#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM2	2515	genome.wustl.edu	37	8	39695678	39695678	+	Silent	SNP	G	G	A			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr8:39695678G>A	ENST00000265708.4	-	1	130	c.27C>T	c.(25-27)agC>agT	p.S9S	ADAM2_ENST00000521880.1_Silent_p.S9S|ADAM2_ENST00000379853.2_Silent_p.S9S|ADAM2_ENST00000347580.4_Silent_p.S9S|ADAM2_ENST00000523181.1_5'UTR	NM_001464.3	NP_001455.3	Q99965	ADAM2_HUMAN	ADAM metallopeptidase domain 2	9					adult behavior (GO:0030534)|binding of sperm to zona pellucida (GO:0007339)|cell adhesion (GO:0007155)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)|visual learning (GO:0008542)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(11)|lung(29)|ovary(3)|prostate(1)|skin(5)|urinary_tract(1)	53		all_cancers(7;2.38e-28)|all_epithelial(6;8.85e-21)|all_lung(54;1.24e-07)|Lung NSC(58;1.94e-07)|Hepatocellular(245;0.00745)|Breast(189;0.00908)|Renal(179;0.0183)|Colorectal(162;0.246)	LUSC - Lung squamous cell carcinoma(45;0.000149)	READ - Rectum adenocarcinoma(644;0.0689)|Kidney(114;0.162)		CGCCGAGCCCGCTGAGCAGAA	0.577																																						dbGAP											0													76.0	76.0	76.0					8																	39695678		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U52370	CCDS34884.1, CCDS64882.1, CCDS64883.1	8p11.2	2009-03-25	2008-07-31		ENSG00000104755	ENSG00000104755		"""ADAM metallopeptidase domain containing"""	198	protein-coding gene	gene with protein product	"""cancer/testis antigen 15"""	601533	"""fertilin beta"""	FTNB		8702389, 9070941	Standard	NM_001278113		Approved	PH-30b, PH30, CT15	uc003xnj.4	Q99965	OTTHUMG00000164041	ENST00000265708.4:c.27C>T	8.37:g.39695678G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P78326|Q9UQQ8	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S9	ENST00000265708.4	37	c.27	CCDS34884.1	8																																																																																			ADAM2	-	NULL	ENSG00000104755		0.577	ADAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM2	HGNC	protein_coding	OTTHUMT00000376926.1	59	0.00	0	G	NM_001464		39695678	39695678	-1	no_errors	ENST00000265708	ensembl	human	known	69_37n	silent	65	13.33	10	SNP	0.001	A
ARPP21	10777	genome.wustl.edu	37	3	35833914	35833914	+	Silent	SNP	C	C	A			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr3:35833914C>A	ENST00000187397.4	+	19	2529	c.2073C>A	c.(2071-2073)ggC>ggA	p.G691G	ARPP21_ENST00000476052.1_3'UTR|ARPP21_ENST00000444190.1_Silent_p.G672G|ARPP21_ENST00000458225.1_Silent_p.G692G|ARPP21_ENST00000417925.1_Silent_p.G692G|ARPP21_ENST00000337271.5_Silent_p.G672G	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	691	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						GATTCCAAGGCCTAATAGGAG	0.463																																						dbGAP											0													166.0	163.0	164.0					3																	35833914		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.2073C>A	3.37:g.35833914C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Silent	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.G692	ENST00000187397.4	37	c.2076	CCDS2661.1	3																																																																																			ARPP21	-	NULL	ENSG00000172995		0.463	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	60	0.00	0	C	NM_198399		35833914	35833914	+1	no_errors	ENST00000417925	ensembl	human	known	69_37n	silent	33	31.25	15	SNP	0.982	A
CELSR2	1952	genome.wustl.edu	37	1	109814957	109814957	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr1:109814957T>C	ENST00000271332.3	+	29	8045	c.7984T>C	c.(7984-7986)Tcg>Ccg	p.S2662P	CELSR2_ENST00000498157.1_3'UTR	NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	2662					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CTACGGAGACTCGGCCGGCTC	0.627																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													81.0	90.0	87.0					1																	109814957		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.7984T>C	1.37:g.109814957T>C	ENSP00000271332:p.Ser2662Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.S2662P	ENST00000271332.3	37	c.7984	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	T	23.7	4.450914	0.84209	.	.	ENSG00000143126	ENST00000271332	T	0.72615	-0.67	4.6	4.6	0.57074	.	.	.	.	.	T	0.79076	0.4385	M	0.75615	2.305	0.46222	D	0.998934	D	0.89917	1.0	D	0.87578	0.998	T	0.82114	-0.0617	9	0.72032	D	0.01	.	12.6667	0.56846	0.0:0.0:0.0:1.0	.	2662	Q9HCU4	CELR2_HUMAN	P	2662	ENSP00000271332:S2662P	ENSP00000271332:S2662P	S	+	1	0	CELSR2	109616480	1.000000	0.71417	0.980000	0.43619	0.921000	0.55340	3.910000	0.56371	2.078000	0.62432	0.459000	0.35465	TCG	CELSR2	-	NULL	ENSG00000143126		0.627	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	15	0.00	0	T	NM_001408		109814957	109814957	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	4	66.67	8	SNP	1.000	C
CREBL2	1389	genome.wustl.edu	37	12	12788868	12788868	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr12:12788868G>T	ENST00000228865.2	+	2	454	c.173G>T	c.(172-174)cGa>cTa	p.R58L	CREBL2_ENST00000540224.1_3'UTR	NM_001310.2	NP_001301.1	O60519	CRBL2_HUMAN	cAMP responsive element binding protein-like 2	58	Basic motif. {ECO:0000250}.|bZIP.				cell cycle (GO:0007049)|cell differentiation (GO:0030154)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of glucose import (GO:0046326)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)	1		Prostate(47;0.0684)		BRCA - Breast invasive adenocarcinoma(232;0.0503)		GTATCCAGTCGAGAAAGAGCT	0.408																																						dbGAP											0													49.0	52.0	51.0					12																	12788868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039081	CCDS8651.1	12p13.2	2013-01-10			ENSG00000111269	ENSG00000111269		"""basic leucine zipper proteins"""	2350	protein-coding gene	gene with protein product		603476				9693048	Standard	NM_001310		Approved		uc001rap.1	O60519	OTTHUMG00000168704	ENST00000228865.2:c.173G>T	12.37:g.12788868G>T	ENSP00000228865:p.Arg58Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUM5	Missense_Mutation	SNP	pfam_bZIP_2,pfam_bZIP_1	p.R58L	ENST00000228865.2	37	c.173	CCDS8651.1	12	.	.	.	.	.	.	.	.	.	.	G	19.97	3.924567	0.73213	.	.	ENSG00000111269	ENST00000228865	D	0.86366	-2.11	5.58	5.58	0.84498	Basic leucine zipper (1);	0.054654	0.64402	D	0.000001	D	0.86640	0.5981	M	0.62723	1.935	0.37854	D	0.929507	P	0.43909	0.821	B	0.42214	0.38	D	0.89814	0.3984	10	0.87932	D	0	-11.0767	14.7479	0.69501	0.0713:0.0:0.9287:0.0	.	58	O60519	CRBL2_HUMAN	L	58	ENSP00000228865:R58L	ENSP00000228865:R58L	R	+	2	0	CREBL2	12680135	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.294000	0.78760	2.626000	0.88956	0.455000	0.32223	CGA	CREBL2	-	pfam_bZIP_2,pfam_bZIP_1	ENSG00000111269		0.408	CREBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBL2	HGNC	protein_coding	OTTHUMT00000400660.1	18	0.00	0	G	NM_001310		12788868	12788868	+1	no_errors	ENST00000228865	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.999	T
DMBX1	127343	genome.wustl.edu	37	1	46977791	46977791	+	Silent	SNP	G	G	A	rs114951731	byFrequency	TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr1:46977791G>A	ENST00000360032.3	+	4	773	c.759G>A	c.(757-759)tcG>tcA	p.S253S	DMBX1_ENST00000371956.4_Silent_p.S258S	NM_172225.1	NP_757379.1			diencephalon/mesencephalon homeobox 1											endometrium(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Acute lymphoblastic leukemia(166;0.155)					CCTATTCCTCGTCCCCGCTGA	0.632													G|||	6	0.00119808	0.0045	0.0	5008	,	,		17476	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													81.0	84.0	83.0					1																	46977791		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037699	CCDS536.1	1p34.1	2011-06-20	2004-03-29	2004-03-30	ENSG00000197587	ENSG00000197587		"""Homeoboxes / PRD class"""	19026	protein-coding gene	gene with protein product		607410	"""orthodenticle homolog 3 (Drosophila)"""	OTX3			Standard	NM_147192		Approved	PAXB	uc001cpx.3	Q8NFW5	OTTHUMG00000007982	ENST00000360032.3:c.759G>A	1.37:g.46977791G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.S258	ENST00000360032.3	37	c.774	CCDS536.1	1																																																																																			DMBX1	-	NULL	ENSG00000197587		0.632	DMBX1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DMBX1	HGNC	protein_coding	OTTHUMT00000021895.1	41	0.00	0	G			46977791	46977791	+1	no_errors	ENST00000371956	ensembl	human	known	69_37n	silent	4	55.56	5	SNP	0.031	A
DNAH1	25981	genome.wustl.edu	37	3	52404645	52404645	+	Missense_Mutation	SNP	C	C	A	rs372595174	byFrequency	TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr3:52404645C>A	ENST00000420323.2	+	40	6672	c.6411C>A	c.(6409-6411)aaC>aaA	p.N2137K		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2137					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGATGGAGAACGAACAGGTGA	0.627																																						dbGAP											0													29.0	31.0	31.0					3																	52404645		1977	4149	6126	-	-	-	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.6411C>A	3.37:g.52404645C>A	ENSP00000401514:p.Asn2137Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.N2137K	ENST00000420323.2	37	c.6411	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	C	0.792	-0.758542	0.03019	.	.	ENSG00000114841	ENST00000420323	T	0.22945	1.93	4.47	-8.95	0.00765	.	3.164890	0.00812	N	0.001514	T	0.06280	0.0162	N	0.01431	-0.87	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.15037	-1.0451	10	0.05525	T	0.97	.	3.2474	0.06802	0.1252:0.3518:0.1402:0.3828	.	2137	C9JXH6	.	K	2137	ENSP00000401514:N2137K	ENSP00000401514:N2137K	N	+	3	2	DNAH1	52379685	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-2.818000	0.00751	-4.483000	0.00046	-1.717000	0.00709	AAC	DNAH1	-	NULL	ENSG00000114841		0.627	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	31	0.00	0	C	NM_015512		52404645	52404645	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	0.000	A
GALNT8	26290	genome.wustl.edu	37	12	4874615	4874615	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr12:4874615G>A	ENST00000252318.2	+	10	2001	c.1664G>A	c.(1663-1665)cGc>cAc	p.R555H		NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	555	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						GCTAGTGATCGCTGCCTGACA	0.443																																					Colon(108;631 1558 7270 20097 39846)	dbGAP											0													108.0	104.0	105.0					12																	4874615		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.1664G>A	12.37:g.4874615G>A	ENSP00000252318:p.Arg555His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU02	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R555H	ENST00000252318.2	37	c.1664	CCDS8533.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.85|11.85	1.762846|1.762846	0.31228|0.31228	.|.	.|.	ENSG00000130035|ENSG00000130035	ENST00000542998;ENST00000535354|ENST00000252318	.|T	.|0.31247	.|1.5	4.04|4.04	-2.05|-2.05	0.07321|0.07321	.|Ricin B-related lectin (1);Ricin B lectin (3);	.|0.270337	.|0.36893	.|N	.|0.002357	T|T	0.16938|0.16938	0.0407|0.0407	L|L	0.42744|0.42744	1.35|1.35	0.09310|0.09310	N|N	1|1	.|B	.|0.31227	.|0.314	.|B	.|0.22601	.|0.04	T|T	0.09228|0.09228	-1.0684|-1.0684	5|10	.|0.62326	.|D	.|0.03	.|.	2.8311|2.8311	0.05501|0.05501	0.3287:0.0:0.3426:0.3288|0.3287:0.0:0.3426:0.3288	.|.	.|555	.|Q9NY28	.|GALT8_HUMAN	T|H	72;51|555	.|ENSP00000252318:R555H	.|ENSP00000252318:R555H	A|R	+|+	1|2	0|0	GALNT8|GALNT8	4744876|4744876	0.018000|0.018000	0.18449|0.18449	0.084000|0.084000	0.20598|0.20598	0.273000|0.273000	0.26683|0.26683	0.046000|0.046000	0.14035|0.14035	-0.265000|-0.265000	0.09352|0.09352	0.655000|0.655000	0.94253|0.94253	GCT|CGC	GALNT8	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000130035		0.443	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GALNT8	HGNC	protein_coding	OTTHUMT00000388277.2	77	0.00	0	G	NM_017417		4874615	4874615	+1	no_errors	ENST00000252318	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	0.132	A
GHRHR	2692	genome.wustl.edu	37	7	31013744	31013744	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr7:31013744G>A	ENST00000326139.2	+	7	788	c.742G>A	c.(742-744)Gct>Act	p.A248T	GHRHR_ENST00000461424.1_3'UTR|GHRHR_ENST00000409904.3_Missense_Mutation_p.A184T|GHRHR_ENST00000409316.1_Intron	NM_000823.3	NP_000814.2	Q02643	GHRHR_HUMAN	growth hormone releasing hormone receptor	248					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|cAMP-mediated signaling (GO:0019933)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|determination of adult lifespan (GO:0008340)|growth hormone secretion (GO:0030252)|hormone metabolic process (GO:0042445)|lactation (GO:0007595)|multicellular organismal reproductive process (GO:0048609)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cell proliferation (GO:0008284)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of multicellular organism growth (GO:0040018)|regulation of intracellular steroid hormone receptor signaling pathway (GO:0033143)|regulation of protein metabolic process (GO:0051246)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to insulin (GO:0032868)|somatotropin secreting cell development (GO:0060133)|water homeostasis (GO:0030104)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)|nuclear matrix (GO:0016363)|nuclear outer membrane (GO:0005640)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)	G-protein coupled receptor activity (GO:0004930)|growth factor binding (GO:0019838)|growth hormone-releasing hormone receptor activity (GO:0016520)|peptide hormone binding (GO:0017046)			biliary_tract(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	35					Sermorelin(DB00010)|Tesamorelin(DB08869)	GCTGGTTCTCGCTGGCTGGGG	0.617																																						dbGAP											0													50.0	53.0	52.0					7																	31013744		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5432.1	7p14	2012-08-10			ENSG00000106128	ENSG00000106128		"""GPCR / Class B : Glucagon receptors"""	4266	protein-coding gene	gene with protein product		139191				7680413, 7514564	Standard	NM_000823		Approved		uc003tbx.3	Q02643	OTTHUMG00000152801	ENST00000326139.2:c.742G>A	7.37:g.31013744G>A	ENSP00000320180:p.Ala248Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99863	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GHRH_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_VIP_rcpt_1	p.A248T	ENST00000326139.2	37	c.742	CCDS5432.1	7	.	.	.	.	.	.	.	.	.	.	g	18.73	3.687131	0.68157	.	.	ENSG00000106128	ENST00000326139;ENST00000409904	T;T	0.46063	0.88;0.88	4.93	4.93	0.64822	GPCR, family 2-like (1);	.	.	.	.	T	0.38348	0.1037	N	0.14661	0.345	0.80722	D	1	D;D	0.65815	0.995;0.995	P;P	0.56278	0.795;0.795	T	0.28522	-1.0041	9	0.72032	D	0.01	.	9.1483	0.36946	0.0962:0.0:0.9038:0.0	.	184;248	Q9HB45;Q02643	.;GHRHR_HUMAN	T	248;184	ENSP00000320180:A248T;ENSP00000387113:A184T	ENSP00000320180:A248T	A	+	1	0	GHRHR	30980269	0.939000	0.31865	0.926000	0.36857	0.411000	0.31082	1.577000	0.36515	2.556000	0.86216	0.552000	0.68991	GCT	GHRHR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000106128		0.617	GHRHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHRHR	HGNC	protein_coding	OTTHUMT00000327967.2	31	0.00	0	G			31013744	31013744	+1	no_errors	ENST00000326139	ensembl	human	known	69_37n	missense	10	61.54	16	SNP	0.820	A
GOLGA8I	283796	genome.wustl.edu	37	15	23259835	23259835	+	Missense_Mutation	SNP	C	C	T	rs200135916	byFrequency	TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr15:23259835C>T	ENST00000450802.3	+	8	603	c.505C>T	c.(505-507)Cgc>Tgc	p.R169C		NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	169						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											TCTGGCTGTCCGCCTGCAACA	0.502													.|||	1837	0.366813	0.2791	0.4006	5008	,	,		20385	0.4881		0.2704	False		,,,				2504	0.4356					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.505C>T	15.37:g.23259835C>T	ENSP00000399637:p.Arg169Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R169C	ENST00000450802.3	37	c.505		15	.	.	.	.	.	.	.	.	.	.	.	4.787	0.146248	0.09134	.	.	ENSG00000153666	ENST00000450802	T	0.23552	1.9	0.83	0.83	0.18854	.	.	.	.	.	T	0.18923	0.0454	.	.	.	.	.	.	B	0.27286	0.174	B	0.26202	0.067	T	0.22730	-1.0208	7	0.66056	D	0.02	.	7.6315	0.28243	0.0:1.0:0.0:0.0	.	88	Q8NA68	.	C	169	ENSP00000399637:R169C	ENSP00000399637:R169C	R	+	1	0	GOLGA8IP	20811276	0.867000	0.29959	0.016000	0.15963	0.363000	0.29612	2.001000	0.40825	0.775000	0.33450	0.064000	0.15345	CGC	GOLGA8IP	-	NULL	ENSG00000153666		0.502	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8IP	HGNC	protein_coding	OTTHUMT00000251213.2	8	0.00	0	C	NR_024074		23259835	23259835	+1	no_errors	ENST00000450802	ensembl	human	known	69_37n	missense	6	50.00	6	SNP	0.288	T
GPC3	2719	genome.wustl.edu	37	X	132887946	132887946	+	Nonsense_Mutation	SNP	G	G	A	rs104894855		TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chrX:132887946G>A	ENST00000370818.3	-	3	1040	c.595C>T	c.(595-597)Cga>Tga	p.R199*	GPC3_ENST00000394299.2_Nonsense_Mutation_p.R199*|GPC3_ENST00000543339.1_Nonsense_Mutation_p.R145*	NM_001164618.1|NM_004484.3	NP_001158090.1|NP_004475.1	P51654	GPC3_HUMAN	glypican 3	199					anatomical structure morphogenesis (GO:0009653)|anterior/posterior axis specification (GO:0009948)|body morphogenesis (GO:0010171)|bone mineralization (GO:0030282)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cell proliferation involved in metanephros development (GO:0072203)|chondroitin sulfate metabolic process (GO:0030204)|coronary vasculature development (GO:0060976)|embryonic hindlimb morphogenesis (GO:0035116)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lung development (GO:0030324)|mesenchymal cell proliferation involved in ureteric bud development (GO:0072138)|mesonephric duct morphogenesis (GO:0072180)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of growth (GO:0045926)|negative regulation of smoothened signaling pathway (GO:0045879)|osteoclast differentiation (GO:0030316)|phototransduction, visible light (GO:0007603)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endocytosis (GO:0045807)|positive regulation of glucose import (GO:0046326)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000096)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of plasma membrane (GO:0046658)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	peptidyl-dipeptidase inhibitor activity (GO:0060422)			breast(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(17)|prostate(1)|skin(2)	36	Acute lymphoblastic leukemia(192;0.000127)					CTTGCTCCTCGGAGGCACTCA	0.478			"""T, D, Mis, N, F, S"""			Wilms tumour			Simpson-Golabi-Behmel syndrome																													dbGAP	yes	Rec/X		Simpson-Golabi-Behmel syndrome	X	Xq26.1	2719	glypican 3		O	0			GRCh37	CM001185	GPC3	M	rs104894855						408.0	307.0	341.0					X																	132887946		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	SGBS	L47125	CCDS14638.1, CCDS55496.1	Xq26	2014-09-17			ENSG00000147257	ENSG00000147257		"""Proteoglycans / Cell Surface : Glypicans"""	4451	protein-coding gene	gene with protein product	"""glypican proteoglycan 3"""	300037		SDYS		8589713, 9787072	Standard	NM_004484		Approved	OCI-5, SGBS, SGBS1, SGB, DGSX	uc010nrn.2	P51654	OTTHUMG00000022448	ENST00000370818.3:c.595C>T	X.37:g.132887946G>A	ENSP00000359854:p.Arg199*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JLE3|G3V1R0|Q2L880|Q2L882	Nonsense_Mutation	SNP	pfam_Glypican	p.R199*	ENST00000370818.3	37	c.595	CCDS14638.1	X	.	.	.	.	.	.	.	.	.	.	G	39	7.746126	0.98465	.	.	ENSG00000147257	ENST00000370818;ENST00000394299;ENST00000543339	.	.	.	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.2544	0.87051	0.0:0.0:1.0:0.0	.	.	.	.	X	199;199;145	.	ENSP00000359854:R199X	R	-	1	2	GPC3	132715612	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.034000	0.70933	2.285000	0.76669	0.594000	0.82650	CGA	GPC3	-	pfam_Glypican	ENSG00000147257		0.478	GPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC3	HGNC	protein_coding	OTTHUMT00000058356.1	139	0.00	0	G	NM_004484		132887946	132887946	-1	no_errors	ENST00000394299	ensembl	human	known	69_37n	nonsense	126	19.75	31	SNP	1.000	A
IGHG4	3503	genome.wustl.edu	37	14	106092401	106092401	+	RNA	SNP	A	A	G	rs28595098	byFrequency	TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr14:106092401A>G	ENST00000390543.2	-	0	2							P01861	IGHG4_HUMAN	immunoglobulin heavy constant gamma 4 (G4m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										CCTTGGTGGAAGCTGCAAGAG	0.662													N|||	1261	0.251797	0.0212	0.2305	5008	,	,		15489	0.4444		0.3797	False		,,,				2504	0.2485					dbGAP											0													30.0	21.0	24.0					14																	106092401		2005	4012	6017	-	-	-			0			K01316		14q32.33	2012-10-02			ENSG00000211892	ENSG00000211892		"""Immunoglobulins / IGH locus"""	5528	other	immunoglobulin gene		147130					Standard	NG_001019		Approved			P01861	OTTHUMG00000152481		14.37:g.106092401A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.A1	ENST00000390543.2	37	c.3		14																																																																																			IGHG4	-	NULL	ENSG00000211892		0.662	IGHG4-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHG4	HGNC	IG_C_gene	OTTHUMT00000326390.1	17	0.00	0	A	NG_001019		106092401	106092401	-1	no_start_codon	ENST00000390543	ensembl	human	known	69_37n	silent	16	27.27	6	SNP	0.002	G
LBH	81606	genome.wustl.edu	37	2	30457271	30457271	+	Splice_Site	SNP	C	C	T			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr2:30457271C>T	ENST00000395323.3	+	2	235	c.27C>T	c.(25-27)tgC>tgT	p.C9C	LBH_ENST00000407930.2_5'UTR|LBH_ENST00000467242.1_3'UTR|LBH_ENST00000404397.1_Splice_Site_p.C9C|LBH_ENST00000401506.1_Splice_Site_p.C15C|LBH_ENST00000406087.1_Splice_Site_p.C9C	NM_030915.3	NP_112177.2	Q53QV2	LBH_HUMAN	limb bud and heart development	9					multicellular organismal development (GO:0007275)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|large_intestine(1)|lung(2)	5	Acute lymphoblastic leukemia(172;0.155)					TTCTTGGCAGCCCCGACTATC	0.542																																						dbGAP											0													133.0	112.0	120.0					2																	30457271		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF110224	CCDS33173.1	2p23.1	2012-12-07	2012-12-07		ENSG00000213626	ENSG00000213626			29532	protein-coding gene	gene with protein product		611763	"""limb bud and heart development homolog (mouse)"""			11230166, 11336496	Standard	NM_030915		Approved		uc002rne.2	Q53QV2	OTTHUMG00000152051	ENST00000395323.3:c.27-1C>T	2.37:g.30457271C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBC2|Q9H0Q1	Silent	SNP	pirsf_LBH,prints_LBH	p.C9	ENST00000395323.3	37	c.27	CCDS33173.1	2																																																																																			LBH	-	pirsf_LBH	ENSG00000213626		0.542	LBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LBH	HGNC	protein_coding	OTTHUMT00000325091.1	65	0.00	0	C	NM_030915	Silent	30457271	30457271	+1	no_errors	ENST00000395323	ensembl	human	known	69_37n	silent	34	26.09	12	SNP	1.000	T
MAGEA12	4111	genome.wustl.edu	37	X	151900138	151900138	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chrX:151900138G>C	ENST00000357916.4	-	2	818	c.663C>G	c.(661-663)atC>atG	p.I221M	MAGEA12_ENST00000393869.3_Missense_Mutation_p.I221M|MAGEA12_ENST00000393900.3_Missense_Mutation_p.I221M|CSAG4_ENST00000361201.4_RNA	NM_005367.5	NP_005358.2	P43365	MAGAC_HUMAN	melanoma antigen family A, 12	221	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(5)|large_intestine(5)|liver(1)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Acute lymphoblastic leukemia(192;6.56e-05)					GCTCCTCCCAGATTTTCTCCT	0.557																																						dbGAP											0													161.0	153.0	156.0					X																	151900138		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS76048.1	Xq28	2009-03-13			ENSG00000213401	ENSG00000213401			6799	protein-coding gene	gene with protein product	"""cancer/testis antigen family 1, member 12"""	300177		MAGE12		8575766	Standard	NM_001166386		Approved	CT1.12	uc004fgc.3	P43365	OTTHUMG00000022650	ENST00000357916.4:c.663C>G	X.37:g.151900138G>C	ENSP00000350592:p.Ile221Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NSD3	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.I221M	ENST00000357916.4	37	c.663	CCDS14710.1	X	.	.	.	.	.	.	.	.	.	.	G	8.057	0.767338	0.15983	.	.	ENSG00000213401	ENST00000357916;ENST00000393869;ENST00000393900	T;T;T	0.06068	3.35;3.35;3.35	0.809	0.809	0.18725	.	0.980022	0.08394	N	0.952540	T	0.12561	0.0305	L	0.59436	1.845	0.09310	N	1	B	0.23540	0.087	B	0.41174	0.349	T	0.48198	-0.9056	9	0.52906	T	0.07	.	.	.	.	.	221	P43365	MAGAC_HUMAN	M	221	ENSP00000350592:I221M;ENSP00000377447:I221M;ENSP00000377478:I221M	ENSP00000350592:I221M	I	-	3	3	MAGEA12	151650794	0.598000	0.26882	0.014000	0.15608	0.074000	0.17049	1.558000	0.36309	0.675000	0.31264	0.181000	0.17075	ATC	MAGEA12	-	pfam_MAGE,pfscan_MAGE	ENSG00000213401		0.557	MAGEA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA12	HGNC	protein_coding	OTTHUMT00000058764.1	116	0.00	0	G	NM_005367		151900138	151900138	-1	no_errors	ENST00000357916	ensembl	human	known	69_37n	missense	75	10.59	9	SNP	0.014	C
MYT1L	23040	genome.wustl.edu	37	2	1926290	1926290	+	Silent	SNP	C	C	T			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr2:1926290C>T	ENST00000399161.2	-	10	1998	c.1251G>A	c.(1249-1251)tcG>tcA	p.S417S	MYT1L_ENST00000428368.2_Silent_p.S417S	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	417					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		CAGACCTGTCCGAGTTCACAG	0.577																																						dbGAP											0													91.0	91.0	91.0					2																	1926290		2119	4232	6351	-	-	-	SO:0001819	synonymous_variant	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1251G>A	2.37:g.1926290C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Silent	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.S417	ENST00000399161.2	37	c.1251		2																																																																																			MYT1L	-	NULL	ENSG00000186487		0.577	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	74	0.00	0	C	NM_015025		1926290	1926290	-1	no_errors	ENST00000399161	ensembl	human	known	69_37n	silent	20	45.95	17	SNP	0.141	T
OR51E2	81285	genome.wustl.edu	37	11	4703421	4703421	+	Missense_Mutation	SNP	G	G	A	rs537787175		TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr11:4703421G>A	ENST00000396950.3	-	2	760	c.521C>T	c.(520-522)tCg>tTg	p.S174L		NM_030774.3	NP_110401.1	Q9H255	O51E2_HUMAN	olfactory receptor, family 51, subfamily E, member 2	174					cellular response to fatty acid (GO:0071398)|detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|positive regulation of blood pressure (GO:0045777)|positive regulation of renin secretion into blood stream (GO:1900135)|steroid hormone mediated signaling pathway (GO:0043401)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)|signaling receptor activity (GO:0038023)|steroid hormone receptor activity (GO:0003707)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(3)	23		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;3e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00476)|LUSC - Lung squamous cell carcinoma(625;0.2)		ATAGGAGTGCGAGAGGACATT	0.537													G|||	1	0.000199681	0.0	0.0	5008	,	,		23175	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													92.0	88.0	89.0					11																	4703421		2201	4298	6499	-	-	-	SO:0001583	missense	0			AY033942	CCDS7751.1	11p15	2012-08-09			ENSG00000167332	ENSG00000167332		"""GPCR / Class A : Olfactory receptors"""	15195	protein-coding gene	gene with protein product		611268				11118034	Standard	NM_030774		Approved	PSGR	uc001lzk.2	Q9H255	OTTHUMG00000133362	ENST00000396950.3:c.521C>T	11.37:g.4703421G>A	ENSP00000380153:p.Ser174Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA63|Q6IF94	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S174L	ENST00000396950.3	37	c.521	CCDS7751.1	11	.	.	.	.	.	.	.	.	.	.	G	16.00	2.998072	0.54147	.	.	ENSG00000167332	ENST00000396950	T	0.37058	1.22	4.83	4.83	0.62350	GPCR, rhodopsin-like superfamily (1);	0.194987	0.25552	N	0.029888	T	0.44953	0.1318	M	0.85710	2.77	0.09310	N	1	P	0.44627	0.839	P	0.47251	0.542	T	0.47086	-0.9144	10	0.28530	T	0.3	.	6.1331	0.20217	0.0928:0.0:0.7198:0.1875	.	174	Q9H255	O51E2_HUMAN	L	174	ENSP00000380153:S174L	ENSP00000380153:S174L	S	-	2	0	OR51E2	4659997	0.000000	0.05858	0.993000	0.49108	0.884000	0.51177	0.868000	0.27982	2.530000	0.85305	0.655000	0.94253	TCG	OR51E2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000167332		0.537	OR51E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51E2	HGNC	protein_coding	OTTHUMT00000257198.1	11	0.00	0	G	NM_030774		4703421	4703421	-1	no_errors	ENST00000396950	ensembl	human	known	69_37n	missense	20	44.44	16	SNP	0.006	A
PIK3CA	5290	genome.wustl.edu	37	3	178928086	178928087	+	Frame_Shift_Ins	INS	-	-	G	rs397517200		TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr3:178928086_178928087insG	ENST00000263967.3	+	8	1521_1522	c.1364_1365insG	c.(1363-1368)ttgctgfs	p.L456fs		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	456	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H450fs*9(1)|p.G451_L456>V(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TTAGAAGATTTGCTGAACCCTA	0.342		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	2	Complex - frameshift(1)|Complex - deletion inframe(1)	breast(1)|endometrium(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1365dupG	3.37:g.178928087_178928087dupG	ENSP00000263967:p.Leu456fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Frame_Shift_Ins	INS	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.L456fs	ENST00000263967.3	37	c.1364_1365	CCDS43171.1	3																																																																																			PIK3CA	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000121879		0.342	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	95	0.00	0	-			178928086	178928087	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	frame_shift_ins	40	11.11	5	INS	1.000:1.000	G
SF3B1	23451	genome.wustl.edu	37	2	198266834	198266834	+	Missense_Mutation	SNP	T	T	C	rs559063155		TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr2:198266834T>C	ENST00000335508.6	-	15	2189	c.2098A>G	c.(2098-2100)Aaa>Gaa	p.K700E	SF3B1_ENST00000462613.1_5'UTR|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	700					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K700E(179)|p.Q699_K700del(2)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTCCGAACTTTCTGCTGCTCA	0.408			Mis		myelodysplastic syndrome								T|||	1	0.000199681	0.0	0.0	5008	,	,		17946	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	181	Substitution - Missense(179)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(153)|NS(20)|breast(5)|pancreas(2)|central_nervous_system(1)																																								-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2098A>G	2.37:g.198266834T>C	ENSP00000335321:p.Lys700Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K700E	ENST00000335508.6	37	c.2098	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.243295	0.95272	.	.	ENSG00000115524	ENST00000335508	T	0.63580	-0.05	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85609	0.5736	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89820	0.3988	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	700	O75533	SF3B1_HUMAN	E	700	ENSP00000335321:K700E	ENSP00000335321:K700E	K	-	1	0	SF3B1	197975079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.304000	0.77564	0.528000	0.53228	AAA	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.408	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	24	0.00	0	T			198266834	198266834	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	8	61.90	13	SNP	1.000	C
TBC1D3P5	440419	genome.wustl.edu	37	17	25752519	25752519	+	RNA	SNP	C	C	T			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr17:25752519C>T	ENST00000586223.1	+	0	1354					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		GCCCAAATGGCGGGACAGTTC	0.552																																						dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25752519C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000586223.1	37	NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.552	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	60	0.00	0	C	NR_033892		25752519	25752519	+1	no_errors	ENST00000586223	ensembl	human	known	69_37n	rna	31	16.22	6	SNP	0.001	T
USH1C	10083	genome.wustl.edu	37	11	17518353	17518353	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr11:17518353A>C	ENST00000318024.4	-	20	1706	c.1598T>G	c.(1597-1599)aTc>aGc	p.I533S	USH1C_ENST00000005226.7_Missense_Mutation_p.I833S|USH1C_ENST00000527020.1_Missense_Mutation_p.I514S|USH1C_ENST00000529563.1_5'UTR|USH1C_ENST00000527720.1_Missense_Mutation_p.I502S	NM_005709.3	NP_005700.2	Q9Y6N9	USH1C_HUMAN	Usher syndrome 1C (autosomal recessive, severe)	533	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				auditory receptor cell differentiation (GO:0042491)|equilibrioception (GO:0050957)|G2/M transition of mitotic cell cycle (GO:0000086)|inner ear morphogenesis (GO:0042472)|parallel actin filament bundle assembly (GO:0030046)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	spectrin binding (GO:0030507)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(9)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(1)	48						CACAAGGTCGATCCAGTCCTG	0.577																																						dbGAP											0													142.0	103.0	116.0					11																	17518353		2200	4293	6493	-	-	-	SO:0001583	missense	0			AB006955	CCDS7825.1, CCDS31438.1, CCDS73265.1	11p14.3	2013-06-19	2004-05-19		ENSG00000006611	ENSG00000006611			12597	protein-coding gene	gene with protein product	"""harmonin"""	605242	"""deafness, autosomal recessive 18"""	DFNB18		10973247, 12107438	Standard	NM_005709		Approved	PDZ73, harmonin, NY-CO-37, NY-CO-38, PDZ-73, AIE-75, PDZD7C	uc001mne.3	Q9Y6N9	OTTHUMG00000166323	ENST00000318024.4:c.1598T>G	11.37:g.17518353A>C	ENSP00000317018:p.Ile533Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K423|Q7RTU8|Q96B29|Q9UM04|Q9UM17|Q9UPC3	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.I833S	ENST00000318024.4	37	c.2498	CCDS31438.1	11	.	.	.	.	.	.	.	.	.	.	A	19.45	3.830824	0.71258	.	.	ENSG00000006611	ENST00000318024;ENST00000527720;ENST00000527020;ENST00000005226	T;T;T;T	0.35236	1.32;1.32;1.32;1.32	5.21	5.21	0.72293	PDZ/DHR/GLGF (2);	0.063428	0.64402	D	0.000010	T	0.55529	0.1926	L	0.57536	1.79	0.34911	D	0.747503	D;D;D	0.76494	0.993;0.999;0.999	D;D;D	0.87578	0.976;0.998;0.997	T	0.68938	-0.5277	10	0.87932	D	0	.	13.0432	0.58913	1.0:0.0:0.0:0.0	.	514;533;833	Q9Y6N9-4;Q9Y6N9;Q7RTU8	.;USH1C_HUMAN;.	S	533;502;514;833	ENSP00000317018:I533S;ENSP00000432944:I502S;ENSP00000436934:I514S;ENSP00000005226:I833S	ENSP00000005226:I833S	I	-	2	0	USH1C	17474929	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.700000	0.74619	1.973000	0.57446	0.454000	0.30748	ATC	USH1C	-	superfamily_PDZ,smart_PDZ	ENSG00000006611		0.577	USH1C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	USH1C	HGNC	protein_coding	OTTHUMT00000389146.1	33	0.00	0	A	NM_005709		17518353	17518353	-1	no_errors	ENST00000005226	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.998	C
WDR66	144406	genome.wustl.edu	37	12	122359385	122359385	+	Frame_Shift_Del	DEL	C	C	-	rs370060195		TCGA-EW-A1P5-01A-11D-A142-09	TCGA-EW-A1P5-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	84b4da42-9b73-4448-9185-a12857ab422f	a25a1ed5-8ba9-44fb-957f-3f928f2c0e28	g.chr12:122359385delC	ENST00000288912.4	+	2	1028	c.174delC	c.(172-174)ggcfs	p.G58fs	WDR66_ENST00000397454.2_Frame_Shift_Del_p.G58fs	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	58	Glu-rich.						calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ggaaaacgggcgaggaggaag	0.463																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													44.0	45.0	45.0					12																	122359385		1915	4116	6031	-	-	-	SO:0001589	frameshift_variant	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.174delC	12.37:g.122359385delC	ENSP00000288912:p.Gly58fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Frame_Shift_Del	DEL	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E59fs	ENST00000288912.4	37	c.174	CCDS41853.1	12																																																																																			WDR66	-	NULL	ENSG00000158023		0.463	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	25	0.00	0	C	NM_144668		122359385	122359385	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	frame_shift_del	18	20.83	5	DEL	0.000	-
