMAN	family with sequence similarity 105, member A	73										large_intestine(3)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11	Lung NSC(4;0.00592)					GGCACAAGCTGAAATGGTAGG	0.388																																						dbGAP											0													179.0	170.0	173.0					5																	14601228		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3884.1	5p15.2	2014-02-24			ENSG00000145569	ENSG00000145569		"""OTU domain containing"""	25629	protein-coding gene	gene with protein product						12477932	Standard	NM_019018		Approved	FLJ11127, NET20	uc003jfj.3	Q9NUU6	OTTHUMG00000131056	ENST00000274217.3:c.219G>A	5.37:g.14601228G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53H50|Q9H037	Silent	SNP	prints_FAM105,prints_FAM105A	p.L73	ENST00000274217.3	37	c.219	CCDS3884.1	5																																																																																			FAM105A	-	NULL	ENSG00000145569		0.388	FAM105A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM105A	HGNC	protein_coding	OTTHUMT00000253710.1	97	0.00	0	G	NM_019018		14601228	14601228	+1	no_errors	ENST00000274217	ensembl	human	known	69_37n	silent	63	35.71	35	SNP	0.992	A
FAM120A	23196	genome.wustl.edu	37	9	96238576	96238576	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:96238576C>T	ENST00000277165.6	+	3	954	c.760C>T	c.(760-762)Cac>Tac	p.H254Y	FAM120A_ENST00000333936.5_Missense_Mutation_p.H254Y|FAM120A_ENST00000375389.3_Missense_Mutation_p.H254Y|FAM120A_ENST00000340893.4_Missense_Mutation_p.H254Y	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	254						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						GGCTTCCTTTCACTGGAGTTT	0.348																																						dbGAP											0													139.0	127.0	131.0					9																	96238576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.760C>T	9.37:g.96238576C>T	ENSP00000277165:p.His254Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	NULL	p.H254Y	ENST00000277165.6	37	c.760	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	C	26.0	4.690550	0.88735	.	.	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	5.52	5.52	0.82312	.	0.000000	0.64402	D	0.000001	T	0.69548	0.3123	L	0.53249	1.67	0.80722	D	1	P;D;D;D	0.89917	0.862;0.989;0.996;1.0	P;D;D;D	0.87578	0.569;0.979;0.986;0.998	T	0.64689	-0.6348	10	0.37606	T	0.19	-15.061	19.6296	0.95694	0.0:1.0:0.0:0.0	.	254;254;254;254	Q9NZB2-6;Q9NZB2-5;Q9NZB2;Q9NZB2-2	.;.;F120A_HUMAN;.	Y	254	ENSP00000364538:H254Y;ENSP00000277165:H254Y;ENSP00000334918:H254Y;ENSP00000344698:H254Y	ENSP00000277165:H254Y	H	+	1	0	FAM120A	95278397	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.549000	0.82163	2.873000	0.98535	0.563000	0.77884	CAC	FAM120A	-	NULL	ENSG00000048828		0.348	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	169	0.00	0	C	NM_014612		96238576	96238576	+1	no_errors	ENST00000333936	ensembl	human	known	69_37n	missense	130	32.47	63	SNP	1.000	T
FAM120A	23196	genome.wustl.edu	37	9	96261150	96261150	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:96261150C>T	ENST00000277165.6	+	5	1206	c.1012C>T	c.(1012-1014)Cat>Tat	p.H338Y	FAM120A_ENST00000333936.5_Missense_Mutation_p.H338Y|FAM120A_ENST00000375389.3_Missense_Mutation_p.H338Y|FAM120A_ENST00000340893.4_Missense_Mutation_p.H338Y	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	338						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TATGTCATTTCATCCACCACA	0.333																																						dbGAP											0													144.0	150.0	148.0					9																	96261150		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.1012C>T	9.37:g.96261150C>T	ENSP00000277165:p.His338Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	NULL	p.H338Y	ENST00000277165.6	37	c.1012	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	C	16.07	3.019554	0.54576	.	.	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.46063	0.88;0.88;0.88;0.88	5.06	5.06	0.68205	.	0.083308	0.52532	D	0.000066	T	0.36608	0.0973	N	0.08118	0	0.43724	D	0.996201	P;P;P;P	0.52316	0.898;0.886;0.886;0.952	B;B;B;P	0.52793	0.354;0.271;0.359;0.709	T	0.20874	-1.0262	10	0.23891	T	0.37	-14.6133	18.6404	0.91393	0.0:1.0:0.0:0.0	.	338;338;338;338	Q9NZB2-6;Q9NZB2-5;Q9NZB2;Q9NZB2-2	.;.;F120A_HUMAN;.	Y	338	ENSP00000364538:H338Y;ENSP00000277165:H338Y;ENSP00000334918:H338Y;ENSP00000344698:H338Y	ENSP00000277165:H338Y	H	+	1	0	FAM120A	95300971	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.422000	0.73357	2.631000	0.89168	0.650000	0.86243	CAT	FAM120A	-	NULL	ENSG00000048828		0.333	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	110	0.90	1	C	NM_014612		96261150	96261150	+1	no_errors	ENST00000333936	ensembl	human	known	69_37n	missense	64	31.91	30	SNP	1.000	T
FAM13B	51306	genome.wustl.edu	37	5	137289107	137289107	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:137289107C>G	ENST00000033079.3	-	15	2151	c.1700G>C	c.(1699-1701)aGa>aCa	p.R567T	FAM13B_ENST00000420893.2_Missense_Mutation_p.R567T|FAM13B_ENST00000425075.2_Missense_Mutation_p.R471T	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	567					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						ATAAGGTGTTCTGTCCTCTCT	0.358																																						dbGAP											0													181.0	170.0	174.0					5																	137289107		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.1700G>C	5.37:g.137289107C>G	ENSP00000033079:p.Arg567Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R567T	ENST00000033079.3	37	c.1700	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	C	14.96	2.691317	0.48097	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	D;T;D	0.95342	-3.68;1.93;-3.68	5.17	4.17	0.49024	.	0.197082	0.45126	D	0.000395	D	0.86826	0.6026	N	0.25647	0.755	0.33961	D	0.645619	B;B;B	0.31625	0.332;0.027;0.102	B;B;B	0.29440	0.102;0.051;0.047	D	0.85298	0.1071	10	0.41790	T	0.15	-10.7218	3.3434	0.07127	0.0:0.6124:0.0:0.3876	.	471;567;567	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	T	567;471;567	ENSP00000033079:R567T;ENSP00000394669:R471T;ENSP00000388521:R567T	ENSP00000033079:R567T	R	-	2	0	FAM13B	137317006	0.996000	0.38824	1.000000	0.80357	0.967000	0.64934	0.403000	0.20982	2.403000	0.81681	0.585000	0.79938	AGA	FAM13B	-	NULL	ENSG00000031003		0.358	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	181	0.00	0	C			137289107	137289107	-1	no_errors	ENST00000033079	ensembl	human	known	69_37n	missense	163	23.11	49	SNP	1.000	G
NUTM2F	54754	genome.wustl.edu	37	9	97080967	97080967	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:97080967C>G	ENST00000253262.4	-	7	2071	c.2051G>C	c.(2050-2052)aGa>aCa	p.R684T	NUTM2F_ENST00000341207.4_Missense_Mutation_p.R669T|NUTM2F_ENST00000335456.7_Intron	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	684																	GCTGAGGCCTCTTTTCTGAGC	0.622																																						dbGAP											0													47.0	38.0	41.0					9																	97080967		1870	4085	5955	-	-	-	SO:0001583	missense	0				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.2051G>C	9.37:g.97080967C>G	ENSP00000253262:p.Arg684Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	NULL	p.R684T	ENST00000253262.4	37	c.2051	CCDS47994.1	9	.	.	.	.	.	.	.	.	.	.	C	8.079	0.771982	0.16051	.	.	ENSG00000130950	ENST00000253262;ENST00000341207;ENST00000375347	T;T	0.12774	2.65;2.66	1.52	-0.873	0.10635	Nuclear Testis protein, C-terminal (1);	1.355360	0.05085	N	0.484283	T	0.25344	0.0616	L	0.54323	1.7	0.09310	N	1	D	0.57257	0.979	P	0.57846	0.828	T	0.27088	-1.0084	10	0.49607	T	0.09	.	7.023	0.24924	0.0:0.4348:0.5652:0.0	.	684	A1L443	FA22F_HUMAN	T	684;669;518	ENSP00000253262:R684T;ENSP00000343865:R669T	ENSP00000253262:R684T	R	-	2	0	FAM22F	96120788	0.000000	0.05858	0.001000	0.08648	0.086000	0.17979	-2.010000	0.01454	-0.203000	0.10251	0.456000	0.33151	AGA	FAM22F	-	NULL	ENSG00000130950		0.622	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM22F	HGNC	protein_coding	OTTHUMT00000053173.2	116	0.00	0	C	NM_017561		97080967	97080967	-1	no_errors	ENST00000253262	ensembl	human	known	69_37n	missense	103	12.71	15	SNP	0.001	G
SUPT20H	55578	genome.wustl.edu	37	13	37584769	37584769	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:37584769C>T	ENST00000350612.6	-	25	2342	c.2122G>A	c.(2122-2124)Gag>Aag	p.E708K	SUPT20H_ENST00000475892.1_Intron|SUPT20H_ENST00000464744.1_Intron|SUPT20H_ENST00000356185.3_Intron|SUPT20H_ENST00000360252.4_Intron	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)	708	Gln-rich.				autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										GGTCTGTTCTCGGCAGAGCCA	0.488																																						dbGAP											0													76.0	74.0	74.0					13																	37584769		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.2122G>A	13.37:g.37584769C>T	ENSP00000218894:p.Glu708Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ER46|Q71RF3|Q9Y6A6	Missense_Mutation	SNP	pfam_Spt20	p.E708K	ENST00000350612.6	37	c.2122	CCDS31959.1	13	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486398	0.44147	.	.	ENSG00000102710	ENST00000350612	T	0.30182	1.54	5.55	5.55	0.83447	.	0.127030	0.53938	D	0.000041	T	0.28200	0.0696	L	0.55481	1.735	0.80722	D	1	B	0.27679	0.185	B	0.21708	0.036	T	0.03193	-1.1062	10	0.18276	T	0.48	.	13.939	0.64043	0.0:0.9256:0.0:0.0744	.	708	Q8NEM7	FA48A_HUMAN	K	708	ENSP00000218894:E708K	ENSP00000218894:E708K	E	-	1	0	FAM48A	36482769	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.979000	0.40608	2.885000	0.99019	0.655000	0.94253	GAG	FAM48A	-	NULL	ENSG00000102710		0.488	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM48A	HGNC	protein_coding	OTTHUMT00000354766.1	75	0.00	0	C	NM_017569		37584769	37584769	-1	no_errors	ENST00000350612	ensembl	human	known	69_37n	missense	47	35.62	26	SNP	1.000	T
FAM65A	79567	genome.wustl.edu	37	16	67578631	67578631	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:67578631G>A	ENST00000379312.3	+	16	2900	c.2779G>A	c.(2779-2781)Gag>Aag	p.E927K	CTD-2012K14.4_ENST00000564717.1_RNA|FAM65A_ENST00000540839.3_Missense_Mutation_p.E942K|FAM65A_ENST00000428437.2_Missense_Mutation_p.E937K|CTD-2012K14.3_ENST00000563083.1_RNA|FAM65A_ENST00000042381.4_Missense_Mutation_p.E923K|FAM65A_ENST00000422602.2_Missense_Mutation_p.E943K	NM_001193522.1|NM_024519.3	NP_001180451.1|NP_078795.2	Q6ZS17	FA65A_HUMAN	family with sequence similarity 65, member A	927						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(12)|lung(12)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0474)|Epithelial(162;0.117)		GCGCTGCCAGGAGGCATGGGC	0.657																																						dbGAP											0													55.0	64.0	61.0					16																	67578631		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK127792	CCDS10840.1, CCDS54026.1, CCDS54027.1, CCDS54028.1	16q22.1	2008-02-05			ENSG00000039523	ENSG00000039523			25836	protein-coding gene	gene with protein product						11572484	Standard	NM_001193522		Approved	FLJ13725	uc010vjp.2	Q6ZS17	OTTHUMG00000137536	ENST00000379312.3:c.2779G>A	16.37:g.67578631G>A	ENSP00000368614:p.Glu927Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEQ9|B4DIM2|E9PBS3|Q4G0A4|Q7Z5R7|Q8NDA4|Q96J39|Q96PV8|Q9H8D9	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_HR1_rho-bd	p.E943K	ENST00000379312.3	37	c.2827	CCDS54028.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	35|35	5.517972|5.517972	0.96416|0.96416	.|.	.|.	ENSG00000039523|ENSG00000039523	ENST00000379312;ENST00000042381;ENST00000422602;ENST00000540839|ENST00000428437	T;T;T|.	0.76839|.	-1.05;-1.05;-1.05|.	5.65|5.65	5.65|5.65	0.86999|0.86999	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.75620|0.75620	0.3874|0.3874	M|M	0.67953|0.67953	2.075|2.075	0.51767|0.51767	D|D	0.999934|0.999934	D;D;D|.	0.76494|.	0.999;0.999;0.999|.	D;D;D|.	0.78314|.	0.991;0.991;0.991|.	T|T	0.73154|0.73154	-0.4072|-0.4072	10|5	0.54805|.	T|.	0.06|.	-15.6206|-15.6206	19.7362|19.7362	0.96205|0.96205	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	937;943;927|.	B4DIM2;E9PBS3;Q6ZS17|.	.;.;FA65A_HUMAN|.	K|E	927;923;943;937|916	ENSP00000368614:E927K;ENSP00000042381:E923K;ENSP00000400099:E943K|.	ENSP00000042381:E923K|.	E|G	+|+	1|2	0|0	FAM65A|FAM65A	66136132|66136132	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	8.759000|8.759000	0.91667|0.91667	2.678000|2.678000	0.91216|0.91216	0.655000|0.655000	0.94253|0.94253	GAG|GGA	FAM65A	-	NULL	ENSG00000039523		0.657	FAM65A-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM65A	HGNC	protein_coding	OTTHUMT00000268866.3	14	0.00	0	G	NM_024519		67578631	67578631	+1	no_errors	ENST00000422602	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	1.000	A
FAT4	79633	genome.wustl.edu	37	4	126369700	126369700	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:126369700C>T	ENST00000394329.3	+	9	7542	c.7529C>T	c.(7528-7530)tCt>tTt	p.S2510F	FAT4_ENST00000335110.5_Missense_Mutation_p.S808F	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	2510	Cadherin 24. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						GGTAGAAATTCTGAAAAATTT	0.418																																						dbGAP											0													65.0	68.0	67.0					4																	126369700		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.7529C>T	4.37:g.126369700C>T	ENSP00000377862:p.Ser2510Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S2510F	ENST00000394329.3	37	c.7529	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	C	22.8	4.333064	0.81801	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.62364	0.03;0.03	5.92	5.07	0.68467	Cadherin (4);Cadherin-like (1);	0.260166	0.19863	U	0.104362	T	0.78091	0.4229	M	0.76170	2.325	0.52099	D	0.999944	P;D	0.61080	0.925;0.989	P;D	0.63192	0.568;0.912	T	0.80362	-0.1414	10	0.59425	D	0.04	.	17.3104	0.87208	0.0:0.875:0.125:0.0	.	808;2510	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	F	2510;808	ENSP00000377862:S2510F;ENSP00000335169:S808F	ENSP00000335169:S808F	S	+	2	0	FAT4	126589150	1.000000	0.71417	0.996000	0.52242	0.978000	0.69477	5.914000	0.69964	1.494000	0.48533	0.650000	0.86243	TCT	FAT4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.418	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	59	0.00	0	C	NM_024582		126369700	126369700	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	0.999	T
FAT1	2195	genome.wustl.edu	37	4	187628122	187628122	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:187628122G>A	ENST00000441802.2	-	2	3069	c.2860C>T	c.(2860-2862)Cct>Tct	p.P954S		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	954	Cadherin 8. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						CCTAAATCAGGATCGTGGGCT	0.468										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	dbGAP											0													211.0	201.0	204.0					4																	187628122		1928	4147	6075	-	-	-	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.2860C>T	4.37:g.187628122G>A	ENSP00000406229:p.Pro954Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.P954S	ENST00000441802.2	37	c.2860	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	14.30	2.494894	0.44352	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.51574	0.7	4.66	4.66	0.58398	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.65995	0.2745	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.62779	-0.6782	10	0.32370	T	0.25	.	18.0867	0.89460	0.0:0.0:1.0:0.0	.	954	Q14517	FAT1_HUMAN	S	954	ENSP00000406229:P954S	ENSP00000260147:P954S	P	-	1	0	FAT1	187865116	1.000000	0.71417	0.897000	0.35233	0.050000	0.14768	7.620000	0.83070	2.574000	0.86865	0.484000	0.47621	CCT	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.468	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	59	0.00	0	G	NM_005245		187628122	187628122	-1	no_errors	ENST00000441802	ensembl	human	known	69_37n	missense	38	32.14	18	SNP	1.000	A
FBF1	85302	genome.wustl.edu	37	17	73910890	73910890	+	Missense_Mutation	SNP	C	C	T	rs577460839	byFrequency	TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:73910890C>T	ENST00000586717.1	-	24	2983	c.2710G>A	c.(2710-2712)Gag>Aag	p.E904K	FBF1_ENST00000319129.5_Missense_Mutation_p.E903K|FBF1_ENST00000389570.4_Missense_Mutation_p.E904K|RP11-552F3.12_ENST00000587556.1_5'Flank			Q8TES7	FBF1_HUMAN	Fas (TNFRSF6) binding factor 1	904					apical junction assembly (GO:0043297)|cilium assembly (GO:0042384)|establishment of epithelial cell polarity (GO:0090162)	cell junction (GO:0030054)|centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|spindle pole (GO:0000922)				large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	4						CGCTCGGCCTCGCGCTCGGCC	0.701																																						dbGAP											0													13.0	18.0	16.0					17																	73910890		2078	4185	6263	-	-	-	SO:0001583	missense	0			AK074045	CCDS45779.1	17q25.3	2011-04-21			ENSG00000188878	ENSG00000188878			24674	protein-coding gene	gene with protein product	"""albatross"""					11347906	Standard	NM_001080542		Approved	FLJ00103, FBF-1, KIAA1863, ALB	uc002jqc.3	Q8TES7		ENST00000586717.1:c.2710G>A	17.37:g.73910890C>T	ENSP00000465132:p.Glu904Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEM5|Q96IF6|Q96JG4|Q96MA8	Missense_Mutation	SNP	superfamily_HRDC-like	p.E904K	ENST00000586717.1	37	c.2710		17	.	.	.	.	.	.	.	.	.	.	C	16.87	3.241810	0.58995	.	.	ENSG00000188878	ENST00000389570;ENST00000319129;ENST00000427433	T;T	0.20881	2.04;2.04	5.58	3.55	0.40652	.	.	.	.	.	T	0.42314	0.1197	L	0.56769	1.78	0.41833	D	0.990085	D;D	0.89917	0.972;1.0	P;D	0.85130	0.552;0.997	T	0.24048	-1.0171	9	0.42905	T	0.14	-8.0856	15.7176	0.77681	0.0:0.7212:0.2788:0.0	.	918;903	Q8TES7-6;A6NLR5	.;.	K	904;903;917	ENSP00000374221:E904K;ENSP00000324292:E903K	ENSP00000324292:E903K	E	-	1	0	FBF1	71422485	0.994000	0.37717	0.004000	0.12327	0.017000	0.09413	3.438000	0.52871	0.681000	0.31386	-0.219000	0.12488	GAG	FBF1	-	NULL	ENSG00000188878		0.701	FBF1-001	KNOWN	basic|appris_candidate	protein_coding	FBF1	HGNC	protein_coding	OTTHUMT00000448945.2	11	0.00	0	C	NM_001080542		73910890	73910890	-1	no_errors	ENST00000389570	ensembl	human	known	69_37n	missense	10	47.37	9	SNP	0.922	T
FBXO32	114907	genome.wustl.edu	37	8	124544170	124544170	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:124544170G>C	ENST00000517956.1	-	4	531	c.340C>G	c.(340-342)Ctg>Gtg	p.L114V	FBXO32_ENST00000443022.2_Missense_Mutation_p.L114V	NM_058229.3|NM_148177.2	NP_478136.1|NP_680482.1	Q969P5	FBX32_HUMAN	F-box protein 32	114					cellular response to dexamethasone stimulus (GO:0071549)|protein ubiquitination (GO:0016567)|response to denervation involved in regulation of muscle adaptation (GO:0014894)	nucleolus (GO:0005730)|Z disc (GO:0030018)				autonomic_ganglia(1)|breast(3)|endometrium(2)|large_intestine(5)|lung(6)|skin(3)|stomach(1)	21	Lung NSC(37;1.13e-13)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			CTGGAATCCAGAATGGCAGTT	0.473																																						dbGAP											0													99.0	99.0	99.0					8																	124544170		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ420108	CCDS6345.1, CCDS56553.1	8q24.13	2008-01-28	2004-06-15		ENSG00000156804	ENSG00000156804		"""F-boxes /  ""other"""""	16731	protein-coding gene	gene with protein product		606604	"""F-box only protein 32"""			11679633, 11717410	Standard	NM_058229		Approved	MAFbx, ATROGIN1, Fbx32	uc003yqr.3	Q969P5	OTTHUMG00000164981	ENST00000517956.1:c.340C>G	8.37:g.124544170G>C	ENSP00000428205:p.Leu114Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4KYM0	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like	p.L114V	ENST00000517956.1	37	c.340	CCDS6345.1	8	.	.	.	.	.	.	.	.	.	.	G	12.35	1.911943	0.33721	.	.	ENSG00000156804	ENST00000517956;ENST00000443022	T;T	0.18016	2.24;2.24	5.61	3.8	0.43715	.	0.188265	0.46145	D	0.000306	T	0.13841	0.0335	L	0.29908	0.895	0.24490	N	0.994301	B;B	0.29646	0.201;0.253	B;B	0.33960	0.109;0.173	T	0.20571	-1.0271	10	0.12766	T	0.61	0.0672	14.6113	0.68517	0.1321:0.0:0.8679:0.0	.	114;114	A4KYM0;Q969P5	.;FBX32_HUMAN	V	114	ENSP00000428205:L114V;ENSP00000390790:L114V	ENSP00000390790:L114V	L	-	1	2	FBXO32	124613351	1.000000	0.71417	0.995000	0.50966	0.860000	0.49131	2.182000	0.42556	0.739000	0.32628	-0.813000	0.03139	CTG	FBXO32	-	NULL	ENSG00000156804		0.473	FBXO32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO32	HGNC	protein_coding	OTTHUMT00000381281.1	72	0.00	0	G			124544170	124544170	-1	no_errors	ENST00000517956	ensembl	human	known	69_37n	missense	69	22.47	20	SNP	1.000	C
FCGBP	8857	genome.wustl.edu	37	19	40367774	40367774	+	Missense_Mutation	SNP	C	C	T	rs553648815	byFrequency	TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:40367774C>T	ENST00000221347.6	-	29	13193	c.13186G>A	c.(13186-13188)Gtg>Atg	p.V4396M		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4396	TIL 10.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCACTTAACACGAAACCCGCG	0.657													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15955	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													9.0	13.0	11.0					19																	40367774		1956	3826	5782	-	-	-	SO:0001583	missense	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.13186G>A	19.37:g.40367774C>T	ENSP00000221347:p.Val4396Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.V4396M	ENST00000221347.6	37	c.13186	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803692	0.31869	.	.	ENSG00000090920	ENST00000221347	D	0.92647	-3.08	4.05	3.02	0.34903	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	0.085887	0.44902	U	0.000401	D	0.96231	0.8771	M	0.94101	3.495	0.29983	N	0.817566	D	0.89917	1.0	D	0.77004	0.989	D	0.91782	0.5436	10	0.30854	T	0.27	.	11.3824	0.49766	0.0:0.9018:0.0:0.0982	.	4396	Q9Y6R7	FCGBP_HUMAN	M	4396	ENSP00000221347:V4396M	ENSP00000221347:V4396M	V	-	1	0	FCGBP	45059614	0.758000	0.28405	0.910000	0.35882	0.236000	0.25371	0.598000	0.24074	2.261000	0.74972	0.298000	0.19748	GTG	FCGBP	-	pfam_TIL_dom,superfamily_TIL_dom,smart_EGF-like	ENSG00000090920		0.657	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	20	0.00	0	C	NM_003890		40367774	40367774	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	missense	8	66.67	16	SNP	1.000	T
FCGBP	8857	genome.wustl.edu	37	19	40433879	40433879	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:40433879C>T	ENST00000221347.6	-	2	397	c.390G>A	c.(388-390)ctG>ctA	p.L130L		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	130	IgGFc-binding.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCAGCAGTGTCAGCTCCGCTG	0.577																																						dbGAP											0													67.0	56.0	60.0					19																	40433879		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.390G>A	19.37:g.40433879C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.L130	ENST00000221347.6	37	c.390	CCDS12546.1	19																																																																																			FCGBP	-	NULL	ENSG00000090920		0.577	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	53	0.00	0	C	NM_003890		40433879	40433879	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	silent	41	30.51	18	SNP	0.860	T
FGD2	221472	genome.wustl.edu	37	6	36995215	36995215	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:36995215C>T	ENST00000274963.8	+	15	1787	c.1616C>T	c.(1615-1617)tCa>tTa	p.S539L		NM_173558.3	NP_775829.2	Q7Z6J4	FGD2_HUMAN	FYVE, RhoGEF and PH domain containing 2	539					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)	25						AAAGGGTCCTCAGCCACGCCT	0.602																																						dbGAP											0													108.0	109.0	109.0					6																	36995215		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097230	CCDS4829.1	6p21.2	2013-01-10	2004-08-24		ENSG00000146192	ENSG00000146192		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	3664	protein-coding gene	gene with protein product		605091	"""FGD1 family, member 2"""			10458911	Standard	NM_173558		Approved	ZFYVE4	uc010jwp.1	Q7Z6J4	OTTHUMG00000014616	ENST00000274963.8:c.1616C>T	6.37:g.36995215C>T	ENSP00000274963:p.Ser539Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T8I1|Q6P6A8|Q6ZNL5|Q8IZ32|Q8N868|Q9H7M2	Missense_Mutation	SNP	pfam_DH-domain,pfam_Znf_FYVE,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S539L	ENST00000274963.8	37	c.1616	CCDS4829.1	6	.	.	.	.	.	.	.	.	.	.	C	12.47	1.946281	0.34377	.	.	ENSG00000146192	ENST00000274963;ENST00000394459	T	0.60299	0.2	5.41	0.615	0.17608	.	1.448260	0.04577	N	0.394266	T	0.32734	0.0839	L	0.51914	1.62	0.09310	N	1	B;B	0.11235	0.0;0.004	B;B	0.14578	0.0;0.011	T	0.42172	-0.9467	10	0.52906	T	0.07	-1.5726	10.1672	0.42888	0.0:0.6723:0.0:0.3277	.	539;116	Q7Z6J4;Q7Z6J4-2	FGD2_HUMAN;.	L	539;167	ENSP00000274963:S539L	ENSP00000274963:S539L	S	+	2	0	FGD2	37103193	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.195000	0.17155	-0.105000	0.12132	0.655000	0.94253	TCA	FGD2	-	NULL	ENSG00000146192		0.602	FGD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD2	HGNC	protein_coding	OTTHUMT00000040398.2	24	0.00	0	C	NM_173558		36995215	36995215	+1	no_errors	ENST00000274963	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	0.000	T
FHOD3	80206	genome.wustl.edu	37	18	34326920	34326920	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:34326920C>G	ENST00000359247.4	+	20	3478	c.3478C>G	c.(3478-3480)Caa>Gaa	p.Q1160E	FHOD3_ENST00000257209.4_Missense_Mutation_p.Q1177E|FHOD3_ENST00000591635.1_Missense_Mutation_p.Q373E|FHOD3_ENST00000590592.1_Missense_Mutation_p.Q1352E|FHOD3_ENST00000592128.1_Missense_Mutation_p.Q156E|FHOD3_ENST00000445677.1_Missense_Mutation_p.Q1139E	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	1160	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				TGACTTTGATCAACTTCAGGA	0.428																																						dbGAP											0													70.0	66.0	67.0					18																	34326920		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.3478C>G	18.37:g.34326920C>G	ENSP00000352186:p.Gln1160Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Nonsense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.S937*	ENST00000359247.4	37	c.2810		18	.	.	.	.	.	.	.	.	.	.	C	15.14	2.744993	0.49151	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.16324	2.35;2.35;2.35	5.12	5.12	0.69794	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.000000	0.85682	D	0.000000	T	0.25044	0.0608	N	0.16743	0.435	0.80722	D	1	B;D;D;B	0.63046	0.015;0.99;0.992;0.02	B;D;D;B	0.76071	0.086;0.979;0.987;0.033	T	0.08680	-1.0710	10	0.15499	T	0.54	.	17.1643	0.86811	0.0:1.0:0.0:0.0	.	381;1139;1160;1177	E7ETX5;Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;.;FHOD3_HUMAN;.	E	1177;1160;1139	ENSP00000257209:Q1177E;ENSP00000352186:Q1160E;ENSP00000411430:Q1139E	ENSP00000257209:Q1177E	Q	+	1	0	FHOD3	32580918	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.087000	0.71362	2.386000	0.81285	0.462000	0.41574	CAA	FHOD3	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000134775		0.428	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	65	0.00	0	C	XM_371114		34326920	34326920	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000592930	ensembl	human	putative	69_37n	nonsense	32	42.86	24	SNP	1.000	G
FKBP4	2288	genome.wustl.edu	37	12	2910381	2910381	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:2910381G>A	ENST00000001008.4	+	9	1318	c.1131G>A	c.(1129-1131)caG>caA	p.Q377Q	RP4-816N1.6_ENST00000547834.1_RNA|RP4-816N1.7_ENST00000547042.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	377	Interaction with tubulin. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			CTGATTTCCAGAAGGTCCTGC	0.607																																						dbGAP											0													56.0	62.0	60.0					12																	2910381		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.1131G>A	12.37:g.2910381G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	pfscan_TPR-contain_dom	p.R13K	ENST00000001008.4	37	c.38	CCDS8512.1	12	.	.	.	.	.	.	.	.	.	.	G	9.875	1.200097	0.22121	.	.	ENSG00000004478	ENST00000539181	.	.	.	5.57	4.67	0.58626	.	.	.	.	.	T	0.59676	0.2211	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57447	-0.7810	4	.	.	.	-30.2571	9.0837	0.36567	0.1673:0.0:0.8327:0.0	.	.	.	.	K	13	.	.	R	+	2	0	FKBP4	2780642	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.284000	0.51708	1.324000	0.45282	0.561000	0.74099	AGA	FKBP4	-	pfscan_TPR-contain_dom	ENSG00000004478		0.607	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP4	HGNC	protein_coding	OTTHUMT00000206861.1	37	0.00	0	G			2910381	2910381	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000539181	ensembl	human	putative	69_37n	missense	32	31.91	15	SNP	1.000	A
FLG2	388698	genome.wustl.edu	37	1	152325364	152325364	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:152325364G>C	ENST00000388718.5	-	3	4970	c.4898C>G	c.(4897-4899)tCt>tGt	p.S1633C	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1633					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCATGACCAGAGTGGGAATG	0.517																																						dbGAP											0													391.0	349.0	364.0					1																	152325364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.4898C>G	1.37:g.152325364G>C	ENSP00000373370:p.Ser1633Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S1633C	ENST00000388718.5	37	c.4898	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	G	12.19	1.863214	0.32884	.	.	ENSG00000143520	ENST00000388718	T	0.08634	3.07	4.47	4.47	0.54385	.	.	.	.	.	T	0.14013	0.0339	M	0.68593	2.085	0.09310	N	1	D	0.89917	1.0	P	0.62813	0.907	T	0.02121	-1.1210	9	0.56958	D	0.05	1.7988	13.1319	0.59387	0.0:0.0:1.0:0.0	.	1633	Q5D862	FILA2_HUMAN	C	1633	ENSP00000373370:S1633C	ENSP00000373370:S1633C	S	-	2	0	FLG2	150591988	0.001000	0.12720	0.003000	0.11579	0.131000	0.20780	0.989000	0.29629	2.234000	0.73211	0.478000	0.44815	TCT	FLG2	-	NULL	ENSG00000143520		0.517	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	275	0.00	0	G	NM_001014342		152325364	152325364	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	696	28.32	275	SNP	0.007	C
FOXA1	3169	genome.wustl.edu	37	14	38061312	38061312	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:38061312T>C	ENST00000250448.2	-	2	738	c.677A>G	c.(676-678)gAc>gGc	p.D226G	FOXA1_ENST00000540786.1_Missense_Mutation_p.D193G|FOXA1_ENST00000545425.2_5'UTR	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	226					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		GACGAAGCAGTCATTGAAGGA	0.607																																						dbGAP											0													49.0	48.0	49.0					14																	38061312		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.677A>G	14.37:g.38061312T>C	ENSP00000250448:p.Asp226Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.D226G	ENST00000250448.2	37	c.677	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	T	23.3	4.394232	0.83011	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95690	-3.78;-3.78	4.0	4.0	0.46444	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.85682	D	0.000000	D	0.97093	0.9050	M	0.85099	2.735	0.80722	D	1	P	0.44627	0.839	P	0.56788	0.806	D	0.97601	1.0123	10	0.87932	D	0	.	12.0003	0.53226	0.0:0.0:0.0:1.0	.	226	P55317	FOXA1_HUMAN	G	226;193	ENSP00000250448:D226G;ENSP00000440178:D193G	ENSP00000250448:D226G	D	-	2	0	FOXA1	37131063	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.761000	0.85260	1.671000	0.50874	0.329000	0.21502	GAC	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000129514		0.607	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	45	0.00	0	T			38061312	38061312	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	1.000	C
FOXN4	121643	genome.wustl.edu	37	12	109725248	109725248	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:109725248G>C	ENST00000299162.5	-	6	654	c.550C>G	c.(550-552)Caa>Gaa	p.Q184E	FOXN4_ENST00000355216.1_Intron	NM_213596.2	NP_998761.2	Q96NZ1	FOXN4_HUMAN	forkhead box N4	184					amacrine cell differentiation (GO:0035881)|atrioventricular canal development (GO:0036302)|heart looping (GO:0001947)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of heart contraction (GO:0008016)|regulation of transcription, DNA-templated (GO:0006355)|retina layer formation (GO:0010842)|transcription, DNA-templated (GO:0006351)|ventral spinal cord interneuron fate commitment (GO:0060579)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|lung(9)|ovary(2)	16						TGCAGTTCTTGAGATGAATGC	0.662																																						dbGAP											0													38.0	46.0	44.0					12																	109725248		692	1591	2283	-	-	-	SO:0001583	missense	0			AF425596	CCDS9126.2	12q24.12	2008-02-05			ENSG00000139445	ENSG00000139445		"""Forkhead boxes"""	21399	protein-coding gene	gene with protein product		609429					Standard	NM_213596		Approved		uc001toe.4	Q96NZ1	OTTHUMG00000152868	ENST00000299162.5:c.550C>G	12.37:g.109725248G>C	ENSP00000299162:p.Gln184Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMR4|Q96NZ0	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.Q184E	ENST00000299162.5	37	c.550	CCDS9126.2	12	.	.	.	.	.	.	.	.	.	.	G	9.905	1.207847	0.22205	.	.	ENSG00000139445	ENST00000299162	D	0.92858	-3.12	4.47	2.46	0.29980	Winged helix-turn-helix transcription repressor DNA-binding (1);	1.626850	0.03013	N	0.149679	D	0.89880	0.6843	L	0.53729	1.69	0.39028	D	0.959879	B	0.10296	0.003	B	0.12156	0.007	T	0.74365	-0.3689	10	0.28530	T	0.3	-1.6561	7.8376	0.29378	0.0873:0.0:0.7527:0.16	.	184	Q96NZ1	FOXN4_HUMAN	E	184	ENSP00000299162:Q184E	ENSP00000299162:Q184E	Q	-	1	0	FOXN4	108209631	1.000000	0.71417	0.009000	0.14445	0.246000	0.25737	7.414000	0.80117	1.006000	0.39211	0.609000	0.83330	CAA	FOXN4	-	NULL	ENSG00000139445		0.662	FOXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXN4	HGNC	protein_coding	OTTHUMT00000328306.1	34	0.00	0	G	XM_062735		109725248	109725248	-1	no_errors	ENST00000299162	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	0.971	C
FRMD4B	23150	genome.wustl.edu	37	3	69230351	69230351	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:69230351C>G	ENST00000398540.3	-	21	2633	c.2550G>C	c.(2548-2550)caG>caC	p.Q850H	FRMD4B_ENST00000542259.1_Missense_Mutation_p.Q796H|FRMD4B_ENST00000478263.1_Missense_Mutation_p.Q502H	NM_015123.1	NP_055938	Q9Y2L6	FRM4B_HUMAN	FERM domain containing 4B	850					establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|ruffle (GO:0001726)				NS(2)|central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(1)|ovary(3)|prostate(3)|skin(2)	19		Lung NSC(201;0.0138)|Prostate(884;0.11)		BRCA - Breast invasive adenocarcinoma(55;0.000201)|Epithelial(33;0.00141)|LUSC - Lung squamous cell carcinoma(21;0.00999)|Lung(16;0.0182)		TGTAGTCCCTCTGGCGCTCAT	0.517																																						dbGAP											0													71.0	70.0	71.0					3																	69230351		1988	4149	6137	-	-	-	SO:0001583	missense	0			AL832231	CCDS46863.1	3p14.2	2006-04-12			ENSG00000114541	ENSG00000114541			24886	protein-coding gene	gene with protein product						10231032, 11445584	Standard	XM_005264720		Approved	KIAA1013, GRSP1	uc003dnv.2	Q9Y2L6	OTTHUMG00000158772	ENST00000398540.3:c.2550G>C	3.37:g.69230351C>G	ENSP00000381549:p.Gln850His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAI3	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,pfscan_FERM_domain	p.Q850H	ENST00000398540.3	37	c.2550	CCDS46863.1	3	.	.	.	.	.	.	.	.	.	.	C	5.124	0.208574	0.09757	.	.	ENSG00000114541	ENST00000398540;ENST00000542259;ENST00000478263	D;D	0.83075	-1.68;-1.68	5.83	-1.31	0.09230	.	0.914332	0.09542	N	0.788093	T	0.47581	0.1453	N	0.00483	-1.445	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.45308	-0.9270	10	0.15066	T	0.55	-0.2112	3.7909	0.08719	0.0975:0.4219:0.2442:0.2364	.	694;850	B4DHD5;Q9Y2L6	.;FRM4B_HUMAN	H	850;796;502	ENSP00000381549:Q850H;ENSP00000437658:Q796H	ENSP00000381549:Q850H	Q	-	3	2	FRMD4B	69313041	0.168000	0.22989	0.108000	0.21378	0.907000	0.53573	0.202000	0.17295	-0.174000	0.10743	-0.469000	0.05056	CAG	FRMD4B	-	NULL	ENSG00000114541		0.517	FRMD4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD4B	HGNC	protein_coding	OTTHUMT00000352111.1	58	0.00	0	C			69230351	69230351	-1	no_errors	ENST00000398540	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	0.102	G
MAD1L1	8379	genome.wustl.edu	37	7	2274964	2274964	+	5'Flank	SNP	G	G	T	rs201716266		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:2274964G>T	ENST00000406869.1	-	0	0				FTSJ2_ENST00000242257.8_Silent_p.L178L|FTSJ2_ENST00000407040.1_Silent_p.L84L|FTSJ2_ENST00000486040.1_5'UTR|MAD1L1_ENST00000265854.7_5'Flank|FTSJ2_ENST00000440306.2_3'UTR|MAD1L1_ENST00000399654.2_5'Flank|MAD1L1_ENST00000402746.1_5'Flank			Q9Y6D9	MD1L1_HUMAN	MAD1 mitotic arrest deficient-like 1 (yeast)						mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|regulation of metaphase plate congression (GO:0090235)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|spindle (GO:0005819)				central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(20)|ovary(1)|prostate(5)	36		Ovarian(82;0.0272)		UCEC - Uterine corpus endometrioid carcinoma (27;0.134)|OV - Ovarian serous cystadenocarcinoma(56;3.63e-14)		GGGTCACGCTGAGAAGGGTCA	0.567																																						dbGAP											0													87.0	80.0	83.0					7																	2274964		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			U33822	CCDS43539.1	7p22	2013-01-17	2001-11-28		ENSG00000002822	ENSG00000002822			6762	protein-coding gene	gene with protein product		602686	"""MAD1 (mitotic arrest deficient, yeast, homolog)-like 1"""			10049595, 9546394	Standard	XM_005249876		Approved	HsMAD1, TXBP181, MAD1, PIG9, TP53I9	uc003slg.1	Q9Y6D9	OTTHUMG00000151493		7.37:g.2274964G>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR41|Q13312|Q75MI0|Q86UM4|Q9UNH0	Silent	SNP	pfam_rRNA_MeTrfase_FtsJ_dom,pirsf_rRNA-MeTfrase_E	p.L178	ENST00000406869.1	37	c.534	CCDS43539.1	7																																																																																			FTSJ2	-	pfam_rRNA_MeTrfase_FtsJ_dom,pirsf_rRNA-MeTfrase_E	ENSG00000122687		0.567	MAD1L1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FTSJ2	HGNC	protein_coding	OTTHUMT00000322871.1	88	0.00	0	G	NM_003550		2274964	2274964	-1	no_errors	ENST00000242257	ensembl	human	known	69_37n	silent	48	32.39	23	SNP	0.999	T
GAB3	139716	genome.wustl.edu	37	X	153924289	153924289	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:153924289C>T	ENST00000369575.3	-	8	1461	c.1430G>A	c.(1429-1431)cGa>cAa	p.R477Q	GAB3_ENST00000496390.1_5'UTR|GAB3_ENST00000424127.2_Missense_Mutation_p.R478Q	NM_001081573.1|NM_080612.2	NP_001075042.1|NP_542179.1	Q8WWW8	GAB3_HUMAN	GRB2-associated binding protein 3	477					macrophage differentiation (GO:0030225)					NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(6)|ovary(2)|prostate(1)|skin(1)	25	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					AAAGCTGGTTCGACTGCTAAG	0.418																																						dbGAP											0													51.0	45.0	47.0					X																	153924289		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY057989	CCDS14760.1, CCDS48198.1, CCDS65357.1	Xq28	2013-01-10			ENSG00000160219	ENSG00000160219		"""Pleckstrin homology (PH) domain containing"""	17515	protein-coding gene	gene with protein product	"""DOS/Gab family member 3"", ""Gab3 scaffolding protein"""	300482				11739737	Standard	XM_005274648		Approved		uc004fmk.1	Q8WWW8	OTTHUMG00000024245	ENST00000369575.3:c.1430G>A	X.37:g.153924289C>T	ENSP00000358588:p.Arg477Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHF8|E9PB44	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R478Q	ENST00000369575.3	37	c.1433	CCDS14760.1	X	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118394	0.56505	.	.	ENSG00000160219	ENST00000369575;ENST00000369568;ENST00000424127	T;T;T	0.24350	1.86;1.86;1.86	5.57	4.7	0.59300	.	0.417365	0.25050	N	0.033527	T	0.21841	0.0526	M	0.62154	1.92	0.37751	D	0.925977	D;P;D	0.54397	0.966;0.911;0.966	B;B;B	0.35550	0.205;0.138;0.205	T	0.18681	-1.0329	10	0.32370	T	0.25	-5.4185	11.6306	0.51173	0.0:0.9089:0.0:0.0911	.	478;478;477	A6NHF8;E9PB44;Q8WWW8	.;.;GAB3_HUMAN	Q	477;478;478	ENSP00000358588:R477Q;ENSP00000358581:R478Q;ENSP00000399588:R478Q	ENSP00000358581:R478Q	R	-	2	0	GAB3	153577483	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	3.672000	0.54583	2.341000	0.79615	0.600000	0.82982	CGA	GAB3	-	NULL	ENSG00000160219		0.418	GAB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAB3	HGNC	protein_coding	OTTHUMT00000061192.2	75	0.00	0	C	NM_001081573		153924289	153924289	-1	no_errors	ENST00000424127	ensembl	human	known	69_37n	missense	41	33.87	21	SNP	1.000	T
GABBR1	2550	genome.wustl.edu	37	6	29589569	29589569	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:29589569C>T	ENST00000377034.4	-	10	1426	c.1091G>A	c.(1090-1092)gGa>gAa	p.G364E	GABBR1_ENST00000355973.3_Missense_Mutation_p.G247E|GABBR1_ENST00000376977.3_Missense_Mutation_p.G364E|GABBR1_ENST00000377016.4_Missense_Mutation_p.G302E|GABBR1_ENST00000377012.4_Missense_Mutation_p.G247E	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	364					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	ATAGAAAAGTCCCACGATGAT	0.532																																						dbGAP											0													59.0	62.0	61.0					6																	29589569		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.1091G>A	6.37:g.29589569C>T	ENSP00000366233:p.Gly364Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.G364E	ENST00000377034.4	37	c.1091	CCDS4663.1	6	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901014	0.92035	.	.	ENSG00000204681	ENST00000355973;ENST00000376977;ENST00000377016;ENST00000377012;ENST00000377034	D;D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66;-1.66	4.55	4.55	0.56014	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.91304	0.7258	M	0.90650	3.135	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.996;1.0;1.0;1.0	D	0.92872	0.6315	10	0.87932	D	0	-18.7639	14.8382	0.70201	0.0:1.0:0.0:0.0	.	364;302;364;247	Q9UBS5-5;Q9UBS5-3;Q9UBS5;Q5SUJ9	.;.;GABR1_HUMAN;.	E	247;364;302;247;364	ENSP00000348248:G247E;ENSP00000366176:G364E;ENSP00000366215:G302E;ENSP00000366211:G247E;ENSP00000366233:G364E	ENSP00000348248:G247E	G	-	2	0	GABBR1	29697548	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.793000	0.75130	2.381000	0.81170	0.637000	0.83480	GGA	GABBR1	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3_GABA_rcpt_B	ENSG00000204681		0.532	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3	44	0.00	0	C			29589569	29589569	-1	no_errors	ENST00000377034	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	T
GABRA5	2558	genome.wustl.edu	37	15	27185157	27185157	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:27185157G>A	ENST00000335625.5	+	9	1698	c.810G>A	c.(808-810)atG>atA	p.M270I	GABRA5_ENST00000355395.5_Missense_Mutation_p.M270I|GABRB3_ENST00000541819.2_5'Flank|GABRA5_ENST00000400081.3_Missense_Mutation_p.M270I	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	270					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)	p.M270I(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CCTGCATAATGACCGTGATCT	0.493																																						dbGAP											1	Substitution - Missense(1)	lung(1)											130.0	125.0	126.0					15																	27185157		1994	4170	6164	-	-	-	SO:0001583	missense	0				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.810G>A	15.37:g.27185157G>A	ENSP00000335592:p.Met270Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa5_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.M270I	ENST00000335625.5	37	c.810	CCDS45194.1	15	.	.	.	.	.	.	.	.	.	.	G	27.6	4.846924	0.91277	.	.	ENSG00000186297	ENST00000335625;ENST00000355395;ENST00000400081	D;D;D	0.85556	-2.0;-2.0;-2.0	5.32	5.32	0.75619	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.88355	0.6414	L	0.34521	1.04	0.80722	D	1	D	0.55385	0.971	D	0.64877	0.93	D	0.89718	0.3917	10	0.87932	D	0	.	17.9859	0.89156	0.0:0.0:1.0:0.0	.	270	P31644	GBRA5_HUMAN	I	270	ENSP00000335592:M270I;ENSP00000347557:M270I;ENSP00000382953:M270I	ENSP00000335592:M270I	M	+	3	0	GABRA5	24767903	1.000000	0.71417	0.991000	0.47740	0.983000	0.72400	9.592000	0.98245	2.491000	0.84063	0.561000	0.74099	ATG	GABRA5	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000186297		0.493	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA5	HGNC	protein_coding	OTTHUMT00000415234.1	74	0.00	0	G			27185157	27185157	+1	no_errors	ENST00000335625	ensembl	human	known	69_37n	missense	82	36.92	48	SNP	1.000	A
GAMT	2593	genome.wustl.edu	37	19	1398963	1398963	+	Missense_Mutation	SNP	C	C	A	rs370421531		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:1398963C>A	ENST00000252288.2	-	5	588	c.522G>T	c.(520-522)tgG>tgT	p.W174C	GAMT_ENST00000447102.3_Missense_Mutation_p.W174C|AC005329.7_ENST00000501448.1_RNA	NM_000156.5	NP_000147.1	Q14353	GAMT_HUMAN	guanidinoacetate N-methyltransferase	174	RMT2. {ECO:0000255|PROSITE- ProRule:PRU00892}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine biosynthetic process (GO:0006601)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|organ morphogenesis (GO:0009887)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	guanidinoacetate N-methyltransferase activity (GO:0030731)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|upper_aerodigestive_tract(1)	6		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Lung NSC(49;0.000195)|Breast(49;0.000231)|all_lung(49;0.000247)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Creatine(DB00148)|Guanidine(DB00536)	TCAGCTCCCCCCAGGAGGTGA	0.602																																					Colon(167;1531 1939 13427 28842 31956)	dbGAP											0			GRCh37	CI086246|CM090567	GAMT	I|M							79.0	65.0	69.0					19																	1398963		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z49878	CCDS12064.1, CCDS45897.1	19p13.3	2008-02-05							4136	protein-coding gene	gene with protein product		601240				9570966, 8547310	Standard	NM_000156		Approved	PIG2, TP53I2	uc002lsk.4	Q14353		ENST00000252288.2:c.522G>T	19.37:g.1398963C>A	ENSP00000252288:p.Trp174Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0A0|Q53Y34|Q8WVJ1	Missense_Mutation	SNP	NULL	p.W174C	ENST00000252288.2	37	c.522	CCDS12064.1	19	.	.	.	.	.	.	.	.	.	.	C	20.1	3.935479	0.73442	.	.	ENSG00000130005	ENST00000252288;ENST00000447102	D;D	0.89196	-2.48;-2.48	3.96	3.96	0.45880	.	0.120475	0.64402	D	0.000011	D	0.92961	0.7760	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.986	D	0.92254	0.5811	10	0.38643	T	0.18	-14.1903	13.56	0.61784	0.0:1.0:0.0:0.0	.	174;174	A8K0A0;Q14353	.;GAMT_HUMAN	C	174	ENSP00000252288:W174C;ENSP00000403536:W174C	ENSP00000252288:W174C	W	-	3	0	GAMT	1349963	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.235000	0.78143	2.040000	0.60383	0.297000	0.19635	TGG	GAMT	-	NULL	ENSG00000130005		0.602	GAMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAMT	HGNC	protein_coding	OTTHUMT00000449739.1	47	0.00	0	C	NM_138924		1398963	1398963	-1	no_errors	ENST00000447102	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	1.000	A
GDA	9615	genome.wustl.edu	37	9	74817626	74817626	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:74817626G>A	ENST00000358399.3	+	3	445	c.352G>A	c.(352-354)Gac>Aac	p.D118N	GDA_ENST00000376989.3_Missense_Mutation_p.D93N|GDA_ENST00000477618.1_3'UTR|GDA_ENST00000376986.1_Missense_Mutation_p.D76N|GDA_ENST00000238018.4_Missense_Mutation_p.D118N|GDA_ENST00000545168.1_Missense_Mutation_p.D44N	NM_001242505.2|NM_001242506.2|NM_004293.4	NP_001229434.1|NP_001229435.1|NP_004284.1	Q9Y2T3	GUAD_HUMAN	guanine deaminase	118					guanine catabolic process (GO:0006147)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	guanine deaminase activity (GO:0008892)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|kidney(1)|large_intestine(1)|lung(20)|ovary(2)|skin(2)|urinary_tract(1)	32		Myeloproliferative disorder(762;0.0122)		Lung(182;0.0583)		CCAGAACATCGACTTTGCAGA	0.428																																						dbGAP											0													224.0	203.0	210.0					9																	74817626		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095286	CCDS6641.1, CCDS56576.1, CCDS56577.1	9q21.13	2008-05-14			ENSG00000119125	ENSG00000119125			4212	protein-coding gene	gene with protein product		139260				10075721, 3966794	Standard	NM_001242507		Approved		uc004air.3	Q9Y2T3	OTTHUMG00000020005	ENST00000358399.3:c.352G>A	9.37:g.74817626G>A	ENSP00000351170:p.Asp118Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTY5|Q5SZC7|Q9H335|Q9ULG2	Missense_Mutation	SNP	pfam_Amidohydro_1,tigrfam_Guanine_deaminase	p.D118N	ENST00000358399.3	37	c.352	CCDS6641.1	9	.	.	.	.	.	.	.	.	.	.	G	9.145	1.014772	0.19355	.	.	ENSG00000119125	ENST00000545168;ENST00000238018;ENST00000376989;ENST00000376986;ENST00000358399	D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72	5.62	5.62	0.85841	Amidohydrolase 1 (1);	0.243341	0.47093	D	0.000260	D	0.85186	0.5639	L	0.33668	1.02	0.45704	D	0.998612	B;B;B	0.15719	0.014;0.009;0.003	B;B;B	0.16289	0.015;0.004;0.002	T	0.79603	-0.1735	10	0.27785	T	0.31	-16.3006	13.8865	0.63712	0.0725:0.0:0.9275:0.0	.	76;118;118	Q5SZC6;Q9Y2T3-3;Q9Y2T3	.;.;GUAD_HUMAN	N	44;118;93;76;118	ENSP00000437972:D44N;ENSP00000238018:D118N;ENSP00000366188:D93N;ENSP00000366185:D76N;ENSP00000351170:D118N	ENSP00000238018:D118N	D	+	1	0	GDA	74007446	1.000000	0.71417	0.900000	0.35374	0.013000	0.08279	3.375000	0.52410	2.659000	0.90383	0.655000	0.94253	GAC	GDA	-	pfam_Amidohydro_1,tigrfam_Guanine_deaminase	ENSG00000119125		0.428	GDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDA	HGNC	protein_coding	OTTHUMT00000052633.1	109	0.00	0	G			74817626	74817626	+1	no_errors	ENST00000238018	ensembl	human	known	69_37n	missense	57	37.36	34	SNP	0.924	A
GIMAP7	168537	genome.wustl.edu	37	7	150217320	150217320	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:150217320C>T	ENST00000313543.4	+	2	415	c.258C>T	c.(256-258)atC>atT	p.I86I		NM_153236.3	NP_694968.1	Q8NHV1	GIMA7_HUMAN	GTPase, IMAP family member 7	86	AIG1-type G.				GTP catabolic process (GO:0006184)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)			breast(1)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	17			OV - Ovarian serous cystadenocarcinoma(82;0.0218)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		GCTGCATCATCTCCTCCTGCC	0.552																																						dbGAP											0													49.0	50.0	50.0					7																	150217320		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC027613	CCDS5903.1	7q36.1	2014-04-04			ENSG00000179144	ENSG00000179144		"""GTPases, IMAP"""	22404	protein-coding gene	gene with protein product	"""immune-associated nucleotide-binding protein 7"""					15474311	Standard	NM_153236		Approved	MGC27027, IAN7	uc003whk.3	Q8NHV1	OTTHUMG00000157626	ENST00000313543.4:c.258C>T	7.37:g.150217320C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_AIG1	p.I86	ENST00000313543.4	37	c.258	CCDS5903.1	7																																																																																			GIMAP7	-	pfam_AIG1	ENSG00000179144		0.552	GIMAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIMAP7	HGNC	protein_coding	OTTHUMT00000349277.1	55	0.00	0	C	NM_153236		150217320	150217320	+1	no_errors	ENST00000313543	ensembl	human	known	69_37n	silent	34	26.09	12	SNP	0.000	T
GJD4	219770	genome.wustl.edu	37	10	35896648	35896648	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:35896648C>G	ENST00000321660.1	+	2	365	c.207C>G	c.(205-207)ttC>ttG	p.F69L	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	69					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						ACGACGTCTTCTCCCCCGTGT	0.632																																						dbGAP											0													186.0	155.0	166.0					10																	35896648		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.207C>G	10.37:g.35896648C>G	ENSP00000315070:p.Phe69Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2R7	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.F69L	ENST00000321660.1	37	c.207	CCDS7191.1	10	.	.	.	.	.	.	.	.	.	.	C	17.59	3.428230	0.62844	.	.	ENSG00000177291	ENST00000321660	D	0.99070	-5.39	6.11	4.23	0.50019	Connexin, N-terminal (2);	0.042922	0.85682	D	0.000000	D	0.99149	0.9706	M	0.87097	2.86	0.48696	D	0.999694	D	0.71674	0.998	D	0.74674	0.984	D	0.99376	1.0921	10	0.36615	T	0.2	.	10.9189	0.47152	0.0:0.7963:0.0:0.2037	.	69	Q96KN9	CXD4_HUMAN	L	69	ENSP00000315070:F69L	ENSP00000315070:F69L	F	+	3	2	GJD4	35936654	0.980000	0.34600	0.997000	0.53966	0.130000	0.20726	0.425000	0.21346	1.568000	0.49683	0.655000	0.94253	TTC	GJD4	-	pfam_Connexin_N,smart_Connexin_N,prints_Connexin	ENSG00000177291		0.632	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD4	HGNC	protein_coding	OTTHUMT00000047576.1	33	0.00	0	C	NM_153368		35896648	35896648	+1	no_errors	ENST00000321660	ensembl	human	known	69_37n	missense	47	30.88	21	SNP	1.000	G
GLA	2717	genome.wustl.edu	37	X	100655659	100655659	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:100655659G>C	ENST00000218516.3	-	4	655	c.634C>G	c.(634-636)Caa>Gaa	p.Q212E	GLA_ENST00000479445.1_5'Flank|RPL36A-HNRNPH2_ENST00000409170.3_Intron	NM_000169.2	NP_000160.1	P06280	AGAL_HUMAN	galactosidase, alpha	212					glycoside catabolic process (GO:0016139)|glycosphingolipid catabolic process (GO:0046479)|glycosphingolipid metabolic process (GO:0006687)|glycosylceramide catabolic process (GO:0046477)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric-oxide synthase activity (GO:0051001)|oligosaccharide metabolic process (GO:0009311)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)	alpha-galactosidase activity (GO:0004557)|catalytic activity (GO:0003824)|galactoside binding (GO:0016936)|hydrolase activity (GO:0016787)|protein homodimerization activity (GO:0042803)|raffinose alpha-galactosidase activity (GO:0052692)|receptor binding (GO:0005102)			endometrium(1)|kidney(1)|large_intestine(4)|lung(8)	14						CTCACCTTTTGAAAGGGCCAC	0.433																																					Colon(193;776 2816 31189 44474)	dbGAP											0													68.0	57.0	61.0					X																	100655659		2203	4300	6503	-	-	-	SO:0001583	missense	0			X16889	CCDS14484.1	Xq21.3-q22	2014-09-17			ENSG00000102393	ENSG00000102393	3.2.1.22		4296	protein-coding gene	gene with protein product		300644					Standard	NM_000169		Approved	GALA	uc004ehl.1	P06280	OTTHUMG00000022026	ENST00000218516.3:c.634C>G	X.37:g.100655659G>C	ENSP00000218516:p.Gln212Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LER7	Missense_Mutation	SNP	pfam_Glyco_hydro_GHD,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_27	p.Q212E	ENST00000218516.3	37	c.634	CCDS14484.1	X	.	.	.	.	.	.	.	.	.	.	G	0.004	-2.274006	0.00257	.	.	ENSG00000102393	ENST00000218516	D	0.99929	-8.14	5.3	0.209	0.15226	Aldolase-type TIM barrel (1);Glycoside hydrolase, superfamily (1);	0.910714	0.09700	N	0.767126	D	0.98789	0.9592	.	.	.	0.09310	N	1	B	0.23540	0.087	B	0.12837	0.008	D	0.99999	1.7952	9	0.02654	T	1	0.8099	2.2143	0.03955	0.1456:0.1204:0.3555:0.3785	.	212	P06280	AGAL_HUMAN	E	212	ENSP00000218516:Q212E	ENSP00000218516:Q212E	Q	-	1	0	GLA	100542315	0.968000	0.33430	0.001000	0.08648	0.302000	0.27658	0.452000	0.21795	-0.466000	0.06943	-0.237000	0.12165	CAA	GLA	-	superfamily_Glycoside_hydrolase_SF	ENSG00000102393		0.433	GLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLA	HGNC	protein_coding	OTTHUMT00000057540.1	86	0.00	0	G			100655659	100655659	-1	no_errors	ENST00000218516	ensembl	human	known	69_37n	missense	67	25.56	23	SNP	0.000	C
GPR113	165082	genome.wustl.edu	37	2	26538505	26538505	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:26538505C>T	ENST00000311519.1	-	6	806	c.807G>A	c.(805-807)ctG>ctA	p.L269L	GPR113_ENST00000333478.6_Intron|GPR113_ENST00000459892.1_5'UTR|GPR113_ENST00000541401.1_Intron|GPR113_ENST00000421160.2_Silent_p.L200L	NM_001145168.1	NP_001138640.1	Q8IZF5	GP113_HUMAN	G protein-coupled receptor 113	269					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	24	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CTGGGTGCCTCAGGAACCAGC	0.632																																						dbGAP											0													40.0	49.0	46.0					2																	26538505		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AB083619	CCDS33159.2, CCDS46238.1, CCDS46239.1	2p24.1	2014-08-08			ENSG00000173567	ENSG00000173567		"""-"", ""GPCR / Class B : Orphans"""	18989	protein-coding gene	gene with protein product						12435584	Standard	NM_153835		Approved	hGPCR37, PGR23	uc002rhe.4	Q8IZF5	OTTHUMG00000150225	ENST00000311519.1:c.807G>A	2.37:g.26538505C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF15|E9PEV1|Q53TA5|Q6UXT7|Q6UXX3|Q86SL7|Q8IXD8|Q8TDT3	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_GPS_dom,pfam_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.L269	ENST00000311519.1	37	c.807	CCDS46239.1	2																																																																																			GPR113	-	NULL	ENSG00000173567		0.632	GPR113-004	PUTATIVE	basic|CCDS	protein_coding	GPR113	HGNC	protein_coding	OTTHUMT00000316892.1	39	0.00	0	C	NM_153835		26538505	26538505	-1	no_errors	ENST00000311519	ensembl	human	putative	69_37n	silent	23	42.50	17	SNP	0.983	T
GPR116	221395	genome.wustl.edu	37	6	46828604	46828604	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:46828604C>T	ENST00000283296.7	-	16	2515	c.2227G>A	c.(2227-2229)Gag>Aag	p.E743K	GPR116_ENST00000545669.1_Missense_Mutation_p.E172K|GPR116_ENST00000362015.4_Missense_Mutation_p.E743K|GPR116_ENST00000265417.7_Missense_Mutation_p.E743K|GPR116_ENST00000456426.2_Missense_Mutation_p.E601K	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116	743					energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			GGGAGCATCTCATCCTGAGAG	0.413																																					NSCLC(59;410 1274 8751 36715 50546)	dbGAP											0													84.0	82.0	83.0					6																	46828604		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.2227G>A	6.37:g.46828604C>T	ENSP00000283296:p.Glu743Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_SEA,pfam_GPS_dom,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,pfscan_Ig-like,prints_GPCR_2_Ig-hepta_rcpt,prints_GPCR_2_secretin-like	p.E743K	ENST00000283296.7	37	c.2227	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	C	9.859	1.195748	0.22037	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000456426;ENST00000545557;ENST00000265417;ENST00000545669	T;T;T;T;T	0.28069	1.69;2.07;1.7;1.69;1.63	5.68	1.1	0.20463	.	0.634935	0.14624	N	0.308216	T	0.04952	0.0133	N	0.17474	0.49	0.18873	N	0.999986	B;B;B;B;B	0.19445	0.012;0.002;0.001;0.036;0.001	B;B;B;B;B	0.18263	0.009;0.003;0.001;0.021;0.001	T	0.45145	-0.9281	10	0.15066	T	0.55	-3.1577	7.6636	0.28417	0.0:0.5645:0.3314:0.1041	.	172;298;743;601;743	F5GWK9;B4DTV3;E9PBS6;Q8IZF2-3;Q8IZF2	.;.;.;.;GP116_HUMAN	K	743;743;743;601;114;743;172	ENSP00000283296:E743K;ENSP00000354563:E743K;ENSP00000412866:E601K;ENSP00000265417:E743K;ENSP00000441581:E172K	ENSP00000265417:E743K	E	-	1	0	GPR116	46936563	0.088000	0.21588	0.048000	0.18961	0.972000	0.66771	0.210000	0.17455	-0.114000	0.11936	0.655000	0.94253	GAG	GPR116	-	NULL	ENSG00000069122		0.413	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2	95	0.00	0	C	NM_015234		46828604	46828604	-1	no_errors	ENST00000265417	ensembl	human	known	69_37n	missense	42	35.38	23	SNP	0.239	T
GPRASP2	114928	genome.wustl.edu	37	X	101972129	101972129	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:101972129C>G	ENST00000535209.1	+	4	3163	c.2332C>G	c.(2332-2334)Caa>Gaa	p.Q778E	GPRASP2_ENST00000543253.1_Missense_Mutation_p.Q778E|GPRASP2_ENST00000332262.5_Missense_Mutation_p.Q778E			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	778						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TGATAATATTCAAATTGTTAT	0.313																																						dbGAP											0													75.0	83.0	80.0					X																	101972129		2203	4295	6498	-	-	-	SO:0001583	missense	0			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.2332C>G	X.37:g.101972129C>G	ENSP00000437394:p.Gln778Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXA0|Q8NAB4	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.Q778E	ENST00000535209.1	37	c.2332	CCDS14501.1	X	.	.	.	.	.	.	.	.	.	.	C	7.525	0.657462	0.14645	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.29142	1.58;1.58;1.58	4.17	2.37	0.29283	Armadillo-type fold (1);	0.165498	0.29113	N	0.013117	T	0.29028	0.0721	M	0.65975	2.015	0.25928	N	0.983029	B	0.29612	0.251	B	0.31614	0.133	T	0.22626	-1.0211	10	0.52906	T	0.07	-5.7442	6.0247	0.19648	0.217:0.577:0.206:0.0	.	778	Q96D09	GASP2_HUMAN	E	778	ENSP00000437872:Q778E;ENSP00000437394:Q778E;ENSP00000339057:Q778E	ENSP00000339057:Q778E	Q	+	1	0	GPRASP2	101858785	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	0.984000	0.29565	0.513000	0.28278	0.513000	0.50165	CAA	GPRASP2	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000158301		0.313	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	HGNC	protein_coding	OTTHUMT00000057626.2	65	0.00	0	C	NM_138437		101972129	101972129	+1	no_errors	ENST00000332262	ensembl	human	known	69_37n	missense	24	24.24	8	SNP	0.996	G
GPT	2875	genome.wustl.edu	37	8	145730399	145730399	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:145730399C>G	ENST00000528431.1	+	5	537	c.380C>G	c.(379-381)tCc>tGc	p.S127C	GPT_ENST00000394955.2_Missense_Mutation_p.S127C			P24298	ALAT1_HUMAN	glutamic-pyruvate transaminase (alanine aminotransferase)	127					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|lung(2)|ovary(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)		L-Alanine(DB00160)|Phenelzine(DB00780)	AGCGTCAGCTCCGGCATCCAG	0.642																																						dbGAP											0													61.0	65.0	64.0					8																	145730399		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6430.1	8q24.3	2013-09-19			ENSG00000167701	ENSG00000167701	2.6.1.2		4552	protein-coding gene	gene with protein product		138200					Standard	NM_005309		Approved	ALT1, GPT1	uc003zdh.4	P24298	OTTHUMG00000165176	ENST00000528431.1:c.380C>G	8.37:g.145730399C>G	ENSP00000433586:p.Ser127Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ18|D3DWM7|P78398|Q93076	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_ACC_synthase	p.S127C	ENST00000528431.1	37	c.380	CCDS6430.1	8	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065205	0.76187	.	.	ENSG00000167701	ENST00000528431;ENST00000394955	D;D	0.90788	-2.73;-2.73	5.23	5.23	0.72850	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.254195	0.39687	N	0.001286	D	0.88640	0.6491	N	0.11560	0.145	0.35498	D	0.799525	D;B	0.58268	0.982;0.04	D;B	0.65140	0.932;0.063	D	0.91453	0.5183	10	0.56958	D	0.05	-10.8671	11.3874	0.49793	0.181:0.819:0.0:0.0	.	127;127	B4DPT5;P24298	.;ALAT1_HUMAN	C	127	ENSP00000433586:S127C;ENSP00000378408:S127C	ENSP00000378408:S127C	S	+	2	0	GPT	145701207	0.985000	0.35326	0.958000	0.39756	0.970000	0.65996	2.958000	0.49145	2.431000	0.82371	0.561000	0.74099	TCC	GPT	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000167701		0.642	GPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT	HGNC	protein_coding	OTTHUMT00000382471.1	37	0.00	0	C			145730399	145730399	+1	no_errors	ENST00000394955	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.998	G
GRB7	2886	genome.wustl.edu	37	17	37898674	37898674	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:37898674G>C	ENST00000309156.4	+	2	377	c.120G>C	c.(118-120)aaG>aaC	p.K40N	GRB7_ENST00000394211.3_Missense_Mutation_p.K40N|GRB7_ENST00000445327.2_Missense_Mutation_p.K63N|GRB7_ENST00000394209.2_Missense_Mutation_p.K40N|GRB7_ENST00000309185.3_Missense_Mutation_p.K40N|GRB7_ENST00000394204.1_Missense_Mutation_p.K40N|GRB7_ENST00000578702.1_3'UTR	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	40					blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AGGAGGTAAAGAGGTCCCAGC	0.637																																						dbGAP											0													42.0	47.0	45.0					17																	37898674		2202	4300	6502	-	-	-	SO:0001583	missense	0			D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.120G>C	17.37:g.37898674G>C	ENSP00000310771:p.Lys40Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.K63N	ENST00000309156.4	37	c.189	CCDS11345.1	17	.	.	.	.	.	.	.	.	.	.	G	12.65	2.002390	0.35320	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	T;T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9;0.9	4.61	4.61	0.57282	.	0.142661	0.46758	D	0.000262	T	0.46737	0.1408	L	0.50333	1.59	0.40199	D	0.977493	D;B	0.53462	0.96;0.286	P;B	0.50537	0.643;0.142	T	0.50558	-0.8814	10	0.54805	T	0.06	-20.4417	12.9557	0.58425	0.0:0.0:1.0:0.0	.	40;40	Q14451-2;Q14451	.;GRB7_HUMAN	N	40;40;40;40;63;40	ENSP00000311752:K40N;ENSP00000310771:K40N;ENSP00000377761:K40N;ENSP00000377759:K40N;ENSP00000403459:K63N;ENSP00000377754:K40N	ENSP00000310771:K40N	K	+	3	2	GRB7	35152200	0.988000	0.35896	1.000000	0.80357	0.942000	0.58702	1.373000	0.34272	2.113000	0.64589	0.561000	0.74099	AAG	GRB7	-	NULL	ENSG00000141738		0.637	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB7	HGNC	protein_coding	OTTHUMT00000257024.2	28	0.00	0	G	NM_005310		37898674	37898674	+1	no_errors	ENST00000445327	ensembl	human	known	69_37n	missense	10	61.54	16	SNP	1.000	C
GREB1L	80000	genome.wustl.edu	37	18	19029635	19029635	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:19029635G>C	ENST00000580732.2	+	12	1939	c.1558G>C	c.(1558-1560)Gac>Cac	p.D520H	GREB1L_ENST00000269218.6_Intron|GREB1L_ENST00000400483.4_Missense_Mutation_p.D520H|GREB1L_ENST00000431264.1_Missense_Mutation_p.D520H|RP11-296E23.1_ENST00000584611.1_RNA|GREB1L_ENST00000578368.1_3'UTR|GREB1L_ENST00000424526.1_Missense_Mutation_p.D520H|SNORD23_ENST00000408212.1_RNA			Q9C091	GRB1L_HUMAN	growth regulation by estrogen in breast cancer-like	520						integral component of membrane (GO:0016021)				breast(5)|endometrium(4)|kidney(6)|lung(1)|skin(1)	17						CGTATCTCAAGACTTGGTTCA	0.498																																						dbGAP											0													169.0	144.0	152.0					18																	19029635		692	1591	2283	-	-	-	SO:0001583	missense	0			AK023749	CCDS45836.1	18q11.2	2009-09-08	2009-09-08	2009-09-08					31042	protein-coding gene	gene with protein product			"""KIAA1772"""	KIAA1772		11214970	Standard	NM_001142966		Approved	FLJ13687, C18orf6	uc010xam.2	Q9C091		ENST00000580732.2:c.1558G>C	18.37:g.19029635G>C	ENSP00000464162:p.Asp520His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QN17|Q9H8F1	Missense_Mutation	SNP	NULL	p.D520H	ENST00000580732.2	37	c.1558	CCDS45836.1	18	.	.	.	.	.	.	.	.	.	.	G	27.3	4.822928	0.90873	.	.	ENSG00000141449	ENST00000424526;ENST00000400483;ENST00000431264	T;T;T	0.17054	3.06;2.3;2.3	5.57	5.57	0.84162	.	.	.	.	.	T	0.41903	0.1179	L	0.61218	1.895	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.73380	0.964;0.98	T	0.10291	-1.0636	9	0.54805	T	0.06	.	19.5391	0.95267	0.0:0.0:1.0:0.0	.	520;520	Q9C091;Q9C091-2	GRB1L_HUMAN;.	H	520	ENSP00000412060:D520H;ENSP00000383331:D520H;ENSP00000393125:D520H	ENSP00000383331:D520H	D	+	1	0	GREB1L	17283633	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.529000	0.81952	2.639000	0.89480	0.655000	0.94253	GAC	GREB1L	-	NULL	ENSG00000141449		0.498	GREB1L-003	KNOWN	not_organism_supported|upstream_uORF|basic|appris_principal|CCDS	protein_coding	GREB1L	HGNC	protein_coding	OTTHUMT00000443782.2	109	0.00	0	G	NM_024935		19029635	19029635	+1	no_errors	ENST00000424526	ensembl	human	known	69_37n	missense	71	26.04	25	SNP	1.000	C
GRINA	2907	genome.wustl.edu	37	8	145066883	145066883	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:145066883G>A	ENST00000313269.5	+	7	1268	c.990G>A	c.(988-990)ctG>ctA	p.L330L	GRINA_ENST00000395068.4_Silent_p.L330L	NM_000837.1	NP_000828.1	Q7Z429	LFG1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding)	330						integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|stomach(1)	9	all_cancers(97;8.2e-11)|all_epithelial(106;1.1e-09)|Lung NSC(106;5.89e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.31e-40)|Epithelial(56;1.16e-39)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.105)			ACACCCAGCTGCTACTGGGGA	0.582																																						dbGAP											0													131.0	89.0	103.0					8																	145066883		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			NM_001009184	CCDS34961.1	8q24.3	2010-03-18	2008-04-01						4589	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 3"""	138251		NMDARA1		1719427, 8406459	Standard	XM_005250899		Approved	HNRGW, TMBIM3, LFG1	uc003zao.1	Q7Z429		ENST00000313269.5:c.990G>A	8.37:g.145066883G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXM7|O43836|Q8IVW7	Missense_Mutation	SNP	NULL	p.C309Y	ENST00000313269.5	37	c.926	CCDS34961.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.80|10.80	1.453453|1.453453	0.26161|0.26161	.|.	.|.	ENSG00000178719|ENSG00000178719	ENST00000533044;ENST00000527194|ENST00000534791	.|.	.|.	.|.	4.72|4.72	2.89|2.89	0.33648|0.33648	.|.	.|.	.|.	.|.	.|.	T|T	0.55955|0.55955	0.1953|0.1953	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.48468|0.48468	-0.9033|-0.9033	4|4	.|.	.|.	.|.	-9.131|-9.131	7.4961|7.4961	0.27490|0.27490	0.2001:0.0:0.7999:0.0|0.2001:0.0:0.7999:0.0	.|.	.|.	.|.	.|.	T|Y	153;143|309	.|.	.|.	A|C	+|+	1|2	0|0	GRINA|GRINA	145138871|145138871	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.947000|0.947000	0.59692|0.59692	0.369000|0.369000	0.20416|0.20416	0.580000|0.580000	0.29522|0.29522	-0.350000|-0.350000	0.07774|0.07774	GCT|TGC	GRINA	-	NULL	ENSG00000178719		0.582	GRINA-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GRINA	HGNC	protein_coding	OTTHUMT00000384048.1	59	0.00	0	G	NM_001009184		145066883	145066883	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000534791	ensembl	human	putative	69_37n	missense	42	25.00	14	SNP	1.000	A
GRM2	2912	genome.wustl.edu	37	3	51747097	51747097	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:51747097C>G	ENST00000395052.3	+	3	1293	c.1059C>G	c.(1057-1059)ttC>ttG	p.F353L	GRM2_ENST00000475478.1_Intron|GRM2_ENST00000442933.2_Missense_Mutation_p.F353L	NM_000839.3	NP_000830.2	Q14416	GRM2_HUMAN	glutamate receptor, metabotropic 2	353					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|glutamate secretion (GO:0014047)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(1)|lung(11)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGCAGAGGTTCCGCTGCAGCT	0.587																																						dbGAP											0													42.0	38.0	40.0					3																	51747097		2203	4300	6503	-	-	-	SO:0001583	missense	0			L35318	CCDS2834.1	3p21.2	2013-09-20			ENSG00000164082	ENSG00000164082		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4594	protein-coding gene	gene with protein product		604099				7620613	Standard	NM_000839		Approved	GPRC1B, mGlu2, MGLUR2	uc010hlv.3	Q14416	OTTHUMG00000156902	ENST00000395052.3:c.1059C>G	3.37:g.51747097C>G	ENSP00000378492:p.Phe353Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M0K7|Q14CU5|Q52MC6|Q9H3N6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_GABA_rcpt_B	p.F353L	ENST00000395052.3	37	c.1059	CCDS2834.1	3	.	.	.	.	.	.	.	.	.	.	C	17.79	3.475022	0.63737	.	.	ENSG00000164082	ENST00000395052;ENST00000442933	D;D	0.90197	-2.63;-2.63	4.95	1.02	0.19986	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.94450	0.8214	M	0.84511	2.7	0.58432	D	0.999997	D	0.65815	0.995	D	0.68353	0.957	D	0.93663	0.6983	10	0.87932	D	0	.	11.2239	0.48871	0.0:0.6628:0.0:0.3372	.	353	Q14416	GRM2_HUMAN	L	353	ENSP00000378492:F353L;ENSP00000408906:F353L	ENSP00000296479:F353L	F	+	3	2	GRM2	51722137	0.175000	0.23083	0.995000	0.50966	0.983000	0.72400	0.555000	0.23422	0.236000	0.21180	0.555000	0.69702	TTC	GRM2	-	pfam_ANF_lig-bd_rcpt	ENSG00000164082		0.587	GRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM2	HGNC	protein_coding	OTTHUMT00000346542.1	24	0.00	0	C			51747097	51747097	+1	no_errors	ENST00000395052	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.688	G
GRXCR1	389207	genome.wustl.edu	37	4	42895457	42895457	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:42895457C>T	ENST00000399770.2	+	1	174	c.174C>T	c.(172-174)tcC>tcT	p.S58S	RN7SKP82_ENST00000516786.1_RNA	NM_001080476.2	NP_001073945.1	A8MXD5	GRCR1_HUMAN	glutaredoxin, cysteine rich 1	58					auditory receptor cell differentiation (GO:0042491)|cell redox homeostasis (GO:0045454)|inner ear receptor cell development (GO:0060119)|inner ear receptor stereocilium organization (GO:0060122)|negative regulation of phosphatase activity (GO:0010923)|post-embryonic organ morphogenesis (GO:0048563)|sensory perception of sound (GO:0007605)|vestibular receptor cell development (GO:0060118)	kinocilium (GO:0060091)|stereocilium (GO:0032420)	electron carrier activity (GO:0009055)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(22)|ovary(1)|prostate(2)|skin(1)	32						TAGGTGATTCCGATGGACAGC	0.502																																						dbGAP											0													177.0	182.0	180.0					4																	42895457		2025	4199	6224	-	-	-	SO:0001819	synonymous_variant	0				CCDS43225.1	4p14	2014-06-12			ENSG00000215203	ENSG00000215203			31673	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 88"""	613283	"""deafness, autosomal recessive 25"""	DFNB25		20137778	Standard	NM_001080476		Approved	PPP1R88	uc003gwt.3	A8MXD5	OTTHUMG00000160434	ENST00000399770.2:c.174C>T	4.37:g.42895457C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold,superfamily_HSP_DnaJ_Cys-rich_dom	p.S58	ENST00000399770.2	37	c.174	CCDS43225.1	4																																																																																			GRXCR1	-	NULL	ENSG00000215203		0.502	GRXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRXCR1	HGNC	protein_coding	OTTHUMT00000360576.1	79	0.00	0	C	NM_001080476		42895457	42895457	+1	no_errors	ENST00000399770	ensembl	human	known	69_37n	silent	78	21.21	21	SNP	0.953	T
GXYLT2	727936	genome.wustl.edu	37	3	73004303	73004303	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:73004303C>T	ENST00000389617.4	+	4	816	c.655C>T	c.(655-657)Ctg>Ttg	p.L219L		NM_001080393.1	NP_001073862.1	A0PJZ3	GXLT2_HUMAN	glucoside xylosyltransferase 2	219					O-glycan processing (GO:0016266)	integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)|urinary_tract(3)	18						TGTCCTCTTTCTGAGACCTGT	0.493																																						dbGAP											0													74.0	71.0	72.0					3																	73004303		1939	4157	6096	-	-	-	SO:0001819	synonymous_variant	0			AC098481	CCDS46870.1	3p13	2013-02-22	2009-11-17	2009-11-17	ENSG00000172986	ENSG00000172986		"""Glycosyltransferase family 8 domain containing"""	33383	protein-coding gene	gene with protein product		613322	"""glycosyltransferase 8 domain containing 4"""	GLT8D4		19940119	Standard	NM_001080393		Approved		uc003dpg.3	A0PJZ3	OTTHUMG00000158815	ENST00000389617.4:c.655C>T	3.37:g.73004303C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Glyco_trans_8	p.L219	ENST00000389617.4	37	c.655	CCDS46870.1	3																																																																																			GXYLT2	-	pfam_Glyco_trans_8	ENSG00000172986		0.493	GXYLT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GXYLT2	HGNC	protein_coding	OTTHUMT00000352318.1	66	0.00	0	C	NM_001080393		73004303	73004303	+1	no_errors	ENST00000389617	ensembl	human	known	69_37n	silent	32	37.25	19	SNP	1.000	T
HAO1	54363	genome.wustl.edu	37	20	7866374	7866374	+	Missense_Mutation	SNP	G	G	C	rs146949214		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:7866374G>C	ENST00000378789.3	-	6	1002	c.951C>G	c.(949-951)atC>atG	p.I317M		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	317	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						AGCCCCAAACGATTGGTCTCC	0.448																																						dbGAP											0													111.0	112.0	112.0					20																	7866374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.951C>G	20.37:g.7866374G>C	ENSP00000368066:p.Ile317Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	pfam_FMN-dep_DH,pfam_Glu_synth_centr_C,pirsf_Alpha-hydoxy_acid_DH_FMN	p.I317M	ENST00000378789.3	37	c.951	CCDS13100.1	20	.	.	.	.	.	.	.	.	.	.	G	17.69	3.451557	0.63290	.	.	ENSG00000101323	ENST00000378789	T	0.31510	1.49	5.84	2.71	0.32032	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.401360	0.30639	N	0.009187	T	0.26376	0.0644	L	0.28192	0.835	0.35922	D	0.831874	B;B	0.15719	0.014;0.014	B;B	0.38156	0.266;0.266	T	0.30475	-0.9977	10	0.48119	T	0.1	-5.213	8.2869	0.31935	0.1353:0.0:0.7363:0.1284	.	317;317	A8K058;Q9UJM8	.;HAOX1_HUMAN	M	317	ENSP00000368066:I317M	ENSP00000368066:I317M	I	-	3	3	HAO1	7814374	1.000000	0.71417	0.838000	0.33150	0.884000	0.51177	0.592000	0.23984	1.477000	0.48234	0.484000	0.47621	ATC	HAO1	-	pfam_FMN-dep_DH,pirsf_Alpha-hydoxy_acid_DH_FMN	ENSG00000101323		0.448	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO1	HGNC	protein_coding	OTTHUMT00000077926.2	69	0.00	0	G			7866374	7866374	-1	no_errors	ENST00000378789	ensembl	human	known	69_37n	missense	61	21.79	17	SNP	0.995	C
HARS	3035	genome.wustl.edu	37	5	140070834	140070834	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:140070834C>T	ENST00000504156.1	-	1	775	c.56G>A	c.(55-57)cGa>cAa	p.R19Q	HARS_ENST00000307633.3_Missense_Mutation_p.R19Q|HARS2_ENST00000448069.2_5'Flank|HARS_ENST00000457527.2_Missense_Mutation_p.R19Q|HARS2_ENST00000508522.1_5'Flank|HARS_ENST00000448240.1_5'UTR|HARS_ENST00000415192.2_Missense_Mutation_p.R19Q|HARS2_ENST00000432671.2_5'Flank|HARS2_ENST00000230771.3_5'Flank|HARS2_ENST00000437649.2_5'Flank|HARS_ENST00000431330.2_Missense_Mutation_p.R19Q|HARS_ENST00000438307.2_Missense_Mutation_p.R19Q|HARS2_ENST00000435019.2_5'Flank	NM_002109.4	NP_002100.2	P12081	SYHC_HUMAN	histidyl-tRNA synthetase	19	WHEP-TRS.				gene expression (GO:0010467)|histidyl-tRNA aminoacylation (GO:0006427)|translation (GO:0006412)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|histidine-tRNA ligase activity (GO:0004821)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	19			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)		L-Histidine(DB00117)	CTTGAGGCCTCGCACGCGCTC	0.647																																						dbGAP											0													41.0	35.0	37.0					5																	140070834		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000498	CCDS4237.1, CCDS58976.1, CCDS58977.1, CCDS58978.1, CCDS75323.1, CCDS75324.1	5q31.3	2012-10-02			ENSG00000170445	ENSG00000170445	6.1.1.21	"""Aminoacyl tRNA synthetases / Class II"""	4816	protein-coding gene	gene with protein product	"""histidine tRNA ligase 1, cytoplasmic"""	142810					Standard	XM_005268428		Approved		uc003lgv.4	P12081	OTTHUMG00000129502	ENST00000504156.1:c.56G>A	5.37:g.140070834C>T	ENSP00000425634:p.Arg19Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHQ1|B4DY73|D6REN6|J3KNE5	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_WHEP-TRS,superfamily_Anticodon-bd,superfamily_S15_NS1_RNA-bd,pirsf_His-tRNA_synth_IIA,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_His-tRNA-synth_IIa_subgr	p.R19Q	ENST00000504156.1	37	c.56	CCDS4237.1	5	.	.	.	.	.	.	.	.	.	.	c	21.5	4.162131	0.78226	.	.	ENSG00000170445	ENST00000504156;ENST00000457527;ENST00000431330;ENST00000307633;ENST00000438307;ENST00000415192;ENST00000507746	T;T;T;T;T;T;T	0.75938	-0.98;-0.98;-0.98;-0.98;-0.98;-0.98;-0.98	5.65	4.77	0.60923	WHEP-TRS (3);S15/NS1, RNA-binding (2);	0.060448	0.64402	D	0.000002	T	0.80939	0.4720	L	0.60455	1.87	0.80722	D	1	D;D;D;P;B;P;B;B	0.63046	0.992;0.98;0.98;0.728;0.369;0.862;0.141;0.12	P;P;P;B;B;B;B;B	0.57776	0.827;0.578;0.578;0.082;0.031;0.316;0.027;0.013	T	0.82446	-0.0453	10	0.54805	T	0.06	-2.9938	14.9538	0.71094	0.1441:0.8559:0.0:0.0	.	19;19;19;19;19;19;19;19	B4DEA2;B4E1C5;B4DDD8;B4DHQ1;B4DY73;Q52NV4;D6REN6;P12081	.;.;.;.;.;.;.;SYHC_HUMAN	Q	19	ENSP00000425634:R19Q;ENSP00000387893:R19Q;ENSP00000393244:R19Q;ENSP00000304668:R19Q;ENSP00000411511:R19Q;ENSP00000411085:R19Q;ENSP00000425889:R19Q	ENSP00000304668:R19Q	R	-	2	0	HARS	140051018	0.994000	0.37717	0.971000	0.41717	0.759000	0.43091	3.452000	0.52971	1.602000	0.50124	0.655000	0.94253	CGA	HARS	-	pfam_WHEP-TRS,superfamily_S15_NS1_RNA-bd,pfscan_WHEP-TRS	ENSG00000170445		0.647	HARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HARS	HGNC	protein_coding	OTTHUMT00000251673.2	24	0.00	0	C	NM_002109		140070834	140070834	-1	no_errors	ENST00000504156	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	T
HECW2	57520	genome.wustl.edu	37	2	197183447	197183447	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:197183447C>T	ENST00000260983.3	-	9	2349	c.2167G>A	c.(2167-2169)Gaa>Aaa	p.E723K	HECW2_ENST00000409111.1_Missense_Mutation_p.E367K	NM_020760.1	NP_065811.1	Q9P2P5	HECW2_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 2	723					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(24)|lung(45)|ovary(5)|pancreas(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	113						GTGGCCGATTCTGCCCCTGGC	0.657																																						dbGAP											0													30.0	32.0	32.0					2																	197183447		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL390186	CCDS33354.1	2q32.3	2004-12-13			ENSG00000138411	ENSG00000138411			29853	protein-coding gene	gene with protein product						10718198, 12890487	Standard	NM_020760		Approved	KIAA1301, NEDL2	uc002utm.1	Q9P2P5	OTTHUMG00000154435	ENST00000260983.3:c.2167G>A	2.37:g.197183447C>T	ENSP00000260983:p.Glu723Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZB4|Q17RT5|Q68DF8|Q9NPS9	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.E723K	ENST00000260983.3	37	c.2167	CCDS33354.1	2	.	.	.	.	.	.	.	.	.	.	C	13.95	2.389711	0.42410	.	.	ENSG00000138411	ENST00000409111;ENST00000260983	T;T	0.31510	1.49;1.49	4.38	3.47	0.39725	.	2.202810	0.01816	N	0.033757	T	0.22322	0.0538	N	0.08118	0	0.34863	D	0.742869	B	0.06786	0.001	B	0.04013	0.001	T	0.07790	-1.0754	10	0.39692	T	0.17	.	12.5438	0.56186	0.0:0.8325:0.1675:0.0	.	723	Q9P2P5	HECW2_HUMAN	K	367;723	ENSP00000386775:E367K;ENSP00000260983:E723K	ENSP00000260983:E723K	E	-	1	0	HECW2	196891692	0.962000	0.33011	0.339000	0.25562	0.946000	0.59487	2.087000	0.41653	1.026000	0.39733	0.462000	0.41574	GAA	HECW2	-	NULL	ENSG00000138411		0.657	HECW2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW2	HGNC	protein_coding	OTTHUMT00000335199.3	22	0.00	0	C	NM_020760		197183447	197183447	-1	no_errors	ENST00000260983	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	0.877	T
HERC2	8924	genome.wustl.edu	37	15	28369301	28369301	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:28369301G>C	ENST00000261609.7	-	85	13178	c.13070C>G	c.(13069-13071)tCc>tGc	p.S4357C		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		GAAGAGCTCGGAGAGGTGGTG	0.572																																						dbGAP											0													102.0	88.0	92.0					15																	28369301		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.13070C>G	15.37:g.28369301G>C	ENSP00000261609:p.Ser4357Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.S4357C	ENST00000261609.7	37	c.13070	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	G	27.2	4.808599	0.90707	.	.	ENSG00000128731	ENST00000261609	T	0.48201	0.82	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.70211	0.3198	M	0.75777	2.31	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.73110	-0.4086	10	0.87932	D	0	.	19.5062	0.95116	0.0:0.0:1.0:0.0	.	4357	O95714	HERC2_HUMAN	C	4357	ENSP00000261609:S4357C	ENSP00000261609:S4357C	S	-	2	0	HERC2	26042896	1.000000	0.71417	0.983000	0.44433	0.718000	0.41266	9.860000	0.99555	2.604000	0.88044	0.655000	0.94253	TCC	HERC2	-	NULL	ENSG00000128731		0.572	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	70	0.00	0	G	NM_004667		28369301	28369301	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	22	42.11	16	SNP	1.000	C
HERC2	8924	genome.wustl.edu	37	15	28391398	28391398	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:28391398C>T	ENST00000261609.7	-	71	11101	c.10993G>A	c.(10993-10995)Gtc>Atc	p.V3665I		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CGCACGGAGACGATCCTGTTG	0.557																																						dbGAP											0													150.0	101.0	118.0					15																	28391398		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.10993G>A	15.37:g.28391398C>T	ENSP00000261609:p.Val3665Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.V3665I	ENST00000261609.7	37	c.10993	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	20.3	3.960008	0.74016	.	.	ENSG00000128731	ENST00000261609	T	0.39229	1.09	5.35	5.35	0.76521	.	0.064511	0.64402	N	0.000011	T	0.26738	0.0654	N	0.25060	0.705	0.80722	D	1	P	0.44044	0.825	B	0.26693	0.072	T	0.09907	-1.0653	10	0.37606	T	0.19	.	19.1305	0.93404	0.0:1.0:0.0:0.0	.	3665	O95714	HERC2_HUMAN	I	3665	ENSP00000261609:V3665I	ENSP00000261609:V3665I	V	-	1	0	HERC2	26064993	1.000000	0.71417	0.977000	0.42913	0.927000	0.56198	7.818000	0.86416	2.532000	0.85374	0.551000	0.68910	GTC	HERC2	-	superfamily_CUB	ENSG00000128731		0.557	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	47	0.00	0	C	NM_004667		28391398	28391398	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	1.000	T
HERC1	8925	genome.wustl.edu	37	15	63947976	63947976	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:63947976C>G	ENST00000443617.2	-	50	10136	c.10049G>C	c.(10048-10050)aGa>aCa	p.R3350T		NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	3350					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						ATAGTTAGGTCTTAGTTTGGC	0.383																																						dbGAP											0													62.0	55.0	57.0					15																	63947976		1843	4088	5931	-	-	-	SO:0001583	missense	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.10049G>C	15.37:g.63947976C>G	ENSP00000390158:p.Arg3350Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW65	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.R3350T	ENST00000443617.2	37	c.10049	CCDS45277.1	15	.	.	.	.	.	.	.	.	.	.	C	15.75	2.926446	0.52759	.	.	ENSG00000103657	ENST00000443617	T	0.23552	1.9	5.06	5.06	0.68205	.	0.063936	0.56097	D	0.000036	T	0.24275	0.0588	L	0.36672	1.1	0.53688	D	0.999972	P	0.34522	0.455	B	0.32624	0.149	T	0.03829	-1.1000	10	0.48119	T	0.1	.	18.803	0.92025	0.0:1.0:0.0:0.0	.	3350	Q15751	HERC1_HUMAN	T	3350	ENSP00000390158:R3350T	ENSP00000390158:R3350T	R	-	2	0	HERC1	61735029	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.956000	0.70315	2.520000	0.84964	0.655000	0.94253	AGA	HERC1	-	NULL	ENSG00000103657		0.383	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	144	0.00	0	C	NM_003922		63947976	63947976	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	missense	104	26.24	37	SNP	1.000	G
HERC6	55008	genome.wustl.edu	37	4	89334350	89334350	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:89334350G>A	ENST00000264346.7	+	12	1549	c.1490G>A	c.(1489-1491)tGg>tAg	p.W497*	HERC6_ENST00000380265.5_Nonsense_Mutation_p.W497*	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	497					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		TCTAAGAACTGGAAGAACCTG	0.423																																						dbGAP											0													159.0	157.0	157.0					4																	89334350		1930	4185	6115	-	-	-	SO:0001587	stop_gained	0			AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.1490G>A	4.37:g.89334350G>A	ENSP00000264346:p.Trp497*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Nonsense_Mutation	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.W497*	ENST00000264346.7	37	c.1490	CCDS47098.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.439800	0.96168	.	.	ENSG00000138642	ENST00000380265;ENST00000264346	.	.	.	4.76	0.891	0.19224	.	0.540548	0.18137	N	0.150560	.	.	.	.	.	.	0.26396	N	0.976497	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	4.8015	0.13299	0.0875:0.4638:0.3075:0.1412	.	.	.	.	X	497	.	ENSP00000264346:W497X	W	+	2	0	HERC6	89553373	0.961000	0.32948	0.124000	0.21820	0.555000	0.35460	0.634000	0.24614	-0.059000	0.13154	0.585000	0.79938	TGG	HERC6	-	NULL	ENSG00000138642		0.423	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERC6	HGNC	protein_coding	OTTHUMT00000363259.2	113	0.00	0	G			89334350	89334350	+1	no_errors	ENST00000264346	ensembl	human	known	69_37n	nonsense	62	32.61	30	SNP	0.196	A
HIST1H2BB	3018	genome.wustl.edu	37	6	26043570	26043570	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:26043570C>A	ENST00000357905.2	-	1	315	c.316G>T	c.(316-318)Gag>Tag	p.E106*	HIST1H3C_ENST00000540144.1_5'Flank	NM_021062.2	NP_066406.1	P33778	H2B1B_HUMAN	histone cluster 1, H2bb	106					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7						TTAGCCAGCTCCCCAGGCAGC	0.562																																						dbGAP											0													47.0	48.0	48.0					6																	26043570		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF531285	CCDS4575.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196226			"""Histones / Replication-dependent"""	4751	protein-coding gene	gene with protein product		602803	"""H2B histone family, member F"", ""histone 1, H2bb"""	H2BFF		8227173, 12408966	Standard	NM_021062		Approved	H2B/f	uc003nfu.3	P33778	OTTHUMG00000014421	ENST00000357905.2:c.316G>T	6.37:g.26043570C>A	ENSP00000350580:p.Glu106*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN36	Nonsense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E106*	ENST00000357905.2	37	c.316	CCDS4575.1	6	.	.	.	.	.	.	.	.	.	.	c	15.37	2.814390	0.50527	.	.	ENSG00000196226	ENST00000357905	.	.	.	5.08	5.08	0.68730	.	0.000000	0.64402	U	0.000020	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.8155	0.88632	0.0:1.0:0.0:0.0	.	.	.	.	X	106	.	ENSP00000350580:E106X	E	-	1	0	HIST1H2BB	26151549	1.000000	0.71417	1.000000	0.80357	0.240000	0.25518	6.088000	0.71371	2.498000	0.84270	0.467000	0.42956	GAG	HIST1H2BB	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000196226		0.562	HIST1H2BB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BB	HGNC	protein_coding	OTTHUMT00000040083.1	61	0.00	0	C	NM_021062		26043570	26043570	-1	no_errors	ENST00000357905	ensembl	human	known	69_37n	nonsense	55	35.29	30	SNP	1.000	A
HP1BP3	50809	genome.wustl.edu	37	1	21072124	21072124	+	Missense_Mutation	SNP	C	C	G	rs367692918		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:21072124C>G	ENST00000312239.5	-	12	1418	c.1279G>C	c.(1279-1281)Gag>Cag	p.E427Q	RP5-930J4.4_ENST00000413451.1_RNA|HP1BP3_ENST00000375003.2_Missense_Mutation_p.E275Q	NM_016287.3	NP_057371.2	Q5SSJ5	HP1B3_HUMAN	heterochromatin protein 1, binding protein 3	427					nucleosome assembly (GO:0006334)	nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(2)|skin(2)|urinary_tract(1)	16		all_lung(284;6.55e-06)|Lung NSC(340;6.59e-06)|Colorectal(325;3.46e-05)|Renal(390;9.67e-05)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.26e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00015)|GBM - Glioblastoma multiforme(114;0.000521)|Kidney(64;0.000529)|STAD - Stomach adenocarcinoma(196;0.00311)|KIRC - Kidney renal clear cell carcinoma(64;0.00687)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.201)		TCATCTGGCTCTTTCTTCGGA	0.408																																						dbGAP											0													112.0	102.0	105.0					1																	21072124		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC053327	CCDS30621.1	1p36.12	2008-02-05			ENSG00000127483	ENSG00000127483			24973	protein-coding gene	gene with protein product						12477932	Standard	NM_016287		Approved	HP1-BP74	uc001bdw.1	Q5SSJ5	OTTHUMG00000002622	ENST00000312239.5:c.1279G>C	1.37:g.21072124C>G	ENSP00000312625:p.Glu427Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI71|A8K5D7|B3KMZ8|B4E210|Q05BI0|Q5SSJ6|Q5SWC6|Q6PIM9|Q8NDF0|Q9UHY0	Missense_Mutation	SNP	pfam_Histone_H1/H5,smart_Histone_H1/H5	p.E427Q	ENST00000312239.5	37	c.1279	CCDS30621.1	1	.	.	.	.	.	.	.	.	.	.	C	11.55	1.672954	0.29693	.	.	ENSG00000127483	ENST00000312239;ENST00000375004;ENST00000375003	T;T	0.46063	0.89;0.88	5.72	5.72	0.89469	.	0.485962	0.24769	N	0.035750	T	0.25975	0.0633	N	0.22421	0.69	0.80722	D	1	B	0.10296	0.003	B	0.06405	0.002	T	0.07083	-1.0791	10	0.02654	T	1	-10.4036	13.3986	0.60870	0.0:0.8426:0.1574:0.0	.	427	Q5SSJ5	HP1B3_HUMAN	Q	427;389;275	ENSP00000312625:E427Q;ENSP00000364142:E275Q	ENSP00000312625:E427Q	E	-	1	0	HP1BP3	20944711	1.000000	0.71417	1.000000	0.80357	0.868000	0.49771	3.946000	0.56644	2.865000	0.98341	0.655000	0.94253	GAG	HP1BP3	-	NULL	ENSG00000127483		0.408	HP1BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HP1BP3	HGNC	protein_coding	OTTHUMT00000007457.2	113	0.00	0	C	NM_016287		21072124	21072124	-1	no_errors	ENST00000312239	ensembl	human	known	69_37n	missense	37	57.95	51	SNP	1.000	G
HMCN1	83872	genome.wustl.edu	37	1	186057115	186057115	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:186057115G>A	ENST00000271588.4	+	61	9644	c.9415G>A	c.(9415-9417)Gat>Aat	p.D3139N	HMCN1_ENST00000367492.2_Missense_Mutation_p.D3139N	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	3139	Ig-like C2-type 29.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						AGCAGGACGGGATGATAAAAA	0.353																																						dbGAP											0													138.0	143.0	141.0					1																	186057115		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.9415G>A	1.37:g.186057115G>A	ENSP00000271588:p.Asp3139Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.D3139N	ENST00000271588.4	37	c.9415	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.845506	0.91197	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.67698	-0.28;-0.28	5.68	5.68	0.88126	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.049084	0.85682	D	0.000000	T	0.79851	0.4517	M	0.64997	1.995	0.54753	D	0.999984	D	0.89917	1.0	D	0.87578	0.998	T	0.73678	-0.3907	10	0.19590	T	0.45	.	19.7939	0.96471	0.0:0.0:1.0:0.0	.	3139	Q96RW7	HMCN1_HUMAN	N	3139	ENSP00000271588:D3139N;ENSP00000356462:D3139N	ENSP00000271588:D3139N	D	+	1	0	HMCN1	184323738	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.750000	0.98875	2.668000	0.90789	0.563000	0.77884	GAT	HMCN1	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000143341		0.353	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	129	0.00	0	G	NM_031935		186057115	186057115	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	177	12.38	25	SNP	1.000	A
HIST3H3	8290	genome.wustl.edu	37	1	228612849	228612849	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:228612849C>T	ENST00000366696.1	-	1	177	c.178G>A	c.(178-180)Gag>Aag	p.E60K		NM_003493.2	NP_003484.1	Q16695	H31T_HUMAN	histone cluster 3, H3	60					telomere maintenance (GO:0000723)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(1)|lung(2)|prostate(2)|skin(1)	6		Prostate(94;0.0724)				ATTAGCAGCTCAGTGGACTTC	0.652																																						dbGAP											0													83.0	86.0	85.0					1																	228612849		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z49861	CCDS1572.1	1q42.13	2012-09-19	2006-10-11	2003-02-21	ENSG00000168148	ENSG00000168148		"""Histones / Replication-dependent"""	4778	protein-coding gene	gene with protein product		602820	"""H3 histone family, member T"", ""histone 3, H3"""	H3FT		8834248, 12408966	Standard	NM_003493		Approved	H3t, H3/g, H3.4	uc001hsx.1	Q16695	OTTHUMG00000040044	ENST00000366696.1:c.178G>A	1.37:g.228612849C>T	ENSP00000355657:p.Glu60Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5K3|Q6FGU4	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.E60K	ENST00000366696.1	37	c.178	CCDS1572.1	1	.	.	.	.	.	.	.	.	.	.	c	12.08	1.831937	0.32421	.	.	ENSG00000168148	ENST00000366696	T	0.43294	0.95	3.89	3.89	0.44902	Histone-fold (2);Histone core (1);	0.000000	0.40144	N	0.001172	T	0.50565	0.1623	L	0.60957	1.885	0.44073	D	0.996822	P	0.52170	0.951	P	0.51974	0.686	T	0.56202	-0.8018	10	0.66056	D	0.02	.	14.213	0.65776	0.0:1.0:0.0:0.0	.	60	Q16695	H31T_HUMAN	K	60	ENSP00000355657:E60K	ENSP00000355657:E60K	E	-	1	0	HIST3H3	226679472	0.999000	0.42202	0.938000	0.37757	0.019000	0.09904	4.374000	0.59543	2.438000	0.82558	0.645000	0.84053	GAG	HIST3H3	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000168148		0.652	HIST3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST3H3	HGNC	protein_coding	OTTHUMT00000096595.2	52	0.00	0	C	NM_003493		228612849	228612849	-1	no_errors	ENST00000366696	ensembl	human	known	69_37n	missense	91	26.02	32	SNP	0.999	T
ICAM1	3383	genome.wustl.edu	37	19	10394426	10394426	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:10394426G>C	ENST00000264832.3	+	3	926	c.601G>C	c.(601-603)Gag>Cag	p.E201Q	CTD-2369P2.8_ENST00000589379.1_RNA|CTD-2369P2.5_ENST00000592893.1_RNA|ICAM1_ENST00000423829.2_Intron	NM_000201.2	NP_000192.2	P05362	ICAM1_HUMAN	intercellular adhesion molecule 1	201					adhesion of symbiont to host (GO:0044406)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell aging (GO:0007569)|cellular response to alkaloid (GO:0071312)|cellular response to glucose stimulus (GO:0071333)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to nutrient levels (GO:0031669)|cellular response to tumor necrosis factor (GO:0071356)|cytokine-mediated signaling pathway (GO:0019221)|establishment of endothelial barrier (GO:0061028)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|ovarian follicle development (GO:0001541)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cellular extravasation (GO:0002693)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of vasoconstriction (GO:0045907)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of cell adhesion (GO:0030155)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of leukocyte mediated cytotoxicity (GO:0001910)|regulation of ruffle assembly (GO:1900027)|response to amino acid (GO:0043200)|response to amphetamine (GO:0001975)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to gonadotropin (GO:0034698)|response to ionizing radiation (GO:0010212)|response to organic cyclic compound (GO:0014070)|response to sulfur dioxide (GO:0010477)|T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:0002291)|T cell antigen processing and presentation (GO:0002457)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)|virus receptor activity (GO:0001618)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;2.81e-06)|all cancers(31;6.56e-06)		Hyaluronan(DB08818)|Natalizumab(DB00108)	GGAGCTGTTTGAGAACACCTC	0.602																																						dbGAP											0													24.0	25.0	25.0					19																	10394426		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12231.1	19p13.3-p13.2	2014-01-30	2008-07-18			ENSG00000090339		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Endogenous ligands"""	5344	protein-coding gene	gene with protein product	"""human rhinovirus receptor"""	147840				2453850, 3871395	Standard	NM_000201		Approved	BB2, CD54	uc002mnq.2	P05362		ENST00000264832.3:c.601G>C	19.37:g.10394426G>C	ENSP00000264832:p.Glu201Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6M3|Q5NKV7|Q96B50	Missense_Mutation	SNP	pfam_ICAM_N,smart_Ig_sub,prints_ICAM_VCAM_N,prints_ICAM	p.E201Q	ENST00000264832.3	37	c.601	CCDS12231.1	19	.	.	.	.	.	.	.	.	.	.	G	0.331	-0.955937	0.02267	.	.	ENSG00000090339	ENST00000264832	T	0.03181	4.02	4.11	-7.43	0.01383	Intercellular adhesion molecule (1);Immunoglobulin-like fold (1);	1.342420	0.05292	N	0.521288	T	0.00936	0.0031	N	0.01096	-1.015	0.09310	N	0.999999	B	0.02656	0.0	B	0.06405	0.002	T	0.43540	-0.9385	10	0.06494	T	0.89	-1.693	3.0478	0.06159	0.4457:0.2994:0.1652:0.0897	.	201	P05362	ICAM1_HUMAN	Q	201	ENSP00000264832:E201Q	ENSP00000264832:E201Q	E	+	1	0	ICAM1	10255426	0.000000	0.05858	0.001000	0.08648	0.039000	0.13416	-4.335000	0.00251	-1.397000	0.02068	-0.350000	0.07774	GAG	ICAM1	-	prints_ICAM	ENSG00000090339		0.602	ICAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICAM1	HGNC	protein_coding	OTTHUMT00000451207.1	17	0.00	0	G			10394426	10394426	+1	no_errors	ENST00000264832	ensembl	human	known	69_37n	missense	6	53.85	7	SNP	0.001	C
ICOSLG	23308	genome.wustl.edu	37	21	45656866	45656866	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr21:45656866G>A	ENST00000407780.3	-	3	417	c.290C>T	c.(289-291)tCc>tTc	p.S97F	ICOSLG_ENST00000400377.3_Intron|ICOSLG_ENST00000400379.3_Missense_Mutation_p.S97F|ICOSLG_ENST00000344330.4_Missense_Mutation_p.S97F	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand	97	Ig-like V-type.				B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		CAAGCGCAGGGAGAAGTCGCC	0.592																																						dbGAP											0													82.0	99.0	93.0					21																	45656866		2158	4269	6427	-	-	-	SO:0001583	missense	0			AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.290C>T	21.37:g.45656866G>A	ENSP00000384432:p.Ser97Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUZ1|Q9HD18|Q9NRQ1	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	p.S97F	ENST00000407780.3	37	c.290	CCDS42952.1	21	.	.	.	.	.	.	.	.	.	.	G	16.13	3.037292	0.54896	.	.	ENSG00000160223	ENST00000344330;ENST00000407780;ENST00000400379	T;T;T	0.70282	-0.47;-0.47;-0.47	5.01	5.01	0.66863	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.53938	D	0.000049	D	0.85492	0.5709	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87603	0.2498	10	0.87932	D	0	.	14.542	0.68002	0.0:0.0:1.0:0.0	.	97;97	A0N0L8;O75144	.;ICOSL_HUMAN	F	97	ENSP00000339477:S97F;ENSP00000384432:S97F;ENSP00000383230:S97F	ENSP00000339477:S97F	S	-	2	0	ICOSLG	44481294	0.998000	0.40836	0.972000	0.41901	0.093000	0.18481	4.279000	0.58953	2.713000	0.92767	0.655000	0.94253	TCC	ICOSLG	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000160223		0.592	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICOSLG	HGNC	protein_coding	OTTHUMT00000195838.1	67	0.00	0	G	NM_015259		45656866	45656866	-1	no_errors	ENST00000344330	ensembl	human	known	69_37n	missense	70	27.08	26	SNP	0.985	A
IGKV6D-21	28870	genome.wustl.edu	37	2	90060741	90060741	+	RNA	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:90060741C>T	ENST00000436451.2	+	0	155									immunoglobulin kappa variable 6D-21 (non-functional)																		TCCAGACTTTCAGTCTGTGAC	0.453																																						dbGAP											0													3.0	3.0	3.0					2																	90060741		1306	2915	4221	-	-	-			0			X12683		2p11.2	2012-02-10	2008-09-10		ENSG00000225523	ENSG00000225523		"""Immunoglobulins / IGK locus"""	5837	other	immunoglobulin gene			"""immunoglobulin kappa variable 6D-21"""				Standard	NG_000833		Approved	IGKV6D21, A10			OTTHUMG00000151608		2.37:g.90060741C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.Q30*	ENST00000436451.2	37	c.88		2																																																																																			IGKV6D-21	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000225523		0.453	IGKV6D-21-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV6D-21	HGNC	IG_V_gene	OTTHUMT00000323280.1	50	0.00	0	C	NG_000833		90060741	90060741	+1	no_stop_codon	ENST00000436451	ensembl	human	known	69_37n	nonsense	53	22.06	15	SNP	0.000	T
IGLV5-45	28781	genome.wustl.edu	37	22	22730813	22730813	+	RNA	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:22730813C>T	ENST00000390296.2	+	0	336									immunoglobulin lambda variable 5-45																		TTACTCATCTCTGGGCTCCAG	0.512																																						dbGAP											0													132.0	127.0	128.0					22																	22730813		1914	4132	6046	-	-	-			0			Z73670		22q11.2	2012-02-08			ENSG00000211650	ENSG00000211650		"""Immunoglobulins / IGL locus"""	5924	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151054		22.37:g.22730813C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S103F	ENST00000390296.2	37	c.308		22																																																																																			IGLV5-45	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211650		0.512	IGLV5-45-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGLV5-45	HGNC	IG_V_gene	OTTHUMT00000321114.2	104	0.00	0	C	NG_000002		22730813	22730813	+1	no_stop_codon	ENST00000390296	ensembl	human	known	69_37n	missense	79	23.30	24	SNP	0.404	T
IL1RAP	3556	genome.wustl.edu	37	3	190366258	190366258	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:190366258C>T	ENST00000412504.2	+	11	1729	c.1477C>T	c.(1477-1479)Cgg>Tgg	p.R493W	IL1RAP_ENST00000317757.3_Intron|IL1RAP_ENST00000443369.2_Intron|IL1RAP_ENST00000447382.1_Missense_Mutation_p.R493W|IL1RAP_ENST00000072516.3_Missense_Mutation_p.R493W|IL1RAP_ENST00000439062.1_Missense_Mutation_p.R493W			Q9NPH3	IL1AP_HUMAN	interleukin 1 receptor accessory protein	493	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-2 biosynthetic process (GO:0042094)|protein complex assembly (GO:0006461)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	interleukin-1 receptor activity (GO:0004908)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20	all_cancers(143;3.61e-10)|Ovarian(172;0.0733)|Breast(254;0.21)		Lung(62;1.95e-06)|LUSC - Lung squamous cell carcinoma(58;2.05e-06)	GBM - Glioblastoma multiforme(93;0.00851)		TATGGCCTCTCGGGGCAACAT	0.512																																						dbGAP											0													91.0	93.0	92.0					3																	190366258		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006537	CCDS3298.1, CCDS46982.1, CCDS54696.1	3q28	2013-01-11			ENSG00000196083	ENSG00000196083		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5995	protein-coding gene	gene with protein product		602626				9479509, 9065432	Standard	NM_002182		Approved	IL-1RAcP, IL1R3, C3orf13	uc003fsq.3	Q9NPH3	OTTHUMG00000156211	ENST00000412504.2:c.1477C>T	3.37:g.190366258C>T	ENSP00000412053:p.Arg493Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1NLD0|D3DNW0|O14915|Q86WJ7	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_IL1_rcpt_I/II	p.R493W	ENST00000412504.2	37	c.1477	CCDS3298.1	3	.	.	.	.	.	.	.	.	.	.	C	14.90	2.673663	0.47781	.	.	ENSG00000196083	ENST00000072516;ENST00000412504;ENST00000439062;ENST00000447382	T;T;T;T	0.08458	3.09;3.09;3.09;3.09	5.64	4.69	0.59074	Toll/interleukin-1 receptor homology (TIR) domain (4);	1.590950	0.03399	N	0.203003	T	0.10035	0.0246	N	0.24115	0.695	0.23876	N	0.996598	B	0.17038	0.02	B	0.20184	0.028	T	0.19063	-1.0317	10	0.62326	D	0.03	.	13.0632	0.59018	0.2201:0.7799:0.0:0.0	.	493	Q9NPH3	IL1AP_HUMAN	W	493	ENSP00000072516:R493W;ENSP00000412053:R493W;ENSP00000401132:R493W;ENSP00000390541:R493W	ENSP00000072516:R493W	R	+	1	2	IL1RAP	191848952	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.937000	0.40193	2.676000	0.91093	0.557000	0.71058	CGG	IL1RAP	-	pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,pfscan_TIR_dom,prints_IL1_rcpt_1	ENSG00000196083		0.512	IL1RAP-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	IL1RAP	HGNC	protein_coding	OTTHUMT00000343497.1	54	0.00	0	C			190366258	190366258	+1	no_errors	ENST00000072516	ensembl	human	known	69_37n	missense	44	25.42	15	SNP	1.000	T
ITFG3	83986	genome.wustl.edu	37	16	309544	309544	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:309544C>G	ENST00000399932.3	+	4	782	c.331C>G	c.(331-333)Ctt>Gtt	p.L111V	ITFG3_ENST00000301679.2_Missense_Mutation_p.L111V|ITFG3_ENST00000600536.1_Missense_Mutation_p.L111V|ITFG3_ENST00000442458.2_Missense_Mutation_p.L111V|ITFG3_ENST00000301678.3_Missense_Mutation_p.L111V|ITFG3_ENST00000450082.2_Missense_Mutation_p.L111V	NM_001284497.1	NP_001271426.1	Q9H0X4	ITFG3_HUMAN	integrin alpha FG-GAP repeat containing 3	111						cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(3)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16		all_cancers(16;0.000129)|all_epithelial(16;0.000206)|Hepatocellular(16;0.00264)|Lung NSC(18;0.0626)|all_lung(18;0.13)				TGTTCTTTTTCTTTATAAAAA	0.418																																						dbGAP											0													149.0	152.0	151.0					16																	309544		1847	4098	5945	-	-	-	SO:0001583	missense	0			AL136542	CCDS10402.1	16p13.3	2006-03-31	2006-03-31	2006-03-31	ENSG00000167930	ENSG00000167930			14163	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 9"""	C16orf9			Standard	XM_005255622		Approved	DKFZP761D0211, FLJ32603	uc002cgf.3	Q9H0X4	OTTHUMG00000060728	ENST00000399932.3:c.331C>G	16.37:g.309544C>G	ENSP00000382814:p.Leu111Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU45|Q7L416|Q96FR1|Q96MC7|Q96S30	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like	p.L111V	ENST00000399932.3	37	c.331	CCDS10402.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.444|6.444	0.450136|0.450136	0.12223|0.12223	.|.	.|.	ENSG00000167930|ENSG00000167930	ENST00000421000|ENST00000399932;ENST00000301679;ENST00000438220;ENST00000453430;ENST00000442458;ENST00000449945;ENST00000420046;ENST00000301678;ENST00000450082	.|T;T;T;T;T;T;T;T	.|0.58652	.|0.32;0.32;0.32;0.32;0.32;0.32;0.32;0.32	5.35|5.35	5.35|5.35	0.76521|0.76521	.|Quinonprotein alcohol dehydrogenase-like (1);	.|0.242186	.|0.35013	.|N	.|0.003505	T|T	0.53546|0.53546	0.1803|0.1803	L|L	0.59436|0.59436	1.845|1.845	0.34464|0.34464	D|D	0.702127|0.702127	.|P;P	.|0.40970	.|0.734;0.734	.|B;B	.|0.39531	.|0.302;0.203	T|T	0.63937|0.63937	-0.6524|-0.6524	6|10	0.36615|0.23302	T|T	0.2|0.38	-9.4384|-9.4384	14.198|14.198	0.65684|0.65684	0.0:0.8494:0.1506:0.0|0.0:0.8494:0.1506:0.0	.|.	.|111;111	.|Q9H0X4-2;Q9H0X4	.|.;ITFG3_HUMAN	L|V	39|111	.|ENSP00000382814:L111V;ENSP00000301679:L111V;ENSP00000399150:L111V;ENSP00000397477:L111V;ENSP00000407669:L111V;ENSP00000398433:L111V;ENSP00000301678:L111V;ENSP00000411394:L111V	ENSP00000412581:F39L|ENSP00000301678:L111V	F|L	+|+	3|1	2|0	ITFG3|ITFG3	249545|249545	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.631000|0.631000	0.37964|0.37964	2.645000|2.645000	0.46621|0.46621	2.523000|2.523000	0.85059|0.85059	0.655000|0.655000	0.94253|0.94253	TTC|CTT	ITFG3	-	superfamily_Quinonprotein_ADH-like	ENSG00000167930		0.418	ITFG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITFG3	HGNC	protein_coding	OTTHUMT00000134227.2	124	0.00	0	C	NM_032039		309544	309544	+1	no_errors	ENST00000301678	ensembl	human	known	69_37n	missense	125	20.38	32	SNP	1.000	G
KAZN	23254	genome.wustl.edu	37	1	15439019	15439019	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:15439019C>T	ENST00000376030.2	+	14	2439	c.2145C>T	c.(2143-2145)ctC>ctT	p.L715L		NM_201628.2	NP_963922.2	Q674X7	KAZRN_HUMAN	kazrin, periplakin interacting protein	715					keratinization (GO:0031424)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|desmosome (GO:0030057)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(1)|prostate(2)	25						GCAGCGGTCTCAAGTACAAGG	0.602																																						dbGAP											0													36.0	35.0	35.0					1																	15439019		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AY505119	CCDS30604.1, CCDS41267.1, CCDS152.2, CCDS41268.1	1p36.21	2014-02-12	2011-01-31		ENSG00000189337	ENSG00000189337		"""Sterile alpha motif (SAM) domain containing"""	29173	protein-coding gene	gene with protein product						15337775, 18840647	Standard	NM_015209		Approved	KIAA1026, KAZRIN, FLJ43806	uc001avm.4	Q674X7	OTTHUMG00000002042	ENST00000376030.2:c.2145C>T	1.37:g.15439019C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYQ0|B1AK78|Q5TGF1|Q674X4|Q674X6|Q6ZUD1|Q8IYN7|Q8N409|Q9UIL2|Q9UPX4	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.L715	ENST00000376030.2	37	c.2145	CCDS152.2	1																																																																																			KAZN	-	NULL	ENSG00000189337		0.602	KAZN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAZN	HGNC	protein_coding	OTTHUMT00000005690.2	42	0.00	0	C	NM_001017999		15439019	15439019	+1	no_errors	ENST00000376030	ensembl	human	known	69_37n	silent	18	62.50	30	SNP	0.479	T
IVNS1ABP	10625	genome.wustl.edu	37	1	185276197	185276197	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:185276197C>T	ENST00000367498.3	-	7	1228	c.606G>A	c.(604-606)gtG>gtA	p.V202V	IVNS1ABP_ENST00000392007.3_5'UTR|IVNS1ABP_ENST00000459929.1_5'UTR	NM_006469.4	NP_006460.2	Q9Y6Y0	NS1BP_HUMAN	influenza virus NS1A binding protein	202	BACK.|Sufficient for AHR interaction and signaling.				negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|response to virus (GO:0009615)|RNA splicing (GO:0008380)|transcription from RNA polymerase III promoter (GO:0006383)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|spliceosomal complex (GO:0005681)|transcription factor complex (GO:0005667)				breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(11)|ovary(4)|prostate(2)	29						TGCTACGCTGCACCCAGTTGA	0.378																																						dbGAP											0													97.0	93.0	94.0					1																	185276197		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020657	CCDS1368.1	1q25.1-q31.1	2013-01-30			ENSG00000116679	ENSG00000116679		"""Kelch-like"", ""BTB/POZ domain containing"""	16951	protein-coding gene	gene with protein product	"""kelch-like family member 39"""	609209				9696811, 10048485	Standard	NM_006469		Approved	NS1-BP, HSPC068, NS-1, KIAA0850, ND1, KLHL39	uc001grl.3	Q9Y6Y0	OTTHUMG00000035384	ENST00000367498.3:c.606G>A	1.37:g.185276197C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8R6|Q1G4T6|Q1G4T7|Q5TF75|Q6NW38|Q7LCG2|Q9NZX0|Q9Y480	Silent	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V202	ENST00000367498.3	37	c.606	CCDS1368.1	1																																																																																			IVNS1ABP	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000116679		0.378	IVNS1ABP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVNS1ABP	HGNC	protein_coding	OTTHUMT00000085774.1	104	0.00	0	C	NM_006469		185276197	185276197	-1	no_errors	ENST00000367498	ensembl	human	known	69_37n	silent	147	17.42	31	SNP	0.998	T
KEAP1	9817	genome.wustl.edu	37	19	10600510	10600510	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:10600510C>A	ENST00000171111.5	-	4	1892	c.1345G>T	c.(1345-1347)Gag>Tag	p.E449*	CTC-429L19.3_ENST00000592671.1_RNA|KEAP1_ENST00000588024.1_5'Flank|KEAP1_ENST00000393623.2_Nonsense_Mutation_p.E449*	NM_203500.1	NP_987096.1	Q14145	KEAP1_HUMAN	kelch-like ECH-associated protein 1	449					cellular response to interleukin-4 (GO:0071353)|in utero embryonic development (GO:0001701)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein ubiquitination (GO:0016567)|regulation of epidermal cell differentiation (GO:0045604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|nucleus (GO:0005634)		p.E449*(2)		breast(3)|endometrium(2)|kidney(4)|large_intestine(4)|liver(2)|lung(69)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	92			OV - Ovarian serous cystadenocarcinoma(20;2.71e-09)|Epithelial(33;2.32e-06)|all cancers(31;1.42e-05)		Dimethyl fumarate(DB08908)	AAGTGCCACTCATCCCGCTCT	0.537																																						dbGAP											2	Substitution - Nonsense(2)	lung(2)											46.0	40.0	42.0					19																	10600510		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF361886	CCDS12239.1	19p13.2	2013-01-30				ENSG00000079999		"""Kelch-like"", ""BTB/POZ domain containing"""	23177	protein-coding gene	gene with protein product	"""kelch-like family member 19"""	606016					Standard	NM_012289		Approved	KIAA0132, MGC10630, MGC1114, MGC20887, MGC4407, MGC9454, INrf2, KLHL19	uc002mor.1	Q14145		ENST00000171111.5:c.1345G>T	19.37:g.10600510C>A	ENSP00000171111:p.Glu449*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPD5|Q6LEP0|Q8WTX1|Q9BPY9	Nonsense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.E449*	ENST00000171111.5	37	c.1345	CCDS12239.1	19	.	.	.	.	.	.	.	.	.	.	C	38	7.180174	0.98118	.	.	ENSG00000079999	ENST00000171111;ENST00000393623	.	.	.	5.79	4.76	0.60689	.	0.123768	0.56097	D	0.000033	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6728	0.56876	0.0:0.9204:0.0:0.0796	.	.	.	.	X	449	.	ENSP00000171111:E449X	E	-	1	0	KEAP1	10461510	0.793000	0.28825	0.974000	0.42286	0.839000	0.47603	1.303000	0.33470	1.469000	0.48083	0.558000	0.71614	GAG	KEAP1	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000079999		0.537	KEAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEAP1	HGNC	protein_coding	OTTHUMT00000452000.1	34	0.00	0	C	NM_012289		10600510	10600510	-1	no_errors	ENST00000171111	ensembl	human	known	69_37n	nonsense	29	14.71	5	SNP	0.990	A
KIAA0586	9786	genome.wustl.edu	37	14	58895061	58895061	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:58895061C>G	ENST00000556134.1	+	2	308	c.34C>G	c.(34-36)Caa>Gaa	p.Q12E	TIMM9_ENST00000555593.1_5'Flank|RP11-517O13.1_ENST00000556734.1_RNA|TIMM9_ENST00000556007.2_5'Flank|TIMM9_ENST00000395159.2_5'Flank|KIAA0586_ENST00000423743.3_Intron|TIMM9_ENST00000216463.4_5'Flank|KIAA0586_ENST00000261244.5_Missense_Mutation_p.Q27E|KIAA0586_ENST00000354386.6_Missense_Mutation_p.Q39E|TIMM9_ENST00000555404.1_5'Flank	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	12					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGTAGTTTCTCAAAATCATGG	0.428																																						dbGAP											0													148.0	137.0	140.0					14																	58895061		1973	4161	6134	-	-	-	SO:0001583	missense	0			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.34C>G	14.37:g.58895061C>G	ENSP00000452351:p.Gln12Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	NULL	p.Q12E	ENST00000556134.1	37	c.34	CCDS58321.1	14	.	.	.	.	.	.	.	.	.	.	C	8.225	0.803428	0.16397	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000261244	T;T;T	0.41758	0.99;1.01;1.01	5.08	4.19	0.49359	.	0.464162	0.20197	N	0.097180	T	0.31979	0.0814	.	.	.	0.22500	N	0.999043	B;B;B	0.25667	0.131;0.031;0.031	B;B;B	0.23018	0.043;0.02;0.02	T	0.27157	-1.0082	9	0.62326	D	0.03	.	9.1135	0.36744	0.0:0.9023:0.0:0.0977	.	39;27;12	E7EWM8;E9PGW8;Q9BVV6	.;.;K0586_HUMAN	E	39;12;27	ENSP00000346359:Q39E;ENSP00000452351:Q12E;ENSP00000261244:Q27E	ENSP00000261244:Q27E	Q	+	1	0	KIAA0586	57964814	1.000000	0.71417	0.969000	0.41365	0.555000	0.35460	0.702000	0.25631	1.379000	0.46325	0.655000	0.94253	CAA	KIAA0586	-	NULL	ENSG00000100578		0.428	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0586	HGNC	protein_coding	OTTHUMT00000411887.1	122	0.00	0	C	NM_014749		58895061	58895061	+1	no_errors	ENST00000556134	ensembl	human	known	69_37n	missense	98	30.99	44	SNP	0.985	G
ZSWIM8	23053	genome.wustl.edu	37	10	75559813	75559813	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:75559813G>A	ENST00000605216.1	+	22	4912	c.4695G>A	c.(4693-4695)gtG>gtA	p.V1565V	ZSWIM8_ENST00000398706.2_Silent_p.V1570V|ZSWIM8_ENST00000603114.1_Silent_p.V1532V|ZSWIM8_ENST00000604729.1_Silent_p.V1570V|ZSWIM8_ENST00000604524.1_Intron|ZSWIM8-AS1_ENST00000456638.2_RNA|RP11-574K11.31_ENST00000603027.1_Intron	NM_001242487.1	NP_001229416.1	A7E2V4	ZSWM8_HUMAN	zinc finger, SWIM-type containing 8	1565	Pro-rich.						zinc ion binding (GO:0008270)										CTTATTCAGTGACTCCTCCCT	0.547																																						dbGAP											0													121.0	121.0	121.0					10																	75559813		2106	4220	6326	-	-	-	SO:0001819	synonymous_variant	0			BC151206, BC040726	CCDS44440.1, CCDS60560.1	10q22.3	2012-11-02	2012-11-02	2012-11-02	ENSG00000214655	ENSG00000214655		"""Zinc fingers, SWIM-type"""	23528	protein-coding gene	gene with protein product			"""KIAA0913"""	KIAA0913			Standard	NM_015037		Approved	4832404P21Rik	uc001jvj.3	A7E2V4	OTTHUMG00000018486	ENST00000605216.1:c.4695G>A	10.37:g.75559813G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP37|O94987|Q17RS8|Q2TAB8|Q6P439|Q8IW81|Q8NB34|Q9H8F3	Silent	SNP	pfscan_Znf_SWIM	p.V1570	ENST00000605216.1	37	c.4710		10																																																																																			KIAA0913	-	NULL	ENSG00000214655		0.547	ZSWIM8-012	NOVEL	basic|appris_principal	protein_coding	KIAA0913	HGNC	protein_coding	OTTHUMT00000468545.1	90	0.00	0	G	NM_001242487		75559813	75559813	+1	no_errors	ENST00000398706	ensembl	human	known	69_37n	silent	67	33.00	33	SNP	1.000	A
KIAA1468	57614	genome.wustl.edu	37	18	59895760	59895760	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:59895760G>A	ENST00000398130.2	+	8	1609	c.1377G>A	c.(1375-1377)agG>agA	p.R459R	KIAA1468_ENST00000592479.1_3'UTR|KIAA1468_ENST00000256858.6_Silent_p.R459R	NM_020854.3	NP_065905.2	Q9P260	K1468_HUMAN	KIAA1468	459										autonomic_ganglia(1)|breast(4)|endometrium(4)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47		Colorectal(73;0.186)				CATTCCCCAGGAGAGAAAGAG	0.358																																						dbGAP											0													66.0	63.0	64.0					18																	59895760		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011992	CCDS11979.2	18q21.33	2005-11-03			ENSG00000134444	ENSG00000134444			29289	protein-coding gene	gene with protein product						11973628	Standard	NM_020854		Approved	HsT885, HsT3308, FLJ33841	uc002lil.3	Q9P260	OTTHUMG00000132780	ENST00000398130.2:c.1377G>A	18.37:g.59895760G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_HEAT,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_HEAT_type_2,pfscan_LisH_dimerisation	p.R459	ENST00000398130.2	37	c.1377	CCDS11979.2	18																																																																																			KIAA1468	-	NULL	ENSG00000134444		0.358	KIAA1468-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1468	HGNC	protein_coding	OTTHUMT00000256187.1	95	0.00	0	G	NM_020854		59895760	59895760	+1	no_errors	ENST00000256858	ensembl	human	known	69_37n	silent	37	30.19	16	SNP	0.339	A
KLHL7	55975	genome.wustl.edu	37	7	23180527	23180527	+	Silent	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:23180527C>A	ENST00000339077.5	+	5	825	c.582C>A	c.(580-582)ctC>ctA	p.L194L	KLHL7_ENST00000479288.1_3'UTR|KLHL7_ENST00000322231.7_Silent_p.L172L|KLHL7_ENST00000542558.1_5'UTR|KLHL7_ENST00000409689.1_Silent_p.L146L|KLHL7_ENST00000545443.1_Silent_p.L172L|KLHL7_ENST00000539124.1_Silent_p.L118L	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	194	BACK.				protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CACATCTTCTCAACCAGGACA	0.358																																						dbGAP											0													116.0	110.0	112.0					7																	23180527		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.582C>A	7.37:g.23180527C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L194	ENST00000339077.5	37	c.582	CCDS34609.1	7																																																																																			KLHL7	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000122550		0.358	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL7	HGNC	protein_coding	OTTHUMT00000326860.3	81	0.00	0	C	NM_018846		23180527	23180527	+1	no_errors	ENST00000339077	ensembl	human	known	69_37n	silent	38	30.91	17	SNP	1.000	A
KLK14	43847	genome.wustl.edu	37	19	51581409	51581409	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:51581409G>C	ENST00000156499.2	-	7	877	c.659C>G	c.(658-660)tCt>tGt	p.S220C	KLK14_ENST00000391802.1_Missense_Mutation_p.S220C			Q9P0G3	KLK14_HUMAN	kallikrein-related peptidase 14	220	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				epidermis morphogenesis (GO:0048730)|fertilization (GO:0009566)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|positive regulation of G-protein coupled receptor protein signaling pathway (GO:0045745)|proteolysis (GO:0006508)|seminal clot liquefaction (GO:0070684)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)			kidney(4)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(1)	11		all_neural(266;0.0199)		OV - Ovarian serous cystadenocarcinoma(262;0.00328)|GBM - Glioblastoma multiforme(134;0.00422)		GGGTCCCCCAGAGTCACCCTG	0.622																																					GBM(117;2161 2172 2448 22911)	dbGAP											0													30.0	33.0	32.0					19																	51581409		2039	4194	6233	-	-	-	SO:0001583	missense	0			AF283670	CCDS12823.2	19q13.3-q13.4	2008-02-05	2006-10-27		ENSG00000129437	ENSG00000129437		"""Kallikreins"""	6362	protein-coding gene	gene with protein product		606135	"""kallikrein 14"""			16800724, 16800723	Standard	XM_006723224		Approved	KLK-L6	uc002pvs.1	Q9P0G3	OTTHUMG00000143721	ENST00000156499.2:c.659C>G	19.37:g.51581409G>C	ENSP00000156499:p.Ser220Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7UNK5|Q1RMZ2|Q6B089	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S220C	ENST00000156499.2	37	c.659	CCDS12823.2	19	.	.	.	.	.	.	.	.	.	.	g	22.5	4.296245	0.81025	.	.	ENSG00000129437	ENST00000156499;ENST00000391802	D;D	0.96802	-4.13;-4.13	4.64	4.64	0.57946	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	.	.	.	.	D	0.98798	0.9595	H	0.97440	4.005	0.58432	D	0.999997	D	0.89917	1.0	D	0.97110	1.0	D	0.99548	1.0965	9	0.87932	D	0	.	15.0173	0.71597	0.0:0.0:1.0:0.0	.	220	Q9P0G3	KLK14_HUMAN	C	220	ENSP00000156499:S220C;ENSP00000375678:S220C	ENSP00000156499:S220C	S	-	2	0	KLK14	56273221	1.000000	0.71417	0.983000	0.44433	0.998000	0.95712	9.019000	0.93662	2.134000	0.65973	0.651000	0.88453	TCT	KLK14	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000129437		0.622	KLK14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK14	HGNC	protein_coding	OTTHUMT00000289774.2	30	0.00	0	G	NM_022046		51581409	51581409	-1	no_errors	ENST00000156499	ensembl	human	known	69_37n	missense	9	47.06	8	SNP	1.000	C
KRT19	3880	genome.wustl.edu	37	17	39684181	39684181	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:39684181C>A	ENST00000361566.3	-	1	379	c.319G>T	c.(319-321)Gag>Tag	p.E107*		NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	107	Coil 1A.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				ACCTCTAGCTCGCCGTTGGCC	0.652																																						dbGAP											0													47.0	54.0	52.0					17																	39684181		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0				CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.319G>T	17.37:g.39684181C>A	ENSP00000355124:p.Glu107*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Nonsense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.E107*	ENST00000361566.3	37	c.319	CCDS11399.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.273579	0.97431	.	.	ENSG00000171345	ENST00000361566;ENST00000455635	.	.	.	4.83	3.84	0.44239	.	0.274046	0.25759	N	0.028491	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	15.6832	0.77388	0.0:0.6505:0.3495:0.0	.	.	.	.	X	107	.	ENSP00000355124:E107X	E	-	1	0	KRT19	36937707	0.439000	0.25610	1.000000	0.80357	0.992000	0.81027	1.591000	0.36665	1.135000	0.42183	0.462000	0.41574	GAG	KRT19	-	pfam_F	ENSG00000171345		0.652	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT19	HGNC	protein_coding	OTTHUMT00000257285.1	37	0.00	0	C	NM_002276		39684181	39684181	-1	no_errors	ENST00000361566	ensembl	human	known	69_37n	nonsense	53	25.35	18	SNP	0.958	A
KRTAP10-9	386676	genome.wustl.edu	37	21	46047160	46047160	+	Missense_Mutation	SNP	G	G	C	rs201201187		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr21:46047160G>C	ENST00000397911.3	+	1	121	c.72G>C	c.(70-72)gaG>gaC	p.E24D	TSPEAR_ENST00000323084.4_Intron|KRTAP10-9_ENST00000484861.1_3'UTR	NM_198690.2	NP_941963.2	P60411	KR109_HUMAN	keratin associated protein 10-9	24						keratin filament (GO:0045095)				endometrium(1)|kidney(1)|large_intestine(1)|lung(6)	9						ACTGCCCAGAGAGCTGCTGTG	0.701																																						dbGAP											0													44.0	53.0	50.0					21																	46047160		2196	4290	6486	-	-	-	SO:0001583	missense	0			AJ566386	CCDS42961.1	21q22.3	2007-10-05			ENSG00000221837	ENSG00000221837		"""Keratin associated proteins"""	22971	protein-coding gene	gene with protein product				KRTAP18-9			Standard	NM_198690		Approved	KAP10.9, KAP18.9	uc002zfp.4	P60411	OTTHUMG00000057637	ENST00000397911.3:c.72G>C	21.37:g.46047160G>C	ENSP00000381009:p.Glu24Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRG1|A6NIR9|Q70LJ1	Missense_Mutation	SNP	NULL	p.E24D	ENST00000397911.3	37	c.72	CCDS42961.1	21	.	.	.	.	.	.	.	.	.	.	g	13.62	2.290192	0.40494	.	.	ENSG00000221837	ENST00000397911	T	0.13538	2.58	3.53	3.53	0.40419	.	.	.	.	.	T	0.33556	0.0867	M	0.83852	2.665	0.25083	N	0.990919	D	0.63046	0.992	P	0.61658	0.892	T	0.07385	-1.0775	9	0.39692	T	0.17	.	9.255	0.37577	0.0:0.2227:0.7773:0.0	.	24	P60411	KR109_HUMAN	D	24	ENSP00000381009:E24D	ENSP00000381009:E24D	E	+	3	2	KRTAP10-9	44871588	1.000000	0.71417	1.000000	0.80357	0.726000	0.41606	0.798000	0.27014	1.662000	0.50781	0.655000	0.94253	GAG	KRTAP10-9	-	NULL	ENSG00000221837		0.701	KRTAP10-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-9	HGNC	protein_coding	OTTHUMT00000128040.1	74	0.00	0	G			46047160	46047160	+1	no_errors	ENST00000397911	ensembl	human	known	69_37n	missense	26	29.73	11	SNP	1.000	C
KRTAP9-2	83899	genome.wustl.edu	37	17	39383235	39383235	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:39383235C>G	ENST00000377721.3	+	1	336	c.329C>G	c.(328-330)tCc>tGc	p.S110C	KRTAP9-2_ENST00000455970.2_Missense_Mutation_p.S94C	NM_031961.2	NP_114167.2	Q9BYQ4	KRA92_HUMAN	keratin associated protein 9-2	110	17 X 5 AA repeats of C-C-[RQVSGE]-[SPTQ]- [TASP].					keratin filament (GO:0045095)				large_intestine(1)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000397)			CAGAGCAGCTCCTGTGCACCT	0.627																																						dbGAP											0													74.0	76.0	75.0					17																	39383235		2203	4296	6499	-	-	-	SO:0001583	missense	0			AJ406946	CCDS32651.1	17q21.2	2013-06-25			ENSG00000239886	ENSG00000239886		"""Keratin associated proteins"""	16926	protein-coding gene	gene with protein product						11279113	Standard	NM_031961		Approved	KAP9.2	uc002hwf.3	Q9BYQ4	OTTHUMG00000133609	ENST00000377721.3:c.329C>G	17.37:g.39383235C>G	ENSP00000366950:p.Ser110Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RK8|Q2TB15|Q6ISF6	Missense_Mutation	SNP	NULL	p.S110C	ENST00000377721.3	37	c.329	CCDS32651.1	17	.	.	.	.	.	.	.	.	.	.	.	0.010	-1.779247	0.00634	.	.	ENSG00000239886	ENST00000377721;ENST00000455970	T;T	0.00848	5.62;5.62	2.55	1.56	0.23342	.	.	.	.	.	T	0.00384	0.0012	N	0.00652	-1.29	0.18873	N	0.999989	B	0.02656	0.0	B	0.04013	0.001	T	0.41070	-0.9529	9	0.02654	T	1	.	9.0482	0.36360	0.0:0.2728:0.7272:0.0	.	110	Q9BYQ4	KRA92_HUMAN	C	110;94	ENSP00000366950:S110C;ENSP00000398325:S94C	ENSP00000366950:S110C	S	+	2	0	KRTAP9-2	36636761	0.011000	0.17503	0.029000	0.17559	0.048000	0.14542	0.877000	0.28106	0.632000	0.30432	0.537000	0.68136	TCC	KRTAP9-2	-	NULL	ENSG00000239886		0.627	KRTAP9-2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KRTAP9-2	HGNC	protein_coding	OTTHUMT00000257717.1	108	0.00	0	C			39383235	39383235	+1	no_errors	ENST00000377721	ensembl	human	known	69_37n	missense	132	45.93	113	SNP	0.403	G
L3MBTL4	91133	genome.wustl.edu	37	18	5969468	5969468	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:5969468C>T	ENST00000284898.6	-	18	1765	c.1565G>A	c.(1564-1566)aGg>aAg	p.R522K	L3MBTL4_ENST00000400105.2_Missense_Mutation_p.R522K|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.R513K|L3MBTL4_ENST00000535782.1_Missense_Mutation_p.R326K	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	522					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				GTGTTGCTCCCTGCCGAGGGG	0.617																																					Esophageal Squamous(41;748 902 17366 28959 43175)	dbGAP											0													67.0	74.0	72.0					18																	5969468		2121	4233	6354	-	-	-	SO:0001583	missense	0			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.1565G>A	18.37:g.5969468C>T	ENSP00000284898:p.Arg522Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTL8|Q8IXS3	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_Znf_C2HC,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.R522K	ENST00000284898.6	37	c.1565	CCDS11839.2	18	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394025	0.83011	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000535782	T;T;T;T	0.14022	2.54;2.57;2.54;2.58	5.45	3.63	0.41609	.	0.073101	0.56097	D	0.000027	T	0.15739	0.0379	L	0.44542	1.39	0.33632	D	0.606203	P;D	0.55385	0.951;0.971	P;P	0.55161	0.593;0.77	T	0.11591	-1.0581	10	0.05959	T	0.93	.	7.4835	0.27419	0.0:0.7432:0.1673:0.0895	.	522;513	Q8NA19;F8W9S8	LMBL4_HUMAN;.	K	522;513;522;326	ENSP00000382976:R522K;ENSP00000318543:R513K;ENSP00000284898:R522K;ENSP00000444774:R326K	ENSP00000284898:R522K	R	-	2	0	L3MBTL4	5959468	0.998000	0.40836	0.699000	0.30290	0.879000	0.50718	1.419000	0.34793	0.633000	0.30452	0.655000	0.94253	AGG	L3MBTL4	-	NULL	ENSG00000154655		0.617	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL4	HGNC	protein_coding	OTTHUMT00000254448.2	17	0.00	0	C	NM_173464		5969468	5969468	-1	no_errors	ENST00000284898	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.992	T
LAMP2	3920	genome.wustl.edu	37	X	119589289	119589289	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:119589289G>A	ENST00000200639.4	-	3	456	c.320C>T	c.(319-321)tCt>tTt	p.S107F	LAMP2_ENST00000538785.1_Intron|LAMP2_ENST00000434600.2_Missense_Mutation_p.S107F|LAMP2_ENST00000540603.1_Missense_Mutation_p.S60F|LAMP2_ENST00000371335.4_Missense_Mutation_p.S107F			P13473	LAMP2_HUMAN	lysosomal-associated membrane protein 2	107	First lumenal domain.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|platelet dense granule membrane (GO:0031088)	enzyme binding (GO:0019899)			endometrium(4)|large_intestine(2)|lung(5)|ovary(2)|urinary_tract(2)	15						TGAATAAGTAGATGCTGCCTT	0.408																																						dbGAP											0													165.0	142.0	150.0					X																	119589289		2203	4300	6503	-	-	-	SO:0001583	missense	0			X77196	CCDS14599.1, CCDS14600.1, CCDS48159.1	Xq24-q25	2014-09-17			ENSG00000005893	ENSG00000005893		"""CD molecules"""	6501	protein-coding gene	gene with protein product		309060					Standard	NM_002294		Approved	CD107b	uc004ess.4	P13473	OTTHUMG00000022301	ENST00000200639.4:c.320C>T	X.37:g.119589289G>A	ENSP00000200639:p.Ser107Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X5|D3DTF0|Q16641|Q6Q3G8|Q96J30|Q99534|Q9UD93	Missense_Mutation	SNP	pfam_Lysosome-assoc_membr_glycop,prints_Lysosome-assoc_membr_glycop	p.S107F	ENST00000200639.4	37	c.320	CCDS14599.1	X	.	.	.	.	.	.	.	.	.	.	G	12.47	1.947800	0.34377	.	.	ENSG00000005893	ENST00000434600;ENST00000200639;ENST00000371335;ENST00000540603	T;T;T;T	0.36699	1.24;1.26;1.26;1.26	5.45	4.53	0.55603	.	1.070490	0.07097	N	0.839740	T	0.56963	0.2021	M	0.77103	2.36	0.09310	N	0.999997	P;D;P;P	0.55800	0.918;0.973;0.918;0.954	P;P;P;P	0.59825	0.717;0.864;0.717;0.789	T	0.44236	-0.9341	10	0.87932	D	0	-11.1311	7.4895	0.27454	0.0:0.1768:0.637:0.1862	.	60;107;107;107	B4E2S7;P13473-2;P13473;Q6Q3G8	.;.;LAMP2_HUMAN;.	F	107;107;107;60	ENSP00000408411:S107F;ENSP00000200639:S107F;ENSP00000360386:S107F;ENSP00000440479:S60F	ENSP00000200639:S107F	S	-	2	0	LAMP2	119473317	0.012000	0.17670	0.084000	0.20598	0.122000	0.20287	0.803000	0.27083	2.278000	0.76064	0.600000	0.82982	TCT	LAMP2	-	NULL	ENSG00000005893		0.408	LAMP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LAMP2	HGNC	protein_coding	OTTHUMT00000058099.1	148	0.00	0	G			119589289	119589289	-1	no_errors	ENST00000434600	ensembl	human	known	69_37n	missense	88	34.56	47	SNP	0.036	A
LDOC1L	84247	genome.wustl.edu	37	22	44892894	44892894	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:44892894G>A	ENST00000341255.3	-	2	1052	c.543C>T	c.(541-543)ctC>ctT	p.L181L		NM_032287.2	NP_115663.2	Q6ICC9	LDOCL_HUMAN	leucine zipper, down-regulated in cancer 1-like	181										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(3)|prostate(2)	11		Ovarian(80;0.024)|all_neural(38;0.0416)		LUAD - Lung adenocarcinoma(64;0.0161)		GCGCATGCCGGAGCGGAGACT	0.622																																						dbGAP											0													36.0	38.0	37.0					22																	44892894		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			CR456439	CCDS33662.1	22q13.3	2006-09-06			ENSG00000188636	ENSG00000188636			13343	protein-coding gene	gene with protein product						15716091, 16093683	Standard	NM_032287		Approved	dJ1033E15.2, DKFZp761O17121, Mart6, Mar6	uc003beu.1	Q6ICC9	OTTHUMG00000150465	ENST00000341255.3:c.543C>T	22.37:g.44892894G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZTR1	Silent	SNP	NULL	p.L181	ENST00000341255.3	37	c.543	CCDS33662.1	22																																																																																			LDOC1L	-	NULL	ENSG00000188636		0.622	LDOC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDOC1L	HGNC	protein_coding	OTTHUMT00000318222.1	32	0.00	0	G	NM_032287		44892894	44892894	-1	no_errors	ENST00000341255	ensembl	human	known	69_37n	silent	15	34.78	8	SNP	0.000	A
LIN54	132660	genome.wustl.edu	37	4	83905683	83905683	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:83905683C>G	ENST00000340417.3	-	2	692	c.315G>C	c.(313-315)caG>caC	p.Q105H	LIN54_ENST00000510557.1_Intron|LIN54_ENST00000505397.1_Missense_Mutation_p.Q105H|LIN54_ENST00000395282.2_Missense_Mutation_p.Q105H|LIN54_ENST00000446851.2_Intron|LIN54_ENST00000506560.1_Missense_Mutation_p.Q105H|LIN54_ENST00000395283.2_Missense_Mutation_p.Q105H|LIN54_ENST00000442461.2_Intron	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	105					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				TCACAGGAGTCTGAGCACCAA	0.388																																						dbGAP											0													222.0	222.0	222.0					4																	83905683		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.315G>C	4.37:g.83905683C>G	ENSP00000341947:p.Gln105His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32M68|Q32M69|Q6N071|Q76B60	Missense_Mutation	SNP	pfam_TCR	p.Q105H	ENST00000340417.3	37	c.315	CCDS3599.1	4	.	.	.	.	.	.	.	.	.	.	C	13.81	2.347308	0.41599	.	.	ENSG00000189308	ENST00000340417;ENST00000395283;ENST00000395282;ENST00000506560;ENST00000505397	.	.	.	5.36	5.36	0.76844	.	0.138062	0.51477	D	0.000088	T	0.50905	0.1643	N	0.19112	0.55	0.41867	D	0.990259	D;P	0.55605	0.972;0.952	P;P	0.52217	0.693;0.496	T	0.54886	-0.8226	9	0.51188	T	0.08	-7.138	17.2517	0.87044	0.0:1.0:0.0:0.0	.	105;105	Q6MZP7-2;Q6MZP7	.;LIN54_HUMAN	H	105	.	ENSP00000341947:Q105H	Q	-	3	2	LIN54	84124707	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.900000	0.39828	2.505000	0.84491	0.655000	0.94253	CAG	LIN54	-	NULL	ENSG00000189308		0.388	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN54	HGNC	protein_coding	OTTHUMT00000252626.2	199	0.00	0	C	NM_194282		83905683	83905683	-1	no_errors	ENST00000340417	ensembl	human	known	69_37n	missense	173	32.30	83	SNP	1.000	G
LMBRD1	55788	genome.wustl.edu	37	6	70462186	70462186	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:70462186C>T	ENST00000370577.3	-	4	599	c.370G>A	c.(370-372)Gaa>Aaa	p.E124K	LMBRD1_ENST00000370570.1_Missense_Mutation_p.E51K	NM_018368.3	NP_060838.3	Q9NUN5	LMBD1_HUMAN	LMBR1 domain containing 1	124					cobalamin metabolic process (GO:0009235)|insulin receptor internalization (GO:0038016)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase B signaling (GO:0051898)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	clathrin-coated endocytic vesicle (GO:0045334)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cobalamin binding (GO:0031419)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)	31						TCCTTTTCTTCATAATAGAAG	0.294																																						dbGAP											0													55.0	58.0	57.0					6																	70462186		2197	4279	6476	-	-	-	SO:0001583	missense	0			AF113224	CCDS4969.1	6q13	2011-05-12	2005-07-25	2005-07-25	ENSG00000168216	ENSG00000168216			23038	protein-coding gene	gene with protein product		612625	"""chromosome 6 open reading frame 209"""	C6orf209		19136951	Standard	NM_018368		Approved	FLJ11240, bA810I22.1, cblF	uc003pfa.3	Q9NUN5	OTTHUMG00000014985	ENST00000370577.3:c.370G>A	6.37:g.70462186C>T	ENSP00000359609:p.Glu124Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K204|E1P531|Q5VUN6|Q86Y70|Q96FW4|Q9BY56|Q9NZD6	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot	p.E124K	ENST00000370577.3	37	c.370	CCDS4969.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.189900	0.94923	.	.	ENSG00000168216	ENST00000370577;ENST00000370570	T;T	0.39229	1.09;1.09	5.33	5.33	0.75918	LMBR1-like membrane protein (1);	0.000000	0.85682	D	0.000000	T	0.39655	0.1086	M	0.79123	2.44	0.80722	D	1	P	0.36086	0.536	B	0.38562	0.276	T	0.42666	-0.9438	10	0.46703	T	0.11	-12.6377	17.7923	0.88558	0.0:1.0:0.0:0.0	.	124	Q9NUN5	LMBD1_HUMAN	K	124;51	ENSP00000359609:E124K;ENSP00000359602:E51K	ENSP00000359602:E51K	E	-	1	0	LMBRD1	70518907	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.028000	0.76470	2.499000	0.84300	0.557000	0.71058	GAA	LMBRD1	-	pfam_LMBR1-like_membr_prot	ENSG00000168216		0.294	LMBRD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD1	HGNC	protein_coding	OTTHUMT00000041124.1	83	0.00	0	C	NM_018368		70462186	70462186	-1	no_errors	ENST00000370577	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	1.000	T
LPHN3	23284	genome.wustl.edu	37	4	62897274	62897274	+	Silent	SNP	C	C	T	rs531126871		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:62897274C>T	ENST00000514591.1	+	22	3662	c.3333C>T	c.(3331-3333)ttC>ttT	p.F1111F	LPHN3_ENST00000506746.1_Silent_p.F1170F|LPHN3_ENST00000545650.1_Silent_p.F1111F|LPHN3_ENST00000507164.1_Silent_p.F1170F|LPHN3_ENST00000511324.1_Silent_p.F1170F|LPHN3_ENST00000512091.2_Silent_p.F1111F|LPHN3_ENST00000507625.1_Silent_p.F1170F|LPHN3_ENST00000508693.1_Silent_p.F1179F|LPHN3_ENST00000506720.1_Silent_p.F1179F|LPHN3_ENST00000514996.1_Silent_p.F1102F|LPHN3_ENST00000508946.1_Silent_p.F1111F|LPHN3_ENST00000509896.1_Silent_p.F1179F|LPHN3_ENST00000506700.1_Silent_p.F1102F|LPHN3_ENST00000504896.1_Silent_p.F1111F|LPHN3_ENST00000514157.1_Silent_p.F1102F			Q9HAR2	LPHN3_HUMAN	latrophilin 3	1089					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						TCACCATTTTCAATTCTCTAC	0.348																																						dbGAP											0													106.0	101.0	103.0					4																	62897274		1836	4086	5922	-	-	-	SO:0001819	synonymous_variant	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.3333C>T	4.37:g.62897274C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE04|O94867|Q9NWK5	Nonsense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_secretin-like,prints_GPCR_2_latrophilin,pfscan_GPS_dom,pfscan_GPCR_2-like	p.Q560*	ENST00000514591.1	37	c.1678	CCDS54768.1	4	.	.	.	.	.	.	.	.	.	.	C	8.169	0.791251	0.16258	.	.	ENSG00000150471	ENST00000502815	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.6803	0.56918	0.0:0.9247:0.0:0.0753	.	.	.	.	X	560	.	.	Q	+	1	0	LPHN3	62579869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.686000	0.46968	2.584000	0.87258	0.655000	0.94253	CAA	LPHN3	-	pfam_GPCR_2_secretin-like,prints_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000150471		0.348	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	132	0.00	0	C			62897274	62897274	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000502815	ensembl	human	known	69_37n	nonsense	72	28.71	29	SNP	1.000	T
LRP5	4041	genome.wustl.edu	37	11	68181258	68181258	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:68181258G>A	ENST00000294304.7	+	12	2711	c.2605G>A	c.(2605-2607)Gag>Aag	p.E869K		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	869	Beta-propeller 3.				adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GCACAGCATTGAGCGGGCCGA	0.602																																						dbGAP											0													102.0	87.0	92.0					11																	68181258		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.2605G>A	11.37:g.68181258G>A	ENSP00000294304:p.Glu869Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96TD6|Q9UES7|Q9UP66	Missense_Mutation	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EGF-like,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.E869K	ENST00000294304.7	37	c.2605	CCDS8181.1	11	.	.	.	.	.	.	.	.	.	.	G	36	5.775716	0.96922	.	.	ENSG00000162337	ENST00000294304	D	0.95980	-3.87	5.02	5.02	0.67125	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.48767	U	0.000163	D	0.97832	0.9288	M	0.85462	2.755	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.97509	1.0065	10	0.40728	T	0.16	.	18.5313	0.90993	0.0:0.0:1.0:0.0	.	869;869	Q9UES7;O75197	.;LRP5_HUMAN	K	869	ENSP00000294304:E869K	ENSP00000294304:E869K	E	+	1	0	LRP5	67937834	1.000000	0.71417	0.991000	0.47740	0.982000	0.71751	5.188000	0.65093	2.601000	0.87937	0.561000	0.74099	GAG	LRP5	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt	ENSG00000162337		0.602	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	HGNC	protein_coding	OTTHUMT00000395088.1	28	0.00	0	G	NM_002335		68181258	68181258	+1	no_errors	ENST00000294304	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	A
LRRC4	64101	genome.wustl.edu	37	7	127670274	127670274	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:127670274G>A	ENST00000249363.3	-	2	677	c.420C>T	c.(418-420)agC>agT	p.S140S	SND1_ENST00000354725.3_Intron	NM_022143.4	NP_071426.1	Q9HBW1	LRRC4_HUMAN	leucine rich repeat containing 4	140					postsynaptic density protein 95 clustering (GO:0097119)|regulation of synapse organization (GO:0050807)|synapse organization (GO:0050808)	cell junction (GO:0030054)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(4)|pancreas(1)|skin(2)	26				Lung(243;0.124)		CAAAGGCCCCGCTAGGGATGA	0.607																																						dbGAP											0													76.0	80.0	79.0					7																	127670274		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF196976	CCDS5799.1	7q31	2013-01-14	2003-11-19		ENSG00000128594	ENSG00000128594		"""Immunoglobulin superfamily / I-set domain containing"""	15586	protein-coding gene	gene with protein product		610486	"""leucine-rich repeat-containing 4"""			12969517	Standard	NM_022143		Approved	NAG14	uc003vmk.3	Q9HBW1	OTTHUMG00000157563	ENST00000249363.3:c.420C>T	7.37:g.127670274G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Y9|Q14DU9|Q6ZMI8|Q96A85	Silent	SNP	pfam_Leu-rich_rpt,pfam_Ig_I-set,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S140	ENST00000249363.3	37	c.420	CCDS5799.1	7																																																																																			LRRC4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000128594		0.607	LRRC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC4	HGNC	protein_coding	OTTHUMT00000349170.1	70	0.00	0	G	NM_022143		127670274	127670274	-1	no_errors	ENST00000249363	ensembl	human	known	69_37n	silent	49	14.04	8	SNP	0.995	A
LRRK1	79705	genome.wustl.edu	37	15	101595248	101595248	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:101595248C>T	ENST00000388948.3	+	27	4511	c.4152C>T	c.(4150-4152)ttC>ttT	p.F1384F	LRRK1_ENST00000284395.5_Silent_p.F1381F|RP11-505E24.2_ENST00000559857.1_RNA	NM_024652.3	NP_078928.3			leucine-rich repeat kinase 1											breast(2)|central_nervous_system(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(25)|ovary(4)|prostate(1)|skin(1)	72	Melanoma(26;0.00505)|Lung NSC(78;0.00793)|all_lung(78;0.0094)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ACATCATCTTCTGTGACCTGA	0.493																																						dbGAP											0													142.0	137.0	138.0					15																	101595248		2030	4179	6209	-	-	-	SO:0001819	synonymous_variant	0			AB058693	CCDS42086.1	15q26.3	2007-01-29			ENSG00000154237	ENSG00000154237			18608	protein-coding gene	gene with protein product		610986				11347906, 14654223	Standard	XM_005254979		Approved	FLJ23119, KIAA1790, Roco1, RIPK6	uc002bwr.3	Q38SD2	OTTHUMG00000165514	ENST00000388948.3:c.4152C>T	15.37:g.101595248C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S61F	ENST00000388948.3	37	c.182	CCDS42086.1	15																																																																																			LRRK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000154237		0.493	LRRK1-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRK1	HGNC	protein_coding	OTTHUMT00000384567.2	89	0.00	0	C	NM_024652		101595248	101595248	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000526457	ensembl	human	known	69_37n	missense	67	34.31	35	SNP	1.000	T
LRRK2	120892	genome.wustl.edu	37	12	40681261	40681261	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:40681261C>G	ENST00000298910.7	+	20	2667	c.2609C>G	c.(2608-2610)tCt>tGt	p.S870C	LRRK2_ENST00000343742.2_Missense_Mutation_p.S870C	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	870					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GATGTGCTGTCTAAATTTGAT	0.378																																						dbGAP											0													124.0	120.0	121.0					12																	40681261		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2609C>G	12.37:g.40681261C>G	ENSP00000298910:p.Ser870Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.S870C	ENST00000298910.7	37	c.2609	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	C	5.541	0.284668	0.10513	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.72835	2.15;-0.69	5.5	1.52	0.23074	.	0.367330	0.27856	N	0.017574	T	0.47581	0.1453	N	0.08118	0	0.09310	N	1	B;B	0.25719	0.102;0.132	B;B	0.27262	0.078;0.012	T	0.41448	-0.9508	10	0.56958	D	0.05	.	8.1946	0.31389	0.6178:0.2558:0.0:0.1264	.	870;870	E9PC85;Q5S007	.;LRRK2_HUMAN	C	870	ENSP00000341930:S870C;ENSP00000298910:S870C	ENSP00000298910:S870C	S	+	2	0	LRRK2	38967528	0.996000	0.38824	0.001000	0.08648	0.129000	0.20672	0.999000	0.29757	0.013000	0.14918	-0.714000	0.03626	TCT	LRRK2	-	NULL	ENSG00000188906		0.378	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	121	0.00	0	C	XM_058513		40681261	40681261	+1	no_errors	ENST00000298910	ensembl	human	known	69_37n	missense	83	31.40	38	SNP	0.061	G
LRRN3	54674	genome.wustl.edu	37	7	110763804	110763804	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:110763804C>G	ENST00000422987.3	+	2	1807	c.976C>G	c.(976-978)Cac>Gac	p.H326D	IMMP2L_ENST00000437687.1_Intron|IMMP2L_ENST00000447215.1_Intron|IMMP2L_ENST00000331762.3_Intron|IMMP2L_ENST00000450877.1_Intron|IMMP2L_ENST00000489381.1_Intron|IMMP2L_ENST00000415362.1_Intron|LRRN3_ENST00000451085.1_Missense_Mutation_p.H326D|IMMP2L_ENST00000405709.2_Intron|IMMP2L_ENST00000452895.1_Intron|LRRN3_ENST00000308478.5_Missense_Mutation_p.H326D	NM_018334.4	NP_060804.3	Q9H3W5	LRRN3_HUMAN	leucine rich repeat neuronal 3	326					positive regulation of protein phosphorylation (GO:0001934)	clathrin adaptor complex (GO:0030131)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(15)|lung(20)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				UCEC - Uterine corpus endometrioid carcinoma (4;0.245)|LUSC - Lung squamous cell carcinoma(290;0.0715)|Lung(3;0.0864)|STAD - Stomach adenocarcinoma(3;0.125)		GTCTTACATTCACCCCAATGC	0.433																																						dbGAP											0													97.0	98.0	98.0					7																	110763804		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB060967	CCDS5754.1	7q31.1	2013-02-11			ENSG00000173114	ENSG00000173114		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17200	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 5"""					11549284	Standard	NM_001099660		Approved	NLRR3, FLJ11129, FIGLER5	uc003vfs.4	Q9H3W5	OTTHUMG00000155039	ENST00000422987.3:c.976C>G	7.37:g.110763804C>G	ENSP00000412417:p.His326Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O43377|Q6I9V8|Q8IYQ6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_LRR-contain_N,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.H326D	ENST00000422987.3	37	c.976	CCDS5754.1	7	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058835	0.55325	.	.	ENSG00000173114	ENST00000308478;ENST00000451085;ENST00000422987	T;T;T	0.22134	1.97;1.97;1.97	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000005	T	0.27241	0.0668	N	0.10645	0.015	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.20042	-1.0287	10	0.12430	T	0.62	.	20.0656	0.97703	0.0:1.0:0.0:0.0	.	326	Q9H3W5	LRRN3_HUMAN	D	326	ENSP00000312001:H326D;ENSP00000397312:H326D;ENSP00000412417:H326D	ENSP00000312001:H326D	H	+	1	0	LRRN3	110551040	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.747000	0.94245	0.650000	0.86243	CAC	LRRN3	-	NULL	ENSG00000173114		0.433	LRRN3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN3	HGNC	protein_coding	OTTHUMT00000338171.2	73	0.00	0	C	NM_018334		110763804	110763804	+1	no_errors	ENST00000308478	ensembl	human	known	69_37n	missense	57	25.97	20	SNP	1.000	G
LY86	9450	genome.wustl.edu	37	6	6654780	6654780	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:6654780G>A	ENST00000379953.2	+	6	761	c.409G>A	c.(409-411)Gaa>Aaa	p.E137K	LY86_ENST00000230568.4_Missense_Mutation_p.E137K			O95711	LY86_HUMAN	lymphocyte antigen 86	137					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)				large_intestine(2)|lung(6)	8	Ovarian(93;0.0377)					CTTGCAGGGAGAATACCAGGT	0.453																																						dbGAP											0													141.0	122.0	129.0					6																	6654780		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057178	CCDS4498.1	6p24.3	2010-07-08			ENSG00000112799	ENSG00000112799			16837	protein-coding gene	gene with protein product		605241				9763566	Standard	NM_004271		Approved	MD-1, dJ80N2.1	uc003mwy.1	O95711	OTTHUMG00000014190	ENST00000379953.2:c.409G>A	6.37:g.6654780G>A	ENSP00000369286:p.Glu137Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQC4	Missense_Mutation	SNP	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog	p.E137K	ENST00000379953.2	37	c.409	CCDS4498.1	6	.	.	.	.	.	.	.	.	.	.	G	13.35	2.209687	0.39003	.	.	ENSG00000112799	ENST00000379953;ENST00000230568	T;T	0.72942	-0.7;-0.7	4.13	1.31	0.21738	MD-2-related lipid-recognition (2);Immunoglobulin E-set (1);	0.192077	0.32093	N	0.006596	T	0.42337	0.1198	L	0.51422	1.61	0.34450	D	0.700621	B	0.12013	0.005	B	0.10450	0.005	T	0.17349	-1.0372	10	0.51188	T	0.08	-7.0909	6.5797	0.22588	0.3285:0.0:0.6715:0.0	.	137	O95711	LY86_HUMAN	K	137	ENSP00000369286:E137K;ENSP00000230568:E137K	ENSP00000230568:E137K	E	+	1	0	LY86	6599779	1.000000	0.71417	0.998000	0.56505	0.763000	0.43281	0.391000	0.20784	0.132000	0.18615	-0.245000	0.11935	GAA	LY86	-	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog	ENSG00000112799		0.453	LY86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY86	HGNC	protein_coding	OTTHUMT00000039762.2	68	0.00	0	G			6654780	6654780	+1	no_errors	ENST00000230568	ensembl	human	known	69_37n	missense	46	45.88	39	SNP	1.000	A
MAB21L1	4081	genome.wustl.edu	37	13	36050059	36050059	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:36050059C>T	ENST00000379919.4	-	1	773	c.217G>A	c.(217-219)Gaa>Aaa	p.E73K	NBEA_ENST00000537702.1_5'Flank|NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000310336.4_Intron	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	73					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)		p.E73K(1)		breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		ACTTCAAATTCGGTGGGGGAG	0.577																																						dbGAP											1	Substitution - Missense(1)	skin(1)											94.0	94.0	94.0					13																	36050059		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.217G>A	13.37:g.36050059C>T	ENSP00000369251:p.Glu73Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6I9T5	Missense_Mutation	SNP	pfam_Mab-21_dom	p.E73K	ENST00000379919.4	37	c.217	CCDS9353.1	13	.	.	.	.	.	.	.	.	.	.	C	26.4	4.729709	0.89390	.	.	ENSG00000180660	ENST00000379919	T	0.11063	2.81	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.27594	0.0678	M	0.82323	2.585	0.80722	D	1	P	0.48230	0.907	P	0.47827	0.558	T	0.02901	-1.1096	10	0.54805	T	0.06	-0.5448	19.7375	0.96212	0.0:1.0:0.0:0.0	.	73	Q13394	MB211_HUMAN	K	73	ENSP00000369251:E73K	ENSP00000369251:E73K	E	-	1	0	MAB21L1	34948059	1.000000	0.71417	0.993000	0.49108	0.986000	0.74619	7.818000	0.86416	2.680000	0.91292	0.655000	0.94253	GAA	MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.577	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	45	0.00	0	C	NM_005584		36050059	36050059	-1	no_errors	ENST00000379919	ensembl	human	known	69_37n	missense	27	40.00	18	SNP	1.000	T
MAGEB1	4112	genome.wustl.edu	37	X	30269445	30269445	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:30269445G>A	ENST00000378981.3	+	4	1156	c.835G>A	c.(835-837)Gaa>Aaa	p.E279K	MAGEB1_ENST00000397548.2_Missense_Mutation_p.E279K|MAGEB1_ENST00000397550.1_Missense_Mutation_p.E279K	NM_002363.4	NP_002354.2	P43366	MAGB1_HUMAN	melanoma antigen family B, 1	279	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									NS(2)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(8)|lung(12)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	32						AGCCTATGCTGAAACCACCAA	0.502																																						dbGAP											0													117.0	102.0	107.0					X																	30269445		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS14222.1	Xp21.3	2009-03-17			ENSG00000214107	ENSG00000214107			6808	protein-coding gene	gene with protein product	"""DSS/AHC critical interval MAGE superfamily 10"", ""cancer/testis antigen family 3, member 1"""	300097				7761436, 9441743	Standard	NM_002363		Approved	MAGEL1, MAGE-Xp, DAM10, MGC9322, CT3.1	uc004dce.3	P43366	OTTHUMG00000021322	ENST00000378981.3:c.835G>A	X.37:g.30269445G>A	ENSP00000368264:p.Glu279Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC79|O00601|O75862|Q6FHJ0|Q96CW8	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E279K	ENST00000378981.3	37	c.835	CCDS14222.1	X	.	.	.	.	.	.	.	.	.	.	G	14.34	2.506304	0.44558	.	.	ENSG00000214107	ENST00000378981;ENST00000397550;ENST00000397548	T;T;T	0.25912	1.77;1.77;1.77	3.86	3.86	0.44501	.	0.000000	0.85682	D	0.000000	T	0.60366	0.2263	H	0.96080	3.765	0.09310	N	0.999999	D	0.89917	1.0	D	0.78314	0.991	T	0.59386	-0.7464	10	0.87932	D	0	.	10.2273	0.43233	0.0:0.0:1.0:0.0	.	279	P43366	MAGB1_HUMAN	K	279	ENSP00000368264:E279K;ENSP00000380683:E279K;ENSP00000380681:E279K	ENSP00000368264:E279K	E	+	1	0	MAGEB1	30179366	0.997000	0.39634	0.130000	0.21974	0.180000	0.23129	4.019000	0.57181	2.167000	0.68274	0.513000	0.50165	GAA	MAGEB1	-	pfam_MAGE,pfscan_MAGE	ENSG00000214107		0.502	MAGEB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB1	HGNC	protein_coding	OTTHUMT00000056160.1	122	0.00	0	G	NM_002363		30269445	30269445	+1	no_errors	ENST00000378981	ensembl	human	known	69_37n	missense	108	28.95	44	SNP	0.129	A
MAGEC3	139081	genome.wustl.edu	37	X	140953296	140953296	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:140953296C>T	ENST00000298296.1	+	2	163	c.163C>T	c.(163-165)Cat>Tat	p.H55Y		NM_138702.1	NP_619647.1	Q8TD91	MAGC3_HUMAN	melanoma antigen family C, 3	55								p.H55Y(1)		NS(2)|breast(3)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|liver(1)|lung(32)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(2)	69	Acute lymphoblastic leukemia(192;6.56e-05)					TTCTGCCTTTCATCTTGGGCA	0.512																																						dbGAP											1	Substitution - Missense(1)	lung(1)											195.0	155.0	168.0					X																	140953296		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF490508	CCDS14676.1, CCDS14677.1	Xq27.2	2009-03-25			ENSG00000165509	ENSG00000165509			23798	protein-coding gene	gene with protein product	"""cancer/testis antigen family 7, member 2"""	300469				10861452	Standard	NM_138702		Approved	HCA2, MAGE-C3, CT7.2	uc011mwp.2	Q8TD91	OTTHUMG00000022570	ENST00000298296.1:c.163C>T	X.37:g.140953296C>T	ENSP00000298296:p.His55Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYA7|Q5JZ43|Q9BZ80	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.H55Y	ENST00000298296.1	37	c.163	CCDS14676.1	X	.	.	.	.	.	.	.	.	.	.	C	8.075	0.771012	0.15983	.	.	ENSG00000165509	ENST00000298296	T	0.08458	3.09	2.12	1.21	0.21127	.	.	.	.	.	T	0.03390	0.0098	N	0.08118	0	0.09310	N	1	B	0.33266	0.404	B	0.15484	0.013	T	0.39800	-0.9596	9	0.87932	D	0	.	5.3343	0.15949	0.3354:0.6646:0.0:0.0	.	55	Q8TD91	MAGC3_HUMAN	Y	55	ENSP00000298296:H55Y	ENSP00000298296:H55Y	H	+	1	0	MAGEC3	140780962	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.249000	0.08842	0.334000	0.23590	0.544000	0.68410	CAT	MAGEC3	-	NULL	ENSG00000165509		0.512	MAGEC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGEC3	HGNC	protein_coding	OTTHUMT00000058606.1	134	0.00	0	C	NM_138702		140953296	140953296	+1	no_errors	ENST00000298296	ensembl	human	known	69_37n	missense	65	32.29	31	SNP	0.000	T
MAGI2	9863	genome.wustl.edu	37	7	79082424	79082424	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:79082424C>T	ENST00000354212.4	-	1	466	c.213G>A	c.(211-213)gaG>gaA	p.E71E	MAGI2-AS3_ENST00000448195.1_RNA|MAGI2_ENST00000419488.1_Silent_p.E71E|MAGI2-AS3_ENST00000451809.1_RNA|MAGI2-AS3_ENST00000414797.1_RNA|MAGI2-AS3_ENST00000429408.1_RNA|MAGI2-AS3_ENST00000422093.1_RNA|MAGI2-AS3_ENST00000426835.1_RNA|MAGI2-AS3_ENST00000424477.1_RNA|MAGI2_ENST00000522391.1_Silent_p.E71E|MAGI2-AS3_ENST00000446159.1_RNA	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	71	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				CCACGGGGGTCTCGTTCACCT	0.627																																						dbGAP											0													49.0	54.0	52.0					7																	79082424		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.213G>A	7.37:g.79082424C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.E71	ENST00000354212.4	37	c.213	CCDS5594.1	7																																																																																			MAGI2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000187391		0.627	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	16	0.00	0	C	NM_012301		79082424	79082424	-1	no_errors	ENST00000354212	ensembl	human	known	69_37n	silent	8	52.94	9	SNP	1.000	T
MAP4	4134	genome.wustl.edu	37	3	47957724	47957724	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:47957724G>A	ENST00000360240.6	-	7	2111	c.1593C>T	c.(1591-1593)atC>atT	p.I531I	MAP4_ENST00000395734.3_Silent_p.I531I|MAP4_ENST00000426837.2_Silent_p.I548I|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	531	17 X 14 AA tandem repeats.				cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	ATACGTTCTTGATGAGAACTA	0.507																																						dbGAP											0													138.0	126.0	130.0					3																	47957724		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1593C>T	3.37:g.47957724G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Silent	SNP	pfam_Tau/MAP_tubulin-bd_rpt	p.I531	ENST00000360240.6	37	c.1593	CCDS33750.1	3																																																																																			MAP4	-	NULL	ENSG00000047849		0.507	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1	113	0.00	0	G	NM_002375		47957724	47957724	-1	no_errors	ENST00000360240	ensembl	human	known	69_37n	silent	76	23.23	23	SNP	0.038	A
MAP3K13	9175	genome.wustl.edu	37	3	185198077	185198077	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:185198077C>G	ENST00000265026.3	+	13	2893	c.2559C>G	c.(2557-2559)ttC>ttG	p.F853L	MAP3K13_ENST00000535426.1_Missense_Mutation_p.F709L|TMEM41A_ENST00000475480.1_5'UTR|MAP3K13_ENST00000424227.1_Missense_Mutation_p.F853L|MAP3K13_ENST00000443863.1_Missense_Mutation_p.F709L|MAP3K13_ENST00000446828.1_Missense_Mutation_p.F646L	NM_004721.4	NP_004712.1			mitogen-activated protein kinase kinase kinase 13											NS(1)|biliary_tract(1)|breast(3)|endometrium(3)|kidney(1)|large_intestine(13)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54	all_cancers(143;7.21e-11)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.93e-20)			CTGAGAATTTCTCTGTGTCTG	0.468																																						dbGAP											0													93.0	97.0	96.0					3																	185198077		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031677	CCDS3270.1, CCDS56298.1	3q27	2011-06-09			ENSG00000073803	ENSG00000073803		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6852	protein-coding gene	gene with protein product	"""leucine zipper-bearing kinase"""	604915				9353328	Standard	NM_004721		Approved	LZK, MEKK13	uc003fpi.3	O43283	OTTHUMG00000156673	ENST00000265026.3:c.2559C>G	3.37:g.185198077C>G	ENSP00000265026:p.Phe853Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pirsf_MAP3K12_MAP3K13,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F853L	ENST00000265026.3	37	c.2559	CCDS3270.1	3	.	.	.	.	.	.	.	.	.	.	C	9.727	1.161343	0.21538	.	.	ENSG00000073803	ENST00000446828;ENST00000424227;ENST00000443863;ENST00000535426;ENST00000265026	T;T;T;T;T	0.12879	2.64;2.64;2.64;2.64;2.64	5.72	3.95	0.45737	.	0.064521	0.64402	D	0.000004	T	0.04815	0.0130	N	0.03608	-0.345	0.80722	D	1	B;B;B	0.14012	0.009;0.009;0.005	B;B;B	0.11329	0.006;0.006;0.003	T	0.28267	-1.0049	10	0.02654	T	1	.	9.4713	0.38844	0.0:0.7859:0.0:0.2141	.	709;646;853	O43283-4;O43283-5;O43283	.;.;M3K13_HUMAN	L	646;853;709;709;853	ENSP00000411483:F646L;ENSP00000399910:F853L;ENSP00000409325:F709L;ENSP00000439257:F709L;ENSP00000265026:F853L	ENSP00000265026:F853L	F	+	3	2	MAP3K13	186680771	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	2.431000	0.44775	0.774000	0.33427	-0.136000	0.14681	TTC	MAP3K13	-	pirsf_MAP3K12_MAP3K13	ENSG00000073803		0.468	MAP3K13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K13	HGNC	protein_coding	OTTHUMT00000345268.1	27	0.00	0	C	NM_004721		185198077	185198077	+1	no_errors	ENST00000265026	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	1.000	G
MAP4K4	9448	genome.wustl.edu	37	2	102456320	102456320	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:102456320G>A	ENST00000347699.4	+	10	813	c.813G>A	c.(811-813)gtG>gtA	p.V271V	MAP4K4_ENST00000425019.1_Silent_p.V271V|MAP4K4_ENST00000456652.1_Intron|MAP4K4_ENST00000350878.4_Silent_p.V251V|MAP4K4_ENST00000302217.5_Intron|MAP4K4_ENST00000350198.4_Silent_p.V271V|MAP4K4_ENST00000413150.2_Silent_p.V271V|MAP4K4_ENST00000324219.4_Silent_p.V271V	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	271	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GGTGCCTGGTGAAGAATTACA	0.383																																						dbGAP											0													78.0	68.0	71.0					2																	102456320		1827	4081	5908	-	-	-	SO:0001819	synonymous_variant	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.813G>A	2.37:g.102456320G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75172|Q9NST7	Missense_Mutation	SNP	pfam_Citron,superfamily_Kinase-like_dom,smart_Citron	p.E11K	ENST00000347699.4	37	c.31	CCDS56130.1	2	.	.	.	.	.	.	.	.	.	.	G	10.21	1.288412	0.23478	.	.	ENSG00000071054	ENST00000421882	.	.	.	5.8	4.89	0.63831	.	.	.	.	.	T	0.71804	0.3383	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70124	-0.4958	4	.	.	.	.	16.3219	0.82953	0.0:0.0:0.8674:0.1326	.	.	.	.	K	11	.	.	E	+	1	0	MAP4K4	101822752	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.742000	0.74843	2.735000	0.93741	0.655000	0.94253	GAA	MAP4K4	-	superfamily_Kinase-like_dom	ENSG00000071054		0.383	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	120	0.00	0	G	NM_004834		102456320	102456320	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000421882	ensembl	human	novel	69_37n	missense	66	31.25	30	SNP	1.000	A
MAP4K4	9448	genome.wustl.edu	37	2	102456440	102456440	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:102456440G>A	ENST00000347699.4	+	10	933	c.933G>A	c.(931-933)aaG>aaA	p.K311K	MAP4K4_ENST00000425019.1_Silent_p.K311K|MAP4K4_ENST00000456652.1_Intron|MAP4K4_ENST00000350878.4_Silent_p.K291K|MAP4K4_ENST00000302217.5_Intron|MAP4K4_ENST00000350198.4_Silent_p.K311K|MAP4K4_ENST00000413150.2_Silent_p.K311K|MAP4K4_ENST00000324219.4_Silent_p.K311K	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	311					intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GTACCAGGAAGAAGAGAGGCG	0.403																																						dbGAP											0													75.0	70.0	72.0					2																	102456440		1865	4095	5960	-	-	-	SO:0001819	synonymous_variant	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.933G>A	2.37:g.102456440G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75172|Q9NST7	Missense_Mutation	SNP	pfam_Citron,superfamily_Kinase-like_dom,smart_Citron	p.E51K	ENST00000347699.4	37	c.151	CCDS56130.1	2	.	.	.	.	.	.	.	.	.	.	G	8.931	0.963515	0.18583	.	.	ENSG00000071054	ENST00000421882	.	.	.	5.91	5.02	0.67125	.	.	.	.	.	T	0.71256	0.3318	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68949	-0.5274	4	.	.	.	.	15.4808	0.75524	0.0671:0.0:0.9329:0.0	.	.	.	.	K	51	.	.	E	+	1	0	MAP4K4	101822872	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.693000	0.74582	2.793000	0.96121	0.655000	0.94253	GAA	MAP4K4	-	superfamily_Kinase-like_dom	ENSG00000071054		0.403	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	68	0.00	0	G	NM_004834		102456440	102456440	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000421882	ensembl	human	novel	69_37n	missense	27	28.95	11	SNP	1.000	A
MBOAT7	79143	genome.wustl.edu	37	19	54677852	54677852	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:54677852G>A	ENST00000245615.1	-	8	1785	c.1305C>T	c.(1303-1305)ttC>ttT	p.F435F	TMC4_ENST00000301187.4_5'Flank|MBOAT7_ENST00000431666.2_Silent_p.F362F|MBOAT7_ENST00000338624.6_Silent_p.F362F|TMC4_ENST00000376591.4_5'Flank|TMC4_ENST00000476013.2_5'Flank	NM_024298.3	NP_077274.3	Q96N66	MBOA7_HUMAN	membrane bound O-acyltransferase domain containing 7	435					glycerophospholipid biosynthetic process (GO:0046474)|layer formation in cerebral cortex (GO:0021819)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|ventricular system development (GO:0021591)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipid acyltransferase activity (GO:0071617)			endometrium(4)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	10	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CCAGGGCCAGGAAGTGGATAC	0.642																																					NSCLC(97;826 2151 10470 22540)	dbGAP											0													63.0	60.0	61.0					19																	54677852		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF211969	CCDS12883.1, CCDS54315.1, CCDS54316.1	19q13.4	2008-12-15	2008-01-17	2008-01-17	ENSG00000125505	ENSG00000125505			15505	protein-coding gene	gene with protein product	"""lysophosphatidylinositol acyltransferase"""	606048	"""leukocyte receptor cluster (LRC) member 4"""	LENG4		10941842, 8702217, 18094042	Standard	NM_024298		Approved	BB1, hMBOA-7, LPIAT	uc002qdr.3	Q96N66	OTTHUMG00000066516	ENST00000245615.1:c.1305C>T	19.37:g.54677852G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9C4B6|B0V3I5|B4DQ87|Q05DF0|Q7L5N2|Q99908|Q9BPV2|Q9BRE9	Silent	SNP	pfam_MBOAT_fam	p.F435	ENST00000245615.1	37	c.1305	CCDS12883.1	19																																																																																			MBOAT7	-	NULL	ENSG00000125505		0.642	MBOAT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT7	HGNC	protein_coding	OTTHUMT00000142203.1	36	0.00	0	G	NM_024298		54677852	54677852	-1	no_errors	ENST00000245615	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	0.011	A
MBP	4155	genome.wustl.edu	37	18	74696844	74696844	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:74696844C>T	ENST00000397869.3	-	5	599	c.553G>A	c.(553-555)Gaa>Aaa	p.E185K	MBP_ENST00000355994.2_Missense_Mutation_p.E253K|MBP_ENST00000527041.1_Intron|RP11-862L9.3_ENST00000582546.1_RNA|MBP_ENST00000382582.3_Missense_Mutation_p.E146K|MBP_ENST00000578193.1_Missense_Mutation_p.E120K|MBP_ENST00000397866.4_Missense_Mutation_p.E120K|MBP_ENST00000397865.5_Missense_Mutation_p.E109K|MBP_ENST00000397875.3_Missense_Mutation_p.E130K|MBP_ENST00000580402.1_Missense_Mutation_p.E253K|MBP_ENST00000359645.3_Missense_Mutation_p.E135K|MBP_ENST00000528160.1_Intron|RP11-862L9.3_ENST00000582763.1_RNA|MBP_ENST00000579129.1_Intron|MBP_ENST00000354542.4_Intron|MBP_ENST00000526111.1_Missense_Mutation_p.E98K|RP11-862L9.3_ENST00000580580.1_RNA			P13727	PRG2_HUMAN	myelin basic protein	176	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	19		Prostate(75;0.0865)|Esophageal squamous(42;0.129)|Melanoma(33;0.211)		OV - Ovarian serous cystadenocarcinoma(15;1.79e-06)|BRCA - Breast invasive adenocarcinoma(31;0.113)|READ - Rectum adenocarcinoma(1;0.188)	Sargramostim(DB00020)	CTCTGGCCTTCGGCCCCCTGC	0.637																																					NSCLC(17;72 1131 19392)	dbGAP											0													71.0	68.0	69.0					18																	74696844		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12011.1, CCDS32847.1, CCDS42448.1, CCDS42449.1, CCDS42450.1	18q23	2008-08-01			ENSG00000197971	ENSG00000197971			6925	protein-coding gene	gene with protein product		159430				2425357	Standard	XM_005266699		Approved		uc010xfd.2	P02686	OTTHUMG00000132874	ENST00000397869.3:c.553G>A	18.37:g.74696844C>T	ENSP00000380967:p.Glu185Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	pfam_Myelin_BP,prints_Myelin_BP	p.E253K	ENST00000397869.3	37	c.757		18	.	.	.	.	.	.	.	.	.	.	C	24.3	4.519160	0.85495	.	.	ENSG00000197971	ENST00000382582;ENST00000355994;ENST00000397875;ENST00000397866;ENST00000397865;ENST00000359645;ENST00000397869;ENST00000526111;ENST00000397868;ENST00000447114	.	.	.	4.55	4.55	0.56014	.	0.000000	0.45606	D	0.000359	T	0.68952	0.3057	L	0.48642	1.525	0.34608	D	0.717259	D;D;D;D	0.76494	0.999;0.998;0.992;0.994	P;D;P;P	0.73380	0.873;0.98;0.803;0.775	T	0.78851	-0.2041	9	0.72032	D	0.01	0.952	14.4763	0.67548	0.0:1.0:0.0:0.0	.	253;109;135;146	P02686;P02686-6;P02686-4;P02686-3	MBP_HUMAN;.;.;.	K	146;253;130;120;109;135;185;98;120;64	.	ENSP00000348273:E253K	E	-	1	0	MBP	72825832	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	4.192000	0.58378	2.070000	0.61991	0.462000	0.41574	GAA	MBP	-	pfam_Myelin_BP	ENSG00000197971		0.637	MBP-024	NOVEL	basic|exp_conf	protein_coding	MBP	HGNC	protein_coding	OTTHUMT00000267964.1	41	0.00	0	C	NM_001025081		74696844	74696844	-1	no_errors	ENST00000355994	ensembl	human	known	69_37n	missense	34	29.17	14	SNP	1.000	T
MCF2L	23263	genome.wustl.edu	37	13	113748898	113748898	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:113748898G>C	ENST00000375608.3	+	28	3172	c.3114G>C	c.(3112-3114)caG>caC	p.Q1038H	MCF2L_ENST00000535094.2_Missense_Mutation_p.Q1008H|MCF2L_ENST00000375604.2_Missense_Mutation_p.Q1065H|MCF2L_ENST00000375601.3_Missense_Mutation_p.Q1012H|MCF2L_ENST00000434480.2_Missense_Mutation_p.Q1014H|MCF2L_ENST00000423482.2_Missense_Mutation_p.Q1006H|MCF2L_ENST00000442652.2_Missense_Mutation_p.Q1038H|MCF2L_ENST00000421756.1_Missense_Mutation_p.Q1012H|MCF2L_ENST00000397030.1_Missense_Mutation_p.Q1041H			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like	1038					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				CAGAGGAGCAGATTAACTCGT	0.642																																						dbGAP											0													40.0	46.0	44.0					13																	113748898		1561	3582	5143	-	-	-	SO:0001583	missense	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.3114G>C	13.37:g.113748898G>C	ENSP00000364758:p.Gln1038His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	Missense_Mutation	SNP	pfam_DH-domain,pfam_Spectrin_repeat,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,smart_Spectrin/alpha-actinin,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_CRAL-TRIO_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.Q1065H	ENST00000375608.3	37	c.3195		13	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	4.383|4.383|4.383	0.070703|0.070703|0.070703	0.08436|0.08436|0.08436	.|.|.	.|.|.	ENSG00000126217|ENSG00000126217|ENSG00000126217	ENST00000397017;ENST00000453297;ENST00000439475;ENST00000441756|ENST00000375608;ENST00000442652;ENST00000375604;ENST00000397030;ENST00000535094;ENST00000421756;ENST00000375601;ENST00000434480;ENST00000423482;ENST00000440749|ENST00000413354;ENST00000261963;ENST00000420013	.|T;T;T;T;T;T;T;T;T|.	.|0.35973|.	.|1.33;1.33;1.28;1.35;1.29;1.36;1.29;1.34;1.3|.	4.83|4.83|4.83	-9.66|-9.66|-9.66	0.00534|0.00534|0.00534	.|.|.	.|0.179966|.	.|0.49305|.	.|D|.	.|0.000145|.	T|T|T	0.10852|0.10852|0.10852	0.0265|0.0265|0.0265	N|N|N	0.08118|0.08118|0.08118	0|0|0	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|P;P;P;P|.	.|0.44478|.	.|0.775;0.775;0.824;0.836|.	.|P;P;P;P|.	.|0.52267|.	.|0.579;0.579;0.694;0.497|.	T|T|T	0.14227|0.14227|0.14227	-1.0480|-1.0480|-1.0480	5|10|5	.|0.15499|.	.|T|.	.|0.54|.	.|.|.	1.4813|1.4813|1.4813	0.02437|0.02437|0.02437	0.2416:0.3614:0.1643:0.2328|0.2416:0.3614:0.1643:0.2328|0.2416:0.3614:0.1643:0.2328	.|.|.	.|1006;1008;1065;1038|.	.|E9PDN8;O15068-9;G5E9A1;O15068|.	.|.;.;.;MCF2L_HUMAN|.	H|H|T	694;219;145;37|1038;1038;1065;1041;1008;1012;1012;1014;1006;849|291;179;80	.|ENSP00000364758:Q1038H;ENSP00000401422:Q1038H;ENSP00000364754:Q1065H;ENSP00000380225:Q1041H;ENSP00000440374:Q1008H;ENSP00000397285:Q1012H;ENSP00000364751:Q1012H;ENSP00000407722:Q1014H;ENSP00000405639:Q1006H|.	.|ENSP00000364751:Q1012H|.	D|Q|R	+|+|+	1|3|2	0|2|0	MCF2L|MCF2L|MCF2L	112796899|112796899|112796899	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.001000|0.001000|0.001000	0.01503|0.01503|0.01503	-1.927000|-1.927000|-1.927000	0.01561|0.01561|0.01561	-1.843000|-1.843000|-1.843000	0.01179|0.01179|0.01179	-1.014000|-1.014000|-1.014000	0.02459|0.02459|0.02459	GAT|CAG|AGA	MCF2L	-	NULL	ENSG00000126217		0.642	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4	47	0.00	0	G			113748898	113748898	+1	no_errors	ENST00000375604	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	0.000	C
MED26	9441	genome.wustl.edu	37	19	16687047	16687047	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:16687047C>G	ENST00000263390.3	-	3	1856	c.1594G>C	c.(1594-1596)Gtg>Ctg	p.V532L	CTC-429P9.4_ENST00000593962.1_5'Flank|CTD-3222D19.2_ENST00000409035.1_Intron	NM_004831.3	NP_004822.2	O95402	MED26_HUMAN	mediator complex subunit 26	532					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|RNA polymerase II transcription cofactor activity (GO:0001104)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|skin(1)	8						CTTTGAGGCACCAGCACATGC	0.657																																						dbGAP											0													46.0	47.0	47.0					19																	16687047		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104253	CCDS12347.1	19p13.11	2008-02-05	2007-07-30	2007-07-30		ENSG00000105085			2376	protein-coding gene	gene with protein product		605043	"""cofactor required for Sp1 transcriptional activation, subunit 7, 70kDa"""	CRSP7		9989412	Standard	NM_004831		Approved	CRSP70	uc002nen.1	O95402		ENST00000263390.3:c.1594G>C	19.37:g.16687047C>G	ENSP00000263390:p.Val532Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4S3|Q0VGB6	Missense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.V532L	ENST00000263390.3	37	c.1594	CCDS12347.1	19	.	.	.	.	.	.	.	.	.	.	C	6.033	0.374491	0.11409	.	.	ENSG00000105085	ENST00000263390	T	0.38722	1.12	5.28	1.47	0.22746	.	0.791113	0.11573	N	0.550593	T	0.33265	0.0857	L	0.31294	0.92	0.21147	N	0.99977	B	0.02656	0.0	B	0.01281	0.0	T	0.19582	-1.0301	10	0.30078	T	0.28	-1.9605	16.1562	0.81670	0.0:0.4909:0.5091:0.0	.	532	O95402	MED26_HUMAN	L	532	ENSP00000263390:V532L	ENSP00000263390:V532L	V	-	1	0	MED26	16548047	0.638000	0.27225	0.717000	0.30585	0.546000	0.35178	2.355000	0.44107	0.096000	0.17463	0.591000	0.81541	GTG	MED26	-	NULL	ENSG00000105085		0.657	MED26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED26	HGNC	protein_coding	OTTHUMT00000461178.1	33	0.00	0	C	NM_004831		16687047	16687047	-1	no_errors	ENST00000263390	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	0.856	G
MEP1A	4224	genome.wustl.edu	37	6	46766377	46766377	+	Silent	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:46766377C>G	ENST00000230588.4	+	4	189	c.180C>G	c.(178-180)ctC>ctG	p.L60L		NM_005588.2	NP_005579.2	Q16819	MEP1A_HUMAN	meprin A, alpha (PABA peptide hydrolase)	60					digestion (GO:0007586)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|meprin A complex (GO:0017090)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(21)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42			Lung(136;0.192)			GGGACATCCTCTTGCAGGTGA	0.458																																						dbGAP											0													73.0	72.0	72.0					6																	46766377		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4918.1	6p12-p11	2010-10-18			ENSG00000112818	ENSG00000112818	3.4.24.18		7015	protein-coding gene	gene with protein product		600388				7774936	Standard	NM_005588		Approved	PPHA	uc010jzh.1	Q16819	OTTHUMG00000014790	ENST00000230588.4:c.180C>G	6.37:g.46766377C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM4|B0AZP9|B2RCS2|Q8TDC9|Q9H1R1	Silent	SNP	pirsf_Pept_M12A_Meprin,pfam_Peptidase_M12A,pfam_MATH,pfam_MAM_dom,pfam_EGF-like_dom,superfamily_TRAF-like,superfamily_ConA-like_lec_gl,smart_Peptidase_Metallo,smart_MAM_dom,smart_MATH,prints_Peptidase_M12A,prints_MAM_dom,pfscan_EG-like_dom,pfscan_MATH,pfscan_MAM_dom	p.L60	ENST00000230588.4	37	c.180	CCDS4918.1	6																																																																																			MEP1A	-	pirsf_Pept_M12A_Meprin	ENSG00000112818		0.458	MEP1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEP1A	HGNC	protein_coding	OTTHUMT00000040803.1	79	0.00	0	C	NM_005588		46766377	46766377	+1	no_errors	ENST00000230588	ensembl	human	known	69_37n	silent	29	27.50	11	SNP	0.325	G
MET	4233	genome.wustl.edu	37	7	116371761	116371761	+	Missense_Mutation	SNP	G	G	A	rs540540827		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:116371761G>A	ENST00000318493.6	+	3	1427	c.1240G>A	c.(1240-1242)Gat>Aat	p.D414N	MET_ENST00000436117.2_Missense_Mutation_p.D414N|MET_ENST00000495962.1_3'UTR|MET_ENST00000397752.3_Missense_Mutation_p.D414N			Q9NWH9	SLTM_HUMAN	MET proto-oncogene, receptor tyrosine kinase	0	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(10)|breast(4)|central_nervous_system(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(25)|large_intestine(8)|liver(3)|lung(70)|ovary(10)|pleura(2)|prostate(4)|skin(5)|stomach(6)|testis(1)|thyroid(4)|upper_aerodigestive_tract(64)|urinary_tract(3)	233	all_cancers(3;1.25e-07)|all_epithelial(6;4.07e-08)|Lung NSC(10;0.00108)|all_lung(10;0.00125)	Ovarian(593;0.133)	GBM - Glioblastoma multiforme(2;2.31e-07)|all cancers(2;0.000419)|STAD - Stomach adenocarcinoma(10;0.000512)			AGCGCGCCGTGATGAATATCG	0.408			Mis		"""papillary renal, head-neck squamous cell """	papillary renal			Hereditary Papillary Renal Carcinoma (type 1)				G|||	1	0.000199681	0.0	0.0	5008	,	,		21128	0.001		0.0	False		,,,				2504	0.0					dbGAP		Dom	yes	Familial Papillary Renal Cancer	7	7q31	4233	met proto-oncogene (hepatocyte growth factor receptor)		E	0													108.0	98.0	101.0					7																	116371761		1888	4105	5993	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPRC, Hereditary Papillary Renal Cell Cancer	M35073	CCDS43636.1, CCDS47689.1	7q31	2014-09-17	2014-06-26		ENSG00000105976	ENSG00000105976	2.7.10.1		7029	protein-coding gene	gene with protein product	"""hepatocyte growth factor receptor"""	164860	"""met proto-oncogene"""			1846706, 1611909	Standard	NM_001127500		Approved	HGFR, RCCP2	uc010lkh.3	P08581	OTTHUMG00000023299	ENST00000318493.6:c.1240G>A	7.37:g.116371761G>A	ENSP00000317272:p.Asp414Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Semaphorin/CD100_Ag,pfscan_Prot_kinase_cat_dom	p.D414N	ENST00000318493.6	37	c.1240	CCDS47689.1	7	.	.	.	.	.	.	.	.	.	.	G	16.79	3.219227	0.58560	.	.	ENSG00000105976	ENST00000397752;ENST00000318493;ENST00000436117	T;T;T	0.10860	2.83;2.83;2.83	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.099426	0.64402	D	0.000001	T	0.36468	0.0968	M	0.79805	2.47	0.80722	D	1	D;P;D;P;P;P;P;P;P;P;D	0.76494	0.999;0.51;0.962;0.775;0.65;0.775;0.775;0.775;0.835;0.863;0.96	D;B;P;P;B;P;P;P;P;P;P	0.66847	0.947;0.428;0.82;0.601;0.428;0.601;0.697;0.601;0.466;0.697;0.816	T	0.08722	-1.0708	10	0.49607	T	0.09	.	19.2697	0.94004	0.0:0.0:1.0:0.0	.	414;414;414;414;414;414;414;414;414;414;414	B5A929;E7EQ94;B5A930;B5A934;B5A936;B5A937;B5A939;B5A941;P08581-2;B5A942;P08581	.;.;.;.;.;.;.;.;.;.;MET_HUMAN	N	414	ENSP00000380860:D414N;ENSP00000317272:D414N;ENSP00000410980:D414N	ENSP00000317272:D414N	D	+	1	0	MET	116158997	1.000000	0.71417	0.974000	0.42286	0.339000	0.28857	5.790000	0.69038	2.536000	0.85505	0.655000	0.94253	GAT	MET	-	pirsf_Tyr_kinase_HGF/MSP_rcpt,pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000105976		0.408	MET-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MET	HGNC	protein_coding	OTTHUMT00000059620.3	89	0.00	0	G			116371761	116371761	+1	no_errors	ENST00000318493	ensembl	human	known	69_37n	missense	60	28.57	24	SNP	0.998	A
MFSD6	54842	genome.wustl.edu	37	2	191354510	191354510	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:191354510C>T	ENST00000392328.1	+	6	2133	c.1809C>T	c.(1807-1809)ttC>ttT	p.F603F	MFSD6_ENST00000535751.1_Silent_p.F65F|MFSD6_ENST00000281416.7_Silent_p.F603F	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	603					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						CTGCAACCTTCCGAGGAATTG	0.443																																						dbGAP											0													88.0	82.0	84.0					2																	191354510		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.1809C>T	2.37:g.191354510C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	pfam_MFS,pfam_MFS_enterobactin_exp_EntS,superfamily_MFS_dom_general_subst_transpt	p.P139S	ENST00000392328.1	37	c.415	CCDS2306.1	2	.	.	.	.	.	.	.	.	.	.	C	10.27	1.303843	0.23736	.	.	ENSG00000151690	ENST00000434582	.	.	.	5.65	3.81	0.43845	.	.	.	.	.	T	0.61664	0.2365	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58216	-0.7675	4	.	.	.	-29.2639	10.8055	0.46516	0.0:0.8439:0.0:0.1561	.	.	.	.	S	139	.	.	P	+	1	0	MFSD6	191062755	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.634000	0.61325	0.884000	0.36064	0.655000	0.94253	CCG	MFSD6	-	pfam_MFS,pfam_MFS_enterobactin_exp_EntS,superfamily_MFS_dom_general_subst_transpt	ENSG00000151690		0.443	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	HGNC	protein_coding	OTTHUMT00000255931.1	133	0.00	0	C			191354510	191354510	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000434582	ensembl	human	novel	69_37n	missense	93	35.42	51	SNP	1.000	T
MGA	23269	genome.wustl.edu	37	15	42041852	42041852	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:42041852C>T	ENST00000570161.1	+	16	6047	c.6047C>T	c.(6046-6048)aCc>aTc	p.T2016I	MGA_ENST00000566586.1_Missense_Mutation_p.T1807I|MGA_ENST00000545763.1_Missense_Mutation_p.T1807I|MGA_ENST00000219905.7_Missense_Mutation_p.T2016I|MGA_ENST00000389936.4_Missense_Mutation_p.T1977I			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GGAGCTGCTACCTCAGAAGAA	0.423																																						dbGAP											0													101.0	99.0	100.0					15																	42041852		1871	4108	5979	-	-	-	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.6047C>T	15.37:g.42041852C>T	ENSP00000457035:p.Thr2016Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.T2016I	ENST00000570161.1	37	c.6047	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	4.099	0.016391	0.07959	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.84370	-1.84;-1.84;-1.83	4.97	0.811	0.18739	.	2.027910	0.02166	N	0.059237	T	0.70037	0.3178	N	0.08118	0	0.09310	N	1	B;B;B;B	0.13145	0.0;0.0;0.007;0.007	B;B;B;B	0.14023	0.0;0.001;0.01;0.01	T	0.59107	-0.7516	10	0.66056	D	0.02	.	0.5822	0.00714	0.2509:0.3181:0.1229:0.3081	.	632;1807;2016;1977	B4DVS1;F5H7K2;E7ENI0;Q8IWI9	.;.;.;MGAP_HUMAN	I	2016;1977;1807	ENSP00000219905:T2016I;ENSP00000374586:T1977I;ENSP00000442467:T1807I	ENSP00000219905:T2016I	T	+	2	0	MGA	39829144	0.000000	0.05858	0.854000	0.33618	0.824000	0.46624	-0.117000	0.10708	-0.003000	0.14444	-0.253000	0.11424	ACC	MGA	-	NULL	ENSG00000174197		0.423	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	67	0.00	0	C	NM_001164273.1		42041852	42041852	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	missense	38	25.49	13	SNP	0.245	T
MGAT4B	11282	genome.wustl.edu	37	5	179225428	179225428	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:179225428G>A	ENST00000292591.7	-	13	1779	c.1429C>T	c.(1429-1431)Cag>Tag	p.Q477*	MIR1229_ENST00000408467.1_RNA|MGAT4B_ENST00000337755.5_Nonsense_Mutation_p.Q492*|MGAT4B_ENST00000521305.1_5'Flank	NM_014275.4	NP_055090.1	Q9UQ53	MGT4B_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B	477					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	13	all_cancers(89;0.000201)|all_epithelial(37;6.84e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0525)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTGTCTGACTGAGGGTTCTGG	0.662																																					GBM(13;414 434 4098 22176 23230)	dbGAP											0													37.0	37.0	37.0					5																	179225428		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			AB000624	CCDS4448.1, CCDS4449.1	5q35	2013-02-25	2005-11-16		ENSG00000161013	ENSG00000161013	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7048	protein-coding gene	gene with protein product		604561	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme B"""			10372966	Standard	NM_014275		Approved	GnT-Ivb	uc003mks.3	Q9UQ53	OTTHUMG00000130912	ENST00000292591.7:c.1429C>T	5.37:g.179225428G>A	ENSP00000292591:p.Gln477*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPR0|Q86TF1|Q96GH4|Q9NSK6	Nonsense_Mutation	SNP	pfam_Glyco_transf_54	p.Q492*	ENST00000292591.7	37	c.1474	CCDS4448.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.8|23.8	4.459505|4.459505	0.84317|0.84317	.|.	.|.	ENSG00000161013|ENSG00000161013	ENST00000337755;ENST00000292591;ENST00000519836|ENST00000518778;ENST00000520875	.|.	.|.	.|.	4.96|4.96	4.02|4.02	0.46733|0.46733	.|.	0.000000|.	0.64402|.	D|.	0.000003|.	.|T	.|0.62060	.|0.2397	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.69518	.|-0.5124	.|3	0.07175|.	T|.	0.84|.	-14.3067|-14.3067	12.7559|12.7559	0.57335|0.57335	0.0:0.1651:0.8349:0.0|0.0:0.1651:0.8349:0.0	.|.	.|.	.|.	.|.	X|L	492;477;345|301;257	.|.	ENSP00000292591:Q477X|.	Q|S	-|-	1|2	0|0	MGAT4B|MGAT4B	179158034|179158034	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.798000|0.798000	0.45092|0.45092	3.920000|3.920000	0.56446|0.56446	2.306000|2.306000	0.77630|0.77630	0.462000|0.462000	0.41574|0.41574	CAG|TCA	MGAT4B	-	NULL	ENSG00000161013		0.662	MGAT4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4B	HGNC	protein_coding	OTTHUMT00000253503.3	18	0.00	0	G	NM_014275		179225428	179225428	-1	no_errors	ENST00000337755	ensembl	human	known	69_37n	nonsense	8	50.00	8	SNP	1.000	A
MICALCL	84953	genome.wustl.edu	37	11	12315771	12315771	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:12315771C>T	ENST00000256186.2	+	3	1084	c.793C>T	c.(793-795)Cca>Tca	p.P265S		NM_032867.2	NP_116256.2	Q6ZW33	MICLK_HUMAN	MICAL C-terminal like	265					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)	mitogen-activated protein kinase binding (GO:0051019)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(5)|lung(5)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	30				Epithelial(150;0.00177)		AAACGTGCCTCCACCCAAGTC	0.632																																						dbGAP											0													35.0	38.0	37.0					11																	12315771		1936	4136	6072	-	-	-	SO:0001583	missense	0			BK000463	CCDS41620.1	11p15.3	2005-11-01			ENSG00000133808	ENSG00000133808			25933	protein-coding gene	gene with protein product		612355				12110185	Standard	NM_032867		Approved	FLJ14966	uc001mkg.1	Q6ZW33	OTTHUMG00000165777	ENST00000256186.2:c.793C>T	11.37:g.12315771C>T	ENSP00000256186:p.Pro265Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7RTP7|Q96JU6	Missense_Mutation	SNP	pfam_DUF3585,smart_Fertility_inhib_FinO/ProQ	p.P265S	ENST00000256186.2	37	c.793	CCDS41620.1	11	.	.	.	.	.	.	.	.	.	.	C	10.89	1.478441	0.26511	.	.	ENSG00000133808	ENST00000256186	T	0.34472	1.36	5.03	1.9	0.25705	.	0.359123	0.20750	N	0.086368	T	0.45034	0.1322	M	0.62723	1.935	0.09310	N	1	D	0.76494	0.999	D	0.64144	0.922	T	0.19745	-1.0296	10	0.30078	T	0.28	.	3.8908	0.09117	0.2017:0.5971:0.0:0.2012	.	265	Q6ZW33	MICLK_HUMAN	S	265	ENSP00000256186:P265S	ENSP00000256186:P265S	P	+	1	0	MICALCL	12272347	0.001000	0.12720	0.170000	0.22879	0.057000	0.15508	1.312000	0.33574	0.709000	0.31976	0.557000	0.71058	CCA	MICALCL	-	NULL	ENSG00000133808		0.632	MICALCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALCL	HGNC	protein_coding	OTTHUMT00000386164.1	19	0.00	0	C	NM_032867		12315771	12315771	+1	no_errors	ENST00000256186	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	0.054	T
MID1	4281	genome.wustl.edu	37	X	10442697	10442697	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:10442697C>T	ENST00000317552.4	-	6	1507	c.1107G>A	c.(1105-1107)gaG>gaA	p.E369E	MID1_ENST00000380787.1_Silent_p.E369E|MID1_ENST00000380785.1_Silent_p.E369E|MID1_ENST00000380780.1_Silent_p.E369E|MID1_ENST00000380779.1_Silent_p.E369E|MID1_ENST00000453318.2_Silent_p.E369E|MID1_ENST00000380782.2_Silent_p.E369E	NM_000381.3|NM_033289.1	NP_000372.1|NP_150631.1	O15344	TRI18_HUMAN	midline 1	369	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				microtubule cytoskeleton organization (GO:0000226)|negative regulation of microtubule depolymerization (GO:0007026)|pattern specification process (GO:0007389)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein localization to microtubule (GO:0035372)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	ligase activity (GO:0016874)|microtubule binding (GO:0008017)|phosphoprotein binding (GO:0051219)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	26						GCAGTTTCTTCTCTCGGGAAA	0.388																																						dbGAP											0													127.0	118.0	121.0					X																	10442697		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y13667	CCDS14138.1, CCDS75952.1, CCDS75953.1	Xp22	2014-06-18	2014-06-18		ENSG00000101871	ENSG00000101871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	7095	protein-coding gene	gene with protein product	"""Opitz/BBB syndrome"""	300552				9354791, 9425238	Standard	NM_001098624		Approved	OS, FXY, TRIM18, RNF59	uc004cti.4	O15344	OTTHUMG00000021127	ENST00000317552.4:c.1107G>A	X.37:g.10442697C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG2|O75361|Q9BZX5	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.E369	ENST00000317552.4	37	c.1107	CCDS14138.1	X																																																																																			MID1	-	superfamily_Fibronectin_type3	ENSG00000101871		0.388	MID1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MID1	HGNC	protein_coding	OTTHUMT00000055738.1	140	0.71	1	C			10442697	10442697	-1	no_errors	ENST00000317552	ensembl	human	known	69_37n	silent	99	30.77	44	SNP	1.000	T
JMJD1C	221037	genome.wustl.edu	37	10	65132739	65132739	+	Intron	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:65132739G>A	ENST00000399262.2	-	2	552				MIR1296_ENST00000408136.1_RNA|JMJD1C_ENST00000399251.1_Intron	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C						blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GGTTAGGGTCGAAGCCCCACT	0.512																																						dbGAP											0													35.0	37.0	37.0					10																	65132739		1558	3562	5120	-	-	-	SO:0001627	intron_variant	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.333+7338C>T	10.37:g.65132739G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	RNA	SNP	-	NULL	ENST00000399262.2	37	NULL	CCDS41532.1	10																																																																																			MIR1296	-	-	ENSG00000221063		0.512	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIR1296	HGNC	protein_coding	OTTHUMT00000048249.2	64	0.00	0	G	NM_004241		65132739	65132739	-1	no_errors	ENST00000408136	ensembl	human	known	69_37n	rna	18	25.00	6	SNP	0.231	A
MKI67	4288	genome.wustl.edu	37	10	129901071	129901071	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:129901071C>T	ENST00000368654.3	-	13	9408	c.9033G>A	c.(9031-9033)agG>agA	p.R3011R	MKI67_ENST00000368653.3_Silent_p.R2651R	NM_002417.4	NP_002408.3	P46013	KI67_HUMAN	marker of proliferation Ki-67	3011					cell proliferation (GO:0008283)|cellular response to heat (GO:0034605)|DNA metabolic process (GO:0006259)|hyaluronan metabolic process (GO:0030212)|meiotic nuclear division (GO:0007126)|organ regeneration (GO:0031100)|response to organic cyclic compound (GO:0014070)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(5)|kidney(7)|large_intestine(30)|lung(64)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|soft_tissue(1)|stomach(10)|upper_aerodigestive_tract(4)|urinary_tract(4)	159		all_epithelial(44;2.12e-05)|all_lung(145;0.00679)|Lung NSC(174;0.00998)|all_neural(114;0.0936)|Colorectal(57;0.14)|Breast(234;0.166)|Melanoma(40;0.203)				TGCAGCGCAGCCTCTTGGTTC	0.572																																						dbGAP											0													80.0	75.0	77.0					10																	129901071		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X65550	CCDS7659.1, CCDS53588.1	10q26.2	2014-06-12	2013-10-10		ENSG00000148773	ENSG00000148773			7107	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 105"""	176741	"""antigen identified by monoclonal antibody Ki-67"""			2571566, 16206250	Standard	NM_002417		Approved	MIB-, PPP1R105	uc001lke.3	P46013	OTTHUMG00000019255	ENST00000368654.3:c.9033G>A	10.37:g.129901071C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWH2	Silent	SNP	pfam_K167R,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.R3011	ENST00000368654.3	37	c.9033	CCDS7659.1	10																																																																																			MKI67	-	NULL	ENSG00000148773		0.572	MKI67-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MKI67	HGNC	protein_coding	OTTHUMT00000050999.1	57	0.00	0	C	NM_002417		129901071	129901071	-1	no_errors	ENST00000368654	ensembl	human	known	69_37n	silent	51	43.33	39	SNP	0.000	T
KMT2C	58508	genome.wustl.edu	37	7	152027786	152027786	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:152027786C>G	ENST00000262189.6	-	3	507	c.289G>C	c.(289-291)Gaa>Caa	p.E97Q	KMT2C_ENST00000355193.2_Missense_Mutation_p.E97Q	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	97					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTATCCACTTCTGCTTCAGCA	0.403																																						dbGAP											0													203.0	182.0	189.0					7																	152027786		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.289G>C	7.37:g.152027786C>G	ENSP00000262189:p.Glu97Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E97Q	ENST00000262189.6	37	c.289	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	17.46	3.396407	0.62177	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000452749	D;D	0.84589	-1.87;-1.87	5.5	4.61	0.57282	.	0.316608	0.22258	N	0.062444	T	0.81269	0.4787	L	0.29908	0.895	0.80722	D	1	P	0.45044	0.849	P	0.45377	0.478	T	0.82242	-0.0554	10	0.56958	D	0.05	.	14.1554	0.65415	0.0:0.9274:0.0:0.0726	.	97	Q8NEZ4	MLL3_HUMAN	Q	97;97;98	ENSP00000262189:E97Q;ENSP00000347325:E97Q	ENSP00000262189:E97Q	E	-	1	0	MLL3	151658719	0.998000	0.40836	0.642000	0.29436	0.904000	0.53231	4.973000	0.63763	1.314000	0.45095	0.650000	0.86243	GAA	MLL3	-	NULL	ENSG00000055609		0.403	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	169	0.00	0	C			152027786	152027786	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	missense	128	35.03	69	SNP	0.966	G
MOS	4342	genome.wustl.edu	37	8	57026109	57026109	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:57026109C>G	ENST00000311923.1	-	1	432	c.433G>C	c.(433-435)Gtc>Ctc	p.V145L		NM_005372.1	NP_005363.1	P00540	MOS_HUMAN	v-mos Moloney murine sarcoma viral oncogene homolog	145	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|chromatin organization (GO:0006325)|establishment of meiotic spindle orientation (GO:0051296)|MAPK cascade (GO:0000165)|meiotic spindle organization (GO:0000212)|negative regulation of metaphase/anaphase transition of meiotic cell cycle (GO:1902103)|protein autophosphorylation (GO:0046777)|regulation of meiosis (GO:0040020)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|large_intestine(5)|lung(12)|ovary(1)|urinary_tract(2)	22			Epithelial(17;0.00117)|all cancers(17;0.00879)			TGTAAAGTGACGTTGCCACCG	0.622																																					Esophageal Squamous(124;373 2870 4778)	dbGAP											0													91.0	85.0	87.0					8																	57026109		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6164.1	8q11	2012-10-02			ENSG00000172680	ENSG00000172680			7199	protein-coding gene	gene with protein product		190060				9552420	Standard	NM_005372		Approved		uc011leb.2	P00540	OTTHUMG00000164299	ENST00000311923.1:c.433G>C	8.37:g.57026109C>G	ENSP00000310722:p.Val145Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KPG9|Q3KPH0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V145L	ENST00000311923.1	37	c.433	CCDS6164.1	8	.	.	.	.	.	.	.	.	.	.	C	10.33	1.319234	0.23994	.	.	ENSG00000172680	ENST00000311923	D	0.93189	-3.18	5.69	0.0482	0.14284	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.434110	0.04291	N	0.345440	D	0.86477	0.5942	N	0.12663	0.25	0.09310	N	1	B	0.20671	0.047	B	0.25614	0.062	T	0.75230	-0.3391	10	0.46703	T	0.11	.	6.8763	0.24149	0.0:0.3773:0.1217:0.501	.	145	P00540	MOS_HUMAN	L	145	ENSP00000310722:V145L	ENSP00000310722:V145L	V	-	1	0	MOS	57188663	0.000000	0.05858	0.023000	0.16930	0.936000	0.57629	-0.479000	0.06567	-0.200000	0.10300	0.557000	0.71058	GTC	MOS	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000172680		0.622	MOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOS	HGNC	protein_coding	OTTHUMT00000378174.1	25	0.00	0	C	NM_005372		57026109	57026109	-1	no_errors	ENST00000311923	ensembl	human	known	69_37n	missense	15	40.00	10	SNP	0.000	G
MRPL11	65003	genome.wustl.edu	37	11	66203553	66203553	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:66203553C>T	ENST00000310999.7	-	5	597	c.504G>A	c.(502-504)caG>caA	p.Q168Q	MRPL11_ENST00000329819.4_3'UTR|MRPL11_ENST00000430466.2_Silent_p.Q142Q|MRPL11_ENST00000524576.1_5'UTR	NM_016050.3	NP_057134.1	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11	168					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|prostate(1)	7						CTCGTTCCTTCTGGAAAGCTG	0.527																																						dbGAP											0													53.0	47.0	49.0					11																	66203553		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AB051338	CCDS8139.1, CCDS8140.1, CCDS44655.1	11q13.2	2012-11-14			ENSG00000174547	ENSG00000174547		"""Mitochondrial ribosomal proteins / large subunits"""	14042	protein-coding gene	gene with protein product		611826					Standard	XR_247672		Approved		uc001ohz.4	Q9Y3B7	OTTHUMG00000167097	ENST00000310999.7:c.504G>A	11.37:g.66203553C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLT0|A8K219|Q32P46|Q96Q73	Silent	SNP	pfam_Ribosomal_L11_N,pfam_Ribosomal_L11_C,superfamily_Ribosomal_L11_N,superfamily_Ribosomal_L11_C,smart_Ribosomal_L11,tigrfam_Ribosomal_L11_bac-typ	p.Q168	ENST00000310999.7	37	c.504	CCDS8139.1	11																																																																																			MRPL11	-	NULL	ENSG00000174547		0.527	MRPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL11	HGNC	protein_coding	OTTHUMT00000393098.2	61	0.00	0	C	NM_016050		66203553	66203553	-1	no_errors	ENST00000310999	ensembl	human	known	69_37n	silent	38	28.30	15	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9057612	9057612	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:9057612G>A	ENST00000397910.4	-	3	30037	c.29834C>T	c.(29833-29835)tCa>tTa	p.S9945L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	9947	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CATCATGGATGAGGAAGAGAG	0.463																																						dbGAP											0													255.0	247.0	250.0					19																	9057612		1982	4169	6151	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.29834C>T	19.37:g.9057612G>A	ENSP00000381008:p.Ser9945Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S9945L	ENST00000397910.4	37	c.29834	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	8.539	0.872858	0.17322	.	.	ENSG00000181143	ENST00000397910	T	0.02656	4.21	2.38	2.38	0.29361	.	.	.	.	.	T	0.04048	0.0113	L	0.29908	0.895	.	.	.	P	0.44344	0.833	P	0.47744	0.556	T	0.25328	-1.0135	8	0.87932	D	0	.	8.3522	0.32310	0.0:0.0:1.0:0.0	.	9945	B5ME49	.	L	9945	ENSP00000381008:S9945L	ENSP00000381008:S9945L	S	-	2	0	MUC16	8918612	0.000000	0.05858	0.001000	0.08648	0.087000	0.18053	0.555000	0.23422	1.639000	0.50556	0.460000	0.39030	TCA	MUC16	-	NULL	ENSG00000181143		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	88	0.00	0	G	NM_024690		9057612	9057612	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	94	22.31	27	SNP	0.001	A
MUM1	84939	genome.wustl.edu	37	19	1367172	1367172	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:1367172C>T	ENST00000415183.3	+	8	1404	c.1378C>T	c.(1378-1380)Ctt>Ttt	p.L460F	MUM1_ENST00000591806.1_Missense_Mutation_p.L460F|MUM1_ENST00000344663.3_Missense_Mutation_p.L460F|MUM1_ENST00000311401.5_Missense_Mutation_p.L391F			Q2TAK8	MUM1_HUMAN	melanoma associated antigen (mutated) 1	459	PWWP.				chromatin organization (GO:0006325)|DNA repair (GO:0006281)	nucleus (GO:0005634)	nucleosome binding (GO:0031491)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(4)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CACAGTGTCTCTTAAAAGTTT	0.358																																						dbGAP											0													154.0	157.0	156.0					19																	1367172		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075241	CCDS12062.1	19p13.3	2008-02-05				ENSG00000160953			29641	protein-coding gene	gene with protein product						11042152, 7644523	Standard	NM_032853		Approved	MUM-1	uc002lrz.2	Q2TAK8		ENST00000415183.3:c.1378C>T	19.37:g.1367172C>T	ENSP00000394925:p.Leu460Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L489|B5ME02|B7ZLY8|J3KQD6|Q13109|Q5XKB9|Q8N2I4|Q96A67	Missense_Mutation	SNP	pfam_PWWP	p.L460F	ENST00000415183.3	37	c.1378		19	.	.	.	.	.	.	.	.	.	.	C	15.53	2.860583	0.51482	.	.	ENSG00000160953	ENST00000344663;ENST00000311401;ENST00000415183	T;T;T	0.70631	-0.5;-0.5;-0.5	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	T	0.77955	0.4208	L	0.40543	1.245	0.48632	D	0.999682	D;D;D;D	0.89917	1.0;1.0;1.0;0.985	D;D;D;P	0.91635	0.999;0.999;0.999;0.734	T	0.74150	-0.3758	10	0.27082	T	0.32	.	16.4232	0.83773	0.0:1.0:0.0:0.0	.	460;460;391;459	B7ZLY8;D6W5Y8;Q2TAK8-2;Q2TAK8	.;.;.;MUM1_HUMAN	F	460;391;460	ENSP00000345789:L460F;ENSP00000309135:L391F;ENSP00000394925:L460F	ENSP00000309135:L391F	L	+	1	0	MUM1	1318172	0.996000	0.38824	0.057000	0.19452	0.009000	0.06853	4.092000	0.57707	2.536000	0.85505	0.655000	0.94253	CTT	MUM1	-	NULL	ENSG00000160953		0.358	MUM1-016	NOVEL	basic|exp_conf	protein_coding	MUM1	HGNC	protein_coding	OTTHUMT00000449510.1	208	0.00	0	C	NM_032853		1367172	1367172	+1	no_errors	ENST00000344663	ensembl	human	known	69_37n	missense	187	32.25	89	SNP	0.925	T
MUC16	94025	genome.wustl.edu	37	19	9087590	9087590	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:9087590C>G	ENST00000397910.4	-	1	4428	c.4225G>C	c.(4225-4227)Gag>Cag	p.E1409Q		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1409	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GACTGTGTCTCAAATCCAGAT	0.473																																						dbGAP											0													143.0	139.0	141.0					19																	9087590		2074	4213	6287	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.4225G>C	19.37:g.9087590C>G	ENSP00000381008:p.Glu1409Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.E1409Q	ENST00000397910.4	37	c.4225	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	2.203	-0.382451	0.04966	.	.	ENSG00000181143	ENST00000397910	T	0.02737	4.18	1.19	-1.85	0.07784	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	.	.	.	P	0.50710	0.938	B	0.40506	0.331	T	0.47749	-0.9093	8	0.87932	D	0	.	5.2397	0.15465	0.5918:0.4082:0.0:0.0	.	1409	B5ME49	.	Q	1409	ENSP00000381008:E1409Q	ENSP00000381008:E1409Q	E	-	1	0	MUC16	8948590	0.000000	0.05858	0.000000	0.03702	0.093000	0.18481	-0.037000	0.12164	-0.437000	0.07243	0.305000	0.20034	GAG	MUC16	-	NULL	ENSG00000181143		0.473	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	125	0.00	0	C	NM_024690		9087590	9087590	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	117	25.00	39	SNP	0.000	G
MUT	4594	genome.wustl.edu	37	6	49399509	49399509	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:49399509G>A	ENST00000274813.3	-	13	2312	c.2185C>T	c.(2185-2187)Cca>Tca	p.P729S		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	729	B12-binding. {ECO:0000255|PROSITE- ProRule:PRU00666}.				cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GCAGCCTTTGGAATTCGAGTC	0.348																																						dbGAP											0													156.0	163.0	160.0					6																	49399509		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.2185C>T	6.37:g.49399509G>A	ENSP00000274813:p.Pro729Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	pfam_MeMalonylCoA_mutase_a/b_cat,pfam_Cobalamin-bd,superfamily_Cbl-dep_enz_cat,superfamily_Cobalamin-bd,tigrfam_MMCoA_mutase_a_cat,tigrfam_Acid_CoA_mut_C	p.P729S	ENST00000274813.3	37	c.2185	CCDS4924.1	6	.	.	.	.	.	.	.	.	.	.	G	21.2	4.118863	0.77323	.	.	ENSG00000146085	ENST00000274813;ENST00000540138	D	0.94723	-3.5	5.55	5.55	0.83447	Cobalamin (vitamin B12)-binding (3);Methylmalonyl-CoA mutase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92097	0.7495	L	0.38692	1.165	0.80722	D	1	P	0.37708	0.606	P	0.46299	0.511	D	0.92037	0.5638	10	0.44086	T	0.13	-16.3406	18.4826	0.90818	0.0:0.0:1.0:0.0	.	729	P22033	MUTA_HUMAN	S	729;176	ENSP00000274813:P729S	ENSP00000274813:P729S	P	-	1	0	MUT	49507468	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.141000	0.77330	2.597000	0.87782	0.655000	0.94253	CCA	MUT	-	superfamily_Cobalamin-bd,tigrfam_Acid_CoA_mut_C	ENSG00000146085		0.348	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUT	HGNC	protein_coding	OTTHUMT00000040854.1	83	0.00	0	G			49399509	49399509	-1	no_errors	ENST00000274813	ensembl	human	known	69_37n	missense	40	27.27	15	SNP	1.000	A
MYEF2	50804	genome.wustl.edu	37	15	48443700	48443700	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:48443700G>A	ENST00000324324.7	-	13	1555	c.1276C>T	c.(1276-1278)Caa>Taa	p.Q426*	MYEF2_ENST00000267836.6_Nonsense_Mutation_p.Q426*	NM_016132.3	NP_057216	Q9P2K5	MYEF2_HUMAN	myelin expression factor 2	426	Gly-rich.		Q -> R (in dbSNP:rs2470103). {ECO:0000269|PubMed:10718198, ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334, ECO:0000269|Ref.5}.		myotube differentiation (GO:0014902)|neuron differentiation (GO:0030182)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(1)|large_intestine(8)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		all_lung(180;0.00217)		all cancers(107;3.73e-10)|GBM - Glioblastoma multiforme(94;7.81e-07)		CCAAAGCCTTGATTTATTCCA	0.388																																						dbGAP											0													242.0	253.0	249.0					15																	48443700		2198	4297	6495	-	-	-	SO:0001587	stop_gained	0			AB037762	CCDS32230.1, CCDS73722.1	15q15.1	2013-07-16				ENSG00000104177		"""RNA binding motif (RRM) containing"""	17940	protein-coding gene	gene with protein product						10718198, 2601707	Standard	XM_005254422		Approved	MEF-2, FLJ11213, KIAA1341, HsT18564	uc001zwi.4	Q9P2K5		ENST00000324324.7:c.1276C>T	15.37:g.48443700G>A	ENSP00000316950:p.Gln426*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MCZ9|C9J921|C9K0J4|Q6NUM5|Q7L388|Q7Z4B7|Q9H922|Q9NUQ1	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q426*	ENST00000324324.7	37	c.1276	CCDS32230.1	15	.	.	.	.	.	.	.	.	.	.	G	39	7.841322	0.98519	.	.	ENSG00000104177	ENST00000324324;ENST00000267836;ENST00000454655	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-4.3785	20.0762	0.97745	0.0:0.0:1.0:0.0	.	.	.	.	X	426;426;38	.	ENSP00000267836:Q426X	Q	-	1	0	MYEF2	46230992	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.880000	0.75578	2.756000	0.94617	0.655000	0.94253	CAA	MYEF2	-	NULL	ENSG00000104177		0.388	MYEF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYEF2	HGNC	protein_coding	OTTHUMT00000416909.2	127	0.00	0	G	NM_016132		48443700	48443700	-1	no_errors	ENST00000324324	ensembl	human	known	69_37n	nonsense	112	24.32	36	SNP	1.000	A
MYH6	4624	genome.wustl.edu	37	14	23858138	23858138	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:23858138C>T	ENST00000356287.3	-	28	4134	c.4105G>A	c.(4105-4107)Gag>Aag	p.E1369K	MIR208A_ENST00000362287.1_RNA|MYH6_ENST00000405093.3_Missense_Mutation_p.E1369K			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	1369					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TGGGCCACCTCCGAGTTGGCC	0.632																																						dbGAP											0													79.0	73.0	75.0					14																	23858138		2203	4300	6503	-	-	-	SO:0001583	missense	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.4105G>A	14.37:g.23858138C>T	ENSP00000348634:p.Glu1369Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1369K	ENST00000356287.3	37	c.4105	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	N	36	5.602900	0.96614	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	T;T	0.80480	-1.38;-1.38	4.74	4.74	0.60224	Myosin tail (1);	.	.	.	.	D	0.93393	0.7893	H	0.96970	3.915	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	D	0.95737	0.8780	9	0.87932	D	0	.	18.113	0.89541	0.0:1.0:0.0:0.0	.	1369	P13533	MYH6_HUMAN	K	1369	ENSP00000386041:E1369K;ENSP00000348634:E1369K	ENSP00000348634:E1369K	E	-	1	0	MYH6	22927978	1.000000	0.71417	0.972000	0.41901	0.968000	0.65278	7.568000	0.82369	2.336000	0.79503	0.650000	0.86243	GAG	MYH6	-	pfam_Myosin_tail	ENSG00000197616		0.632	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	36	0.00	0	C			23858138	23858138	-1	no_errors	ENST00000356287	ensembl	human	known	69_37n	missense	47	41.25	33	SNP	1.000	T
MYH6	4624	genome.wustl.edu	37	14	23867983	23867983	+	Silent	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:23867983G>C	ENST00000356287.3	-	14	1874	c.1845C>G	c.(1843-1845)ctC>ctG	p.L615L	MYH6_ENST00000405093.3_Silent_p.L615L			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	615	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CCATGAGCTTGAGGGAGGACT	0.567																																						dbGAP											0													173.0	151.0	158.0					14																	23867983		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1845C>G	14.37:g.23867983G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L615	ENST00000356287.3	37	c.1845	CCDS9600.1	14																																																																																			MYH6	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000197616		0.567	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	102	0.00	0	G			23867983	23867983	-1	no_errors	ENST00000356287	ensembl	human	known	69_37n	silent	105	31.37	48	SNP	1.000	C
MYH9	4627	genome.wustl.edu	37	22	36708234	36708234	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:36708234C>T	ENST00000216181.5	-	14	1818	c.1588G>A	c.(1588-1590)Gag>Aag	p.E530K		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	530	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)	p.E530K(1)		NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CAGCACTCCTCGTCCAGCAGG	0.637			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																													dbGAP		Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	1	Substitution - Missense(1)	prostate(1)											81.0	70.0	73.0					22																	36708234		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.1588G>A	22.37:g.36708234C>T	ENSP00000216181:p.Glu530Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS	p.E530K	ENST00000216181.5	37	c.1588	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.433500	0.96150	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	T	0.80653	-1.4	4.57	4.57	0.56435	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93930	0.8057	H	0.98559	4.265	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.96569	0.9421	10	0.87932	D	0	.	17.3444	0.87306	0.0:1.0:0.0:0.0	.	530	P35579	MYH9_HUMAN	K	394;530	ENSP00000216181:E530K	ENSP00000216181:E530K	E	-	1	0	MYH9	35038180	1.000000	0.71417	0.995000	0.50966	0.939000	0.58152	7.818000	0.86416	2.258000	0.74832	0.561000	0.74099	GAG	MYH9	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000100345		0.637	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	56	0.00	0	C	NM_002473		36708234	36708234	-1	no_errors	ENST00000216181	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	1.000	T
NBPF10	100132406	genome.wustl.edu	37	1	145368577	145368577	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:145368577G>T	ENST00000369339.3	+	17	2162	c.1909G>T	c.(1909-1911)Gag>Tag	p.E637*	NBPF10_ENST00000342960.5_Nonsense_Mutation_p.E3519*|NBPF10_ENST00000369338.1_Nonsense_Mutation_p.E635*			Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	814	NBPF 4. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TTACTCATTTGAGGAACAGCA	0.443																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000369339.3:c.1909G>T	1.37:g.145368577G>T	ENSP00000358345:p.Glu637*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5RHC0|Q9NWN6	Nonsense_Mutation	SNP	pfam_NBPF_dom	p.E3519*	ENST00000369339.3	37	c.10555		1	.	.	.	.	.	.	.	.	.	.	.	15.82	2.946727	0.53186	.	.	ENSG00000163386	ENST00000369339;ENST00000369338;ENST00000342960	.	.	.	0.732	0.732	0.18283	.	.	.	.	.	.	.	.	.	.	.	0.46749	D	0.999184	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	4.8119	0.13347	0.0:0.0:1.0:0.0	.	.	.	.	X	639;635;3519	.	ENSP00000345684:E3519X	E	+	1	0	NBPF10	144079934	0.076000	0.21285	0.007000	0.13788	0.036000	0.12997	1.133000	0.31430	0.689000	0.31550	0.384000	0.25694	GAG	NBPF10	-	pfam_NBPF_dom	ENSG00000163386		0.443	NBPF10-001	KNOWN	not_best_in_genome_evidence|basic	protein_coding	NBPF10	HGNC	protein_coding	OTTHUMT00000038550.3	385	0.00	0	G	NM_001039703		145368577	145368577	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	nonsense	1144	13.26	175	SNP	0.007	T
MYOC	4653	genome.wustl.edu	37	1	171621262	171621262	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:171621262C>T	ENST00000037502.6	-	1	561	c.490G>A	c.(490-492)Gag>Aag	p.E164K		NM_000261.1	NP_000252.1	Q99972	MYOC_HUMAN	myocilin, trabecular meshwork inducible glucocorticoid response	164					bone development (GO:0060348)|clustering of voltage-gated sodium channels (GO:0045162)|ERBB2-ERBB3 signaling pathway (GO:0038133)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neuron projection development (GO:0031175)|non-canonical Wnt signaling pathway via JNK cascade (GO:0038031)|osteoblast differentiation (GO:0001649)|positive regulation of cell migration (GO:0030335)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of mitochondrial depolarization (GO:0051901)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of MAPK cascade (GO:0043408)|skeletal muscle hypertrophy (GO:0014734)	cilium (GO:0005929)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|node of Ranvier (GO:0033268)|proteinaceous extracellular matrix (GO:0005578)	fibronectin binding (GO:0001968)|frizzled binding (GO:0005109)|myosin light chain binding (GO:0032027)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(2)|prostate(1)|urinary_tract(2)	28	all_cancers(6;5.47e-10)|all_hematologic(923;0.088)|Acute lymphoblastic leukemia(37;0.181)					GCCAGATTCTCATTTTCTTGC	0.567																																						dbGAP											0													201.0	217.0	212.0					1																	171621262		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029261	CCDS1297.1	1q23-q24	2008-02-05			ENSG00000034971	ENSG00000034971			7610	protein-coding gene	gene with protein product		601652		GLC1A		9169133, 9005853	Standard	NM_000261		Approved	TIGR, JOAG1	uc001ghu.3	Q99972	OTTHUMG00000034789	ENST00000037502.6:c.490G>A	1.37:g.171621262C>T	ENSP00000037502:p.Glu164Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD84|O00620|Q7Z6Q9	Missense_Mutation	SNP	pfam_Olfac-like,smart_Olfac-like,pfscan_Olfac-like	p.E164K	ENST00000037502.6	37	c.490	CCDS1297.1	1	.	.	.	.	.	.	.	.	.	.	C	11.12	1.544280	0.27563	.	.	ENSG00000034971	ENST00000037502;ENST00000357746;ENST00000536591;ENST00000537133	D	0.83335	-1.71	5.6	-0.0313	0.13910	.	0.451961	0.25106	N	0.033082	T	0.45796	0.1360	L	0.42245	1.32	0.09310	N	1	B;B	0.09022	0.001;0.002	B;B	0.08055	0.002;0.003	T	0.28235	-1.0050	10	0.09338	T	0.73	.	2.1345	0.03758	0.1371:0.4848:0.1338:0.2443	.	106;164	B4DV44;Q99972	.;MYOC_HUMAN	K	164;117;97;164	ENSP00000037502:E164K	ENSP00000037502:E164K	E	-	1	0	MYOC	169887885	0.000000	0.05858	0.726000	0.30738	0.866000	0.49608	0.191000	0.17076	0.260000	0.21731	0.655000	0.94253	GAG	MYOC	-	NULL	ENSG00000034971		0.567	MYOC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOC	HGNC	protein_coding	OTTHUMT00000084178.2	76	0.00	0	C	NM_000261		171621262	171621262	-1	no_errors	ENST00000037502	ensembl	human	known	69_37n	missense	118	34.08	61	SNP	0.013	T
NCAPD3	23310	genome.wustl.edu	37	11	134029897	134029897	+	Missense_Mutation	SNP	C	C	G	rs201766156		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:134029897C>G	ENST00000534548.2	-	29	3821	c.3757G>C	c.(3757-3759)Gag>Cag	p.E1253Q		NM_015261.2	NP_056076.1	P42695	CNDD3_HUMAN	non-SMC condensin II complex, subunit D3	1253					mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	germinal vesicle (GO:0042585)|membrane (GO:0016020)|nuclear condensin complex (GO:0000799)|nuclear pericentric heterochromatin (GO:0031618)|nucleoplasm (GO:0005654)	methylated histone binding (GO:0035064)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(9)|liver(1)|lung(28)|ovary(3)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71	all_hematologic(175;0.127)	all_cancers(12;1.68e-21)|all_epithelial(12;5.86e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;8.74e-10)|BRCA - Breast invasive adenocarcinoma(10;1e-08)|all cancers(11;1.46e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00345)|Lung(977;0.227)		ATGTCATACTCAAGCTCTGAT	0.532													C|||	1	0.000199681	0.0	0.0	5008	,	,		20441	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													139.0	120.0	127.0					11																	134029897		2201	4297	6498	-	-	-	SO:0001583	missense	0			AK124878	CCDS31723.1	11q25	2008-02-04			ENSG00000151503	ENSG00000151503			28952	protein-coding gene	gene with protein product		609276				7584044, 8619474, 14532007	Standard	NM_015261		Approved	hCAP-D3, CAP-D3, hHCP-6, KIAA0056, FLJ42888, hcp-6	uc001qhd.1	P42695	OTTHUMG00000167172	ENST00000534548.2:c.3757G>C	11.37:g.134029897C>G	ENSP00000433681:p.Glu1253Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS2|Q4KMQ9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pirsf_Condns_HCP-6	p.E1253Q	ENST00000534548.2	37	c.3757	CCDS31723.1	11	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	24.6	4.545928	0.86022	.	.	ENSG00000151503	ENST00000534548;ENST00000527944	T	0.31510	1.49	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.51787	0.1695	M	0.68952	2.095	0.80722	D	1	D;D	0.61080	0.985;0.989	P;P	0.58780	0.845;0.8	T	0.51068	-0.8752	10	0.54805	T	0.06	-34.0247	19.4536	0.94878	0.0:1.0:0.0:0.0	.	1253;313	P42695;Q96FA6	CNDD3_HUMAN;.	Q	1253;158	ENSP00000433681:E1253Q	ENSP00000432532:E158Q	E	-	1	0	NCAPD3	133535107	1.000000	0.71417	0.989000	0.46669	0.625000	0.37756	7.776000	0.85560	2.648000	0.89879	0.655000	0.94253	GAG	NCAPD3	-	pirsf_Condns_HCP-6	ENSG00000151503		0.532	NCAPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAPD3	HGNC	protein_coding	OTTHUMT00000393575.2	84	0.00	0	C	NM_015261		134029897	134029897	-1	no_errors	ENST00000534548	ensembl	human	known	69_37n	missense	51	43.33	39	SNP	1.000	G
NCOR1	9611	genome.wustl.edu	37	17	16062146	16062146	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:16062146C>T	ENST00000268712.3	-	6	917	c.660G>A	c.(658-660)gaG>gaA	p.E220E	NCOR1_ENST00000395848.1_Silent_p.E111E|NCOR1_ENST00000395851.1_Silent_p.E220E	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	220	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ACACGGGCTTCTCAGGCTCAG	0.493																																						dbGAP											0													88.0	78.0	81.0					17																	16062146		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.660G>A	17.37:g.16062146C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Silent	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E220	ENST00000268712.3	37	c.660	CCDS11175.1	17																																																																																			NCOR1	-	NULL	ENSG00000141027		0.493	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	58	0.00	0	C	NM_006311		16062146	16062146	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	silent	26	51.85	28	SNP	1.000	T
NDST3	9348	genome.wustl.edu	37	4	118975584	118975584	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:118975584G>C	ENST00000296499.5	+	2	922	c.519G>C	c.(517-519)caG>caC	p.Q173H	NDST3_ENST00000433996.2_Missense_Mutation_p.Q173H	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	173	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						AGAGTGTACAGAGCTTTCAGT	0.358																																						dbGAP											0													68.0	67.0	67.0					4																	118975584		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.519G>C	4.37:g.118975584G>C	ENSP00000296499:p.Gln173His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.Q173H	ENST00000296499.5	37	c.519	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	G	12.79	2.043860	0.36085	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.42900	1.27;0.96	5.3	5.3	0.74995	.	0.181624	0.49916	D	0.000124	T	0.45216	0.1331	L	0.27053	0.805	0.36560	D	0.872344	P;B;D	0.71674	0.938;0.034;0.998	P;B;D	0.80764	0.579;0.043;0.994	T	0.46289	-0.9202	10	0.20519	T	0.43	.	8.3595	0.32351	0.0778:0.0:0.767:0.1552	.	173;173;173	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	H	173	ENSP00000296499:Q173H;ENSP00000396625:Q173H	ENSP00000296499:Q173H	Q	+	3	2	NDST3	119195032	0.984000	0.35163	1.000000	0.80357	0.962000	0.63368	1.172000	0.31908	2.464000	0.83262	0.655000	0.94253	CAG	NDST3	-	pfam_Heparan_SO4_deacetylase	ENSG00000164100		0.358	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	HGNC	protein_coding	OTTHUMT00000256517.4	42	0.00	0	G	NM_004784		118975584	118975584	+1	no_errors	ENST00000296499	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	C
NFIL3	4783	genome.wustl.edu	37	9	94172741	94172741	+	Missense_Mutation	SNP	C	C	G	rs551990947		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:94172741C>G	ENST00000297689.3	-	2	670	c.276G>C	c.(274-276)gaG>gaC	p.E92D		NM_005384.2	NP_005375.2	Q16649	NFIL3_HUMAN	nuclear factor, interleukin 3 regulated	92	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to interleukin-4 (GO:0071353)|circadian rhythm (GO:0007623)|immune response (GO:0006955)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of gene expression (GO:0010628)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	16						GTCGACGCTTCTCACGAGATC	0.398																																					Esophageal Squamous(152;732 1832 10053 26981 51762)	dbGAP											0													229.0	234.0	232.0					9																	94172741		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64318	CCDS6690.1	9q22	2013-01-10			ENSG00000165030	ENSG00000165030		"""basic leucine zipper proteins"""	7787	protein-coding gene	gene with protein product		605327		IL3BP1		7565758, 1620116	Standard	NM_005384		Approved	E4BP4, NFIL3A, NF-IL3A	uc004arh.3	Q16649	OTTHUMG00000020209	ENST00000297689.3:c.276G>C	9.37:g.94172741C>G	ENSP00000297689:p.Glu92Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Y8|Q14211|Q6FGQ8|Q96HS0	Missense_Mutation	SNP	pfam_Vert_IL3-reg_TF,pfam_bZIP_2,pfam_bZIP_1,smart_bZIP,pirsf_TF_bZIP_E4BP4,pfscan_bZIP	p.E92D	ENST00000297689.3	37	c.276	CCDS6690.1	9	.	.	.	.	.	.	.	.	.	.	C	16.44	3.123908	0.56613	.	.	ENSG00000165030	ENST00000375724;ENST00000297689	T	0.42900	0.96	4.89	3.05	0.35203	Basic-leucine zipper (bZIP) transcription factor (3);Basic leucine zipper (1);	0.069502	0.56097	N	0.000039	T	0.48786	0.1519	L	0.43757	1.38	0.58432	D	0.999999	D	0.63880	0.993	D	0.72625	0.978	T	0.38972	-0.9636	10	0.36615	T	0.2	-21.3204	6.0019	0.19525	0.0:0.5777:0.0:0.4223	.	92	Q16649	NFIL3_HUMAN	D	92	ENSP00000297689:E92D	ENSP00000297689:E92D	E	-	3	2	NFIL3	93212562	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	2.683000	0.46943	0.779000	0.33543	0.561000	0.74099	GAG	NFIL3	-	pfam_bZIP_2,pfam_bZIP_1,smart_bZIP,pirsf_TF_bZIP_E4BP4,pfscan_bZIP	ENSG00000165030		0.398	NFIL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFIL3	HGNC	protein_coding	OTTHUMT00000053038.2	130	0.00	0	C	NM_005384		94172741	94172741	-1	no_errors	ENST00000297689	ensembl	human	known	69_37n	missense	75	36.44	43	SNP	1.000	G
NLRP2	55655	genome.wustl.edu	37	19	55502000	55502000	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:55502000G>C	ENST00000543010.1	+	10	2811	c.2668G>C	c.(2668-2670)Gag>Cag	p.E890Q	NLRP2_ENST00000538819.1_Missense_Mutation_p.E866Q|NLRP2_ENST00000339757.7_Missense_Mutation_p.E868Q|NLRP2_ENST00000263437.6_Missense_Mutation_p.E887Q|NLRP2_ENST00000537859.1_Missense_Mutation_p.E868Q|NLRP2_ENST00000586512.1_3'UTR|NLRP2_ENST00000427260.2_Missense_Mutation_p.E867Q|NLRP2_ENST00000391721.4_Missense_Mutation_p.E866Q|NLRP2_ENST00000448584.2_Missense_Mutation_p.E890Q	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2	890					positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GTTTCTGTGTGAGGGCTTGAG	0.577																																						dbGAP											0													138.0	138.0	138.0					19																	55502000		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2668G>C	19.37:g.55502000G>C	ENSP00000445135:p.Glu890Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E890Q	ENST00000543010.1	37	c.2668	CCDS12913.1	19	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320222	0.23994	.	.	ENSG00000022556	ENST00000543010;ENST00000391721;ENST00000339757;ENST00000448584;ENST00000537859;ENST00000427260;ENST00000538819;ENST00000263437	T;T;T;T;T;T;T;T	0.53640	0.61;0.61;0.61;0.61;0.61;0.61;0.61;0.61	2.31	1.26	0.21427	.	.	.	.	.	T	0.53190	0.1781	L	0.45051	1.395	0.24399	N	0.994719	D;D;D;D;P	0.89917	0.983;0.998;0.991;1.0;0.947	P;D;D;D;P	0.75484	0.897;0.97;0.949;0.986;0.845	T	0.35126	-0.9801	9	0.37606	T	0.19	.	5.0612	0.14559	0.1743:0.0:0.8257:0.0	.	867;868;887;866;890	B4DZL7;Q9NX02-2;A8K9G6;Q9NX02-4;Q9NX02	.;.;.;.;NALP2_HUMAN	Q	890;866;868;890;868;867;866;887	ENSP00000445135:E890Q;ENSP00000375601:E866Q;ENSP00000344074:E868Q;ENSP00000409370:E890Q;ENSP00000440601:E868Q;ENSP00000402474:E867Q;ENSP00000441133:E866Q;ENSP00000263437:E887Q	ENSP00000263437:E887Q	E	+	1	0	NLRP2	60193812	0.884000	0.30299	0.460000	0.27093	0.109000	0.19521	1.015000	0.29963	0.525000	0.28522	0.561000	0.74099	GAG	NLRP2	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000022556		0.577	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	169	0.00	0	G	NM_017852		55502000	55502000	+1	no_errors	ENST00000448584	ensembl	human	known	69_37n	missense	129	25.86	45	SNP	0.790	C
NOMO1	23420	genome.wustl.edu	37	16	14966096	14966096	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:14966096C>A	ENST00000287667.7	+	18	2135	c.1964C>A	c.(1963-1965)tCa>tAa	p.S655*		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	655						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						TGTAGGTCTTCACCTAGTATC	0.423																																						dbGAP											0													1.0	1.0	1.0					16																	14966096		500	1108	1608	-	-	-	SO:0001587	stop_gained	0			X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.1964C>A	16.37:g.14966096C>A	ENSP00000287667:p.Ser655*	Somatic		WXS	Illumina GAIIx	Phase_IV	P78421|Q8IW21|Q96DG0	Nonsense_Mutation	SNP	pfam_DUF2012,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,superfamily_Collagen-bd_Cna_B-typ_dom	p.S655*	ENST00000287667.7	37	c.1964	CCDS10556.1	16	.	.	.	.	.	.	.	.	.	.	.	38	7.228543	0.98150	.	.	ENSG00000103512	ENST00000287667;ENST00000456867;ENST00000536948	.	.	.	3.44	3.44	0.39384	.	0.067478	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.3609	12.4779	0.55825	0.0:1.0:0.0:0.0	.	.	.	.	X	655;655;488	.	ENSP00000287667:S655X	S	+	2	0	NOMO1	14873597	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	5.213000	0.65230	1.747000	0.51819	0.398000	0.26397	TCA	NOMO1	-	NULL	ENSG00000103512		0.423	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOMO1	HGNC	protein_coding	OTTHUMT00000207065.1	68	0.00	0	C			14966096	14966096	+1	no_errors	ENST00000287667	ensembl	human	known	69_37n	nonsense	31	32.61	15	SNP	1.000	A
NONO	4841	genome.wustl.edu	37	X	70517738	70517738	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:70517738G>A	ENST00000276079.8	+	9	1286	c.1081G>A	c.(1081-1083)Gaa>Aaa	p.E361K	NONO_ENST00000373841.1_Missense_Mutation_p.E361K|NONO_ENST00000373856.3_Missense_Mutation_p.E361K|NONO_ENST00000490044.1_3'UTR|NONO_ENST00000535149.1_Missense_Mutation_p.E272K	NM_007363.4	NP_031389.3	Q15233	NONO_HUMAN	non-POU domain containing, octamer-binding	361	DBHS.				circadian rhythm (GO:0007623)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|mRNA processing (GO:0006397)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of circadian rhythm (GO:0042752)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|paraspeckles (GO:0042382)	core promoter binding (GO:0001047)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)		NONO/TFE3(2)	endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|upper_aerodigestive_tract(1)	19	Renal(35;0.156)					GCAGCAAGAAGAAATGATGCG	0.517			T	TFE3	papillary renal cancer																																	dbGAP		Dom	yes		X	Xq13.1	4841	"""non-POU domain containing, octamer-binding"""		E	0													89.0	68.0	75.0					X																	70517738		2203	4300	6503	-	-	-	SO:0001583	missense	0			L14599	CCDS14410.1, CCDS55445.1	Xq13.1	2014-06-13	2002-01-14		ENSG00000147140	ENSG00000147140		"""RNA binding motif (RRM) containing"""	7871	protein-coding gene	gene with protein product	"""Nuclear RNA-binding protein, 54-kD"", ""non-Pou domain-containing octamer (ATGCAAAT) binding protein"", ""protein phosphatase 1, regulatory subunit 114"""	300084	"""non-POU-domain-containing, octamer-binding"""			8371983, 9360842	Standard	NM_007363		Approved	NRB54, NMT55, P54NRB, P54, PPP1R114	uc004dzp.3	Q15233	OTTHUMG00000021798	ENST00000276079.8:c.1081G>A	X.37:g.70517738G>A	ENSP00000276079:p.Glu361Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4C2|D3DVV4|F5GYZ3|O00201|P30807|Q12786|Q9BQC5	Missense_Mutation	SNP	pfam_RRM_dom,pfam_NOPS,smart_RRM_dom,pfscan_RRM_dom	p.E361K	ENST00000276079.8	37	c.1081	CCDS14410.1	X	.	.	.	.	.	.	.	.	.	.	g	26.6	4.755170	0.89843	.	.	ENSG00000147140	ENST00000535149;ENST00000276079;ENST00000373856;ENST00000373841	T;T;T;T	0.25579	1.83;1.79;1.79;1.79	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.41488	0.1161	M	0.74467	2.265	0.80722	D	1	D	0.55172	0.97	P	0.48704	0.587	T	0.46386	-0.9195	10	0.72032	D	0.01	-12.0924	17.9427	0.89030	0.0:0.0:1.0:0.0	.	361	Q15233	NONO_HUMAN	K	272;361;361;361	ENSP00000441364:E272K;ENSP00000276079:E361K;ENSP00000362963:E361K;ENSP00000362947:E361K	ENSP00000276079:E361K	E	+	1	0	NONO	70434463	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.594000	0.82698	2.427000	0.82271	0.529000	0.55759	GAA	NONO	-	NULL	ENSG00000147140		0.517	NONO-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NONO	HGNC	protein_coding	OTTHUMT00000057138.1	26	0.00	0	G	NM_007363		70517738	70517738	+1	no_errors	ENST00000276079	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	1.000	A
NPAS4	266743	genome.wustl.edu	37	11	66188755	66188755	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:66188755C>T	ENST00000311034.2	+	1	281	c.105C>T	c.(103-105)gtC>gtT	p.V35V		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	35	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						CGGACAAGGTCCGGCTGTCCT	0.647																																						dbGAP											0													73.0	59.0	64.0					11																	66188755		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.105C>T	11.37:g.66188755C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.V35	ENST00000311034.2	37	c.105	CCDS8138.1	11																																																																																			NPAS4	-	NULL	ENSG00000174576		0.647	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	32	0.00	0	C	NM_178864		66188755	66188755	+1	no_errors	ENST00000311034	ensembl	human	known	69_37n	silent	22	29.03	9	SNP	1.000	T
NPAS4	266743	genome.wustl.edu	37	11	66192503	66192503	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:66192503C>T	ENST00000311034.2	+	7	2318	c.2142C>T	c.(2140-2142)ttC>ttT	p.F714F		NM_178864.3	NP_849195.2	Q8IUM7	NPAS4_HUMAN	neuronal PAS domain protein 4	714					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|kidney(3)|large_intestine(11)|liver(2)|lung(20)|ovary(1)|prostate(3)|skin(3)	49						AAGACATCTTCATGGATCTCT	0.592																																						dbGAP											0													68.0	75.0	73.0					11																	66192503		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AB049469	CCDS8138.1	11q13.2	2013-05-21			ENSG00000174576	ENSG00000174576		"""Basic helix-loop-helix proteins"""	18983	protein-coding gene	gene with protein product		608554				14701734	Standard	NM_178864		Approved	PASD10, NXF, Le-PAS, bHLHe79	uc001ohx.1	Q8IUM7	OTTHUMG00000167045	ENST00000311034.2:c.2142C>T	11.37:g.66192503C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL81|Q8N8S5|Q8N9Q9	Silent	SNP	pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.F714	ENST00000311034.2	37	c.2142	CCDS8138.1	11																																																																																			NPAS4	-	NULL	ENSG00000174576		0.592	NPAS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAS4	HGNC	protein_coding	OTTHUMT00000392634.1	46	0.00	0	C	NM_178864		66192503	66192503	+1	no_errors	ENST00000311034	ensembl	human	known	69_37n	silent	23	32.35	11	SNP	1.000	T
NPHP4	261734	genome.wustl.edu	37	1	5925232	5925232	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:5925232G>C	ENST00000378156.4	-	27	4011	c.3746C>G	c.(3745-3747)tCc>tGc	p.S1249C	NPHP4_ENST00000478423.2_5'UTR|MIR4689_ENST00000582517.1_RNA	NM_015102.3	NP_055917.1	O75161	NPHP4_HUMAN	nephronophthisis 4	1249					actin cytoskeleton organization (GO:0030036)|hippo signaling (GO:0035329)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|retina development in camera-type eye (GO:0060041)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|visual behavior (GO:0007632)	cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|tight junction (GO:0005923)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(4)	47	Ovarian(185;0.0634)	all_cancers(23;7.53e-41)|all_epithelial(116;3.96e-23)|all_lung(118;5.12e-09)|all_hematologic(16;5.45e-07)|Lung NSC(185;5.49e-07)|all_neural(13;3.21e-06)|Acute lymphoblastic leukemia(12;3.44e-05)|Breast(487;0.000601)|Renal(390;0.0007)|Colorectal(325;0.00113)|Hepatocellular(190;0.00213)|Glioma(11;0.00223)|Myeloproliferative disorder(586;0.0256)|Ovarian(437;0.04)|Lung SC(97;0.128)|Medulloblastoma(700;0.213)		Epithelial(90;1.69e-36)|GBM - Glioblastoma multiforme(13;5.07e-29)|OV - Ovarian serous cystadenocarcinoma(86;1.05e-19)|Colorectal(212;4.54e-07)|COAD - Colon adenocarcinoma(227;3.14e-05)|Kidney(185;0.00012)|BRCA - Breast invasive adenocarcinoma(365;0.00102)|KIRC - Kidney renal clear cell carcinoma(229;0.00179)|STAD - Stomach adenocarcinoma(132;0.00472)|READ - Rectum adenocarcinoma(331;0.0649)		AAGGACAAGGGACAGGCGGGT	0.632																																						dbGAP											0													36.0	45.0	42.0					1																	5925232		2050	4198	6248	-	-	-	SO:0001583	missense	0			AB014573	CCDS44052.1	1p36	2010-03-26			ENSG00000131697	ENSG00000131697			19104	protein-coding gene	gene with protein product	"""nephroretinin"", ""nephrocystin-4"", ""POC10 centriolar protein homolog (Chlamydomonas)"""	607215				11920287, 12205563	Standard	XR_244787		Approved	SLSN4, KIAA0673, POC10	uc001alq.2	O75161	OTTHUMG00000000701	ENST00000378156.4:c.3746C>G	1.37:g.5925232G>C	ENSP00000367398:p.Ser1249Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWC0	Missense_Mutation	SNP	NULL	p.S1249C	ENST00000378156.4	37	c.3746	CCDS44052.1	1	.	.	.	.	.	.	.	.	.	.	G	26.7	4.765310	0.90020	.	.	ENSG00000131697	ENST00000378156	T	0.76186	-1.0	5.42	5.42	0.78866	.	0.075070	0.52532	D	0.000062	D	0.85673	0.5751	M	0.77820	2.39	0.46028	D	0.998822	D	0.71674	0.998	P	0.62813	0.907	D	0.87412	0.2376	10	0.87932	D	0	.	18.217	0.89889	0.0:0.0:1.0:0.0	.	1249	O75161	NPHP4_HUMAN	C	1249	ENSP00000367398:S1249C	ENSP00000367398:S1249C	S	-	2	0	NPHP4	5847819	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	8.944000	0.92980	2.535000	0.85469	0.655000	0.94253	TCC	NPHP4	-	NULL	ENSG00000131697		0.632	NPHP4-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	NPHP4	HGNC	protein_coding	OTTHUMT00000001715.2	25	0.00	0	G			5925232	5925232	-1	no_errors	ENST00000378156	ensembl	human	known	69_37n	missense	4	76.47	13	SNP	1.000	C
NR1H3	10062	genome.wustl.edu	37	11	47289528	47289528	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:47289528C>T	ENST00000467728.1	+	7	2291	c.1053C>T	c.(1051-1053)ctC>ctT	p.L351L	NR1H3_ENST00000527949.1_Silent_p.L200L|NR1H3_ENST00000405576.1_Silent_p.L246L|NR1H3_ENST00000405853.3_Silent_p.L291L|NR1H3_ENST00000407404.1_Silent_p.L291L|MADD_ENST00000406482.1_5'Flank|MADD_ENST00000395344.3_5'Flank|RP11-17G12.3_ENST00000545474.1_RNA|MADD_ENST00000402192.2_5'Flank|MADD_ENST00000402799.1_5'Flank|MADD_ENST00000342922.4_5'Flank|NR1H3_ENST00000481889.2_Silent_p.L370L|MADD_ENST00000349238.3_5'Flank|NR1H3_ENST00000441012.2_Silent_p.L351L|MADD_ENST00000395336.3_5'Flank|RP11-17G12.3_ENST00000543925.1_RNA|NR1H3_ENST00000395397.3_Silent_p.L306L|NR1H3_ENST00000529540.1_3'UTR|MADD_ENST00000407859.3_5'Flank|MADD_ENST00000311027.5_5'Flank			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	351	Ligand-binding. {ECO:0000255}.				apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						AGCTGCAACTCAATGATGCCG	0.542																																						dbGAP											0													137.0	115.0	123.0					11																	47289528		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.1053C>T	11.37:g.47289528C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3J9|D3DQR1|Q8IW13|Q96H87	Silent	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Liver_X_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Ecdystd_rcpt	p.L351	ENST00000467728.1	37	c.1053	CCDS7929.1	11																																																																																			NR1H3	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Liver_X_rcpt,prints_Str_hrmn_rcpt,prints_ThyrH_rcpt,prints_Ecdystd_rcpt	ENSG00000025434		0.542	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1H3	HGNC	protein_coding	OTTHUMT00000319214.3	103	0.00	0	C			47289528	47289528	+1	no_errors	ENST00000441012	ensembl	human	known	69_37n	silent	72	33.33	36	SNP	1.000	T
NR5A2	2494	genome.wustl.edu	37	1	200017590	200017590	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:200017590C>T	ENST00000367362.3	+	5	1000	c.754C>T	c.(754-756)Cac>Tac	p.H252Y	NR5A2_ENST00000236914.3_Missense_Mutation_p.H206Y|NR5A2_ENST00000544748.1_Missense_Mutation_p.H180Y	NM_001276464.1|NM_205860.1	NP_001263393.1|NP_995582.1	O00482	NR5A2_HUMAN	nuclear receptor subfamily 5, group A, member 2	252					bile acid metabolic process (GO:0008206)|cholesterol homeostasis (GO:0042632)|embryo development (GO:0009790)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|homeostatic process (GO:0042592)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral genome replication (GO:0045070)|regulation of cell proliferation (GO:0042127)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	31	Prostate(682;0.19)					AATGCCCCCTCACGGCAGCCT	0.532																																					Melanoma(179;1138 2773 15678 26136)	dbGAP											0													117.0	115.0	116.0					1																	200017590		2203	4300	6503	-	-	-	SO:0001583	missense	0			U93553	CCDS1400.1, CCDS1401.1, CCDS60383.1	1q32.11	2013-01-16			ENSG00000116833	ENSG00000116833		"""Nuclear hormone receptors"""	7984	protein-coding gene	gene with protein product	"""liver receptor homolog-1"""	604453		FTF		9858833, 7680097	Standard	NM_205860		Approved	FTZ-F1beta, hB1F, LRH-1, FTZ-F1, hB1F-2, B1F2	uc001gvb.4	O00482	OTTHUMG00000035635	ENST00000367362.3:c.754C>T	1.37:g.200017590C>T	ENSP00000356331:p.His252Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2P3|O95642|Q147U3	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pirsf_Steroidogenic_factor_1,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.H252Y	ENST00000367362.3	37	c.754	CCDS1401.1	1	.	.	.	.	.	.	.	.	.	.	C	14.59	2.580780	0.46006	.	.	ENSG00000116833	ENST00000367362;ENST00000236914;ENST00000544748;ENST00000235480	D;D;D	0.94376	-3.35;-3.41;-3.4	5.09	5.09	0.68999	Nuclear hormone receptor, ligand-binding (1);	0.090016	0.85682	D	0.000000	D	0.90397	0.6994	L	0.42529	1.33	0.51012	D	0.999902	B;B	0.11235	0.004;0.001	B;B	0.09377	0.004;0.001	D	0.86117	0.1566	9	.	.	.	.	18.8454	0.92203	0.0:1.0:0.0:0.0	.	206;252	F1D8R9;O00482	.;NR5A2_HUMAN	Y	252;206;180;172	ENSP00000356331:H252Y;ENSP00000236914:H206Y;ENSP00000439116:H180Y	.	H	+	1	0	NR5A2	198284213	0.999000	0.42202	0.984000	0.44739	0.979000	0.70002	7.394000	0.79862	2.523000	0.85059	0.563000	0.77884	CAC	NR5A2	-	superfamily_Nucl_hormone_rcpt_ligand-bd,pirsf_Steroidogenic_factor_1	ENSG00000116833		0.532	NR5A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NR5A2	HGNC	protein_coding	OTTHUMT00000086497.2	66	0.00	0	C			200017590	200017590	+1	no_errors	ENST00000367362	ensembl	human	known	69_37n	missense	131	22.94	39	SNP	0.997	T
NUP107	57122	genome.wustl.edu	37	12	69094517	69094517	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:69094517G>A	ENST00000229179.4	+	7	896	c.564G>A	c.(562-564)ctG>ctA	p.L188L	NUP107_ENST00000539906.1_Silent_p.L159L|NUP107_ENST00000378905.2_Silent_p.L37L	NM_020401.2	NP_065134.1	P57740	NU107_HUMAN	nucleoporin 107kDa	188					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA export from nucleus (GO:0006406)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore outer ring (GO:0031080)|nucleus (GO:0005634)	nucleocytoplasmic transporter activity (GO:0005487)|structural constituent of nuclear pore (GO:0017056)		NUP107/LGR5(2)	breast(3)|endometrium(4)|kidney(4)|large_intestine(12)|lung(11)|prostate(1)|skin(2)|urinary_tract(2)	39	Breast(13;6.25e-06)		Lung(24;0.000131)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.00694)			TGAATATACTGAGTAAAATAG	0.353																																						dbGAP											0													50.0	50.0	50.0					12																	69094517		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055629	CCDS8985.1	12q14	2004-03-19			ENSG00000111581	ENSG00000111581			29914	protein-coding gene	gene with protein product		607617				12552102, 12705868	Standard	XM_005269037		Approved	NUP84	uc001suf.3	P57740	OTTHUMG00000169265	ENST00000229179.4:c.564G>A	12.37:g.69094517G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ67|Q6PJE1	Silent	SNP	pfam_Nup84_Nup100	p.L188	ENST00000229179.4	37	c.564	CCDS8985.1	12																																																																																			NUP107	-	NULL	ENSG00000111581		0.353	NUP107-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP107	HGNC	protein_coding	OTTHUMT00000403195.1	98	0.00	0	G	NM_020401		69094517	69094517	+1	no_errors	ENST00000229179	ensembl	human	known	69_37n	silent	34	34.62	18	SNP	0.554	A
NUPL1	9818	genome.wustl.edu	37	13	25901082	25901082	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:25901082G>C	ENST00000381736.3	+	11	1310	c.1060G>C	c.(1060-1062)Gag>Cag	p.E354Q	NUPL1_ENST00000463407.1_Missense_Mutation_p.E354Q|NUPL1_ENST00000381718.3_Missense_Mutation_p.E342Q|NUPL1_ENST00000466694.1_3'UTR	NM_001008564.1|NM_014089.3	NP_001008564.1|NP_054808.1	Q9BVL2	NUPL1_HUMAN	nucleoporin like 1	354	14 X 2 AA repeats of F-G.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)	nucleocytoplasmic transporter activity (GO:0005487)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(7)|stomach(1)|urinary_tract(1)	16		Lung SC(185;0.0225)|Breast(139;0.0351)		all cancers(112;0.0092)|Epithelial(112;0.0477)|OV - Ovarian serous cystadenocarcinoma(117;0.165)|GBM - Glioblastoma multiforme(144;0.244)		TCAGCAATTTGAGGTACAGCT	0.338																																					Pancreas(166;1040 2004 4560 4728 37041)|GBM(109;1045 1520 7614 9308 19618)	dbGAP											0													94.0	93.0	93.0					13																	25901082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007870	CCDS9314.1, CCDS31949.1	13q12.12	2011-04-12			ENSG00000139496	ENSG00000139496			20261	protein-coding gene	gene with protein product		607615				9455477	Standard	NM_014089		Approved	KIAA0410	uc001uqi.3	Q9BVL2	OTTHUMG00000016608	ENST00000381736.3:c.1060G>C	13.37:g.25901082G>C	ENSP00000371155:p.Glu354Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI12|B4DZJ1|O43160|Q5JRG2|Q5JRG5	Missense_Mutation	SNP	NULL	p.E354Q	ENST00000381736.3	37	c.1060	CCDS9314.1	13	.	.	.	.	.	.	.	.	.	.	G	26.1	4.702325	0.88924	.	.	ENSG00000139496	ENST00000381736;ENST00000381745;ENST00000313619;ENST00000463407;ENST00000381718;ENST00000381747;ENST00000394327	T;T;T;T;T	0.57436	0.54;0.79;0.85;0.67;0.4	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.64649	0.2617	M	0.82716	2.605	0.80722	D	1	P;B;P	0.41102	0.51;0.369;0.738	B;B;B	0.43386	0.386;0.251;0.418	T	0.71639	-0.4532	10	0.72032	D	0.01	-11.2553	19.2055	0.93728	0.0:0.0:1.0:0.0	.	342;354;354	A6NI12;Q9BVL2;Q9BVL2-2	.;NUPL1_HUMAN;.	Q	354;342;331;354;342;354;301	ENSP00000371155:E354Q;ENSP00000418555:E354Q;ENSP00000371137:E342Q;ENSP00000371166:E354Q;ENSP00000408147:E301Q	ENSP00000318459:E331Q	E	+	1	0	NUPL1	24799082	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.834000	0.86773	2.607000	0.88179	0.591000	0.81541	GAG	NUPL1	-	NULL	ENSG00000139496		0.338	NUPL1-001	KNOWN	basic|CCDS	protein_coding	NUPL1	HGNC	protein_coding	OTTHUMT00000044228.2	104	0.95	1	G			25901082	25901082	+1	no_errors	ENST00000381736	ensembl	human	known	69_37n	missense	57	33.72	29	SNP	1.000	C
TENM2	57451	genome.wustl.edu	37	5	167671524	167671524	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:167671524G>A	ENST00000518659.1	+	26	5659	c.5620G>A	c.(5620-5622)Gac>Aac	p.D1874N	TENM2_ENST00000519204.1_Missense_Mutation_p.D1753N|TENM2_ENST00000403607.2_Missense_Mutation_p.D1698N|TENM2_ENST00000545108.1_Missense_Mutation_p.D1873N|TENM2_ENST00000520394.1_Missense_Mutation_p.D1635N	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1874					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										GATCATTTATGACCAGGTGGG	0.537																																						dbGAP											0													56.0	58.0	57.0					5																	167671524		1912	4116	6028	-	-	-	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5620G>A	5.37:g.167671524G>A	ENSP00000429430:p.Asp1874Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl,superfamily_Cytokine_IL1-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.D1874N	ENST00000518659.1	37	c.5620		5	.	.	.	.	.	.	.	.	.	.	G	33	5.222819	0.95139	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.93133	-2.68;-2.67;-2.81;-3.1;-3.17	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	D	0.96417	0.8831	M	0.74647	2.275	0.58432	D	0.999998	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.91635	0.999;0.999;0.991	D	0.96414	0.9306	10	0.49607	T	0.09	.	17.8465	0.88731	0.0:0.0:1.0:0.0	.	1873;1874;1635	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	N	1874;1873;1753;1635;1698	ENSP00000429430:D1874N;ENSP00000438635:D1873N;ENSP00000428964:D1753N;ENSP00000427874:D1635N;ENSP00000384905:D1698N	ENSP00000384905:D1698N	D	+	1	0	ODZ2	167604102	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	9.813000	0.99286	2.214000	0.71695	0.561000	0.74099	GAC	ODZ2	-	superfamily_ConA-like_lec_gl	ENSG00000145934		0.537	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	HGNC	protein_coding	OTTHUMT00000376096.1	40	0.00	0	G	NM_001122679		167671524	167671524	+1	no_errors	ENST00000518659	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	A
OGDH	4967	genome.wustl.edu	37	7	44734059	44734059	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:44734059G>A	ENST00000222673.5	+	12	1594	c.1552G>A	c.(1552-1554)Gag>Aag	p.E518K	OGDH_ENST00000449767.1_Missense_Mutation_p.E514K|OGDH_ENST00000439616.2_Missense_Mutation_p.E368K|OGDH_ENST00000447398.1_Missense_Mutation_p.E529K|OGDH_ENST00000543843.1_Missense_Mutation_p.E469K|OGDH_ENST00000444676.1_Missense_Mutation_p.E533K	NM_002541.3	NP_002532.2	Q02218	ODO1_HUMAN	oxoglutarate (alpha-ketoglutarate) dehydrogenase (lipoamide)	518					2-oxoglutarate metabolic process (GO:0006103)|cellular metabolic process (GO:0044237)|cellular nitrogen compound metabolic process (GO:0034641)|cerebellar cortex development (GO:0021695)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hippocampus development (GO:0021766)|lysine catabolic process (GO:0006554)|NADH metabolic process (GO:0006734)|olfactory bulb mitral cell layer development (GO:0061034)|pyramidal neuron development (GO:0021860)|small molecule metabolic process (GO:0044281)|striatum development (GO:0021756)|succinyl-CoA metabolic process (GO:0006104)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)|thalamus development (GO:0021794)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrion (GO:0005739)|oxoglutarate dehydrogenase complex (GO:0045252)	metal ion binding (GO:0046872)|oxoglutarate dehydrogenase (NAD+) activity (GO:0034602)|oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(2)|endometrium(5)|kidney(2)|large_intestine(6)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	36					Valproic Acid(DB00313)	CGAGATGGATGAGCCCATGTT	0.567																																						dbGAP											0													123.0	99.0	107.0					7																	44734059		2203	4300	6503	-	-	-	SO:0001583	missense	0			D10523	CCDS34627.1, CCDS47580.1, CCDS55107.1	7p13-p11.2	2010-11-23			ENSG00000105953	ENSG00000105953	1.2.4.2		8124	protein-coding gene	gene with protein product		613022				8020988, 1542694	Standard	NM_002541		Approved	E1k	uc003tln.3	Q02218	OTTHUMG00000155304	ENST00000222673.5:c.1552G>A	7.37:g.44734059G>A	ENSP00000222673:p.Glu518Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2U9|D3DVL0|E9PBM1|Q96DD3|Q9UDX0	Missense_Mutation	SNP	pfam_DH_E1,pfam_Transketolase-like_Pyr-bd,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.E518K	ENST00000222673.5	37	c.1552	CCDS34627.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.813562	0.96975	.	.	ENSG00000105953	ENST00000439616;ENST00000449767;ENST00000447398;ENST00000444676;ENST00000222673;ENST00000543843	D;D;D;D;D;D	0.96459	-4.02;-4.02;-4.02;-4.02;-4.02;-4.02	5.31	5.31	0.75309	Dehydrogenase, E1 component (1);	0.000000	0.85682	D	0.000000	D	0.98855	0.9613	H	0.97131	3.945	0.80722	D	1	D;D;D;D;D;D	0.76494	0.997;0.997;0.999;0.999;0.994;0.999	D;D;D;D;D;D	0.74674	0.973;0.973;0.984;0.984;0.973;0.984	D	0.99501	1.0953	10	0.87932	D	0	-43.8313	18.9458	0.92621	0.0:0.0:1.0:0.0	.	313;368;514;529;420;518	B4E3E9;E9PFG7;E9PBM1;E9PDF2;A2VCT2;Q02218	.;.;.;.;.;ODO1_HUMAN	K	368;514;529;533;518;469	ENSP00000398576:E368K;ENSP00000392878:E514K;ENSP00000388183:E529K;ENSP00000414662:E533K;ENSP00000222673:E518K;ENSP00000443821:E469K	ENSP00000222673:E518K	E	+	1	0	OGDH	44700584	1.000000	0.71417	0.982000	0.44146	0.990000	0.78478	9.813000	0.99286	2.652000	0.90054	0.655000	0.94253	GAG	OGDH	-	pfam_DH_E1,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	ENSG00000105953		0.567	OGDH-001	KNOWN	basic|CCDS	protein_coding	OGDH	HGNC	protein_coding	OTTHUMT00000339391.1	55	0.00	0	G			44734059	44734059	+1	no_errors	ENST00000222673	ensembl	human	known	69_37n	missense	45	32.84	22	SNP	1.000	A
OPALIN	93377	genome.wustl.edu	37	10	98108050	98108050	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:98108050G>A	ENST00000371172.3	-	5	650	c.245C>T	c.(244-246)tCt>tTt	p.S82F	OPALIN_ENST00000536387.1_Missense_Mutation_p.S72F|OPALIN_ENST00000393870.2_Missense_Mutation_p.S71F|OPALIN_ENST00000393871.1_Missense_Mutation_p.S59F|OPALIN_ENST00000419479.1_Missense_Mutation_p.S72F	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	82						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						TCTTACCTCAGATATCTTGGG	0.333																																						dbGAP											0													89.0	87.0	88.0					10																	98108050		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.245C>T	10.37:g.98108050G>A	ENSP00000360214:p.Ser82Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	NULL	p.S82F	ENST00000371172.3	37	c.245	CCDS7448.1	10	.	.	.	.	.	.	.	.	.	.	G	14.26	2.480905	0.44044	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	4.63	3.72	0.42706	.	0.483083	0.18674	N	0.134375	T	0.31420	0.0796	N	0.24115	0.695	0.23572	N	0.997382	B;B;P	0.45176	0.4;0.4;0.852	B;B;P	0.48400	0.118;0.118;0.576	T	0.08827	-1.0703	9	0.72032	D	0.01	-2.3713	8.9121	0.35559	0.1023:0.0:0.8977:0.0	.	59;82;72	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	F	82;59;72;71;72	.	ENSP00000360214:S82F	S	-	2	0	OPALIN	98098040	0.249000	0.23941	0.962000	0.40283	0.964000	0.63967	1.668000	0.37481	1.306000	0.44926	0.558000	0.71614	TCT	OPALIN	-	NULL	ENSG00000197430		0.333	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	HGNC	protein_coding	OTTHUMT00000049606.1	80	0.00	0	G	NM_033207		98108050	98108050	-1	no_errors	ENST00000371172	ensembl	human	known	69_37n	missense	56	30.86	25	SNP	0.971	A
OR10K2	391107	genome.wustl.edu	37	1	158390018	158390018	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:158390018C>T	ENST00000314902.2	-	1	638	c.639G>A	c.(637-639)ttG>ttA	p.L213L		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	213						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L213F(1)		NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					ACACCAAGATCAACAATAAGG	0.448																																						dbGAP											1	Substitution - Missense(1)	cervix(1)											146.0	135.0	139.0					1																	158390018		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.639G>A	1.37:g.158390018C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L213	ENST00000314902.2	37	c.639	CCDS30896.1	1																																																																																			OR10K2	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000180708		0.448	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K2	HGNC	protein_coding	OTTHUMT00000051854.1	103	0.00	0	C	NM_001004476		158390018	158390018	-1	no_errors	ENST00000314902	ensembl	human	known	69_37n	silent	189	15.25	34	SNP	0.660	T
OR2L8	391190	genome.wustl.edu	37	1	248113011	248113011	+	Silent	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:248113011C>G	ENST00000357191.3	+	1	852	c.852C>G	c.(850-852)ctC>ctG	p.L284L	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	284						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CCCCAATGCTCAACCCCATCA	0.493																																						dbGAP											0													85.0	68.0	73.0					1																	248113011		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.852C>G	1.37:g.248113011C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF03	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L284	ENST00000357191.3	37	c.852	CCDS31101.1	1																																																																																			OR2L8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000196936		0.493	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	HGNC	protein_coding	OTTHUMT00000096853.2	100	0.00	0	C			248113011	248113011	+1	no_errors	ENST00000357191	ensembl	human	known	69_37n	silent	127	28.65	51	SNP	0.968	G
OR2AK2	391191	genome.wustl.edu	37	1	248129439	248129439	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:248129439C>A	ENST00000366480.3	+	1	905	c.806C>A	c.(805-807)aCc>aAc	p.T269N	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			TTCTATGCAACCACTCTCTTT	0.493																																					Melanoma(45;390 1181 23848 28461 41504)	dbGAP											0													179.0	138.0	152.0					1																	248129439		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.806C>A	1.37:g.248129439C>A	ENSP00000355436:p.Thr269Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RND1|Q6IF05	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T269N	ENST00000366480.3	37	c.806	CCDS31102.1	1	.	.	.	.	.	.	.	.	.	.	.	14.00	2.405106	0.42613	.	.	ENSG00000187080	ENST00000366480	T	0.00289	8.28	3.04	3.04	0.35103	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00637	0.0021	M	0.74881	2.28	0.09310	N	1	D	0.64830	0.994	D	0.69824	0.966	T	0.51028	-0.8757	9	0.87932	D	0	.	14.1274	0.65230	0.0:1.0:0.0:0.0	.	269	Q8NG84	O2AK2_HUMAN	N	269	ENSP00000355436:T269N	ENSP00000355436:T269N	T	+	2	0	OR2AK2	246196062	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.681000	0.25320	1.683000	0.51011	0.462000	0.41574	ACC	OR2AK2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187080		0.493	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AK2	HGNC	protein_coding	OTTHUMT00000096858.2	118	0.00	0	C	NM_001004491		248129439	248129439	+1	no_errors	ENST00000366480	ensembl	human	known	69_37n	missense	204	19.37	49	SNP	0.007	A
OR2W5	441932	genome.wustl.edu	37	1	247655373	247655373	+	RNA	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:247655373C>T	ENST00000522351.1	+	0	1004							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGGGGAGCCTCAACGAGGGGA	0.488																																						dbGAP											0													52.0	56.0	55.0					1																	247655373		2203	4300	6503	-	-	-			0					1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655373C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH85	RNA	SNP	-	NULL	ENST00000522351.1	37	NULL		1																																																																																			OR2W5	-	-	ENSG00000203664		0.488	OR2W5-002	KNOWN	basic	processed_transcript	OR2W5	HGNC	pseudogene	OTTHUMT00000375789.1	20	0.00	0	C	NM_001004698		247655373	247655373	+1	no_errors	ENST00000522351	ensembl	human	known	69_37n	rna	14	22.22	4	SNP	0.019	T
OR2T2	401992	genome.wustl.edu	37	1	248616623	248616623	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:248616623C>T	ENST00000342927.3	+	1	547	c.525C>T	c.(523-525)atC>atT	p.I175I		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	175						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			CCCGAGAGATCAATCACTTTT	0.517																																						dbGAP											0													13.0	17.0	15.0					1																	248616623		2172	4240	6412	-	-	-	SO:0001819	synonymous_variant	0			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.525C>T	1.37:g.248616623C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNM1|B9EH01	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I175	ENST00000342927.3	37	c.525	CCDS31116.1	1																																																																																			OR2T2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196240		0.517	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	44	0.00	0	C	NM_001004136		248616623	248616623	+1	no_errors	ENST00000342927	ensembl	human	known	69_37n	silent	58	13.43	9	SNP	0.353	T
OR4C16	219428	genome.wustl.edu	37	11	55340509	55340509	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:55340509G>C	ENST00000314634.3	+	1	906	c.906G>C	c.(904-906)aaG>aaC	p.K302N		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				TTTGGAGCAAGAAATTGATCA	0.328																																						dbGAP											0													34.0	34.0	34.0					11																	55340509		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.906G>C	11.37:g.55340509G>C	ENSP00000324913:p.Lys302Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEV8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.K302N	ENST00000314634.3	37	c.906	CCDS31502.1	11	.	.	.	.	.	.	.	.	.	.	G	6.683	0.494624	0.12702	.	.	ENSG00000181935	ENST00000314634	T	0.38887	1.11	4.68	0.511	0.16989	.	0.615822	0.15537	N	0.257183	T	0.24928	0.0605	N	0.26092	0.79	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.16897	-1.0387	10	0.56958	D	0.05	.	4.6139	0.12417	0.1997:0.3556:0.4447:0.0	.	302	Q8NGL9	OR4CG_HUMAN	N	302	ENSP00000324913:K302N	ENSP00000324913:K302N	K	+	3	2	OR4C16	55097085	0.000000	0.05858	0.008000	0.14137	0.620000	0.37586	-0.820000	0.04457	0.593000	0.29745	0.549000	0.68633	AAG	OR4C16	-	NULL	ENSG00000181935		0.328	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	42	0.00	0	G	NM_001004701		55340509	55340509	+1	no_errors	ENST00000314634	ensembl	human	known	69_37n	missense	36	29.41	15	SNP	0.000	C
OR4D2	124538	genome.wustl.edu	37	17	56247698	56247698	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:56247698C>T	ENST00000545221.1	+	1	682	c.682C>T	c.(682-684)Cat>Tat	p.H228Y		NM_001004707.3	NP_001004707.1	P58180	OR4D2_HUMAN	olfactory receptor, family 4, subfamily D, member 2	228						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|kidney(1)|large_intestine(1)|lung(19)|ovary(1)|skin(2)|stomach(1)	26						GCTGAGGTCACATCCAGGGGA	0.537																																						dbGAP											0													166.0	115.0	132.0					17																	56247698		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32688.1	17q22	2013-09-23			ENSG00000255713	ENSG00000255713		"""GPCR / Class A : Olfactory receptors"""	8294	protein-coding gene	gene with protein product							Standard	NM_001004707		Approved		uc010wnp.2	P58180	OTTHUMG00000178801	ENST00000545221.1:c.682C>T	17.37:g.56247698C>T	ENSP00000441354:p.His228Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFN8|Q96R75	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.H228Y	ENST00000545221.1	37	c.682	CCDS32688.1	17	.	.	.	.	.	.	.	.	.	.	C	10.13	1.264768	0.23136	.	.	ENSG00000255713	ENST00000545221	T	0.00099	8.73	5.71	4.74	0.60224	GPCR, rhodopsin-like superfamily (1);	0.105129	0.42294	N	0.000727	T	0.00210	0.0006	M	0.74546	2.27	0.09310	N	1	B	0.14805	0.011	B	0.20577	0.03	T	0.31392	-0.9945	10	0.46703	T	0.11	-14.2228	12.7381	0.57236	0.0:0.9199:0.0:0.0801	.	228	P58180	OR4D2_HUMAN	Y	228	ENSP00000441354:H228Y	ENSP00000441354:H228Y	H	+	1	0	OR4D2	53602697	0.000000	0.05858	0.708000	0.30435	0.481000	0.33189	0.506000	0.22658	1.550000	0.49438	0.609000	0.83330	CAT	OR4D2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000255713		0.537	OR4D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4D2	HGNC	protein_coding	OTTHUMT00000443366.1	95	0.00	0	C			56247698	56247698	+1	no_errors	ENST00000545221	ensembl	human	known	69_37n	missense	137	23.33	42	SNP	0.137	T
OR52K2	119774	genome.wustl.edu	37	11	4471264	4471264	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:4471264C>T	ENST00000325719.4	+	1	740	c.695C>T	c.(694-696)tCt>tTt	p.S232F		NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	232						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTGCTTGCCTCTCAGGAGGCC	0.473																																						dbGAP											0													283.0	244.0	257.0					11																	4471264		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.695C>T	11.37:g.4471264C>T	ENSP00000318956:p.Ser232Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUY8|B2RP35|Q6IFK4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S232F	ENST00000325719.4	37	c.695	CCDS31351.1	11	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870214	0.51588	.	.	ENSG00000181963	ENST00000325719	T	0.00340	8.04	4.02	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.146929	0.31721	N	0.007165	T	0.01061	0.0035	M	0.90252	3.1	0.36582	D	0.873613	D	0.76494	0.999	D	0.91635	0.999	T	0.58154	-0.7686	10	0.87932	D	0	.	14.9222	0.70847	0.0:1.0:0.0:0.0	.	232	Q8NGK3	O52K2_HUMAN	F	232	ENSP00000318956:S232F	ENSP00000318956:S232F	S	+	2	0	OR52K2	4427840	0.001000	0.12720	1.000000	0.80357	0.537000	0.34900	1.406000	0.34646	2.082000	0.62665	0.485000	0.47835	TCT	OR52K2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181963		0.473	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K2	HGNC	protein_coding	OTTHUMT00000385844.1	178	0.00	0	C	NM_001005172		4471264	4471264	+1	no_errors	ENST00000325719	ensembl	human	known	69_37n	missense	200	30.56	88	SNP	1.000	T
OR5I1	10798	genome.wustl.edu	37	11	55703532	55703532	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:55703532G>A	ENST00000301532.3	-	1	344	c.345C>T	c.(343-345)ttC>ttT	p.F115F		NM_006637.1	NP_006628.1	Q13606	OR5I1_HUMAN	olfactory receptor, family 5, subfamily I, member 1	115					signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(34)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						CGGCCAGGATGAAGGATTCTG	0.433																																						dbGAP											0													49.0	52.0	51.0					11																	55703532		2201	4292	6493	-	-	-	SO:0001819	synonymous_variant	0			BC069093	CCDS7949.1	11q11	2012-08-09			ENSG00000167825	ENSG00000167825		"""GPCR / Class A : Olfactory receptors"""	8347	protein-coding gene	gene with protein product		608496				9017400, 9787077	Standard	NM_006637		Approved	HSOlf1, OLF1	uc010ris.2	Q13606	OTTHUMG00000166821	ENST00000301532.3:c.345C>T	11.37:g.55703532G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEU4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F115	ENST00000301532.3	37	c.345	CCDS7949.1	11																																																																																			OR5I1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000167825		0.433	OR5I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5I1	HGNC	protein_coding	OTTHUMT00000391528.1	37	0.00	0	G	NM_006637		55703532	55703532	-1	no_errors	ENST00000301532	ensembl	human	known	69_37n	silent	20	35.48	11	SNP	0.031	A
OR5F1	338674	genome.wustl.edu	37	11	55761969	55761969	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:55761969T>C	ENST00000278409.1	-	1	132	c.133A>G	c.(133-135)Atg>Gtg	p.M45V		NM_003697.1	NP_003688.1	O95221	OR5F1_HUMAN	olfactory receptor, family 5, subfamily F, member 1	45					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(11)|liver(1)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	58	Esophageal squamous(21;0.00448)					AAGAGGATCATCCCGAGATTT	0.428																																						dbGAP											0													60.0	56.0	58.0					11																	55761969		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF065863	CCDS31515.1	11q11	2012-08-09			ENSG00000149133	ENSG00000149133		"""GPCR / Class A : Olfactory receptors"""	8343	protein-coding gene	gene with protein product		608492				9787077	Standard	NM_003697		Approved	OR11-10	uc010riv.2	O95221	OTTHUMG00000166825	ENST00000278409.1:c.133A>G	11.37:g.55761969T>C	ENSP00000278409:p.Met45Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495D1|Q6IFB9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M45V	ENST00000278409.1	37	c.133	CCDS31515.1	11	.	.	.	.	.	.	.	.	.	.	T	2.735	-0.263623	0.05754	.	.	ENSG00000149133	ENST00000278409	T	0.00408	7.54	3.03	3.03	0.35002	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00328	0.0010	L	0.48260	1.515	0.09310	N	1	P	0.37141	0.584	B	0.34418	0.182	T	0.48625	-0.9019	9	0.72032	D	0.01	.	7.7236	0.28746	0.0:0.0:0.2127:0.7873	.	45	O95221	OR5F1_HUMAN	V	45	ENSP00000278409:M45V	ENSP00000278409:M45V	M	-	1	0	OR5F1	55518545	0.084000	0.21492	0.162000	0.22713	0.150000	0.21749	0.296000	0.19083	1.167000	0.42706	0.247000	0.18012	ATG	OR5F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000149133		0.428	OR5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5F1	HGNC	protein_coding	OTTHUMT00000391532.1	22	0.00	0	T	NM_003697		55761969	55761969	-1	no_errors	ENST00000278409	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.003	C
OR5T2	219464	genome.wustl.edu	37	11	56000014	56000014	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:56000014G>A	ENST00000313264.4	-	1	723	c.648C>T	c.(646-648)gtC>gtT	p.V216V		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					TATCACAAAAGACACGCCTAA	0.423																																						dbGAP											0													170.0	153.0	158.0					11																	56000014		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.648C>T	11.37:g.56000014G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGX5|Q6IFC8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V216	ENST00000313264.4	37	c.648	CCDS31523.1	11																																																																																			OR5T2	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181718		0.423	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	HGNC	protein_coding	OTTHUMT00000391598.1	94	0.00	0	G	NM_001004746		56000014	56000014	-1	no_errors	ENST00000313264	ensembl	human	known	69_37n	silent	97	24.81	32	SNP	0.179	A
OS9	10956	genome.wustl.edu	37	12	58088532	58088532	+	Splice_Site	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:58088532G>A	ENST00000315970.7	+	2	203		c.e2-1		OS9_ENST00000389146.6_Splice_Site|OS9_ENST00000389142.5_Splice_Site|OS9_ENST00000413095.2_Splice_Site|OS9_ENST00000439210.2_Intron|OS9_ENST00000435406.2_Splice_Site|OS9_ENST00000551035.1_Splice_Site|OS9_ENST00000257966.8_Splice_Site|RP11-571M6.7_ENST00000549477.1_RNA|OS9_ENST00000552285.1_Splice_Site	NM_001017958.2|NM_006812.3	NP_001017958.1|NP_006803.1	Q13438	OS9_HUMAN	osteosarcoma amplified 9, endoplasmic reticulum lectin						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|protein retention in ER lumen (GO:0006621)|protein targeting (GO:0006605)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum lumen (GO:0005788)|Hrd1p ubiquitin ligase complex (GO:0000836)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|urinary_tract(1)	21	all_neural(12;0.00548)|Glioma(12;0.0126)|Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			TTCTTTCCCAGAGCCAATCTT	0.542																																						dbGAP											0													63.0	55.0	58.0					12																	58088532		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002806	CCDS31843.1, CCDS31844.1, CCDS31845.1, CCDS31846.1, CCDS58246.1, CCDS58247.1, CCDS58248.1, CCDS58249.1	12q13	2009-08-26	2009-08-26						16994	protein-coding gene	gene with protein product	"""endoplasmic reticulum lectin 2"", ""erlectin 2"""	609677				8634085, 9498564, 19346256, 18264092	Standard	NM_006812		Approved	OS-9, ERLEC2	uc001spj.3	Q13438	OTTHUMG00000170284	ENST00000315970.7:c.163-1G>A	12.37:g.58088532G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDD1|A6NFR7|A6NLB2|A8K5Q9|B4DE28|B4DPX1|B4E1I6|E7ENT8|E7EW91|F8VUH2|G3XA88|O00579|Q6IBL2|Q8IZ58|Q9BW99	Splice_Site	SNP	-	e2-1	ENST00000315970.7	37	c.163-1	CCDS31843.1	12	.	.	.	.	.	.	.	.	.	.	G	22.1	4.242521	0.79912	.	.	ENSG00000135506	ENST00000552285;ENST00000315970;ENST00000547079;ENST00000389146;ENST00000413095;ENST00000551035;ENST00000257966;ENST00000435406;ENST00000550372;ENST00000389142	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.7487	0.85479	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OS9	56374799	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	7.899000	0.87370	2.478000	0.83669	0.313000	0.20887	.	OS9	-	-	ENSG00000135506		0.542	OS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OS9	HGNC	protein_coding	OTTHUMT00000408344.1	37	0.00	0	G	NM_006812	Intron	58088532	58088532	+1	no_errors	ENST00000315970	ensembl	human	known	69_37n	splice_site	21	32.26	10	SNP	1.000	A
OXER1	165140	genome.wustl.edu	37	2	42990854	42990854	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:42990854C>G	ENST00000378661.2	-	1	547	c.466G>C	c.(466-468)Gag>Cag	p.E156Q		NM_148962.4	NP_683765.1	Q8TDS5	OXER1_HUMAN	oxoeicosanoid (OXE) receptor 1	156					G-protein coupled receptor signaling pathway (GO:0007186)|regulation of cAMP biosynthetic process (GO:0030817)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	5(S)-hydroxyperoxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050648)|5-hydroxy-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050647)|5-oxo-6E,8Z,11Z,14Z-icosatetraenoic acid binding (GO:0050646)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	10						CGCCAGGTCTCATGGAGGAGG	0.612																																						dbGAP											0													74.0	62.0	66.0					2																	42990854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB083055	CCDS1810.1	2p22.1	2012-08-10			ENSG00000162881	ENSG00000162881		"""GPCR / Class A : Leukotriene receptors"""	24884	protein-coding gene	gene with protein product	"""5-oxo-ETE acid G-protein-coupled receptor 1"""					12065583, 15001665	Standard	NM_148962		Approved	GPCR, TG1019, GPR170	uc002rss.3	Q8TDS5	OTTHUMG00000128643	ENST00000378661.2:c.466G>C	2.37:g.42990854C>G	ENSP00000367930:p.Glu156Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WP7|Q8NGW4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.E156Q	ENST00000378661.2	37	c.466	CCDS1810.1	2	.	.	.	.	.	.	.	.	.	.	C	5.611	0.297531	0.10622	.	.	ENSG00000162881	ENST00000378661	T	0.37584	1.19	4.09	3.13	0.36017	GPCR, rhodopsin-like superfamily (1);	0.875838	0.09520	U	0.791088	T	0.20740	0.0499	N	0.11756	0.17	0.09310	N	1	P	0.34757	0.467	B	0.38296	0.27	T	0.16778	-1.0391	10	0.14656	T	0.56	.	6.656	0.22988	0.0:0.6813:0.2024:0.1163	.	156	Q8TDS5	OXER1_HUMAN	Q	156	ENSP00000367930:E156Q	ENSP00000367930:E156Q	E	-	1	0	OXER1	42844358	0.000000	0.05858	0.064000	0.19789	0.263000	0.26337	-1.007000	0.03667	1.828000	0.53243	0.555000	0.69702	GAG	OXER1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000162881		0.612	OXER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXER1	HGNC	protein_coding	OTTHUMT00000250514.1	39	0.00	0	C	NM_148962		42990854	42990854	-1	no_errors	ENST00000378661	ensembl	human	known	69_37n	missense	26	48.00	24	SNP	0.003	G
PANK3	79646	genome.wustl.edu	37	5	167984582	167984582	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:167984582G>A	ENST00000239231.6	-	7	1423	c.1107C>T	c.(1105-1107)ttC>ttT	p.F369F	PANK3_ENST00000520504.1_5'Flank	NM_024594.3	NP_078870.1	Q9H999	PANK3_HUMAN	pantothenate kinase 3	369					coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			NS(1)|cervix(2)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	16	Renal(175;0.000159)|Lung NSC(126;0.0441)|all_lung(126;0.0909)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.0989)|OV - Ovarian serous cystadenocarcinoma(192;0.147)|Epithelial(171;0.188)		TGCTTTAGCTGAAATTTGGCA	0.378																																						dbGAP											0													129.0	117.0	121.0					5																	167984582		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022961	CCDS4368.1	5q35.1	2008-02-05			ENSG00000120137	ENSG00000120137			19365	protein-coding gene	gene with protein product		606161				11479594	Standard	NM_024594		Approved	FLJ12899	uc003lzz.2	Q9H999	OTTHUMG00000130410	ENST00000239231.6:c.1107C>T	5.37:g.167984582G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQL1|Q53FJ9|Q7RTX4	Silent	SNP	pfam_Type_II_PanK,tigrfam_Type_II_PanK	p.F369	ENST00000239231.6	37	c.1107	CCDS4368.1	5																																																																																			PANK3	-	NULL	ENSG00000120137		0.378	PANK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK3	HGNC	protein_coding	OTTHUMT00000252793.2	98	0.00	0	G	NM_024594		167984582	167984582	-1	no_errors	ENST00000239231	ensembl	human	known	69_37n	silent	67	24.72	22	SNP	1.000	A
PAPPA	5069	genome.wustl.edu	37	9	118950076	118950076	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:118950076G>A	ENST00000328252.3	+	2	1428	c.1059G>A	c.(1057-1059)gtG>gtA	p.V353V	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	353	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						CCAAGGTGGTGCGCTACCGCG	0.567																																						dbGAP											0													56.0	52.0	54.0					9																	118950076		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1059G>A	9.37:g.118950076G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.V353	ENST00000328252.3	37	c.1059	CCDS6813.1	9																																																																																			PAPPA	-	NULL	ENSG00000182752		0.567	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	26	0.00	0	G	NM_002581		118950076	118950076	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	silent	22	26.67	8	SNP	0.916	A
PCDHGA2	56113	genome.wustl.edu	37	5	140718650	140718650	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:140718650G>C	ENST00000394576.2	+	1	112	c.112G>C	c.(112-114)Gag>Cag	p.E38Q	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	38	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTGCGGGAAGAGATCGACAG	0.597											OREG0016854	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													72.0	72.0	72.0					5																	140718650		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.112G>C	5.37:g.140718650G>C	ENSP00000378077:p.Glu38Gln	Somatic	1658	WXS	Illumina GAIIx	Phase_IV	Q52LL6|Q9Y5D5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E38Q	ENST00000394576.2	37	c.112	CCDS47289.1	5	.	.	.	.	.	.	.	.	.	.	.	16.90	3.251341	0.59212	.	.	ENSG00000081853	ENST00000394576	T	0.60040	0.22	5.07	5.07	0.68467	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	0.000000	0.41605	U	0.000860	D	0.88396	0.6425	H	0.99922	4.955	0.37232	D	0.905738	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.95221	0.8334	10	0.87932	D	0	.	18.4118	0.90554	0.0:0.0:1.0:0.0	.	38;38	Q9Y5H1-2;Q9Y5H1	.;PCDG2_HUMAN	Q	38	ENSP00000378077:E38Q	ENSP00000378077:E38Q	E	+	1	0	PCDHGA2	140698834	1.000000	0.71417	0.908000	0.35775	0.051000	0.14879	9.784000	0.99039	2.520000	0.84964	0.585000	0.79938	GAG	PCDHGA2	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin	ENSG00000081853		0.597	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	57	0.00	0	G	NM_018915		140718650	140718650	+1	no_errors	ENST00000394576	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	1.000	C
PCDHGB7	56099	genome.wustl.edu	37	5	140798462	140798462	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:140798462G>A	ENST00000398594.2	+	1	1036	c.1036G>A	c.(1036-1038)Gaa>Aaa	p.E346K	PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA10_ENST00000398610.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	346	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAACAGCCCAGAAATAATCAT	0.433																																						dbGAP											0													77.0	71.0	73.0					5																	140798462		1883	4107	5990	-	-	-	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.1036G>A	5.37:g.140798462G>A	ENSP00000381594:p.Glu346Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E346K	ENST00000398594.2	37	c.1036	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	17.54	3.416353	0.62511	.	.	ENSG00000254122	ENST00000398594	T	0.20738	2.05	5.6	5.6	0.85130	Cadherin (2);Cadherin-like (1);	0.000000	0.33401	U	0.004952	T	0.44808	0.1311	L	0.59436	1.845	0.24829	N	0.992534	D;D	0.61697	0.982;0.99	P;D	0.67725	0.839;0.953	T	0.26710	-1.0095	10	0.66056	D	0.02	.	19.6023	0.95568	0.0:0.0:1.0:0.0	.	346;346	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	K	346	ENSP00000381594:E346K	ENSP00000381594:E346K	E	+	1	0	PCDHGB7	140778646	0.806000	0.28996	1.000000	0.80357	0.882000	0.50991	3.777000	0.55364	2.653000	0.90120	0.561000	0.74099	GAA	PCDHGB7	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000254122		0.433	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	61	0.00	0	G	NM_018927		140798462	140798462	+1	no_errors	ENST00000398594	ensembl	human	known	69_37n	missense	44	34.33	23	SNP	0.988	A
PCLO	27445	genome.wustl.edu	37	7	82467571	82467571	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:82467571C>T	ENST00000333891.9	-	15	14522	c.14185G>A	c.(14185-14187)Gac>Aac	p.D4729N	PCLO_ENST00000423517.2_Missense_Mutation_p.D4729N|PCLO_ENST00000426442.2_5'UTR	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						ACAAAAGGGTCAGAATAACCA	0.343																																						dbGAP											0													71.0	69.0	70.0					7																	82467571		1833	4078	5911	-	-	-	SO:0001583	missense	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.14185G>A	7.37:g.82467571C>T	ENSP00000334319:p.Asp4729Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.D4729N	ENST00000333891.9	37	c.14185	CCDS47630.1	7	.	.	.	.	.	.	.	.	.	.	C	19.38	3.817259	0.70912	.	.	ENSG00000186472	ENST00000333891;ENST00000423517;ENST00000380195	T;T	0.58652	0.32;0.32	5.58	5.58	0.84498	.	.	.	.	.	T	0.68513	0.3009	L	0.31578	0.945	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	T	0.71593	-0.4546	9	0.87932	D	0	.	19.5841	0.95484	0.0:1.0:0.0:0.0	.	4729;4729;159;226	Q9Y6V0-5;Q9Y6V0-6;Q9Y6V0-3;Q32P40	.;.;.;.	N	4729;4729;225	ENSP00000334319:D4729N;ENSP00000388393:D4729N	ENSP00000334319:D4729N	D	-	1	0	PCLO	82305507	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	7.188000	0.77739	2.604000	0.88044	0.655000	0.94253	GAC	PCLO	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000186472		0.343	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	91	0.00	0	C	NM_014510		82467571	82467571	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	missense	65	20.73	17	SNP	1.000	T
PCNX	22990	genome.wustl.edu	37	14	71540426	71540426	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:71540426C>T	ENST00000304743.2	+	27	5463	c.5017C>T	c.(5017-5019)Ctg>Ttg	p.L1673L	PCNX_ENST00000238570.5_Silent_p.L1601L|PCNX_ENST00000439984.3_Silent_p.L1562L	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1673						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		AAAGTACATTCTGGAGGGTTA	0.428																																						dbGAP											0													224.0	205.0	211.0					14																	71540426		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.5017C>T	14.37:g.71540426C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR6|O94897|Q96AI7|Q9Y2J9	Silent	SNP	pfam_Pecanex	p.L1673	ENST00000304743.2	37	c.5017	CCDS9806.1	14																																																																																			PCNX	-	NULL	ENSG00000100731		0.428	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	106	0.00	0	C	NM_014982		71540426	71540426	+1	no_errors	ENST00000304743	ensembl	human	known	69_37n	silent	76	34.48	40	SNP	1.000	T
PDE4B	5142	genome.wustl.edu	37	1	66834514	66834514	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:66834514C>T	ENST00000329654.4	+	16	1894	c.1707C>T	c.(1705-1707)acC>acT	p.T569T	PDE4B_ENST00000423207.2_Silent_p.T554T|PDE4B_ENST00000371049.3_Silent_p.T569T|PDE4B_ENST00000371045.5_Silent_p.T397T|PDE4B_ENST00000480109.2_Silent_p.T336T	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	569					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	GCAACCCCACCAAGTCCTTGG	0.468																																						dbGAP											0													112.0	103.0	106.0					1																	66834514		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.1707C>T	1.37:g.66834514C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.T569	ENST00000329654.4	37	c.1707	CCDS632.1	1																																																																																			PDE4B	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	ENSG00000184588		0.468	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	66	0.00	0	C	NM_002600		66834514	66834514	+1	no_errors	ENST00000329654	ensembl	human	known	69_37n	silent	23	50.00	23	SNP	1.000	T
PDS5B	23047	genome.wustl.edu	37	13	33281154	33281154	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:33281154G>A	ENST00000315596.10	+	18	2126	c.1940G>A	c.(1939-1941)aGa>aAa	p.R647K		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	647					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		CAAGCCATCAGAGCAGGTCTT	0.318																																						dbGAP											0													102.0	99.0	100.0					13																	33281154		1877	4105	5982	-	-	-	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1940G>A	13.37:g.33281154G>A	ENSP00000313851:p.Arg647Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R647K	ENST00000315596.10	37	c.1940	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	G	32	5.157433	0.94686	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.91	5.91	0.95273	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64571	0.2610	L	0.51422	1.61	0.58432	D	0.999998	P	0.40660	0.726	P	0.46026	0.501	T	0.56372	-0.7990	9	0.12430	T	0.62	1.0E-4	20.3011	0.98612	0.0:0.0:1.0:0.0	.	647	Q9NTI5	PDS5B_HUMAN	K	647	.	ENSP00000313851:R647K	R	+	2	0	PDS5B	32179154	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	9.700000	0.98707	2.804000	0.96469	0.650000	0.86243	AGA	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.318	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	92	0.00	0	G	NM_015032		33281154	33281154	+1	no_errors	ENST00000315596	ensembl	human	known	69_37n	missense	45	19.64	11	SNP	1.000	A
PENK	5179	genome.wustl.edu	37	8	57354326	57354326	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:57354326G>A	ENST00000314922.3	-	2	385	c.309C>T	c.(307-309)ttC>ttT	p.F103F	PENK_ENST00000451791.2_Silent_p.F103F|PENK_ENST00000523274.1_5'UTR	NM_006211.3	NP_006202.1	P01210	PENK_HUMAN	proenkephalin	103					aggressive behavior (GO:0002118)|behavioral fear response (GO:0001662)|locomotory behavior (GO:0007626)|neuropeptide signaling pathway (GO:0007218)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|startle response (GO:0001964)	extracellular region (GO:0005576)	neuropeptide hormone activity (GO:0005184)			central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	21		all_lung(136;0.229)	Epithelial(17;0.000873)|all cancers(17;0.0069)			ACCTTTTCATGAAGCCCCCAT	0.488																																						dbGAP											0													111.0	104.0	107.0					8																	57354326		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6168.1	8q23-q24	2013-02-26				ENSG00000181195		"""Endogenous ligands"""	8831	protein-coding gene	gene with protein product	"""preproenkephalin"""	131330				6281660	Standard	NM_006211		Approved		uc003xsz.2	P01210		ENST00000314922.3:c.309C>T	8.37:g.57354326G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC23|Q6FHC6|Q6FHE6	Silent	SNP	pfam_Opioid_neupept,prints_Proenkphlin_A,prints_Opioid_neupept	p.F103	ENST00000314922.3	37	c.309	CCDS6168.1	8																																																																																			PENK	-	prints_Opioid_neupept	ENSG00000181195		0.488	PENK-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PENK	HGNC	protein_coding	OTTHUMT00000378645.1	84	0.00	0	G			57354326	57354326	-1	no_errors	ENST00000314922	ensembl	human	known	69_37n	silent	54	29.87	23	SNP	1.000	A
PGM2	55276	genome.wustl.edu	37	4	37841763	37841763	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:37841763G>C	ENST00000381967.4	+	6	701	c.601G>C	c.(601-603)Gaa>Caa	p.E201Q	PGM2_ENST00000544359.1_Missense_Mutation_p.E62Q|PGM2_ENST00000537241.1_Missense_Mutation_p.E41Q	NM_018290.3	NP_060760.2	Q96G03	PGM2_HUMAN	phosphoglucomutase 2	201					carbohydrate metabolic process (GO:0005975)|deoxyribose phosphate catabolic process (GO:0046386)|galactose catabolic process (GO:0019388)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	magnesium ion binding (GO:0000287)|phosphoglucomutase activity (GO:0004614)|phosphopentomutase activity (GO:0008973)			breast(1)|kidney(2)|large_intestine(3)|lung(10)|ovary(2)|urinary_tract(1)	19						AGAAAATCTAGAACCGTGGCC	0.423																																						dbGAP											0													110.0	119.0	116.0					4																	37841763		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC010087	CCDS3443.1	4p14	2012-10-02			ENSG00000169299	ENSG00000169299	5.4.2.2		8906	protein-coding gene	gene with protein product	"""phosphopentomutase"""	172000				9549096	Standard	NM_018290		Approved	FLJ10983	uc011byb.1	Q96G03	OTTHUMG00000097813	ENST00000381967.4:c.601G>C	4.37:g.37841763G>C	ENSP00000371393:p.Glu201Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0G8|Q53FP5|Q5QTR0|Q9H0P9|Q9NV22	Missense_Mutation	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III,prints_Alpha-D-phosphohexomutase_SF	p.E201Q	ENST00000381967.4	37	c.601	CCDS3443.1	4	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440331	0.63067	.	.	ENSG00000169299	ENST00000381967;ENST00000544359;ENST00000537241	T;T	0.64991	-0.13;1.82	5.95	5.11	0.69529	Alpha-D-phosphohexomutase, alpha/beta/alpha I/II/III (2);	0.041945	0.85682	D	0.000000	T	0.65995	0.2745	M	0.69523	2.12	0.80722	D	1	B;B	0.32302	0.036;0.363	B;B	0.38327	0.091;0.271	T	0.65882	-0.6060	10	0.41790	T	0.15	-14.5789	14.9152	0.70792	0.068:0.0:0.932:0.0	.	201;62	Q96G03;B4E0G8	PGM2_HUMAN;.	Q	201;62;41	ENSP00000371393:E201Q;ENSP00000437342:E41Q	ENSP00000371393:E201Q	E	+	1	0	PGM2	37518158	1.000000	0.71417	0.955000	0.39395	0.741000	0.42261	7.941000	0.87700	1.533000	0.49186	0.650000	0.86243	GAA	PGM2	-	superfamily_A-D-PHexomutase_a/b/a-I/II/III	ENSG00000169299		0.423	PGM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM2	HGNC	protein_coding	OTTHUMT00000215079.2	47	0.00	0	G	NM_018290		37841763	37841763	+1	no_errors	ENST00000381967	ensembl	human	known	69_37n	missense	48	28.36	19	SNP	1.000	C
PIK3C2B	5287	genome.wustl.edu	37	1	204412635	204412635	+	Silent	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:204412635C>A	ENST00000367187.3	-	20	3514	c.2958G>T	c.(2956-2958)ctG>ctT	p.L986L	PIK3C2B_ENST00000424712.2_Silent_p.L958L	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	986					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			ACTCTTCTCTCAGCCCCTTGC	0.592																																						dbGAP											0													91.0	93.0	92.0					1																	204412635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2958G>T	1.37:g.204412635C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95666|Q5SW99	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.L986	ENST00000367187.3	37	c.2958	CCDS1446.1	1																																																																																			PIK3C2B	-	pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,smart_PInositide-3_kin_accessory_dom	ENSG00000133056		0.592	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	28	0.00	0	C	NM_002646		204412635	204412635	-1	no_errors	ENST00000367187	ensembl	human	known	69_37n	silent	36	35.71	20	SNP	0.981	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	106	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	52	31.58	24	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:178938934G>A	ENST00000263967.3	+	14	2333	c.2176G>A	c.(2176-2178)Gaa>Aaa	p.E726K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	726			E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E726K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAGAAGGATGAAACACAAAA	0.428		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	8	Substitution - Missense(8)	lung(4)|large_intestine(2)|breast(2)											89.0	78.0	82.0					3																	178938934		1917	4118	6035	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2176G>A	3.37:g.178938934G>A	ENSP00000263967:p.Glu726Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E726K	ENST00000263967.3	37	c.2176	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308869	0.60305	.	.	ENSG00000121879	ENST00000263967	T	0.80653	-1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.166180	0.38778	U	0.001568	T	0.73450	0.3588	L	0.36672	1.1	0.80722	D	1	P	0.46064	0.872	B	0.42738	0.396	T	0.71401	-0.4604	10	0.02654	T	1	-19.3819	19.7612	0.96319	0.0:0.0:1.0:0.0	.	726	P42336	PK3CA_HUMAN	K	726	ENSP00000263967:E726K	ENSP00000263967:E726K	E	+	1	0	PIK3CA	180421628	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.476000	0.97823	2.670000	0.90874	0.655000	0.94253	GAA	PIK3CA	-	superfamily_Kinase-like_dom	ENSG00000121879		0.428	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	87	0.00	0	G			178938934	178938934	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	43	31.75	20	SNP	1.000	A
PIK3R1	5295	genome.wustl.edu	37	5	67590481	67590481	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:67590481G>A	ENST00000521381.1	+	12	2159	c.1543G>A	c.(1543-1545)Gaa>Aaa	p.E515K	PIK3R1_ENST00000396611.1_Missense_Mutation_p.E515K|PIK3R1_ENST00000521657.1_Missense_Mutation_p.E515K|PIK3R1_ENST00000274335.5_Missense_Mutation_p.E515K|PIK3R1_ENST00000523872.1_Missense_Mutation_p.E152K|PIK3R1_ENST00000336483.5_Missense_Mutation_p.E245K|PIK3R1_ENST00000320694.8_Missense_Mutation_p.E215K	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	515					B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	GTTTAAACGTGAAGGCAATGA	0.358			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																												dbGAP		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)											70.0	72.0	71.0					5																	67590481		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1543G>A	5.37:g.67590481G>A	ENSP00000428056:p.Glu515Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.E515K	ENST00000521381.1	37	c.1543	CCDS3993.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.840551	0.97009	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000336483;ENST00000519025;ENST00000523872	T;T;T;T;D;D;T;D	0.82984	-0.59;-0.59;-0.45;-0.59;-1.59;-1.61;0.1;-1.67	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	D	0.92179	0.7520	M	0.87547	2.89	0.80722	D	1	D;P;P;D	0.76494	0.985;0.76;0.812;0.999	P;P;P;D	0.69479	0.761;0.541;0.505;0.964	D	0.92748	0.6213	10	0.66056	D	0.02	-26.6281	19.2559	0.93945	0.0:0.0:1.0:0.0	.	185;245;215;515	B7Z2N8;P27986-2;P27986-3;P27986	.;.;.;P85A_HUMAN	K	515;515;515;515;215;245;188;152	ENSP00000428056:E515K;ENSP00000429277:E515K;ENSP00000379855:E515K;ENSP00000274335:E515K;ENSP00000323512:E215K;ENSP00000338554:E245K;ENSP00000429156:E188K;ENSP00000430098:E152K	ENSP00000274335:E515K	E	+	1	0	PIK3R1	67626237	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	9.574000	0.98184	2.861000	0.98227	0.650000	0.86243	GAA	PIK3R1	-	superfamily_Guanylate-bd_C,prints_PI3kinase_P85	ENSG00000145675		0.358	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2	72	0.00	0	G	NM_181504		67590481	67590481	+1	no_errors	ENST00000396611	ensembl	human	known	69_37n	missense	46	31.34	21	SNP	1.000	A
PIP4K2B	8396	genome.wustl.edu	37	17	36955585	36955585	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:36955585C>T	ENST00000269554.3	-	1	573	c.93G>A	c.(91-93)caG>caA	p.Q31Q	PIP4K2B_ENST00000311500.6_5'UTR	NM_003559.4	NP_003550.1	P78356	PI42B_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, beta	31					cell surface receptor signaling pathway (GO:0007166)|intracellular signal transduction (GO:0035556)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|receptor signaling protein activity (GO:0005057)			endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(8)|ovary(1)	19						GCTTCACTTTCTGGCACACGA	0.652																																						dbGAP											0													78.0	75.0	76.0					17																	36955585		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U85245	CCDS11329.1	17q21.2	2007-08-14	2007-08-14	2007-08-14		ENSG00000276293	2.7.1.149		8998	protein-coding gene	gene with protein product		603261	"""phosphatidylinositol-4-phosphate 5-kinase, type II, beta"""	PIP5K2B		9038203, 14691457, 9367159	Standard	NM_003559		Approved	PIP5KIIB, PIP5KIIbeta	uc002hqs.3	P78356		ENST00000269554.3:c.93G>A	17.37:g.36955585C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5U0E8|Q8TBP2	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.Q31	ENST00000269554.3	37	c.93	CCDS11329.1	17																																																																																			PIP4K2B	-	NULL	ENSG00000141720		0.652	PIP4K2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2B	HGNC	protein_coding	OTTHUMT00000256791.1	20	0.00	0	C	NM_003559		36955585	36955585	-1	no_errors	ENST00000269554	ensembl	human	known	69_37n	silent	59	22.37	17	SNP	1.000	T
PKP3	11187	genome.wustl.edu	37	11	403681	403681	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:403681C>T	ENST00000331563.2	+	10	2063	c.1987C>T	c.(1987-1989)Cgt>Tgt	p.R663C		NM_007183.2	NP_009114.1	Q9Y446	PKP3_HUMAN	plakophilin 3	663					desmosome assembly (GO:0002159)|establishment of protein localization to plasma membrane (GO:0090002)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|desmosome (GO:0030057)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	cell adhesion molecule binding (GO:0050839)			breast(1)|central_nervous_system(1)|endometrium(3)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11		all_cancers(49;3.02e-09)|all_epithelial(84;2.09e-06)|Breast(177;0.000162)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.0538)|all_lung(207;0.0713)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CCTGCTAGACCGTGTCAGGAC	0.657																																						dbGAP											0													78.0	68.0	71.0					11																	403681		2182	4282	6464	-	-	-	SO:0001583	missense	0			Z98265	CCDS7695.1	11p15	2013-02-14			ENSG00000184363	ENSG00000184363		"""Armadillo repeat containing"""	9025	protein-coding gene	gene with protein product		605561				10374265	Standard	XM_005252760		Approved		uc001lpc.3	Q9Y446	OTTHUMG00000119068	ENST00000331563.2:c.1987C>T	11.37:g.403681C>T	ENSP00000331678:p.Arg663Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	F8J390|Q53EX8	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R663C	ENST00000331563.2	37	c.1987	CCDS7695.1	11	.	.	.	.	.	.	.	.	.	.	c	11.10	1.540150	0.27563	.	.	ENSG00000184363	ENST00000331563	T	0.48201	0.82	3.85	2.92	0.33932	Armadillo-like helical (1);Armadillo-type fold (1);	0.161832	0.42548	D	0.000699	T	0.32734	0.0839	L	0.40543	1.245	0.58432	D	0.999993	P	0.39551	0.678	B	0.26864	0.074	T	0.31194	-0.9952	10	0.87932	D	0	-14.452	11.8159	0.52211	0.3169:0.6831:0.0:0.0	.	663	Q9Y446	PKP3_HUMAN	C	663	ENSP00000331678:R663C	ENSP00000331678:R663C	R	+	1	0	PKP3	393681	1.000000	0.71417	0.978000	0.43139	0.056000	0.15407	3.445000	0.52921	0.961000	0.38030	0.306000	0.20318	CGT	PKP3	-	superfamily_ARM-type_fold	ENSG00000184363		0.657	PKP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP3	HGNC	protein_coding	OTTHUMT00000239281.1	27	0.00	0	C	NM_007183		403681	403681	+1	no_errors	ENST00000331563	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	1.000	T
PLEKHG7	440107	genome.wustl.edu	37	12	93149662	93149662	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:93149662G>C	ENST00000344636.3	+	7	736	c.552G>C	c.(550-552)gaG>gaC	p.E184D		NM_001004330.2	NP_001004330.1	Q6ZR37	PKHG7_HUMAN	pleckstrin homology domain containing, family G (with RhoGef domain) member 7	184							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)	17						ATCTACAGGAGATTATAGTGT	0.358																																						dbGAP											0													75.0	81.0	79.0					12																	93149662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK128530	CCDS31873.1	12q22	2013-01-11				ENSG00000187510		"""Pleckstrin homology (PH) domain containing"""	33829	protein-coding gene	gene with protein product							Standard	NM_001004330		Approved	FLJ46688	uc001tcj.2	Q6ZR37		ENST00000344636.3:c.552G>C	12.37:g.93149662G>C	ENSP00000344961:p.Glu184Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNR7	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E184D	ENST00000344636.3	37	c.552	CCDS31873.1	12	.	.	.	.	.	.	.	.	.	.	G	12.71	2.020372	0.35606	.	.	ENSG00000187510	ENST00000344636	T	0.68624	-0.34	5.29	3.4	0.38934	Dbl homology (DH) domain (2);	0.148735	0.64402	N	0.000013	T	0.53867	0.1823	L	0.45581	1.43	0.38384	D	0.945215	B	0.23490	0.086	B	0.20955	0.032	T	0.50092	-0.8868	10	0.22109	T	0.4	-28.1763	8.2444	0.31680	0.1424:0.1313:0.7263:0.0	.	184	Q6ZR37	PKHG7_HUMAN	D	184	ENSP00000344961:E184D	ENSP00000344961:E184D	E	+	3	2	PLEKHG7	91673793	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.159000	0.31749	1.178000	0.42870	0.561000	0.74099	GAG	PLEKHG7	-	superfamily_DH-domain	ENSG00000187510		0.358	PLEKHG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHG7	HGNC	protein_coding	OTTHUMT00000407288.1	48	0.00	0	G	NM_001004330		93149662	93149662	+1	no_errors	ENST00000344636	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	C
PLOD1	5351	genome.wustl.edu	37	1	12030796	12030796	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:12030796G>C	ENST00000196061.4	+	17	1852	c.1825G>C	c.(1825-1827)Gag>Cag	p.E609Q	PLOD1_ENST00000376369.3_Missense_Mutation_p.E656Q	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1	609					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	GATCGGCTTTGAGCGGGAGTG	0.577																																						dbGAP											0													113.0	95.0	101.0					1																	12030796		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1825G>C	1.37:g.12030796G>C	ENSP00000196061:p.Glu609Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR87|Q96AV9|Q9H132	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.E656Q	ENST00000196061.4	37	c.1966	CCDS142.1	1	.	.	.	.	.	.	.	.	.	.	G	24.0	4.484216	0.84854	.	.	ENSG00000083444	ENST00000414311;ENST00000376369;ENST00000196061	T;T	0.66815	-0.23;-0.23	5.94	5.94	0.96194	Prolyl 4-hydroxylase, alpha subunit (1);	0.000000	0.85682	D	0.000000	T	0.80082	0.4558	L	0.52905	1.665	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.995	T	0.79577	-0.1746	10	0.62326	D	0.03	.	19.3514	0.94389	0.0:0.0:1.0:0.0	.	656;609	B4DR87;Q02809	.;PLOD1_HUMAN	Q	273;656;609	ENSP00000365548:E656Q;ENSP00000196061:E609Q	ENSP00000196061:E609Q	E	+	1	0	PLOD1	11953383	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	7.904000	0.87408	2.826000	0.97356	0.561000	0.74099	GAG	PLOD1	-	smart_Pro_4_hyd_alph	ENSG00000083444		0.577	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	52	0.00	0	G	NM_000302		12030796	12030796	+1	no_errors	ENST00000376369	ensembl	human	known	69_37n	missense	27	57.81	37	SNP	1.000	C
PLS3	5358	genome.wustl.edu	37	X	114868384	114868384	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:114868384C>T	ENST00000420625.2	+	6	707	c.573C>T	c.(571-573)ttC>ttT	p.F191F	PLS3_ENST00000537301.1_Silent_p.F169F|PLS3_ENST00000355899.3_Silent_p.F191F|PLS3_ENST00000539310.1_Silent_p.F146F|PLS3_ENST00000289290.3_Silent_p.F146F	NM_001136025.3|NM_001172335.1|NM_001282338.1	NP_001129497.1|NP_001165806.1|NP_001269267.1	P13797	PLST_HUMAN	plastin 3	191	Actin-binding 1.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.				bone development (GO:0060348)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(11)	26						TTACACCCTTCATCATTCAGG	0.388																																					Colon(160;1047 1864 8490 12969 29601)	dbGAP											0													226.0	199.0	208.0					X																	114868384		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L05491	CCDS14568.1, CCDS65312.1	Xq23	2013-01-10	2010-02-10		ENSG00000102024	ENSG00000102024		"""EF-hand domain containing"""	9091	protein-coding gene	gene with protein product		300131	"""plastin 3 (T isoform)"""			8428952	Standard	NM_005032		Approved	T-plastin	uc004eqe.3	P13797	OTTHUMG00000022237	ENST00000420625.2:c.573C>T	X.37:g.114868384C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K579|B1AQ09|B4DGB4|B7Z6M1|Q86YI6	Silent	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.F191	ENST00000420625.2	37	c.573	CCDS14568.1	X																																																																																			PLS3	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000102024		0.388	PLS3-201	KNOWN	basic|CCDS	protein_coding	PLS3	HGNC	protein_coding	OTTHUMT00000057976.2	136	0.00	0	C			114868384	114868384	+1	no_errors	ENST00000355899	ensembl	human	known	69_37n	silent	87	26.27	31	SNP	1.000	T
PLXNA1	5361	genome.wustl.edu	37	3	126751260	126751260	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:126751260C>G	ENST00000393409.2	+	29	5262	c.5262C>G	c.(5260-5262)atC>atG	p.I1754M	PLXNA1_ENST00000251772.4_Missense_Mutation_p.I1731M|PLXNA1_ENST00000505278.1_3'UTR	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1754					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TGAACGTGATCAAGAACCCAC	0.597																																						dbGAP											0													118.0	108.0	111.0					3																	126751260		2203	4300	6503	-	-	-	SO:0001583	missense	0			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.5262C>G	3.37:g.126751260C>G	ENSP00000377061:p.Ile1754Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.I1754M	ENST00000393409.2	37	c.5262	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	C	16.69	3.193594	0.58017	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.29142	1.58;1.58	3.98	3.09	0.35607	Plexin, cytoplasmic RasGAP domain (1);Rho GTPase activation protein (1);	0.079266	0.51477	D	0.000081	T	0.52224	0.1721	M	0.85041	2.73	0.52501	D	0.999953	D;D	0.63046	0.991;0.992	D;D	0.72338	0.977;0.977	T	0.53208	-0.8471	10	0.87932	D	0	.	4.8713	0.13635	0.0:0.5745:0.0:0.4255	.	368;1754	Q6ZTY7;Q9UIW2	.;PLXA1_HUMAN	M	1754;1731	ENSP00000377061:I1754M;ENSP00000251772:I1731M	ENSP00000251772:I1731M	I	+	3	3	PLXNA1	128233950	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	1.695000	0.37763	0.974000	0.38366	0.467000	0.42956	ATC	PLXNA1	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000114554		0.597	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	64	0.00	0	C	NM_032242		126751260	126751260	+1	no_errors	ENST00000393409	ensembl	human	known	69_37n	missense	79	26.85	29	SNP	1.000	G
PMS1	5378	genome.wustl.edu	37	2	190660667	190660667	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:190660667G>A	ENST00000441310.2	+	3	538	c.305G>A	c.(304-306)tGt>tAt	p.C102Y	PMS1_ENST00000409985.1_Missense_Mutation_p.C102Y|PMS1_ENST00000374826.4_Missense_Mutation_p.C102Y|PMS1_ENST00000432292.3_Intron|PMS1_ENST00000409823.3_Missense_Mutation_p.C102Y|PMS1_ENST00000418224.3_5'UTR|PMS1_ENST00000447232.2_Missense_Mutation_p.C102Y|PMS1_ENST00000421722.1_3'UTR	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	102					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			TCAATTTGTTGTATAGCTGAG	0.328			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														dbGAP	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	0													107.0	105.0	105.0					2																	190660667		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.305G>A	2.37:g.190660667G>A	ENSP00000406490:p.Cys102Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_HMG_superfamily,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily,tigrfam_DNA_mismatch_repair_N	p.C102Y	ENST00000441310.2	37	c.305	CCDS2302.1	2	.	.	.	.	.	.	.	.	.	.	G	14.21	2.467951	0.43839	.	.	ENSG00000064933	ENST00000441310;ENST00000409985;ENST00000409823;ENST00000374826;ENST00000424766;ENST00000447232	D;D;D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51;-3.51;-3.51	5.93	4.08	0.47627	DNA mismatch repair protein, N-terminal (1);ATPase-like, ATP-binding domain (4);	0.302579	0.41294	D	0.000913	D	0.92945	0.7755	N	0.17594	0.5	0.80722	D	1	B;P;P;D;B;B;B	0.55385	0.061;0.847;0.721;0.971;0.232;0.131;0.232	B;P;P;P;B;B;B	0.62491	0.102;0.699;0.625;0.903;0.138;0.102;0.138	D	0.92562	0.6059	10	0.87932	D	0	-6.6278	10.0198	0.42035	0.0719:0.3894:0.5387:0.0	.	102;102;102;102;102;102;102	B4DMF4;E9PC40;Q5FBZ4;Q5FBZ9;Q5FBZ3;Q5FBZ8;P54277	.;.;.;.;.;.;PMS1_HUMAN	Y	102	ENSP00000406490:C102Y;ENSP00000386623:C102Y;ENSP00000387125:C102Y;ENSP00000363959:C102Y;ENSP00000410082:C102Y;ENSP00000401064:C102Y	ENSP00000343888:C102Y	C	+	2	0	PMS1	190368912	1.000000	0.71417	0.896000	0.35187	0.904000	0.53231	2.755000	0.47540	0.787000	0.33731	0.637000	0.83480	TGT	PMS1	-	pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,tigrfam_DNA_mismatch_repair_N	ENSG00000064933		0.328	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	125	0.00	0	G			190660667	190660667	+1	no_errors	ENST00000441310	ensembl	human	known	69_37n	missense	80	31.03	36	SNP	0.992	A
PNLIPRP3	119548	genome.wustl.edu	37	10	118196375	118196375	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:118196375C>T	ENST00000369230.3	+	2	348	c.202C>T	c.(202-204)Cag>Tag	p.Q68*		NM_001011709.2	NP_001011709.2	Q17RR3	LIPR3_HUMAN	pancreatic lipase-related protein 3	68					lipid catabolic process (GO:0016042)	extracellular region (GO:0005576)	triglyceride lipase activity (GO:0004806)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(29)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	50				all cancers(201;0.0131)		CAATGCCTATCAGGTAAGCTA	0.393																																						dbGAP											0													153.0	140.0	144.0					10																	118196375		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC015840	CCDS31292.1	10q26.12	2014-03-14			ENSG00000203837	ENSG00000203837	3.1.1.3		23492	protein-coding gene	gene with protein product							Standard	NM_001011709		Approved		uc001lcl.4	Q17RR3	OTTHUMG00000019100	ENST00000369230.3:c.202C>T	10.37:g.118196375C>T	ENSP00000358232:p.Gln68*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,prints_Lipase_panc	p.Q68*	ENST00000369230.3	37	c.202	CCDS31292.1	10	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977958	0.92982	.	.	ENSG00000203837	ENST00000369230	.	.	.	4.45	3.54	0.40534	.	0.524549	0.15255	U	0.272109	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	8.5922	0.33695	0.0:0.7552:0.1548:0.09	.	.	.	.	X	68	.	ENSP00000358232:Q68X	Q	+	1	0	PNLIPRP3	118186365	0.982000	0.34865	0.602000	0.28890	0.030000	0.12068	2.615000	0.46368	1.170000	0.42753	-0.142000	0.14014	CAG	PNLIPRP3	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase_panc	ENSG00000203837		0.393	PNLIPRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIPRP3	HGNC	protein_coding	OTTHUMT00000050520.1	90	0.00	0	C	XM_058404		118196375	118196375	+1	no_errors	ENST00000369230	ensembl	human	known	69_37n	nonsense	71	21.98	20	SNP	0.835	T
POLR1A	25885	genome.wustl.edu	37	2	86272802	86272802	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:86272802C>T	ENST00000263857.6	-	20	3202	c.2824G>A	c.(2824-2826)Gag>Aag	p.E942K	POLR1A_ENST00000409681.1_Missense_Mutation_p.E942K			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	942					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GGGGTGAACTCATAAGGCTCA	0.542																																						dbGAP											0													77.0	87.0	84.0					2																	86272802		1928	4143	6071	-	-	-	SO:0001583	missense	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.2824G>A	2.37:g.86272802C>T	ENSP00000263857:p.Glu942Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.E942K	ENST00000263857.6	37	c.2824	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	C	21.5	4.163661	0.78226	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.68331	-0.32;-0.32	5.71	4.84	0.62591	RNA polymerase Rpb1, domain 4 (1);	0.221758	0.45126	D	0.000387	T	0.70657	0.3249	M	0.72118	2.19	0.53688	D	0.999979	P	0.37688	0.605	B	0.43445	0.42	T	0.74016	-0.3800	10	0.72032	D	0.01	-15.257	12.9721	0.58517	0.0:0.9255:0.0:0.0745	.	942	O95602	RPA1_HUMAN	K	942	ENSP00000263857:E942K;ENSP00000386300:E942K	ENSP00000263857:E942K	E	-	1	0	POLR1A	86126313	1.000000	0.71417	0.219000	0.23793	0.993000	0.82548	5.446000	0.66600	1.436000	0.47453	0.655000	0.94253	GAG	POLR1A	-	pfam_RNA_pol_Rpb1_4	ENSG00000068654		0.542	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	33	0.00	0	C	NM_015425		86272802	86272802	-1	no_errors	ENST00000263857	ensembl	human	known	69_37n	missense	23	37.84	14	SNP	0.996	T
PPM1A	5494	genome.wustl.edu	37	14	60750229	60750229	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:60750229G>A	ENST00000395076.4	+	2	1238	c.808G>A	c.(808-810)Gaa>Aaa	p.E270K	PPM1A_ENST00000529574.1_Missense_Mutation_p.E270K|PPM1A_ENST00000325642.3_Missense_Mutation_p.E343K|PPM1A_ENST00000325658.3_Missense_Mutation_p.E270K	NM_021003.4	NP_066283.1	P35813	PPM1A_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1A	270					cell cycle arrest (GO:0007050)|dephosphorylation (GO:0016311)|gene expression (GO:0010467)|insulin receptor signaling pathway (GO:0008286)|N-terminal protein myristoylation (GO:0006499)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of SMAD protein complex assembly (GO:0010991)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-threonine dephosphorylation (GO:0035970)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|protein dephosphorylation (GO:0006470)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|voltage-gated calcium channel complex (GO:0005891)	calmodulin-dependent protein phosphatase activity (GO:0033192)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)|R-SMAD binding (GO:0070412)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(1)|large_intestine(8)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	14				OV - Ovarian serous cystadenocarcinoma(108;0.046)		AGTTTGCAATGAAGTAGTCGA	0.338																																						dbGAP											0													126.0	125.0	125.0					14																	60750229		2203	4300	6503	-	-	-	SO:0001583	missense	0			S87759	CCDS9744.1, CCDS9745.1, CCDS45120.1	14q23.1	2013-01-24	2010-03-05		ENSG00000100614	ENSG00000100614	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9275	protein-coding gene	gene with protein product	"""phosphatase 2C alpha"", ""protein phosphatase 2C, alpha isoform"""	606108	"""protein phosphatase 1A (formerly 2C), magnesium-dependent, alpha isoform"""			1311954	Standard	NM_177952		Approved	MGC9201, PP2Calpha, PP2CA	uc001xew.4	P35813	OTTHUMG00000140333	ENST00000395076.4:c.808G>A	14.37:g.60750229G>A	ENSP00000378514:p.Glu270Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BU11|J3KNM0|O75551	Missense_Mutation	SNP	pfam_PP2C-like,pfam_PP2C_C,superfamily_PP2C-like,superfamily_PP2C_C,smart_PP2C-like	p.E343K	ENST00000395076.4	37	c.1027	CCDS9744.1	14	.	.	.	.	.	.	.	.	.	.	G	20.7	4.036248	0.75617	.	.	ENSG00000100614	ENST00000325642;ENST00000529574;ENST00000395076;ENST00000325658	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.69	5.69	0.88448	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.17959	0.0431	L	0.38692	1.165	0.80722	D	1	P;P;B	0.39116	0.66;0.631;0.141	B;B;B	0.37304	0.246;0.201;0.226	T	0.01262	-1.1402	10	0.36615	T	0.2	-6.3382	19.8148	0.96562	0.0:0.0:1.0:0.0	.	270;270;270	P35813;P35813-2;B2R8E4	PPM1A_HUMAN;.;.	K	343;270;270;270	ENSP00000327255:E343K;ENSP00000432966:E270K;ENSP00000378514:E270K;ENSP00000314850:E270K	ENSP00000327255:E343K	E	+	1	0	PPM1A	59819982	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.876000	0.87215	2.685000	0.91497	0.585000	0.79938	GAA	PPM1A	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000100614		0.338	PPM1A-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PPM1A	HGNC	protein_coding	OTTHUMT00000276949.2	68	0.00	0	G	NM_021003		60750229	60750229	+1	no_errors	ENST00000325642	ensembl	human	known	69_37n	missense	37	35.09	20	SNP	1.000	A
PRKDC	5591	genome.wustl.edu	37	8	48811083	48811083	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:48811083G>A	ENST00000314191.2	-	29	3467	c.3411C>T	c.(3409-3411)atC>atT	p.I1137I	PRKDC_ENST00000338368.3_Silent_p.I1137I|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1137					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	TCTTTTCAATGATGCGGCATA	0.383								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											0													86.0	83.0	84.0					8																	48811083		1871	4108	5979	-	-	-	SO:0001819	synonymous_variant	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.3411C>T	8.37:g.48811083G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.I1137	ENST00000314191.2	37	c.3411		8																																																																																			PRKDC	-	superfamily_ARM-type_fold	ENSG00000253729		0.383	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		84	0.00	0	G	NM_001081640		48811083	48811083	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	silent	75	32.43	36	SNP	1.000	A
PREX2	80243	genome.wustl.edu	37	8	69020348	69020348	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:69020348C>G	ENST00000288368.4	+	24	2997	c.2720C>G	c.(2719-2721)tCt>tGt	p.S907C		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	907					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TTGCAGTTTTCTCGTGTACTG	0.398																																						dbGAP											0													74.0	65.0	68.0					8																	69020348		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2720C>G	8.37:g.69020348C>G	ENSP00000288368:p.Ser907Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.S907C	ENST00000288368.4	37	c.2720	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.113095	0.94339	.	.	ENSG00000046889	ENST00000288368;ENST00000396539	T	0.37235	1.21	5.85	5.85	0.93711	.	0.060613	0.64402	D	0.000002	T	0.57858	0.2082	L	0.53249	1.67	0.80722	D	1	D;D	0.71674	0.998;0.977	D;P	0.71414	0.973;0.832	T	0.53837	-0.8382	10	0.52906	T	0.07	.	20.1634	0.98142	0.0:1.0:0.0:0.0	.	972;907	Q70Z35-2;Q70Z35	.;PREX2_HUMAN	C	907;973	ENSP00000288368:S907C	ENSP00000288368:S907C	S	+	2	0	PREX2	69182902	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.773000	0.95371	0.655000	0.94253	TCT	PREX2	-	NULL	ENSG00000046889		0.398	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	157	0.00	0	C	NM_025170		69020348	69020348	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	104	25.18	35	SNP	1.000	G
PTGIS	5740	genome.wustl.edu	37	20	48164524	48164524	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:48164524G>A	ENST00000244043.4	-	3	260	c.231C>T	c.(229-231)ctC>ctT	p.L77L	PTGIS_ENST00000478971.1_Intron	NM_000961.3	NP_000952.1	Q16647	PTGIS_HUMAN	prostaglandin I2 (prostacyclin) synthase	77					apoptotic signaling pathway (GO:0097190)|arachidonic acid metabolic process (GO:0019369)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to interleukin-6 (GO:0071354)|cyclooxygenase pathway (GO:0019371)|icosanoid metabolic process (GO:0006690)|negative regulation of inflammatory response (GO:0050728)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|positive regulation of angiogenesis (GO:0045766)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostaglandin biosynthetic process (GO:0001516)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	caveola (GO:0005901)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)|prostaglandin-I synthase activity (GO:0008116)			endometrium(1)|kidney(1)|large_intestine(7)|lung(6)|ovary(3)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	27			BRCA - Breast invasive adenocarcinoma(12;2.37e-05)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)		Epoprostenol(DB01240)|Phenylbutazone(DB00812)	GTGGGTCCAGGAGAACGGTGA	0.572																																						dbGAP											0													95.0	80.0	85.0					20																	48164524		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13419.1	20q13	2013-11-18			ENSG00000124212	ENSG00000124212	5.3.99.4	"""Cytochrome P450s"""	9603	protein-coding gene	gene with protein product	"""cytochrome P450, family 8, subfamily A, polypeptide 1"""	601699				8812456	Standard	NM_000961		Approved	PGIS, CYP8A1	uc002xut.3	Q16647	OTTHUMG00000033077	ENST00000244043.4:c.231C>T	20.37:g.48164524G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MII8|Q9HAX2|Q9HAX3|Q9HAX4	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.L77	ENST00000244043.4	37	c.231	CCDS13419.1	20																																																																																			PTGIS	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I	ENSG00000124212		0.572	PTGIS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGIS	HGNC	protein_coding	OTTHUMT00000080496.2	30	0.00	0	G			48164524	48164524	-1	no_errors	ENST00000244043	ensembl	human	known	69_37n	silent	48	18.64	11	SNP	0.998	A
PTGS2	5743	genome.wustl.edu	37	1	186648206	186648206	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:186648206C>T	ENST00000367468.5	-	3	433	c.297G>A	c.(295-297)atG>atA	p.M99I	RP5-973M2.2_ENST00000608917.1_lincRNA|PTGS2_ENST00000490885.2_5'UTR	NM_000963.2	NP_000954.1	P35354	PGH2_HUMAN	prostaglandin-endoperoxide synthase 2 (prostaglandin G/H synthase and cyclooxygenase)	99					anagen (GO:0042640)|angiogenesis (GO:0001525)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|brown fat cell differentiation (GO:0050873)|cellular component movement (GO:0006928)|cellular response to ATP (GO:0071318)|cellular response to hypoxia (GO:0071456)|cellular response to mechanical stimulus (GO:0071260)|cellular response to UV (GO:0034644)|cyclooxygenase pathway (GO:0019371)|decidualization (GO:0046697)|embryo implantation (GO:0007566)|inflammatory response (GO:0006954)|learning (GO:0007612)|lipoxygenase pathway (GO:0019372)|maintenance of blood-brain barrier (GO:0035633)|memory (GO:0007613)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of smooth muscle contraction (GO:0045986)|negative regulation of synaptic transmission, dopaminergic (GO:0032227)|ovulation (GO:0030728)|positive regulation of apoptotic process (GO:0043065)|positive regulation of brown fat cell differentiation (GO:0090336)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of fever generation (GO:0031622)|positive regulation of fibroblast growth factor production (GO:0090271)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of platelet-derived growth factor production (GO:0090362)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of synaptic plasticity (GO:0031915)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of transforming growth factor beta production (GO:0071636)|positive regulation of vasoconstriction (GO:0045907)|positive regulation vascular endothelial growth factor production (GO:0010575)|prostaglandin biosynthetic process (GO:0001516)|prostaglandin metabolic process (GO:0006693)|regulation of blood pressure (GO:0008217)|regulation of inflammatory response (GO:0050727)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to fatty acid (GO:0070542)|response to fructose (GO:0009750)|response to glucocorticoid (GO:0051384)|response to lipopolysaccharide (GO:0032496)|response to lithium ion (GO:0010226)|response to manganese ion (GO:0010042)|response to oxidative stress (GO:0006979)|response to tumor necrosis factor (GO:0034612)|response to vitamin D (GO:0033280)|sensory perception of pain (GO:0019233)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)	arachidonate 15-lipoxygenase activity (GO:0050473)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|lipid binding (GO:0008289)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)|prostaglandin-endoperoxide synthase activity (GO:0004666)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27					Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Aldesleukin(DB00041)|Aminosalicylic Acid(DB00233)|Antipyrine(DB01435)|Antrafenine(DB01419)|Balsalazide(DB01014)|Bromfenac(DB00963)|Bumetanide(DB00887)|Carprofen(DB00821)|Celecoxib(DB00482)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Clodronate(DB00720)|Dapsone(DB00250)|Desmopressin(DB00035)|Diclofenac(DB00586)|Diflunisal(DB00861)|Dihomo-gamma-linolenic acid(DB00154)|Drospirenone(DB01395)|Etanercept(DB00005)|Etodolac(DB00749)|Etoposide(DB00773)|Etoricoxib(DB01628)|Fenoprofen(DB00573)|Flurbiprofen(DB00712)|Ginseng(DB01404)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Ketorolac(DB00465)|Lenalidomide(DB00480)|Lornoxicam(DB06725)|Lumiracoxib(DB01283)|Magnesium salicylate(DB01397)|Meclofenamic acid(DB00939)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Mesalazine(DB00244)|Nabumetone(DB00461)|Naproxen(DB00788)|Nepafenac(DB06802)|Niflumic Acid(DB04552)|Nonoxynol-9(DB06804)|Oxaprozin(DB00991)|Phenylbutazone(DB00812)|Piroxicam(DB00554)|Pomalidomide(DB08910)|Risedronate(DB00884)|Salicylate-sodium(DB01398)|Salicylic acid(DB00936)|Salsalate(DB01399)|Sulfasalazine(DB00795)|Sulindac(DB00605)|Suprofen(DB00870)|Tafluprost(DB08819)|Tenoxicam(DB00469)|Tetrahydrobiopterin(DB00360)|Thalidomide(DB01041)|Tiaprofenic acid(DB01600)|Tolmetin(DB00500)|Triamcinolone(DB00620)|Trisalicylate-choline(DB01401)	ACACATAACTCATAATTGCAT	0.348																																						dbGAP											0													70.0	68.0	69.0					1																	186648206		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28235	CCDS1371.1	1q25.2-q25.3	2008-02-05			ENSG00000073756	ENSG00000073756	1.14.99.1		9605	protein-coding gene	gene with protein product		600262				1380156	Standard	NM_000963		Approved	COX2	uc001gsb.3	P35354	OTTHUMG00000035473	ENST00000367468.5:c.297G>A	1.37:g.186648206C>T	ENSP00000356438:p.Met99Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K802|Q16876	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,prints_Haem_peroxidase_animal_subgr,pfscan_EG-like_dom,pfscan_Haem_peroxidase_animal	p.M99I	ENST00000367468.5	37	c.297	CCDS1371.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.343338	0.95783	.	.	ENSG00000073756	ENST00000367468	T	0.17370	2.28	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.45816	0.1361	M	0.90082	3.085	0.80722	D	1	D	0.53462	0.96	P	0.53490	0.727	T	0.53746	-0.8395	10	0.72032	D	0.01	-31.935	20.3368	0.98748	0.0:1.0:0.0:0.0	.	99	P35354	PGH2_HUMAN	I	99	ENSP00000356438:M99I	ENSP00000356438:M99I	M	-	3	0	PTGS2	184914829	1.000000	0.71417	0.993000	0.49108	0.950000	0.60333	7.627000	0.83176	2.805000	0.96524	0.655000	0.94253	ATG	PTGS2	-	superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000073756		0.348	PTGS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGS2	HGNC	protein_coding	OTTHUMT00000086157.2	86	0.00	0	C	NM_000963		186648206	186648206	-1	no_errors	ENST00000367468	ensembl	human	known	69_37n	missense	92	10.68	11	SNP	1.000	T
PTPN14	5784	genome.wustl.edu	37	1	214557650	214557650	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:214557650C>G	ENST00000366956.5	-	13	1742	c.1548G>C	c.(1546-1548)caG>caC	p.Q516H	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	516					lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TTGGGTTCCTCTGGTCAGATG	0.587																																					Colon(92;557 1424 24372 34121 40073)	dbGAP											0													130.0	135.0	133.0					1																	214557650		2203	4300	6503	-	-	-	SO:0001583	missense	0			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.1548G>C	1.37:g.214557650C>G	ENSP00000355923:p.Gln516His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSI0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.Q516H	ENST00000366956.5	37	c.1548	CCDS1514.1	1	.	.	.	.	.	.	.	.	.	.	C	0.124	-1.121993	0.01785	.	.	ENSG00000152104	ENST00000366956	T	0.69306	-0.39	5.19	-6.49	0.01890	.	0.810106	0.11661	N	0.541880	T	0.51635	0.1686	L	0.44542	1.39	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39035	-0.9633	10	0.51188	T	0.08	.	10.5828	0.45265	0.0:0.1105:0.566:0.3234	.	516	Q15678	PTN14_HUMAN	H	516	ENSP00000355923:Q516H	ENSP00000355923:Q516H	Q	-	3	2	PTPN14	212624273	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.592000	0.05747	-1.181000	0.02730	-0.219000	0.12488	CAG	PTPN14	-	pirsf_Tyr_Pase_non-rcpt_typ-14/21	ENSG00000152104		0.587	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	22	0.00	0	C	NM_005401		214557650	214557650	-1	no_errors	ENST00000366956	ensembl	human	known	69_37n	missense	82	16.33	16	SNP	0.000	G
PTPRM	5797	genome.wustl.edu	37	18	8244068	8244068	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:8244068G>A	ENST00000332175.8	+	15	3350	c.2313G>A	c.(2311-2313)aaG>aaA	p.K771K	PTPRM_ENST00000400053.4_Silent_p.K709K|PTPRM_ENST00000444013.1_Silent_p.K558K|PTPRM_ENST00000580170.1_Silent_p.K771K|PTPRM_ENST00000400060.4_Silent_p.K771K	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	771					homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				AACTGGCCAAGAAGCGGAAAG	0.463																																						dbGAP											0													103.0	104.0	103.0					18																	8244068		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2313G>A	18.37:g.8244068G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN1|D3DUH8|J3QL11	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.K771	ENST00000332175.8	37	c.2313	CCDS11840.1	18																																																																																			PTPRM	-	NULL	ENSG00000173482		0.463	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	50	0.00	0	G			8244068	8244068	+1	no_errors	ENST00000400060	ensembl	human	known	69_37n	silent	34	29.17	14	SNP	1.000	A
RAI14	26064	genome.wustl.edu	37	5	34813753	34813753	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:34813753C>G	ENST00000265109.3	+	11	1127	c.840C>G	c.(838-840)atC>atG	p.I280M	RAI14_ENST00000503673.1_Missense_Mutation_p.I280M|RAI14_ENST00000506376.1_Missense_Mutation_p.I272M|RAI14_ENST00000397449.1_Missense_Mutation_p.I273M|RAI14_ENST00000512629.1_Intron|RAI14_ENST00000428746.2_Missense_Mutation_p.I280M|RAI14_ENST00000515799.1_Missense_Mutation_p.I283M	NM_001145522.1|NM_015577.2	NP_001138994.1|NP_056392.2	Q9P0K7	RAI14_HUMAN	retinoic acid induced 14	280						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(19)|lung(22)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56	all_lung(31;0.000191)					CACCTCCTATCAGTCCTACCC	0.378																																						dbGAP											0													108.0	103.0	105.0					5																	34813753		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037755	CCDS34142.1, CCDS54837.1, CCDS54838.1, CCDS54839.1	5p13.3-p13.2	2013-01-10			ENSG00000039560	ENSG00000039560		"""Ankyrin repeat domain containing"""	14873	protein-coding gene	gene with protein product	"""novel retinal pigment epithelial"""	606586				11042181	Standard	NM_015577		Approved	NORPEG, KIAA1334, RAI13, DKFZp564G013	uc011coj.2	Q9P0K7	OTTHUMG00000162019	ENST00000265109.3:c.840C>G	5.37:g.34813753C>G	ENSP00000265109:p.Ile280Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PED3|Q6V1W9|Q7Z5I4|Q7Z733|Q9P2L2|Q9Y3T5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I283M	ENST00000265109.3	37	c.849	CCDS34142.1	5	.	.	.	.	.	.	.	.	.	.	C	16.09	3.024198	0.54683	.	.	ENSG00000039560	ENST00000265109;ENST00000428746;ENST00000503673;ENST00000515799;ENST00000506376;ENST00000397449	T;T;T;T;T;T	0.38401	1.14;1.14;1.14;1.14;1.18;1.17	5.78	5.78	0.91487	.	.	.	.	.	T	0.43188	0.1236	L	0.40543	1.245	0.47476	D	0.999439	P;P;B	0.44478	0.836;0.573;0.437	P;P;B	0.48425	0.577;0.468;0.131	T	0.07751	-1.0756	9	0.38643	T	0.18	-5.399	20.0216	0.97506	0.0:1.0:0.0:0.0	.	272;283;280	Q9P0K7-3;Q9P0K7-2;Q9P0K7	.;.;RAI14_HUMAN	M	280;280;280;283;272;273	ENSP00000265109:I280M;ENSP00000388725:I280M;ENSP00000422942:I280M;ENSP00000427123:I283M;ENSP00000423854:I272M;ENSP00000380591:I273M	ENSP00000265109:I280M	I	+	3	3	RAI14	34849510	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.684000	0.54671	2.735000	0.93741	0.650000	0.86243	ATC	RAI14	-	NULL	ENSG00000039560		0.378	RAI14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RAI14	HGNC	protein_coding	OTTHUMT00000366786.1	155	0.00	0	C	NM_015577		34813753	34813753	+1	no_errors	ENST00000515799	ensembl	human	known	69_37n	missense	111	21.83	31	SNP	1.000	G
RANBP2	5903	genome.wustl.edu	37	2	109389434	109389434	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:109389434G>A	ENST00000283195.6	+	23	8350	c.8224G>A	c.(8224-8226)Gat>Aat	p.D2742N		NM_006267.4	NP_006258.3	P49792	RBP2_HUMAN	RAN binding protein 2	2742	2 X 50 AA approximate repeats.|Interaction with SUMO1.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of glucokinase activity (GO:0033132)|protein folding (GO:0006457)|protein import into nucleus (GO:0006606)|protein sumoylation (GO:0016925)|regulation of gluconeogenesis involved in cellular glucose homeostasis (GO:0090526)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)	ligase activity (GO:0016874)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|Ran GTPase binding (GO:0008536)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)		RANBP2/ALK(34)	NS(1)|biliary_tract(1)|breast(3)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(21)|large_intestine(19)|lung(51)|pancreas(1)|prostate(8)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	129						AGTCTGTAGTGATACTGATGA	0.358																																						dbGAP											0													90.0	83.0	85.0					2																	109389434		2203	4300	6503	-	-	-	SO:0001583	missense	0			D42063	CCDS2079.1	2q13	2013-11-14			ENSG00000153201	ENSG00000153201		"""Tetratricopeptide (TTC) repeat domain containing"""	9848	protein-coding gene	gene with protein product		601181	"""acute necrotizing encephalopathy 1 (autosomal dominant)"""	ANE1		7724562, 19118815	Standard	NM_006267		Approved	NUP358, ADANE	uc002tem.4	P49792	OTTHUMG00000130981	ENST00000283195.6:c.8224G>A	2.37:g.109389434G>A	ENSP00000283195:p.Asp2742Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13074|Q15280|Q53TE2|Q59FH7	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_Znf_RanBP2,pfam_IR1-M,pfam_Cyclophilin-like_PPIase_dom,pfam_TPR-1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,smart_Ran_bind_dom,smart_Znf_RanBP2,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RanBP2,pfscan_Cyclophilin-like_PPIase_dom,pfscan_Ran_bind_dom,prints_Cyclophilin-like_PPIase_dom	p.D2742N	ENST00000283195.6	37	c.8224	CCDS2079.1	2	.	.	.	.	.	.	.	.	.	.	G	27.7	4.851947	0.91355	.	.	ENSG00000153201	ENST00000409491;ENST00000283195	T	0.35605	1.3	5.98	5.98	0.97165	Nup358/RanBP2 E3 ligase domain (1);	.	.	.	.	T	0.42832	0.1220	L	0.29908	0.895	0.38119	D	0.937792	P	0.44260	0.83	P	0.53062	0.717	T	0.07790	-1.0754	9	0.17832	T	0.49	-27.0847	20.0624	0.97681	0.0:0.0:1.0:0.0	.	2742	P49792	RBP2_HUMAN	N	1766;2742	ENSP00000283195:D2742N	ENSP00000283195:D2742N	D	+	1	0	RANBP2	108755866	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.121000	0.64691	2.838000	0.97847	0.591000	0.81541	GAT	RANBP2	-	pfam_IR1-M	ENSG00000153201		0.358	RANBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP2	HGNC	protein_coding	OTTHUMT00000253594.1	123	0.00	0	G	NM_006267		109389434	109389434	+1	no_errors	ENST00000283195	ensembl	human	known	69_37n	missense	55	36.78	32	SNP	1.000	A
RAPGEF6	51735	genome.wustl.edu	37	5	130846097	130846097	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:130846097C>T	ENST00000509018.1	-	8	920	c.715G>A	c.(715-717)Gag>Aag	p.E239K	CTC-432M15.3_ENST00000514667.1_Missense_Mutation_p.E289K|RAPGEF6_ENST00000510071.1_Missense_Mutation_p.E239K|RAPGEF6_ENST00000296859.6_Missense_Mutation_p.E239K|RAPGEF6_ENST00000308008.6_Missense_Mutation_p.E239K|RAPGEF6_ENST00000507093.1_Missense_Mutation_p.E239K|RAPGEF6_ENST00000307984.5_Missense_Mutation_p.E239K|RAPGEF6_ENST00000512052.1_5'Flank	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	239					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		CGATCAATCTCTTCATCTTCC	0.423																																					Melanoma(168;435 1955 13113 13877 23213)	dbGAP											0													126.0	117.0	120.0					5																	130846097		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.715G>A	5.37:g.130846097C>T	ENSP00000421684:p.Glu239Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_PDZ,pfam_Ras-assoc,pfam_cNMP-bd_dom,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.E239K	ENST00000509018.1	37	c.715	CCDS34225.1	5	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651047	0.88056	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000308008;ENST00000510071;ENST00000513227;ENST00000504575;ENST00000504039;ENST00000514667	T;T;T;T;T;T;T;T	0.47869	1.8;1.7;1.7;1.8;1.58;2.1;0.83;1.89	5.33	5.33	0.75918	.	0.117408	0.56097	D	0.000028	T	0.36220	0.0959	N	0.14661	0.345	0.80722	D	1	B;B;P;B;B;B	0.35139	0.039;0.018;0.486;0.128;0.03;0.018	B;B;B;B;B;B	0.35278	0.04;0.04;0.199;0.066;0.087;0.04	T	0.29549	-1.0008	10	0.49607	T	0.09	.	19.359	0.94428	0.0:1.0:0.0:0.0	.	239;239;239;289;239;239	A3KN82;B7ZML2;Q8TEU7-2;E9PCH4;Q8TEU7-3;Q8TEU7	.;.;.;.;.;RPGF6_HUMAN	K	239;239;239;239;239;239;239;67;92;92;289	ENSP00000421684:E239K;ENSP00000309298:E239K;ENSP00000426081:E239K;ENSP00000296859:E239K;ENSP00000311419:E239K;ENSP00000425389:E239K;ENSP00000424574:E67K;ENSP00000426948:E289K	ENSP00000426948:E289K	E	-	1	0	RAPGEF6;FNIP1	130873996	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.776000	0.85560	2.657000	0.90304	0.563000	0.77884	GAG	RAPGEF6	-	NULL	ENSG00000158987		0.423	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF6	HGNC	protein_coding	OTTHUMT00000370059.1	109	0.00	0	C	NM_016340		130846097	130846097	-1	no_errors	ENST00000509018	ensembl	human	known	69_37n	missense	63	30.77	28	SNP	1.000	T
RASAL2	9462	genome.wustl.edu	37	1	178410736	178410736	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:178410736G>C	ENST00000462775.1	+	5	562	c.437G>C	c.(436-438)aGa>aCa	p.R146T	RASAL2_ENST00000367649.3_Missense_Mutation_p.R294T|RASAL2_ENST00000448150.3_Missense_Mutation_p.R276T	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	146	PH.				negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						GCTTCTGAGAGAGACAAGTGG	0.338																																						dbGAP											0													82.0	81.0	82.0					1																	178410736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.437G>C	1.37:g.178410736G>C	ENSP00000420558:p.Arg146Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.R294T	ENST00000462775.1	37	c.881	CCDS1322.1	1	.	.	.	.	.	.	.	.	.	.	G	25.9	4.686394	0.88639	.	.	ENSG00000075391	ENST00000448150;ENST00000367649;ENST00000462775	T;T;D	0.94046	1.33;1.33;-3.34	5.85	5.85	0.93711	Pleckstrin homology-type (1);Pleckstrin homology domain (1);	0.000000	0.85682	D	0.000000	D	0.97210	0.9088	M	0.85041	2.73	0.80722	D	1	D;D	0.76494	0.999;0.99	D;P	0.87578	0.998;0.844	D	0.97286	0.9921	10	0.87932	D	0	.	20.1606	0.98132	0.0:0.0:1.0:0.0	.	146;294	Q9UJF2;F8W755	NGAP_HUMAN;.	T	276;294;146	ENSP00000407768:R276T;ENSP00000356621:R294T;ENSP00000420558:R146T	ENSP00000356621:R294T	R	+	2	0	RASAL2	176677359	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.930000	0.87610	2.772000	0.95346	0.650000	0.86243	AGA	RASAL2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000075391		0.338	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000084758.3	89	0.00	0	G	NM_170692		178410736	178410736	+1	no_errors	ENST00000367649	ensembl	human	known	69_37n	missense	122	19.21	29	SNP	1.000	C
RASD2	23551	genome.wustl.edu	37	22	35943080	35943080	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:35943080C>T	ENST00000216127.4	+	2	866	c.224C>T	c.(223-225)tCt>tTt	p.S75F		NM_014310.3	NP_055125.2	Q96D21	RHES_HUMAN	RASD family, member 2	75					locomotory behavior (GO:0007626)|negative regulation of protein ubiquitination (GO:0031397)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein sumoylation (GO:0033235)|regulation of cAMP-mediated signaling (GO:0043949)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission, dopaminergic (GO:0001963)	plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	13						CTGGATACCTCTGGCAACCAC	0.642																																						dbGAP											0													121.0	93.0	103.0					22																	35943080		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF279143	CCDS13916.1	22q13.1	2014-05-09			ENSG00000100302	ENSG00000100302			18229	protein-coding gene	gene with protein product	"""tumor endothelial marker 2"", ""Ras homolog enriched in striatum"""	612842				10947988, 10467249, 14724584	Standard	NM_014310		Approved	TEM2, Rhes, MGC:4834	uc003anx.3	Q96D21	OTTHUMG00000150607	ENST00000216127.4:c.224C>T	22.37:g.35943080C>T	ENSP00000216127:p.Ser75Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O95520|Q5THY8	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S75F	ENST00000216127.4	37	c.224	CCDS13916.1	22	.	.	.	.	.	.	.	.	.	.	C	24.3	4.514339	0.85389	.	.	ENSG00000100302	ENST00000216127	T	0.77358	-1.09	5.3	5.3	0.74995	Small GTP-binding protein domain (1);	0.000000	0.85682	D	0.000000	D	0.90000	0.6878	M	0.86573	2.825	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	D	0.91429	0.5164	10	0.72032	D	0.01	.	19.0173	0.92900	0.0:1.0:0.0:0.0	.	75	Q96D21	RHES_HUMAN	F	75	ENSP00000216127:S75F	ENSP00000216127:S75F	S	+	2	0	RASD2	34273026	1.000000	0.71417	0.989000	0.46669	0.978000	0.69477	5.909000	0.69923	2.499000	0.84300	0.558000	0.71614	TCT	RASD2	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000100302		0.642	RASD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASD2	HGNC	protein_coding	OTTHUMT00000319063.1	34	0.00	0	C	NM_014310		35943080	35943080	+1	no_errors	ENST00000216127	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	0.998	T
RBBP8	5932	genome.wustl.edu	37	18	20573141	20573141	+	Missense_Mutation	SNP	G	G	A	rs201845876		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:20573141G>A	ENST00000399722.2	+	11	1702	c.1351G>A	c.(1351-1353)Gag>Aag	p.E451K	RBBP8_ENST00000360790.5_Missense_Mutation_p.E451K|RBBP8_ENST00000327155.5_Missense_Mutation_p.E451K|RBBP8_ENST00000399725.2_Missense_Mutation_p.E451K	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	451					blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			GAAGAAAACTGAGGAAGAAAG	0.398								Homologous recombination					G|||	1	0.000199681	0.0	0.0014	5008	,	,		17583	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													50.0	53.0	52.0					18																	20573141		2199	4299	6498	-	-	-	SO:0001583	missense	0			AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.1351G>A	18.37:g.20573141G>A	ENSP00000382628:p.Glu451Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	pfam_CtIP_N,pfam_DNA-repair_Sae2/CtIP	p.E451K	ENST00000399722.2	37	c.1351	CCDS11875.1	18	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	G	24.7	4.557903	0.86231	.	.	ENSG00000101773	ENST00000327155;ENST00000399725;ENST00000399722;ENST00000399721;ENST00000360790	T;T;T;T;T	0.41758	1.04;0.99;1.04;1.03;1.04	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000002	T	0.60843	0.2300	M	0.68317	2.08	0.80722	D	1	D;D;D	0.76494	0.985;0.999;0.977	P;D;P	0.65987	0.732;0.94;0.647	T	0.61850	-0.6978	10	0.72032	D	0.01	-16.3284	13.7331	0.62802	0.0698:0.0:0.9302:0.0	.	451;451;451	E7ETY1;A6NKN2;Q99708	.;.;COM1_HUMAN	K	451	ENSP00000323050:E451K;ENSP00000382630:E451K;ENSP00000382628:E451K;ENSP00000382627:E451K;ENSP00000354024:E451K	ENSP00000323050:E451K	E	+	1	0	RBBP8	18827139	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	6.761000	0.74945	2.873000	0.98535	0.561000	0.74099	GAG	RBBP8	-	NULL	ENSG00000101773		0.398	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBBP8	HGNC	protein_coding	OTTHUMT00000446387.1	69	0.00	0	G	NM_203291		20573141	20573141	+1	no_errors	ENST00000327155	ensembl	human	known	69_37n	missense	20	35.48	11	SNP	0.996	A
RBM24	221662	genome.wustl.edu	37	6	17292010	17292010	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:17292010C>T	ENST00000379052.5	+	4	607	c.371C>T	c.(370-372)cCg>cTg	p.P124L	RBM24_ENST00000425446.2_Missense_Mutation_p.P66L|RBM24_ENST00000318204.5_Missense_Mutation_p.P79L|RBM24_ENST00000508508.1_3'UTR	NM_001143942.1	NP_001137414.1	Q9BX46	RBM24_HUMAN	RNA binding motif protein 24	124					cell differentiation (GO:0030154)|regulation of mRNA stability (GO:0043488)|regulation of myotube differentiation (GO:0010830)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			endometrium(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(1)	13	Breast(50;0.0615)|Ovarian(93;0.0733)	all_hematologic(90;0.062)	all cancers(50;0.131)|Epithelial(50;0.15)			TATGTCTATCCGCAGGCTTTT	0.502																																						dbGAP											0													109.0	121.0	117.0					6																	17292010		2099	4245	6344	-	-	-	SO:0001583	missense	0			BC040928	CCDS4538.1, CCDS47378.1, CCDS47379.1	6p22.3	2013-02-12	2004-04-23	2004-04-23	ENSG00000112183	ENSG00000112183		"""RNA binding motif (RRM) containing"""	21539	protein-coding gene	gene with protein product			"""RNA-binding region (RNP1, RRM) containing 6"""	RNPC6			Standard	NM_153020		Approved	FLJ30829, dJ259A10.1	uc003nbz.4	Q9BX46	OTTHUMG00000014306	ENST00000379052.5:c.371C>T	6.37:g.17292010C>T	ENSP00000368341:p.Pro124Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PAY4|Q6QDA4|Q8N9D3|Q96NI3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P124L	ENST00000379052.5	37	c.371	CCDS47378.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.3|24.3	4.520699|4.520699	0.85495|0.85495	.|.	.|.	ENSG00000112183|ENSG00000112183	ENST00000379052;ENST00000425446;ENST00000318204|ENST00000503965	T;T;T|.	0.30448|.	2.2;1.53;1.67|.	5.71|5.71	5.71|5.71	0.89125|0.89125	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.71099|0.71099	0.3300|0.3300	M|M	0.76574|0.76574	2.34|2.34	0.80722|0.80722	D|D	1|1	D;P|D;D	0.58620|0.76494	0.983;0.775|0.999;0.999	P;B|P;P	0.48901|0.56700	0.594;0.312|0.804;0.804	T|T	0.70802|0.70802	-0.4773|-0.4773	10|7	0.54805|.	T|.	0.06|.	-17.3528|-17.3528	19.8414|19.8414	0.96690|0.96690	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	79;124|23;38	Q9BX46-2;Q9BX46|B7Z6B4;B7Z6B7	.;RBM24_HUMAN|.;.	L|C	124;66;79|89	ENSP00000368341:P124L;ENSP00000396898:P66L;ENSP00000319551:P79L|.	ENSP00000319551:P79L|.	P|R	+|+	2|1	0|0	RBM24|RBM24	17399989|17399989	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.648000|7.648000	0.83479|0.83479	2.695000|2.695000	0.91970|0.91970	0.591000|0.591000	0.81541|0.81541	CCG|CGC	RBM24	-	NULL	ENSG00000112183		0.502	RBM24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM24	HGNC	protein_coding	OTTHUMT00000039946.2	36	0.00	0	C	NM_153020		17292010	17292010	+1	no_errors	ENST00000379052	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	1.000	T
RBM34	23029	genome.wustl.edu	37	1	235316075	235316075	+	Silent	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:235316075C>A	ENST00000408888.3	-	5	833	c.603G>T	c.(601-603)ctG>ctT	p.L201L	RBM34_ENST00000366606.3_Silent_p.L196L			P42696	RBM34_HUMAN	RNA binding motif protein 34	201	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.					nucleolus (GO:0005730)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			central_nervous_system(1)	1	Ovarian(103;0.0398)	all_cancers(173;0.177)|Prostate(94;0.0166)	OV - Ovarian serous cystadenocarcinoma(106;5.43e-05)|Epithelial(3;0.000121)			AAAACGACTTCAGCTTCTAAA	0.284																																						dbGAP											0													44.0	46.0	45.0					1																	235316075		1797	4068	5865	-	-	-	SO:0001819	synonymous_variant	0				CCDS41477.1, CCDS41477.2	1q42.3	2013-02-12			ENSG00000188739	ENSG00000188739		"""RNA binding motif (RRM) containing"""	28965	protein-coding gene	gene with protein product						7788527, 15134903	Standard	NM_015014		Approved	KIAA0117	uc001hwn.3	P42696	OTTHUMG00000039620	ENST00000408888.3:c.603G>T	1.37:g.235316075C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8J7|Q8N2Z8|Q9H5A1	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L201	ENST00000408888.3	37	c.603	CCDS41477.2	1																																																																																			RBM34	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000188739		0.284	RBM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM34	HGNC	protein_coding	OTTHUMT00000100146.1	46	0.00	0	C	NM_015014		235316075	235316075	-1	no_errors	ENST00000408888	ensembl	human	known	69_37n	silent	58	14.71	10	SNP	1.000	A
RCBTB1	55213	genome.wustl.edu	37	13	50108389	50108389	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:50108389C>G	ENST00000378302.2	-	13	1725	c.1465G>C	c.(1465-1467)Gaa>Caa	p.E489Q	RCBTB1_ENST00000471984.1_5'UTR|RCBTB1_ENST00000258646.3_Missense_Mutation_p.E489Q	NM_018191.3	NP_060661.3	Q8NDN9	RCBT1_HUMAN	regulator of chromosome condensation (RCC1) and BTB (POZ) domain containing protein 1	489	BTB 2. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cell cycle (GO:0007049)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|urinary_tract(1)	16		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;4.7e-09)		AAGCAGAATTCTTCTAAATCC	0.363																																						dbGAP											0													70.0	69.0	70.0					13																	50108389		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF334406	CCDS9418.1	13q14	2013-01-08			ENSG00000136144	ENSG00000136144		"""BTB/POZ domain containing"""	18243	protein-coding gene	gene with protein product		607867				11306461	Standard	XM_005266441		Approved	FLJ10716, CLLD7, CLLL7	uc001vde.1	Q8NDN9	OTTHUMG00000016915	ENST00000378302.2:c.1465G>C	13.37:g.50108389C>G	ENSP00000367552:p.Glu489Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IY29|Q969U9	Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_BTB_POZ,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_Reg_chr_condens,pfscan_BTB/POZ-like,pfscan_Reg_chr_condens	p.E489Q	ENST00000378302.2	37	c.1465	CCDS9418.1	13	.	.	.	.	.	.	.	.	.	.	C	19.12	3.765896	0.69878	.	.	ENSG00000136144	ENST00000258646;ENST00000378302	T;T	0.38722	1.12;1.12	5.66	5.66	0.87406	.	0.182001	0.64402	D	0.000016	T	0.58836	0.2150	M	0.83118	2.625	0.80722	D	1	P	0.37176	0.586	B	0.43809	0.432	T	0.63143	-0.6703	10	0.72032	D	0.01	-23.3698	20.1041	0.97884	0.0:1.0:0.0:0.0	.	489	Q8NDN9	RCBT1_HUMAN	Q	489	ENSP00000258646:E489Q;ENSP00000367552:E489Q	ENSP00000258646:E489Q	E	-	1	0	RCBTB1	49006390	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.826000	0.97356	0.655000	0.94253	GAA	RCBTB1	-	superfamily_BTB/POZ_fold	ENSG00000136144		0.363	RCBTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCBTB1	HGNC	protein_coding	OTTHUMT00000044912.2	51	0.00	0	C	NM_018191		50108389	50108389	-1	no_errors	ENST00000258646	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	G
RECQL5	9400	genome.wustl.edu	37	17	73647280	73647280	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:73647280G>T	ENST00000317905.5	-	8	1374	c.1215C>A	c.(1213-1215)ttC>ttA	p.F405L	RECQL5_ENST00000584999.1_Missense_Mutation_p.F405L|RECQL5_ENST00000420326.2_Missense_Mutation_p.F405L|RECQL5_ENST00000340830.5_Missense_Mutation_p.F405L|RECQL5_ENST00000423245.2_Missense_Mutation_p.F378L	NM_004259.6	NP_004250.4	O94762	RECQ5_HUMAN	RecQ protein-like 5	405					chromosome separation (GO:0051304)|DNA duplex unwinding (GO:0032508)|DNA metabolic process (GO:0006259)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|mitotic nuclear division (GO:0007067)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA helicase activity (GO:0003678)|nucleic acid binding (GO:0003676)|RNA polymerase II core binding (GO:0000993)			breast(1)|cervix(3)|endometrium(3)|kidney(7)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	36	all_cancers(13;2.73e-08)|Breast(9;6.04e-09)|all_epithelial(9;6.79e-09)		all cancers(21;1.15e-06)|Epithelial(20;2.19e-06)|Lung(188;0.101)|LUSC - Lung squamous cell carcinoma(166;0.112)			GTTCTTCACAGAAGGTCACCA	0.438								Other identified genes with known or suspected DNA repair function																														dbGAP											0													337.0	342.0	340.0					17																	73647280		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006533	CCDS32735.1, CCDS42380.1, CCDS45777.1	17q25	2014-03-07	2014-03-07	2014-03-07	ENSG00000108469	ENSG00000108469			9950	protein-coding gene	gene with protein product	"""RecQ protein 5"""	603781				9878247	Standard	NM_004259		Approved	RecQ5, FLJ90603	uc010dgl.3	O94762		ENST00000317905.5:c.1215C>A	17.37:g.73647280G>T	ENSP00000317636:p.Phe405Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0B1|Q9P1W7|Q9UNC8	Missense_Mutation	SNP	pfam_RecQ_helicase-like_5,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.F405L	ENST00000317905.5	37	c.1215	CCDS42380.1	17	.	.	.	.	.	.	.	.	.	.	G	15.43	2.832148	0.50845	.	.	ENSG00000108469	ENST00000423245;ENST00000317905;ENST00000420326;ENST00000340830	T;T;T	0.58358	0.34;0.63;0.78	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.68833	0.3044	L	0.52573	1.65	0.80722	D	1	P;D;D	0.63880	0.884;0.993;0.968	P;D;P	0.67103	0.686;0.949;0.805	T	0.68315	-0.5441	10	0.62326	D	0.03	-20.7509	20.0852	0.97797	0.0:0.0:1.0:0.0	.	405;378;405	O94762;Q6P4G0;O94762-3	RECQ5_HUMAN;.;.	L	405	ENSP00000317636:F405L;ENSP00000414933:F405L;ENSP00000341983:F405L	ENSP00000317636:F405L	F	-	3	2	RECQL5	71158875	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.264000	0.51553	2.756000	0.94617	0.561000	0.74099	TTC	RECQL5	-	tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000108469		0.438	RECQL5-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	RECQL5	HGNC	protein_coding	OTTHUMT00000448207.1	158	0.00	0	G	NM_004259		73647280	73647280	-1	no_errors	ENST00000317905	ensembl	human	known	69_37n	missense	141	18.02	31	SNP	1.000	T
RELB	5971	genome.wustl.edu	37	19	45528975	45528975	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:45528975C>T	ENST00000221452.8	+	7	1016	c.866C>T	c.(865-867)tCc>tTc	p.S289F	RELB_ENST00000505236.1_Missense_Mutation_p.S286F|RELB_ENST00000540120.1_Missense_Mutation_p.S289F	NM_006509.3	NP_006500.2	Q01201	RELB_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog B	289	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				antigen processing and presentation (GO:0019882)|circadian regulation of gene expression (GO:0032922)|myeloid dendritic cell differentiation (GO:0043011)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of gene expression (GO:0010628)|T-helper 1 cell differentiation (GO:0045063)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(3)|skin(1)	12		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00986)		CCTGTGCTTTCCGAGCCCGTC	0.542																																						dbGAP											0													229.0	226.0	227.0					19																	45528975		2067	4210	6277	-	-	-	SO:0001583	missense	0			M83221	CCDS46110.1	19q13.32	2013-07-09	2013-07-09		ENSG00000104856	ENSG00000104856			9956	protein-coding gene	gene with protein product		604758	"""v-rel avian reticuloendotheliosis viral oncogene homolog B (nuclear factor of kappa light polypeptide gene enhancer in B-cells 3)"""			1531086	Standard	NM_006509		Approved	REL-B	uc021uvp.1	Q01201	OTTHUMG00000162116	ENST00000221452.8:c.866C>T	19.37:g.45528975C>T	ENSP00000221452:p.Ser289Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GTX7|Q9UEI7	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NF_Rel_dor	p.S289F	ENST00000221452.8	37	c.866	CCDS46110.1	19	.	.	.	.	.	.	.	.	.	.	C	17.56	3.420439	0.62622	.	.	ENSG00000104856	ENST00000221452;ENST00000540120;ENST00000505236	T;T;T	0.69561	-0.41;-0.41;-0.41	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.83408	0.5248	M	0.84433	2.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85970	0.1476	10	0.87932	D	0	-17.3368	16.069	0.80909	0.0:1.0:0.0:0.0	.	286	D6R992	.	F	289;289;286	ENSP00000221452:S289F;ENSP00000445542:S289F;ENSP00000423287:S286F	ENSP00000221452:S289F	S	+	2	0	RELB	50220815	1.000000	0.71417	0.916000	0.36221	0.109000	0.19521	7.099000	0.76981	2.660000	0.90430	0.655000	0.94253	TCC	RELB	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD,prints_NF_Rel_dor	ENSG00000104856		0.542	RELB-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELB	HGNC	protein_coding	OTTHUMT00000367361.2	68	0.00	0	C			45528975	45528975	+1	no_errors	ENST00000221452	ensembl	human	known	69_37n	missense	60	29.41	25	SNP	1.000	T
REPS2	9185	genome.wustl.edu	37	X	17047736	17047736	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:17047736C>T	ENST00000357277.3	+	5	932	c.761C>T	c.(760-762)tCc>tTc	p.S254F	REPS2_ENST00000380064.4_Missense_Mutation_p.S114F|REPS2_ENST00000303843.7_Missense_Mutation_p.S253F	NM_001080975.1|NM_004726.2	NP_001074444.1|NP_004717.2	Q8NFH8	REPS2_HUMAN	RALBP1 associated Eps domain containing 2	254					epidermal growth factor receptor signaling pathway (GO:0007173)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(3)|urinary_tract(1)	17	Hepatocellular(33;0.183)					CATCAGGCTTCCCTTATCCGG	0.542																																						dbGAP											0													65.0	57.0	59.0					X																	17047736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF010233	CCDS14180.2, CCDS43919.1	Xp22.2	2013-01-10			ENSG00000169891	ENSG00000169891		"""EF-hand domain containing"""	9963	protein-coding gene	gene with protein product		300317				9422736, 9928989	Standard	NM_001080975		Approved	POB1	uc004cxv.1	Q8NFH8	OTTHUMG00000021199	ENST00000357277.3:c.761C>T	X.37:g.17047736C>T	ENSP00000349824:p.Ser254Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PWZ6|O43428|Q5JNZ8|Q8NFI5	Missense_Mutation	SNP	smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.S254F	ENST00000357277.3	37	c.761	CCDS14180.2	X	.	.	.	.	.	.	.	.	.	.	C	16.35	3.099647	0.56183	.	.	ENSG00000169891	ENST00000357277;ENST00000380063;ENST00000303843;ENST00000380064	T;T;T	0.35973	1.28;1.35;1.34	5.5	3.72	0.42706	.	0.216636	0.32935	N	0.005468	T	0.41696	0.1170	L	0.29908	0.895	0.31105	N	0.710578	D;D;D	0.71674	0.997;0.998;0.995	D;D;D	0.65010	0.931;0.916;0.926	T	0.45026	-0.9289	10	0.59425	D	0.04	-5.5466	8.282	0.31906	0.0:0.6302:0.2872:0.0826	.	114;253;254	B4DQQ8;Q8NFH8-4;Q8NFH8	.;.;REPS2_HUMAN	F	254;254;253;114	ENSP00000349824:S254F;ENSP00000306033:S253F;ENSP00000369404:S114F	ENSP00000306033:S253F	S	+	2	0	REPS2	16957657	0.998000	0.40836	0.783000	0.31826	0.842000	0.47809	2.673000	0.46858	0.498000	0.27948	0.544000	0.68410	TCC	REPS2	-	NULL	ENSG00000169891		0.542	REPS2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REPS2	HGNC	protein_coding	OTTHUMT00000316778.1	73	0.00	0	C	NM_004726		17047736	17047736	+1	no_errors	ENST00000357277	ensembl	human	known	69_37n	missense	33	34.00	17	SNP	0.678	T
RFTN2	130132	genome.wustl.edu	37	2	198498526	198498526	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:198498526C>A	ENST00000295049.4	-	4	1170	c.634G>T	c.(634-636)Gag>Tag	p.E212*		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	212					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						AGTTCTTCCTCAATTCCGCTT	0.403																																						dbGAP											0													236.0	212.0	220.0					2																	198498526		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.634G>T	2.37:g.198498526C>A	ENSP00000295049:p.Glu212*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Nonsense_Mutation	SNP	NULL	p.E212*	ENST00000295049.4	37	c.634	CCDS2323.1	2	.	.	.	.	.	.	.	.	.	.	C	43	9.961201	0.99305	.	.	ENSG00000162944	ENST00000295049	.	.	.	5.27	5.27	0.74061	.	1.539810	0.03847	N	0.271650	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	-15.6437	17.4389	0.87560	0.0:1.0:0.0:0.0	.	.	.	.	X	212	.	ENSP00000295049:E212X	E	-	1	0	RFTN2	198206771	0.976000	0.34144	0.124000	0.21820	0.972000	0.66771	3.425000	0.52771	2.619000	0.88677	0.655000	0.94253	GAG	RFTN2	-	NULL	ENSG00000162944		0.403	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFTN2	HGNC	protein_coding	OTTHUMT00000256106.2	156	0.00	0	C	NM_144629		198498526	198498526	-1	no_errors	ENST00000295049	ensembl	human	known	69_37n	nonsense	147	29.67	62	SNP	0.614	A
RILPL1	353116	genome.wustl.edu	37	12	123983136	123983136	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:123983136C>G	ENST00000376874.4	-	4	991	c.756G>C	c.(754-756)gaG>gaC	p.E252D	RILPL1_ENST00000340724.6_Missense_Mutation_p.E100D	NM_178314.3	NP_847884.2	Q5EBL4	RIPL1_HUMAN	Rab interacting lysosomal protein-like 1	252					epithelial cell morphogenesis (GO:0003382)|intracellular protein transport (GO:0006886)|regulation of neuron death (GO:1901214)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)				endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000224)|Epithelial(86;0.00067)|all cancers(50;0.00836)|BRCA - Breast invasive adenocarcinoma(302;0.197)		CCTGCAGCCTCTCTCGCAACT	0.632																																						dbGAP											0													51.0	56.0	54.0					12																	123983136		2076	4208	6284	-	-	-	SO:0001583	missense	0			AK097550	CCDS45006.1	12q24.31	2007-11-27			ENSG00000188026	ENSG00000188026			26814	protein-coding gene	gene with protein product		614092				14668488	Standard	NM_178314		Approved	FLJ39378	uc001ufe.2	Q5EBL4	OTTHUMG00000168686	ENST00000376874.4:c.756G>C	12.37:g.123983136C>G	ENSP00000366070:p.Glu252Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q66K36|Q8N1M0	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,pfam_RILP	p.E252D	ENST00000376874.4	37	c.756	CCDS45006.1	12	.	.	.	.	.	.	.	.	.	.	C	14.96	2.690897	0.48097	.	.	ENSG00000188026	ENST00000376874;ENST00000340724	T;T	0.24151	1.87;1.87	5.22	5.22	0.72569	.	0.115347	0.56097	D	0.000023	T	0.17789	0.0427	L	0.28740	0.885	0.80722	D	1	B;B;B	0.16396	0.01;0.017;0.01	B;B;B	0.13407	0.006;0.006;0.009	T	0.05022	-1.0911	10	0.35671	T	0.21	-9.0734	8.7588	0.34661	0.0:0.7606:0.1536:0.0858	.	228;252;101	Q5EBL4-2;Q5EBL4;Q5EBL4-3	.;RIPL1_HUMAN;.	D	252;100	ENSP00000366070:E252D;ENSP00000345874:E100D	ENSP00000345874:E100D	E	-	3	2	RILPL1	122549089	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.809000	0.38922	2.610000	0.88304	0.555000	0.69702	GAG	RILPL1	-	NULL	ENSG00000188026		0.632	RILPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RILPL1	HGNC	protein_coding	OTTHUMT00000400595.1	45	0.00	0	C	NM_178314		123983136	123983136	-1	no_errors	ENST00000376874	ensembl	human	known	69_37n	missense	30	34.78	16	SNP	1.000	G
RNF115	27246	genome.wustl.edu	37	1	145663210	145663210	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:145663210C>G	ENST00000369291.5	+	4	475	c.271C>G	c.(271-273)Cta>Gta	p.L91V		NM_014455.2	NP_055270.1			ring finger protein 115											breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	13						TAGACCCTTTCTAAGTAGCAG	0.428																																						dbGAP											0													98.0	94.0	95.0					1																	145663210		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF419857	CCDS72863.1	1q12	2013-01-09	2008-06-16	2008-06-16	ENSG00000121848	ENSG00000265491		"""RING-type (C3HC4) zinc fingers"""	18154	protein-coding gene	gene with protein product			"""zinc finger protein 364"""	ZNF364			Standard	NM_014455		Approved	CL469780	uc001eoj.3	Q9Y4L5	OTTHUMG00000013758	ENST00000369291.5:c.271C>G	1.37:g.145663210C>G	ENSP00000358297:p.Leu91Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L91V	ENST00000369291.5	37	c.271	CCDS922.1	1	.	.	.	.	.	.	.	.	.	.	C	11.33	1.606874	0.28623	.	.	ENSG00000121848	ENST00000369291	T	0.11821	2.74	5.14	3.29	0.37713	.	0.297280	0.27792	N	0.017837	T	0.13157	0.0319	L	0.47716	1.5	0.34776	D	0.734259	D	0.63880	0.993	D	0.70016	0.967	T	0.05971	-1.0853	10	0.23891	T	0.37	-9.057	9.3429	0.38091	0.0:0.8283:0.0:0.1717	.	91	Q9Y4L5	RN115_HUMAN	V	91	ENSP00000358297:L91V	ENSP00000358297:L91V	L	+	1	2	RNF115	144374567	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	1.080000	0.30779	0.766000	0.33244	-0.136000	0.14681	CTA	RNF115	-	NULL	ENSG00000121848		0.428	RNF115-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF115	HGNC	protein_coding	OTTHUMT00000038554.2	131	0.00	0	C	NM_014455		145663210	145663210	+1	no_errors	ENST00000369291	ensembl	human	known	69_37n	missense	173	15.61	32	SNP	1.000	G
RNF133	168433	genome.wustl.edu	37	7	122338358	122338358	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:122338358G>A	ENST00000340112.2	-	1	852	c.615C>T	c.(613-615)ttC>ttT	p.F205F	CADPS2_ENST00000313070.7_Intron|CADPS2_ENST00000449022.2_Intron|CADPS2_ENST00000412584.2_Intron|CADPS2_ENST00000334010.7_Intron	NM_139175.1	NP_631914.1	Q8WVZ7	RN133_HUMAN	ring finger protein 133	205					protein autoubiquitination (GO:0051865)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|urinary_tract(1)	21						GATAAAAGATGAAATATGCTA	0.408																																					Colon(198;1778 2057 7449 19869 45985)	dbGAP											0													99.0	89.0	92.0					7																	122338358		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF447589	CCDS5784.1	7q31.33	2013-01-09			ENSG00000188050	ENSG00000188050		"""RING-type (C3HC4) zinc fingers"""	21154	protein-coding gene	gene with protein product							Standard	NM_139175		Approved		uc003vkj.1	Q8WVZ7	OTTHUMG00000157092	ENST00000340112.2:c.615C>T	7.37:g.122338358G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0W2|Q8N7G7	Silent	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.F205	ENST00000340112.2	37	c.615	CCDS5784.1	7																																																																																			RNF133	-	NULL	ENSG00000188050		0.408	RNF133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF133	HGNC	protein_coding	OTTHUMT00000347413.1	104	0.00	0	G	NM_139175		122338358	122338358	-1	no_errors	ENST00000340112	ensembl	human	known	69_37n	silent	71	24.47	23	SNP	1.000	A
RNF6	6049	genome.wustl.edu	37	13	26788189	26788189	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:26788189C>T	ENST00000381588.4	-	5	2582	c.1830G>A	c.(1828-1830)caG>caA	p.Q610Q	RNF6_ENST00000399762.2_Silent_p.Q254Q|RNF6_ENST00000381570.3_Silent_p.Q610Q|RNF6_ENST00000468480.1_Intron|RNF6_ENST00000346166.3_Silent_p.Q610Q	NM_005977.3	NP_005968.1	Q9Y252	RNF6_HUMAN	ring finger protein (C3H2C3 type) 6	610	Required for polyubiquitination. {ECO:0000250}.				negative regulation of axon extension (GO:0030517)|positive regulation of transcription, DNA-templated (GO:0045893)|protein K27-linked ubiquitination (GO:0044314)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)	axon (GO:0030424)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|PML body (GO:0016605)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(3)|ovary(2)|prostate(2)|skin(2)	23	Colorectal(5;0.000442)	Lung SC(185;0.0156)|Breast(139;0.147)		all cancers(112;0.00893)|Epithelial(112;0.0481)|OV - Ovarian serous cystadenocarcinoma(117;0.148)|GBM - Glioblastoma multiforme(144;0.23)|Lung(94;0.245)		GATTGTCAATCTGCTCTTTGG	0.363																																						dbGAP											0													172.0	162.0	166.0					13																	26788189		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ010346	CCDS9316.1	13q12.2	2013-01-09			ENSG00000127870	ENSG00000127870		"""RING-type (C3HC4) zinc fingers"""	10069	protein-coding gene	gene with protein product	"""RING-H2 protein RNF-6"""	604242				10331950	Standard	NM_005977		Approved	DKFZp686P0776	uc001uqq.3	Q9Y252	OTTHUMG00000016614	ENST00000381588.4:c.1830G>A	13.37:g.26788189C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDP0|Q5W0H0|Q9BZP5|Q9UF41	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q610	ENST00000381588.4	37	c.1830	CCDS9316.1	13																																																																																			RNF6	-	NULL	ENSG00000127870		0.363	RNF6-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF6	HGNC	protein_coding	OTTHUMT00000044246.2	117	0.00	0	C	NM_005977		26788189	26788189	-1	no_errors	ENST00000346166	ensembl	human	known	69_37n	silent	78	35.54	43	SNP	1.000	T
ROBO2	6092	genome.wustl.edu	37	3	77617518	77617518	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:77617518G>C	ENST00000461745.1	+	13	2804	c.1904G>C	c.(1903-1905)gGa>gCa	p.G635A	ROBO2_ENST00000487694.3_Missense_Mutation_p.G651A|ROBO2_ENST00000332191.8_Missense_Mutation_p.G635A	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	635					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		AAAGAGCTAGGAGATGTCCTT	0.448																																						dbGAP											0													115.0	116.0	115.0					3																	77617518		2085	4215	6300	-	-	-	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1904G>C	3.37:g.77617518G>C	ENSP00000417164:p.Gly635Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G635A	ENST00000461745.1	37	c.1904	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825638	0.50739	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.64438	-0.1;-0.06;-0.04	5.3	4.41	0.53225	Fibronectin, type III (2);	0.000000	0.45361	D	0.000372	T	0.69378	0.3104	L	0.38838	1.175	0.44702	D	0.997691	P;D;P	0.67145	0.714;0.996;0.714	P;D;P	0.71414	0.51;0.973;0.51	T	0.69453	-0.5141	9	0.27082	T	0.32	.	16.1272	0.81404	0.0:0.1342:0.8658:0.0	.	651;635;635	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	A	651;651;655;635;635;356	ENSP00000417335:G651A;ENSP00000417164:G635A;ENSP00000327536:G635A	ENSP00000327536:G635A	G	+	2	0	ROBO2	77700208	1.000000	0.71417	0.763000	0.31416	0.357000	0.29423	9.743000	0.98849	1.340000	0.45581	0.650000	0.86243	GGA	ROBO2	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000185008		0.448	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	79	0.00	0	G	XM_031246		77617518	77617518	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	missense	32	46.67	28	SNP	0.999	C
ROBO1	6091	genome.wustl.edu	37	3	79639053	79639053	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:79639053C>G	ENST00000464233.1	-	2	122	c.9G>C	c.(7-9)tgG>tgC	p.W3C		NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	3					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		GAACATGTTTCCATTTCATCT	0.388																																						dbGAP											0													157.0	153.0	154.0					3																	79639053		1894	4123	6017	-	-	-	SO:0001583	missense	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.9G>C	3.37:g.79639053C>G	ENSP00000420321:p.Trp3Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.W3C	ENST00000464233.1	37	c.9	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	C	5.563	0.288672	0.10513	.	.	ENSG00000169855	ENST00000464233;ENST00000398414	T	0.60040	0.22	5.24	5.24	0.73138	.	0.000000	0.35772	N	0.002993	T	0.56891	0.2016	N	0.08118	0	0.80722	D	1	D	0.69078	0.997	D	0.72338	0.977	T	0.59343	-0.7472	9	.	.	.	.	16.6141	0.84902	0.0:1.0:0.0:0.0	.	3	Q9Y6N7	ROBO1_HUMAN	C	3	ENSP00000420321:W3C	.	W	-	3	0	ROBO1	79721743	1.000000	0.71417	1.000000	0.80357	0.236000	0.25371	5.010000	0.64004	2.449000	0.82847	0.460000	0.39030	TGG	ROBO1	-	NULL	ENSG00000169855		0.388	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	91	0.00	0	C	NM_002941		79639053	79639053	-1	no_errors	ENST00000464233	ensembl	human	known	69_37n	missense	43	32.81	21	SNP	1.000	G
ROPN1B	152015	genome.wustl.edu	37	3	125696002	125696002	+	Frame_Shift_Del	DEL	G	G	-			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:125696002delG	ENST00000514116.1	+	5	705	c.390delG	c.(388-390)ctgfs	p.L130fs	ROPN1B_ENST00000511082.1_Frame_Shift_Del_p.L38fs|ROPN1B_ENST00000505382.1_Frame_Shift_Del_p.L38fs|ROPN1B_ENST00000251776.4_Frame_Shift_Del_p.L130fs			Q9BZX4	ROP1B_HUMAN	rhophilin associated tail protein 1B	130					acrosome reaction (GO:0007340)|cytokinesis (GO:0000910)|fusion of sperm to egg plasma membrane (GO:0007342)|Rho protein signal transduction (GO:0007266)|single organismal cell-cell adhesion (GO:0016337)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	8				GBM - Glioblastoma multiforme(114;0.151)		GCAGCGCTCTGGGAGTTGTAA	0.498																																						dbGAP											0													3.0	5.0	4.0					3																	125696002		1570	3329	4899	-	-	-	SO:0001589	frameshift_variant	0			AF231410	CCDS33841.1	3q21.2	2011-01-20	2011-01-20		ENSG00000114547	ENSG00000114547			31927	protein-coding gene	gene with protein product			"""ropporin, rhophilin associated protein 1B"""				Standard	XM_005247137		Approved		uc003eih.3	Q9BZX4	OTTHUMG00000162651	ENST00000514116.1:c.390delG	3.37:g.125696002delG	ENSP00000426271:p.Leu130fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNA6|Q96BM7	Frame_Shift_Del	DEL	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.G131fs	ENST00000514116.1	37	c.390	CCDS33841.1	3																																																																																			ROPN1B	-	NULL	ENSG00000114547		0.498	ROPN1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ROPN1B	HGNC	protein_coding	OTTHUMT00000369931.1	34	0.00	0	G	NM_001012337		125696002	125696002	+1	no_errors	ENST00000251776	ensembl	human	known	69_37n	frame_shift_del	18	33.33	9	DEL	0.990	-
RPH3A	22895	genome.wustl.edu	37	12	113285625	113285625	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:113285625G>A	ENST00000389385.4	+	5	705	c.208G>A	c.(208-210)Gag>Aag	p.E70K	RPH3A_ENST00000420983.2_Missense_Mutation_p.E70K|RPH3A_ENST00000415485.3_Missense_Mutation_p.E70K|RPH3A_ENST00000548866.1_Intron|RPH3A_ENST00000551052.1_Missense_Mutation_p.E66K|RPH3A_ENST00000447659.2_Intron|RPH3A_ENST00000543106.2_Missense_Mutation_p.E70K	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	70	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		GAAAATGGAAGAGATGGAGCA	0.572																																						dbGAP											0													89.0	72.0	78.0					12																	113285625		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.208G>A	12.37:g.113285625G>A	ENSP00000374036:p.Glu70Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3C3|Q96AE0	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Rabphilin3A_effector_Zn-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.E70K	ENST00000389385.4	37	c.208	CCDS44979.1	12	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036233	0.35893	.	.	ENSG00000089169	ENST00000548197;ENST00000547686;ENST00000543106;ENST00000551593;ENST00000551748;ENST00000546703;ENST00000547840;ENST00000547728;ENST00000549769;ENST00000552667;ENST00000389385;ENST00000550901;ENST00000551198;ENST00000551052;ENST00000415485;ENST00000553114;ENST00000420983	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.74842	-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88;-0.88	5.07	5.07	0.68467	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Rabphilin-3A effector, zinc-binding (1);Zinc finger, FYVE/PHD-type (1);	0.099107	0.42964	D	0.000639	T	0.71762	0.3378	L	0.52364	1.645	0.44085	D	0.996845	P;P;P	0.40578	0.722;0.722;0.675	B;B;B	0.40825	0.341;0.239;0.154	T	0.71381	-0.4610	9	.	.	.	.	17.5808	0.87968	0.0:0.0:1.0:0.0	.	70;70;66	B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;RP3A_HUMAN;.	K	70;70;70;70;70;70;70;70;70;70;70;3;70;66;70;70;70	ENSP00000446570:E70K;ENSP00000449705:E70K;ENSP00000440384:E70K;ENSP00000446780:E70K;ENSP00000447306:E70K;ENSP00000446556:E70K;ENSP00000450382:E70K;ENSP00000449613:E70K;ENSP00000447505:E70K;ENSP00000449650:E70K;ENSP00000374036:E70K;ENSP00000448100:E3K;ENSP00000447083:E70K;ENSP00000448297:E66K;ENSP00000405357:E70K;ENSP00000450216:E70K;ENSP00000408889:E70K	.	E	+	1	0	RPH3A	111770008	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.797000	0.91882	2.492000	0.84095	0.655000	0.94253	GAG	RPH3A	-	pfam_Rabphilin3A_effector_Zn-bd,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	ENSG00000089169		0.572	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	47	0.00	0	G	NM_014954		113285625	113285625	+1	no_errors	ENST00000389385	ensembl	human	known	69_37n	missense	33	34.00	17	SNP	1.000	A
RPLP0P2	113157	genome.wustl.edu	37	11	61404878	61404878	+	RNA	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:61404878G>C	ENST00000496593.1	+	0	1482					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		TTCTATCATCGACGGGTACAA	0.522																																						dbGAP											0																																										-	-	-			0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404878G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.522	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1	35	0.00	0	G	NR_002775		61404878	61404878	+1	no_errors	ENST00000496593	ensembl	human	known	69_37n	rna	38	33.33	19	SNP	1.000	C
RSPH14	27156	genome.wustl.edu	37	22	23401817	23401817	+	Silent	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:23401817C>A	ENST00000216036.4	-	7	1066	c.870G>T	c.(868-870)ctG>ctT	p.L290L		NM_014433.2	NP_055248.1	Q9UHP6	RTDR1_HUMAN		290										breast(1)|endometrium(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|stomach(1)|urinary_tract(1)	18	all_hematologic(9;0.0197)|Acute lymphoblastic leukemia(84;0.181)			READ - Rectum adenocarcinoma(21;0.175)		TGGTGGCATTCAGGCGCGCTA	0.652																																						dbGAP											0													86.0	83.0	84.0					22																	23401817		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000216036.4:c.870G>T	22.37:g.23401817C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_HEAT,pfam_Armadillo,superfamily_ARM-type_fold	p.L290	ENST00000216036.4	37	c.870	CCDS13803.1	22																																																																																			RTDR1	-	superfamily_ARM-type_fold	ENSG00000100218		0.652	RTDR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTDR1	HGNC	protein_coding	OTTHUMT00000319049.1	26	0.00	0	C			23401817	23401817	-1	no_errors	ENST00000216036	ensembl	human	known	69_37n	silent	14	36.36	8	SNP	1.000	A
RUFY3	22902	genome.wustl.edu	37	4	71654529	71654529	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:71654529G>A	ENST00000226328.4	+	11	1641	c.1078G>A	c.(1078-1080)Gag>Aag	p.E360K	RUFY3_ENST00000381006.3_Missense_Mutation_p.E360K|RUFY3_ENST00000502653.1_Missense_Mutation_p.E307K|RUFY3_ENST00000536664.1_Missense_Mutation_p.E344K|RUFY3_ENST00000417478.2_Missense_Mutation_p.E420K	NM_014961.3	NP_055776.1	Q7L099	RUFY3_HUMAN	RUN and FYVE domain containing 3	360					negative regulation of axonogenesis (GO:0050771)	filopodium (GO:0030175)|growth cone (GO:0030426)				endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	16		all_hematologic(202;0.248)	Lung(101;0.235)			GCAGGATGTTGAGAAAGAACT	0.433																																						dbGAP											0													107.0	93.0	98.0					4																	71654529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112221	CCDS3547.1, CCDS34001.1, CCDS47068.1, CCDS75138.1	4q13.3	2009-05-29			ENSG00000018189	ENSG00000018189		"""Zinc fingers, FYVE domain containing"""	30285	protein-coding gene	gene with protein product	"""single axon-related 1"""	611194				17439943	Standard	NM_001130709		Approved	RIPx, KIAA0871, Singar1	uc003hfr.3	Q7L099	OTTHUMG00000129910	ENST00000226328.4:c.1078G>A	4.37:g.71654529G>A	ENSP00000226328:p.Glu360Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KM25|B4DYW7|D9N163|O94948|Q9UI00	Missense_Mutation	SNP	pfam_Run,superfamily_Prefoldin,smart_Run,pfscan_Run	p.E420K	ENST00000226328.4	37	c.1258	CCDS3547.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.429909	0.96131	.	.	ENSG00000018189	ENST00000417478;ENST00000381006;ENST00000226328;ENST00000536664;ENST00000502653	T;T;T;T;T	0.13901	2.55;2.55;2.55;2.55;2.55	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.40094	0.1103	M	0.72353	2.195	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;0.993;0.997	D;D;D;D	0.97110	0.935;1.0;0.971;0.947	T	0.08289	-1.0729	10	0.54805	T	0.06	-24.0704	19.6014	0.95563	0.0:0.0:1.0:0.0	.	344;360;360;420	B4DKC2;Q7L099-3;Q7L099;Q7L099-2	.;.;RUFY3_HUMAN;.	K	420;360;360;344;307	ENSP00000399771:E420K;ENSP00000370394:E360K;ENSP00000226328:E360K;ENSP00000443652:E344K;ENSP00000425400:E307K	ENSP00000226328:E360K	E	+	1	0	RUFY3	71873393	1.000000	0.71417	1.000000	0.80357	0.863000	0.49368	9.476000	0.97823	2.622000	0.88805	0.650000	0.86243	GAG	RUFY3	-	NULL	ENSG00000018189		0.433	RUFY3-001	KNOWN	basic|CCDS	protein_coding	RUFY3	HGNC	protein_coding	OTTHUMT00000252161.2	84	0.00	0	G	NM_014961		71654529	71654529	+1	no_errors	ENST00000417478	ensembl	human	known	69_37n	missense	50	37.50	30	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237664064	237664064	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:237664064G>A	ENST00000366574.2	+	21	2574	c.2257G>A	c.(2257-2259)Gat>Aat	p.D753N	RYR2_ENST00000360064.6_Missense_Mutation_p.D751N|RYR2_ENST00000542537.1_Missense_Mutation_p.D737N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	753	B30.2/SPRY 1. {ECO:0000255|PROSITE- ProRule:PRU00548}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGAACTGATGATGTCATCAG	0.398																																						dbGAP											0													311.0	294.0	299.0					1																	237664064		1923	4134	6057	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2257G>A	1.37:g.237664064G>A	ENSP00000355533:p.Asp753Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.D751N	ENST00000366574.2	37	c.2251	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	36	5.695569	0.96802	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;T;T	0.65732	-0.17;-0.17;-0.17	5.95	5.95	0.96441	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.64402	D	0.000004	D	0.87354	0.6156	H	0.97023	3.925	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.90574	0.4524	10	0.87932	D	0	.	20.4024	0.99000	0.0:0.0:1.0:0.0	.	753	Q92736	RYR2_HUMAN	N	753;751;737	ENSP00000355533:D753N;ENSP00000353174:D751N;ENSP00000443798:D737N	ENSP00000353174:D751N	D	+	1	0	RYR2	235730687	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.805000	0.99149	2.827000	0.97445	0.650000	0.86243	GAT	RYR2	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000198626		0.398	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	125	0.00	0	G	NM_001035		237664064	237664064	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	242	11.03	30	SNP	1.000	A
SAG	6295	genome.wustl.edu	37	2	234237145	234237145	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:234237145C>T	ENST00000409110.1	+	8	764	c.534C>T	c.(532-534)atC>atT	p.I178I	SAG_ENST00000449594.2_Silent_p.I44I	NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	178					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		GATTACTGATCCGCAAAGTAC	0.602																																						dbGAP											0													173.0	153.0	159.0					2																	234237145		1996	4167	6163	-	-	-	SO:0001819	synonymous_variant	0				CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.534C>T	2.37:g.234237145C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FDN6|Q53SV3|Q99858	Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.I178	ENST00000409110.1	37	c.534	CCDS46545.1	2																																																																																			SAG	-	pfam_Arrestin-like_N,superfamily_Ig_E-set,prints_Arrestin	ENSG00000130561		0.602	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAG	HGNC	protein_coding	OTTHUMT00000330126.1	40	0.00	0	C	NM_000541		234237145	234237145	+1	no_errors	ENST00000409110	ensembl	human	known	69_37n	silent	36	20.00	9	SNP	1.000	T
SALL4	57167	genome.wustl.edu	37	20	50407290	50407290	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:50407290G>C	ENST00000217086.4	-	2	1843	c.1732C>G	c.(1732-1734)Cag>Gag	p.Q578E	SALL4_ENST00000371539.3_Intron|SALL4_ENST00000483130.1_5'Flank|SALL4_ENST00000395997.3_Intron	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	578					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AGGGAGCTCTGACAGCTTAAG	0.517																																						dbGAP											0													122.0	104.0	110.0					20																	50407290		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.1732C>G	20.37:g.50407290G>C	ENSP00000217086:p.Gln578Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2D8|Q540H3|Q6Y8G6	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q578E	ENST00000217086.4	37	c.1732	CCDS13438.1	20	.	.	.	.	.	.	.	.	.	.	G	16.16	3.044445	0.55110	.	.	ENSG00000101115	ENST00000217086	T	0.07216	3.21	5.59	4.55	0.56014	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43260	D	0.000599	T	0.18425	0.0442	M	0.82517	2.595	0.80722	D	1	P	0.49090	0.919	P	0.44447	0.45	T	0.04767	-1.0928	10	0.45353	T	0.12	-12.7205	17.1616	0.86805	0.0:0.0:0.8651:0.1349	.	578	Q9UJQ4	SALL4_HUMAN	E	578	ENSP00000217086:Q578E	ENSP00000217086:Q578E	Q	-	1	0	SALL4	49840697	1.000000	0.71417	0.999000	0.59377	0.860000	0.49131	7.913000	0.87471	2.620000	0.88729	0.650000	0.86243	CAG	SALL4	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000101115		0.517	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	74	0.00	0	G			50407290	50407290	-1	no_errors	ENST00000217086	ensembl	human	known	69_37n	missense	103	15.57	19	SNP	1.000	C
SAMD9L	219285	genome.wustl.edu	37	7	92764738	92764738	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:92764738G>C	ENST00000318238.4	-	5	1763	c.547C>G	c.(547-549)Cta>Gta	p.L183V	SAMD9L_ENST00000411955.1_Missense_Mutation_p.L183V|SAMD9L_ENST00000437805.1_Missense_Mutation_p.L183V	NM_152703.2	NP_689916.2	Q8IVG5	SAM9L_HUMAN	sterile alpha motif domain containing 9-like	183					common myeloid progenitor cell proliferation (GO:0035726)|endosomal vesicle fusion (GO:0034058)|hematopoietic progenitor cell differentiation (GO:0002244)|regulation of protein catabolic process (GO:0042176)|spleen development (GO:0048536)|stem cell division (GO:0017145)	early endosome (GO:0005769)				central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(23)|liver(2)|lung(31)|ovary(5)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	88	all_cancers(62;4.15e-11)|all_epithelial(64;2.29e-10)|Breast(17;0.000675)|Lung NSC(181;0.0755)|all_lung(186;0.0989)		STAD - Stomach adenocarcinoma(171;0.000302)			TCAGGTTGTAGAGTATAATGT	0.393																																						dbGAP											0													230.0	223.0	225.0					7																	92764738		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB095926	CCDS34681.1	7q21.2	2013-01-10		2005-04-26	ENSG00000177409	ENSG00000177409		"""Sterile alpha motif (SAM) domain containing"""	1349	protein-coding gene	gene with protein product		611170	"""chromosome 7 open reading frame 6"""	C7orf6			Standard	NM_152703		Approved	KIAA2005, FLJ39885	uc003umh.1	Q8IVG5	OTTHUMG00000155807	ENST00000318238.4:c.547C>G	7.37:g.92764738G>C	ENSP00000326247:p.Leu183Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP23|A0JP24|A0PJG8|A4D1G8|D6W5Q6|Q2TV71|Q2TV75|Q2UZV8|Q8IWI4|Q8N3L9|Q8N875	Missense_Mutation	SNP	superfamily_SAM/pointed,pfscan_SAM	p.L183V	ENST00000318238.4	37	c.547	CCDS34681.1	7	.	.	.	.	.	.	.	.	.	.	G	16.16	3.045583	0.55110	.	.	ENSG00000177409	ENST00000318238;ENST00000411955;ENST00000437805	T;T;T	0.16597	2.33;2.33;2.33	4.95	0.83	0.18854	.	0.000000	0.56097	D	0.000035	T	0.20088	0.0483	M	0.66939	2.045	0.21802	N	0.99954	P	0.51351	0.944	P	0.46510	0.519	T	0.09487	-1.0672	10	0.72032	D	0.01	-4.9472	6.3357	0.21294	0.2183:0.0:0.6439:0.1378	.	183	Q8IVG5	SAM9L_HUMAN	V	183	ENSP00000326247:L183V;ENSP00000405760:L183V;ENSP00000408796:L183V	ENSP00000326247:L183V	L	-	1	2	SAMD9L	92602674	0.971000	0.33674	0.007000	0.13788	0.084000	0.17831	1.612000	0.36889	0.211000	0.20683	0.460000	0.39030	CTA	SAMD9L	-	NULL	ENSG00000177409		0.393	SAMD9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD9L	HGNC	protein_coding	OTTHUMT00000341730.1	179	0.00	0	G	NM_152703		92764738	92764738	-1	no_errors	ENST00000318238	ensembl	human	known	69_37n	missense	138	32.68	67	SNP	0.291	C
SCAPER	49855	genome.wustl.edu	37	15	77067266	77067266	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:77067266G>A	ENST00000563290.1	-	9	1060	c.965C>T	c.(964-966)tCt>tTt	p.S322F	SCAPER_ENST00000562890.1_5'Flank|SCAPER_ENST00000324767.7_Missense_Mutation_p.S322F|SCAPER_ENST00000538941.2_Missense_Mutation_p.S76F			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	322						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TATAGTATTAGAAGTTCCATC	0.373																																						dbGAP											0													123.0	121.0	122.0					15																	77067266		1849	4087	5936	-	-	-	SO:0001583	missense	0			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.965C>T	15.37:g.77067266G>A	ENSP00000454973:p.Ser322Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.S322F	ENST00000563290.1	37	c.965	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	G	11.44	1.638075	0.29157	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.24908	1.86;1.83	5.77	4.86	0.63082	.	0.576608	0.18260	N	0.146665	T	0.26340	0.0643	L	0.51422	1.61	0.09310	N	1	P;P;B	0.39094	0.631;0.659;0.432	B;B;B	0.39185	0.293;0.167;0.098	T	0.15037	-1.0451	10	0.59425	D	0.04	.	11.2029	0.48751	0.1466:0.0:0.8534:0.0	.	322;337;76	Q6NSF1;Q9BY12-2;F5H7X8	.;.;.	F	322;76;338	ENSP00000326924:S322F;ENSP00000442190:S76F	ENSP00000303560:S338F	S	-	2	0	SCAPER	74854321	0.800000	0.28916	0.011000	0.14972	0.742000	0.42306	5.090000	0.64498	1.448000	0.47680	-0.136000	0.14681	TCT	SCAPER	-	NULL	ENSG00000140386		0.373	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	98	0.00	0	G	NM_020843		77067266	77067266	-1	no_errors	ENST00000324767	ensembl	human	known	69_37n	missense	62	38.00	38	SNP	0.007	A
SCN3B	55800	genome.wustl.edu	37	11	123508916	123508916	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:123508916C>G	ENST00000392770.2	-	4	1364	c.562G>C	c.(562-564)Gaa>Caa	p.E188Q	SCN3B_ENST00000530277.1_Missense_Mutation_p.E188Q|SCN3B_ENST00000299333.3_Missense_Mutation_p.E188Q	NM_018400.3	NP_060870.1	Q9NY72	SCN3B_HUMAN	sodium channel, voltage-gated, type III, beta subunit	188					atrial cardiac muscle cell action potential (GO:0086014)|axon guidance (GO:0007411)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|positive regulation of heart rate (GO:0010460)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transporter activity (GO:2000649)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sensory perception of pain (GO:0019233)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|ventricular cardiac muscle cell action potential (GO:0086005)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ion channel binding (GO:0044325)|sodium channel regulator activity (GO:0017080)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)	p.E188K(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(16)|ovary(2)|skin(2)	26		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0227)	Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTGCCTCTTCGGCTTTTGAG	0.463																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											136.0	113.0	121.0					11																	123508916		2202	4299	6501	-	-	-	SO:0001583	missense	0			AJ243396	CCDS8442.1	11q24.1	2014-09-17	2012-02-28		ENSG00000166257	ENSG00000166257		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"", ""Immunoglobulin superfamily / V-set domain containing"""	20665	protein-coding gene	gene with protein product		608214	"""sodium channel, voltage-gated, type III, beta"""			10688874	Standard	XR_428980		Approved	HSA243396	uc001pzb.1	Q9NY72	OTTHUMG00000166006	ENST00000392770.2:c.562G>C	11.37:g.123508916C>G	ENSP00000376523:p.Glu188Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5H1I5|Q17RL3|Q9ULR2	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.E188Q	ENST00000392770.2	37	c.562	CCDS8442.1	11	.	.	.	.	.	.	.	.	.	.	C	28.2	4.896913	0.91962	.	.	ENSG00000166257	ENST00000392770;ENST00000299333;ENST00000530277	D;D;D	0.96587	-4.06;-4.06;-4.06	5.7	5.7	0.88788	.	0.042915	0.85682	D	0.000000	D	0.94833	0.8331	N	0.22421	0.69	0.58432	D	0.999998	D	0.59357	0.985	P	0.51701	0.677	D	0.93495	0.6839	10	0.25751	T	0.34	-4.591	19.8411	0.96685	0.0:1.0:0.0:0.0	.	188	Q9NY72	SCN3B_HUMAN	Q	188	ENSP00000376523:E188Q;ENSP00000299333:E188Q;ENSP00000432785:E188Q	ENSP00000299333:E188Q	E	-	1	0	SCN3B	123014126	1.000000	0.71417	0.961000	0.40146	0.755000	0.42902	7.481000	0.81124	2.683000	0.91414	0.655000	0.94253	GAA	SCN3B	-	NULL	ENSG00000166257		0.463	SCN3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN3B	HGNC	protein_coding	OTTHUMT00000387412.1	82	0.00	0	C	NM_018400		123508916	123508916	-1	no_errors	ENST00000299333	ensembl	human	known	69_37n	missense	36	43.75	28	SNP	1.000	G
SCN7A	6332	genome.wustl.edu	37	2	167273255	167273255	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:167273255C>T	ENST00000409855.1	-	20	3502	c.3376G>A	c.(3376-3378)Gat>Aat	p.D1126N		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	1126					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	CCAACATTATCAAAGTTCATT	0.343																																						dbGAP											0													83.0	74.0	77.0					2																	167273255		1848	4095	5943	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.3376G>A	2.37:g.167273255C>T	ENSP00000386796:p.Asp1126Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.D1126N	ENST00000409855.1	37	c.3376	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	C	28.0	4.883156	0.91740	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.97529	-4.42	4.87	4.87	0.63330	Ion transport (1);	0.000000	0.64402	D	0.000004	D	0.98096	0.9372	M	0.89353	3.025	0.51012	D	0.999902	P	0.51537	0.946	P	0.54590	0.756	D	0.98826	1.0749	10	0.72032	D	0.01	.	15.5609	0.76244	0.0:1.0:0.0:0.0	.	1126	Q01118	SCN7A_HUMAN	N	1126	ENSP00000386796:D1126N	ENSP00000259060:D1126N	D	-	1	0	SCN7A	166981501	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.606000	0.82863	2.547000	0.85894	0.650000	0.86243	GAT	SCN7A	-	pfam_Ion_trans_dom	ENSG00000136546		0.343	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	100	0.00	0	C			167273255	167273255	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	57	26.92	21	SNP	1.000	T
SEMA3A	10371	genome.wustl.edu	37	7	83675694	83675694	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:83675694G>A	ENST00000265362.4	-	6	927	c.613C>T	c.(613-615)Ctt>Ttt	p.L205F	SEMA3A_ENST00000436949.1_Missense_Mutation_p.L205F	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	205	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)			breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						TGGTGCCCAAGAGTTCGGAAG	0.433																																						dbGAP											0													219.0	196.0	204.0					7																	83675694		2203	4300	6503	-	-	-	SO:0001583	missense	0			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.613C>T	7.37:g.83675694G>A	ENSP00000265362:p.Leu205Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.L205F	ENST00000265362.4	37	c.613	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443025	0.83993	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.26957	1.7;1.7	5.88	4.99	0.66335	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.058133	0.64402	D	0.000002	T	0.52306	0.1726	M	0.78916	2.43	0.58432	D	0.999999	D	0.89917	1.0	D	0.77004	0.989	T	0.56288	-0.8004	10	0.51188	T	0.08	.	15.4075	0.74890	0.0673:0.0:0.9327:0.0	.	205	Q14563	SEM3A_HUMAN	F	205	ENSP00000265362:L205F;ENSP00000415260:L205F	ENSP00000265362:L205F	L	-	1	0	SEMA3A	83513630	1.000000	0.71417	0.995000	0.50966	0.996000	0.88848	5.132000	0.64758	1.459000	0.47892	0.650000	0.86243	CTT	SEMA3A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000075213		0.433	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	136	0.00	0	G	NM_006080		83675694	83675694	-1	no_errors	ENST00000265362	ensembl	human	known	69_37n	missense	94	27.48	36	SNP	1.000	A
SERPINB11	89778	genome.wustl.edu	37	18	61387387	61387387	+	RNA	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:61387387G>A	ENST00000382749.5	+	0	861				SERPINB11_ENST00000536691.1_RNA|SERPINB11_ENST00000489748.1_RNA|SERPINB11_ENST00000538847.1_RNA|SERPINB11_ENST00000544088.1_RNA			Q96P15	SPB11_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 11 (gene/pseudogene)						negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|kidney(1)|lung(3)	6		Esophageal squamous(42;0.129)				TCAGCTAAGTGAGGTAAGTAT	0.313																																					Ovarian(27;496 784 5942 8975 23930)	dbGAP											0													43.0	44.0	44.0					18																	61387387		1824	4078	5902	-	-	-			0					18q21.33	2014-02-18	2009-01-22		ENSG00000206072	ENSG00000206072		"""Serine (or cysteine) peptidase inhibitors"""	14221	protein-coding gene	gene with protein product		615682	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 11"", ""serpin peptidase inhibitor, clade B (ovalbumin), member 11"""			17562709, 24172014	Standard	XM_006722569		Approved	EPIPIN	uc002ljk.4	Q96P15	OTTHUMG00000060404		18.37:g.61387387G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9R0|Q5Q120|Q5Q121|Q5Q122|Q5Q123|Q6ISD3|Q96P13|Q96P14	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.E31K	ENST00000382749.5	37	c.91		18	.	.	.	.	.	.	.	.	.	.	G	4.592	0.109928	0.08780	.	.	ENSG00000206072	ENST00000544088;ENST00000536691	D;D	0.82255	-1.59;-1.59	5.62	1.72	0.24424	Serpin domain (3);	.	.	.	.	T	0.58509	0.2127	N	0.05050	-0.12	0.21897	N	0.999489	B;B;B	0.12013	0.004;0.004;0.005	B;B;B	0.16722	0.009;0.009;0.016	T	0.48822	-0.9001	9	0.02654	T	1	.	5.6177	0.17440	0.2137:0.2736:0.5127:0.0	.	31;206;206	F5GWT8;F5GYW9;Q96P15	.;.;SPB11_HUMAN	K	206;31	ENSP00000441497:E206K;ENSP00000441708:E31K	ENSP00000421854:E206K	E	+	1	0	SERPINB11	59538367	0.001000	0.12720	0.746000	0.31095	0.817000	0.46193	-0.234000	0.09028	0.378000	0.24764	0.655000	0.94253	GAG	SERPINB11	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000206072		0.313	SERPINB11-002	KNOWN	basic	polymorphic_pseudogene	SERPINB11	HGNC	polymorphic_pseudogene	OTTHUMT00000207392.3	67	0.00	0	G	NM_080475		61387387	61387387	+1	no_errors	ENST00000536691	ensembl	human	known	69_37n	missense	21	46.15	18	SNP	0.918	A
SETD2	29072	genome.wustl.edu	37	3	47158173	47158173	+	Missense_Mutation	SNP	C	C	G	rs528393799		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:47158173C>G	ENST00000409792.3	-	4	4568	c.4526G>C	c.(4525-4527)aGa>aCa	p.R1509T		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1509	AWS. {ECO:0000255|PROSITE- ProRule:PRU00562}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ACCTTGAGCTCTTTCATCTTT	0.348			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													120.0	119.0	119.0					3																	47158173		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4526G>C	3.37:g.47158173C>G	ENSP00000386759:p.Arg1509Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.R1509T	ENST00000409792.3	37	c.4526	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	C	31	5.092306	0.94149	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	T	0.80653	-1.4	5.93	5.93	0.95920	AWS (2);	0.000000	0.64402	D	0.000013	D	0.89072	0.6611	M	0.61703	1.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.991;0.991	D	0.88279	0.2935	10	0.56958	D	0.05	.	20.3495	0.98807	0.0:1.0:0.0:0.0	.	1509;1509	F2Z317;Q9BYW2	.;SETD2_HUMAN	T	1509	ENSP00000386759:R1509T	ENSP00000386759:R1509T	R	-	2	0	SETD2	47133177	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.759000	0.85235	2.814000	0.96858	0.591000	0.81541	AGA	SETD2	-	smart_AWS,pfscan_AWS	ENSG00000181555		0.348	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	128	0.00	0	C	NM_014159		47158173	47158173	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	missense	40	37.50	24	SNP	1.000	G
SETX	23064	genome.wustl.edu	37	9	135205472	135205472	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:135205472C>G	ENST00000224140.5	-	10	1695	c.1513G>C	c.(1513-1515)Gag>Cag	p.E505Q	SETX_ENST00000393220.1_Missense_Mutation_p.E505Q|SETX_ENST00000372169.2_Missense_Mutation_p.E505Q	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	505					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		GATGATTTCTCAGAACTCCGT	0.438																																						dbGAP											0													102.0	107.0	105.0					9																	135205472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.1513G>C	9.37:g.135205472C>G	ENSP00000224140:p.Glu505Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	NULL	p.E505Q	ENST00000224140.5	37	c.1513	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	C	22.7	4.325793	0.81580	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.81821	-1.54;-1.54;-1.54	5.82	5.82	0.92795	.	0.693856	0.14468	N	0.317791	D	0.85323	0.5670	L	0.29908	0.895	0.36138	D	0.846573	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.80764	0.994;0.986;0.994	D	0.87559	0.2470	10	0.87932	D	0	.	17.2572	0.87060	0.0:1.0:0.0:0.0	.	505;505;505	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	Q	505	ENSP00000224140:E505Q;ENSP00000361242:E505Q;ENSP00000376913:E505Q	ENSP00000224140:E505Q	E	-	1	0	SETX	134195293	0.998000	0.40836	1.000000	0.80357	0.998000	0.95712	5.038000	0.64177	2.754000	0.94517	0.650000	0.86243	GAG	SETX	-	NULL	ENSG00000107290		0.438	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	58	0.00	0	C	NM_015046		135205472	135205472	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	1.000	G
SFSWAP	6433	genome.wustl.edu	37	12	132237743	132237743	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:132237743G>A	ENST00000261674.4	+	8	1298	c.1157G>A	c.(1156-1158)gGa>gAa	p.G386E	SFSWAP_ENST00000541286.1_Missense_Mutation_p.G386E	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	386					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						CCCCCTCCCGGAATCGACGTG	0.617																																						dbGAP											0													149.0	132.0	137.0					12																	132237743		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.1157G>A	12.37:g.132237743G>A	ENSP00000261674:p.Gly386Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Missense_Mutation	SNP	pfam_SWAP_N_domain,pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	p.G386E	ENST00000261674.4	37	c.1157	CCDS9273.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.3|22.3	4.267909|4.267909	0.80469|0.80469	.|.	.|.	ENSG00000061936|ENSG00000061936	ENST00000537164|ENST00000261674;ENST00000544623;ENST00000535236;ENST00000541286	.|T;T;T	.|0.25250	.|2.78;1.81;2.8	5.28|5.28	5.28|5.28	0.74379|0.74379	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.50411|0.50411	0.1614|0.1614	M|M	0.66939|0.66939	2.045|2.045	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;0.999;1.0	T|T	0.32322|0.32322	-0.9911|-0.9911	5|10	.|0.27785	.|T	.|0.31	-42.728|-42.728	19.2737|19.2737	0.94021|0.94021	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|386;386;323	.|F5H6B8;Q12872;F5H525	.|.;SFSWA_HUMAN;.	K|E	26|386;323;179;386	.|ENSP00000261674:G386E;ENSP00000443045:G179E;ENSP00000437738:G386E	.|ENSP00000261674:G386E	E|G	+|+	1|2	0|0	SFSWAP|SFSWAP	130803696|130803696	1.000000|1.000000	0.71417|0.71417	0.177000|0.177000	0.23020|0.23020	0.295000|0.295000	0.27426|0.27426	9.705000|9.705000	0.98719|0.98719	2.622000|2.622000	0.88805|0.88805	0.462000|0.462000	0.41574|0.41574	GAA|GGA	SFSWAP	-	NULL	ENSG00000061936		0.617	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SFSWAP	HGNC	protein_coding	OTTHUMT00000399276.1	34	0.00	0	G	NM_004592		132237743	132237743	+1	no_errors	ENST00000261674	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	A
SGIP1	84251	genome.wustl.edu	37	1	67155912	67155912	+	Missense_Mutation	SNP	C	C	A	rs374477039		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:67155912C>A	ENST00000371037.4	+	17	1560	c.1483C>A	c.(1483-1485)Cct>Act	p.P495T	SGIP1_ENST00000371035.3_Missense_Mutation_p.P285T|SGIP1_ENST00000371036.3_Missense_Mutation_p.P295T|SGIP1_ENST00000237247.6_Missense_Mutation_p.P526T|SGIP1_ENST00000371039.1_Missense_Mutation_p.P296T	NM_032291.2	NP_115667.2	Q9BQI5	SGIP1_HUMAN	SH3-domain GRB2-like (endophilin) interacting protein 1	495	Pro-rich.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of feeding behavior (GO:2000253)|positive regulation of receptor-mediated endocytosis (GO:0048260)|response to dietary excess (GO:0002021)	AP-2 adaptor complex (GO:0030122)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phospholipid binding (GO:0005543)|SH3 domain binding (GO:0017124)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(43)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	71						TTCCAGCCCTCCTCCAATAGC	0.458																																						dbGAP											0													174.0	166.0	168.0					1																	67155912		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136561	CCDS30744.1	1p31.3	2008-02-05			ENSG00000118473	ENSG00000118473			25412	protein-coding gene	gene with protein product		611540				11230166	Standard	NM_032291		Approved	DKFZp761D221	uc001dcr.3	Q9BQI5	OTTHUMG00000009161	ENST00000371037.4:c.1483C>A	1.37:g.67155912C>A	ENSP00000360076:p.Pro495Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL81|A6NLD1|Q4LE32|Q5VYE2|Q5VYE3|Q5VYE4|Q68D76|Q6MZY6|Q8IWC2	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C	p.P526T	ENST00000371037.4	37	c.1576	CCDS30744.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.615550	0.87359	.	.	ENSG00000118473	ENST00000237247;ENST00000371039;ENST00000371035;ENST00000371038;ENST00000407289;ENST00000371036;ENST00000371037	T;T;T;T;T	0.03035	4.07;4.07;4.07;4.07;4.07	6.04	6.04	0.98038	.	0.000000	0.64402	D	0.000001	T	0.12603	0.0306	M	0.71581	2.175	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.998;1.0	D;D;D;D	0.83275	0.996;0.987;0.987;0.996	T	0.03259	-1.1055	10	0.33141	T	0.24	-11.6547	20.5792	0.99380	0.0:1.0:0.0:0.0	.	525;95;285;495	A6NEV3;B3KR01;B7Z5H8;Q9BQI5	.;.;.;SGIP1_HUMAN	T	526;296;285;525;498;295;495	ENSP00000237247:P526T;ENSP00000360078:P296T;ENSP00000360074:P285T;ENSP00000360075:P295T;ENSP00000360076:P495T	ENSP00000237247:P526T	P	+	1	0	SGIP1	66928500	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.456000	0.80751	2.873000	0.98535	0.561000	0.74099	CCT	SGIP1	-	NULL	ENSG00000118473		0.458	SGIP1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGIP1	HGNC	protein_coding	OTTHUMT00000025395.4	135	0.00	0	C	NM_032291		67155912	67155912	+1	no_errors	ENST00000237247	ensembl	human	known	69_37n	missense	43	58.25	60	SNP	1.000	A
SHISA9	729993	genome.wustl.edu	37	16	13002435	13002435	+	Intron	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:13002435C>G	ENST00000424107.3	+	1	1008				SHISA9_ENST00000558583.1_Intron|SHISA9_ENST00000423335.2_Silent_p.V221V|SHISA9_ENST00000482916.1_3'UTR|SHISA9_ENST00000558318.1_Silent_p.V262V			B4DS77	SHSA9_HUMAN	shisa family member 9						regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)				breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						CCTGGACAGTCTGAGTGCACG	0.532																																						dbGAP											0													103.0	82.0	89.0					16																	13002435		692	1591	2283	-	-	-	SO:0001627	intron_variant	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.563+5951C>G	16.37:g.13002435C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J314|C9JCE9	Silent	SNP	NULL	p.V262	ENST00000424107.3	37	c.786	CCDS45417.2	16																																																																																			SHISA9	-	NULL	ENSG00000237515		0.532	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	54	0.00	0	C	NM_001145204		13002435	13002435	+1	no_errors	ENST00000558318	ensembl	human	known	69_37n	silent	45	34.78	24	SNP	0.000	G
SIPA1L1	26037	genome.wustl.edu	37	14	72139289	72139289	+	Silent	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:72139289C>A	ENST00000555818.1	+	9	3402	c.3054C>A	c.(3052-3054)gtC>gtA	p.V1018V	SIPA1L1_ENST00000537413.1_Silent_p.V493V|SIPA1L1_ENST00000358550.2_Silent_p.V1018V|SIPA1L1_ENST00000381232.3_Silent_p.V1018V	NM_001284247.1|NM_015556.1	NP_001271176.1|NP_056371.1	O43166	SI1L1_HUMAN	signal-induced proliferation-associated 1 like 1	1018	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton reorganization (GO:0031532)|activation of Rap GTPase activity (GO:0032861)|ephrin receptor signaling pathway (GO:0048013)|regulation of axonogenesis (GO:0050770)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of Rap GTPase activity (GO:0032317)|regulation of synaptic plasticity (GO:0048167)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(1)|large_intestine(22)|liver(2)|lung(25)|ovary(3)|prostate(3)|skin(3)|stomach(1)	78				all cancers(60;0.00169)|BRCA - Breast invasive adenocarcinoma(234;0.00912)|OV - Ovarian serous cystadenocarcinoma(108;0.0109)		GAACATCTGTCACGGTGAAGG	0.597																																						dbGAP											0													80.0	66.0	71.0					14																	72139289		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB007900	CCDS9807.1, CCDS61490.1, CCDS61491.1	14q24.1	2003-12-11				ENSG00000197555			20284	protein-coding gene	gene with protein product						9858596	Standard	XM_005267514		Approved	KIAA0440, E6TP1	uc001xmr.1	O43166		ENST00000555818.1:c.3054C>A	14.37:g.72139289C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP19|O95321|Q9UDU4|Q9UNU4	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.V1018	ENST00000555818.1	37	c.3054	CCDS9807.1	14																																																																																			SIPA1L1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ	ENSG00000197555		0.597	SIPA1L1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SIPA1L1	HGNC	protein_coding	OTTHUMT00000412806.1	52	0.00	0	C	NM_015556		72139289	72139289	+1	no_errors	ENST00000555818	ensembl	human	known	69_37n	silent	31	41.51	22	SNP	1.000	A
SLC44A4	80736	genome.wustl.edu	37	6	31833105	31833105	+	Missense_Mutation	SNP	G	G	C	rs372077719		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:31833105G>C	ENST00000229729.6	-	17	1767	c.1747C>G	c.(1747-1749)Cga>Gga	p.R583G	SLC44A4_ENST00000544672.1_Missense_Mutation_p.R507G|SLC44A4_ENST00000375562.4_Missense_Mutation_p.R541G|NEU1_ENST00000375631.4_5'Flank	NM_025257.2	NP_079533.2	Q53GD3	CTL4_HUMAN	solute carrier family 44, member 4	583					acetylcholine biosynthetic process (GO:0008292)|acetylcholine secretion (GO:0061526)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of cell growth (GO:0030307)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|prostate(3)|skin(1)|urinary_tract(2)	35					Choline(DB00122)	ACAATGTTTCGCATGAGTAGC	0.562																																						dbGAP											0													159.0	165.0	163.0					6																	31833105		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF134726	CCDS4724.2, CCDS54989.1, CCDS54990.1	6p21.3	2014-02-17	2005-09-06	2005-09-06	ENSG00000204385	ENSG00000204385		"""Solute carriers"""	13941	protein-coding gene	gene with protein product		606107	"""chromosome 6 open reading frame 29"""	C6orf29		10677542, 15715662, 24379411	Standard	NM_025257		Approved	NG22, CTL4, FLJ14491, TPPT	uc010jti.3	Q53GD3	OTTHUMG00000031133	ENST00000229729.6:c.1747C>G	6.37:g.31833105G>C	ENSP00000229729:p.Arg583Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BED3|B0UXX8|B0UZY8|B4DU94|B4DWM2|E9PEK7|Q5JP84|Q5JQ93|Q658S8|Q6UX89|Q8TEW4|Q96C58|Q96K59|Q9Y332	Missense_Mutation	SNP	pfam_Choline_transptr-like	p.R583G	ENST00000229729.6	37	c.1747	CCDS4724.2	6	.	.	.	.	.	.	.	.	.	.	G	15.72	2.915582	0.52546	.	.	ENSG00000204385	ENST00000229729;ENST00000375562;ENST00000544672	T;T;T	0.25749	1.78;1.78;1.78	5.25	0.778	0.18543	.	0.124466	0.53938	D	0.000043	T	0.48277	0.1491	M	0.93106	3.38	0.58432	D	0.999998	D	0.89917	1.0	D	0.91635	0.999	T	0.65076	-0.6256	10	0.87932	D	0	-23.6503	13.8168	0.63297	0.0:0.0:0.2566:0.7434	.	583	Q53GD3	CTL4_HUMAN	G	583;541;507	ENSP00000229729:R583G;ENSP00000364712:R541G;ENSP00000444109:R507G	ENSP00000229729:R583G	R	-	1	2	SLC44A4	31941084	1.000000	0.71417	0.998000	0.56505	0.632000	0.37999	0.943000	0.29030	0.284000	0.22305	0.561000	0.74099	CGA	SLC44A4	-	pfam_Choline_transptr-like	ENSG00000204385		0.562	SLC44A4-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SLC44A4	HGNC	protein_coding	OTTHUMT00000076234.3	45	0.00	0	G			31833105	31833105	-1	no_errors	ENST00000229729	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	C
SLC5A1	6523	genome.wustl.edu	37	22	32506050	32506050	+	Silent	SNP	C	C	T	rs33954001	byFrequency	TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:32506050C>T	ENST00000266088.4	+	15	2095	c.1845C>T	c.(1843-1845)caC>caT	p.H615H	SLC5A1_ENST00000543737.1_Silent_p.H488H	NM_000343.3	NP_000334.1	P13866	SC5A1_HUMAN	solute carrier family 5 (sodium/glucose cotransporter), member 1	615					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|intestinal absorption (GO:0050892)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	glucose:sodium symporter activity (GO:0005412)			NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(18)|ovary(1)|prostate(2)|skin(4)|urinary_tract(1)	37					Canagliflozin(DB08907)	TAGAGCAGCACGGTGCACCCA	0.463																																						dbGAP											0			GRCh37	CM961339	SLC5A1	M	rs33954001						173.0	145.0	154.0					22																	32506050		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13902.1, CCDS58805.1	22q12.3	2013-05-22			ENSG00000100170	ENSG00000100170		"""Solute carriers"""	11036	protein-coding gene	gene with protein product	"""sodium/glucose cotransporter 1"""	182380		SGLT1		8195156	Standard	NM_000343		Approved	D22S675, NAGT	uc003amc.3	P13866	OTTHUMG00000030768	ENST00000266088.4:c.1845C>T	22.37:g.32506050C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7E2|B7Z4Q9|B7ZA69	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.H615	ENST00000266088.4	37	c.1845	CCDS13902.1	22																																																																																			SLC5A1	-	NULL	ENSG00000100170		0.463	SLC5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A1	HGNC	protein_coding	OTTHUMT00000075656.3	142	0.00	0	C	NM_000343		32506050	32506050	+1	no_errors	ENST00000266088	ensembl	human	known	69_37n	silent	126	28.41	50	SNP	0.831	T
SLC5A6	8884	genome.wustl.edu	37	2	27430197	27430197	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:27430197G>A	ENST00000310574.3	-	3	795	c.322C>T	c.(322-324)Ctg>Ttg	p.L108L	SLC5A6_ENST00000408041.1_Silent_p.L108L	NM_021095.2	NP_066918.2	Q9Y289	SC5A6_HUMAN	solute carrier family 5 (sodium/multivitamin and iodide cotransporter), member 6	108					biotin metabolic process (GO:0006768)|biotin transport (GO:0015878)|pantothenate metabolic process (GO:0015939)|pantothenate transmembrane transport (GO:0015887)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	sodium-dependent multivitamin transmembrane transporter activity (GO:0008523)			endometrium(2)|kidney(2)|large_intestine(3)|lung(8)|ovary(3)|prostate(1)|skin(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Biotin(DB00121)|gabapentin enacarbil(DB08872)|Lipoic Acid(DB00166)	AGCAGCCCCAGAAAGTAGCAG	0.572																																						dbGAP											0													63.0	56.0	58.0					2																	27430197		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF069307	CCDS1740.1	2p23	2013-07-19	2013-07-19		ENSG00000138074	ENSG00000138074		"""Solute carriers"""	11041	protein-coding gene	gene with protein product		604024	"""solute carrier family 5 (sodium-dependent vitamin transporter), member 6"""			9516450, 10329687	Standard	NM_021095		Approved	SMVT	uc002rjd.3	Q9Y289	OTTHUMG00000097075	ENST00000310574.3:c.322C>T	2.37:g.27430197G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB85|D6W549|Q969Y5	Silent	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.L108	ENST00000310574.3	37	c.322	CCDS1740.1	2																																																																																			SLC5A6	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	ENSG00000138074		0.572	SLC5A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A6	HGNC	protein_coding	OTTHUMT00000214194.1	26	0.00	0	G	NM_021095		27430197	27430197	-1	no_errors	ENST00000310574	ensembl	human	known	69_37n	silent	23	20.69	6	SNP	1.000	A
SLITRK4	139065	genome.wustl.edu	37	X	142716423	142716423	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:142716423C>G	ENST00000381779.4	-	2	2727	c.2502G>C	c.(2500-2502)ttG>ttC	p.L834F	SLITRK4_ENST00000338017.4_Missense_Mutation_p.L834F|SLITRK4_ENST00000356928.1_Missense_Mutation_p.L834F	NM_001184749.2|NM_001184750.1|NM_173078.4	NP_001171678.1|NP_001171679.1|NP_775101.1	Q8IW52	SLIK4_HUMAN	SLIT and NTRK-like family, member 4	834						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(27)|ovary(2)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(2)	60	Acute lymphoblastic leukemia(192;6.56e-05)					AGATCTTGTTCAAAGCTGTTT	0.373																																						dbGAP											0													94.0	82.0	86.0					X																	142716423		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040986	CCDS14679.1	Xq27.3	2004-06-23			ENSG00000179542	ENSG00000179542			23502	protein-coding gene	gene with protein product		300562				14557068	Standard	NM_001184749		Approved	DKFZp547M2010	uc004fby.3	Q8IW52	OTTHUMG00000022580	ENST00000381779.4:c.2502G>C	X.37:g.142716423C>G	ENSP00000371198:p.Leu834Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXG3|Q8TCM8|Q96DL3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.L834F	ENST00000381779.4	37	c.2502	CCDS14679.1	X	.	.	.	.	.	.	.	.	.	.	C	5.831	0.337563	0.11013	.	.	ENSG00000179542	ENST00000381779;ENST00000356928;ENST00000338017	T;T;T	0.52057	0.68;0.68;0.68	5.36	5.36	0.76844	.	0.000000	0.56097	U	0.000027	T	0.30510	0.0767	N	0.17474	0.49	0.58432	D	0.999999	B	0.23540	0.087	B	0.20955	0.032	T	0.13926	-1.0491	10	0.06625	T	0.88	-3.804	16.6088	0.84838	0.0:1.0:0.0:0.0	.	834	Q8IW52	SLIK4_HUMAN	F	834	ENSP00000371198:L834F;ENSP00000349400:L834F;ENSP00000336627:L834F	ENSP00000336627:L834F	L	-	3	2	SLITRK4	142544089	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.086000	0.30853	2.236000	0.73375	0.529000	0.55759	TTG	SLITRK4	-	NULL	ENSG00000179542		0.373	SLITRK4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK4	HGNC	protein_coding	OTTHUMT00000058617.1	110	0.00	0	C	NM_173078		142716423	142716423	-1	no_errors	ENST00000338017	ensembl	human	known	69_37n	missense	59	31.40	27	SNP	1.000	G
SMG1	23049	genome.wustl.edu	37	16	18903670	18903670	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:18903670G>A	ENST00000446231.2	-	4	831	c.419C>T	c.(418-420)tCg>tTg	p.S140L	SMG1_ENST00000389467.3_Missense_Mutation_p.S140L|SMG1_ENST00000565224.1_Missense_Mutation_p.S114L			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	140	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						ATAAGACATCGATCTCTCTGT	0.323																																						dbGAP											0													22.0	18.0	19.0					16																	18903670		1682	3767	5449	-	-	-	SO:0001583	missense	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.419C>T	16.37:g.18903670G>A	ENSP00000402515:p.Ser140Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S140L	ENST00000446231.2	37	c.419	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	17.22	3.334206	0.60853	.	.	ENSG00000157106	ENST00000446231;ENST00000389467;ENST00000532700	T;T;T	0.13657	2.57;2.57;2.57	4.82	4.82	0.62117	.	0.221276	0.31624	U	0.007322	T	0.09862	0.0242	N	0.19112	0.55	0.34527	D	0.708778	B	0.31519	0.327	B	0.16289	0.015	T	0.15636	-1.0430	10	0.42905	T	0.14	.	18.29	0.90126	0.0:0.0:1.0:0.0	.	140	Q96Q15	SMG1_HUMAN	L	140;140;114	ENSP00000402515:S140L;ENSP00000374118:S140L;ENSP00000432825:S114L	ENSP00000374118:S140L	S	-	2	0	SMG1	18811171	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	5.603000	0.67619	2.392000	0.81423	0.555000	0.69702	TCG	SMG1	-	NULL	ENSG00000157106		0.323	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	74	0.00	0	G	NM_015092		18903670	18903670	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	A
SNX17	9784	genome.wustl.edu	37	2	27599541	27599541	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:27599541C>T	ENST00000233575.2	+	15	1590	c.1368C>T	c.(1366-1368)gtC>gtT	p.V456V	ZNF513_ENST00000491924.1_5'Flank|SNX17_ENST00000542478.1_Silent_p.V242V|SNX17_ENST00000537606.1_Silent_p.V431V|SNX17_ENST00000543024.1_Silent_p.V242V	NM_001267059.1|NM_001267061.1|NM_014748.3	NP_001253988.1|NP_001253990.1|NP_055563.1	Q15036	SNX17_HUMAN	sorting nexin 17	456					cholesterol catabolic process (GO:0006707)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|receptor-mediated endocytosis (GO:0006898)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)	low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol binding (GO:0035091)|protein C-terminus binding (GO:0008022)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCAGTGATGTCCACGGCAATT	0.537																																						dbGAP											0													116.0	103.0	107.0					2																	27599541		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D31764	CCDS1750.1, CCDS58704.1	2p23-p22	2008-05-21			ENSG00000115234	ENSG00000115234		"""Sorting nexins"""	14979	protein-coding gene	gene with protein product		605963				12169628, 15769472	Standard	NM_014748		Approved	KIAA0064	uc002rkg.2	Q15036	OTTHUMG00000097781	ENST00000233575.2:c.1368C>T	2.37:g.27599541C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQM7|Q53HN7|Q6IAS3	Silent	SNP	pfam_Phox,superfamily_Phox,superfamily_FERM_central,smart_Phox,pfscan_Phox,pfscan_Ras-assoc	p.V456	ENST00000233575.2	37	c.1368	CCDS1750.1	2																																																																																			SNX17	-	NULL	ENSG00000115234		0.537	SNX17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX17	HGNC	protein_coding	OTTHUMT00000215024.1	103	0.00	0	C	NM_014748		27599541	27599541	+1	no_errors	ENST00000233575	ensembl	human	known	69_37n	silent	95	35.14	52	SNP	1.000	T
SORBS1	10580	genome.wustl.edu	37	10	97110968	97110968	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:97110968C>T	ENST00000361941.3	-	23	2406	c.2380G>A	c.(2380-2382)Gag>Aag	p.E794K	SORBS1_ENST00000393949.1_Missense_Mutation_p.E764K|SORBS1_ENST00000353505.5_Missense_Mutation_p.E645K|SORBS1_ENST00000371241.1_Intron|SORBS1_ENST00000474353.2_Intron|SORBS1_ENST00000607232.1_Missense_Mutation_p.E1054K|SORBS1_ENST00000371246.2_Missense_Mutation_p.E816K|SORBS1_ENST00000354106.3_Missense_Mutation_p.E764K|SORBS1_ENST00000277982.5_Missense_Mutation_p.E816K|SORBS1_ENST00000306402.6_Missense_Mutation_p.E541K|SORBS1_ENST00000371247.2_Missense_Mutation_p.E794K|SORBS1_ENST00000371249.2_Intron|SORBS1_ENST00000371245.3_Missense_Mutation_p.E645K|SORBS1_ENST00000371227.4_Missense_Mutation_p.E748K|SORBS1_ENST00000347291.4_Missense_Mutation_p.E606K|SORBS1_ENST00000371239.1_Missense_Mutation_p.E571K	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		AAACAGACCTCTGACCCAGAT	0.483																																						dbGAP											0													107.0	99.0	102.0					10																	97110968		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.2380G>A	10.37:g.97110968C>T	ENSP00000355136:p.Glu794Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.E794K	ENST00000361941.3	37	c.2380	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023249	0.93462	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000354106;ENST00000371239	T;T;T;T;T;T;T;T;T;T;T;T	0.13307	2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6;2.6	5.99	5.99	0.97316	Src homology-3 domain (2);	0.000000	0.40728	N	0.001039	T	0.24236	0.0587	N	0.16130	0.375	0.80722	D	1	B;D;D;D;D;P;D;P;P;B	0.89917	0.013;0.998;0.992;0.999;1.0;0.787;0.998;0.832;0.905;0.112	B;D;D;D;D;P;D;P;P;B	0.91635	0.035;0.998;0.912;0.996;0.999;0.613;0.997;0.708;0.876;0.056	T	0.07158	-1.0787	10	0.33141	T	0.24	-17.3289	20.4777	0.99188	0.0:1.0:0.0:0.0	.	509;748;541;571;645;794;816;606;764;288	B4DTX5;Q9BX66-11;Q9BX66-9;Q9BX66-8;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6;Q9BX66-5;Q6MZY5	.;.;.;.;.;SRBS1_HUMAN;.;.;.;.	K	645;541;794;748;816;764;645;606;794;816;764;571	ENSP00000360291:E645K;ENSP00000302556:E541K;ENSP00000360293:E794K;ENSP00000360271:E748K;ENSP00000360292:E816K;ENSP00000377521:E764K;ENSP00000343998:E645K;ENSP00000277985:E606K;ENSP00000355136:E794K;ENSP00000277982:E816K;ENSP00000277984:E764K;ENSP00000360283:E571K	ENSP00000277982:E816K	E	-	1	0	SORBS1	97100958	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.786000	0.85741	2.840000	0.97914	0.655000	0.94253	GAG	SORBS1	-	superfamily_SH3_domain,pfscan_SH3_domain	ENSG00000095637		0.483	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	95	0.00	0	C			97110968	97110968	-1	no_errors	ENST00000361941	ensembl	human	known	69_37n	missense	74	29.52	31	SNP	1.000	T
SORCS1	114815	genome.wustl.edu	37	10	108536409	108536409	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:108536409C>T	ENST00000263054.6	-	4	775	c.768G>A	c.(766-768)ttG>ttA	p.L256L	SORCS1_ENST00000344440.6_Silent_p.L256L	NM_001206570.1|NM_052918.4	NP_001193499.1|NP_443150.3	Q8WY21	SORC1_HUMAN	sortilin-related VPS10 domain containing receptor 1	256					neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	neuropeptide receptor activity (GO:0008188)			breast(5)|central_nervous_system(1)|cervix(2)|endometrium(9)|kidney(2)|large_intestine(24)|lung(69)|ovary(1)|prostate(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	127		Breast(234;0.0256)|Colorectal(252;0.09)|Lung NSC(174;0.168)		Epithelial(162;1.66e-05)|all cancers(201;0.000689)		CTGAGCTGATCAATAAACTGC	0.388																																						dbGAP											0													124.0	116.0	119.0					10																	108536409		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF284756	CCDS7559.1	10q23-q25	2004-04-20			ENSG00000108018	ENSG00000108018			16697	protein-coding gene	gene with protein product		606283				11499680	Standard	NM_001206570		Approved	sorCS1	uc001kyl.3	Q8WY21	OTTHUMG00000019018	ENST00000263054.6:c.768G>A	10.37:g.108536409C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRF4|Q59GG7|Q5JVT7|Q5JVT8|Q5VY14|Q86WQ1|Q86WQ2|Q9H1Y1|Q9H1Y2	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_VPS10,pfscan_PKD_dom	p.L256	ENST00000263054.6	37	c.768	CCDS7559.1	10																																																																																			SORCS1	-	smart_VPS10	ENSG00000108018		0.388	SORCS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORCS1	HGNC	protein_coding	OTTHUMT00000050232.4	130	0.00	0	C	NM_052918		108536409	108536409	-1	no_errors	ENST00000344440	ensembl	human	known	69_37n	silent	80	31.62	37	SNP	1.000	T
SPAG17	200162	genome.wustl.edu	37	1	118558619	118558619	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:118558619G>C	ENST00000336338.5	-	29	4321	c.4256C>G	c.(4255-4257)tCc>tGc	p.S1419C		NM_206996.2	NP_996879.1	Q6Q759	SPG17_HUMAN	sperm associated antigen 17	1419						cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)|sperm flagellum (GO:0036126)		p.S1419Y(1)		NS(1)|biliary_tract(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(30)|liver(2)|lung(56)|ovary(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	123	Esophageal squamous(2;0.0106)	all_cancers(81;0.0204)|all_lung(203;9.46e-05)|Lung NSC(69;0.000675)|all_epithelial(167;0.01)		Lung(183;0.0858)		GGCCTGAAAGGATAACAATGG	0.413																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											153.0	162.0	159.0					1																	118558619		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS899.1	1p12	2014-01-21			ENSG00000155761	ENSG00000155761			26620	protein-coding gene	gene with protein product							Standard	NM_206996		Approved	FLJ34497, PF6, RP4-776P7.2, CT143	uc001ehk.2	Q6Q759	OTTHUMG00000012198	ENST00000336338.5:c.4256C>G	1.37:g.118558619G>C	ENSP00000337804:p.Ser1419Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAZ1|Q9NT21	Missense_Mutation	SNP	NULL	p.S1419C	ENST00000336338.5	37	c.4256	CCDS899.1	1	.	.	.	.	.	.	.	.	.	.	G	11.96	1.795786	0.31777	.	.	ENSG00000155761	ENST00000336338	T	0.20069	2.1	4.98	2.04	0.26737	.	0.457000	0.24511	N	0.037884	T	0.14399	0.0348	L	0.45581	1.43	0.21627	N	0.999617	D	0.65815	0.995	P	0.55824	0.785	T	0.05666	-1.0871	10	0.66056	D	0.02	.	7.6275	0.28220	0.2821:0.0:0.7179:0.0	.	1419	Q6Q759	SPG17_HUMAN	C	1419	ENSP00000337804:S1419C	ENSP00000337804:S1419C	S	-	2	0	SPAG17	118360142	1.000000	0.71417	0.313000	0.25210	0.331000	0.28603	1.873000	0.39558	0.140000	0.18849	0.460000	0.39030	TCC	SPAG17	-	NULL	ENSG00000155761		0.413	SPAG17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG17	HGNC	protein_coding	OTTHUMT00000033723.1	139	0.00	0	G	NM_206996		118558619	118558619	-1	no_errors	ENST00000336338	ensembl	human	known	69_37n	missense	131	11.49	17	SNP	0.951	C
SPARC	6678	genome.wustl.edu	37	5	151046073	151046073	+	Intron	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:151046073G>A	ENST00000231061.4	-	8	899				SPARC_ENST00000537849.1_5'UTR	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)						blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)			central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		TTCTTCACCTGAGGGAGTAGA	0.572																																						dbGAP											0													39.0	37.0	38.0					5																	151046073		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.586-3C>T	5.37:g.151046073G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQH9|Q6IBK4	RNA	SNP	-	NULL	ENST00000231061.4	37	NULL	CCDS4318.1	5																																																																																			SPARC	-	-	ENSG00000113140		0.572	SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARC	HGNC	protein_coding	OTTHUMT00000252430.1	52	0.00	0	G	NM_003118		151046073	151046073	-1	no_errors	ENST00000537849	ensembl	human	known	69_37n	rna	25	30.56	11	SNP	1.000	A
SPDYE3	441272	genome.wustl.edu	37	7	99905564	99905564	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:99905564C>G	ENST00000332397.6	+	1	240	c.56C>G	c.(55-57)tCa>tGa	p.S19*	SPDYE3_ENST00000437326.2_5'UTR	NM_001004351.4	NP_001004351.3	A6NKU9	SPDE3_HUMAN	speedy/RINGO cell cycle regulator family member E3	19										endometrium(10)|kidney(1)|lung(8)|urinary_tract(1)	20						CGGAGCACCTCAGGGTACCCC	0.562																																						dbGAP											0													13.0	12.0	12.0					7																	99905564		873	1980	2853	-	-	-	SO:0001587	stop_gained	0			BC056606	CCDS47658.1, CCDS47658.2	7q22.1	2013-05-08	2013-05-08		ENSG00000214300	ENSG00000214300		"""Speedy homologs"""	35462	protein-coding gene	gene with protein product			"""speedy homolog E3 (Xenopus laevis)"""				Standard	NM_001004351		Approved		uc022aij.1	A6NKU9	OTTHUMG00000155462	ENST00000332397.6:c.56C>G	7.37:g.99905564C>G	ENSP00000329565:p.Ser19*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495Y9|Q6PHC4	Nonsense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.S19*	ENST00000332397.6	37	c.56	CCDS47658.2	7	.	.	.	.	.	.	.	.	.	.	C	13.26	2.184795	0.38609	.	.	ENSG00000214300	ENST00000332397	.	.	.	0.185	0.185	0.15096	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	.	.	.	.	.	.	.	X	19	.	ENSP00000329565:S19X	S	+	2	0	SPDYE3	99743500	0.973000	0.33851	0.007000	0.13788	0.007000	0.05969	0.686000	0.25392	0.293000	0.22520	0.298000	0.19748	TCA	SPDYE3	-	NULL	ENSG00000214300		0.562	SPDYE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPDYE3	HGNC	protein_coding	OTTHUMT00000340224.2	122	0.00	0	C	NM_001004351		99905564	99905564	+1	no_errors	ENST00000332397	ensembl	human	known	69_37n	nonsense	50	29.58	21	SNP	0.007	G
SRPRB	58477	genome.wustl.edu	37	3	133530017	133530017	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:133530017C>A	ENST00000466490.2	+	5	669	c.384C>A	c.(382-384)ttC>ttA	p.F128L		NM_021203.3	NP_067026.3	Q9Y5M8	SRPRB_HUMAN	signal recognition particle receptor, B subunit	128					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|small GTPase mediated signal transduction (GO:0007264)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	GTP binding (GO:0005525)			breast(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(2)	12						GGCTTCAGTTCTTAGAGCGGT	0.453																																						dbGAP											0													148.0	139.0	142.0					3																	133530017		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075531	CCDS3081.1	3q22.1	2004-01-29			ENSG00000144867	ENSG00000144867			24085	protein-coding gene	gene with protein product						7844142, 10859309	Standard	NM_021203		Approved	APMCF1	uc003epx.2	Q9Y5M8	OTTHUMG00000159753	ENST00000466490.2:c.384C>A	3.37:g.133530017C>A	ENSP00000418401:p.Phe128Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P595|Q8N2D8	Missense_Mutation	SNP	pfam_SRP_receptor_beta_su,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA	p.F128L	ENST00000466490.2	37	c.384	CCDS3081.1	3	.	.	.	.	.	.	.	.	.	.	C	15.64	2.892639	0.52121	.	.	ENSG00000144867	ENST00000466490	T	0.12774	2.65	5.44	4.57	0.56435	.	0.449783	0.20625	N	0.088686	T	0.08714	0.0216	N	0.13272	0.32	0.32130	N	0.5869	B	0.09022	0.002	B	0.14023	0.01	T	0.10245	-1.0638	10	0.25751	T	0.34	-8.5606	12.0891	0.53715	0.0:0.8572:0.0:0.1428	.	128	Q9Y5M8	SRPRB_HUMAN	L	128	ENSP00000418401:F128L	ENSP00000418401:F128L	F	+	3	2	SRPRB	135012707	0.996000	0.38824	1.000000	0.80357	0.997000	0.91878	1.716000	0.37981	1.314000	0.45095	0.555000	0.69702	TTC	SRPRB	-	pfam_SRP_receptor_beta_su,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA	ENSG00000144867		0.453	SRPRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPRB	HGNC	protein_coding	OTTHUMT00000357170.2	110	0.00	0	C			133530017	133530017	+1	no_errors	ENST00000466490	ensembl	human	known	69_37n	missense	78	37.60	47	SNP	1.000	A
STAB2	55576	genome.wustl.edu	37	12	104146997	104146997	+	Splice_Site	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:104146997G>C	ENST00000388887.2	+	61	6784		c.e61-1		RP11-341G23.4_ENST00000551299.1_RNA	NM_017564.9	NP_060034.9			stabilin 2											NS(4)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(11)|large_intestine(26)|lung(77)|ovary(10)|pancreas(1)|prostate(5)|skin(14)|stomach(2)	174						TCCTCATCCAGATACCACTGT	0.532																																						dbGAP											0													84.0	76.0	79.0					12																	104146997		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF160476	CCDS31888.1	12q23.3	2007-01-29				ENSG00000136011			18629	protein-coding gene	gene with protein product	"""hyaluronic acid receptor for endocytosis"""	608561				11829752, 12077138	Standard	XR_429107		Approved	DKFZP434E0321, FELL, STAB-2, HARE, FEEL-2	uc001tjw.3	Q8WWQ8	OTTHUMG00000170056	ENST00000388887.2:c.6581-1G>C	12.37:g.104146997G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e61-1	ENST00000388887.2	37	c.6581-1	CCDS31888.1	12	.	.	.	.	.	.	.	.	.	.	G	19.65	3.868175	0.72065	.	.	ENSG00000136011	ENST00000388887;ENST00000258495	.	.	.	5.17	5.17	0.71159	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0196	0.92908	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB2	102671127	1.000000	0.71417	0.583000	0.28640	0.343000	0.28985	9.048000	0.93830	2.563000	0.86464	0.650000	0.86243	.	STAB2	-	-	ENSG00000136011		0.532	STAB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB2	HGNC	protein_coding	OTTHUMT00000407089.1	62	0.00	0	G		Intron	104146997	104146997	+1	no_errors	ENST00000388887	ensembl	human	known	69_37n	splice_site	49	30.00	21	SNP	1.000	C
STARD3	10948	genome.wustl.edu	37	17	37809924	37809924	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:37809924C>T	ENST00000336308.5	+	2	358	c.140C>T	c.(139-141)tCt>tTt	p.S47F	STARD3_ENST00000394250.4_Missense_Mutation_p.S47F|STARD3_ENST00000580611.1_Missense_Mutation_p.S47F|STARD3_ENST00000578232.1_3'UTR|STARD3_ENST00000544210.2_Missense_Mutation_p.S47F	NM_001165937.1|NM_006804.3	NP_001159409.1|NP_006795.3	Q14849	STAR3_HUMAN	StAR-related lipid transfer (START) domain containing 3	47	MENTAL. {ECO:0000255|PROSITE- ProRule:PRU00770}.				cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|mitochondrial transport (GO:0006839)|progesterone biosynthetic process (GO:0006701)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|mitochondrion (GO:0005739)	cholesterol binding (GO:0015485)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|prostate(2)|stomach(1)	14	Lung NSC(9;1.15e-09)|all_lung(9;6.24e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|BRCA - Breast invasive adenocarcinoma(8;1.04e-44)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			AGGGCCATCTCTGATGTCCGC	0.637											OREG0024381	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													121.0	95.0	104.0					17																	37809924		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11341.1, CCDS54117.1, CCDS54118.1	17q11-q12	2011-09-12	2007-08-16		ENSG00000131748	ENSG00000131748		"""StAR-related lipid transfer (START) domain containing"""	17579	protein-coding gene	gene with protein product		607048	"""START domain containing 3"""				Standard	NM_006804		Approved	es64, MLN64	uc002hsd.3	Q14849	OTTHUMG00000133213	ENST00000336308.5:c.140C>T	17.37:g.37809924C>T	ENSP00000337446:p.Ser47Phe	Somatic	873	WXS	Illumina GAIIx	Phase_IV	A8MXA4|B4DUY1|F5H0G2|Q53Y53|Q96HM9	Missense_Mutation	SNP	pfam_MENTAL,pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd,prints_StAR	p.S47F	ENST00000336308.5	37	c.140	CCDS11341.1	17	.	.	.	.	.	.	.	.	.	.	C	11.58	1.680473	0.29872	.	.	ENSG00000131748	ENST00000336308;ENST00000544210;ENST00000394250;ENST00000443521	T;T;T;T	0.61392	0.11;0.11;0.11;0.11	4.48	4.48	0.54585	MENTAL domain (2);	0.000000	0.85682	D	0.000000	T	0.79627	0.4478	M	0.87900	2.915	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	1.0;0.998;1.0;1.0	D	0.84484	0.0607	10	0.87932	D	0	.	17.5282	0.87807	0.0:1.0:0.0:0.0	.	47;47;47;47	F5H0G2;B4DWG5;A8MXA4;Q14849	.;.;.;STAR3_HUMAN	F	47	ENSP00000337446:S47F;ENSP00000439869:S47F;ENSP00000377794:S47F;ENSP00000411710:S47F	ENSP00000337446:S47F	S	+	2	0	STARD3	35063450	1.000000	0.71417	0.982000	0.44146	0.127000	0.20565	7.437000	0.80417	2.214000	0.71695	0.313000	0.20887	TCT	STARD3	-	pfam_MENTAL	ENSG00000131748		0.637	STARD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD3	HGNC	protein_coding	OTTHUMT00000256933.1	67	0.00	0	C			37809924	37809924	+1	no_errors	ENST00000336308	ensembl	human	known	69_37n	missense	70	44.00	55	SNP	1.000	T
STAT5A	6776	genome.wustl.edu	37	17	40447795	40447795	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:40447795G>C	ENST00000345506.4	+	6	1176	c.534G>C	c.(532-534)gaG>gaC	p.E178D	STAT5A_ENST00000590949.1_Missense_Mutation_p.E178D|STAT5A_ENST00000452307.2_Missense_Mutation_p.E178D|STAT5A_ENST00000546010.2_Missense_Mutation_p.E148D|STAT5A_ENST00000588868.1_Missense_Mutation_p.E178D	NM_003152.3	NP_003143.2	P42229	STA5A_HUMAN	signal transducer and activator of transcription 5A	178					2-oxoglutarate metabolic process (GO:0006103)|allantoin metabolic process (GO:0000255)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|development of secondary female sexual characteristics (GO:0046543)|development of secondary male sexual characteristics (GO:0046544)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|fatty acid metabolic process (GO:0006631)|female pregnancy (GO:0007565)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lactation (GO:0007595)|lipid storage (GO:0019915)|luteinization (GO:0001553)|mammary gland epithelium development (GO:0061180)|natural killer cell differentiation (GO:0001779)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of mast cell apoptotic process (GO:0033026)|oxaloacetate metabolic process (GO:0006107)|peptidyl-tyrosine phosphorylation (GO:0018108)|Peyer's patch development (GO:0048541)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of mast cell differentiation (GO:0060376)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin signaling pathway (GO:0038161)|prostate gland epithelium morphogenesis (GO:0060740)|regulation of cell adhesion (GO:0030155)|regulation of epithelial cell differentiation (GO:0030856)|regulation of multicellular organism growth (GO:0040014)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|succinate metabolic process (GO:0006105)|T cell differentiation in thymus (GO:0033077)|T cell homeostasis (GO:0043029)|taurine metabolic process (GO:0019530)|transcription, DNA-templated (GO:0006351)|valine metabolic process (GO:0006573)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	calcium ion binding (GO:0005509)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	14		all_cancers(22;1.56e-06)|all_epithelial(22;3.17e-05)|Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.128)		AGTACCAGGAGAGCCTGAGGA	0.557																																						dbGAP											0													95.0	66.0	76.0					17																	40447795		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43185	CCDS11424.1, CCDS74066.1, CCDS74067.1	17q11.2	2013-02-14			ENSG00000126561	ENSG00000126561		"""SH2 domain containing"""	11366	protein-coding gene	gene with protein product		601511		STAT5		7719937, 8631883	Standard	NM_003152		Approved	MGF	uc002hzj.2	P42229	OTTHUMG00000150725	ENST00000345506.4:c.534G>C	17.37:g.40447795G>C	ENSP00000341208:p.Glu178Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1KLZ6	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.E178D	ENST00000345506.4	37	c.534	CCDS11424.1	17	.	.	.	.	.	.	.	.	.	.	G	14.91	2.675749	0.47781	.	.	ENSG00000126561	ENST00000345506;ENST00000546010;ENST00000540577;ENST00000452307	T;T;T	0.62639	0.01;0.01;0.01	5.42	4.46	0.54185	STAT transcription factor, all-alpha (2);STAT transcription factor, coiled coil (1);	0.000000	0.85682	D	0.000000	T	0.59649	0.2209	L	0.55103	1.725	0.80722	D	1	B;B;B	0.26577	0.001;0.153;0.003	B;B;B	0.31101	0.021;0.124;0.017	T	0.58393	-0.7644	10	0.41790	T	0.15	-18.4536	14.4414	0.67321	0.0711:0.0:0.9289:0.0	.	148;180;178	Q1KLZ6;Q59GY7;P42229	.;.;STA5A_HUMAN	D	178;148;180;178	ENSP00000341208:E178D;ENSP00000443107:E148D;ENSP00000400320:E178D	ENSP00000341208:E178D	E	+	3	2	STAT5A	37701321	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.053000	0.57427	1.309000	0.44985	-0.222000	0.12452	GAG	STAT5A	-	pfam_STAT_TF_alpha,superfamily_STAT_TF_coiled-coil	ENSG00000126561		0.557	STAT5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT5A	HGNC	protein_coding	OTTHUMT00000319804.1	81	0.00	0	G	NM_003152		40447795	40447795	+1	no_errors	ENST00000345506	ensembl	human	known	69_37n	missense	111	21.28	30	SNP	1.000	C
STIM2	57620	genome.wustl.edu	37	4	27009196	27009196	+	Silent	SNP	G	G	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:27009196G>T	ENST00000467011.1	+	8	1448	c.1023G>T	c.(1021-1023)ctG>ctT	p.L341L	STIM2_ENST00000465503.1_Silent_p.L341L|STIM2_ENST00000412829.2_Silent_p.L428L|STIM2_ENST00000467087.1_Silent_p.L341L|STIM2_ENST00000382009.3_Silent_p.L428L|STIM2_ENST00000237364.5_Silent_p.L428L	NM_001169117.1	NP_001162588	Q9P246	STIM2_HUMAN	stromal interaction molecule 2	341					activation of store-operated calcium channel activity (GO:0032237)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|positive regulation of calcium ion transport (GO:0051928)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|store-operated calcium channel activity (GO:0015279)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	25		Breast(46;0.0503)				AATTTGAACTGAGAAGCAGTT	0.403																																						dbGAP											0													66.0	65.0	65.0					4																	27009196		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040915	CCDS3440.1, CCDS3440.2, CCDS54751.1, CCDS54752.1	4p15.2	2013-01-10			ENSG00000109689	ENSG00000109689		"""Sterile alpha motif (SAM) domain containing"""	19205	protein-coding gene	gene with protein product		610841				11463338	Standard	NM_020860		Approved		uc003gsh.4	Q9P246	OTTHUMG00000097805	ENST00000467011.1:c.1023G>T	4.37:g.27009196G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8L7|B7ZVY0|Q96BF1|Q9BQH2|Q9H8R1	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_SAM/pointed,pfscan_SAM	p.L428	ENST00000467011.1	37	c.1284	CCDS54752.1	4																																																																																			STIM2	-	NULL	ENSG00000109689		0.403	STIM2-003	NOVEL	basic|exp_conf|CCDS	protein_coding	STIM2	HGNC	protein_coding	OTTHUMT00000356861.1	81	0.00	0	G	NM_020860		27009196	27009196	+1	no_errors	ENST00000382009	ensembl	human	known	69_37n	silent	45	28.57	18	SNP	0.983	T
STT3B	201595	genome.wustl.edu	37	3	31661244	31661244	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:31661244G>A	ENST00000295770.2	+	9	1458	c.1249G>A	c.(1249-1251)Gat>Aat	p.D417N	STT3B_ENST00000453168.1_Intron	NM_178862.1	NP_849193.1	Q8TCJ2	STT3B_HUMAN	STT3B, subunit of the oligosaccharyltransferase complex (catalytic)	417					co-translational protein modification (GO:0043686)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|oligosaccharyltransferase complex (GO:0008250)	dolichyl-diphosphooligosaccharide-protein glycotransferase activity (GO:0004579)			autonomic_ganglia(1)|biliary_tract(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	19						TTTCTTCTTTGATCTACATAT	0.348																																						dbGAP											0													229.0	196.0	207.0					3																	31661244		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027789	CCDS2650.1	3p24.1	2013-03-06	2013-03-06		ENSG00000163527	ENSG00000163527	2.4.99.18		30611	protein-coding gene	gene with protein product	"""source of immunodominant MHC associated peptides"", ""dolichyl-diphosphooligosaccharide protein glycotransferase"""	608605	"""STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)"""			12887896, 12439619	Standard	XM_006713017		Approved	SIMP, FLJ90106, STT3-B	uc011axe.2	Q8TCJ2	OTTHUMG00000130673	ENST00000295770.2:c.1249G>A	3.37:g.31661244G>A	ENSP00000295770:p.Asp417Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JZ4|Q96KY7	Missense_Mutation	SNP	pfam_Oligo_trans_STT3	p.D417N	ENST00000295770.2	37	c.1249	CCDS2650.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.599034	0.96614	.	.	ENSG00000163527	ENST00000295770	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	D	0.87172	0.6111	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88902	0.3353	9	0.52906	T	0.07	-0.033	19.8236	0.96607	0.0:0.0:1.0:0.0	.	417	Q8TCJ2	STT3B_HUMAN	N	417	.	ENSP00000295770:D417N	D	+	1	0	STT3B	31636248	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.869000	0.99810	2.681000	0.91329	0.491000	0.48974	GAT	STT3B	-	pfam_Oligo_trans_STT3	ENSG00000163527		0.348	STT3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STT3B	HGNC	protein_coding	OTTHUMT00000253166.2	221	0.00	0	G	NM_178862		31661244	31661244	+1	no_errors	ENST00000295770	ensembl	human	known	69_37n	missense	146	25.89	51	SNP	1.000	A
SUCO	51430	genome.wustl.edu	37	1	172571319	172571319	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:172571319C>T	ENST00000263688.3	+	21	3353	c.3134C>T	c.(3133-3135)tCa>tTa	p.S1045L	SUCO_ENST00000608151.1_Missense_Mutation_p.S1197L|SUCO_ENST00000367723.4_Missense_Mutation_p.S1196L|SUCO_ENST00000610051.1_Missense_Mutation_p.S674L	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1045					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											GATTATATTTCAAAACTTCCT	0.308																																						dbGAP											0													85.0	78.0	81.0					1																	172571319		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3134C>T	1.37:g.172571319C>T	ENSP00000263688:p.Ser1045Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.S1197L	ENST00000263688.3	37	c.3590	CCDS1303.1	1	.	.	.	.	.	.	.	.	.	.	C	17.70	3.455128	0.63401	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.54	4.63	0.57726	.	0.332001	0.32753	N	0.005684	T	0.49133	0.1539	M	0.71581	2.175	0.41313	D	0.987129	P;P;P;B	0.48998	0.918;0.578;0.722;0.44	B;B;B;B	0.43701	0.428;0.322;0.164;0.075	T	0.57046	-0.7878	9	0.51188	T	0.08	-2.2923	15.2614	0.73625	0.0:0.8592:0.1408:0.0	.	674;1045;1197;1045	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	L	1197;1045	.	ENSP00000263688:S1045L	S	+	2	0	C1orf9	170837942	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.176000	0.58269	1.315000	0.45114	0.650000	0.86243	TCA	SUCO	-	NULL	ENSG00000094975		0.308	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCO	HGNC	protein_coding	OTTHUMT00000084273.1	140	0.00	0	C	NM_016227		172571319	172571319	+1	no_errors	ENST00000367723	ensembl	human	known	69_37n	missense	158	17.28	33	SNP	1.000	T
SUSD4	55061	genome.wustl.edu	37	1	223396894	223396894	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:223396894C>T	ENST00000343846.3	-	7	1774	c.1141G>A	c.(1141-1143)Gaa>Aaa	p.E381K	SUSD4_ENST00000454695.2_Missense_Mutation_p.E221K|SUSD4_ENST00000478605.1_Intron|SUSD4_ENST00000484758.2_Missense_Mutation_p.E312K|SUSD4_ENST00000494793.2_Missense_Mutation_p.E381K|SUSD4_ENST00000366878.4_Missense_Mutation_p.E381K			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	381						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		CTCACAGCTTCGTCATAGGAC	0.632																																						dbGAP											0													25.0	30.0	28.0					1																	223396894		2186	4276	6462	-	-	-	SO:0001583	missense	0			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.1141G>A	1.37:g.223396894C>T	ENSP00000344219:p.Glu381Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.E381K	ENST00000343846.3	37	c.1141	CCDS41471.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.376817	0.95945	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000454695	T;T;T	0.51071	0.72;0.72;0.85	5.16	5.16	0.70880	.	0.000000	0.50627	D	0.000113	T	0.69233	0.3088	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	T	0.72786	-0.4188	10	0.72032	D	0.01	-29.1821	18.6628	0.91477	0.0:1.0:0.0:0.0	.	381	Q5VX71	SUSD4_HUMAN	K	381;381;312;221	ENSP00000344219:E381K;ENSP00000355843:E381K;ENSP00000399288:E221K	ENSP00000344219:E381K	E	-	1	0	SUSD4	221463517	1.000000	0.71417	0.999000	0.59377	0.904000	0.53231	6.362000	0.73077	2.405000	0.81733	0.655000	0.94253	GAA	SUSD4	-	NULL	ENSG00000143502		0.632	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	22	0.00	0	C	NM_017982		223396894	223396894	-1	no_errors	ENST00000343846	ensembl	human	known	69_37n	missense	21	46.15	18	SNP	1.000	T
SYCP2	10388	genome.wustl.edu	37	20	58460989	58460989	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:58460989G>A	ENST00000357552.3	-	26	2748	c.2523C>T	c.(2521-2523)ctC>ctT	p.L841L	SYCP2_ENST00000371001.2_Silent_p.L841L			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	841					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			CTACCTTACTGAGTTGTACAA	0.274																																						dbGAP											0													66.0	61.0	63.0					20																	58460989		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.2523C>T	20.37:g.58460989G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Silent	SNP	NULL	p.L841	ENST00000357552.3	37	c.2523	CCDS13482.1	20																																																																																			SYCP2	-	NULL	ENSG00000196074		0.274	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	105	0.00	0	G	NM_014258		58460989	58460989	-1	no_errors	ENST00000357552	ensembl	human	known	69_37n	silent	68	18.07	15	SNP	0.004	A
SYCP2	10388	genome.wustl.edu	37	20	58470578	58470578	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:58470578G>A	ENST00000357552.3	-	20	1804	c.1579C>T	c.(1579-1581)Caa>Taa	p.Q527*	SYCP2_ENST00000371001.2_Nonsense_Mutation_p.Q527*			Q9BX26	SYCP2_HUMAN	synaptonemal complex protein 2	527					female meiotic division (GO:0007143)|fertilization (GO:0009566)|male genitalia morphogenesis (GO:0048808)|male meiosis (GO:0007140)|negative regulation of apoptotic process (GO:0043066)|synaptonemal complex assembly (GO:0007130)	lateral element (GO:0000800)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	DNA binding (GO:0003677)			NS(4)|breast(2)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(14)|lung(12)|ovary(4)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53	all_lung(29;0.00344)		BRCA - Breast invasive adenocarcinoma(7;1.19e-09)			TCTGATGTTTGAGAAACACTA	0.383																																						dbGAP											0													200.0	191.0	194.0					20																	58470578		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Y08982	CCDS13482.1	20q13.33	2007-07-02			ENSG00000196074	ENSG00000196074			11490	protein-coding gene	gene with protein product		604105				10341103, 9592139	Standard	NM_014258		Approved	SCP2	uc002yaz.3	Q9BX26	OTTHUMG00000032872	ENST00000357552.3:c.1579C>T	20.37:g.58470578G>A	ENSP00000350162:p.Gln527*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUE5|O75763|Q5JX11|Q9NTX8|Q9UG27	Nonsense_Mutation	SNP	NULL	p.Q527*	ENST00000357552.3	37	c.1579	CCDS13482.1	20	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063582	0.76187	.	.	ENSG00000196074	ENST00000371001;ENST00000357552;ENST00000446834	.	.	.	4.72	1.21	0.21127	.	0.684405	0.14345	N	0.325458	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.3837	3.9838	0.09506	0.0:0.1997:0.1955:0.6047	.	.	.	.	X	527	.	ENSP00000350162:Q527X	Q	-	1	0	SYCP2	57903973	0.033000	0.19621	0.023000	0.16930	0.032000	0.12392	-0.125000	0.10579	0.082000	0.17018	-1.058000	0.02302	CAA	SYCP2	-	NULL	ENSG00000196074		0.383	SYCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYCP2	HGNC	protein_coding	OTTHUMT00000079930.3	176	0.00	0	G	NM_014258		58470578	58470578	-1	no_errors	ENST00000357552	ensembl	human	known	69_37n	nonsense	163	31.80	76	SNP	0.026	A
SYNE2	23224	genome.wustl.edu	37	14	64691728	64691728	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:64691728G>A	ENST00000344113.4	+	114	20627	c.20415G>A	c.(20413-20415)gtG>gtA	p.V6805V	SYNE2_ENST00000441438.2_Silent_p.V349V|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Silent_p.V3461V|SYNE2_ENST00000358025.3_Silent_p.V6827V|SYNE2_ENST00000554584.1_Missense_Mutation_p.E6726K|SYNE2_ENST00000394768.2_Silent_p.V3190V|SYNE2_ENST00000554805.1_Silent_p.V588V|SYNE2_ENST00000357395.3_Silent_p.V3190V|SYNE2_ENST00000555022.1_Silent_p.V683V|SYNE2_ENST00000458046.2_Silent_p.V476V	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6805					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCAGAGCAGTGAGAACTACAG	0.448																																						dbGAP											0													69.0	69.0	69.0					14																	64691728		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.20415G>A	14.37:g.64691728G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_Calpain_domain_III,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain	p.E6726K	ENST00000344113.4	37	c.20176	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	12.16	1.855326	0.32791	.	.	ENSG00000054654	ENST00000554584;ENST00000261678	T	0.57273	0.41	6.17	1.28	0.21552	.	.	.	.	.	T	0.23727	0.0574	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.23691	-1.0181	6	0.02654	T	1	.	8.1817	0.31315	0.3998:0.0:0.6002:0.0	.	.	.	.	K	6726;6732	ENSP00000452570:E6726K	ENSP00000261678:E6732K	E	+	1	0	SYNE2	63761481	0.145000	0.22656	0.000000	0.03702	0.010000	0.07245	0.765000	0.26546	0.173000	0.19788	0.655000	0.94253	GAG	SYNE2	-	NULL	ENSG00000054654		0.448	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	54	0.00	0	G	NM_182914		64691728	64691728	+1	no_errors	ENST00000554584	ensembl	human	novel	69_37n	missense	43	28.33	17	SNP	0.000	A
SYNE2	23224	genome.wustl.edu	37	14	64692244	64692244	+	Nonstop_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr14:64692244G>C	ENST00000344113.4	+	115	20870	c.20658G>C	c.(20656-20658)taG>taC	p.*6886Y	SYNE2_ENST00000441438.2_Nonstop_Mutation_p.*430Y|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Nonstop_Mutation_p.*3542Y|SYNE2_ENST00000358025.3_Nonstop_Mutation_p.*6908Y|SYNE2_ENST00000554584.1_Missense_Mutation_p.E6807Q|SYNE2_ENST00000394768.2_Nonstop_Mutation_p.*3271Y|SYNE2_ENST00000554805.1_Nonstop_Mutation_p.*669Y|SYNE2_ENST00000357395.3_Nonstop_Mutation_p.*3271Y|SYNE2_ENST00000555022.1_Nonstop_Mutation_p.*764Y|SYNE2_ENST00000458046.2_Nonstop_Mutation_p.*557Y	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	0					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CCCCCACATAGAGGGCATAGC	0.582																																						dbGAP											0													28.0	26.0	26.0					14																	64692244		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.20658G>C	14.37:g.64692244G>C	ENSP00000341781:p.*6886Tyrext*3	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_Calpain_domain_III,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain	p.E6807Q	ENST00000344113.4	37	c.20419	CCDS41963.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.36|18.36	3.608000|3.608000	0.66558|0.66558	.|.	.|.	ENSG00000054654|ENSG00000054654	ENST00000554584;ENST00000261678|ENST00000358025;ENST00000357395;ENST00000344113;ENST00000555002;ENST00000394768;ENST00000555022;ENST00000554805;ENST00000458046;ENST00000441438	T|.	0.58506|.	0.33|.	5.79|5.79	3.02|3.02	0.34903|0.34903	.|.	.|.	.|.	.|.	.|.	T|.	0.58323|.	0.2114|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.51196|.	-0.8736|.	6|.	0.87932|.	D|.	0|.	.|.	8.9379|8.9379	0.35711|0.35711	0.3406:0.0:0.6594:0.0|0.3406:0.0:0.6594:0.0	.|.	.|.	.|.	.|.	Q|Y	6807;6813|6908;3271;6886;3542;3271;764;669;557;430	ENSP00000452570:E6807Q|.	ENSP00000261678:E6813Q|.	E|X	+|+	1|3	0|2	SYNE2|SYNE2	63761997|63761997	0.978000|0.978000	0.34361|0.34361	0.058000|0.058000	0.19502|0.19502	0.377000|0.377000	0.30045|0.30045	1.345000|1.345000	0.33953|0.33953	0.394000|0.394000	0.25230|0.25230	-0.122000|-0.122000	0.15005|0.15005	GAG|TAG	SYNE2	-	NULL	ENSG00000054654		0.582	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	22	0.00	0	G	NM_182914		64692244	64692244	+1	no_errors	ENST00000554584	ensembl	human	novel	69_37n	missense	13	31.58	6	SNP	0.622	C
SYT11	23208	genome.wustl.edu	37	1	155838164	155838164	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:155838164C>T	ENST00000368324.4	+	2	696	c.443C>T	c.(442-444)tCt>tTt	p.S148F	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	148					negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			AAAACCACCTCTCCATCATCT	0.498																																						dbGAP											0													97.0	95.0	96.0					1																	155838164		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.443C>T	1.37:g.155838164C>T	ENSP00000357307:p.Ser148Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.S148F	ENST00000368324.4	37	c.443	CCDS1122.1	1	.	.	.	.	.	.	.	.	.	.	C	23.0	4.361738	0.82353	.	.	ENSG00000132718	ENST00000368324	T	0.49432	0.78	5.35	5.35	0.76521	.	0.059799	0.64402	D	0.000001	T	0.51787	0.1695	L	0.46157	1.445	0.80722	D	1	D	0.67145	0.996	P	0.57548	0.823	T	0.53995	-0.8359	10	0.87932	D	0	.	18.8354	0.92161	0.0:1.0:0.0:0.0	.	148	Q9BT88	SYT11_HUMAN	F	148	ENSP00000357307:S148F	ENSP00000357307:S148F	S	+	2	0	SYT11	154104788	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.949000	0.75971	2.781000	0.95711	0.655000	0.94253	TCT	SYT11	-	NULL	ENSG00000132718		0.498	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT11	HGNC	protein_coding	OTTHUMT00000039597.1	16	0.00	0	C	NM_152280		155838164	155838164	+1	no_errors	ENST00000368324	ensembl	human	known	69_37n	missense	24	41.46	17	SNP	1.000	T
SYTL2	54843	genome.wustl.edu	37	11	85445351	85445351	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:85445351C>T	ENST00000528231.1	-	6	1295	c.1018G>A	c.(1018-1020)Gag>Aag	p.E340K	SYTL2_ENST00000527523.1_Missense_Mutation_p.E292K|SYTL2_ENST00000389960.4_Missense_Mutation_p.E340K|SYTL2_ENST00000316356.4_Missense_Mutation_p.E341K|SYTL2_ENST00000524452.1_Missense_Mutation_p.E340K	NM_001162951.1|NM_001162953.1	NP_001156423.1|NP_001156425.1	Q9HCH5	SYTL2_HUMAN	synaptotagmin-like 2	340					exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of mucus secretion (GO:0070257)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|exocytic vesicle (GO:0070382)|extrinsic component of plasma membrane (GO:0019897)|Golgi apparatus (GO:0005794)|melanosome (GO:0042470)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	neurexin family protein binding (GO:0042043)|phosphatase binding (GO:0019902)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(22)|ovary(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;4.19e-06)|all_hematologic(158;0.0033)		KIRC - Kidney renal clear cell carcinoma(183;0.202)|Kidney(183;0.237)		TGTGGAAGCTCATCCTTCACT	0.443																																						dbGAP											0													105.0	107.0	106.0					11																	85445351		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ303364	CCDS31649.1, CCDS31652.1, CCDS41698.1, CCDS53687.1, CCDS53688.1, CCDS53689.1	11q14.1	2014-06-13			ENSG00000137501	ENSG00000137501			15585	protein-coding gene	gene with protein product	"""chromosome 11 synaptotagmin"", ""breast cancer-associated antigen SGA-72M"", ""protein phosphatase 1, regulatory subunit 151"""	612880				10997877	Standard	XM_005274057		Approved	FLJ20163, FLJ21219, KIAA1597, exophilin-4, CHR11SYT, SLP2, SGA72M, MGC102768, PPP1R151	uc001pbb.3	Q9HCH5	OTTHUMG00000166977	ENST00000528231.1:c.1018G>A	11.37:g.85445351C>T	ENSP00000431701:p.Glu340Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRS3|B4DJT5|B4DKW3|B4DQ26|B7SA85|B7ZLX6|B7ZLX7|Q2YDA7|Q6TV07|Q6ZN59|Q6ZVC5|Q8ND34|Q96BJ2|Q9H768|Q9NXM1	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain	p.E341K	ENST00000528231.1	37	c.1021	CCDS53688.1	11	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564823	0.65651	.	.	ENSG00000137501	ENST00000389960;ENST00000316356;ENST00000528231;ENST00000527523;ENST00000524452	T;T;T;T;T	0.29142	1.66;1.69;1.69;1.58;1.66	6.17	6.17	0.99709	.	.	.	.	.	T	0.31979	0.0814	L	0.54323	1.7	0.80722	D	1	B;B;B;B;B	0.26318	0.146;0.04;0.024;0.019;0.069	B;B;B;B;B	0.31337	0.128;0.019;0.008;0.014;0.082	T	0.03717	-1.1010	8	.	.	.	.	13.2059	0.59795	0.0:0.9258:0.0:0.0742	.	292;340;340;341;198	Q9HCH5-14;Q9HCH5-6;Q9HCH5;Q9HCH5-13;Q9HCH5-15	.;.;SYTL2_HUMAN;.;.	K	340;341;340;292;340	ENSP00000374610:E340K;ENSP00000318803:E341K;ENSP00000431701:E340K;ENSP00000434010:E292K;ENSP00000435238:E340K	.	E	-	1	0	SYTL2	85122999	0.864000	0.29904	0.992000	0.48379	0.952000	0.60782	1.787000	0.38704	2.941000	0.99782	0.655000	0.94253	GAG	SYTL2	-	NULL	ENSG00000137501		0.443	SYTL2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL2	HGNC	protein_coding	OTTHUMT00000392192.1	96	0.00	0	C	NM_206927		85445351	85445351	-1	no_errors	ENST00000316356	ensembl	human	known	69_37n	missense	19	57.78	26	SNP	1.000	T
TADA2A	6871	genome.wustl.edu	37	17	35827573	35827573	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr17:35827573G>A	ENST00000394395.2	+	12	1012	c.839G>A	c.(838-840)cGa>cAa	p.R280Q	TADA2A_ENST00000225396.6_Missense_Mutation_p.R280Q|TADA2A_ENST00000591992.1_3'UTR	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	280					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						TTTGAACTCCGAAGGGAAATC	0.378																																						dbGAP											0													105.0	93.0	97.0					17																	35827573		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.839G>A	17.37:g.35827573G>A	ENSP00000377918:p.Arg280Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_SWIRM,pfscan_Myb-like_dom	p.R280Q	ENST00000394395.2	37	c.839	CCDS11319.1	17	.	.	.	.	.	.	.	.	.	.	G	21.1	4.105301	0.77096	.	.	ENSG00000108264	ENST00000394395;ENST00000428846;ENST00000225396	T;T	0.39787	1.06;1.06	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.39733	0.1089	L	0.60012	1.86	0.80722	D	1	P	0.35011	0.48	B	0.18561	0.022	T	0.33574	-0.9863	10	0.45353	T	0.12	-7.1498	19.5751	0.95439	0.0:0.0:1.0:0.0	.	280	O75478	TAD2A_HUMAN	Q	280;179;280	ENSP00000377918:R280Q;ENSP00000225396:R280Q	ENSP00000225396:R280Q	R	+	2	0	TADA2A	32901686	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.225000	0.78051	2.642000	0.89623	0.561000	0.74099	CGA	TADA2A	-	pirsf_Transcriptional_adaptor_2	ENSG00000108264		0.378	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2A	HGNC	protein_coding	OTTHUMT00000256677.3	96	0.00	0	G	NM_001488		35827573	35827573	+1	no_errors	ENST00000225396	ensembl	human	known	69_37n	missense	66	22.35	19	SNP	1.000	A
TAMM41	132001	genome.wustl.edu	37	3	11831994	11831994	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:11831994C>T	ENST00000455809.1	-	8	1134	c.999G>A	c.(997-999)ctG>ctA	p.L333L	TAMM41_ENST00000273037.5_Silent_p.L312L	NM_001284401.1	NP_001271330.1	Q96BW9	TAM41_HUMAN	TAM41, mitochondrial translocator assembly and maintenance protein, homolog (S. cerevisiae)	0					cardiolipin biosynthetic process (GO:0032049)|CDP-diacylglycerol biosynthetic process (GO:0016024)	extrinsic component of mitochondrial inner membrane (GO:0031314)	phosphatidate cytidylyltransferase activity (GO:0004605)										ATGTTTTCCTCAGCCACCCTT	0.358																																						dbGAP											0													218.0	203.0	208.0					3																	11831994		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS2607.1, CCDS68345.1	3p25.2	2013-10-18	2011-08-09	2011-08-09	ENSG00000144559	ENSG00000144559			25187	protein-coding gene	gene with protein product		614948	"""chromosome 3 open reading frame 31"""	C3orf31		19237595	Standard	XM_005264873		Approved	MGC16471, DKFZp434E0519	uc003bwh.3	Q96BW9	OTTHUMG00000129741	ENST00000455809.1:c.999G>A	3.37:g.11831994C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIY7|C9J2U4	Silent	SNP	pfam_Mmp37,pirsf_Mmp37	p.L312	ENST00000455809.1	37	c.936		3																																																																																			TAMM41	-	NULL	ENSG00000144559		0.358	TAMM41-005	NOVEL	basic|appris_principal	protein_coding	TAMM41	HGNC	protein_coding	OTTHUMT00000339255.1	159	0.00	0	C	NM_138807		11831994	11831994	-1	no_errors	ENST00000273037	ensembl	human	known	69_37n	silent	75	32.43	36	SNP	0.997	T
TANC1	85461	genome.wustl.edu	37	2	160035418	160035418	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:160035418G>C	ENST00000263635.6	+	14	2491	c.2254G>C	c.(2254-2256)Gag>Cag	p.E752Q	TANC1_ENST00000454300.1_Missense_Mutation_p.E646Q	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	752					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						GTCCGCCTTTGAGAGGGCACT	0.537																																						dbGAP											0													178.0	180.0	179.0					2																	160035418		2019	4164	6183	-	-	-	SO:0001583	missense	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.2254G>C	2.37:g.160035418G>C	ENSP00000263635:p.Glu752Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD88|Q49AI8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.E752Q	ENST00000263635.6	37	c.2254	CCDS42766.1	2	.	.	.	.	.	.	.	.	.	.	g	18.21	3.574586	0.65878	.	.	ENSG00000115183	ENST00000454300;ENST00000263635	T;T	0.71341	-0.56;-0.56	5.66	5.66	0.87406	.	0.100610	0.64402	D	0.000002	T	0.80909	0.4714	M	0.80746	2.51	0.80722	D	1	P;P;B	0.42973	0.693;0.796;0.218	B;P;B	0.48901	0.389;0.594;0.217	T	0.82711	-0.0322	10	0.66056	D	0.02	.	19.7557	0.96287	0.0:0.0:1.0:0.0	.	744;646;752	B9EK39;Q9C0D5-2;Q9C0D5	.;.;TANC1_HUMAN	Q	646;752	ENSP00000396339:E646Q;ENSP00000263635:E752Q	ENSP00000263635:E752Q	E	+	1	0	TANC1	159743664	1.000000	0.71417	0.858000	0.33744	0.771000	0.43674	9.866000	0.99616	2.693000	0.91896	0.651000	0.88453	GAG	TANC1	-	NULL	ENSG00000115183		0.537	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1	48	0.00	0	G			160035418	160035418	+1	no_errors	ENST00000263635	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	1.000	C
TEAD3	7005	genome.wustl.edu	37	6	35446093	35446093	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:35446093G>A	ENST00000402886.3	-	5	462	c.309C>T	c.(307-309)agC>agT	p.S103S	TEAD3_ENST00000338863.7_Silent_p.S163S			Q99594	TEAD3_HUMAN	TEA domain family member 3	163					female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						GAGGGGGGCTGCTCCAGAACT	0.622																																						dbGAP											0													32.0	39.0	36.0					6																	35446093		1985	4159	6144	-	-	-	SO:0001819	synonymous_variant	0			X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.309C>T	6.37:g.35446093G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95910|Q5BJG7|Q8N6Y4	Silent	SNP	pfam_TEA/ATTS,pirsf_TEF	p.S103	ENST00000402886.3	37	c.309		6																																																																																			TEAD3	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000007866		0.622	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	TEAD3	HGNC	protein_coding	OTTHUMT00000316961.2	33	0.00	0	G			35446093	35446093	-1	no_errors	ENST00000402886	ensembl	human	novel	69_37n	silent	8	46.67	7	SNP	1.000	A
TEAD3	7005	genome.wustl.edu	37	6	35446243	35446243	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:35446243G>A	ENST00000402886.3	-	4	421	c.268C>T	c.(268-270)Ctg>Ttg	p.L90L	TEAD3_ENST00000338863.7_Silent_p.L150L			Q99594	TEAD3_HUMAN	TEA domain family member 3	150					female pregnancy (GO:0007565)|gene expression (GO:0010467)|hippo signaling (GO:0035329)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	10						GCCTGGGGCAGAGGGGAAGGT	0.597																																						dbGAP											0													61.0	74.0	70.0					6																	35446243		2129	4249	6378	-	-	-	SO:0001819	synonymous_variant	0			X94439	CCDS47414.1	6p21.2	2008-07-28			ENSG00000007866	ENSG00000007866			11716	protein-coding gene	gene with protein product		603170		TEAD5		9889009, 9148898	Standard	NM_003214		Approved	TEF-5, ETFR-1	uc003oku.4	Q99594	OTTHUMG00000014571	ENST00000402886.3:c.268C>T	6.37:g.35446243G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95910|Q5BJG7|Q8N6Y4	Silent	SNP	pfam_TEA/ATTS,pirsf_TEF	p.L90	ENST00000402886.3	37	c.268		6																																																																																			TEAD3	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000007866		0.597	TEAD3-005	NOVEL	basic|appris_candidate_longest	protein_coding	TEAD3	HGNC	protein_coding	OTTHUMT00000316961.2	66	0.00	0	G			35446243	35446243	-1	no_errors	ENST00000402886	ensembl	human	novel	69_37n	silent	16	51.52	17	SNP	1.000	A
TF	7018	genome.wustl.edu	37	3	133473506	133473506	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:133473506C>G	ENST00000402696.3	+	4	978	c.493C>G	c.(493-495)Ctt>Gtt	p.L165V	TFP1_ENST00000460564.1_RNA|TF_ENST00000264998.3_Missense_Mutation_p.L38V|TF_ENST00000475382.1_3'UTR	NM_001063.3	NP_001054	P02787	TRFE_HUMAN	transferrin	165	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				blood coagulation (GO:0007596)|cellular iron ion homeostasis (GO:0006879)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|retina homeostasis (GO:0001895)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basal part of cell (GO:0045178)|basal plasma membrane (GO:0009925)|blood microparticle (GO:0072562)|cell surface (GO:0009986)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|secretory granule lumen (GO:0034774)|vesicle (GO:0031982)	ferric iron binding (GO:0008199)			NS(1)|autonomic_ganglia(1)|breast(3)|endometrium(7)|large_intestine(13)|liver(2)|lung(16)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	49					Aluminium(DB01370)|Bismuth Subsalicylate(DB01294)|Gallium nitrate(DB05260)|Iron Dextran(DB00893)	ACGTAAACCTCTTGAGAAAGG	0.567																																						dbGAP											0													121.0	123.0	123.0					3																	133473506		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3080.1	3q21	2012-10-02			ENSG00000091513	ENSG00000091513			11740	protein-coding gene	gene with protein product		190000				6585826	Standard	NM_001063		Approved	PRO1557, PRO2086	uc003epv.2	P02787	OTTHUMG00000150356	ENST00000402696.3:c.493C>G	3.37:g.133473506C>G	ENSP00000385834:p.Leu165Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O43890|Q1HBA5|Q9NQB8|Q9UHV0	Missense_Mutation	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.L165V	ENST00000402696.3	37	c.493	CCDS3080.1	3	.	.	.	.	.	.	.	.	.	.	C	2.505	-0.314376	0.05422	.	.	ENSG00000091513	ENST00000402696;ENST00000482271;ENST00000264998	T;T;T	0.32988	1.43;1.43;1.43	5.25	2.12	0.27331	.	0.447702	0.25711	N	0.028801	T	0.18593	0.0446	L	0.33189	0.99	0.21933	N	0.999469	B	0.11235	0.004	B	0.18871	0.023	T	0.28073	-1.0055	10	0.13470	T	0.59	-0.6758	6.9875	0.24737	0.6048:0.3049:0.0:0.0903	.	165	P02787	TRFE_HUMAN	V	165;38;38	ENSP00000385834:L165V;ENSP00000419338:L38V;ENSP00000264998:L38V	ENSP00000264998:L38V	L	+	1	0	TF	134956196	0.000000	0.05858	0.230000	0.23976	0.965000	0.64279	-0.754000	0.04787	0.306000	0.22856	0.561000	0.74099	CTT	TF	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	ENSG00000091513		0.567	TF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TF	HGNC	protein_coding	OTTHUMT00000317775.1	32	0.00	0	C	NM_001063		133473506	133473506	+1	no_errors	ENST00000402696	ensembl	human	known	69_37n	missense	38	30.91	17	SNP	0.061	G
TGOLN2	10618	genome.wustl.edu	37	2	85554057	85554057	+	Silent	SNP	G	G	A	rs137902012	byFrequency	TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:85554057G>A	ENST00000409232.3	-	2	859	c.798C>T	c.(796-798)atC>atT	p.I266I	TGOLN2_ENST00000409015.1_Silent_p.I266I|TGOLN2_ENST00000444342.2_Silent_p.I266I|TGOLN2_ENST00000282120.2_Intron|TGOLN2_ENST00000398263.2_Intron|TGOLN2_ENST00000377386.3_Silent_p.I266I			O43493	TGON2_HUMAN	trans-golgi network protein 2	266						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)											AAGGGTTGGAGATGGGCTTGG	0.547																																						dbGAP											0													77.0	76.0	76.0					2																	85554057		1943	4143	6086	-	-	-	SO:0001819	synonymous_variant	0			AF027515	CCDS46351.1, CCDS56126.1, CCDS56127.1	2p11.2	2012-06-25			ENSG00000152291	ENSG00000152291			15450	protein-coding gene	gene with protein product	"""trans-Golgi network protein (46, 48, 51kD isoforms)"""	603062				9422759, 21994457	Standard	NM_001206840		Approved	TGN51, TGN46, TGN48, TGN38, TTGN2	uc021vjw.1	O43493	OTTHUMG00000153017	ENST00000409232.3:c.798C>T	2.37:g.85554057G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R686|B8ZZ88|D6W5K3|F8WBK2|O15282|O43492|O43499|O43500|O43501|Q53G68|Q53GV2|Q6MZV1|Q6ZTM7|Q8N6T8|Q92760|Q96QL2	Silent	SNP	NULL	p.I266	ENST00000409232.3	37	c.798	CCDS56126.1	2																																																																																			TGOLN2	-	NULL	ENSG00000152291		0.547	TGOLN2-006	NOVEL	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TGOLN2	HGNC	protein_coding	OTTHUMT00000329045.2	107	0.00	0	G	NM_006464		85554057	85554057	-1	no_errors	ENST00000377386	ensembl	human	known	69_37n	silent	57	29.63	24	SNP	0.000	A
TIA1	7072	genome.wustl.edu	37	2	70439953	70439953	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:70439953C>G	ENST00000433529.2	-	13	1269	c.1059G>C	c.(1057-1059)tgG>tgC	p.W353C	TIA1_ENST00000482876.1_5'Flank|C2orf42_ENST00000470096.1_Intron|TIA1_ENST00000282574.4_Missense_Mutation_p.W352C|TIA1_ENST00000415783.2_Missense_Mutation_p.W342C|TIA1_ENST00000445587.1_Missense_Mutation_p.W252C	NM_022173.2	NP_071505.2	P31483	TIA1_HUMAN	TIA1 cytotoxic granule-associated RNA binding protein	353					apoptotic process (GO:0006915)|negative regulation of cytokine biosynthetic process (GO:0042036)|negative regulation of translation (GO:0017148)|regulation of mRNA splicing, via spliceosome (GO:0048024)	cytoplasmic stress granule (GO:0010494)|nuclear stress granule (GO:0097165)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|skin(1)|urinary_tract(1)	17						TTGGTCCCATCCATGGTGCAG	0.473																																						dbGAP											0													105.0	95.0	99.0					2																	70439953		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1900.1, CCDS1901.1	2p13	2013-02-12	2001-11-28		ENSG00000116001	ENSG00000116001		"""RNA binding motif (RRM) containing"""	11802	protein-coding gene	gene with protein product	"""T-cell-restricted intracellular antigen-1"", ""nucleolysin TIA-1 isoform p40"""	603518	"""TIA1 cytotoxic granule-associated RNA-binding protein"""			8176212, 12486009	Standard	NM_022173		Approved		uc002sgj.4	P31483	OTTHUMG00000129644	ENST00000433529.2:c.1059G>C	2.37:g.70439953C>G	ENSP00000401371:p.Trp353Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SS9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.W353C	ENST00000433529.2	37	c.1059	CCDS1901.1	2	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177765	0.57692	.	.	ENSG00000116001	ENST00000433529;ENST00000415783;ENST00000477807;ENST00000282574;ENST00000445587	T;T;T;T	0.25414	1.8;1.98;1.9;2.02	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.31796	0.0808	L	0.55743	1.74	0.80722	D	1	B;B	0.24651	0.108;0.001	B;B	0.29176	0.099;0.006	T	0.03287	-1.1052	10	0.49607	T	0.09	-4.0519	18.7953	0.91991	0.0:1.0:0.0:0.0	.	342;353	P31483-2;P31483	.;TIA1_HUMAN	C	353;342;430;352;252	ENSP00000401371:W353C;ENSP00000404023:W342C;ENSP00000282574:W352C;ENSP00000399567:W252C	ENSP00000282574:W352C	W	-	3	0	TIA1	70293457	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.057000	0.64294	2.789000	0.95967	0.591000	0.81541	TGG	TIA1	-	NULL	ENSG00000116001		0.473	TIA1-001	KNOWN	basic|CCDS	protein_coding	TIA1	HGNC	protein_coding	OTTHUMT00000251842.2	51	0.00	0	C	NM_022037		70439953	70439953	-1	no_errors	ENST00000433529	ensembl	human	known	69_37n	missense	31	39.22	20	SNP	1.000	G
THAP4	51078	genome.wustl.edu	37	2	242572453	242572453	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:242572453C>T	ENST00000407315.1	-	2	1550	c.1119G>A	c.(1117-1119)ctG>ctA	p.L373L		NM_015963.5	NP_057047.4	Q8WY91	THAP4_HUMAN	THAP domain containing 4	373							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	9		all_cancers(19;2.09e-34)|all_epithelial(40;2.09e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Ovarian(221;0.069)|Lung NSC(271;0.0886)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.2)		Epithelial(32;2.3e-33)|all cancers(36;8.99e-31)|OV - Ovarian serous cystadenocarcinoma(60;3.68e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.65e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00154)|Colorectal(34;0.0129)|COAD - Colon adenocarcinoma(134;0.0844)		GCAGGCTCTTCAGCTCGCCGT	0.607																																						dbGAP											0													42.0	44.0	44.0					2																	242572453		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AF258556	CCDS2551.1, CCDS54440.1	2q37.3	2013-01-25			ENSG00000176946	ENSG00000176946		"""THAP (C2CH-type zinc finger) domain containing"""	23187	protein-coding gene	gene with protein product		612533				12575992, 10810093	Standard	NM_015963		Approved	CGI-36	uc002wbt.3	Q8WY91	OTTHUMG00000133410	ENST00000407315.1:c.1119G>A	2.37:g.242572453C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53NU7|Q6GRN0|Q6IPJ3|Q9NW26|Q9Y325	Silent	SNP	pfam_DUF1794,pfam_Znf_C2CH,superfamily_Calycin-like,smart_Znf_C2CH,pfscan_Znf_C2CH	p.L373	ENST00000407315.1	37	c.1119	CCDS2551.1	2																																																																																			THAP4	-	NULL	ENSG00000176946		0.607	THAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP4	HGNC	protein_coding	OTTHUMT00000257267.3	26	0.00	0	C	NM_015963		242572453	242572453	-1	no_errors	ENST00000407315	ensembl	human	known	69_37n	silent	19	47.22	17	SNP	0.048	T
TIMM13	26517	genome.wustl.edu	37	19	2426965	2426965	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:2426965C>A	ENST00000215570.3	-	3	629	c.269G>T	c.(268-270)cGg>cTg	p.R90L	TIMM13_ENST00000591871.1_Missense_Mutation_p.R75L|LMNB2_ENST00000475819.1_5'Flank	NM_012458.2	NP_036590.1	Q9Y5L4	TIM13_HUMAN	translocase of inner mitochondrial membrane 13 homolog (yeast)	90					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein transport (GO:0072321)|protein targeting to mitochondrion (GO:0006626)|sensory perception of sound (GO:0007605)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space protein transporter complex (GO:0042719)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	zinc ion binding (GO:0008270)			endometrium(1)|prostate(1)	2		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGCTCGTTCCCGCTGCAGCCG	0.637																																						dbGAP											0													40.0	28.0	32.0					19																	2426965		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF152352	CCDS12089.1	19p13.3	2008-07-04	2001-11-28	2002-03-17		ENSG00000099800			11816	protein-coding gene	gene with protein product		607383	"""translocase of inner mitochondrial membrane 13 (yeast) homolog B"""	TIMM13B		10552927, 17329230	Standard	NM_012458		Approved	Tim13	uc002lvx.1	Q9Y5L4		ENST00000215570.3:c.269G>T	19.37:g.2426965C>A	ENSP00000215570:p.Arg90Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	P62206|Q9UHL8|Q9WTL1	Missense_Mutation	SNP	pfam_Tim8/9/10/13_Znf-like,superfamily_Tim8/9/10/13_Znf-like	p.R90L	ENST00000215570.3	37	c.269	CCDS12089.1	19	.	.	.	.	.	.	.	.	.	.	C	25.2	4.614529	0.87359	.	.	ENSG00000099800	ENST00000215570	T	0.63096	-0.02	4.37	4.37	0.52481	.	0.069012	0.53938	U	0.000060	T	0.71600	0.3359	.	.	.	0.49798	D	0.999822	D	0.53885	0.963	P	0.52909	0.713	T	0.77143	-0.2696	9	0.72032	D	0.01	-27.4532	15.484	0.75551	0.0:1.0:0.0:0.0	.	90	Q9Y5L4	TIM13_HUMAN	L	90	ENSP00000215570:R90L	ENSP00000215570:R90L	R	-	2	0	TIMM13	2377965	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	2.931000	0.48932	1.961000	0.56991	0.313000	0.20887	CGG	TIMM13	-	superfamily_Tim8/9/10/13_Znf-like	ENSG00000099800		0.637	TIMM13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM13	HGNC	protein_coding	OTTHUMT00000451333.1	13	0.00	0	C			2426965	2426965	-1	no_errors	ENST00000215570	ensembl	human	known	69_37n	missense	6	45.45	5	SNP	1.000	A
TJP3	27134	genome.wustl.edu	37	19	3747917	3747917	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:3747917C>T	ENST00000541714.2	+	19	2910	c.2448C>T	c.(2446-2448)taC>taT	p.Y816Y	TJP3_ENST00000539908.2_Silent_p.Y780Y|TJP3_ENST00000382008.3_Silent_p.Y830Y|TJP3_ENST00000587686.1_Silent_p.Y835Y|TJP3_ENST00000589378.1_Silent_p.Y825Y|TJP3_ENST00000262968.9_Silent_p.Y849Y	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	816					regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GCGGCGCGTACACGGATGGCG	0.701																																						dbGAP											0													36.0	32.0	33.0					19																	3747917		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.2448C>T	19.37:g.3747917C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Silent	SNP	pfam_PDZ,pfam_SH3_2,pfam_Guanylate_kin,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin,prints_ZonOcculS3,prints_ZonOcculdens	p.Y849	ENST00000541714.2	37	c.2547	CCDS32873.2	19																																																																																			TJP3	-	NULL	ENSG00000105289		0.701	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP3	HGNC	protein_coding	OTTHUMT00000453434.1	13	0.00	0	C			3747917	3747917	+1	no_errors	ENST00000262968	ensembl	human	known	69_37n	silent	6	40.00	4	SNP	1.000	T
TLR4	7099	genome.wustl.edu	37	9	120476354	120476354	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:120476354C>A	ENST00000355622.6	+	3	2049	c.1948C>A	c.(1948-1950)Ctg>Atg	p.L650M	TLR4_ENST00000394487.4_Missense_Mutation_p.L610M|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	650					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.L650L(2)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TGTAGCAGTTCTGGTCTATAA	0.428																																						dbGAP											2	Substitution - coding silent(2)	lung(2)											174.0	149.0	158.0					9																	120476354		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.1948C>A	9.37:g.120476354C>A	ENSP00000363089:p.Leu650Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.L650M	ENST00000355622.6	37	c.1948	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286971	0.80803	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	T;T	0.51817	1.03;0.69	6.02	-2.91	0.05631	.	0.000000	0.52532	D	0.000069	T	0.58963	0.2159	M	0.76170	2.325	0.28935	N	0.891329	D	0.89917	1.0	D	0.79784	0.993	T	0.55276	-0.8166	10	0.87932	D	0	.	7.1218	0.25448	0.1079:0.4365:0.0:0.4556	.	650	O00206	TLR4_HUMAN	M	610;650	ENSP00000377997:L610M;ENSP00000363089:L650M	ENSP00000363089:L650M	L	+	1	2	TLR4	119516175	0.068000	0.21057	0.017000	0.16124	0.826000	0.46750	-0.233000	0.09041	-0.110000	0.12022	-0.143000	0.13931	CTG	TLR4	-	pirsf_Toll-like_receptor	ENSG00000136869		0.428	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	167	0.00	0	C	NM_138554		120476354	120476354	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	missense	127	28.49	51	SNP	0.071	A
TMCO3	55002	genome.wustl.edu	37	13	114188406	114188406	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:114188406C>G	ENST00000434316.2	+	9	1749	c.1390C>G	c.(1390-1392)Ctt>Gtt	p.L464V	TMCO3_ENST00000474393.1_3'UTR|TMCO3_ENST00000375391.1_Intron	NM_017905.4	NP_060375.4	Q6UWJ1	TMCO3_HUMAN	transmembrane and coiled-coil domains 3	464						integral component of membrane (GO:0016021)	solute:proton antiporter activity (GO:0015299)			NS(1)|endometrium(4)|large_intestine(9)|liver(1)|lung(8)|prostate(1)|stomach(1)	25	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0145)|all_epithelial(44;0.00286)|all_lung(25;0.0273)|Breast(118;0.0411)|Lung NSC(25;0.0983)	all cancers(43;0.0317)			TGGTCAGATTCTTTTTTCACT	0.398																																						dbGAP											0													197.0	196.0	196.0					13																	114188406		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012564	CCDS9537.1	13q34	2008-02-05	2005-07-22	2005-07-22	ENSG00000150403	ENSG00000150403			20329	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 11"""	C13orf11			Standard	NM_017905		Approved	FLJ20623	uc001vtu.4	Q6UWJ1	OTTHUMG00000017389	ENST00000434316.2:c.1390C>G	13.37:g.114188406C>G	ENSP00000389399:p.Leu464Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSB1|Q6NUN1|Q8NG29|Q8TCI6|Q96EA6|Q9NWT2	Missense_Mutation	SNP	pfam_Cation/H_exchanger	p.L464V	ENST00000434316.2	37	c.1390	CCDS9537.1	13	.	.	.	.	.	.	.	.	.	.	C	15.22	2.768200	0.49680	.	.	ENSG00000150403	ENST00000434316	T	0.16743	2.32	4.75	4.75	0.60458	Cation/H+ exchanger (1);	0.000000	0.85682	D	0.000000	T	0.29389	0.0732	M	0.69823	2.125	0.80722	D	1	P;P	0.51653	0.707;0.947	P;P	0.48524	0.46;0.58	T	0.06588	-1.0818	10	0.29301	T	0.29	-7.4612	17.8175	0.88639	0.0:1.0:0.0:0.0	.	464;464	Q6UWJ1;Q6UWJ1-2	TMCO3_HUMAN;.	V	464	ENSP00000389399:L464V	ENSP00000389399:L464V	L	+	1	0	TMCO3	113236407	0.999000	0.42202	0.033000	0.17914	0.004000	0.04260	3.906000	0.56340	2.195000	0.70347	0.555000	0.69702	CTT	TMCO3	-	pfam_Cation/H_exchanger	ENSG00000150403		0.398	TMCO3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO3	HGNC	protein_coding	OTTHUMT00000045931.3	266	0.00	0	C	NM_017905		114188406	114188406	+1	no_errors	ENST00000434316	ensembl	human	known	69_37n	missense	175	20.36	45	SNP	0.999	G
TMCO6	55374	genome.wustl.edu	37	5	140022222	140022222	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:140022222C>T	ENST00000394671.3	+	6	756	c.655C>T	c.(655-657)Cta>Tta	p.L219L	TMCO6_ENST00000537378.1_5'UTR|NDUFA2_ENST00000510680.1_Intron|TMCO6_ENST00000252100.6_Silent_p.L219L	NM_018502.3	NP_060972.3	Q96DC7	TMCO6_HUMAN	transmembrane and coiled-coil domains 6	219					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|urinary_tract(1)	9			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTCCCAGCTTCTACAGGCTGA	0.527																																						dbGAP											0													88.0	87.0	87.0					5																	140022222		1936	4130	6066	-	-	-	SO:0001819	synonymous_variant	0			BC001910	CCDS4233.2, CCDS75320.1	5q31.3	2008-11-06			ENSG00000113119	ENSG00000113119			28814	protein-coding gene	gene with protein product						12477932	Standard	XM_005268476		Approved	FLJ39769, PRO1580	uc003lgl.3	Q96DC7	OTTHUMG00000129497	ENST00000394671.3:c.655C>T	5.37:g.140022222C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUU0|Q9P198	Silent	SNP	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Importin-a_IBB	p.L219	ENST00000394671.3	37	c.655	CCDS4233.2	5																																																																																			TMCO6	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000113119		0.527	TMCO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMCO6	HGNC	protein_coding	OTTHUMT00000251666.2	56	0.00	0	C	NM_018502		140022222	140022222	+1	no_errors	ENST00000252100	ensembl	human	known	69_37n	silent	40	32.20	19	SNP	0.965	T
TOP3B	8940	genome.wustl.edu	37	22	22319685	22319685	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:22319685C>G	ENST00000398793.2	-	9	1349	c.915G>C	c.(913-915)gaG>gaC	p.E305D	TOP3B_ENST00000413067.2_Missense_Mutation_p.E34D|TOP3B_ENST00000357179.5_Missense_Mutation_p.E305D	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	305					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		CACGCAGCATCTCCACAGTGT	0.567																																						dbGAP											0													85.0	67.0	73.0					22																	22319685		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.915G>C	22.37:g.22319685C>G	ENSP00000381773:p.Glu305Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.E305D	ENST00000398793.2	37	c.915	CCDS13797.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.28|15.28	2.787790|2.787790	0.49997|0.49997	.|.	.|.	ENSG00000100038|ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000413067|ENST00000457270	T;T;T|.	0.22743|.	1.94;1.94;1.94|.	4.37|4.37	3.36|3.36	0.38483|0.38483	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 3 (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.62889|0.62889	0.2465|0.2465	M|M	0.69523|0.69523	2.12|2.12	0.58432|0.58432	D|D	0.999995|0.999995	B;B|.	0.32338|.	0.365;0.185|.	B;B|.	0.37888|.	0.26;0.099|.	T|T	0.60662|0.60662	-0.7219|-0.7219	10|5	0.45353|.	T|.	0.12|.	.|.	7.2653|7.2653	0.26226|0.26226	0.0:0.7148:0.0:0.2852|0.0:0.7148:0.0:0.2852	.|.	305;305|.	O95985;O95985-2|.	TOP3B_HUMAN;.|.	D|T	305;305;34|100	ENSP00000349705:E305D;ENSP00000381773:E305D;ENSP00000393118:E34D|.	ENSP00000349705:E305D|.	E|R	-|-	3|2	2|0	TOP3B|TOP3B	20649685|20649685	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.848000|0.848000	0.48234|0.48234	2.618000|2.618000	0.46393|0.46393	1.046000|1.046000	0.40249|0.40249	-0.258000|-0.258000	0.10820|0.10820	GAG|AGA	TOP3B	-	pfam_Topo_IA_cen,superfamily_Topo_IA_core_domain,smart_Topo_IA_DNA-bd	ENSG00000100038		0.567	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1	66	0.00	0	C	NM_003935		22319685	22319685	-1	no_errors	ENST00000357179	ensembl	human	known	69_37n	missense	47	30.88	21	SNP	1.000	G
TNRC6B	23112	genome.wustl.edu	37	22	40662525	40662525	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr22:40662525C>G	ENST00000454349.2	+	5	2502	c.2291C>G	c.(2290-2292)tCt>tGt	p.S764C	TNRC6B_ENST00000301923.9_Intron|TNRC6B_ENST00000402203.1_Intron|TNRC6B_ENST00000335727.9_Missense_Mutation_p.S764C	NM_001162501.1	NP_001155973.1	Q9UPQ9	TNR6B_HUMAN	trinucleotide repeat containing 6B	764	Interaction with argonaute proteins.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)	1						TGGGAAAGTTCTGCAAGTAAA	0.527																																						dbGAP											0													59.0	64.0	62.0					22																	40662525		1903	4124	6027	-	-	-	SO:0001583	missense	0			AB029016	CCDS46712.1, CCDS46713.1, CCDS54533.1	22q13	2006-08-22			ENSG00000100354	ENSG00000100354		"""Trinucleotide (CAG) repeat containing"""	29190	protein-coding gene	gene with protein product		610740					Standard	NM_015088		Approved	KIAA1093	uc011aor.2	Q9UPQ9	OTTHUMG00000151114	ENST00000454349.2:c.2291C>G	22.37:g.40662525C>G	ENSP00000401946:p.Ser764Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY73|B0QY78|B4DGC0|Q5TH52|Q8TBX2	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,superfamily_UBA-like	p.S764C	ENST00000454349.2	37	c.2291	CCDS54533.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	13.16|13.16	2.155501|2.155501	0.38021|0.38021	.|.	.|.	ENSG00000100354|ENSG00000100354	ENST00000446273|ENST00000454349;ENST00000400140;ENST00000335727	.|T;T	.|0.12774	.|2.65;2.65	5.45|5.45	5.45|5.45	0.79879|0.79879	.|.	.|0.704471	.|0.14894	.|N	.|0.292198	T|T	0.18800|0.18800	0.0451|0.0451	L|L	0.29908|0.29908	0.895|0.895	0.34632|0.34632	D|D	0.719715|0.719715	.|P;B;B	.|0.43169	.|0.8;0.07;0.32	.|P;B;B	.|0.45946	.|0.498;0.112;0.326	T|T	0.12863|0.12863	-1.0531|-1.0531	5|10	.|0.59425	.|D	.|0.04	0.9094|0.9094	19.2879|19.2879	0.94085|0.94085	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|764;764;764	.|Q9UPQ9;A8MYY3;Q9UPQ9-1	.|TNR6B_HUMAN;.;.	V|C	507|764	.|ENSP00000401946:S764C;ENSP00000338371:S764C	.|ENSP00000338371:S764C	L|S	+|+	1|2	2|0	TNRC6B|TNRC6B	38992471|38992471	0.692000|0.692000	0.27719|0.27719	0.983000|0.983000	0.44433|0.44433	0.807000|0.807000	0.45602|0.45602	3.049000|3.049000	0.49869|0.49869	2.571000|2.571000	0.86741|0.86741	0.556000|0.556000	0.70494|0.70494	CTG|TCT	TNRC6B	-	NULL	ENSG00000100354		0.527	TNRC6B-202	KNOWN	basic|CCDS	protein_coding	TNRC6B	HGNC	protein_coding		76	0.00	0	C			40662525	40662525	+1	no_errors	ENST00000454349	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	0.996	G
TOR1AIP1	26092	genome.wustl.edu	37	1	179887000	179887000	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:179887000G>C	ENST00000606911.2	+	10	1569	c.1378G>C	c.(1378-1380)Gag>Cag	p.E460Q	TOR1AIP1_ENST00000435319.4_Missense_Mutation_p.E339Q|TOR1AIP1_ENST00000528443.2_Missense_Mutation_p.E461Q|TOR1AIP1_ENST00000271583.3_Missense_Mutation_p.E476Q			Q5JTV8	TOIP1_HUMAN	torsin A interacting protein 1	460	Interaction with TOR1A.				positive regulation of ATPase activity (GO:0032781)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|cytoskeletal protein binding (GO:0008092)			breast(4)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	18						TGTCAAACTAGAGGTAGACCA	0.443																																						dbGAP											0													84.0	81.0	82.0					1																	179887000		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1335.1, CCDS65737.1	1q24.2	2008-02-05			ENSG00000143337	ENSG00000143337			29456	protein-coding gene	gene with protein product	"""lamina associated polypeptide 1B"""	614512				12061773, 15767459	Standard	NM_015602		Approved	LAP1B, FLJ13142	uc001gnp.2	Q5JTV8	OTTHUMG00000035257	ENST00000606911.2:c.1378G>C	1.37:g.179887000G>C	ENSP00000476687:p.Glu460Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K630|B0QZ57|Q5JTV6|Q8IZ65|Q9H8Y6|Q9HAJ1|Q9NV52|Q9Y3X5	Missense_Mutation	SNP	pfam_Lamina-ass_polypeptide_CLAP1C	p.E460Q	ENST00000606911.2	37	c.1378	CCDS1335.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.01|15.01	2.707466|2.707466	0.48412|0.48412	.|.	.|.	ENSG00000143337|ENSG00000143337	ENST00000271583;ENST00000435319|ENST00000447964	T;T|.	0.25749|.	1.78;1.78|.	5.96|5.96	5.03|5.03	0.67393|0.67393	.|.	0.163795|.	0.53938|.	N|.	0.000048|.	T|.	0.63070|.	0.2480|.	L|L	0.60455|0.60455	1.87|1.87	0.39112|0.39112	D|D	0.961484|0.961484	D|.	0.54397|.	0.966|.	P|.	0.54060|.	0.741|.	T|.	0.64343|.	-0.6430|.	9|.	.|.	.|.	.|.	-7.8537|-7.8537	10.938|10.938	0.47257|0.47257	0.0703:0.1319:0.7978:0.0|0.0703:0.1319:0.7978:0.0	.|.	460|.	Q5JTV8|.	TOIP1_HUMAN|.	Q|Y	476;460|194	ENSP00000271583:E476Q;ENSP00000393292:E460Q|.	.|.	E|X	+|+	1|3	0|2	TOR1AIP1|TOR1AIP1	178153623|178153623	1.000000|1.000000	0.71417|0.71417	0.067000|0.067000	0.19924|0.19924	0.994000|0.994000	0.84299|0.84299	4.504000|4.504000	0.60414|0.60414	1.472000|1.472000	0.48140|0.48140	0.655000|0.655000	0.94253|0.94253	GAG|TAG	TOR1AIP1	-	pfam_Lamina-ass_polypeptide_CLAP1C	ENSG00000143337		0.443	TOR1AIP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOR1AIP1	HGNC	protein_coding	OTTHUMT00000100313.4	60	0.00	0	G	NM_015602		179887000	179887000	+1	no_errors	ENST00000435319	ensembl	human	known	69_37n	missense	76	21.65	21	SNP	0.824	C
TPP2	7174	genome.wustl.edu	37	13	103299562	103299562	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr13:103299562G>A	ENST00000376065.4	+	21	2532	c.2496G>A	c.(2494-2496)aaG>aaA	p.K832K	TPP2_ENST00000376052.3_Silent_p.K832K	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	832					antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AATAGCCCAAGAGTGGGGAAG	0.313																																						dbGAP											0													58.0	59.0	59.0					13																	103299562		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.2496G>A	13.37:g.103299562G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZU8	Silent	SNP	pfam_Peptidase_S8/S53,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.K832	ENST00000376065.4	37	c.2496	CCDS9502.1	13																																																																																			TPP2	-	pfam_Peptidase_S8A_TPPII	ENSG00000134900		0.313	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	111	0.00	0	G			103299562	103299562	+1	no_errors	ENST00000376065	ensembl	human	known	69_37n	silent	49	30.00	21	SNP	1.000	A
TPR	7175	genome.wustl.edu	37	1	186303607	186303607	+	Missense_Mutation	SNP	G	G	C	rs200748289		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:186303607G>C	ENST00000367478.4	-	36	5328	c.5032C>G	c.(5032-5034)Cca>Gca	p.P1678A		NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	1678					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		ACTTTACTTGGAGTAGACACA	0.433			T	NTRK1	papillary thyroid																																	dbGAP		Dom	yes		1	1q25	7175	translocated promoter region		E	0													157.0	161.0	160.0					1																	186303607		1959	4143	6102	-	-	-	SO:0001583	missense	0			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.5032C>G	1.37:g.186303607G>C	ENSP00000356448:p.Pro1678Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.P1678A	ENST00000367478.4	37	c.5032	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	G	18.79	3.698593	0.68386	.	.	ENSG00000047410	ENST00000367478	T	0.25749	1.78	5.29	5.29	0.74685	.	0.164448	0.53938	D	0.000045	T	0.29716	0.0742	L	0.58669	1.825	0.53005	D	0.999969	B	0.27765	0.188	B	0.29267	0.1	T	0.03534	-1.1027	10	0.31617	T	0.26	.	17.4726	0.87650	0.0:0.0:1.0:0.0	.	1678	P12270	TPR_HUMAN	A	1678	ENSP00000356448:P1678A	ENSP00000356448:P1678A	P	-	1	0	TPR	184570230	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.930000	0.70104	2.625000	0.88918	0.467000	0.42956	CCA	TPR	-	NULL	ENSG00000047410		0.433	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	156	0.00	0	G	NM_003292		186303607	186303607	-1	no_errors	ENST00000367478	ensembl	human	known	69_37n	missense	260	17.41	55	SNP	1.000	C
TRIM22	10346	genome.wustl.edu	37	11	5718549	5718549	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:5718549C>T	ENST00000379965.3	+	3	772	c.495C>T	c.(493-495)atC>atT	p.I165I	TRIM5_ENST00000380027.1_Intron	NM_001199573.1|NM_006074.4	NP_001186502.1|NP_006065.2	Q8IYM9	TRI22_HUMAN	tripartite motif containing 22	165					defense response to virus (GO:0051607)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein trimerization (GO:0070206)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			kidney(3)|large_intestine(8)|lung(9)|prostate(1)|stomach(2)	23		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)		Epithelial(150;7.54e-09)|BRCA - Breast invasive adenocarcinoma(625;0.14)		AAGATGACATCAGACAAGAGA	0.493																																					GBM(104;491 2336 5222)	dbGAP											0													47.0	53.0	51.0					11																	5718549		1918	4160	6078	-	-	-	SO:0001819	synonymous_variant	0			X82200	CCDS41612.1	11p15	2013-01-09	2011-01-25		ENSG00000132274	ENSG00000132274		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16379	protein-coding gene	gene with protein product		606559	"""tripartite motif-containing 22"""			11331580, 11096452	Standard	NM_006074		Approved	STAF50, GPSTAF50, RNF94	uc001mbr.3	Q8IYM9	OTTHUMG00000066904	ENST00000379965.3:c.495C>T	11.37:g.5718549C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05CQ0|Q15521	Nonsense_Mutation	SNP	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	p.Q76*	ENST00000379965.3	37	c.226	CCDS41612.1	11																																																																																			TRIM22	-	NULL	ENSG00000132274		0.493	TRIM22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM22	HGNC	protein_coding	OTTHUMT00000143387.2	41	0.00	0	C	NM_006074		5718549	5718549	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000414897	ensembl	human	known	69_37n	nonsense	38	17.39	8	SNP	0.000	T
TRMT1L	81627	genome.wustl.edu	37	1	185120963	185120963	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:185120963C>G	ENST00000367506.5	-	2	608	c.340G>C	c.(340-342)Gat>Cat	p.D114H	TRMT1L_ENST00000367504.3_5'UTR	NM_001202423.1|NM_030934.4	NP_001189352.1|NP_112196.3	Q7Z2T5	TRM1L_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)-like	114					adult locomotory behavior (GO:0008344)		metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	21						ATACCTGCATCAAGATTATCT	0.318																																						dbGAP											0													69.0	68.0	68.0					1																	185120963		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288399	CCDS1366.1	1q25.2	2012-06-29	2012-06-29	2011-01-24	ENSG00000121486	ENSG00000121486			16782	protein-coding gene	gene with protein product	"""TRM1-like"""	611673	"""chromosome 1 open reading frame 25"", ""TRM1 tRNA methyltransferase 1-like"""	C1orf25		11318611, 17198746	Standard	NM_030934		Approved		uc001grf.4	Q7Z2T5	OTTHUMG00000035389	ENST00000367506.5:c.340G>C	1.37:g.185120963C>G	ENSP00000356476:p.Asp114His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TEN0|Q6ZMX0|Q8IWH5|Q8NC68|Q9BZQ1	Missense_Mutation	SNP	pfam_tRNA_MeTrfase_TRM1,pfam_tRNA_Trfase_Trm5/Tyw2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D114H	ENST00000367506.5	37	c.340	CCDS1366.1	1	.	.	.	.	.	.	.	.	.	.	C	13.47	2.246034	0.39697	.	.	ENSG00000121486	ENST00000367506	.	.	.	5.2	3.33	0.38152	.	0.624617	0.18089	N	0.152058	T	0.33527	0.0866	N	0.22421	0.69	0.34668	D	0.723367	B	0.33379	0.41	B	0.35510	0.204	T	0.45338	-0.9268	9	0.59425	D	0.04	-7.2621	8.5776	0.33607	0.0:0.7515:0.0:0.2485	.	114	Q7Z2T5	TRM1L_HUMAN	H	114	.	ENSP00000356476:D114H	D	-	1	0	TRMT1L	183387586	0.996000	0.38824	0.979000	0.43373	0.995000	0.86356	0.977000	0.29475	0.700000	0.31782	0.585000	0.79938	GAT	TRMT1L	-	NULL	ENSG00000121486		0.318	TRMT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT1L	HGNC	protein_coding	OTTHUMT00000085787.1	101	0.00	0	C	NM_030934		185120963	185120963	-1	no_errors	ENST00000367506	ensembl	human	known	69_37n	missense	77	34.75	41	SNP	0.533	G
TRPM6	140803	genome.wustl.edu	37	9	77377646	77377646	+	Missense_Mutation	SNP	C	C	T	rs137885154		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:77377646C>T	ENST00000360774.1	-	26	4178	c.3941G>A	c.(3940-3942)aGa>aAa	p.R1314K	TRPM6_ENST00000361255.3_Missense_Mutation_p.R1309K|TRPM6_ENST00000449912.2_Missense_Mutation_p.R1309K|TRPM6_ENST00000451710.3_Missense_Mutation_p.R1314K|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000376864.4_Missense_Mutation_p.R1314K|TRPM6_ENST00000376872.3_Intron	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1314					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						CTGGTCATTTCTTACATTTGT	0.488																																						dbGAP											0													177.0	186.0	183.0					9																	77377646		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.3941G>A	9.37:g.77377646C>T	ENSP00000354006:p.Arg1314Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.R1314K	ENST00000360774.1	37	c.3941	CCDS6647.1	9	.	.	.	.	.	.	.	.	.	.	C	12.04	1.819259	0.32145	.	.	ENSG00000119121	ENST00000360774;ENST00000451710;ENST00000449912;ENST00000361255;ENST00000376864;ENST00000312449;ENST00000448641	T;T;T;T;T	0.53206	0.72;0.72;0.73;0.72;0.63	5.07	1.98	0.26296	.	1.008410	0.07941	N	0.979227	T	0.30978	0.0782	L	0.32530	0.975	0.09310	N	1	B;B;B	0.09022	0.0;0.002;0.002	B;B;B	0.08055	0.001;0.003;0.003	T	0.25745	-1.0123	10	0.16420	T	0.52	.	2.8613	0.05588	0.1962:0.3999:0.0:0.4039	.	1314;1309;1309	Q9BX84;Q9BX84-3;Q9BX84-2	TRPM6_HUMAN;.;.	K	1314;1314;1309;1309;1314;977;977	ENSP00000354006:R1314K;ENSP00000407341:R1314K;ENSP00000396672:R1309K;ENSP00000354962:R1309K;ENSP00000366060:R1314K	ENSP00000309693:R977K	R	-	2	0	TRPM6	76567466	0.000000	0.05858	0.003000	0.11579	0.019000	0.09904	0.075000	0.14686	0.800000	0.34041	0.655000	0.94253	AGA	TRPM6	-	NULL	ENSG00000119121		0.488	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	116	0.00	0	C	NM_017662		77377646	77377646	-1	no_errors	ENST00000451710	ensembl	human	known	69_37n	missense	91	27.78	35	SNP	0.004	T
TSPAN15	23555	genome.wustl.edu	37	10	71255361	71255361	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:71255361C>A	ENST00000373290.2	+	4	491	c.369C>A	c.(367-369)ttC>ttA	p.F123L	TSPAN15_ENST00000459981.1_3'UTR	NM_012339.3	NP_036471.1	O95858	TSN15_HUMAN	tetraspanin 15	123					establishment of protein localization to plasma membrane (GO:0090002)|protein maturation (GO:0051604)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(1)	9						CCATTGACTTCCTGAACGACA	0.428																																						dbGAP											0													118.0	109.0	112.0					10																	71255361		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358934	CCDS7294.1	10q22.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000099282	ENSG00000099282		"""Tetraspanins"""	23298	protein-coding gene	gene with protein product		613140	"""transmembrane 4 superfamily member 15"""	TM4SF15		11739647, 10719184	Standard	NM_012339		Approved	NET-7	uc001jpo.1	O95858	OTTHUMG00000018381	ENST00000373290.2:c.369C>A	10.37:g.71255361C>A	ENSP00000362387:p.Phe123Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW79	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.F123L	ENST00000373290.2	37	c.369	CCDS7294.1	10	.	.	.	.	.	.	.	.	.	.	C	2.745	-0.261255	0.05791	.	.	ENSG00000099282	ENST00000373290;ENST00000452130	T;T	0.78481	-1.18;-1.18	5.55	-0.855	0.10700	Tetraspanin, EC2 domain (1);	0.468884	0.24917	N	0.034569	T	0.48978	0.1530	N	0.04203	-0.255	0.41639	D	0.98906	B	0.02656	0.0	B	0.06405	0.002	T	0.27839	-1.0062	10	0.09338	T	0.73	-10.4982	10.0289	0.42087	0.0:0.3613:0.0:0.6387	.	123	O95858	TSN15_HUMAN	L	123;32	ENSP00000362387:F123L;ENSP00000404528:F32L	ENSP00000362387:F123L	F	+	3	2	TSPAN15	70925367	0.679000	0.27596	0.969000	0.41365	0.334000	0.28698	0.322000	0.19576	-0.127000	0.11661	-0.302000	0.09304	TTC	TSPAN15	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000099282		0.428	TSPAN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN15	HGNC	protein_coding	OTTHUMT00000048444.1	131	0.00	0	C	NM_012339		71255361	71255361	+1	no_errors	ENST00000373290	ensembl	human	known	69_37n	missense	88	35.77	49	SNP	0.985	A
TSPEAR	54084	genome.wustl.edu	37	21	45929232	45929232	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr21:45929232C>T	ENST00000323084.4	-	10	1669	c.1604G>A	c.(1603-1605)gGg>gAg	p.G535E	TSPEAR-AS1_ENST00000430181.1_RNA|TSPEAR-AS1_ENST00000451035.1_RNA|TSPEAR_ENST00000397916.1_Missense_Mutation_p.G467E	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	535					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						GATCCTCTCCCCGATCTGGAA	0.577																																						dbGAP											0													145.0	98.0	114.0					21																	45929232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1604G>A	21.37:g.45929232C>T	ENSP00000321987:p.Gly535Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EPTP,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_EAR	p.G535E	ENST00000323084.4	37	c.1604	CCDS13712.1	21	.	.	.	.	.	.	.	.	.	.	C	14.72	2.618549	0.46736	.	.	ENSG00000175894	ENST00000323084;ENST00000397918;ENST00000397916;ENST00000341581	D;D	0.82526	-1.62;-1.62	3.83	3.83	0.44106	.	0.258740	0.39615	N	0.001311	T	0.76681	0.4021	L	0.47716	1.5	0.31543	N	0.659675	P	0.35192	0.489	B	0.37731	0.257	T	0.78265	-0.2271	10	0.44086	T	0.13	-26.9647	8.1797	0.31302	0.0:0.8135:0.0:0.1865	.	535	Q8WU66	TSEAR_HUMAN	E	535;388;467;536	ENSP00000321987:G535E;ENSP00000381012:G467E	ENSP00000321987:G535E	G	-	2	0	TSPEAR	44753660	0.352000	0.24895	0.884000	0.34674	0.918000	0.54935	2.044000	0.41241	2.086000	0.62901	0.558000	0.71614	GGG	TSPEAR	-	pfam_EPTP,pfscan_EAR	ENSG00000175894		0.577	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	44	0.00	0	C	NM_144991		45929232	45929232	-1	no_errors	ENST00000323084	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	0.751	T
TTN	7273	genome.wustl.edu	37	2	179426201	179426201	+	Missense_Mutation	SNP	C	C	T	rs538385596		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:179426201C>T	ENST00000591111.1	-	276	79959	c.79735G>A	c.(79735-79737)Gat>Aat	p.D26579N	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.D19347N|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D25652N|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.D19280N|TTN_ENST00000460472.2_Missense_Mutation_p.D19155N|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.D28220N|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26579	Fibronectin type-III 93. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTCCTTCATCAAGGCCGGAG	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		25089	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													116.0	107.0	110.0					2																	179426201		1881	4122	6003	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.79735G>A	2.37:g.179426201C>T	ENSP00000465570:p.Asp26579Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D25652N	ENST00000591111.1	37	c.76954		2	.	.	.	.	.	.	.	.	.	.	C	14.71	2.617470	0.46736	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.56611	0.45;0.45;0.45;0.45	6.01	5.13	0.70059	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.51109	0.1655	N	0.13272	0.32	0.43088	D	0.994757	P;P;P;P	0.43231	0.801;0.801;0.801;0.684	P;P;P;P	0.51550	0.673;0.673;0.673;0.583	T	0.60265	-0.7297	9	0.87932	D	0	.	17.524	0.87794	0.0:0.8764:0.1236:0.0	.	19155;19280;19347;26579	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	25652;19155;19347;19280;19153	ENSP00000343764:D25652N;ENSP00000434586:D19155N;ENSP00000340554:D19347N;ENSP00000352154:D19280N	ENSP00000340554:D19347N	D	-	1	0	TTN	179134447	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	6.093000	0.71422	1.527000	0.49086	0.585000	0.79938	GAT	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.378	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	93	0.00	0	C	NM_133378		179426201	179426201	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179427679	179427679	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:179427679G>C	ENST00000591111.1	-	276	78481	c.78257C>G	c.(78256-78258)tCa>tGa	p.S26086*	TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.S18854*|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.S25159*|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.S18787*|TTN_ENST00000460472.2_Nonsense_Mutation_p.S18662*|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Nonsense_Mutation_p.S27727*|TTN-AS1_ENST00000590932.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26086	Ig-like 126.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATTGTAAATGAGCTGGTCAC	0.408																																						dbGAP											0													79.0	80.0	79.0					2																	179427679		1935	4128	6063	-	-	-	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.78257C>G	2.37:g.179427679G>C	ENSP00000465570:p.Ser26086*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.S25159*	ENST00000591111.1	37	c.75476		2	.	.	.	.	.	.	.	.	.	.	G	65	86.226619	0.99995	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	6.04	6.04	0.98038	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	20.5792	0.99380	0.0:0.0:1.0:0.0	.	.	.	.	X	25159;18662;18854;18787;18660	.	ENSP00000340554:S18854X	S	-	2	0	TTN	179135925	1.000000	0.71417	0.988000	0.46212	0.990000	0.78478	9.869000	0.99810	2.873000	0.98535	0.561000	0.74099	TCA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	56	0.00	0	G	NM_133378		179427679	179427679	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	nonsense	34	38.18	21	SNP	1.000	C
TUBA4A	7277	genome.wustl.edu	37	2	220115948	220115948	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:220115948G>C	ENST00000248437.4	-	4	646	c.473C>G	c.(472-474)tCt>tGt	p.S158C	TUBA4A_ENST00000498660.1_5'UTR|TUBA4B_ENST00000490341.1_RNA|TUBA4A_ENST00000392088.2_Missense_Mutation_p.S143C	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a	158					'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	ATAGTCAACAGAGAGCCGCTC	0.572																																						dbGAP											0													52.0	59.0	57.0					2																	220115948		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.473C>G	2.37:g.220115948G>C	ENSP00000248437:p.Ser158Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB1|B3KNQ6|P05215	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.S158C	ENST00000248437.4	37	c.473	CCDS2438.1	2	.	.	.	.	.	.	.	.	.	.	G	16.06	3.015706	0.54468	.	.	ENSG00000127824	ENST00000248437;ENST00000392088;ENST00000398989;ENST00000427737;ENST00000456818;ENST00000447205	T;T;T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58;-0.58;-0.58	5.28	5.28	0.74379	Tubulin/FtsZ, GTPase domain (4);	0.000000	0.85682	D	0.000000	D	0.89389	0.6701	H	0.95470	3.675	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92091	0.5680	10	0.87932	D	0	.	19.0957	0.93249	0.0:0.0:1.0:0.0	.	158	P68366	TBA4A_HUMAN	C	158;143;5;143;181;143	ENSP00000248437:S158C;ENSP00000375938:S143C;ENSP00000396212:S5C;ENSP00000408194:S143C;ENSP00000416992:S181C;ENSP00000396061:S143C	ENSP00000248437:S158C	S	-	2	0	TUBA4A	219824192	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	9.541000	0.98083	2.755000	0.94549	0.655000	0.94253	TCT	TUBA4A	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Tubulin	ENSG00000127824		0.572	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4A	HGNC	protein_coding	OTTHUMT00000256816.3	50	0.00	0	G	NM_006000		220115948	220115948	-1	no_errors	ENST00000248437	ensembl	human	known	69_37n	missense	27	38.64	17	SNP	1.000	C
TUBGCP2	10844	genome.wustl.edu	37	10	135106636	135106636	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr10:135106636C>G	ENST00000252936.3	-	6	970	c.931G>C	c.(931-933)Gag>Cag	p.E311Q	TUBGCP2_ENST00000368562.1_5'Flank|TUBGCP2_ENST00000417178.2_Missense_Mutation_p.E181Q|RP11-122K13.12_ENST00000424450.1_RNA|TUBGCP2_ENST00000543663.1_Missense_Mutation_p.E339Q|TUBGCP2_ENST00000368563.2_Missense_Mutation_p.E311Q			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2	311					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		TGCAGCTGCTCCAGCTGTGAC	0.622																																						dbGAP											0													65.0	59.0	61.0					10																	135106636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.931G>C	10.37:g.135106636C>G	ENSP00000252936:p.Glu311Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Missense_Mutation	SNP	pfam_Spc97_Spc98,superfamily_Ocr	p.E339Q	ENST00000252936.3	37	c.1015	CCDS7676.1	10	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787329	0.90367	.	.	ENSG00000130640	ENST00000252936;ENST00000417178;ENST00000368563;ENST00000543663	T;T;T;T	0.12774	2.65;2.65;2.65;2.65	4.78	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.35422	0.0931	M	0.64170	1.965	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.80764	0.976;0.994;0.98	T	0.06679	-1.0813	10	0.59425	D	0.04	-39.2426	16.8013	0.85615	0.0:1.0:0.0:0.0	.	339;339;311	F5H4L0;B7ZKL8;Q9BSJ2	.;.;GCP2_HUMAN	Q	311;181;311;339	ENSP00000252936:E311Q;ENSP00000395666:E181Q;ENSP00000357551:E311Q;ENSP00000446093:E339Q	ENSP00000252936:E311Q	E	-	1	0	TUBGCP2	134956626	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	7.509000	0.81698	2.375000	0.81037	0.561000	0.74099	GAG	TUBGCP2	-	pfam_Spc97_Spc98	ENSG00000130640		0.622	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	33	0.00	0	C			135106636	135106636	-1	no_errors	ENST00000543663	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	G
TXK	7294	genome.wustl.edu	37	4	48076019	48076019	+	Missense_Mutation	SNP	G	G	C	rs576457369		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr4:48076019G>C	ENST00000264316.4	-	13	1375	c.1290C>G	c.(1288-1290)atC>atG	p.I430M	TXK_ENST00000507351.1_Missense_Mutation_p.I85M	NM_003328.2	NP_003319.2	P42681	TXK_HUMAN	TXK tyrosine kinase	430	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cytokine production (GO:0001816)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|RNA polymerase II regulatory region DNA binding (GO:0001012)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(2)	25						GGGACCACTTGATTGGGAACT	0.398																																						dbGAP											0													97.0	95.0	96.0					4																	48076019		2203	4300	6503	-	-	-	SO:0001583	missense	0			L27071	CCDS3480.1	4p12	2013-02-14	2003-04-01		ENSG00000074966	ENSG00000074966	2.7.10.1	"""SH2 domain containing"""	12434	protein-coding gene	gene with protein product		600058	"""PTK4 protein tyrosine kinase 4"""	PTK4		7951233, 7528718	Standard	NM_003328		Approved	TKL, PSCTK5, BTKL, RLK	uc003gxx.4	P42681	OTTHUMG00000102065	ENST00000264316.4:c.1290C>G	4.37:g.48076019G>C	ENSP00000264316:p.Ile430Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14220	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.I430M	ENST00000264316.4	37	c.1290	CCDS3480.1	4	.	.	.	.	.	.	.	.	.	.	G	16.59	3.166685	0.57476	.	.	ENSG00000074966	ENST00000264316;ENST00000507351	D;D	0.84370	-1.84;-1.84	5.65	4.79	0.61399	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.662360	0.14379	N	0.323247	D	0.89269	0.6667	M	0.64260	1.97	0.29907	N	0.82386	P;P	0.36222	0.544;0.544	P;P	0.50896	0.653;0.653	D	0.86491	0.1797	10	0.87932	D	0	.	14.1607	0.65446	0.0724:0.0:0.9276:0.0	.	117;430	B4DTB5;P42681	.;TXK_HUMAN	M	430;85	ENSP00000264316:I430M;ENSP00000423481:I85M	ENSP00000264316:I430M	I	-	3	3	TXK	47770776	1.000000	0.71417	0.998000	0.56505	0.699000	0.40488	1.127000	0.31357	2.941000	0.99782	0.655000	0.94253	ATC	TXK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000074966		0.398	TXK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXK	HGNC	protein_coding	OTTHUMT00000219869.7	62	0.00	0	G	NM_003328		48076019	48076019	-1	no_errors	ENST00000264316	ensembl	human	known	69_37n	missense	45	33.82	23	SNP	1.000	C
UBE3B	89910	genome.wustl.edu	37	12	109958979	109958979	+	Silent	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:109958979C>G	ENST00000342494.3	+	20	2698	c.2103C>G	c.(2101-2103)ctC>ctG	p.L701L	UBE3B_ENST00000434735.2_Silent_p.L701L	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	701					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						TTAGGCAGCTCTCCCAGCACG	0.532																																						dbGAP											0													102.0	90.0	94.0					12																	109958979		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.2103C>G	12.37:g.109958979C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Silent	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.L701	ENST00000342494.3	37	c.2103	CCDS9129.1	12																																																																																			UBE3B	-	superfamily_HECT,smart_HECT	ENSG00000151148		0.532	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	56	0.00	0	C	NM_183415		109958979	109958979	+1	no_errors	ENST00000342494	ensembl	human	known	69_37n	silent	30	41.18	21	SNP	0.860	G
UBR1	197131	genome.wustl.edu	37	15	43281144	43281144	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:43281144G>C	ENST00000290650.4	-	35	3948	c.3870C>G	c.(3868-3870)atC>atG	p.I1290M	UBR1_ENST00000382177.2_3'UTR	NM_174916.2	NP_777576.1	Q8IWV7	UBR1_HUMAN	ubiquitin protein ligase E3 component n-recognin 1	1290					cellular response to leucine (GO:0071233)|negative regulation of TOR signaling (GO:0032007)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|proteasome complex (GO:0000502)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(7)|large_intestine(12)|lung(25)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	58		all_cancers(109;4.32e-15)|all_epithelial(112;4.05e-13)|Lung NSC(122;1.75e-08)|all_lung(180;2e-07)|Melanoma(134;0.0179)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.08e-07)|COAD - Colon adenocarcinoma(120;0.185)|Colorectal(105;0.214)		CCATTTCCTTGATGCTATTTG	0.353																																						dbGAP											0													59.0	57.0	57.0					15																	43281144		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS10091.1	15q13	2008-06-23			ENSG00000159459	ENSG00000159459		"""Ubiquitin protein ligase E3 component n-recognins"""	16808	protein-coding gene	gene with protein product		605981				9653112	Standard	NM_174916		Approved		uc001zqq.3	Q8IWV7	OTTHUMG00000130702	ENST00000290650.4:c.3870C>G	15.37:g.43281144G>C	ENSP00000290650:p.Ile1290Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O60708|O75492|Q14D45|Q68DN9|Q8IWY6|Q96JY4	Missense_Mutation	SNP	pfam_ClpS_core,pfam_Znf_N-recognin,superfamily_Ribosomal_L7/12_C/ClpS-like,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.I1290M	ENST00000290650.4	37	c.3870	CCDS10091.1	15	.	.	.	.	.	.	.	.	.	.	G	14.63	2.591398	0.46214	.	.	ENSG00000159459	ENST00000290650	T	0.47177	0.85	4.7	1.68	0.24146	.	0.111999	0.56097	D	0.000022	T	0.52108	0.1714	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	P	0.59171	0.853	T	0.48681	-0.9014	10	0.27785	T	0.31	-24.1631	5.8369	0.18613	0.1542:0.0:0.5823:0.2635	.	1290	Q8IWV7	UBR1_HUMAN	M	1290	ENSP00000290650:I1290M	ENSP00000290650:I1290M	I	-	3	3	UBR1	41068436	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.796000	0.26986	1.196000	0.43129	0.591000	0.81541	ATC	UBR1	-	NULL	ENSG00000159459		0.353	UBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR1	HGNC	protein_coding	OTTHUMT00000253202.1	64	0.00	0	G	NM_174916		43281144	43281144	-1	no_errors	ENST00000290650	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	0.999	C
ULK4	54986	genome.wustl.edu	37	3	41938469	41938469	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr3:41938469G>C	ENST00000301831.4	-	15	1837	c.1375C>G	c.(1375-1377)Caa>Gaa	p.Q459E	U8_ENST00000390843.2_RNA|ULK4_ENST00000420927.1_Missense_Mutation_p.Q459E	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	459					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TTCCAATCTTGATCTTTCAGA	0.383																																						dbGAP											0													70.0	70.0	70.0					3																	41938469		1873	4105	5978	-	-	-	SO:0001583	missense	0			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1375C>G	3.37:g.41938469G>C	ENSP00000301831:p.Gln459Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q459E	ENST00000301831.4	37	c.1375	CCDS43071.1	3	.	.	.	.	.	.	.	.	.	.	G	2.375	-0.343431	0.05243	.	.	ENSG00000168038	ENST00000301831;ENST00000420927	T;T	0.64803	0.82;-0.12	4.68	3.76	0.43208	Armadillo-like helical (1);	0.295213	0.37348	N	0.002132	T	0.43077	0.1231	L	0.28115	0.83	0.80722	D	1	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.33394	-0.9870	10	0.02654	T	1	.	13.157	0.59522	0.0:0.2884:0.7116:0.0	.	459;459	B4E2M4;Q96C45	.;ULK4_HUMAN	E	459	ENSP00000301831:Q459E;ENSP00000412187:Q459E	ENSP00000301831:Q459E	Q	-	1	0	ULK4	41913473	0.986000	0.35501	1.000000	0.80357	0.975000	0.68041	0.977000	0.29475	2.150000	0.67090	0.585000	0.79938	CAA	ULK4	-	NULL	ENSG00000168038		0.383	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	18	0.00	0	G	XM_929989		41938469	41938469	-1	no_errors	ENST00000301831	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	1.000	C
UNC5D	137970	genome.wustl.edu	37	8	35606082	35606082	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:35606082G>A	ENST00000404895.2	+	12	2132	c.1804G>A	c.(1804-1806)Gaa>Aaa	p.E602K	UNC5D_ENST00000416672.1_Missense_Mutation_p.E607K|UNC5D_ENST00000420357.1_Missense_Mutation_p.E535K|UNC5D_ENST00000453357.2_Missense_Mutation_p.E597K|UNC5D_ENST00000287272.2_Missense_Mutation_p.E533K|UNC5D_ENST00000449677.1_Missense_Mutation_p.E178K	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	602	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		CCTGAGTCCTGAAGTCACCTG	0.483																																						dbGAP											0													165.0	138.0	147.0					8																	35606082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.1804G>A	8.37:g.35606082G>A	ENSP00000385143:p.Glu602Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death,pfam_Immunoglobulin,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.E602K	ENST00000404895.2	37	c.1804	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	G	36	5.786802	0.96937	.	.	ENSG00000156687	ENST00000404895;ENST00000420357;ENST00000287272;ENST00000416672;ENST00000453357;ENST00000449677	T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98	6.07	6.07	0.98685	ZU5 (2);	0.085303	0.85682	D	0.000000	T	0.57873	0.2083	L	0.51422	1.61	0.80722	D	1	D;P;D	0.61697	0.99;0.902;0.961	P;P;P	0.57846	0.828;0.52;0.721	T	0.54944	-0.8217	10	0.62326	D	0.03	-22.8037	20.6593	0.99626	0.0:0.0:1.0:0.0	.	178;597;602	E9PDS8;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	K	602;535;533;607;597;178	ENSP00000385143:E602K;ENSP00000392739:E535K;ENSP00000287272:E533K;ENSP00000412652:E607K;ENSP00000394303:E597K;ENSP00000397211:E178K	ENSP00000287272:E533K	E	+	1	0	UNC5D	35725624	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.286000	0.95898	2.885000	0.99019	0.655000	0.94253	GAA	UNC5D	-	pfam_ZU5,smart_ZU5,pfscan_ZU5	ENSG00000156687		0.483	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	65	0.00	0	G			35606082	35606082	+1	no_errors	ENST00000404895	ensembl	human	known	69_37n	missense	51	25.00	17	SNP	1.000	A
USH1C	10083	genome.wustl.edu	37	11	17522697	17522697	+	Splice_Site	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:17522697C>G	ENST00000318024.4	-	18	1489	c.1381G>C	c.(1381-1383)Gag>Cag	p.E461Q	USH1C_ENST00000005226.7_Splice_Site_p.E761Q|USH1C_ENST00000527720.1_Splice_Site_p.E430Q|USH1C_ENST00000527020.1_Splice_Site_p.E442Q|USH1C_ENST00000529563.1_5'UTR	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	461	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						AAGGATCCCTCCTGGTTAGAG	0.587																																						dbGAP											0													52.0	44.0	47.0					11																	17522697		2200	4293	6493	-	-	-	SO:0001630	splice_region_variant	0			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1381-1G>C	11.37:g.17522697C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E761Q	ENST00000318024.4	37	c.2281	CCDS31438.1	11	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351497	0.82132	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	T;T;T;T	0.26223	1.75;1.75;1.75;1.75	5.27	5.27	0.74061	PDZ/DHR/GLGF (3);	0.226314	0.37623	N	0.002009	T	0.49915	0.1585	M	0.62723	1.935	0.38524	D	0.948807	P;P;D	0.63046	0.492;0.548;0.992	B;P;D	0.79784	0.291;0.519;0.993	T	0.51004	-0.8760	10	0.59425	D	0.04	.	17.8381	0.88706	0.0:1.0:0.0:0.0	.	442;461;761	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	Q	461;430;442;761	ENSP00000317018:E461Q;ENSP00000432944:E430Q;ENSP00000436934:E442Q;ENSP00000005226:E761Q	ENSP00000005226:E761Q	E	-	1	0	USH1C	17479273	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.190000	0.72057	2.741000	0.93983	0.650000	0.86243	GAG	USH1C	-	pfam_PDZ,superfamily_PDZ,pfscan_PDZ	ENSG00000006611		0.587	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	HGNC	protein_coding	OTTHUMT00000389146.1	32	0.00	0	C	NM_005709	Missense_Mutation	17522697	17522697	-1	no_errors	ENST00000005226	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	1.000	G
USP34	9736	genome.wustl.edu	37	2	61622053	61622053	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr2:61622053C>G	ENST00000398571.2	-	5	764	c.688G>C	c.(688-690)Gaa>Caa	p.E230Q		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	230					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GTTCCATATTCAAAGCAATCC	0.338																																						dbGAP											0													97.0	87.0	90.0					2																	61622053		1848	4091	5939	-	-	-	SO:0001583	missense	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.688G>C	2.37:g.61622053C>G	ENSP00000381577:p.Glu230Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.E230Q	ENST00000398571.2	37	c.688	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	C	27.3	4.818667	0.90790	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.03663	3.85	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.10937	0.0267	L	0.38838	1.175	0.80722	D	1	D	0.57899	0.981	D	0.65140	0.932	T	0.35773	-0.9775	10	0.25751	T	0.34	.	18.7748	0.91907	0.0:1.0:0.0:0.0	.	230	Q70CQ2	UBP34_HUMAN	Q	78;78;230	ENSP00000381577:E230Q	ENSP00000263989:E78Q	E	-	1	0	USP34	61475557	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.776000	0.85560	2.520000	0.84964	0.591000	0.81541	GAA	USP34	-	NULL	ENSG00000115464		0.338	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	106	0.00	0	C			61622053	61622053	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	67	28.72	27	SNP	1.000	G
USP9X	8239	genome.wustl.edu	37	X	41056704	41056704	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:41056704C>T	ENST00000324545.8	+	29	4954	c.4321C>T	c.(4321-4323)Caa>Taa	p.Q1441*	USP9X_ENST00000378308.2_Nonsense_Mutation_p.Q1441*	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1441					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						ACTGGCCTTTCAAACTTCTGA	0.403																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													71.0	71.0	71.0					X																	41056704		2053	4195	6248	-	-	-	SO:0001587	stop_gained	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.4321C>T	X.37:g.41056704C>T	ENSP00000316357:p.Gln1441*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Nonsense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.Q1441*	ENST00000324545.8	37	c.4321	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	C	49	15.631921	0.99840	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	.	18.2067	0.89857	0.0:1.0:0.0:0.0	.	.	.	.	X	1441	.	ENSP00000316357:Q1441X	Q	+	1	0	USP9X	40941648	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.484000	0.81180	2.325000	0.78763	0.415000	0.27848	CAA	USP9X	-	NULL	ENSG00000124486		0.403	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	116	0.00	0	C	NM_004652		41056704	41056704	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	nonsense	75	20.21	19	SNP	1.000	T
VAV1	7409	genome.wustl.edu	37	19	6826674	6826674	+	Missense_Mutation	SNP	C	C	G	rs563112092		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:6826674C>G	ENST00000602142.1	+	9	961	c.879C>G	c.(877-879)caC>caG	p.H293Q	VAV1_ENST00000304076.2_Missense_Mutation_p.H293Q|VAV1_ENST00000539284.1_Missense_Mutation_p.H196Q|VAV1_ENST00000599806.1_Missense_Mutation_p.H238Q|VAV1_ENST00000596764.1_Missense_Mutation_p.H261Q	NM_005428.3	NP_005419.2	P15498	VAV_HUMAN	vav 1 guanine nucleotide exchange factor	293	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|reactive oxygen species metabolic process (GO:0072593)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(16)|lung(18)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	62						CCAGCAAACACCTGGACCGTG	0.657																																						dbGAP											0													58.0	45.0	50.0					19																	6826674		2175	4271	6446	-	-	-	SO:0001583	missense	0				CCDS12174.1, CCDS59341.1, CCDS59342.1	19p13.2	2013-02-14	2007-07-25			ENSG00000141968		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12657	protein-coding gene	gene with protein product		164875	"""vav 1 oncogene"""	VAV		9438848	Standard	NM_005428		Approved		uc010xjh.2	P15498		ENST00000602142.1:c.879C>G	19.37:g.6826674C>G	ENSP00000472929:p.His293Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVK9|M0QXX6|Q15860	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH3_domain,prints_SH2,prints_SM22_calponin	p.H293Q	ENST00000602142.1	37	c.879	CCDS12174.1	19	.	.	.	.	.	.	.	.	.	.	C	13.77	2.335437	0.41398	.	.	ENSG00000141968	ENST00000304076;ENST00000539284	T;T	0.63096	-0.02;-0.02	5.26	1.98	0.26296	Dbl homology (DH) domain (5);	0.053209	0.64402	D	0.000001	T	0.65502	0.2697	L	0.51422	1.61	0.50313	D	0.999866	D;D;D;P	0.76494	0.998;0.999;0.97;0.919	P;D;P;P	0.65233	0.853;0.933;0.684;0.645	T	0.60239	-0.7302	10	0.28530	T	0.3	.	6.4821	0.22069	0.0:0.6275:0.0:0.3725	.	196;293;238;293	F5H5P4;B2R8B5;Q96D37;P15498	.;.;.;VAV_HUMAN	Q	293;196	ENSP00000302269:H293Q;ENSP00000443242:H196Q	ENSP00000302269:H293Q	H	+	3	2	VAV1	6777674	0.027000	0.19231	1.000000	0.80357	0.642000	0.38348	0.169000	0.16641	0.607000	0.29982	-0.258000	0.10820	CAC	VAV1	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000141968		0.657	VAV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV1	HGNC	protein_coding	OTTHUMT00000458475.1	60	0.00	0	C			6826674	6826674	+1	no_errors	ENST00000304076	ensembl	human	known	69_37n	missense	32	37.25	19	SNP	1.000	G
VPS13C	54832	genome.wustl.edu	37	15	62238536	62238536	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:62238536C>T	ENST00000261517.5	-	44	5023	c.4950G>A	c.(4948-4950)atG>atA	p.M1650I	VPS13C_ENST00000395896.4_Missense_Mutation_p.M1650I|VPS13C_ENST00000395898.3_Missense_Mutation_p.M1607I|VPS13C_ENST00000249837.3_Missense_Mutation_p.M1607I	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						AATCTACATTCATAACTATAA	0.289																																						dbGAP											0													54.0	53.0	53.0					15																	62238536		2203	4294	6497	-	-	-	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.4950G>A	15.37:g.62238536C>T	ENSP00000261517:p.Met1650Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.M1650I	ENST00000261517.5	37	c.4950	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	12.52	1.961264	0.34565	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.39997	1.05;1.05;1.22	5.47	-7.65	0.01281	.	0.588346	0.17317	N	0.178659	T	0.18841	0.0452	N	0.25647	0.755	0.09310	N	0.999999	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.14200	-1.0481	10	0.19147	T	0.46	.	6.2375	0.20772	0.0851:0.0892:0.2516:0.5741	.	1607;1650;1607;1650	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	I	1607;1650;1650;1650	ENSP00000249837:M1607I;ENSP00000261517:M1650I;ENSP00000379233:M1650I	ENSP00000249837:M1607I	M	-	3	0	VPS13C	60025828	0.000000	0.05858	0.004000	0.12327	0.962000	0.63368	-1.620000	0.02046	-1.439000	0.01962	-0.355000	0.07637	ATG	VPS13C	-	NULL	ENSG00000129003		0.289	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	117	0.00	0	C	NM_017684		62238536	62238536	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	45	37.50	27	SNP	0.007	T
VPS72	6944	genome.wustl.edu	37	1	151149393	151149393	+	Silent	SNP	G	G	A	rs144417847		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:151149393G>A	ENST00000354473.4	-	6	891	c.855C>T	c.(853-855)ttC>ttT	p.F285F	TMOD4_ENST00000416280.2_5'Flank|TMOD4_ENST00000601585.1_5'Flank|VPS72_ENST00000496809.1_5'UTR			Q15906	VPS72_HUMAN	vacuolar protein sorting 72 homolog (S. cerevisiae)	274					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACCATTCCTCGAAAGTTGCAT	0.572																																					Pancreas(109;1131 2287 3209 24201)	dbGAP											0													45.0	50.0	48.0					1																	151149393		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D43642	CCDS989.1, CCDS59201.1	1q21	2008-02-05	2006-12-19	2005-09-08	ENSG00000163159	ENSG00000163159			11644	protein-coding gene	gene with protein product		600607	"""transcription factor-like 1"", ""vacuolar protein sorting 72 (yeast)"""	TCFL1		7702631	Standard	NM_001271087		Approved	YL-1, YL1, Swc2	uc001exe.2	Q15906	OTTHUMG00000012345	ENST00000354473.4:c.855C>T	1.37:g.151149393G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLK9|A6PW55|Q53GJ2|Q5U0R4	Silent	SNP	pfam_YL1,pfam_YL1_C	p.F274	ENST00000354473.4	37	c.822	CCDS59201.1	1																																																																																			VPS72	-	NULL	ENSG00000163159		0.572	VPS72-002	NOVEL	mRNA_start_NF|basic|exp_conf|CCDS	protein_coding	VPS72	HGNC	protein_coding	OTTHUMT00000034394.3	33	0.00	0	G	NM_005997		151149393	151149393	-1	no_errors	ENST00000368892	ensembl	human	known	69_37n	silent	44	10.20	5	SNP	1.000	A
VWF	7450	genome.wustl.edu	37	12	6092323	6092323	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:6092323G>A	ENST00000261405.5	-	41	7328	c.7074C>T	c.(7072-7074)ttC>ttT	p.F2358F		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	2358					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	TACCGCAGGTGAAGTTGGGTC	0.617																																						dbGAP											0													107.0	78.0	88.0					12																	6092323		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.7074C>T	12.37:g.6092323G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.F2358	ENST00000261405.5	37	c.7074	CCDS8539.1	12																																																																																			VWF	-	pirsf_VWF	ENSG00000110799		0.617	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	45	0.00	0	G	NM_000552		6092323	6092323	-1	no_errors	ENST00000261405	ensembl	human	known	69_37n	silent	23	25.81	8	SNP	0.985	A
WASF1	8936	genome.wustl.edu	37	6	110424677	110424677	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:110424677C>G	ENST00000392589.1	-	9	1633	c.797G>C	c.(796-798)aGa>aCa	p.R266T	WASF1_ENST00000392586.1_Missense_Mutation_p.R266T|WASF1_ENST00000392588.1_Missense_Mutation_p.R266T|WASF1_ENST00000392587.2_Missense_Mutation_p.R266T|WASF1_ENST00000359451.2_Missense_Mutation_p.R266T	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	266					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		TTCCTCAGCTCTAGTCAGAAG	0.448																																						dbGAP											0													199.0	169.0	179.0					6																	110424677		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.797G>C	6.37:g.110424677C>G	ENSP00000376368:p.Arg266Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5F2|Q5SZK7	Missense_Mutation	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.R266T	ENST00000392589.1	37	c.797	CCDS5080.1	6	.	.	.	.	.	.	.	.	.	.	C	19.71	3.879118	0.72294	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	5.51	5.51	0.81932	.	0.090584	0.85682	D	0.000000	T	0.39009	0.1062	L	0.27053	0.805	0.58432	D	0.999991	D	0.57899	0.981	D	0.67231	0.95	T	0.04961	-1.0915	10	0.11794	T	0.64	.	19.7791	0.96410	0.0:1.0:0.0:0.0	.	266	Q92558	WASF1_HUMAN	T	266	ENSP00000376365:R266T;ENSP00000376366:R266T;ENSP00000376368:R266T;ENSP00000376367:R266T;ENSP00000352425:R266T	ENSP00000352425:R266T	R	-	2	0	WASF1	110531370	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.578000	0.67450	2.763000	0.94921	0.650000	0.86243	AGA	WASF1	-	NULL	ENSG00000112290		0.448	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF1	HGNC	protein_coding	OTTHUMT00000041784.3	112	0.00	0	C	NM_003931		110424677	110424677	-1	no_errors	ENST00000359451	ensembl	human	known	69_37n	missense	37	39.34	24	SNP	1.000	G
WASF1	8936	genome.wustl.edu	37	6	110434547	110434547	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:110434547C>T	ENST00000392589.1	-	5	1086	c.250G>A	c.(250-252)Gat>Aat	p.D84N	WASF1_ENST00000392586.1_Missense_Mutation_p.D84N|WASF1_ENST00000392588.1_Missense_Mutation_p.D84N|WASF1_ENST00000392587.2_Missense_Mutation_p.D84N|WASF1_ENST00000359451.2_Missense_Mutation_p.D84N	NM_003931.2	NP_003922.1	Q92558	WASF1_HUMAN	WAS protein family, member 1	84					actin filament polymerization (GO:0030041)|cellular component movement (GO:0006928)|lamellipodium morphogenesis (GO:0072673)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|Rac protein signal transduction (GO:0016601)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoskeleton (GO:0005856)|lamellipodium (GO:0030027)|mitochondrial outer membrane (GO:0005741)|SCAR complex (GO:0031209)|synapse (GO:0045202)	protein complex binding (GO:0032403)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(87;1.18e-05)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		OV - Ovarian serous cystadenocarcinoma(136;0.0364)|Epithelial(106;0.051)|all cancers(137;0.0687)		TCCTTTGGATCAAGCTGTGTA	0.303																																						dbGAP											0													84.0	82.0	83.0					6																	110434547		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87459	CCDS5080.1	6q21	2010-08-20			ENSG00000112290	ENSG00000112290		"""A-kinase anchor proteins"""	12732	protein-coding gene	gene with protein product		605035				9843499, 9889097	Standard	XM_005267204		Approved	WAVE1, SCAR1, KIAA0269, WAVE	uc003pty.1	Q92558	OTTHUMG00000015357	ENST00000392589.1:c.250G>A	6.37:g.110434547C>T	ENSP00000376368:p.Asp84Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5F2|Q5SZK7	Missense_Mutation	SNP	pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.D84N	ENST00000392589.1	37	c.250	CCDS5080.1	6	.	.	.	.	.	.	.	.	.	.	C	25.5	4.640965	0.87859	.	.	ENSG00000112290	ENST00000392586;ENST00000392587;ENST00000392589;ENST00000392588;ENST00000359451;ENST00000444391;ENST00000265601;ENST00000368938;ENST00000419252;ENST00000447287	T;T;T;T;T;T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26;-0.26	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.81508	0.4837	M	0.85542	2.76	0.80722	D	1	D	0.56521	0.976	D	0.66196	0.942	T	0.82833	-0.0262	10	0.59425	D	0.04	.	19.736	0.96205	0.0:1.0:0.0:0.0	.	84	Q92558	WASF1_HUMAN	N	84	ENSP00000376365:D84N;ENSP00000376366:D84N;ENSP00000376368:D84N;ENSP00000376367:D84N;ENSP00000352425:D84N;ENSP00000407041:D84N;ENSP00000265601:D84N;ENSP00000357934:D84N;ENSP00000404142:D84N;ENSP00000402663:D84N	ENSP00000265601:D84N	D	-	1	0	WASF1	110541240	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.487000	0.81328	2.669000	0.90835	0.591000	0.81541	GAT	WASF1	-	NULL	ENSG00000112290		0.303	WASF1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	WASF1	HGNC	protein_coding	OTTHUMT00000041784.3	92	0.00	0	C	NM_003931		110434547	110434547	-1	no_errors	ENST00000359451	ensembl	human	known	69_37n	missense	39	42.65	29	SNP	1.000	T
WDR36	134430	genome.wustl.edu	37	5	110454814	110454814	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:110454814C>G	ENST00000513710.2	+	17	2072	c.2068C>G	c.(2068-2070)Cta>Gta	p.L690V	WDR36_ENST00000506538.2_Missense_Mutation_p.L690V			Q8NI36	WDR36_HUMAN	WD repeat domain 36	690					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		TGGAATTTATCTATGGTAAGT	0.388																																						dbGAP											0													114.0	121.0	119.0					5																	110454814		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.2068C>G	5.37:g.110454814C>G	ENSP00000424628:p.Leu690Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUS4|Q68E02|Q8N1Q2	Missense_Mutation	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L690V	ENST00000513710.2	37	c.2068	CCDS4102.1	5	.	.	.	.	.	.	.	.	.	.	C	15.52	2.858059	0.51376	.	.	ENSG00000134987	ENST00000506538;ENST00000513710	D;D	0.81499	-1.5;-1.5	6.07	2.4	0.29515	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.84946	0.5585	M	0.82323	2.585	0.80722	D	1	D	0.59767	0.986	P	0.53313	0.723	D	0.84022	0.0354	10	0.87932	D	0	-13.3105	9.438	0.38650	0.0:0.5758:0.0:0.4242	.	690	Q8NI36	WDR36_HUMAN	V	690	ENSP00000423067:L690V;ENSP00000424628:L690V	ENSP00000423067:L690V	L	+	1	2	WDR36	110482713	0.998000	0.40836	0.800000	0.32199	0.595000	0.36748	0.569000	0.23638	0.172000	0.19760	0.585000	0.79938	CTA	WDR36	-	smart_WD40_repeat	ENSG00000134987		0.388	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	150	0.66	1	C	NM_139281		110454814	110454814	+1	no_errors	ENST00000506538	ensembl	human	known	69_37n	missense	97	16.38	19	SNP	0.979	G
XKR7	343702	genome.wustl.edu	37	20	30556266	30556266	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr20:30556266C>T	ENST00000562532.2	+	1	462	c.288C>T	c.(286-288)ttC>ttT	p.F96F		NM_001011718.1	NP_001011718.1	Q5GH72	XKR7_HUMAN	XK, Kell blood group complex subunit-related family, member 7	96						integral component of membrane (GO:0016021)		p.F96F(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CCTTGCTGTTCGTGCTCCTGC	0.632																																						dbGAP											1	Substitution - coding silent(1)	upper_aerodigestive_tract(1)											78.0	60.0	66.0					20																	30556266		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY534245	CCDS33459.1	20q11.21	2014-07-16	2006-01-12		ENSG00000260903	ENSG00000260903			23062	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 7"", ""chromosome 20 open reading frame 159"""	C20orf159			Standard	NM_001011718		Approved	dJ310O13.4	uc002wxe.3	Q5GH72	OTTHUMG00000032198	ENST00000562532.2:c.288C>T	20.37:g.30556266C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NUG5	Silent	SNP	pfam_Transport_prot_XK	p.F96	ENST00000562532.2	37	c.288	CCDS33459.1	20																																																																																			XKR7	-	pfam_Transport_prot_XK	ENSG00000101321		0.632	XKR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR7	HGNC	protein_coding	OTTHUMT00000078597.3	20	0.00	0	C	NM_001011718		30556266	30556266	+1	no_errors	ENST00000217299	ensembl	human	known	69_37n	silent	21	38.24	13	SNP	0.998	T
XPO6	23214	genome.wustl.edu	37	16	28112956	28112956	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:28112956G>A	ENST00000304658.5	-	23	3599	c.3099C>T	c.(3097-3099)gtC>gtT	p.V1033V	XPO6_ENST00000565698.1_Silent_p.V1019V	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	1033					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						TGTGGACCAGGACCTGGAGCA	0.577																																						dbGAP											0													71.0	77.0	75.0					16																	28112956		2072	4217	6289	-	-	-	SO:0001819	synonymous_variant	0			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.3099C>T	16.37:g.28112956G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Silent	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.V1033	ENST00000304658.5	37	c.3099	CCDS42135.1	16																																																																																			XPO6	-	superfamily_ARM-type_fold	ENSG00000169180		0.577	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1	50	0.00	0	G	XM_055195		28112956	28112956	-1	no_errors	ENST00000304658	ensembl	human	known	69_37n	silent	28	34.88	15	SNP	0.993	A
XRCC4	7518	genome.wustl.edu	37	5	82491606	82491606	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr5:82491606C>T	ENST00000511817.1	+	4	413	c.333C>T	c.(331-333)ttC>ttT	p.F111F	XRCC4_ENST00000509268.1_3'UTR|XRCC4_ENST00000396027.4_Silent_p.F111F|XRCC4_ENST00000338635.6_Silent_p.F111F|XRCC4_ENST00000282268.3_Silent_p.F111F			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	111					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		TTGGTTCCTTCAACCTAGAGA	0.363								Non-homologous end-joining																														dbGAP											0													62.0	61.0	61.0					5																	82491606		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.333C>T	5.37:g.82491606C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3X4|Q9BS72|Q9UP94	Silent	SNP	pfam_DNA_ds_break_repair_XRCC4,superfamily_XRCC4_N	p.F111	ENST00000511817.1	37	c.333	CCDS4059.1	5																																																																																			XRCC4	-	pfam_DNA_ds_break_repair_XRCC4,superfamily_XRCC4_N	ENSG00000152422		0.363	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	XRCC4	HGNC	protein_coding	OTTHUMT00000369624.1	119	0.00	0	C	NM_022550		82491606	82491606	+1	no_errors	ENST00000338635	ensembl	human	known	69_37n	silent	76	21.65	21	SNP	0.994	T
YAE1D1	57002	genome.wustl.edu	37	7	39612069	39612069	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:39612069G>C	ENST00000223273.2	+	3	488	c.445G>C	c.(445-447)Gag>Cag	p.E149Q	YAE1D1_ENST00000432096.2_Intron|YAE1D1_ENST00000448268.1_3'UTR	NM_020192.3	NP_064577.1	Q9NRH1	YAED1_HUMAN	Yae1 domain containing 1	149																	AGTTCCAGCTGAGAAAAAGAT	0.378																																						dbGAP											0													125.0	120.0	122.0					7																	39612069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF226046	CCDS5459.1, CCDS64630.1	7p14.1	2011-11-24	2011-11-24	2011-11-24	ENSG00000241127	ENSG00000241127			24857	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 36"""	C7orf36		12477932	Standard	NM_020192		Approved	GK003	uc003thc.4	Q9NRH1	OTTHUMG00000128689	ENST00000223273.2:c.445G>C	7.37:g.39612069G>C	ENSP00000223273:p.Glu149Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1W4|B4DE83|Q6IAF7|Q8WVZ5	Missense_Mutation	SNP	pfam_Essential_protein_Yae1_N	p.E149Q	ENST00000223273.2	37	c.445	CCDS5459.1	7	.	.	.	.	.	.	.	.	.	.	G	9.219	1.032886	0.19590	.	.	ENSG00000241127	ENST00000223273	T	0.45276	0.9	5.84	3.01	0.34805	.	0.536685	0.19704	N	0.107978	T	0.29190	0.0726	L	0.39633	1.23	0.09310	N	0.999999	B	0.17465	0.022	B	0.11329	0.006	T	0.18461	-1.0336	10	0.15952	T	0.53	-14.6425	8.1489	0.31128	0.151:0.1621:0.6869:0.0	.	149	Q9NRH1	CG036_HUMAN	Q	149	ENSP00000223273:E149Q	ENSP00000223273:E149Q	E	+	1	0	C7orf36	39578594	0.874000	0.30092	0.077000	0.20336	0.987000	0.75469	1.913000	0.39956	0.831000	0.34780	0.591000	0.81541	GAG	YAE1D1	-	NULL	ENSG00000241127		0.378	YAE1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YAE1D1	HGNC	protein_coding	OTTHUMT00000250586.1	140	0.00	0	G	NM_020192		39612069	39612069	+1	no_errors	ENST00000223273	ensembl	human	known	69_37n	missense	85	21.30	23	SNP	0.010	C
ZBTB2	57621	genome.wustl.edu	37	6	151694745	151694745	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr6:151694745G>C	ENST00000325144.4	-	2	168	c.28C>G	c.(28-30)Cta>Gta	p.L10V		NM_020861.1	NP_065912.1	Q8N680	ZBTB2_HUMAN	zinc finger and BTB domain containing 2	10					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.63e-11)		TGTTGCAGTAGAATAAGTCCA	0.378																																						dbGAP											0													100.0	102.0	101.0					6																	151694745		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020172	CCDS5231.1	6q25.1	2013-01-09			ENSG00000181472	ENSG00000181472		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	20868	protein-coding gene	gene with protein product						10819331	Standard	NM_020861		Approved	KIAA1483, ZNF437, bA351K16.2	uc003qoh.3	Q8N680	OTTHUMG00000015834	ENST00000325144.4:c.28C>G	6.37:g.151694745G>C	ENSP00000323183:p.Leu10Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7C7|Q5SZ81|Q9P245	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.L10V	ENST00000325144.4	37	c.28	CCDS5231.1	6	.	.	.	.	.	.	.	.	.	.	G	27.2	4.814139	0.90790	.	.	ENSG00000181472	ENST00000325144	T	0.25912	1.77	5.53	5.53	0.82687	BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.37945	0.1022	L	0.45285	1.41	0.80722	D	1	D	0.63880	0.993	D	0.73708	0.981	T	0.18681	-1.0329	10	0.87932	D	0	-17.8138	19.4477	0.94854	0.0:0.0:1.0:0.0	.	10	Q8N680	ZBTB2_HUMAN	V	10	ENSP00000323183:L10V	ENSP00000323183:L10V	L	-	1	2	ZBTB2	151736438	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.999000	0.88496	2.584000	0.87258	0.561000	0.74099	CTA	ZBTB2	-	superfamily_BTB/POZ_fold	ENSG00000181472		0.378	ZBTB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB2	HGNC	protein_coding	OTTHUMT00000042715.1	114	0.00	0	G	NM_020861		151694745	151694745	-1	no_errors	ENST00000325144	ensembl	human	known	69_37n	missense	38	50.65	39	SNP	1.000	C
ZC3H7A	29066	genome.wustl.edu	37	16	11861345	11861345	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr16:11861345C>T	ENST00000396516.2	-	12	1647	c.1450G>A	c.(1450-1452)Gat>Aat	p.D484N	ZC3H7A_ENST00000355758.4_Missense_Mutation_p.D484N			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	484						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						CATGATTTATCTTCAACATTC	0.284																																						dbGAP											0													144.0	140.0	142.0					16																	11861345		2195	4300	6495	-	-	-	SO:0001583	missense	0			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.1450G>A	16.37:g.11861345C>T	ENSP00000379773:p.Asp484Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUG5|Q9NPE9	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.D484N	ENST00000396516.2	37	c.1450	CCDS10550.1	16	.	.	.	.	.	.	.	.	.	.	C	34	5.364837	0.95877	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.10192	2.9;2.9	5.77	5.77	0.91146	.	0.093898	0.64402	D	0.000001	T	0.22589	0.0545	L	0.45051	1.395	0.80722	D	1	P;P	0.48230	0.907;0.849	P;P	0.56563	0.801;0.638	T	0.00180	-1.1948	10	0.29301	T	0.29	.	18.9808	0.92755	0.0:1.0:0.0:0.0	.	205;484	Q9NXC8;Q8IWR0	.;Z3H7A_HUMAN	N	484	ENSP00000347999:D484N;ENSP00000379773:D484N	ENSP00000347999:D484N	D	-	1	0	ZC3H7A	11768846	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.727000	0.68523	2.729000	0.93468	0.467000	0.42956	GAT	ZC3H7A	-	NULL	ENSG00000122299		0.284	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZC3H7A	HGNC	protein_coding	OTTHUMT00000437066.1	225	0.00	0	C	NM_014153		11861345	11861345	-1	no_errors	ENST00000355758	ensembl	human	known	69_37n	missense	147	25.00	49	SNP	1.000	T
ZFYVE19	84936	genome.wustl.edu	37	15	41105568	41105568	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr15:41105568G>A	ENST00000355341.4	+	8	1564	c.1063G>A	c.(1063-1065)Gat>Aat	p.D355N	ZFYVE19_ENST00000564258.1_Missense_Mutation_p.D180N|ZFYVE19_ENST00000570108.1_Missense_Mutation_p.D332N|ZFYVE19_ENST00000299173.10_Missense_Mutation_p.D287N|ZFYVE19_ENST00000336455.5_Missense_Mutation_p.D345N	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	355					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		CCCAGACAGTGATGACGACGA	0.587																																						dbGAP											0													52.0	58.0	56.0					15																	41105568		2084	4218	6302	-	-	-	SO:0001583	missense	0			AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.1063G>A	15.37:g.41105568G>A	ENSP00000347498:p.Asp355Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.D355N	ENST00000355341.4	37	c.1063	CCDS42025.1	15	.	.	.	.	.	.	.	.	.	.	G	24.0	4.482394	0.84747	.	.	ENSG00000166140	ENST00000355341;ENST00000299173;ENST00000336455	T;T;T	0.26660	1.72;1.72;1.72	4.51	4.51	0.55191	.	0.098410	0.64402	D	0.000002	T	0.49966	0.1588	M	0.73962	2.25	0.45129	D	0.99814	D;D;P	0.76494	0.999;0.999;0.933	D;D;P	0.77004	0.989;0.989;0.462	T	0.50101	-0.8867	10	0.45353	T	0.12	-22.0405	14.7438	0.69474	0.0:0.0:1.0:0.0	.	345;287;355	Q96K21-2;Q96K21-3;Q96K21	.;.;ZFY19_HUMAN	N	355;287;345	ENSP00000347498:D355N;ENSP00000299173:D287N;ENSP00000337824:D345N	ENSP00000299173:D287N	D	+	1	0	ZFYVE19	38892860	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	4.308000	0.59129	2.342000	0.79632	0.555000	0.69702	GAT	ZFYVE19	-	NULL	ENSG00000166140		0.587	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	HGNC	protein_coding	OTTHUMT00000418996.1	55	0.00	0	G	NM_032850		41105568	41105568	+1	no_errors	ENST00000355341	ensembl	human	known	69_37n	missense	26	25.71	9	SNP	1.000	A
ZNF20	7568	genome.wustl.edu	37	19	12243957	12243957	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:12243957G>A	ENST00000334213.5	-	4	1268	c.1044C>T	c.(1042-1044)ttC>ttT	p.F348F	ZNF20_ENST00000600335.1_Intron|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000485451.1_5'Flank	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	348					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						AGGTACATCTGAAGGCTTTAC	0.458																																						dbGAP											0													62.0	63.0	63.0					19																	12243957		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.1044C>T	19.37:g.12243957G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N457|Q9UG41	Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F348	ENST00000334213.5	37	c.1044	CCDS45986.1	19																																																																																			ZNF20	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000132010		0.458	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF20	HGNC	protein_coding	OTTHUMT00000344101.1	53	0.00	0	G	NM_021143		12243957	12243957	-1	no_errors	ENST00000334213	ensembl	human	known	69_37n	silent	94	34.27	49	SNP	0.514	A
ZNF20	7568	genome.wustl.edu	37	19	12244352	12244352	+	Missense_Mutation	SNP	G	G	C	rs557596590		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:12244352G>C	ENST00000334213.5	-	4	873	c.649C>G	c.(649-651)Cat>Gat	p.H217D	ZNF20_ENST00000600335.1_Intron|ZNF625-ZNF20_ENST00000430024.1_3'UTR|ZNF20_ENST00000485451.1_5'Flank	NM_001203250.1|NM_021143.3	NP_001190179.1|NP_066966.2	P17024	ZNF20_HUMAN	zinc finger protein 20	217					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|lung(6)	8						ATTCGTTCATGGATAAGACAT	0.388																																						dbGAP											0													114.0	124.0	121.0					19																	12244352		2198	4295	6493	-	-	-	SO:0001583	missense	0			X52344	CCDS45986.1	19p13.2	2013-01-08	2006-05-10		ENSG00000132010	ENSG00000132010		"""Zinc fingers, C2H2-type"", ""-"""	12992	protein-coding gene	gene with protein product		194557	"""zinc finger protein 20 (KOX 13)"""				Standard	NM_021143		Approved	KOX13	uc002mtf.2	P17024	OTTHUMG00000156409	ENST00000334213.5:c.649C>G	19.37:g.12244352G>C	ENSP00000335437:p.His217Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N457|Q9UG41	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H217D	ENST00000334213.5	37	c.649	CCDS45986.1	19	.	.	.	.	.	.	.	.	.	.	G	16.21	3.058267	0.55325	.	.	ENSG00000132010	ENST00000334213;ENST00000292241	D	0.86769	-2.17	0.94	0.94	0.19513	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94295	0.8167	H	0.95294	3.65	0.27895	N	0.939185	D	0.89917	1.0	D	0.91635	0.999	D	0.85590	0.1245	9	0.87932	D	0	.	7.7068	0.28655	0.0:0.0:1.0:0.0	.	217	P17024	ZNF20_HUMAN	D	217	ENSP00000335437:H217D	ENSP00000292241:H217D	H	-	1	0	ZNF20	12105352	1.000000	0.71417	0.009000	0.14445	0.433000	0.31745	5.243000	0.65395	0.783000	0.33636	0.313000	0.20887	CAT	ZNF20	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000132010		0.388	ZNF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF20	HGNC	protein_coding	OTTHUMT00000344101.1	68	0.00	0	G	NM_021143		12244352	12244352	-1	no_errors	ENST00000334213	ensembl	human	known	69_37n	missense	69	34.91	37	SNP	0.475	C
ZNF329	79673	genome.wustl.edu	37	19	58639869	58639869	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:58639869G>A	ENST00000598312.1	-	4	1235	c.1002C>T	c.(1000-1002)ctC>ctT	p.L334L	ZNF329_ENST00000358067.4_Silent_p.L334L	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	334					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		TGTGGATTCTGAGATGCACTG	0.488																																						dbGAP											0													113.0	104.0	107.0					19																	58639869		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.1002C>T	19.37:g.58639869G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR32|Q9H9R7	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L334	ENST00000598312.1	37	c.1002	CCDS12972.1	19																																																																																			ZNF329	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181894		0.488	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF329	HGNC	protein_coding	OTTHUMT00000466724.1	112	0.00	0	G	NM_024620		58639869	58639869	-1	no_errors	ENST00000358067	ensembl	human	known	69_37n	silent	77	34.19	40	SNP	0.968	A
ZNF34	80778	genome.wustl.edu	37	8	145999258	145999258	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr8:145999258C>G	ENST00000343459.4	-	6	1141	c.1076G>C	c.(1075-1077)gGa>gCa	p.G359A	ZNF34_ENST00000429371.2_Missense_Mutation_p.G338A			Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		GGGTTTCTCTCCGGTGTGGAT	0.502																																						dbGAP											0													53.0	59.0	57.0					8																	145999258		2177	4293	6470	-	-	-	SO:0001583	missense	0			BC028136	CCDS47945.1, CCDS69562.1	8q24	2013-01-08	2006-05-11					"""Zinc fingers, C2H2-type"", ""-"""	13098	protein-coding gene	gene with protein product		194526	"""zinc finger protein 34 (KOX 32)"""			8104631, 2014798	Standard	XM_005272349		Approved	KOX32	uc003zdy.4	Q8IZ26		ENST00000343459.4:c.1076G>C	8.37:g.145999258C>G	ENSP00000341528:p.Gly359Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWN1|Q9BSZ0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G359A	ENST00000343459.4	37	c.1076	CCDS47945.1	8	.	.	.	.	.	.	.	.	.	.	C	23.1	4.376772	0.82682	.	.	ENSG00000196378	ENST00000449516;ENST00000527190;ENST00000343459;ENST00000429371	T;T	0.01505	4.82;4.82	3.62	3.62	0.41486	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.32055	N	0.006648	T	0.08223	0.0205	M	0.66297	2.02	0.40594	D	0.981513	D;D	0.62365	0.991;0.991	D;D	0.65874	0.939;0.939	T	0.06041	-1.0849	10	0.87932	D	0	.	15.2236	0.73333	0.0:1.0:0.0:0.0	.	318;359	E7EN25;Q8IZ26	.;ZNF34_HUMAN	A	318;288;359;338	ENSP00000341528:G359A;ENSP00000396894:G338A	ENSP00000341528:G359A	G	-	2	0	ZNF34	145970062	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	4.940000	0.63533	2.302000	0.77476	0.655000	0.94253	GGA	ZNF34	-	pfscan_Znf_C2H2	ENSG00000196378		0.502	ZNF34-006	KNOWN	basic|CCDS	protein_coding	ZNF34	HGNC	protein_coding	OTTHUMT00000382936.1	66	0.00	0	C	NM_030580		145999258	145999258	-1	no_errors	ENST00000343459	ensembl	human	known	69_37n	missense	51	29.17	21	SNP	1.000	G
ZNF347	84671	genome.wustl.edu	37	19	53643693	53643693	+	Silent	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:53643693C>T	ENST00000334197.7	-	5	2456	c.2388G>A	c.(2386-2388)ggG>ggA	p.G796G	ZNF347_ENST00000452676.2_Silent_p.G797G|ZNF347_ENST00000601469.2_Silent_p.G797G|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	796					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		TAAAGGGTTTCCCACACTCAT	0.408																																					Melanoma(64;205 1597 17324 45721)	dbGAP											0													184.0	182.0	183.0					19																	53643693		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.2388G>A	19.37:g.53643693C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU77|B9EG59|G5E9N4|Q8TCN1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G797	ENST00000334197.7	37	c.2391	CCDS33097.1	19																																																																																			ZNF347	-	pfscan_Znf_C2H2	ENSG00000197937		0.408	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	HGNC	protein_coding	OTTHUMT00000464170.1	131	0.76	1	C	NM_032584		53643693	53643693	-1	no_errors	ENST00000452676	ensembl	human	known	69_37n	silent	115	26.75	42	SNP	0.136	T
ZNF385A	25946	genome.wustl.edu	37	12	54778269	54778269	+	Silent	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr12:54778269G>A	ENST00000338010.5	-	2	143	c.90C>T	c.(88-90)atC>atT	p.I30I	ZNF385A_ENST00000546970.1_Silent_p.I10I|ZNF385A_ENST00000551109.1_Silent_p.I10I|ZNF385A_ENST00000551771.1_Silent_p.I10I|RP11-753H16.3_ENST00000550474.1_RNA|ZNF385A_ENST00000394313.2_Silent_p.I10I|ZNF385A_ENST00000352268.6_Silent_p.I30I|RP11-753H16.5_ENST00000552785.1_RNA	NM_001130967.1	NP_001124439.1	Q96PM9	Z385A_HUMAN	zinc finger protein 385A	30					apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|hemostasis (GO:0007599)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|mRNA localization resulting in posttranscriptional regulation of gene expression (GO:0010609)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)|positive regulation of DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:1902164)|positive regulation of fat cell differentiation (GO:0045600)|regulation of cytoplasmic translation (GO:2000765)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA 3'-UTR binding (GO:0003730)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|urinary_tract(1)	15						GGAAGGGCAGGATCTGCTTGA	0.627																																						dbGAP											0													67.0	56.0	60.0					12																	54778269		2199	4296	6495	-	-	-	SO:0001819	synonymous_variant	0			AF304052	CCDS8879.1, CCDS44910.1, CCDS44911.1	12q13.13	2012-10-05	2007-12-06	2007-12-06		ENSG00000161642			17521	protein-coding gene	gene with protein product		609124	"""zinc finger protein 385"""	ZNF385			Standard	XM_005268785		Approved	DKFZp586G1122, Hzf, ZFP385	uc001sfy.3	Q96PM9	OTTHUMG00000169840	ENST00000338010.5:c.90C>T	12.37:g.54778269G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDN5|B4DKH2|F1T0F1|J3KNS3|Q5VH53|Q9H7R6|Q9UFU3	Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.I30	ENST00000338010.5	37	c.90	CCDS44911.1	12																																																																																			ZNF385A	-	NULL	ENSG00000161642		0.627	ZNF385A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385A	HGNC	protein_coding	OTTHUMT00000406162.1	32	0.00	0	G	NM_015481		54778269	54778269	-1	no_errors	ENST00000338010	ensembl	human	known	69_37n	silent	10	41.18	7	SNP	1.000	A
ZNF397	84307	genome.wustl.edu	37	18	32825765	32825765	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr18:32825765G>A	ENST00000330501.7	+	4	1249	c.1096G>A	c.(1096-1098)Gag>Aag	p.E366K	ZNF397_ENST00000355632.4_Intron|ZNF397_ENST00000589420.1_Intron|ZNF397_ENST00000261333.6_Intron|ZNF397_ENST00000592264.1_Intron	NM_001135178.2	NP_001128650.1	Q8NF99	ZN397_HUMAN	zinc finger protein 397	366					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)	12						CCATACTGGTGAGAAAGCTTG	0.383																																						dbGAP											0													43.0	45.0	45.0					18																	32825765		692	1591	2283	-	-	-	SO:0001583	missense	0			BC006172	CCDS32814.1, CCDS45852.1	18p12	2013-01-09	2003-07-22			ENSG00000186812		"""-"", ""Zinc fingers, C2H2-type"""	18818	protein-coding gene	gene with protein product		609601	"""zinc finger protein 47"""	ZNF47			Standard	NM_032347		Approved	ZSCAN15, MGC13250	uc010dmp.3	Q8NF99		ENST00000330501.7:c.1096G>A	18.37:g.32825765G>A	ENSP00000331577:p.Glu366Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRM2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E366K	ENST00000330501.7	37	c.1096	CCDS45852.1	18	.	.	.	.	.	.	.	.	.	.	G	23.5	4.418969	0.83559	.	.	ENSG00000186812	ENST00000330501	T	0.24350	1.86	4.23	4.23	0.50019	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.34386	N	0.004015	T	0.46870	0.1415	M	0.63428	1.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.38134	-0.9675	9	.	.	.	.	14.4635	0.67467	0.0:0.0:1.0:0.0	.	366	Q8NF99	ZN397_HUMAN	K	366	ENSP00000331577:E366K	.	E	+	1	0	ZNF397	31079763	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	7.763000	0.85283	2.355000	0.79922	0.305000	0.20034	GAG	ZNF397	-	pfscan_Znf_C2H2	ENSG00000186812		0.383	ZNF397-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF397	HGNC	protein_coding	OTTHUMT00000442398.1	51	0.00	0	G	NM_032347		32825765	32825765	+1	no_errors	ENST00000330501	ensembl	human	known	69_37n	missense	58	28.40	23	SNP	1.000	A
ZNF462	58499	genome.wustl.edu	37	9	109689443	109689443	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr9:109689443G>C	ENST00000277225.5	+	3	3539	c.3250G>C	c.(3250-3252)Gag>Cag	p.E1084Q	ZNF462_ENST00000441147.2_5'Flank|ZNF462_ENST00000457913.1_Missense_Mutation_p.E1084Q			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1084					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						ATTATCATTTGAGGTGGGTGC	0.512																																						dbGAP											0													86.0	86.0	86.0					9																	109689443		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3250G>C	9.37:g.109689443G>C	ENSP00000277225:p.Glu1084Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1084Q	ENST00000277225.5	37	c.3250	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	G	15.24	2.775770	0.49786	.	.	ENSG00000148143	ENST00000277225;ENST00000457913	T;T	0.06218	3.33;3.77	5.6	5.6	0.85130	.	0.251853	0.43579	D	0.000545	T	0.13500	0.0327	L	0.43152	1.355	0.80722	D	1	D;P	0.56035	0.974;0.895	P;B	0.50659	0.647;0.281	T	0.00409	-1.1757	10	0.49607	T	0.09	.	19.6224	0.95663	0.0:0.0:1.0:0.0	.	1084;1084	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	Q	1084	ENSP00000277225:E1084Q;ENSP00000414570:E1084Q	ENSP00000277225:E1084Q	E	+	1	0	ZNF462	108729264	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.003000	0.76310	2.630000	0.89119	0.655000	0.94253	GAG	ZNF462	-	NULL	ENSG00000148143		0.512	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	53	0.00	0	G	NM_021224		109689443	109689443	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	missense	42	23.64	13	SNP	1.000	C
ZNF630	57232	genome.wustl.edu	37	X	47918311	47918311	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chrX:47918311C>T	ENST00000409324.3	-	5	1746	c.1520G>A	c.(1519-1521)aGa>aAa	p.R507K	ZNF630_ENST00000276054.4_Missense_Mutation_p.R383K|ZNF630_ENST00000442455.3_Missense_Mutation_p.R493K|ZNF630-AS1_ENST00000436124.1_RNA	NM_001037735.2	NP_001032824.2	Q2M218	ZN630_HUMAN	zinc finger protein 630	507					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|large_intestine(6)|lung(11)|ovary(1)	19						TGTATGAATTCTCTGGTGTAT	0.423																																						dbGAP											0													66.0	62.0	63.0					X																	47918311		2193	4287	6480	-	-	-	SO:0001583	missense	0			AK000580	CCDS35237.2, CCDS75971.1	Xp11.3-p11.1	2013-01-08			ENSG00000221994	ENSG00000221994		"""Zinc fingers, C2H2-type"", ""-"""	28855	protein-coding gene	gene with protein product		300819					Standard	NM_001037735		Approved	BC037316, dJ54B20.2, FLJ20573, MGC138344	uc004div.4	Q2M218	OTTHUMG00000021463	ENST00000409324.3:c.1520G>A	X.37:g.47918311C>T	ENSP00000386393:p.Arg507Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WAG4|Q5H8Z5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R507K	ENST00000409324.3	37	c.1520	CCDS35237.2	X	.	.	.	.	.	.	.	.	.	.	.	10.58	1.391288	0.25118	.	.	ENSG00000221994	ENST00000442455;ENST00000276054;ENST00000409324	T;T;T	0.02197	4.4;4.4;4.4	2.31	2.31	0.28768	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.07007	0.0178	L	0.42581	1.335	0.20403	N	0.999901	D	0.62365	0.991	D	0.77004	0.989	T	0.33828	-0.9853	9	0.40728	T	0.16	.	9.8164	0.40856	0.0:1.0:0.0:0.0	.	507	Q2M218	ZN630_HUMAN	K	493;383;507	ENSP00000393163:R493K;ENSP00000354683:R383K;ENSP00000386393:R507K	ENSP00000354683:R383K	R	-	2	0	ZNF630	47803255	0.000000	0.05858	0.933000	0.37362	0.993000	0.82548	-0.006000	0.12833	1.179000	0.42884	0.544000	0.68410	AGA	ZNF630	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000221994		0.423	ZNF630-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF630	HGNC	protein_coding	OTTHUMT00000327254.1	102	0.00	0	C	NM_001037735		47918311	47918311	-1	no_errors	ENST00000409324	ensembl	human	known	69_37n	missense	78	27.78	30	SNP	1.000	T
ZNF804B	219578	genome.wustl.edu	37	7	88965217	88965217	+	Missense_Mutation	SNP	G	G	A	rs372790530		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr7:88965217G>A	ENST00000333190.4	+	4	3530	c.2921G>A	c.(2920-2922)aGa>aAa	p.R974K		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	974							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GGCTGTAACAGACAAGCATTG	0.403										HNSCC(36;0.09)																												dbGAP											0													105.0	105.0	105.0					7																	88965217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.2921G>A	7.37:g.88965217G>A	ENSP00000329638:p.Arg974Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.R974K	ENST00000333190.4	37	c.2921	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	G	0.005	-2.216555	0.00286	.	.	ENSG00000182348	ENST00000333190	T	0.04083	3.71	5.16	2.23	0.28157	.	0.708561	0.13041	N	0.418550	T	0.02807	0.0084	L	0.27053	0.805	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.47873	-0.9083	10	0.07030	T	0.85	-0.079	3.4321	0.07432	0.1619:0.4235:0.2983:0.1163	.	974	A4D1E1	Z804B_HUMAN	K	974	ENSP00000329638:R974K	ENSP00000329638:R974K	R	+	2	0	ZNF804B	88803153	0.000000	0.05858	0.001000	0.08648	0.014000	0.08584	-0.003000	0.12901	0.751000	0.32900	-0.176000	0.13171	AGA	ZNF804B	-	NULL	ENSG00000182348		0.403	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	49	0.00	0	G	NM_181646		88965217	88965217	+1	no_errors	ENST00000333190	ensembl	human	known	69_37n	missense	29	19.44	7	SNP	0.000	A
ZNF836	162962	genome.wustl.edu	37	19	52660057	52660057	+	Silent	SNP	C	C	G	rs78442342		TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr19:52660057C>G	ENST00000322146.8	-	5	1400	c.879G>C	c.(877-879)cgG>cgC	p.R293R	ZNF836_ENST00000597252.1_Silent_p.R293R|CTC-471J1.8_ENST00000594362.1_RNA	NM_001102657.1	NP_001096127.1	Q6ZNA1	ZN836_HUMAN	zinc finger protein 836	293					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26						TGTGACTTCTCCGGTGATTTA	0.393																																						dbGAP											0													84.0	88.0	87.0					19																	52660057		2191	4295	6486	-	-	-	SO:0001819	synonymous_variant	0			BC011784	CCDS46162.1	19q13.33	2013-01-08			ENSG00000196267	ENSG00000196267		"""Zinc fingers, C2H2-type"", ""-"""	34333	protein-coding gene	gene with protein product							Standard	NM_001102657		Approved	FLJ16287	uc010ydj.2	Q6ZNA1		ENST00000322146.8:c.879G>C	19.37:g.52660057C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R293	ENST00000322146.8	37	c.879	CCDS46162.1	19																																																																																			ZNF836	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196267		0.393	ZNF836-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF836	HGNC	protein_coding	OTTHUMT00000462456.1	105	0.00	0	C	NM_001102657		52660057	52660057	-1	no_errors	ENST00000322146	ensembl	human	known	69_37n	silent	83	30.25	36	SNP	0.234	G
ZP1	22917	genome.wustl.edu	37	11	60637194	60637194	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr11:60637194C>G	ENST00000278853.5	+	3	503	c.503C>G	c.(502-504)tCt>tGt	p.S168C		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	168					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CTCCCCACCTCTGGCCATACC	0.622																																						dbGAP											0													83.0	91.0	88.0					11																	60637194		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.503C>G	11.37:g.60637194C>G	ENSP00000278853:p.Ser168Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.S168C	ENST00000278853.5	37	c.503	CCDS31572.1	11	.	.	.	.	.	.	.	.	.	.	C	12.41	1.928664	0.34002	.	.	ENSG00000149506	ENST00000278853	T	0.25250	1.81	3.35	1.36	0.22044	.	.	.	.	.	T	0.19446	0.0467	L	0.36672	1.1	0.09310	N	1	D	0.58620	0.983	B	0.43783	0.431	T	0.13255	-1.0516	9	0.72032	D	0.01	-2.3115	5.0407	0.14458	0.0:0.7037:0.0:0.2963	.	168	P60852	ZP1_HUMAN	C	168	ENSP00000278853:S168C	ENSP00000278853:S168C	S	+	2	0	ZP1	60393770	0.000000	0.05858	0.003000	0.11579	0.039000	0.13416	-0.698000	0.05092	0.483000	0.27608	0.460000	0.39030	TCT	ZP1	-	NULL	ENSG00000149506		0.622	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZP1	HGNC	protein_coding	OTTHUMT00000396329.1	91	0.00	0	C	NM_207341		60637194	60637194	+1	no_errors	ENST00000278853	ensembl	human	known	69_37n	missense	49	19.67	12	SNP	0.001	G
ZP4	57829	genome.wustl.edu	37	1	238053239	238053239	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1J5-01A-11D-A13L-09	TCGA-EW-A1J5-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	98bb3025-0637-4106-8621-12df7b5d662f	d0c5457b-7ba5-4482-acc8-edc375e0e121	g.chr1:238053239C>T	ENST00000366570.4	-	3	486	c.328G>A	c.(328-330)Gaa>Aaa	p.E110K	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	110					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CCTGCTCCTTCAACTCCAACT	0.562																																					NSCLC(166;160 2029 11600 18754 19936)	dbGAP											0													187.0	194.0	192.0					1																	238053239		2203	4300	6503	-	-	-	SO:0001583	missense	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.328G>A	1.37:g.238053239C>T	ENSP00000355529:p.Glu110Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAE1	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.E110K	ENST00000366570.4	37	c.328	CCDS1615.1	1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.244034	0.58995	.	.	ENSG00000116996	ENST00000366570	T	0.76578	-1.03	4.89	1.54	0.23209	.	0.436156	0.23646	N	0.045966	T	0.79482	0.4453	M	0.82923	2.615	0.09310	N	1	D	0.60160	0.987	P	0.54499	0.754	T	0.67130	-0.5748	10	0.28530	T	0.3	-10.7839	1.854	0.03174	0.2519:0.4576:0.1735:0.117	.	110	Q12836	ZP4_HUMAN	K	110	ENSP00000355529:E110K	ENSP00000355529:E110K	E	-	1	0	ZP4	236119862	0.015000	0.18098	0.007000	0.13788	0.008000	0.06430	1.212000	0.32394	0.432000	0.26286	0.655000	0.94253	GAA	ZP4	-	NULL	ENSG00000116996		0.562	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	68	0.00	0	C			238053239	238053239	-1	no_errors	ENST00000366570	ensembl	human	known	69_37n	missense	116	18.88	27	SNP	0.002	T
