#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADH7	131	genome.wustl.edu	37	4	100341943	100341943	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr4:100341943G>A	ENST00000209665.4	-	6	848	c.608C>T	c.(607-609)cCt>cTt	p.P203L	ADH7_ENST00000482593.1_Missense_Mutation_p.P134L|ADH7_ENST00000437033.2_Missense_Mutation_p.P191L|ADH7_ENST00000476959.1_Missense_Mutation_p.P211L	NM_000673.4	NP_000664.2	P40394	ADH7_HUMAN	alcohol dehydrogenase 7 (class IV), mu or sigma polypeptide	203					ethanol catabolic process (GO:0006068)|ethanol oxidation (GO:0006069)|extracellular negative regulation of signal transduction (GO:1900116)|fatty acid omega-oxidation (GO:0010430)|oxidation-reduction process (GO:0055114)|response to bacterium (GO:0009617)|response to ethanol (GO:0045471)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular region (GO:0005576)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|aldehyde oxidase activity (GO:0004031)|ethanol binding (GO:0035276)|receptor antagonist activity (GO:0048019)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|large_intestine(4)|lung(11)|skin(1)	19				OV - Ovarian serous cystadenocarcinoma(123;1.75e-08)		AGTGGAACCAGGTTTGACCTG	0.478																																						dbGAP											0													63.0	54.0	57.0					4																	100341943		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76342	CCDS34034.1, CCDS54781.1	4q23-q24	2008-02-05			ENSG00000196344	ENSG00000196344	1.1.1.1	"""Alcohol dehydrogenases"""	256	protein-coding gene	gene with protein product		600086				8195208	Standard	NM_000673		Approved	ADH-4	uc021xqj.1	P40394	OTTHUMG00000159318	ENST00000209665.4:c.608C>T	4.37:g.100341943G>A	ENSP00000209665:p.Pro203Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRB6|A8MVN9|B2R760|B4DWV6|Q13713	Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like	p.P203L	ENST00000209665.4	37	c.608	CCDS34034.1	4	.	.	.	.	.	.	.	.	.	.	G	14.03	2.412408	0.42817	.	.	ENSG00000196344	ENST00000437033;ENST00000209665;ENST00000482593;ENST00000476959	T;T;T;T	0.25912	1.77;1.77;1.77;1.77	3.8	0.967	0.19674	GroES-like (1);	0.182510	0.48286	D	0.000190	T	0.35624	0.0938	M	0.90483	3.12	0.48975	D	0.999734	B	0.29590	0.25	B	0.32149	0.141	T	0.29852	-0.9998	10	0.87932	D	0	-18.2512	9.8852	0.41257	0.0:0.2828:0.5708:0.1464	.	203	P40394	ADH7_HUMAN	L	191;203;134;211	ENSP00000414254:P191L;ENSP00000209665:P203L;ENSP00000420613:P134L;ENSP00000420269:P211L	ENSP00000209665:P203L	P	-	2	0	ADH7	100560966	0.871000	0.30034	0.025000	0.17156	0.900000	0.52787	1.681000	0.37618	-0.038000	0.13624	0.563000	0.77884	CCT	ADH7	-	superfamily_GroES-like	ENSG00000196344		0.478	ADH7-201	KNOWN	basic|CCDS	protein_coding	ADH7	HGNC	protein_coding		22	0.00	0	G	NM_000673		100341943	100341943	-1	no_errors	ENST00000209665	ensembl	human	known	69_37n	missense	30	25.00	10	SNP	0.924	A
AVPR2	554	genome.wustl.edu	37	X	153171405	153171405	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chrX:153171405C>T	ENST00000358927.2	+	3	654	c.445C>T	c.(445-447)Cgc>Tgc	p.R149C	AVPR2_ENST00000337474.5_Missense_Mutation_p.R149C|AVPR2_ENST00000370049.1_Missense_Mutation_p.R149C			P30518	V2R_HUMAN	arginine vasopressin receptor 2	149					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	GCTGGCGTACCGCCATGGAAG	0.622																																						dbGAP											0													71.0	55.0	60.0					X																	153171405		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.445C>T	X.37:g.153171405C>T	ENSP00000351805:p.Arg149Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	C5HF20|O43192|Q3MJD3|Q9UCV9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Vprsn_rcpt_V2,prints_Vasoprsn_rcpt,prints_7TM_GPCR_Rhodpsn	p.R149C	ENST00000358927.2	37	c.445	CCDS14735.1	X	.	.	.	.	.	.	.	.	.	.	C	12.37	1.918333	0.33908	.	.	ENSG00000126895	ENST00000358927;ENST00000430697;ENST00000337474;ENST00000370049	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	3.54	3.54	0.40534	GPCR, rhodopsin-like superfamily (1);	0.193408	0.45606	D	0.000360	T	0.58963	0.2159	M	0.64260	1.97	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.77557	0.983;0.99	T	0.63497	-0.6624	10	0.87932	D	0	-22.7104	12.0908	0.53724	0.0:1.0:0.0:0.0	.	149;149	P30518-2;P30518	.;V2R_HUMAN	C	149	ENSP00000351805:R149C;ENSP00000393513:R149C;ENSP00000338072:R149C;ENSP00000359066:R149C	ENSP00000338072:R149C	R	+	1	0	AVPR2	152824599	0.348000	0.24861	0.990000	0.47175	0.093000	0.18481	0.564000	0.23563	1.717000	0.51406	0.279000	0.19357	CGC	AVPR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Vprsn_rcpt_V2	ENSG00000126895		0.622	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPR2	HGNC	protein_coding	OTTHUMT00000061127.2	17	0.00	0	C			153171405	153171405	+1	no_errors	ENST00000337474	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	T
BCKDK	10295	genome.wustl.edu	37	16	31121737	31121737	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr16:31121737C>T	ENST00000394951.1	+	8	1182	c.559C>T	c.(559-561)Cgc>Tgc	p.R187C	BCKDK_ENST00000219794.6_Missense_Mutation_p.R187C|BCKDK_ENST00000287507.3_Missense_Mutation_p.R187C|BCKDK_ENST00000394950.3_Missense_Mutation_p.R187C|AC135050.1_ENST00000517000.2_RNA			O14874	BCKD_HUMAN	branched chain ketoacid dehydrogenase kinase	187	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				branched-chain amino acid catabolic process (GO:0009083)|cellular amino acid catabolic process (GO:0009063)|phosphorylation (GO:0016310)|protein phosphorylation (GO:0006468)	mitochondrial alpha-ketoglutarate dehydrogenase complex (GO:0005947)|mitochondrion (GO:0005739)	[3-methyl-2-oxobutanoate dehydrogenase (acetyl-transferring)] kinase activity (GO:0047323)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|stomach(1)	2						AAAGCTCGTCCGCTACTTCTT	0.592																																						dbGAP											0													72.0	76.0	75.0					16																	31121737		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF026548	CCDS10705.1, CCDS45467.1, CCDS61917.1	16p11.2	2008-05-14			ENSG00000103507	ENSG00000103507			16902	protein-coding gene	gene with protein product		614901				1889817	Standard	NM_005881		Approved		uc002eaw.5	O14874	OTTHUMG00000047356	ENST00000394951.1:c.559C>T	16.37:g.31121737C>T	ENSP00000378405:p.Arg187Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY43|Q6FGL4|Q96G95|Q96IN5	Missense_Mutation	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core,prints_Sig_transdc_His_kin-like_C	p.R187C	ENST00000394951.1	37	c.559	CCDS10705.1	16	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698629	0.68501	.	.	ENSG00000103507	ENST00000394951;ENST00000219794;ENST00000394950;ENST00000287507	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.37	4.4	0.53042	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (3);	0.052120	0.85682	D	0.000000	T	0.42810	0.1219	L	0.60455	1.87	0.80722	D	1	D;D	0.76494	0.999;0.999	P;P	0.54174	0.744;0.663	T	0.43278	-0.9401	10	0.87932	D	0	-12.6865	12.8379	0.57784	0.1638:0.8362:0.0:0.0	.	187;187	Q96G95;O14874	.;BCKD_HUMAN	C	187	ENSP00000378405:R187C;ENSP00000219794:R187C;ENSP00000378404:R187C;ENSP00000287507:R187C	ENSP00000219794:R187C	R	+	1	0	BCKDK	31029238	0.992000	0.36948	0.992000	0.48379	0.484000	0.33280	2.359000	0.44142	1.357000	0.45904	0.655000	0.94253	CGC	BCKDK	-	pfam_BCDHK/PDK_N,superfamily_BCDHK/PDK_N	ENSG00000103507		0.592	BCKDK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BCKDK	HGNC	protein_coding	OTTHUMT00000108514.1	16	0.00	0	C	NM_005881		31121737	31121737	+1	no_errors	ENST00000219794	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	1.000	T
C6orf118	168090	genome.wustl.edu	37	6	165711541	165711541	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr6:165711541G>A	ENST00000230301.8	-	5	1006	c.986C>T	c.(985-987)gCg>gTg	p.A329V	C6orf118_ENST00000543069.1_Missense_Mutation_p.A225V	NM_144980.3	NP_659417.2	Q5T5N4	CF118_HUMAN	chromosome 6 open reading frame 118	329										breast(1)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	40		Breast(66;6.27e-05)|Ovarian(120;0.0228)|Prostate(117;0.0906)|all_neural(5;0.157)		OV - Ovarian serous cystadenocarcinoma(33;3.23e-18)|BRCA - Breast invasive adenocarcinoma(81;3.11e-06)|GBM - Glioblastoma multiforme(31;0.000313)		ATCCATGTCCGCCGTCTTCAC	0.597																																						dbGAP											0													105.0	86.0	92.0					6																	165711541		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5288.1	6q27	2012-02-06			ENSG00000112539	ENSG00000112539			21233	protein-coding gene	gene with protein product							Standard	NM_144980		Approved	MGC23884, bA85G2.1	uc003qum.4	Q5T5N4	OTTHUMG00000015984	ENST00000230301.8:c.986C>T	6.37:g.165711541G>A	ENSP00000230301:p.Ala329Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TC11	Missense_Mutation	SNP	superfamily_Ribonuclease/ribotoxin	p.A329V	ENST00000230301.8	37	c.986	CCDS5288.1	6	.	.	.	.	.	.	.	.	.	.	G	14.17	2.455970	0.43634	.	.	ENSG00000112539	ENST00000230301;ENST00000543069	T;T	0.14144	2.53;2.53	4.67	0.799	0.18667	.	1.148650	0.06358	N	0.711065	T	0.06234	0.0161	L	0.58101	1.795	0.09310	N	1	D	0.57899	0.981	P	0.44518	0.452	T	0.35076	-0.9803	10	0.30854	T	0.27	-2.6757	7.0653	0.25149	0.0:0.3768:0.3413:0.2819	.	329	Q5T5N4	CF118_HUMAN	V	329;225	ENSP00000230301:A329V;ENSP00000439288:A225V	ENSP00000230301:A329V	A	-	2	0	C6orf118	165631531	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.139000	0.03213	0.022000	0.15160	0.563000	0.77884	GCG	C6orf118	-	NULL	ENSG00000112539		0.597	C6orf118-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C6orf118	HGNC	protein_coding	OTTHUMT00000043026.1	39	0.00	0	G	NM_144980		165711541	165711541	-1	no_errors	ENST00000230301	ensembl	human	known	69_37n	missense	27	46.15	24	SNP	0.000	A
CDCA8	55143	genome.wustl.edu	37	1	38171237	38171237	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr1:38171237G>A	ENST00000373055.1	+	8	982	c.709G>A	c.(709-711)Gag>Aag	p.E237K	CDCA8_ENST00000327331.2_Missense_Mutation_p.E237K	NM_001256875.1|NM_018101.3	NP_001243804.1|NP_060571.1	Q53HL2	BOREA_HUMAN	cell division cycle associated 8	237					chromosome organization (GO:0051276)|mitotic cell cycle (GO:0000278)|mitotic metaphase plate congression (GO:0007080)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleus (GO:0005634)|protein complex (GO:0043234)				central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(1)|stomach(1)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GGGCGGCGGAGAGGTGAAGTA	0.547																																						dbGAP											0													72.0	68.0	69.0					1																	38171237		2203	4300	6503	-	-	-	SO:0001583	missense	0			BG354581	CCDS424.1	1p34.3	2013-01-17			ENSG00000134690	ENSG00000134690			14629	protein-coding gene	gene with protein product	"""borealin"""	609977				12188893, 15260989	Standard	NM_001256875		Approved	FLJ12042, MESRGP, BOR, DasraB	uc001cbs.4	Q53HL2	OTTHUMG00000004320	ENST00000373055.1:c.709G>A	1.37:g.38171237G>A	ENSP00000362146:p.Glu237Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPT4|Q53HN1|Q96AM3|Q9NVW5	Missense_Mutation	SNP	pfam_Cell_div_borealin,pfam_Borealin-like_N	p.E237K	ENST00000373055.1	37	c.709	CCDS424.1	1	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402677	0.42613	.	.	ENSG00000134690	ENST00000373055;ENST00000327331	T;T	0.44881	0.91;0.91	5.75	4.85	0.62838	.	0.148106	0.64402	N	0.000012	T	0.29458	0.0734	L	0.28694	0.88	0.46849	D	0.999227	B	0.06786	0.001	B	0.10450	0.005	T	0.08046	-1.0741	10	0.33940	T	0.23	-10.2954	8.728	0.34480	0.1696:0.0:0.8304:0.0	.	237	Q53HL2	BOREA_HUMAN	K	237	ENSP00000362146:E237K;ENSP00000316121:E237K	ENSP00000316121:E237K	E	+	1	0	CDCA8	37943824	0.999000	0.42202	0.998000	0.56505	0.930000	0.56654	3.279000	0.51670	1.436000	0.47453	0.643000	0.83706	GAG	CDCA8	-	pfam_Cell_div_borealin	ENSG00000134690		0.547	CDCA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA8	HGNC	protein_coding	OTTHUMT00000012473.1	23	0.00	0	G	NM_018101		38171237	38171237	+1	no_errors	ENST00000327331	ensembl	human	known	69_37n	missense	3	86.36	19	SNP	1.000	A
CHRNA1	1134	genome.wustl.edu	37	2	175618974	175618974	+	Silent	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr2:175618974G>A	ENST00000261007.5	-	6	654	c.588C>T	c.(586-588)taC>taT	p.Y196Y	AC018890.6_ENST00000442996.1_RNA|CHRNA1_ENST00000409542.1_Silent_p.Y89Y|CHRNA1_ENST00000348749.5_Silent_p.Y171Y|CHRNA1_ENST00000409219.1_Silent_p.Y171Y|CHRNA1_ENST00000409323.1_Silent_p.Y171Y	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	196					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	CAGAGCCGTCGTAGGTCCAGG	0.512																																						dbGAP											0													119.0	110.0	113.0					2																	175618974		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.588C>T	2.37:g.175618974G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRV6|D3DPE8	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.Y196	ENST00000261007.5	37	c.588	CCDS33331.1	2																																																																																			CHRNA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd	ENSG00000138435		0.512	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	HGNC	protein_coding	OTTHUMT00000334116.1	38	0.00	0	G			175618974	175618974	-1	no_errors	ENST00000261007	ensembl	human	known	69_37n	silent	30	26.83	11	SNP	0.730	A
COL12A1	1303	genome.wustl.edu	37	6	75904624	75904624	+	Missense_Mutation	SNP	T	T	A	rs200828190		TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr6:75904624T>A	ENST00000322507.8	-	3	422	c.113A>T	c.(112-114)gAa>gTa	p.E38V	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.E38V|COL12A1_ENST00000416123.2_Missense_Mutation_p.E38V	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	38	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						AACAGTATTTTCATCTATAAT	0.343																																						dbGAP											0													82.0	80.0	81.0					6																	75904624		1812	4073	5885	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.113A>T	6.37:g.75904624T>A	ENSP00000325146:p.Glu38Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.E38V	ENST00000322507.8	37	c.113	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	T	25.7	4.666821	0.88251	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.59083	0.29;0.29;0.29	5.95	5.95	0.96441	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000001	T	0.72740	0.3498	M	0.79805	2.47	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.75499	-0.3296	10	0.51188	T	0.08	.	16.4116	0.83717	0.0:0.0:0.0:1.0	.	38	Q99715	COCA1_HUMAN	V	38	ENSP00000325146:E38V;ENSP00000412864:E38V;ENSP00000421216:E38V	ENSP00000325146:E38V	E	-	2	0	COL12A1	75961344	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.552000	0.82192	2.276000	0.75962	0.528000	0.53228	GAA	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.343	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	57	0.00	0	T	NM_004370		75904624	75904624	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	20	47.37	18	SNP	1.000	A
CYP46A1	10858	genome.wustl.edu	37	14	100173036	100173036	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr14:100173036G>A	ENST00000261835.3	+	6	600	c.496G>A	c.(496-498)Gag>Aag	p.E166K	CYP46A1_ENST00000554176.1_Missense_Mutation_p.E13K|CYP46A1_ENST00000423126.2_Missense_Mutation_p.E69K	NM_006668.1	NP_006659.1	Q9Y6A2	CP46A_HUMAN	cytochrome P450, family 46, subfamily A, polypeptide 1	166					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|nervous system development (GO:0007399)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	cholesterol 24-hydroxylase activity (GO:0033781)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|prostate(1)|skin(1)	25		Melanoma(154;0.0866)|all_epithelial(191;0.179)				GCAGCTGGTGGAGATTCTAGA	0.552																																						dbGAP											0													102.0	93.0	96.0					14																	100173036		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF094480	CCDS9954.1	14q32.2	2013-05-03	2003-02-14	2003-02-28	ENSG00000036530	ENSG00000036530		"""Cytochrome P450s"""	2641	protein-coding gene	gene with protein product		604087	"""cytochrome P450, subfamily 46 (cholesterol 24-hydroxylase)"""	CYP46		10377398	Standard	NM_006668		Approved		uc001ygo.3	Q9Y6A2	OTTHUMG00000171510	ENST00000261835.3:c.496G>A	14.37:g.100173036G>A	ENSP00000261835:p.Glu166Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHP8|E7EQG9|Q8N2B0	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.E166K	ENST00000261835.3	37	c.496	CCDS9954.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.90|13.90	2.376393|2.376393	0.42105|0.42105	.|.	.|.	ENSG00000036530|ENSG00000036530	ENST00000261835;ENST00000423126;ENST00000554176|ENST00000380228	T;T;T|.	0.69175|.	-0.38;-0.38;-0.38|.	4.17|4.17	3.25|3.25	0.37280|0.37280	.|.	0.285533|.	0.37437|.	N|.	0.002096|.	T|T	0.50905|0.50905	0.1643|0.1643	L|L	0.33137|0.33137	0.985|0.985	0.42707|0.42707	D|D	0.993635|0.993635	B;B;P|.	0.40332|.	0.082;0.007;0.713|.	B;B;B|.	0.37650|.	0.087;0.034;0.255|.	T|T	0.42155|0.42155	-0.9468|-0.9468	10|5	0.31617|.	T|.	0.26|.	.|.	10.4027|10.4027	0.44239|0.44239	0.0:0.1998:0.8001:0.0|0.0:0.1998:0.8001:0.0	.|.	13;166;137|.	Q8N2B0;Q9Y6A2;Q59ER2|.	.;CP46A_HUMAN;.|.	K|E	166;69;13|152	ENSP00000261835:E166K;ENSP00000405779:E69K;ENSP00000450553:E13K|.	ENSP00000261835:E166K|.	E|G	+|+	1|2	0|0	CYP46A1|CYP46A1	99242789|99242789	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.602000|2.602000	0.46257|0.46257	1.008000|1.008000	0.39264|0.39264	0.650000|0.650000	0.86243|0.86243	GAG|GGA	CYP46A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000036530		0.552	CYP46A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP46A1	HGNC	protein_coding	OTTHUMT00000413814.1	44	0.00	0	G			100173036	100173036	+1	no_errors	ENST00000261835	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	A
CYP4F8	11283	genome.wustl.edu	37	19	15730345	15730345	+	RNA	SNP	C	C	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr19:15730345C>A	ENST00000441682.2	+	0	452							P98187	CP4F8_HUMAN	cytochrome P450, family 4, subfamily F, polypeptide 8						icosanoid metabolic process (GO:0006690)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	alkane 1-monooxygenase activity (GO:0018685)|aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|skin(1)	26						GACCCTGAAGCCCTGGCTGGG	0.537																																						dbGAP											0													67.0	70.0	69.0					19																	15730345		2115	4236	6351	-	-	-			0			AF133298	CCDS74303.1	19p13.12	2013-11-11	2003-01-14		ENSG00000186526	ENSG00000186526		"""Cytochrome P450s"""	2648	protein-coding gene	gene with protein product		611545	"""cytochrome P450, subfamily IVF, polypeptide 8"""			10405341	Standard	NM_007253		Approved		uc002nbi.3	P98187	OTTHUMG00000182386		19.37:g.15730345C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000441682.2	37	NULL		19	.	.	.	.	.	.	.	.	.	.	.	14.52	2.559907	0.45590	.	.	ENSG00000186526	ENST00000441682	.	.	.	3.05	3.05	0.35203	.	0.000000	0.64402	U	0.000001	T	0.68860	0.3047	.	.	.	.	.	.	P	0.51147	0.942	P	0.58577	0.841	T	0.79857	-0.1626	7	0.87932	D	0	.	11.9057	0.52711	0.0:1.0:0.0:0.0	.	130	P98187	CP4F8_HUMAN	T	130	.	ENSP00000409702:P130T	P	+	1	0	CYP4F8	15591345	1.000000	0.71417	0.982000	0.44146	0.173000	0.22820	3.779000	0.55379	1.721000	0.51461	0.411000	0.27672	CCC	CYP4F8	-	-	ENSG00000186526		0.537	CYP4F8-201	KNOWN	basic	processed_transcript	CYP4F8	HGNC	processed_transcript		42	0.00	0	C	NM_007253		15730345	15730345	+1	no_errors	ENST00000441682	ensembl	human	known	69_37n	rna	45	27.42	17	SNP	1.000	A
DLGAP4	22839	genome.wustl.edu	37	20	35060467	35060467	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr20:35060467G>A	ENST00000373907.2	+	2	546	c.347G>A	c.(346-348)cGt>cAt	p.R116H	DLGAP4_ENST00000373913.3_Missense_Mutation_p.R116H|DLGAP4_ENST00000339266.5_Missense_Mutation_p.R116H|DLGAP4_ENST00000401952.2_Missense_Mutation_p.R116H			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	116					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				CCCATCCACCGTGATGGCTTC	0.652																																						dbGAP											0													75.0	75.0	75.0					20																	35060467		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	ENST00000373907.2:c.347G>A	20.37:g.35060467G>A	ENSP00000363014:p.Arg116His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation	SNP	pfam_GKAP	p.R116H	ENST00000373907.2	37	c.347		20	.	.	.	.	.	.	.	.	.	.	G	16.43	3.120472	0.56613	.	.	ENSG00000080845	ENST00000373913;ENST00000401952;ENST00000373907;ENST00000339266	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	5.53	5.53	0.82687	.	0.304625	0.32301	N	0.006300	T	0.22936	0.0554	M	0.61703	1.905	0.36833	D	0.886981	D	0.53885	0.963	B	0.40659	0.336	T	0.18871	-1.0323	10	0.48119	T	0.1	.	11.8619	0.52471	0.0794:0.0:0.9206:0.0	.	116	Q9Y2H0-1	.	H	116	ENSP00000363023:R116H;ENSP00000384954:R116H;ENSP00000363014:R116H;ENSP00000341633:R116H	ENSP00000341633:R116H	R	+	2	0	DLGAP4	34493881	1.000000	0.71417	0.928000	0.36995	0.965000	0.64279	4.910000	0.63321	2.590000	0.87494	0.561000	0.74099	CGT	DLGAP4	-	NULL	ENSG00000080845		0.652	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2	33	0.00	0	G	NM_014902		35060467	35060467	+1	no_errors	ENST00000339266	ensembl	human	known	69_37n	missense	46	36.11	26	SNP	0.987	A
DNAH2	146754	genome.wustl.edu	37	17	7640395	7640395	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr17:7640395G>A	ENST00000572933.1	+	8	2449	c.989G>A	c.(988-990)cGt>cAt	p.R330H	DNAH2_ENST00000570791.1_Missense_Mutation_p.R330H|DNAH2_ENST00000082259.3_Missense_Mutation_p.R330H|DNAH2_ENST00000389173.2_Missense_Mutation_p.R330H			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	330	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GATGGCTCTCGTCAAGCACAG	0.403																																						dbGAP											0													110.0	100.0	104.0					17																	7640395		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.989G>A	17.37:g.7640395G>A	ENSP00000458355:p.Arg330His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.R330H	ENST00000572933.1	37	c.989	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	11.24	1.581109	0.28180	.	.	ENSG00000183914	ENST00000360606;ENST00000389173;ENST00000082259	T;T	0.55588	0.51;0.51	5.8	-0.087	0.13679	Dynein heavy chain, domain-1 (1);	3.209450	0.00815	N	0.001525	T	0.37073	0.0990	N	0.19112	0.55	0.09310	N	1	P;B	0.41393	0.748;0.298	B;B	0.41440	0.357;0.119	T	0.24119	-1.0169	10	0.44086	T	0.13	.	0.6821	0.00876	0.2391:0.1251:0.3186:0.3172	.	330;330	Q9P225;Q9P225-3	DYH2_HUMAN;.	H	330	ENSP00000373825:R330H;ENSP00000082259:R330H	ENSP00000082259:R330H	R	+	2	0	DNAH2	7581120	0.000000	0.05858	0.002000	0.10522	0.789000	0.44602	-0.881000	0.04179	0.246000	0.21394	0.655000	0.94253	CGT	DNAH2	-	pfam_Dynein_heavy_dom-1	ENSG00000183914		0.403	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	58	0.00	0	G	NM_020877		7640395	7640395	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.000	A
DNAH7	56171	genome.wustl.edu	37	2	196729475	196729475	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr2:196729475C>A	ENST00000312428.6	-	41	7004	c.6904G>T	c.(6904-6906)Gaa>Taa	p.E2302*		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2302	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TTGTTGTATTCTTCTAGGTGA	0.403																																						dbGAP											0													207.0	199.0	201.0					2																	196729475		1887	4107	5994	-	-	-	SO:0001587	stop_gained	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6904G>T	2.37:g.196729475C>A	ENSP00000311273:p.Glu2302*	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Nonsense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.E2302*	ENST00000312428.6	37	c.6904	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	45	11.975510	0.99623	.	.	ENSG00000118997	ENST00000312428	.	.	.	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	18.2664	0.90053	0.0:1.0:0.0:0.0	.	.	.	.	X	2302	.	ENSP00000311273:E2302X	E	-	1	0	DNAH7	196437720	1.000000	0.71417	0.882000	0.34594	0.017000	0.09413	7.651000	0.83577	2.652000	0.90054	0.460000	0.39030	GAA	DNAH7	-	NULL	ENSG00000118997		0.403	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	95	0.00	0	C	NM_018897		196729475	196729475	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	nonsense	39	32.76	19	SNP	1.000	A
DSG2	1829	genome.wustl.edu	37	18	29100768	29100768	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr18:29100768A>G	ENST00000261590.8	+	4	428	c.219A>G	c.(217-219)atA>atG	p.I73M	DSG2_ENST00000585206.1_Missense_Mutation_p.I73M	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	73	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			TATGTTAGATACATTCTGATC	0.318																																						dbGAP											0													50.0	47.0	48.0					18																	29100768		1797	4066	5863	-	-	-	SO:0001583	missense	0			Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.219A>G	18.37:g.29100768A>G	ENSP00000261590:p.Ile73Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KKU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin	p.I73M	ENST00000261590.8	37	c.219	CCDS42423.1	18	.	.	.	.	.	.	.	.	.	.	A	7.495	0.651567	0.14516	.	.	ENSG00000046604	ENST00000261590	T	0.62941	-0.01	5.95	0.357	0.16079	Cadherin (3);Cadherin-like (1);	0.000000	0.42682	U	0.000663	T	0.53948	0.1828	L	0.61218	1.895	0.36982	D	0.894328	P	0.35433	0.501	B	0.39660	0.306	T	0.54476	-0.8288	10	0.87932	D	0	.	2.348	0.04276	0.3639:0.2343:0.0628:0.339	.	73	Q14126	DSG2_HUMAN	M	73	ENSP00000261590:I73M	ENSP00000261590:I73M	I	+	3	3	DSG2	27354766	0.997000	0.39634	1.000000	0.80357	0.366000	0.29705	0.635000	0.24629	0.113000	0.18004	0.533000	0.62120	ATA	DSG2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000046604		0.318	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG2	HGNC	protein_coding	OTTHUMT00000447506.1	45	0.00	0	A	NM_001943		29100768	29100768	+1	no_errors	ENST00000261590	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	0.996	G
EFTUD1	79631	genome.wustl.edu	37	15	82450087	82450087	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr15:82450087T>C	ENST00000268206.7	-	17	2165	c.1997A>G	c.(1996-1998)cAc>cGc	p.H666R	EFTUD1_ENST00000359445.3_Missense_Mutation_p.H615R	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	666					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						TCGCTGAAGGTGGACTTCTCC	0.423																																						dbGAP											0													169.0	165.0	166.0					15																	82450087		1927	4125	6052	-	-	-	SO:0001583	missense	0			AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.1997A>G	15.37:g.82450087T>C	ENSP00000268206:p.His666Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY5|B7Z6I0|Q9H8Z6	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Elongation_fac_G/III/V,superfamily_Transl_elong_init/rib_B-barrel,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.H666R	ENST00000268206.7	37	c.1997	CCDS42071.1	15	.	.	.	.	.	.	.	.	.	.	T	27.6	4.843121	0.91197	.	.	ENSG00000140598	ENST00000268206;ENST00000359445	D;D	0.83992	-1.79;-1.79	5.84	5.84	0.93424	Elongation factor G/III/V (1);	0.000000	0.44483	D	0.000450	D	0.93200	0.7834	M	0.92268	3.29	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94666	0.7852	10	0.87932	D	0	-8.1482	16.2047	0.82120	0.0:0.0:0.0:1.0	.	615;666	Q7Z2Z2-2;Q7Z2Z2	.;ETUD1_HUMAN	R	666;615	ENSP00000268206:H666R;ENSP00000352418:H615R	ENSP00000268206:H666R	H	-	2	0	EFTUD1	80237142	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.658000	0.83755	2.216000	0.71823	0.533000	0.62120	CAC	EFTUD1	-	superfamily_Elongation_fac_G/III/V	ENSG00000140598		0.423	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	HGNC	protein_coding	OTTHUMT00000419252.1	57	0.00	0	T	NM_024580		82450087	82450087	-1	no_errors	ENST00000268206	ensembl	human	known	69_37n	missense	50	19.05	12	SNP	1.000	C
PDXDC2P	283970	genome.wustl.edu	37	16	70011737	70011737	+	RNA	SNP	T	T	C	rs199849939	byFrequency	TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr16:70011737T>C	ENST00000531894.1	-	0	2724				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										CAGGGCCCATTTGCTATTACA	0.438													t|||	927	0.185104	0.0227	0.3228	5008	,	,		20508	0.0833		0.4046	False		,,,				2504	0.1861					dbGAP											0																																										-	-	-			0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70011737T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			RP11-419C5.2	-	-	ENSG00000226232		0.438	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	13	0.00	0	T			70011737	70011737	-1	no_errors	ENST00000525562	ensembl	human	known	69_37n	rna	3	66.67	6	SNP	0.002	C
EOGT	285203	genome.wustl.edu	37	3	69054340	69054340	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr3:69054340C>T	ENST00000383701.3	-	7	1208	c.466G>A	c.(466-468)Gca>Aca	p.A156T	EOGT_ENST00000540764.1_Missense_Mutation_p.A55T|EOGT_ENST00000295571.5_Missense_Mutation_p.A156T|EOGT_ENST00000540955.1_5'UTR	NM_001278689.1	NP_001265618.1	Q5NDL2	EOGT_HUMAN	EGF domain-specific O-linked N-acetylglucosamine (GlcNAc) transferase	156					protein O-linked glycosylation (GO:0006493)	endoplasmic reticulum (GO:0005783)	protein N-acetylglucosaminyltransferase activity (GO:0016262)										AGATTGGTTGCTCTGCAGTAC	0.353																																						dbGAP											0													123.0	124.0	124.0					3																	69054340		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091089	CCDS2908.1, CCDS63684.1	3p14.1	2013-10-11	2012-05-21	2012-05-21	ENSG00000163378	ENSG00000163378	2.4.1.255		28526	protein-coding gene	gene with protein product	"""AER61 glycosyltransferase"""	614789	"""chromosome 3 open reading frame 64"""	C3orf64		22310717	Standard	NM_001278689		Approved	AER61, FLJ33770	uc003dnk.3	Q5NDL2	OTTHUMG00000156279	ENST00000383701.3:c.466G>A	3.37:g.69054340C>T	ENSP00000373206:p.Ala156Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U1|B4DFH5|L7X1M5|Q6MZY0|Q6P985|Q6ZTV0	Missense_Mutation	SNP	pfam_Glycosyltransferase_AER61	p.A156T	ENST00000383701.3	37	c.466		3	.	.	.	.	.	.	.	.	.	.	C	21.2	4.118671	0.77323	.	.	ENSG00000163378	ENST00000383701;ENST00000295571;ENST00000540764	T;T;T	0.07021	3.23;3.23;3.23	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	T	0.28797	0.0714	M	0.67700	2.07	0.80722	D	1	P;D	0.89917	0.862;1.0	B;D	0.87578	0.388;0.998	T	0.01323	-1.1385	10	0.59425	D	0.04	-11.5131	17.9693	0.89108	0.0:1.0:0.0:0.0	.	156;156	Q5NDL2;Q5NDL2-3	AER61_HUMAN;.	T	156;156;55	ENSP00000373206:A156T;ENSP00000295571:A156T;ENSP00000443780:A55T	ENSP00000295571:A156T	A	-	1	0	C3orf64	69137030	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	5.967000	0.70403	2.417000	0.82017	0.591000	0.81541	GCA	EOGT	-	pfam_Glycosyltransferase_AER61	ENSG00000163378		0.353	EOGT-002	KNOWN	basic|appris_principal	protein_coding	EOGT	HGNC	protein_coding	OTTHUMT00000343722.1	56	0.00	0	C	NM_173654		69054340	69054340	-1	no_errors	ENST00000383701	ensembl	human	known	69_37n	missense	44	26.67	16	SNP	1.000	T
RMDN3	55177	genome.wustl.edu	37	15	41028781	41028781	+	Silent	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr15:41028781G>A	ENST00000260385.6	-	12	2438	c.1371C>T	c.(1369-1371)atC>atT	p.I457I	RMDN3_ENST00000338376.3_Silent_p.I457I|RMDN3_ENST00000558560.1_5'Flank			Q96TC7	RMD3_HUMAN	regulator of microtubule dynamics 3	457					apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cellular calcium ion homeostasis (GO:0006874)	integral component of membrane (GO:0016021)|microtubule (GO:0005874)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											GGTCCTTCTGGATAGCCAAAT	0.473																																						dbGAP											0													83.0	80.0	81.0					15																	41028781		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001441	CCDS10063.1	15q15.1	2013-01-11	2013-01-11	2013-01-11	ENSG00000137824	ENSG00000137824			25550	protein-coding gene	gene with protein product		611873	"""family with sequence similarity 82, member A2"""	FAM82C, FAM82A2		12975309	Standard	XM_005254531		Approved	FLJ10579, PTPIP51, RMD3	uc001zmp.1	Q96TC7	OTTHUMG00000130066	ENST00000260385.6:c.1371C>T	15.37:g.41028781G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9UMZ9|B3KRR3|Q6ZWE9|Q96H23|Q96SD6|Q9H6G1|Q9NVQ6	Missense_Mutation	SNP	NULL	p.P293S	ENST00000260385.6	37	c.877	CCDS10063.1	15																																																																																			FAM82A2	-	NULL	ENSG00000137824		0.473	RMDN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM82A2	HGNC	protein_coding	OTTHUMT00000252357.1	57	0.00	0	G	NM_018145		41028781	41028781	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000558232	ensembl	human	novel	69_37n	missense	35	35.19	19	SNP	1.000	A
FUT5	2527	genome.wustl.edu	37	19	5867086	5867086	+	Silent	SNP	C	C	T	rs189013086	byFrequency	TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr19:5867086C>T	ENST00000588525.1	-	2	738	c.651G>A	c.(649-651)tcG>tcA	p.S217S	FUT5_ENST00000252675.5_Silent_p.S217S	NM_002034.2	NP_002025.2	Q11128	FUT5_HUMAN	fucosyltransferase 5 (alpha (1,3) fucosyltransferase)	217					carbohydrate metabolic process (GO:0005975)|fucosylation (GO:0036065)|L-fucose catabolic process (GO:0042355)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase activity (GO:0017060)|alpha-(1->3)-fucosyltransferase activity (GO:0046920)|fucosyltransferase activity (GO:0008417)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12						GCACCCTGGCCGAGTCCGGCT	0.677																																						dbGAP											0													65.0	62.0	63.0					19																	5867086		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS12154.1	19p13.3	2013-02-26				ENSG00000130383	2.4.1.65	"""Fucosyltransferases"""	4016	protein-coding gene	gene with protein product		136835				1740457	Standard	NM_002034		Approved	FUC-TV	uc002mdo.4	Q11128	OTTHUMG00000180616	ENST00000588525.1:c.651G>A	19.37:g.5867086C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X2	Silent	SNP	pfam_Glyco_trans_10	p.S217	ENST00000588525.1	37	c.651	CCDS12154.1	19																																																																																			FUT5	-	pfam_Glyco_trans_10	ENSG00000130383		0.677	FUT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT5	HGNC	protein_coding	OTTHUMT00000452213.1	8	0.00	0	C	NM_002034		5867086	5867086	-1	no_errors	ENST00000252675	ensembl	human	known	69_37n	silent	4	63.64	7	SNP	0.000	T
GIGYF1	64599	genome.wustl.edu	37	7	100284283	100284283	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr7:100284283G>A	ENST00000275732.5	-	7	1892	c.683C>T	c.(682-684)tCc>tTc	p.S228F	GIGYF1_ENST00000471340.2_Intron	NM_022574.4	NP_072096.2	O75420	PERQ1_HUMAN	GRB10 interacting GYF protein 1	228					insulin-like growth factor receptor signaling pathway (GO:0048009)					central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23	Lung NSC(181;0.035)|all_lung(186;0.0509)|Esophageal squamous(72;0.0817)					AGGGCTGGCGGAGCGCCAGCG	0.692																																						dbGAP											0													30.0	37.0	35.0					7																	100284283		2190	4279	6469	-	-	-	SO:0001583	missense	0			AF053356	CCDS34708.1	7q22	2008-02-11	2008-02-11	2008-02-11	ENSG00000146830	ENSG00000146830			9126	protein-coding gene	gene with protein product	"""GYF domain containing 1"""	612064	"""PERQ amino acid rich, with GYF domain 1"""	PERQ1		9799793, 12771153	Standard	NM_022574		Approved	GYF1	uc003uwg.1	O75420	OTTHUMG00000157036	ENST00000275732.5:c.683C>T	7.37:g.100284283G>A	ENSP00000275732:p.Ser228Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6Y7W7|Q8WZ38	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.S228F	ENST00000275732.5	37	c.683	CCDS34708.1	7	.	.	.	.	.	.	.	.	.	.	.	17.54	3.415444	0.62511	.	.	ENSG00000146830	ENST00000275732	D	0.84146	-1.81	4.96	4.05	0.47172	.	0.813418	0.11234	N	0.585312	T	0.80369	0.4610	L	0.36672	1.1	0.39798	D	0.972531	B	0.22480	0.07	B	0.26614	0.071	T	0.75841	-0.3175	10	0.62326	D	0.03	-5.7768	11.0151	0.47685	0.0:0.1882:0.8118:0.0	.	228	O75420	PERQ1_HUMAN	F	228	ENSP00000275732:S228F	ENSP00000275732:S228F	S	-	2	0	GIGYF1	100122219	0.995000	0.38212	0.764000	0.31436	0.799000	0.45148	2.848000	0.48278	1.274000	0.44362	0.563000	0.77884	TCC	GIGYF1	-	NULL	ENSG00000146830		0.692	GIGYF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIGYF1	HGNC	protein_coding	OTTHUMT00000347205.2	8	0.00	0	G	NM_022574		100284283	100284283	-1	no_errors	ENST00000275732	ensembl	human	known	69_37n	missense	10	52.38	11	SNP	0.591	A
GSK3B	2932	genome.wustl.edu	37	3	119812255	119812255	+	Silent	SNP	G	G	C			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr3:119812255G>C	ENST00000264235.8	-	1	1009	c.27C>G	c.(25-27)tcC>tcG	p.S9S	RP11-18H7.1_ENST00000469070.1_lincRNA|GSK3B_ENST00000316626.5_Silent_p.S9S	NM_001146156.1|NM_002093.3	NP_001139628.1|NP_002084.2	P49841	GSK3B_HUMAN	glycogen synthase kinase 3 beta	9					axon guidance (GO:0007411)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell migration (GO:0016477)|cellular response to interleukin-3 (GO:0036016)|cellular response to mechanical stimulus (GO:0071260)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial to mesenchymal transition (GO:0001837)|ER overload response (GO:0006983)|establishment of cell polarity (GO:0030010)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|fat cell differentiation (GO:0045444)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glycogen metabolic process (GO:0005977)|hippocampus development (GO:0021766)|hypermethylation of CpG island (GO:0044027)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|myoblast fusion (GO:0007520)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cardiac muscle hypertrophy (GO:0010614)|negative regulation of dendrite morphogenesis (GO:0050774)|negative regulation of glycogen (starch) synthase activity (GO:2000466)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of neuron maturation (GO:0014043)|negative regulation of neuron projection development (GO:0010977)|negative regulation of NFAT protein import into nucleus (GO:0051534)|negative regulation of protein binding (GO:0032091)|negative regulation of protein complex assembly (GO:0031333)|negative regulation of type B pancreatic cell development (GO:2000077)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901030)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein binding (GO:0032092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of stem cell differentiation (GO:2000738)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|protein localization to microtubule (GO:0035372)|protein phosphorylation (GO:0006468)|re-entry into mitotic cell cycle (GO:0000320)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of microtubule-based process (GO:0032886)|regulation of neuronal synaptic plasticity (GO:0048168)|response to drug (GO:0042493)|response to lithium ion (GO:0010226)|superior temporal gyrus development (GO:0071109)	beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|kinase activity (GO:0016301)|NF-kappaB binding (GO:0051059)|p53 binding (GO:0002039)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II transcription factor binding (GO:0001085)|tau-protein kinase activity (GO:0050321)|ubiquitin protein ligase binding (GO:0031625)			endometrium(1)|large_intestine(8)|lung(7)|prostate(2)	18				GBM - Glioblastoma multiforme(114;0.24)	Lithium(DB01356)	TCTCCGCAAAGGAGGTGGTTC	0.493																																						dbGAP											0													101.0	105.0	104.0					3																	119812255		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC012760	CCDS2996.1, CCDS54628.1	3q13.3	2008-02-15			ENSG00000082701	ENSG00000082701			4617	protein-coding gene	gene with protein product		605004				10486203	Standard	NM_002093		Approved		uc003edm.3	P49841	OTTHUMG00000133765	ENST00000264235.8:c.27C>G	3.37:g.119812255G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN89|Q9BWH3|Q9UL47	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S9	ENST00000264235.8	37	c.27	CCDS54628.1	3																																																																																			GSK3B	-	NULL	ENSG00000082701		0.493	GSK3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GSK3B	HGNC	protein_coding	OTTHUMT00000258240.2	18	0.00	0	G			119812255	119812255	-1	no_errors	ENST00000316626	ensembl	human	known	69_37n	silent	26	18.75	6	SNP	1.000	C
HAS1	3036	genome.wustl.edu	37	19	52217080	52217080	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr19:52217080G>A	ENST00000222115.1	-	5	1371	c.1337C>T	c.(1336-1338)gCg>gTg	p.A446V	HAS1_ENST00000601714.1_Missense_Mutation_p.A453V|HAS1_ENST00000540069.2_Missense_Mutation_p.A445V	NM_001523.2	NP_001514.2	Q92839	HYAS1_HUMAN	hyaluronan synthase 1	446					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|extracellular matrix assembly (GO:0085029)|extracellular polysaccharide biosynthetic process (GO:0045226)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan biosynthetic process (GO:0030213)|hyaluronan metabolic process (GO:0030212)|negative regulation of fibroblast migration (GO:0010764)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronan synthase activity (GO:0050501)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	40		all_neural(266;0.0189)|Medulloblastoma(540;0.146)		GBM - Glioblastoma multiforme(134;0.00102)|OV - Ovarian serous cystadenocarcinoma(262;0.0177)		CGCGAAGGCCGCCTTGGCCAG	0.692																																					NSCLC(132;636 2450 45807 47979)	dbGAP											0													18.0	18.0	18.0					19																	52217080		2186	4274	6460	-	-	-	SO:0001583	missense	0			U59269	CCDS12838.1, CCDS74436.1	19q13.3-q13.4	2013-02-22			ENSG00000105509	ENSG00000105509	2.4.1.212	"""Glycosyltransferase family 2 domain containing"""	4818	protein-coding gene	gene with protein product		601463		HAS		9169154	Standard	XM_005258834		Approved		uc002pxo.1	Q92839		ENST00000222115.1:c.1337C>T	19.37:g.52217080G>A	ENSP00000222115:p.Ala446Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14470|Q9NS49	Missense_Mutation	SNP	pfam_Chitin_synth_fng,pfam_Glyco_trans_2	p.A446V	ENST00000222115.1	37	c.1337	CCDS12838.1	19	.	.	.	.	.	.	.	.	.	.	g	20.1	3.939681	0.73557	.	.	ENSG00000105509	ENST00000540069;ENST00000222115	T;T	0.32023	1.47;1.47	3.22	3.22	0.36961	.	0.067695	0.64402	U	0.000020	T	0.37210	0.0995	L	0.39147	1.195	0.58432	D	0.999998	D;D;D	0.59767	0.983;0.986;0.986	P;P;P	0.55749	0.783;0.686;0.686	T	0.22382	-1.0218	10	0.56958	D	0.05	-8.8629	12.2907	0.54817	0.0:0.0:1.0:0.0	.	445;446;445	G3V1S7;Q92839;Q8IYH3	.;HAS1_HUMAN;.	V	445;446	ENSP00000445021:A445V;ENSP00000222115:A446V	ENSP00000222115:A446V	A	-	2	0	HAS1	56908892	1.000000	0.71417	1.000000	0.80357	0.312000	0.27988	7.315000	0.78998	1.816000	0.52996	0.174000	0.16983	GCG	HAS1	-	NULL	ENSG00000105509		0.692	HAS1-005	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	HAS1	HGNC	protein_coding	OTTHUMT00000466953.1	12	0.00	0	G	NM_001523		52217080	52217080	-1	no_errors	ENST00000222115	ensembl	human	known	69_37n	missense	3	57.14	4	SNP	1.000	A
HEATR5B	54497	genome.wustl.edu	37	2	37267505	37267505	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr2:37267505delC	ENST00000233099.5	-	20	3108	c.3013delG	c.(3013-3015)gctfs	p.A1005fs	HEATR5B_ENST00000354531.2_Frame_Shift_Del_p.A1005fs	NM_019024.1	NP_061897.1	Q9P2D3	HTR5B_HUMAN	HEAT repeat containing 5B	1005						extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(3)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|pancreas(1)|prostate(1)|skin(10)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	77		all_hematologic(82;0.21)				GTTATTATAGCACCCAAGCAT	0.383																																						dbGAP											0													186.0	163.0	171.0					2																	37267505		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB037835	CCDS33181.1	2p22.2	2007-01-02			ENSG00000008869	ENSG00000008869			29273	protein-coding gene	gene with protein product						10718198	Standard	XM_005264379		Approved	KIAA1414, DKFZp686P15184	uc002rpp.1	Q9P2D3	OTTHUMG00000152158	ENST00000233099.5:c.3013delG	2.37:g.37267505delC	ENSP00000233099:p.Ala1005fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDU8|Q7Z3B2|Q9NVL7	Frame_Shift_Del	DEL	superfamily_ARM-type_fold	p.A1005fs	ENST00000233099.5	37	c.3013	CCDS33181.1	2																																																																																			HEATR5B	-	superfamily_ARM-type_fold	ENSG00000008869		0.383	HEATR5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR5B	HGNC	protein_coding	OTTHUMT00000325492.1	30	0.00	0	C	NM_019024		37267505	37267505	-1	no_errors	ENST00000233099	ensembl	human	known	69_37n	frame_shift_del	16	45.45	15	DEL	1.000	-
HNRNPA0	10949	genome.wustl.edu	37	5	137089510	137089510	+	Silent	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr5:137089510C>T	ENST00000314940.4	-	1	529	c.246G>A	c.(244-246)gcG>gcA	p.A82A		NM_006805.3	NP_006796.1	Q13151	ROA0_HUMAN	heterogeneous nuclear ribonucleoprotein A0	82	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|response to lipopolysaccharide (GO:0032496)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)			large_intestine(1)|lung(2)|skin(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			CCCGGGACACCGCCCGCTTCA	0.657																																						dbGAP											0													49.0	53.0	52.0					5																	137089510		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U23803	CCDS4193.1	5q31	2013-02-12		2007-08-16	ENSG00000177733	ENSG00000177733		"""RNA binding motif (RRM) containing"""	5030	protein-coding gene	gene with protein product		609409		HNRPA0		7585247	Standard	NM_006805		Approved	hnRNPA0	uc003lbt.3	Q13151	OTTHUMG00000129156	ENST00000314940.4:c.246G>A	5.37:g.137089510C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IB18	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.A82	ENST00000314940.4	37	c.246	CCDS4193.1	5																																																																																			HNRNPA0	-	pfscan_RRM_dom	ENSG00000177733		0.657	HNRNPA0-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPA0	HGNC	protein_coding	OTTHUMT00000251221.1	16	0.00	0	C	NM_006805		137089510	137089510	-1	no_errors	ENST00000314940	ensembl	human	known	69_37n	silent	14	41.67	10	SNP	1.000	T
KCNV2	169522	genome.wustl.edu	37	9	2718185	2718186	+	In_Frame_Ins	INS	-	-	CTT			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr9:2718185_2718186insCTT	ENST00000382082.3	+	1	684_685	c.446_447insCTT	c.(445-450)tacttc>taCTTcttc	p.151_152insF		NM_133497.3	NP_598004.1	Q8TDN2	KCNV2_HUMAN	potassium channel, subfamily V, member 2	151					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(7)|lung(9)|ovary(1)|prostate(2)|skin(2)	35				GBM - Glioblastoma multiforme(50;0.0257)		ACAGACGAATACTTCTTCGACC	0.658																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AF348983	CCDS6447.1	9p24.2	2011-07-05			ENSG00000168263	ENSG00000168263		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19698	protein-coding gene	gene with protein product		607604				12060745, 16382104	Standard	NM_133497		Approved	Kv8.2	uc003zho.2	Q8TDN2	OTTHUMG00000019449	ENST00000382082.3:c.450_452dupCTT	9.37:g.2718189_2718191dupCTT	ENSP00000371514:p.Phe151_Phe151dup	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6X0	In_Frame_Ins	INS	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.152in_frame_insF	ENST00000382082.3	37	c.446_447	CCDS6447.1	9																																																																																			KCNV2	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	ENSG00000168263		0.658	KCNV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV2	HGNC	protein_coding	OTTHUMT00000051528.1	16	0.00	0	-	NM_133497		2718185	2718186	+1	no_errors	ENST00000382082	ensembl	human	known	69_37n	in_frame_ins	6	25.00	2	INS	1.000:1.000	CTT
KIAA0232	9778	genome.wustl.edu	37	4	6863905	6863905	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr4:6863905G>C	ENST00000307659.5	+	7	2251	c.1796G>C	c.(1795-1797)gGt>gCt	p.G599A	KIAA0232_ENST00000425103.1_Missense_Mutation_p.G599A	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	599							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						TCCAGCTCCGGTGATGCTGAT	0.512																																						dbGAP											0													141.0	132.0	135.0					4																	6863905		1960	4161	6121	-	-	-	SO:0001583	missense	0			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.1796G>C	4.37:g.6863905G>C	ENSP00000303928:p.Gly599Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2D2	Missense_Mutation	SNP	NULL	p.G599A	ENST00000307659.5	37	c.1796	CCDS43209.1	4	.	.	.	.	.	.	.	.	.	.	G	7.463	0.645106	0.14451	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.7	5.7	0.88788	.	0.053942	0.85682	D	0.000000	T	0.60090	0.2242	L	0.60455	1.87	0.49582	D	0.999809	D	0.55605	0.972	P	0.48840	0.592	T	0.55835	-0.8078	9	0.22706	T	0.39	-15.6028	14.6392	0.68711	0.0:0.0:0.8545:0.1455	.	599	Q92628	K0232_HUMAN	A	599	.	ENSP00000303928:G599A	G	+	2	0	KIAA0232	6914806	0.999000	0.42202	0.504000	0.27639	0.374000	0.29953	3.244000	0.51399	2.678000	0.91216	0.655000	0.94253	GGT	KIAA0232	-	NULL	ENSG00000170871		0.512	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0232	HGNC	protein_coding	OTTHUMT00000359102.2	79	0.00	0	G	NM_014743		6863905	6863905	+1	no_errors	ENST00000307659	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.988	C
KLHL34	257240	genome.wustl.edu	37	X	21674415	21674415	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chrX:21674415C>T	ENST00000379499.2	-	1	2033	c.1492G>A	c.(1492-1494)Gtc>Atc	p.V498I		NM_153270.1	NP_695002.1	Q8N239	KLH34_HUMAN	kelch-like family member 34	498						extracellular space (GO:0005615)				cervix(1)|endometrium(7)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|urinary_tract(1)	26						GGGCCCAGGACGTATAAGTCC	0.672																																						dbGAP											0													35.0	21.0	25.0					X																	21674415		2201	4299	6500	-	-	-	SO:0001583	missense	0			AK092279	CCDS14199.1	Xp22.12	2013-02-22	2013-02-22		ENSG00000185915	ENSG00000185915		"""Kelch-like"", ""BTB/POZ domain containing"""	26634	protein-coding gene	gene with protein product			"""kelch-like 34 (Drosophila)"""				Standard	NM_153270		Approved	FLJ34960, RP11-450P7.3	uc004czz.1	Q8N239	OTTHUMG00000021234	ENST00000379499.2:c.1492G>A	X.37:g.21674415C>T	ENSP00000368813:p.Val498Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V498I	ENST00000379499.2	37	c.1492	CCDS14199.1	X	.	.	.	.	.	.	.	.	.	.	C	1.930	-0.446260	0.04604	.	.	ENSG00000185915	ENST00000379499	T	0.52295	0.67	4.88	0.747	0.18371	Kelch-type beta propeller (1);	0.917456	0.09224	N	0.831575	T	0.40448	0.1117	L	0.39326	1.205	0.09310	N	1	B	0.24823	0.112	B	0.19391	0.025	T	0.24657	-1.0154	10	0.23891	T	0.37	.	15.7654	0.78123	0.7346:0.2654:0.0:0.0	.	498	Q8N239	KLH34_HUMAN	I	498	ENSP00000368813:V498I	ENSP00000368813:V498I	V	-	1	0	KLHL34	21584336	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	-0.181000	0.09740	-0.179000	0.10654	0.513000	0.50165	GTC	KLHL34	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000185915		0.672	KLHL34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL34	HGNC	protein_coding	OTTHUMT00000056022.1	14	0.00	0	C	NM_153270		21674415	21674415	-1	no_errors	ENST00000379499	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.000	T
LARP4B	23185	genome.wustl.edu	37	10	871204	871204	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr10:871204G>C	ENST00000316157.3	-	12	1325	c.1285C>G	c.(1285-1287)Cct>Gct	p.P429A		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	429					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)	p.P429S(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						AATAACCCAGGTCCCCTCTCT	0.398																																						dbGAP											1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)											111.0	119.0	116.0					10																	871204		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1285C>G	10.37:g.871204G>C	ENSP00000326128:p.Pro429Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.P429A	ENST00000316157.3	37	c.1285	CCDS31131.1	10	.	.	.	.	.	.	.	.	.	.	G	8.505	0.865237	0.17250	.	.	ENSG00000107929	ENST00000316157	T	0.29142	1.58	5.57	3.71	0.42584	.	0.198228	0.53938	N	0.000041	T	0.14356	0.0347	N	0.11000	0.08	0.48830	D	0.999717	B	0.02656	0.0	B	0.06405	0.002	T	0.08432	-1.0722	10	0.23891	T	0.37	-12.9374	7.0614	0.25127	0.0682:0.1257:0.6757:0.1304	.	429	Q92615	LAR4B_HUMAN	A	429	ENSP00000326128:P429A	ENSP00000326128:P429A	P	-	1	0	LARP4B	861204	1.000000	0.71417	0.984000	0.44739	0.729000	0.41735	1.490000	0.35573	0.718000	0.32166	0.655000	0.94253	CCT	LARP4B	-	NULL	ENSG00000107929		0.398	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	44	0.00	0	G	NM_015155		871204	871204	-1	no_errors	ENST00000316157	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.996	C
LIPT1	51601	genome.wustl.edu	37	2	99778781	99778781	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr2:99778781delA	ENST00000393473.2	+	3	585	c.361delA	c.(361-363)aaafs	p.K123fs	LIPT1_ENST00000393474.3_Frame_Shift_Del_p.K123fs|LIPT1_ENST00000340066.1_Frame_Shift_Del_p.K123fs|LIPT1_ENST00000393471.2_Frame_Shift_Del_p.K123fs|LIPT1_ENST00000393477.3_Frame_Shift_Del_p.K123fs|MRPL30_ENST00000410042.1_Intron	NM_001204830.1|NM_015929.3	NP_001191759.1|NP_057013.1	Q9Y234	LIPT_HUMAN	lipoyltransferase 1	123	BPL/LPL catalytic. {ECO:0000255|PROSITE- ProRule:PRU01067}.				cellular protein modification process (GO:0006464)|lipid metabolic process (GO:0006629)|protein lipoylation (GO:0009249)	mitochondrion (GO:0005739)	transferase activity, transferring acyl groups (GO:0016746)			large_intestine(6)|lung(1)	7					Lipoic Acid(DB00166)	CTTTACAACCAAAAAAAAGTA	0.388																																					GBM(84;665 1268 21657 25485 30647)	dbGAP											0													47.0	46.0	46.0					2																	99778781		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB017566	CCDS2039.1	2q11.2	2010-11-25			ENSG00000144182	ENSG00000144182	2.3.1.181		29569	protein-coding gene	gene with protein product		610284				10103005	Standard	NM_145197		Approved	MGC12290, MGC13378	uc002szq.4	Q9Y234	OTTHUMG00000130640	ENST00000393473.2:c.361delA	2.37:g.99778781delA	ENSP00000377115:p.Lys123fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFZ1	Frame_Shift_Del	DEL	pfam_BPL_LipA_LipB,tigrfam_LipoylTrfase_LipoateP_Ligase	p.K123fs	ENST00000393473.2	37	c.361	CCDS2039.1	2																																																																																			LIPT1	-	pfam_BPL_LipA_LipB,tigrfam_LipoylTrfase_LipoateP_Ligase	ENSG00000144182		0.388	LIPT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIPT1	HGNC	protein_coding	OTTHUMT00000253128.1	34	0.00	0	A	NM_015929		99778781	99778781	+1	no_errors	ENST00000340066	ensembl	human	known	69_37n	frame_shift_del	16	11.11	2	DEL	0.994	-
LRRC37A3	374819	genome.wustl.edu	37	17	62892271	62892271	+	Missense_Mutation	SNP	A	A	T	rs62071406		TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr17:62892271A>T	ENST00000584306.1	-	3	1635	c.1105T>A	c.(1105-1107)Tct>Act	p.S369T	RP11-927P21.1_ENST00000584131.1_RNA|LRRC37A3_ENST00000339474.5_Intron|LRRC37A3_ENST00000400877.3_Intron|LRRC37A3_ENST00000319651.5_Missense_Mutation_p.S369T|RP11-927P21.1_ENST00000577938.1_RNA|LRRC37A3_ENST00000577487.1_5'Flank|RP11-927P21.1_ENST00000584959.1_RNA	NM_199340.2	NP_955372.2	O60309	L37A3_HUMAN	leucine rich repeat containing 37, member A3	369						integral component of membrane (GO:0016021)				NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|liver(1)|lung(10)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						TCCCTAGAAGACTCAGAAGGC	0.537																																						dbGAP											0													25.0	32.0	30.0					17																	62892271		1973	4078	6051	-	-	-	SO:0001583	missense	0			AB011135	CCDS32708.1	17q24.1	2008-10-22			ENSG00000176809	ENSG00000176809			32427	protein-coding gene	gene with protein product							Standard	NM_199340		Approved	FLJ34306, KIAA0563	uc031rbi.1	O60309	OTTHUMG00000132307	ENST00000584306.1:c.1105T>A	17.37:g.62892271A>T	ENSP00000464535:p.Ser369Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A01|Q49A80|Q8NB33	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.S369T	ENST00000584306.1	37	c.1105	CCDS32708.1	17	.	.	.	.	.	.	.	.	.	.	.	3.342	-0.134342	0.06711	.	.	ENSG00000176809	ENST00000319651	T	0.58506	0.33	2.69	-3.39	0.04868	.	.	.	.	.	T	0.43010	0.1228	L	0.31294	0.92	0.09310	N	1	P	0.52061	0.95	P	0.46718	0.525	T	0.36890	-0.9729	9	0.56958	D	0.05	.	3.9507	0.09368	0.5048:0.1903:0.3049:0.0	.	369	O60309	L37A3_HUMAN	T	369	ENSP00000325713:S369T	ENSP00000325713:S369T	S	-	1	0	LRRC37A3	60322733	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.093000	0.03362	-0.631000	0.05560	0.234000	0.17832	TCT	LRRC37A3	-	NULL	ENSG00000176809		0.537	LRRC37A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A3	HGNC	protein_coding	OTTHUMT00000445377.1	9	0.00	0	A	NM_199340		62892271	62892271	-1	no_errors	ENST00000319651	ensembl	human	known	69_37n	missense	15	33.33	8	SNP	0.000	T
MAP3K1	4214	genome.wustl.edu	37	5	56180496	56180496	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr5:56180496delT	ENST00000399503.3	+	16	3825	c.3825delT	c.(3823-3825)actfs	p.T1275fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1275	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		AACAGGTGACTTATGTCAGAA	0.343																																						dbGAP											0													88.0	78.0	81.0					5																	56180496		1870	4099	5969	-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3825delT	5.37:g.56180496delT	ENSP00000382423:p.Thr1275fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.Y1276fs	ENST00000399503.3	37	c.3825	CCDS43318.1	5																																																																																			MAP3K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095015		0.343	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	64	0.00	0	T	XM_042066		56180496	56180496	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	8	77.50	31	DEL	0.460	-
KMT2C	58508	genome.wustl.edu	37	7	151891154	151891154	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr7:151891154G>A	ENST00000262189.6	-	31	4818	c.4600C>T	c.(4600-4602)Cag>Tag	p.Q1534*	KMT2C_ENST00000355193.2_Nonsense_Mutation_p.Q1534*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1534					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GGAGTTGGCTGAGTGTTCGCA	0.393																																						dbGAP											0													140.0	127.0	132.0					7																	151891154		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.4600C>T	7.37:g.151891154G>A	ENSP00000262189:p.Gln1534*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q1534*	ENST00000262189.6	37	c.4600	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	44	11.169334	0.99525	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	5.42	5.42	0.78866	.	0.164890	0.28555	N	0.014929	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	19.2266	0.93820	0.0:0.0:1.0:0.0	.	.	.	.	X	1534	.	ENSP00000262189:Q1534X	Q	-	1	0	MLL3	151522087	1.000000	0.71417	0.939000	0.37840	0.431000	0.31685	6.667000	0.74451	2.521000	0.84997	0.650000	0.86243	CAG	MLL3	-	NULL	ENSG00000055609		0.393	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	82	0.00	0	G			151891154	151891154	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	nonsense	21	66.67	42	SNP	0.998	A
MRPS18B	28973	genome.wustl.edu	37	6	30587568	30587568	+	Silent	SNP	T	T	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr6:30587568T>A	ENST00000259873.4	+	3	427	c.270T>A	c.(268-270)acT>acA	p.T90T	PPP1R10_ENST00000376511.2_5'Flank|MRPS18B_ENST00000472229.1_3'UTR|PPP1R10_ENST00000484449.1_5'Flank|MRPS18B_ENST00000506373.2_Silent_p.T90T	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	90					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						CACAGCGGACTCGGAAGACAT	0.517																																						dbGAP											0													86.0	99.0	94.0					6																	30587568		1511	2709	4220	-	-	-	SO:0001819	synonymous_variant	0			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.270T>A	6.37:g.30587568T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ0|Q659G4|Q9BS27	Silent	SNP	pfam_Ribosomal_S18,superfamily_Ribosomal_S18	p.T90	ENST00000259873.4	37	c.270	CCDS4682.1	6																																																																																			MRPS18B	-	superfamily_Ribosomal_S18	ENSG00000204568		0.517	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS18B	HGNC	protein_coding	OTTHUMT00000076584.2	14	0.00	0	T			30587568	30587568	+1	no_errors	ENST00000259873	ensembl	human	known	69_37n	silent	16	30.43	7	SNP	1.000	A
MUC2	4583	genome.wustl.edu	37	11	1093305	1093305	+	Silent	SNP	C	C	A	rs62637245		TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr11:1093305C>A	ENST00000441003.2	+	30	5151	c.5124C>A	c.(5122-5124)acC>acA	p.T1708T	MUC2_ENST00000359061.5_Silent_p.T1675T|MUC2_ENST00000361558.6_Intron|MUC2_ENST00000333592.6_5'Flank	NM_002457.2	NP_002448.2	Q02817	MUC2_HUMAN	mucin 2, oligomeric mucus/gel-forming	0	Approximate repeats.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi lumen (GO:0005796)|inner mucus layer (GO:0070702)|outer mucus layer (GO:0070703)				NS(3)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(5)|lung(22)|ovary(2)|prostate(16)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	102		all_cancers(49;1.08e-07)|all_epithelial(84;5.08e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.191)		BRCA - Breast invasive adenocarcinoma(625;0.000207)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)	Pranlukast(DB01411)	ctacggtgaccccaaccccaa	0.637																																						dbGAP											0													136.0	184.0	168.0					11																	1093305		1897	3515	5412	-	-	-	SO:0001819	synonymous_variant	0			L21998		11p15.5	2011-01-28	2006-03-14		ENSG00000198788	ENSG00000198788		"""Mucins"""	7512	protein-coding gene	gene with protein product		158370	"""mucin 2, intestinal/tracheal"""			15081123	Standard	NM_002457		Approved		uc001lsx.1	Q02817	OTTHUMG00000156800	ENST00000441003.2:c.5124C>A	11.37:g.1093305C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14878	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,superfamily_Prot_inh_PMP,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T1708	ENST00000441003.2	37	c.5124		11																																																																																			MUC2	-	NULL	ENSG00000198788		0.637	MUC2-001	KNOWN	basic|appris_principal	protein_coding	MUC2	HGNC	protein_coding	OTTHUMT00000345894.2	23	0.00	0	C	NM_002457		1093305	1093305	+1	no_errors	ENST00000441003	ensembl	human	known	69_37n	silent	635	14.15	106	SNP	0.009	A
MUC4	4585	genome.wustl.edu	37	3	195511780	195511780	+	Missense_Mutation	SNP	G	G	A	rs391928|rs71291863	byFrequency	TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr3:195511780G>A	ENST00000463781.3	-	2	7130	c.6671C>T	c.(6670-6672)cCt>cTt	p.P2224L	MUC4_ENST00000475231.1_Missense_Mutation_p.P2224L|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.P2224L(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GACAAGAAGAGGGATGGCGTG	0.592																																						dbGAP											1	Substitution - Missense(1)	prostate(1)											34.0	32.0	33.0					3																	195511780		654	1584	2238	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.6671C>T	3.37:g.195511780G>A	ENSP00000417498:p.Pro2224Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.P2224L	ENST00000463781.3	37	c.6671	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	G	4.046	0.006276	0.07866	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.36699	1.24;1.25	.	.	.	.	.	.	.	.	T	0.19927	0.0479	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.24548	-1.0157	6	.	.	.	.	.	.	.	.	2224	E7ESK3	.	L	2224	ENSP00000417498:P2224L;ENSP00000420243:P2224L	.	P	-	2	0	MUC4	196996175	0.116000	0.22171	0.001000	0.08648	0.003000	0.03518	0.211000	0.17474	0.488000	0.27723	0.064000	0.15345	CCT	MUC4	-	NULL	ENSG00000145113		0.592	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	18	0.00	0	G	NM_018406		195511780	195511780	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	193	20.90	51	SNP	0.004	A
MYH1	4619	genome.wustl.edu	37	17	10416983	10416983	+	Silent	SNP	G	G	A	rs565550881		TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr17:10416983G>A	ENST00000226207.5	-	9	859	c.765C>T	c.(763-765)ttC>ttT	p.F255F	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	255	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						CTGTGGTACCGAAGTGGATCC	0.388													G|||	1	0.000199681	0.0008	0.0	5008	,	,		21800	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													113.0	112.0	112.0					17																	10416983		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.765C>T	17.37:g.10416983G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CA4|Q9Y622	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F255	ENST00000226207.5	37	c.765	CCDS11155.1	17																																																																																			MYH1	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000109061		0.388	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	78	0.00	0	G	NM_005963		10416983	10416983	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	silent	7	82.05	32	SNP	0.999	A
NKRF	55922	genome.wustl.edu	37	X	118724319	118724320	+	Missense_Mutation	DNP	CA	CA	TC			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C|A	C|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chrX:118724319_118724320CA>TC	ENST00000371527.1	-	2	1720_1721	c.1068_1069TG>GA	c.(1066-1071)tcTGcc>tcGAcc	p.A357T	NKRF_ENST00000542113.1_Missense_Mutation_p.A372T|NKRF_ENST00000487600.1_Intron|NKRF_ENST00000304449.5_Missense_Mutation_p.A357T	NM_001173488.1	NP_001166959.1	O15226	NKRF_HUMAN	NFKB repressing factor	357					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(3)|skin(1)|urinary_tract(1)	30						TTGAATGAGGCAGAATTGTTAA	0.391																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AJ011812	CCDS35375.1, CCDS55486.1	Xq24	2013-01-28	2008-03-26		ENSG00000186416	ENSG00000186416		"""G patch domain containing"""	19374	protein-coding gene	gene with protein product		300440	"""NF-kappaB repressing factor"""			10562553	Standard	NM_017544		Approved	ITBA4, NRF	uc022cdk.1	O15226	OTTHUMG00000022277	ENST00000371527.1:c.1068_1069delinsTC	X.37:g.118724319_118724320delinsTC	ENSP00000360582:p.Ala357Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1N1|Q4VC41|Q9UJ91	Missense_Mutation|Silent	SNP	pfam_G_patch_dom,pfam_R3H_ss-bd,smart_Ds-RNA-bd,smart_G_patch_dom,smart_R3H_ss-bd,pfscan_G_patch_dom,pfscan_R3H_ss-bd	p.A372T|p.S371	ENST00000371527.1	37	c.1114|c.1113	CCDS35375.1	X																																																																																			NKRF	-	smart_Ds-RNA-bd	ENSG00000186416		0.391	NKRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKRF	HGNC	protein_coding	OTTHUMT00000058044.1	38|39	0.00	0	C|A	NM_017544		118724319|118724320	118724319|118724320	-1	no_errors	ENST00000542113	ensembl	human	known	69_37n	missense|silent	41	14.58	7	SNP	1.000|0.999	T|C
OR2C3	81472	genome.wustl.edu	37	1	247695329	247695329	+	Missense_Mutation	SNP	G	G	A	rs562326145	byFrequency	TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr1:247695329G>A	ENST00000366487.3	-	2	846	c.485C>T	c.(484-486)aCg>aTg	p.T162M	GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000366491.2_Intron|GCSAML_ENST00000366490.3_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000463359.1_Intron	NM_198074.4	NP_932340	Q8N628	OR2C3_HUMAN	olfactory receptor, family 2, subfamily C, member 3	162						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|large_intestine(2)|lung(31)|ovary(1)|prostate(1)|skin(2)	43	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0242)	OV - Ovarian serous cystadenocarcinoma(106;0.0241)			CATGGTGAGCGTGGAGCCCAC	0.557																																						dbGAP											0													57.0	54.0	55.0					1																	247695329		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030717	CCDS1634.2	1q44	2014-02-19	2002-02-28		ENSG00000196242	ENSG00000196242		"""GPCR / Class A : Olfactory receptors"""	15005	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily C, member 4"""	OR2C4, OR2C5P			Standard	NM_198074		Approved	OST742	uc009xgy.3	Q8N628	OTTHUMG00000040579	ENST00000366487.3:c.485C>T	1.37:g.247695329G>A	ENSP00000355443:p.Thr162Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQS4|Q6IEZ1|Q8NGW7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.T162M	ENST00000366487.3	37	c.485	CCDS1634.2	1	.	.	.	.	.	.	.	.	.	.	G	11.57	1.679234	0.29783	.	.	ENSG00000196242	ENST00000366487	T	0.36878	1.23	3.89	2.97	0.34412	GPCR, rhodopsin-like superfamily (1);	0.193330	0.25146	U	0.032788	T	0.28599	0.0708	L	0.59912	1.85	0.09310	N	1	P	0.38767	0.646	B	0.28638	0.092	T	0.23297	-1.0192	10	0.62326	D	0.03	.	9.709	0.40233	0.1052:0.0:0.8948:0.0	.	162	Q8N628	OR2C3_HUMAN	M	162	ENSP00000355443:T162M	ENSP00000355443:T162M	T	-	2	0	OR2C3	245761952	0.000000	0.05858	0.664000	0.29753	0.861000	0.49209	-0.037000	0.12164	0.959000	0.37980	0.650000	0.86243	ACG	OR2C3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196242		0.557	OR2C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2C3	HGNC	protein_coding	OTTHUMT00000097626.2	30	0.00	0	G	NM_198074		247695329	247695329	-1	no_errors	ENST00000366487	ensembl	human	known	69_37n	missense	43	24.56	14	SNP	0.043	A
OR5AR1	219493	genome.wustl.edu	37	11	56431496	56431496	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr11:56431496G>A	ENST00000302969.2	+	1	359	c.335G>A	c.(334-336)tGc>tAc	p.C112Y		NM_001004730.1	NP_001004730.1	Q8NGP9	O5AR1_HUMAN	olfactory receptor, family 5, subfamily AR, member 1 (gene/pseudogene)	112						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(12)|prostate(1)|skin(3)|stomach(1)	26						GATGCTGAGTGCTATGTCCTG	0.502																																						dbGAP											0													166.0	162.0	163.0					11																	56431496		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065740	CCDS31535.1	11q11	2013-10-10	2013-10-10		ENSG00000172459	ENSG00000172459		"""GPCR / Class A : Olfactory receptors"""	15260	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily AR, member 1"""				Standard	NM_001004730		Approved		uc010rjm.2	Q8NGP9	OTTHUMG00000154213	ENST00000302969.2:c.335G>A	11.37:g.56431496G>A	ENSP00000302639:p.Cys112Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF61	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.C112Y	ENST00000302969.2	37	c.335	CCDS31535.1	11	.	.	.	.	.	.	.	.	.	.	G	8.730	0.916485	0.17907	.	.	ENSG00000172459	ENST00000302969	T	0.00463	7.25	4.94	4.94	0.65067	GPCR, rhodopsin-like superfamily (1);	0.000000	0.49305	D	0.000151	T	0.00637	0.0021	M	0.87328	2.875	0.09310	N	1	B	0.14438	0.01	B	0.06405	0.002	T	0.41928	-0.9481	10	0.38643	T	0.18	.	8.1876	0.31348	0.0833:0.0:0.7577:0.159	.	112	Q8NGP9	O5AR1_HUMAN	Y	112	ENSP00000302639:C112Y	ENSP00000302639:C112Y	C	+	2	0	OR5AR1	56188072	0.706000	0.27856	1.000000	0.80357	0.997000	0.91878	1.691000	0.37721	2.575000	0.86900	0.573000	0.79308	TGC	OR5AR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000172459		0.502	OR5AR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5AR1	HGNC	protein_coding	OTTHUMT00000334434.1	127	0.00	0	G	NM_001004730		56431496	56431496	+1	no_errors	ENST00000302969	ensembl	human	known	69_37n	missense	46	37.84	28	SNP	0.067	A
OR9G1	390174	genome.wustl.edu	37	11	56468576	56468576	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr11:56468576C>T	ENST00000312153.1	+	1	713	c.713C>T	c.(712-714)tCc>tTc	p.S238F		NM_001005213.1	NP_001005213.1	Q8NH87	OR9G1_HUMAN	olfactory receptor, family 9, subfamily G, member 1	238						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|kidney(1)|lung(25)|stomach(2)|upper_aerodigestive_tract(1)	31						AAAGCCTTCTCCACATGCTCC	0.493																																						dbGAP											0													217.0	223.0	221.0					11																	56468576		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065500	CCDS31536.1	11q11	2012-08-09			ENSG00000174914	ENSG00000174914		"""GPCR / Class A : Olfactory receptors"""	15319	protein-coding gene	gene with protein product				OR9G5			Standard	NM_001005213		Approved			Q8NH87	OTTHUMG00000167112	ENST00000312153.1:c.713C>T	11.37:g.56468576C>T	ENSP00000309012:p.Ser238Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEU9|Q8NGQ0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S238F	ENST00000312153.1	37	c.713	CCDS31536.1	11	.	.	.	.	.	.	.	.	.	.	C	16.58	3.164056	0.57476	.	.	ENSG00000174914	ENST00000312153	T	0.00311	8.15	4.62	4.62	0.57501	GPCR, rhodopsin-like superfamily (1);	0.000000	0.53938	D	0.000055	T	0.00967	0.0032	M	0.91196	3.185	0.34073	D	0.658681	D	0.89917	1.0	D	0.97110	1.0	T	0.50303	-0.8844	10	0.87932	D	0	-36.0847	17.5976	0.88016	0.0:1.0:0.0:0.0	.	238	Q8NH87	OR9G1_HUMAN	F	238	ENSP00000309012:S238F	ENSP00000309012:S238F	S	+	2	0	OR9G1	56225152	0.014000	0.17966	1.000000	0.80357	0.914000	0.54420	0.990000	0.29642	2.528000	0.85240	0.637000	0.83480	TCC	OR9G1	-	pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000174914		0.493	OR9G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9G1	HGNC	protein_coding	OTTHUMT00000393253.1	126	0.00	0	C	NM_001005213		56468576	56468576	+1	no_errors	ENST00000312153	ensembl	human	known	69_37n	missense	75	19.35	18	SNP	1.000	T
P2RY13	53829	genome.wustl.edu	37	3	151045982	151045982	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr3:151045982C>T	ENST00000325602.5	-	2	881	c.862G>A	c.(862-864)Gac>Aac	p.D288N	MED12L_ENST00000491549.1_Intron|MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	288					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			AGTCTACAGTCAGTCTTATTG	0.358																																						dbGAP											0													107.0	110.0	109.0					3																	151045982		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.862G>A	3.37:g.151045982C>T	ENSP00000320376:p.Asp288Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_P2Y13_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_UDPG_rcpt	p.D288N	ENST00000325602.5	37	c.862	CCDS3158.2	3	.	.	.	.	.	.	.	.	.	.	C	8.366	0.834274	0.16820	.	.	ENSG00000181631	ENST00000325602	T	0.39997	1.05	5.64	1.86	0.25419	GPCR, rhodopsin-like superfamily (1);	0.605252	0.17874	N	0.159099	T	0.35770	0.0943	L	0.46157	1.445	0.20638	N	0.99987	B	0.12630	0.006	B	0.24006	0.05	T	0.34527	-0.9825	10	0.48119	T	0.1	-9.2013	10.5303	0.44973	0.0:0.7397:0.0:0.2603	.	288	Q9BPV8	P2Y13_HUMAN	N	288	ENSP00000320376:D288N	ENSP00000320376:D288N	D	-	1	0	P2RY13	152528672	0.070000	0.21116	0.430000	0.26722	0.331000	0.28603	0.559000	0.23485	0.755000	0.32990	0.655000	0.94253	GAC	P2RY13	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181631		0.358	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY13	HGNC	protein_coding	OTTHUMT00000341468.1	119	0.00	0	C	NM_023914		151045982	151045982	-1	no_errors	ENST00000325602	ensembl	human	known	69_37n	missense	60	33.33	30	SNP	0.049	T
PASK	23178	genome.wustl.edu	37	2	242063401	242063401	+	Missense_Mutation	SNP	G	G	C	rs34168911		TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr2:242063401G>C	ENST00000405260.1	-	11	3565	c.2867C>G	c.(2866-2868)tCt>tGt	p.S956C	PASK_ENST00000358649.4_Missense_Mutation_p.S956C|PASK_ENST00000544142.1_Missense_Mutation_p.S770C|PASK_ENST00000234040.4_Missense_Mutation_p.S956C|PASK_ENST00000539818.1_Missense_Mutation_p.S740C|PASK_ENST00000403638.3_Missense_Mutation_p.S956C	NM_001252120.1	NP_001239049.1	Q96RG2	PASK_HUMAN	PAS domain containing serine/threonine kinase	956					negative regulation of glycogen biosynthetic process (GO:0045719)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of energy homeostasis (GO:2000505)|regulation of glucagon secretion (GO:0070092)|regulation of respiratory gaseous exchange (GO:0043576)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(20)|ovary(4)|prostate(4)|skin(1)|stomach(1)|urinary_tract(2)	53		all_cancers(19;4.46e-39)|all_epithelial(40;1.34e-17)|Breast(86;1.53e-05)|Renal(207;0.00179)|all_lung(227;0.00481)|Lung NSC(271;0.017)|Ovarian(221;0.0228)|Esophageal squamous(248;0.129)|all_hematologic(139;0.158)|Melanoma(123;0.16)|all_neural(83;0.243)|Hepatocellular(293;0.244)		Epithelial(32;1.34e-31)|all cancers(36;1e-28)|OV - Ovarian serous cystadenocarcinoma(60;3.53e-14)|Kidney(56;4.31e-09)|KIRC - Kidney renal clear cell carcinoma(57;4.35e-08)|BRCA - Breast invasive adenocarcinoma(100;5.64e-06)|Lung(119;0.000596)|LUSC - Lung squamous cell carcinoma(224;0.00481)|Colorectal(34;0.014)|COAD - Colon adenocarcinoma(134;0.0968)		AGCAGCGGTAGAGTGGGTGGA	0.602																																						dbGAP											0													50.0	54.0	52.0					2																	242063401		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79240	CCDS2545.1, CCDS58758.1, CCDS58759.1	2q37.3	2008-05-23			ENSG00000115687	ENSG00000115687			17270	protein-coding gene	gene with protein product		607505				11688972, 11459942, 15148392	Standard	NM_001252119		Approved	PASKIN, KIAA0135, STK37	uc010fzl.2	Q96RG2	OTTHUMG00000133392	ENST00000405260.1:c.2867C>G	2.37:g.242063401G>C	ENSP00000384016:p.Ser956Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9F1|Q05BE4|Q68DY3|Q6GSJ5|Q86XH6|Q99763|Q9UFR7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAS_fold,superfamily_Kinase-like_dom,smart_PAS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAS,pfscan_Prot_kinase_cat_dom,tigrfam_PAS	p.S956C	ENST00000405260.1	37	c.2867	CCDS2545.1	2	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840222	0.51057	.	.	ENSG00000115687	ENST00000234040;ENST00000544142;ENST00000405260;ENST00000358649;ENST00000539818;ENST00000403638	T;T;T;T;T;T	0.71341	-0.56;-0.56;-0.56;-0.51;-0.55;0.23	4.87	4.87	0.63330	.	0.000000	0.53938	D	0.000049	D	0.82797	0.5115	M	0.69823	2.125	0.40341	D	0.979038	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.979;0.994;0.991;0.998;0.979	D	0.85618	0.1262	10	0.87932	D	0	.	14.9393	0.70980	0.0:0.0:1.0:0.0	.	921;770;956;956;956	B7Z7R6;F5GYW7;Q96RG2-2;G5E9F1;Q96RG2	.;.;.;.;PASK_HUMAN	C	956;770;956;956;740;956	ENSP00000234040:S956C;ENSP00000441374:S770C;ENSP00000384016:S956C;ENSP00000351475:S956C;ENSP00000443083:S740C;ENSP00000384438:S956C	ENSP00000234040:S956C	S	-	2	0	PASK	241712074	1.000000	0.71417	0.960000	0.40013	0.142000	0.21351	5.248000	0.65421	2.240000	0.73641	0.555000	0.69702	TCT	PASK	-	NULL	ENSG00000115687		0.602	PASK-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PASK	HGNC	protein_coding	OTTHUMT00000323753.1	57	0.00	0	G	NM_015148		242063401	242063401	-1	no_errors	ENST00000358649	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.979	C
PCDHGA7	56108	genome.wustl.edu	37	5	140764593	140764593	+	Silent	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr5:140764593C>T	ENST00000518325.1	+	1	2127	c.2127C>T	c.(2125-2127)ctC>ctT	p.L709L	PCDHGB3_ENST00000576222.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB4_ENST00000519479.1_5'Flank|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron	NM_018920.2	NP_061743.1	Q9Y5G6	PCDG7_HUMAN	protocadherin gamma subfamily A, 7	709					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|biliary_tract(1)|endometrium(8)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|skin(1)|stomach(3)|urinary_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTTCGTCCTCGTACTGCTGG	0.627																																						dbGAP											0													60.0	65.0	64.0					5																	140764593		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152514	CCDS54927.1, CCDS75336.1	5q31	2010-01-26				ENSG00000253537		"""Cadherins / Protocadherins : Clustered"""	8705	other	protocadherin		606294				10380929	Standard	NM_018920		Approved	PCDH-GAMMA-A7		Q9Y5G6		ENST00000518325.1:c.2127C>T	5.37:g.140764593C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN87|Q9Y5D0	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L709	ENST00000518325.1	37	c.2127	CCDS54927.1	5																																																																																			PCDHGA7	-	NULL	ENSG00000253537		0.627	PCDHGA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA7	HGNC	protein_coding	OTTHUMT00000374744.1	8	0.00	0	C	NM_018920		140764593	140764593	+1	no_errors	ENST00000518325	ensembl	human	known	69_37n	silent	8	77.78	28	SNP	0.000	T
PCGF6	84108	genome.wustl.edu	37	10	105073972	105073972	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr10:105073972G>C	ENST00000369847.3	-	9	1034	c.967C>G	c.(967-969)Cga>Gga	p.R323G	RNU11-3P_ENST00000391111.1_RNA|PCGF6_ENST00000337211.4_Missense_Mutation_p.R248G|PCGF6_ENST00000490296.1_5'UTR	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	323					negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		ATTGCACGTCGGATTTCCCTT	0.378																																						dbGAP											0													184.0	144.0	158.0					10																	105073972		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.967C>G	10.37:g.105073972G>C	ENSP00000358862:p.Arg323Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R323G	ENST00000369847.3	37	c.967	CCDS31275.1	10	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417458	0.25552	.	.	ENSG00000156374	ENST00000369847;ENST00000337211	T;T	0.32988	1.47;1.43	5.25	4.31	0.51392	.	0.418678	0.26460	N	0.024244	T	0.28134	0.0694	L	0.44542	1.39	0.23030	N	0.998407	P;P	0.44090	0.673;0.826	B;B	0.41135	0.348;0.146	T	0.08889	-1.0700	10	0.46703	T	0.11	.	12.4643	0.55749	0.0:0.0:0.8193:0.1807	.	248;323	Q9BYE7-3;Q9BYE7	.;PCGF6_HUMAN	G	323;248	ENSP00000358862:R323G;ENSP00000338845:R248G	ENSP00000338845:R248G	R	-	1	2	PCGF6	105063962	1.000000	0.71417	1.000000	0.80357	0.222000	0.24845	2.785000	0.47782	1.124000	0.41980	0.467000	0.42956	CGA	PCGF6	-	NULL	ENSG00000156374		0.378	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF6	HGNC	protein_coding	OTTHUMT00000050132.1	39	0.00	0	G	NM_032154		105073972	105073972	-1	no_errors	ENST00000369847	ensembl	human	known	69_37n	missense	43	21.43	12	SNP	1.000	C
PEAK1	79834	genome.wustl.edu	37	15	77406832	77406832	+	Missense_Mutation	SNP	C	C	T	rs200619883		TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr15:77406832C>T	ENST00000560626.2	-	7	5382	c.4907G>A	c.(4906-4908)cGg>cAg	p.R1636Q	PEAK1_ENST00000312493.4_Missense_Mutation_p.R1636Q			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	1636	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)										CTGCAGACCCCGGGAGTAGGG	0.602																																						dbGAP											0													55.0	59.0	57.0					15																	77406832		1929	4127	6056	-	-	-	SO:0001583	missense	0				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.4907G>A	15.37:g.77406832C>T	ENSP00000452796:p.Arg1636Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.R1636Q	ENST00000560626.2	37	c.4907	CCDS42062.1	15	.	.	.	.	.	.	.	.	.	.	C	9.483	1.098650	0.20552	.	.	ENSG00000173517	ENST00000312493	T	0.64803	-0.12	5.57	3.58	0.41010	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.373801	0.25156	U	0.032707	T	0.32010	0.0815	N	0.08118	0	0.24154	N	0.995684	B	0.10296	0.003	B	0.04013	0.001	T	0.11397	-1.0589	10	0.11485	T	0.65	-2.9805	3.1669	0.06539	0.1444:0.5535:0.1401:0.162	.	1636	Q9H792	PEAK1_HUMAN	Q	1636	ENSP00000309230:R1636Q	ENSP00000309230:R1636Q	R	-	2	0	AC087465.1	75193887	0.212000	0.23540	0.998000	0.56505	0.986000	0.74619	1.211000	0.32382	1.361000	0.45981	0.561000	0.74099	CGG	PEAK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000173517		0.602	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	Clone_based_vega_gene	protein_coding	OTTHUMT00000419483.3	109	0.00	0	C			77406832	77406832	-1	no_errors	ENST00000312493	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	0.873	T
PI4KA	5297	genome.wustl.edu	37	22	21096642	21096642	+	Splice_Site	SNP	A	A	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr22:21096642A>T	ENST00000572273.1	-	32	3671	c.3441T>A	c.(3439-3441)gaT>gaA	p.D1147E	PI4KA_ENST00000255882.6_Splice_Site_p.D1205E			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1147					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			GCGGGTCACAATCTGGAACCA	0.587											OREG0026324	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(136;1332 1831 3115 23601 50806)	dbGAP											0													70.0	73.0	72.0					22																	21096642		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3440-1T>A	22.37:g.21096642A>T		Somatic	745	WXS	Illumina GAIIx	Phase_IV	Q7Z625|Q9UPG2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.D1205E	ENST00000572273.1	37	c.3615		22	.	.	.	.	.	.	.	.	.	.	A	7.543	0.661089	0.14645	.	.	ENSG00000241973	ENST00000255882	.	.	.	4.76	1.34	0.21922	.	0.263304	0.43416	D	0.000565	T	0.16041	0.0386	N	0.04705	-0.18	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.21895	-1.0232	9	0.02654	T	1	.	1.9964	0.03457	0.5058:0.2213:0.1582:0.1147	.	1147	P42356	PI4KA_HUMAN	E	1147	.	ENSP00000255882:D1147E	D	-	3	2	PI4KA	19426642	0.972000	0.33761	1.000000	0.80357	0.900000	0.52787	0.139000	0.16036	0.849000	0.35215	0.482000	0.46254	GAT	PI4KA	-	NULL	ENSG00000241973		0.587	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding		19	0.00	0	A	NM_058004	Missense_Mutation	21096642	21096642	-1	no_errors	ENST00000255882	ensembl	human	known	69_37n	missense	8	35.71	5	SNP	0.993	T
PI4KA	5297	genome.wustl.edu	37	22	21096935	21096936	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr22:21096935_21096936CC>AA	ENST00000572273.1	-	31	3629_3630	c.3399_3400GG>TT	c.(3397-3402)caGGcc>caTTcc	p.1133_1134QA>HS	PI4KA_ENST00000255882.6_Missense_Mutation_p.1191_1192QA>HS			P42356	PI4KA_HUMAN	phosphatidylinositol 4-kinase, catalytic, alpha	1133					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi-associated vesicle membrane (GO:0030660)|membrane (GO:0016020)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(8)|kidney(9)|large_intestine(19)|lung(29)|ovary(1)|pancreas(1)|prostate(3)|salivary_gland(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	79	all_cancers(11;7.59e-25)|all_epithelial(7;1.34e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)			TTGAACATGGCCTGCGTGTAGT	0.49																																					GBM(136;1332 1831 3115 23601 50806)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			L36151	CCDS33603.1, CCDS33603.2	22q11.21	2011-05-25	2007-08-14	2007-08-02	ENSG00000241973	ENSG00000241973			8983	protein-coding gene	gene with protein product		600286		PIK4CA		7961848, 8662589	Standard	NM_002650		Approved	PI4K-ALPHA, pi4K230	uc002zsz.5	P42356	OTTHUMG00000167440	ENST00000572273.1:c.3399_3400delinsAA	22.37:g.21096935_21096936delinsAA	ENSP00000458238:p.Q1133_A1134delinsHS	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z625|Q9UPG2	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.A1192S|p.Q1191H	ENST00000572273.1	37	c.3574|c.3573		22																																																																																			PI4KA	-	NULL	ENSG00000241973		0.490	PI4KA-202	KNOWN	basic|appris_principal	protein_coding	PI4KA	HGNC	protein_coding		123	0.00	0	C	NM_058004		21096935|21096936	21096935|21096936	-1	no_errors	ENST00000255882	ensembl	human	known	69_37n	missense	54|56	26.03|24.32	19|18	SNP	1.000	A
PIK3AP1	118788	genome.wustl.edu	37	10	98362157	98362157	+	Splice_Site	DEL	T	T	-			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr10:98362157delT	ENST00000339364.5	-	16	2361		c.e16-2		PIK3AP1_ENST00000371109.3_Splice_Site|PIK3AP1_ENST00000371110.2_Splice_Site	NM_152309.2	NP_689522.2	Q6ZUJ8	BCAP_HUMAN	phosphoinositide-3-kinase adaptor protein 1						negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|regulation of inflammatory response (GO:0050727)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)			NS(1)|autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(27)|ovary(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(4)	52		Colorectal(252;0.0442)		Epithelial(162;6.29e-08)|all cancers(201;3.18e-06)		TTCATTATCCTACAGCAAAGA	0.542																																						dbGAP											0													63.0	63.0	63.0					10																	98362157		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK092883	CCDS31259.1	10q24.2	2008-10-23			ENSG00000155629	ENSG00000155629			30034	protein-coding gene	gene with protein product		607942				1251844, 11163197	Standard	NM_152309		Approved	BCAP, FLJ35564	uc001kmq.3	Q6ZUJ8	OTTHUMG00000018838	ENST00000339364.5:c.2242-2A>-	10.37:g.98362157delT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TB56|Q5VXJ9|Q8N6J6|Q8NAC8	Splice_Site	DEL	-	e16-2	ENST00000339364.5	37	c.2242-2	CCDS31259.1	10																																																																																			PIK3AP1	-	-	ENSG00000155629		0.542	PIK3AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3AP1	HGNC	protein_coding	OTTHUMT00000049619.2	46	0.00	0	T	NM_152309	Intron	98362157	98362157	-1	no_errors	ENST00000339364	ensembl	human	known	69_37n	splice_site_del	15	11.76	2	DEL	0.984	-
PRPS1	5631	genome.wustl.edu	37	X	106893241	106893241	+	Silent	SNP	A	A	G			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chrX:106893241A>G	ENST00000372435.4	+	7	1058	c.936A>G	c.(934-936)ctA>ctG	p.L312L	PRPS1_ENST00000543248.1_Silent_p.L312L|PRPS1_ENST00000372418.1_Silent_p.L212L|PRPS1_ENST00000372428.4_Silent_p.L245L	NM_002764.3	NP_002755.1	P60891	PRPS1_HUMAN	phosphoribosyl pyrophosphate synthetase 1	312					5-phosphoribose 1-diphosphate biosynthetic process (GO:0006015)|carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|hypoxanthine biosynthetic process (GO:0046101)|nervous system development (GO:0007399)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|pyrimidine nucleotide biosynthetic process (GO:0006221)|ribonucleoside monophosphate biosynthetic process (GO:0009156)|small molecule metabolic process (GO:0044281)|urate biosynthetic process (GO:0034418)	cytosol (GO:0005829)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|protein homodimerization activity (GO:0042803)|ribose phosphate diphosphokinase activity (GO:0004749)			breast(3)|endometrium(2)|kidney(3)|large_intestine(3)|lung(11)|upper_aerodigestive_tract(1)	23						TTTCTTACCTATTCAGCCATG	0.408																																						dbGAP											0													156.0	139.0	145.0					X																	106893241		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X15331	CCDS14529.1, CCDS76007.1	Xq22.3	2014-09-17			ENSG00000147224	ENSG00000147224	2.7.6.1		9462	protein-coding gene	gene with protein product	"""PRS I"", ""ribose-phosphate diphosphokinase 1"""	311850	"""deafness, X-linked 2, perceptive, congenital"""	DFN2		1962753, 20021999	Standard	NM_002764		Approved	CMTX5, DFNX1	uc004ene.4	P60891	OTTHUMG00000022167	ENST00000372435.4:c.936A>G	X.37:g.106893241A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALA8|B2R6T7|B4DNL6|D3DUX6|P09329	Silent	SNP	pfam_PRibTrfase,tigrfam_Rib-P_diPkinase	p.L312	ENST00000372435.4	37	c.936	CCDS14529.1	X																																																																																			PRPS1	-	tigrfam_Rib-P_diPkinase	ENSG00000147224		0.408	PRPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPS1	HGNC	protein_coding	OTTHUMT00000057840.1	90	0.00	0	A			106893241	106893241	+1	no_errors	ENST00000372435	ensembl	human	known	69_37n	silent	44	30.16	19	SNP	0.938	G
PYGB	5834	genome.wustl.edu	37	20	25252038	25252038	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr20:25252038G>A	ENST00000216962.4	+	4	554	c.444G>A	c.(442-444)atG>atA	p.M148I		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	148					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						TTGACTCAATGGCTACCTTGG	0.498																																						dbGAP											0													229.0	211.0	217.0					20																	25252038		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.444G>A	20.37:g.25252038G>A	ENSP00000216962:p.Met148Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AK1|Q9NPX8	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.M148I	ENST00000216962.4	37	c.444	CCDS13171.1	20	.	.	.	.	.	.	.	.	.	.	G	16.91	3.251476	0.59212	.	.	ENSG00000100994	ENST00000216962	D	0.92699	-3.09	4.08	4.08	0.47627	.	0.080004	0.85682	D	0.000000	D	0.91981	0.7460	L	0.51422	1.61	0.80722	D	1	B	0.24186	0.099	B	0.39617	0.305	D	0.91373	0.5121	10	0.62326	D	0.03	-64.1965	16.4443	0.83913	0.0:0.0:1.0:0.0	.	148	P11216	PYGB_HUMAN	I	148	ENSP00000216962:M148I	ENSP00000216962:M148I	M	+	3	0	PYGB	25200038	1.000000	0.71417	1.000000	0.80357	0.724000	0.41520	9.492000	0.97957	2.256000	0.74724	0.563000	0.77884	ATG	PYGB	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100994		0.498	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	81	0.00	0	G	NM_002862		25252038	25252038	+1	no_errors	ENST00000216962	ensembl	human	known	69_37n	missense	76	32.74	37	SNP	1.000	A
RAB37	326624	genome.wustl.edu	37	17	72736906	72736906	+	Splice_Site	SNP	G	G	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr17:72736906G>T	ENST00000392613.5	+	2	149		c.e2-1		RAB37_ENST00000340415.3_Intron|RAB37_ENST00000392615.5_Intron|RAB37_ENST00000392614.4_Splice_Site|RAB37_ENST00000528438.1_Splice_Site|RAB37_ENST00000402449.4_Intron|RAB37_ENST00000392610.1_Splice_Site|RAB37_ENST00000392612.3_Intron	NM_001006638.2	NP_001006639.1	Q96AX2	RAB37_HUMAN	RAB37, member RAS oncogene family						protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|secretory granule (GO:0030141)	GTP binding (GO:0005525)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)	12						CTACCCCCTAGGTGATGCTTC	0.572																																						dbGAP											0													128.0	131.0	130.0					17																	72736906		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC040547	CCDS11703.1, CCDS32722.1, CCDS54161.1, CCDS54162.1	17q25.2	2008-02-05			ENSG00000172794	ENSG00000172794		"""RAB, member RAS oncogene"""	30268	protein-coding gene	gene with protein product		609956				10722846	Standard	NM_175738		Approved		uc002jlk.3	Q96AX2	OTTHUMG00000134282	ENST00000392613.5:c.94-1G>T	17.37:g.72736906G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXF5|A8MYT0|Q8IWA7	Splice_Site	SNP	-	e2-1	ENST00000392613.5	37	c.109-1	CCDS32722.1	17	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897761	0.33535	.	.	ENSG00000172794	ENST00000528438;ENST00000392614;ENST00000392613;ENST00000533530;ENST00000392610	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.6667	0.85254	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RAB37	70248501	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	9.035000	0.93752	2.469000	0.83416	0.561000	0.74099	.	RAB37	-	-	ENSG00000172794		0.572	RAB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB37	HGNC	protein_coding	OTTHUMT00000258872.2	23	0.00	0	G	NM_175738	Intron	72736906	72736906	+1	no_errors	ENST00000392614	ensembl	human	known	69_37n	splice_site	19	42.42	14	SNP	1.000	T
RIMBP2	23504	genome.wustl.edu	37	12	130927144	130927144	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr12:130927144G>T	ENST00000261655.4	-	8	865	c.702C>A	c.(700-702)gaC>gaA	p.D234E	RIMBP2_ENST00000536002.1_Missense_Mutation_p.D142E|RIMBP2_ENST00000535703.1_Missense_Mutation_p.D142E	NM_015347.4	NP_056162.4	O15034	RIMB2_HUMAN	RIMS binding protein 2	234	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				negative regulation of phosphatase activity (GO:0010923)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|synapse (GO:0045202)				NS(2)|breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(33)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	96	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.213)		OV - Ovarian serous cystadenocarcinoma(86;4.29e-06)|all cancers(50;4.56e-05)|Epithelial(86;5.41e-05)		GCGACTCGTTGTCCTGCACAA	0.587																																						dbGAP											0													117.0	118.0	118.0					12																	130927144		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002316	CCDS31925.1	12q24.33	2014-06-13				ENSG00000060709			30339	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 133"""	611602				10748113	Standard	NM_015347		Approved	KIAA0318, RBP2, MGC15831, RIM-BP2, PPP1R133	uc001uil.2	O15034		ENST00000261655.4:c.702C>A	12.37:g.130927144G>T	ENSP00000261655:p.Asp234Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96ID2	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_Fibronectin_type3,smart_SH3_domain,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_SH3_domain,prints_SH3_domain	p.D234E	ENST00000261655.4	37	c.702	CCDS31925.1	12	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101250	0.56183	.	.	ENSG00000060709	ENST00000261655;ENST00000392375;ENST00000535703;ENST00000536002	T;T;T	0.29655	1.56;1.56;1.56	4.53	3.5	0.40072	Src homology-3 domain (2);	0.000000	0.85682	D	0.000000	T	0.45935	0.1367	L	0.60455	1.87	0.44677	D	0.997661	D;D	0.67145	0.967;0.996	P;D	0.77557	0.803;0.99	T	0.36696	-0.9737	10	0.49607	T	0.09	-44.6096	8.0934	0.30813	0.23:0.0:0.77:0.0	.	142;234	O15034-2;O15034	.;RIMB2_HUMAN	E	234;142;142;142	ENSP00000261655:D234E;ENSP00000440347:D142E;ENSP00000439159:D142E	ENSP00000261655:D234E	D	-	3	2	RIMBP2	129493097	1.000000	0.71417	0.994000	0.49952	0.847000	0.48162	2.904000	0.48719	2.053000	0.61076	0.561000	0.74099	GAC	RIMBP2	-	superfamily_SH3_domain,pfscan_SH3_domain	ENSG00000060709		0.587	RIMBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMBP2	HGNC	protein_coding	OTTHUMT00000399520.1	20	0.00	0	G	NM_015347		130927144	130927144	-1	no_errors	ENST00000261655	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	1.000	T
SLC9A7	84679	genome.wustl.edu	37	X	46508206	46508206	+	Silent	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chrX:46508206C>T	ENST00000328306.4	-	11	1399	c.1374G>A	c.(1372-1374)gcG>gcA	p.A458A		NM_001257291.1|NM_032591.2	NP_001244220.1|NP_115980.1	Q96T83	SL9A7_HUMAN	solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7	458					ion transport (GO:0006811)|potassium ion transmembrane transport (GO:0071805)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)	potassium:proton antiporter activity (GO:0015386)|protein homodimerization activity (GO:0042803)|sodium:proton antiporter activity (GO:0015385)			breast(2)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|prostate(1)|skin(1)	21						GGTAGATGTGCGCGGCTCTGC	0.498																																					Pancreas(118;454 1696 1930 13865 39976)	dbGAP											0													98.0	80.0	86.0					X																	46508206		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF298591	CCDS14269.1, CCDS75967.1	Xp11.3	2013-05-22	2012-03-22		ENSG00000065923	ENSG00000065923		"""Solute carriers"""	17123	protein-coding gene	gene with protein product		300368	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 7"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 7"""			11279194	Standard	NM_001257291		Approved	NHE7	uc004dgv.2	Q96T83	OTTHUMG00000021428	ENST00000328306.4:c.1374G>A	X.37:g.46508206C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75827|Q5JXP9	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_6,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.A458	ENST00000328306.4	37	c.1374	CCDS14269.1	X																																																																																			SLC9A7	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000065923		0.498	SLC9A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A7	HGNC	protein_coding	OTTHUMT00000056370.1	87	0.00	0	C	NM_032591		46508206	46508206	-1	no_errors	ENST00000328306	ensembl	human	known	69_37n	silent	46	17.86	10	SNP	0.996	T
TFCP2	7024	genome.wustl.edu	37	12	51501053	51501053	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr12:51501053T>A	ENST00000257915.5	-	7	1252	c.794A>T	c.(793-795)tAt>tTt	p.Y265F	TFCP2_ENST00000548115.1_Missense_Mutation_p.Y214F|TFCP2_ENST00000307660.4_Missense_Mutation_p.Y214F|TFCP2_ENST00000549867.1_Missense_Mutation_p.Y265F	NM_001173452.1|NM_005653.4	NP_001166923.1|NP_005644.2	Q12800	TFCP2_HUMAN	transcription factor CP2	265	DNA-binding.				regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	23						GGAAGGCTGATATTTCTCCTT	0.338																																						dbGAP											0													282.0	273.0	276.0					12																	51501053		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03494	CCDS8808.1, CCDS55827.1	12q13	2004-01-05				ENSG00000135457			11748	protein-coding gene	gene with protein product		189889				8157699	Standard	NM_005653		Approved	CP2, LSF, LBP-1C, TFCP2C	uc001rxw.3	Q12800	OTTHUMG00000169621	ENST00000257915.5:c.794A>T	12.37:g.51501053T>A	ENSP00000257915:p.Tyr265Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E9|Q12801|Q9UD75|Q9UD77	Missense_Mutation	SNP	pfam_CP2,superfamily_SAM/pointed	p.Y265F	ENST00000257915.5	37	c.794	CCDS8808.1	12	.	.	.	.	.	.	.	.	.	.	T	12.65	2.002177	0.35320	.	.	ENSG00000135457	ENST00000257915;ENST00000307660;ENST00000549867;ENST00000548115;ENST00000548108	T;T;T;T;T	0.61627	1.84;0.1;2.07;0.09;1.95	5.39	4.22	0.49857	.	0.000000	0.85682	D	0.000000	T	0.58921	0.2156	M	0.72479	2.2	0.51482	D	0.999921	P;B;P;B	0.42357	0.728;0.168;0.777;0.092	B;B;B;B	0.43575	0.258;0.101;0.424;0.207	T	0.59129	-0.7512	10	0.42905	T	0.14	-4.4093	11.0267	0.47748	0.1397:0.0:0.0:0.8603	.	214;265;265;265	Q12800-2;F8VX55;Q12800;Q12800-4	.;.;TFCP2_HUMAN;.	F	265;214;265;214;167	ENSP00000257915:Y265F;ENSP00000304411:Y214F;ENSP00000449742:Y265F;ENSP00000447991:Y214F;ENSP00000449280:Y167F	ENSP00000257915:Y265F	Y	-	2	0	TFCP2	49787320	1.000000	0.71417	0.881000	0.34555	0.004000	0.04260	7.991000	0.88244	0.980000	0.38523	-0.333000	0.08304	TAT	TFCP2	-	NULL	ENSG00000135457		0.338	TFCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2	HGNC	protein_coding	OTTHUMT00000405119.1	121	0.00	0	T	NM_005653		51501053	51501053	-1	no_errors	ENST00000257915	ensembl	human	known	69_37n	missense	126	17.11	26	SNP	1.000	A
SRRM4	84530	genome.wustl.edu	37	12	119419761	119419761	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr12:119419761C>A	ENST00000267260.4	+	1	462	c.74C>A	c.(73-75)aCc>aAc	p.T25N		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	25					cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						GCGGTGGCCACCCCCCGTCCC	0.607																																						dbGAP											0													26.0	30.0	28.0					12																	119419761		1950	4145	6095	-	-	-	SO:0001583	missense	0			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.74C>A	12.37:g.119419761C>A	ENSP00000267260:p.Thr25Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Missense_Mutation	SNP	NULL	p.T25N	ENST00000267260.4	37	c.74	CCDS44994.1	12	.	.	.	.	.	.	.	.	.	.	C	16.87	3.242420	0.58995	.	.	ENSG00000139767	ENST00000267260	T	0.30714	1.52	4.61	3.7	0.42460	.	0.202243	0.42294	N	0.000723	T	0.23766	0.0575	L	0.38175	1.15	0.43230	D	0.995129	P	0.36412	0.552	B	0.30105	0.111	T	0.11421	-1.0588	10	0.87932	D	0	-23.1646	14.3137	0.66434	0.1497:0.8502:0.0:0.0	.	25	A7MD48	SRRM4_HUMAN	N	25	ENSP00000267260:T25N	ENSP00000267260:T25N	T	+	2	0	SRRM4	117904144	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	3.932000	0.56537	1.241000	0.43820	0.643000	0.83706	ACC	SRRM4	-	NULL	ENSG00000139767		0.607	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM4	HGNC	protein_coding	OTTHUMT00000401640.2	51	0.00	0	C	NM_194286		119419761	119419761	+1	no_errors	ENST00000267260	ensembl	human	known	69_37n	missense	14	44.00	11	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7578275	7578275	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr17:7578275G>A	ENST00000269305.4	-	6	763	c.574C>T	c.(574-576)Cag>Tag	p.Q192*	TP53_ENST00000420246.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000413465.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000445888.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000574684.1_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.Q192*|TP53_ENST00000359597.4_Nonsense_Mutation_p.Q192*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	192	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		Q -> H (in sporadic cancers; somatic mutation).|Q -> K (in a sporadic cancer; somatic mutation).|Q -> L (in sporadic cancers; somatic mutation).|Q -> P (in sporadic cancers; somatic mutation).|Q -> R (in sporadic cancers; somatic mutation).|QH -> HN (in a sporadic cancer; somatic mutation).|QH -> HY (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.Q192*(83)|p.0?(8)|p.Q99*(6)|p.?(6)|p.Q60*(6)|p.P191del(4)|p.P191delP(4)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.P191fs*53(2)|p.G187fs*16(2)|p.P59delP(2)|p.P98delP(2)|p.P191fs*6(1)|p.A189_Q192>E(1)|p.P59_E66>Q(1)|p.P191fs*15(1)|p.P191_Q192delPQ(1)|p.Q192K(1)|p.P98_E105>Q(1)|p.A189fs*53(1)|p.Q192del(1)|p.Q192fs*16(1)|p.L188_P191del(1)|p.Q192fs*30(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATAAGATGCTGAGGAGGGGCC	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	144	Substitution - Nonsense(95)|Deletion - In frame(19)|Whole gene deletion(8)|Deletion - Frameshift(7)|Complex - deletion inframe(6)|Unknown(6)|Insertion - Frameshift(1)|Complex - frameshift(1)|Substitution - Missense(1)	breast(26)|ovary(20)|urinary_tract(15)|lung(12)|upper_aerodigestive_tract(10)|skin(8)|biliary_tract(7)|oesophagus(7)|large_intestine(6)|kidney(6)|stomach(5)|haematopoietic_and_lymphoid_tissue(5)|liver(5)|bone(4)|central_nervous_system(3)|pancreas(2)|cervix(1)|endometrium(1)|eye(1)											89.0	80.0	83.0					17																	7578275		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.574C>T	17.37:g.7578275G>A	ENSP00000269305:p.Gln192*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.Q192*	ENST00000269305.4	37	c.574	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	13.54	2.269040	0.40095	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	5.41	3.36	0.38483	.	0.242461	0.43260	D	0.000594	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-22.6404	8.6971	0.34303	0.0:0.1484:0.545:0.3066	.	.	.	.	X	192;192;192;192;192;192;181;99;60;99;60	.	ENSP00000269305:Q192X	Q	-	1	0	TP53	7519000	1.000000	0.71417	0.987000	0.45799	0.035000	0.12851	2.163000	0.42377	0.732000	0.32470	0.655000	0.94253	CAG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	117	0.00	0	G	NM_000546		7578275	7578275	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	6	84.62	33	SNP	0.998	A
TRPC4	7223	genome.wustl.edu	37	13	38248466	38248466	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr13:38248466C>T	ENST00000379705.3	-	5	2130	c.1273G>A	c.(1273-1275)Gga>Aga	p.G425R	TRPC4_ENST00000379679.1_Missense_Mutation_p.G252R|TRPC4_ENST00000358477.2_Missense_Mutation_p.G425R|TRPC4_ENST00000447043.1_Missense_Mutation_p.G425R|TRPC4_ENST00000355779.2_Missense_Mutation_p.G425R|TRPC4_ENST00000426868.2_Missense_Mutation_p.G425R|TRPC4_ENST00000379681.3_Missense_Mutation_p.G425R|TRPC4_ENST00000338947.5_Missense_Mutation_p.G252R|TRPC4_ENST00000379673.2_Missense_Mutation_p.G425R|TRPC4_ENST00000494529.1_5'UTR			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	425					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)	p.G425R(1)		NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TCCTGAAGTCCGCCATCCCAC	0.333																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											102.0	99.0	100.0					13																	38248466		2202	4300	6502	-	-	-	SO:0001583	missense	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.1273G>A	13.37:g.38248466C>T	ENSP00000369027:p.Gly425Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC4_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.G425R	ENST00000379705.3	37	c.1273	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897469	0.91962	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000338947;ENST00000379679;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	D;D;D;D;D;D;D;D;D	0.98987	-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3;-5.3	5.16	5.16	0.70880	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99351	0.9772	M	0.86178	2.8	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.99174	1.0865	10	0.87932	D	0	-26.1818	18.9997	0.92828	0.0:1.0:0.0:0.0	.	425;425;425;252;425;425	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-6;Q9UBN4-2;Q9UBN4	.;.;.;.;.;TRPC4_HUMAN	R	425;425;252;252;425;425;425;425;425	ENSP00000369027:G425R;ENSP00000369003:G425R;ENSP00000342580:G252R;ENSP00000369001:G252R;ENSP00000410133:G425R;ENSP00000348025:G425R;ENSP00000351264:G425R;ENSP00000368995:G425R;ENSP00000414316:G425R	ENSP00000342580:G252R	G	-	1	0	TRPC4	37146466	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.776000	0.85560	2.549000	0.85964	0.591000	0.81541	GGA	TRPC4	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000133107		0.333	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	136	0.00	0	C	NM_003306		38248466	38248466	-1	no_errors	ENST00000379681	ensembl	human	known	69_37n	missense	36	47.83	33	SNP	1.000	T
UPP1	7378	genome.wustl.edu	37	7	48147844	48147844	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr7:48147844C>T	ENST00000331803.4	+	10	1446	c.823C>T	c.(823-825)Cgc>Tgc	p.R275C	UPP1_ENST00000341253.4_Missense_Mutation_p.R275C|UPP1_ENST00000482015.1_3'UTR|UPP1_ENST00000429491.2_Missense_Mutation_p.R138C|UPP1_ENST00000395564.4_Missense_Mutation_p.R275C			Q16831	UPP1_HUMAN	uridine phosphorylase 1	275					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)			breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	CCTCCTGAACCGCCTGGAAGG	0.577																																						dbGAP											0													92.0	87.0	89.0					7																	48147844		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.823C>T	7.37:g.48147844C>T	ENSP00000330032:p.Arg275Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVM4|Q15362	Missense_Mutation	SNP	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk	p.R275C	ENST00000331803.4	37	c.823	CCDS5507.1	7	.	.	.	.	.	.	.	.	.	.	C	24.0	4.479522	0.84747	.	.	ENSG00000183696	ENST00000331803;ENST00000341253;ENST00000395564;ENST00000429491	T;T;T;T	0.47528	0.84;0.84;0.84;0.84	5.4	4.51	0.55191	Nucleoside phosphorylase domain (1);	0.000000	0.85682	D	0.000000	T	0.76702	0.4024	H	0.94385	3.53	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.83900	0.0289	10	0.87932	D	0	-31.4235	14.5241	0.67875	0.1476:0.8524:0.0:0.0	.	138;275	Q86Y75;Q16831	.;UPP1_HUMAN	C	275;275;275;138	ENSP00000330032:R275C;ENSP00000342878:R275C;ENSP00000378931:R275C;ENSP00000406224:R138C	ENSP00000330032:R275C	R	+	1	0	UPP1	48114369	1.000000	0.71417	0.982000	0.44146	0.950000	0.60333	3.640000	0.54350	1.249000	0.43950	0.650000	0.86243	CGC	UPP1	-	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk	ENSG00000183696		0.577	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPP1	HGNC	protein_coding	OTTHUMT00000251360.1	36	0.00	0	C	NM_003364		48147844	48147844	+1	no_errors	ENST00000331803	ensembl	human	known	69_37n	missense	10	26.67	4	SNP	1.000	T
URB2	9816	genome.wustl.edu	37	1	229773865	229773865	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr1:229773865G>A	ENST00000258243.2	+	4	3641	c.3505G>A	c.(3505-3507)Gcg>Acg	p.A1169T		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1169						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						GCCAGCTCTCGCGGGACATGA	0.522																																						dbGAP											0													138.0	141.0	140.0					1																	229773865		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.3505G>A	1.37:g.229773865G>A	ENSP00000258243:p.Ala1169Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.A1169T	ENST00000258243.2	37	c.3505	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580204	0.28180	.	.	ENSG00000135763	ENST00000258243	T	0.31510	1.49	5.65	1.83	0.25207	.	0.663319	0.15700	N	0.248971	T	0.17534	0.0421	L	0.27053	0.805	0.09310	N	1	B	0.16396	0.017	B	0.08055	0.003	T	0.24119	-1.0169	9	.	.	.	-1.6535	6.2627	0.20910	0.2396:0.0:0.6339:0.1265	.	1169	Q14146	URB2_HUMAN	T	1169	ENSP00000258243:A1169T	.	A	+	1	0	URB2	227840488	0.007000	0.16637	0.000000	0.03702	0.002000	0.02628	1.662000	0.37418	0.149000	0.19098	0.585000	0.79938	GCG	URB2	-	NULL	ENSG00000135763		0.522	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	54	0.00	0	G	NM_014777		229773865	229773865	+1	no_errors	ENST00000258243	ensembl	human	known	69_37n	missense	123	18.54	28	SNP	0.000	A
TBC1D31	93594	genome.wustl.edu	37	8	124113134	124113134	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr8:124113134G>T	ENST00000287380.1	+	7	1009	c.919G>T	c.(919-921)Gaa>Taa	p.E307*	TBC1D31_ENST00000327098.5_Nonsense_Mutation_p.E307*|TBC1D31_ENST00000378080.2_Nonsense_Mutation_p.E202*|TBC1D31_ENST00000522420.1_Nonsense_Mutation_p.E202*|TBC1D31_ENST00000521676.1_Nonsense_Mutation_p.E202*|TBC1D31_ENST00000518805.1_5'Flank|TBC1D31_ENST00000309336.3_Nonsense_Mutation_p.E307*	NM_145647.3	NP_663622.2	Q96DN5	TBC31_HUMAN	TBC1 domain family, member 31	307						centrosome (GO:0005813)	Rab GTPase activator activity (GO:0005097)										GAGCCTCGATGAAGGAATTAG	0.368																																						dbGAP											0													89.0	84.0	86.0					8																	124113134		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK094612	CCDS6338.1, CCDS47916.1	8q24.13	2013-07-10	2013-07-10	2013-07-10	ENSG00000156787	ENSG00000156787		"""WD repeat domain containing"""	30888	protein-coding gene	gene with protein product			"""WD repeat domain 67"""	WDR67		12477932	Standard	NM_001145088		Approved	MGC21654, Gm85	uc003ypp.2	Q96DN5	OTTHUMG00000165081	ENST00000287380.1:c.919G>T	8.37:g.124113134G>T	ENSP00000287380:p.Glu307*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL19|Q2M2J9|Q3MIR6|Q8TBP9	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Rab-GTPase-TBC_dom,smart_WD40_repeat,pfscan_Rab-GTPase-TBC_dom,pfscan_WD40_repeat_dom	p.E307*	ENST00000287380.1	37	c.919	CCDS6338.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.474119|6.474119	0.97594|0.97594	.|.	.|.	ENSG00000156787|ENSG00000156787	ENST00000287380;ENST00000309336;ENST00000543408;ENST00000327098;ENST00000522420;ENST00000521676;ENST00000378080|ENST00000521914	.|.	.|.	.|.	5.26|5.26	4.39|4.39	0.52855|0.52855	.|.	0.598725|.	0.17921|.	N|.	0.157506|.	.|T	.|0.53206	.|0.1782	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.63075	.|-0.6718	.|3	0.19147|.	T|.	0.46|.	-5.3485|-5.3485	9.5812|9.5812	0.39488|0.39488	0.0739:0.1434:0.7827:0.0|0.0739:0.1434:0.7827:0.0	.|.	.|.	.|.	.|.	X|I	307;307;186;307;202;202;202|110	.|.	ENSP00000287380:E307X|.	E|M	+|+	1|3	0|0	WDR67|WDR67	124182315|124182315	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.949000|0.949000	0.60115|0.60115	4.161000|4.161000	0.58170|0.58170	1.237000|1.237000	0.43756|0.43756	-0.226000|-0.226000	0.12346|0.12346	GAA|ATG	WDR67	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000156787		0.368	TBC1D31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR67	HGNC	protein_coding	OTTHUMT00000381721.1	67	0.00	0	G	NM_145647		124113134	124113134	+1	no_errors	ENST00000287380	ensembl	human	known	69_37n	nonsense	78	29.73	33	SNP	0.953	T
WWC3	55841	genome.wustl.edu	37	X	10066593	10066593	+	Silent	SNP	T	T	C			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chrX:10066593T>C	ENST00000380861.4	+	8	1096	c.705T>C	c.(703-705)aaT>aaC	p.N235N	WWC3_ENST00000454666.1_Silent_p.N235N	NM_015691.3	NP_056506.2	Q9ULE0	WWC3_HUMAN	WWC family member 3	235					negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(3)|endometrium(10)|kidney(1)|large_intestine(11)|lung(17)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	52						TCAGACTTAATTGGCAATATG	0.383																																						dbGAP											0													92.0	87.0	89.0					X																	10066593		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091936	CCDS14136.1	Xp22.32	2008-02-05			ENSG00000047644	ENSG00000047644		"""WW, C2 and coiled-coil domain containing"""	29237	protein-coding gene	gene with protein product						10574462	Standard	NM_015691		Approved	KIAA1280, BM042	uc004csx.4	Q9ULE0	OTTHUMG00000021123	ENST00000380861.4:c.705T>C	X.37:g.10066593T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA96|Q659C1|Q9BTQ1	Silent	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.N235	ENST00000380861.4	37	c.705	CCDS14136.1	X																																																																																			WWC3	-	NULL	ENSG00000047644		0.383	WWC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC3	HGNC	protein_coding	OTTHUMT00000055725.1	94	0.00	0	T	NM_015691		10066593	10066593	+1	no_errors	ENST00000380861	ensembl	human	known	69_37n	silent	42	32.81	21	SNP	0.939	C
ZNF292	23036	genome.wustl.edu	37	6	87970171	87970171	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr6:87970171G>T	ENST00000369577.3	+	8	6867	c.6824G>T	c.(6823-6825)cGa>cTa	p.R2275L	ZNF292_ENST00000339907.4_Missense_Mutation_p.R2270L	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	2275						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		AATCTCCTCCGACACATTTTT	0.408																																						dbGAP											0													72.0	70.0	71.0					6																	87970171		1843	4096	5939	-	-	-	SO:0001583	missense	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.6824G>T	6.37:g.87970171G>T	ENSP00000358590:p.Arg2275Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R2275L	ENST00000369577.3	37	c.6824	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091992	0.76756	.	.	ENSG00000188994	ENST00000369577;ENST00000339907;ENST00000496806	T;T;T	0.55413	0.97;0.97;0.52	5.62	5.62	0.85841	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.68860	0.3047	M	0.71296	2.17	0.53005	D	0.999963	D	0.89917	1.0	D	0.81914	0.995	T	0.70988	-0.4722	10	0.72032	D	0.01	.	19.6484	0.95791	0.0:0.0:1.0:0.0	.	2275	O60281	ZN292_HUMAN	L	2275;2270;193	ENSP00000358590:R2275L;ENSP00000342847:R2270L;ENSP00000428857:R193L	ENSP00000342847:R2270L	R	+	2	0	ZNF292	88026890	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.659000	0.90383	0.585000	0.79938	CGA	ZNF292	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000188994		0.408	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	41	0.00	0	G	NM_015021		87970171	87970171	+1	no_errors	ENST00000369577	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	T
ZNF732	654254	genome.wustl.edu	37	4	265013	265013	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr4:265013G>C	ENST00000419098.1	-	4	1643	c.1633C>G	c.(1633-1635)Ctg>Gtg	p.L545V		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	545					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						TATTTATTCAGGACTCTGGAA	0.368																																						dbGAP											0													65.0	58.0	60.0					4																	265013		692	1591	2283	-	-	-	SO:0001583	missense	0			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.1633C>G	4.37:g.265013G>C	ENSP00000415774:p.Leu545Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L545V	ENST00000419098.1	37	c.1633	CCDS46990.1	4	.	.	.	.	.	.	.	.	.	.	G	9.433	1.086004	0.20390	.	.	ENSG00000186777	ENST00000419098	T	0.70749	-0.51	0.977	0.977	0.19733	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.66848	0.2831	M	0.73598	2.24	0.09310	N	1	B	0.19706	0.038	B	0.11329	0.006	T	0.61317	-0.7087	9	0.72032	D	0.01	.	7.3306	0.26580	0.0:0.0:1.0:0.0	.	545	B4DXR9	ZN732_HUMAN	V	545	ENSP00000415774:L545V	ENSP00000415774:L545V	L	-	1	2	ZNF732	255013	0.000000	0.05858	0.006000	0.13384	0.005000	0.04900	-0.429000	0.06982	0.399000	0.25367	0.400000	0.26472	CTG	ZNF732	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186777		0.368	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	HGNC	protein_coding	OTTHUMT00000357937.2	57	0.00	0	G	NM_001137608		265013	265013	-1	no_errors	ENST00000419098	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	0.001	C
ZNF732	654254	genome.wustl.edu	37	4	265525	265525	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr4:265525G>A	ENST00000419098.1	-	4	1131	c.1121C>T	c.(1120-1122)tCc>tTc	p.S374F		NM_001137608.1	NP_001131080.1	B4DXR9	ZN732_HUMAN	zinc finger protein 732	374					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)	3						AAGGGTTGCGGATTGTCTAAA	0.393																																						dbGAP											0													69.0	62.0	64.0					4																	265525		692	1591	2283	-	-	-	SO:0001583	missense	0			AK302099	CCDS46990.1	4p16.3	2014-02-12	2009-07-22		ENSG00000186777	ENSG00000186777		"""Zinc fingers, C2H2-type"", ""-"""	37138	protein-coding gene	gene with protein product							Standard	NM_001137608		Approved	FLJ59067	uc011buu.1	B4DXR9	OTTHUMG00000159883	ENST00000419098.1:c.1121C>T	4.37:g.265525G>A	ENSP00000415774:p.Ser374Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S374F	ENST00000419098.1	37	c.1121	CCDS46990.1	4	.	.	.	.	.	.	.	.	.	.	G	0.106	-1.145617	0.01714	.	.	ENSG00000186777	ENST00000419098	T	0.08008	3.14	0.977	-1.95	0.07548	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10252	0.0251	M	0.78637	2.42	0.09310	N	1	B	0.17038	0.02	B	0.12156	0.007	T	0.31696	-0.9934	9	0.31617	T	0.26	.	6.4212	0.21744	0.0:0.6822:0.3178:0.0	.	374	B4DXR9	ZN732_HUMAN	F	374	ENSP00000415774:S374F	ENSP00000415774:S374F	S	-	2	0	ZNF732	255525	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	-2.330000	0.01110	-0.711000	0.04995	-0.719000	0.03609	TCC	ZNF732	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186777		0.393	ZNF732-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF732	HGNC	protein_coding	OTTHUMT00000357937.2	38	0.00	0	G	NM_001137608		265525	265525	-1	no_errors	ENST00000419098	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.007	A
ZPBP	11055	genome.wustl.edu	37	7	50070741	50070741	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1OY-01A-11D-A142-09	TCGA-EW-A1OY-10A-01W-A187-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	925323a2-ca03-48f4-8c37-1a8a6f8a6daa	0e403dba-b5e9-4232-a8ca-9fa9a26cae1a	g.chr7:50070741C>T	ENST00000046087.2	-	5	722	c.653G>A	c.(652-654)cGc>cAc	p.R218H	ZPBP_ENST00000491129.1_Intron|ZPBP_ENST00000419417.1_Missense_Mutation_p.R217H	NM_001159878.1|NM_007009.2	NP_001153350.1|NP_008940.2	Q9BS86	ZPBP1_HUMAN	zona pellucida binding protein	218					acrosome assembly (GO:0001675)|binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|cell body (GO:0044297)|extracellular region (GO:0005576)|nucleus (GO:0005634)|zona pellucida receptor complex (GO:0002199)				NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(3)	29	Glioma(55;0.08)|all_neural(89;0.245)					CATTTTAACGCGATGGCATTC	0.313																																						dbGAP											0													74.0	79.0	77.0					7																	50070741		2203	4299	6502	-	-	-	SO:0001583	missense	0			D17570	CCDS5509.1, CCDS55110.1	7p14.3	2013-01-11			ENSG00000042813	ENSG00000042813		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15662	protein-coding gene	gene with protein product		608498				9378618	Standard	NM_007009		Approved	SP38, ZPBP1	uc003tou.3	Q9BS86	OTTHUMG00000023528	ENST00000046087.2:c.653G>A	7.37:g.50070741C>T	ENSP00000046087:p.Arg218His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D253|C9JPU1|Q15941|Q75KX9|Q75MI3	Missense_Mutation	SNP	pfam_Sp38-bd,pfscan_Ig-like	p.R218H	ENST00000046087.2	37	c.653	CCDS5509.1	7	.	.	.	.	.	.	.	.	.	.	C	2.236	-0.374976	0.05034	.	.	ENSG00000042813	ENST00000046087;ENST00000419417	T;T	0.52295	0.67;0.67	5.05	-3.55	0.04639	.	0.426171	0.22057	N	0.065239	T	0.22627	0.0546	N	0.12471	0.22	0.23809	N	0.996782	B;B	0.09022	0.002;0.002	B;B	0.06405	0.002;0.002	T	0.20706	-1.0267	9	.	.	.	-5.9714	11.0628	0.47957	0.0:0.3771:0.0:0.6229	.	217;218	C9JPU1;Q9BS86	.;ZPBP1_HUMAN	H	218;217	ENSP00000046087:R218H;ENSP00000402071:R217H	.	R	-	2	0	ZPBP	50041287	0.958000	0.32768	0.929000	0.37066	0.450000	0.32258	-0.146000	0.10250	-0.532000	0.06332	-1.865000	0.00557	CGC	ZPBP	-	pfam_Sp38-bd	ENSG00000042813		0.313	ZPBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZPBP	HGNC	protein_coding	OTTHUMT00000251374.1	51	0.00	0	C	NM_007009		50070741	50070741	-1	no_errors	ENST00000046087	ensembl	human	known	69_37n	missense	11	63.64	21	SNP	0.978	T
