#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACCSL	390110	genome.wustl.edu	37	11	44081434	44081434	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr11:44081434G>C	ENST00000378832.1	+	14	1727	c.1671G>C	c.(1669-1671)ttG>ttC	p.L557F		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	557					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						AGGAGGCTTTGATAGTGAAGC	0.527																																						dbGAP											0													294.0	293.0	293.0					11																	44081434		2049	4198	6247	-	-	-	SO:0001583	missense	0				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.1671G>C	11.37:g.44081434G>C	ENSP00000368109:p.Leu557Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_ACC_synthase	p.L557F	ENST00000378832.1	37	c.1671	CCDS41636.1	11	.	.	.	.	.	.	.	.	.	.	G	0.748	-0.773771	0.02951	.	.	ENSG00000205126	ENST00000378832	T	0.70399	-0.48	3.47	-3.72	0.04411	.	0.826541	0.11193	N	0.589735	T	0.50309	0.1608	L	0.43152	1.355	0.09310	N	1	B	0.30763	0.294	B	0.24006	0.05	T	0.39663	-0.9603	10	0.52906	T	0.07	14.2194	0.5893	0.00725	0.1968:0.2864:0.2257:0.2911	.	557	Q4AC99	1A1L2_HUMAN	F	557	ENSP00000368109:L557F	ENSP00000368109:L557F	L	+	3	2	ACCSL	44038010	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	0.144000	0.16135	-0.837000	0.04223	0.561000	0.74099	TTG	ACCSL	-	NULL	ENSG00000205126		0.527	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCSL	HGNC	protein_coding	OTTHUMT00000389717.1	119	0.00	0	G	NM_001031854		44081434	44081434	+1	no_errors	ENST00000378832	ensembl	human	known	69_37n	missense	298	20.11	75	SNP	0.000	C
ANAPC1	64682	genome.wustl.edu	37	2	112619981	112619981	+	Missense_Mutation	SNP	G	G	A	rs201128090	byFrequency	TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr2:112619981G>A	ENST00000341068.3	-	10	2019	c.1247C>T	c.(1246-1248)aCg>aTg	p.T416M		NM_022662.3	NP_073153.1	Q9H1A4	APC1_HUMAN	anaphase promoting complex subunit 1	416					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)		p.T416M(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(7)|lung(16)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|urinary_tract(1)	49						ATTAGTAATCGTTTCTGTCCA	0.313																																						dbGAP											1	Substitution - Missense(1)	skin(1)											6.0	7.0	7.0					2																	112619981		2139	4197	6336	-	-	-	SO:0001583	missense	0			AJ278357	CCDS2093.1	2q12.1	2011-06-15			ENSG00000153107	ENSG00000153107		"""Anaphase promoting complex subunits"""	19988	protein-coding gene	gene with protein product		608473				11179667	Standard	NM_022662		Approved	MCPR, TSG24, APC1	uc002ssh.3	Q9H1A4	OTTHUMG00000131277	ENST00000341068.3:c.1247C>T	2.37:g.112619981G>A	ENSP00000339109:p.Thr416Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3H8|Q9BSE6|Q9H8D0	Missense_Mutation	SNP	NULL	p.T416M	ENST00000341068.3	37	c.1247	CCDS2093.1	2	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172314	0.38315	.	.	ENSG00000153107	ENST00000341068	.	.	.	5.64	4.75	0.60458	.	0.837001	0.09499	N	0.793841	T	0.39886	0.1095	L	0.50333	1.59	0.09310	N	1	B	0.33904	0.431	B	0.29785	0.107	T	0.32824	-0.9892	9	0.59425	D	0.04	-0.0065	13.163	0.59554	0.0752:0.0:0.9248:0.0	.	416	Q9H1A4	APC1_HUMAN	M	416	.	ENSP00000339109:T416M	T	-	2	0	ANAPC1	112336452	0.983000	0.35010	0.049000	0.19019	0.939000	0.58152	6.428000	0.73383	2.645000	0.89757	0.655000	0.94253	ACG	ANAPC1	-	NULL	ENSG00000153107		0.313	ANAPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANAPC1	HGNC	protein_coding	OTTHUMT00000254045.2	19	0.00	0	G	NM_022662		112619981	112619981	-1	no_errors	ENST00000341068	ensembl	human	known	69_37n	missense	58	17.14	12	SNP	0.027	A
ANKRD36C	400986	genome.wustl.edu	37	2	96657310	96657311	+	Frame_Shift_Ins	INS	-	-	TTCA	rs542264689		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr2:96657310_96657311insTTCA	ENST00000456556.1	-	1	230_231	c.146_147insTGAA	c.(145-147)aagfs	p.K49fs				Q5JPF3	AN36C_HUMAN	ankyrin repeat domain 36C	49							ion channel inhibitor activity (GO:0008200)			breast(1)|endometrium(8)|kidney(5)|lung(4)	18						GCAGAACGAACTTCAGTTCCTC	0.525																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL832836		2q11.1	2013-01-10			ENSG00000174501	ENSG00000174501		"""Ankyrin repeat domain containing"""	32946	protein-coding gene	gene with protein product	"""protein immuno-reactive with anti-PTH polyclonal antibodies"""						Standard	XR_251121		Approved	DKFZp667P0924	uc002suz.1	Q5JPF3	OTTHUMG00000155211	ENST00000456556.1:c.143_146dupTGAA	2.37:g.96657311_96657314dupTTCA	ENSP00000403302:p.Lys49fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JZ08|Q15694|Q53S06|Q658V2	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.K49fs	ENST00000456556.1	37	c.147_146		2																																																																																			ANKRD36C	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000174501		0.525	ANKRD36C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ANKRD36C	HGNC	protein_coding	OTTHUMT00000338799.2	34	0.00	0	-	NM_001010914		96657310	96657311	-1	no_errors	ENST00000456556	ensembl	human	known	69_37n	frame_shift_ins	123	13.38	19	INS	0.005:0.002	TTCA
ANKRD30BL	554226	genome.wustl.edu	37	2	133015302	133015302	+	5'UTR	SNP	T	T	G	rs75692539		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr2:133015302T>G	ENST00000470729.1	-	0	240				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						GCAGAGGCGCTCAGGGACGCC	0.677																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1185A>C	2.37:g.133015302T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.677	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	15	0.00	0	T	NR_027019		133015302	133015302	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	29	42.00	21	SNP	0.013	G
APC	324	genome.wustl.edu	37	5	112164629	112164629	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr5:112164629G>A	ENST00000457016.1	+	14	2083	c.1703G>A	c.(1702-1704)aGt>aAt	p.S568N	APC_ENST00000257430.4_Missense_Mutation_p.S568N|CTC-554D6.1_ENST00000520401.1_Missense_Mutation_p.V64M|APC_ENST00000508376.2_Missense_Mutation_p.S568N			P25054	APC_HUMAN	adenomatous polyposis coli	568	Leu-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GAAGTTGGAAGTGTGAAAGCA	0.328		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	dbGAP	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)											130.0	140.0	137.0					5																	112164629		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.1703G>A	5.37:g.112164629G>A	ENSP00000413133:p.Ser568Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.S568N	ENST00000457016.1	37	c.1703	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.384884	0.95967	.	.	ENSG00000134982	ENST00000457016;ENST00000507379;ENST00000257430;ENST00000508376;ENST00000512211	T;T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13;-0.13	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.76608	0.4011	M	0.67953	2.075	0.80722	D	1	P;P	0.51537	0.946;0.946	P;P	0.58820	0.846;0.846	T	0.77983	-0.2382	10	0.72032	D	0.01	-18.9063	19.6604	0.95864	0.0:0.0:1.0:0.0	.	570;568	Q4LE70;P25054	.;APC_HUMAN	N	568;550;568;568;568	ENSP00000413133:S568N;ENSP00000423224:S550N;ENSP00000257430:S568N;ENSP00000427089:S568N;ENSP00000423828:S568N	ENSP00000257430:S568N	S	+	2	0	APC	112192528	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	9.439000	0.97543	2.648000	0.89879	0.655000	0.94253	AGT	APC	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000134982		0.328	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	126	0.00	0	G	NM_000038		112164629	112164629	+1	no_errors	ENST00000257430	ensembl	human	known	69_37n	missense	53	54.31	63	SNP	1.000	A
ATG4A	115201	genome.wustl.edu	37	X	107396925	107396925	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chrX:107396925G>T	ENST00000372232.3	+	13	1339	c.1180G>T	c.(1180-1182)Gag>Tag	p.E394*	ATG4A_ENST00000345734.3_Nonsense_Mutation_p.E332*|ATG4A_ENST00000489247.1_3'UTR|COL4A6_ENST00000418180.1_Intron|ATG4A_ENST00000372254.3_Nonsense_Mutation_p.E370*|ATG4A_ENST00000545696.1_Nonsense_Mutation_p.E255*	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	394					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)			endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						GGAAGATTTTGAGATTCTGAG	0.388																																						dbGAP											0													156.0	148.0	151.0					X																	107396925		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.1180G>T	X.37:g.107396925G>T	ENSP00000361306:p.Glu394*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Nonsense_Mutation	SNP	pfam_Peptidase_C54	p.E394*	ENST00000372232.3	37	c.1180	CCDS14538.1	X	.	.	.	.	.	.	.	.	.	.	G	37	6.501565	0.97616	.	.	ENSG00000101844	ENST00000372232;ENST00000345734;ENST00000372254;ENST00000545696	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	-13.2503	19.5828	0.95475	0.0:0.0:1.0:0.0	.	.	.	.	X	394;332;370;255	.	ENSP00000298131:E332X	E	+	1	0	ATG4A	107283581	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.774000	0.75012	2.580000	0.87095	0.600000	0.82982	GAG	ATG4A	-	NULL	ENSG00000101844		0.388	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4A	HGNC	protein_coding	OTTHUMT00000057860.1	149	0.00	0	G	NM_052936		107396925	107396925	+1	no_errors	ENST00000372232	ensembl	human	known	69_37n	nonsense	75	46.04	64	SNP	1.000	T
ATXN7L3	56970	genome.wustl.edu	37	17	42274624	42274624	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr17:42274624G>A	ENST00000454077.2	-	3	327	c.328C>T	c.(328-330)Cgg>Tgg	p.R110W	ATXN7L3_ENST00000593073.1_Intron|CTB-175E5.7_ENST00000586560.1_RNA|ATXN7L3_ENST00000389384.4_Missense_Mutation_p.R110W	NM_020218.1	NP_064603.1			ataxin 7-like 3											kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(2)	12		Breast(137;0.00765)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.113)		CTGCTGTTCCGACCCATTCCC	0.617																																						dbGAP											0													61.0	71.0	68.0					17																	42274624		2011	4168	6179	-	-	-	SO:0001583	missense	0			AK056002	CCDS42345.1, CCDS45697.1	17q21	2010-03-10			ENSG00000087152	ENSG00000087152			25416	protein-coding gene	gene with protein product						15115762	Standard	NM_001098833		Approved	DKFZp761G2113	uc002ifz.3	Q14CW9		ENST00000454077.2:c.328C>T	17.37:g.42274624G>A	ENSP00000397259:p.Arg110Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SAGA_su_Sgf11,pfam_SCA7_dom	p.R110W	ENST00000454077.2	37	c.328	CCDS45697.1	17	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653927	0.47362	.	.	ENSG00000087152	ENST00000454077;ENST00000389384	.	.	.	4.29	4.29	0.51040	.	0.000000	0.64402	U	0.000001	T	0.80444	0.4624	M	0.90542	3.125	0.48236	D	0.999611	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.977	D	0.83584	0.0119	9	0.87932	D	0	.	10.0586	0.42261	0.0:0.0:0.6742:0.3258	.	110;110	Q14CW9;Q14CW9-2	AT7L3_HUMAN;.	W	110	.	ENSP00000374035:R110W	R	-	1	2	ATXN7L3	39630150	1.000000	0.71417	0.975000	0.42487	0.431000	0.31685	5.760000	0.68793	2.108000	0.64289	0.655000	0.94253	CGG	ATXN7L3	-	NULL	ENSG00000087152		0.617	ATXN7L3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATXN7L3	HGNC	protein_coding	OTTHUMT00000457724.1	42	0.00	0	G			42274624	42274624	-1	no_errors	ENST00000454077	ensembl	human	known	69_37n	missense	15	53.12	17	SNP	0.998	A
BCL6	604	genome.wustl.edu	37	3	187444543	187444543	+	Missense_Mutation	SNP	C	C	T	rs77733730		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr3:187444543C>T	ENST00000406870.2	-	7	2050	c.1684G>A	c.(1684-1686)Gcc>Acc	p.A562T	RP11-211G3.3_ENST00000449623.1_Intron|BCL6_ENST00000450123.2_Intron|BCL6_ENST00000232014.4_Missense_Mutation_p.A562T|RP11-211G3.3_ENST00000437407.1_Intron	NM_001706.4	NP_001697.2	P41182	BCL6_HUMAN	B-cell CLL/lymphoma 6	562					actin cytoskeleton organization (GO:0030036)|B cell differentiation (GO:0030183)|cell morphogenesis (GO:0000902)|cellular response to DNA damage stimulus (GO:0006974)|erythrocyte development (GO:0048821)|germinal center formation (GO:0002467)|inflammatory response (GO:0006954)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of isotype switching to IgE isotypes (GO:0048294)|negative regulation of mast cell cytokine production (GO:0032764)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of T-helper 2 cell differentiation (GO:0045629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cellular component movement (GO:0051272)|protein import into nucleus, translocation (GO:0000060)|regulation of germinal center formation (GO:0002634)|regulation of immune response (GO:0050776)|regulation of inflammatory response (GO:0050727)|regulation of memory T cell differentiation (GO:0043380)|regulation of Rho GTPase activity (GO:0032319)|Rho protein signal transduction (GO:0007266)|spermatogenesis (GO:0007283)|type 2 immune response (GO:0042092)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|metal ion binding (GO:0046872)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(3)|large_intestine(9)|lung(10)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	40	all_cancers(143;9.45e-12)|Ovarian(172;0.0418)		OV - Ovarian serous cystadenocarcinoma(80;1.76e-18)	GBM - Glioblastoma multiforme(93;0.0141)		TTGTGGCTGGCGAGGTTGCCC	0.592			"""T, Mis"""	"""IG loci, ZNFN1A1, LCP1, PIM1, TFRC, CIITA, NACA, HSPCB, HSPCA, HIST1H4I, IL21R,  POU2AF1, ARHH, EIF4A2, SFRS3"""	"""NHL, CLL"""																																	dbGAP		Dom	yes		3	3q27	604	B-cell CLL/lymphoma 6		L	0													118.0	99.0	105.0					3																	187444543		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3289.1, CCDS46975.1	3q27	2013-01-09	2008-08-01		ENSG00000113916	ENSG00000113916		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1001	protein-coding gene	gene with protein product		109565	"""zinc finger protein 51"""	ZNF51			Standard	NM_001130845		Approved	ZBTB27, LAZ3, BCL5, BCL6A	uc003frq.2	P41182	OTTHUMG00000156441	ENST00000406870.2:c.1684G>A	3.37:g.187444543C>T	ENSP00000384371:p.Ala562Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E241|B8PSA7|D3DNV5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.A562T	ENST00000406870.2	37	c.1684	CCDS3289.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.259388	0.95368	.	.	ENSG00000113916	ENST00000406870;ENST00000232014	T;T	0.07688	3.17;3.17	5.64	5.64	0.86602	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.12817	0.0311	N	0.03999	-0.3	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.51340	-0.8718	10	0.25106	T	0.35	.	19.0794	0.93175	0.0:1.0:0.0:0.0	.	562	P41182	BCL6_HUMAN	T	562	ENSP00000384371:A562T;ENSP00000232014:A562T	ENSP00000232014:A562T	A	-	1	0	BCL6	188927237	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	6.083000	0.71326	2.828000	0.97474	0.655000	0.94253	GCC	BCL6	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000113916		0.592	BCL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6	HGNC	protein_coding	OTTHUMT00000344202.1	89	0.00	0	C	NM_138931		187444543	187444543	-1	no_errors	ENST00000232014	ensembl	human	known	69_37n	missense	53	27.27	27	SNP	1.000	T
BRWD1	54014	genome.wustl.edu	37	21	40600483	40600484	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr21:40600483_40600484delCA	ENST00000333229.2	-	27	3477_3478	c.3150_3151delTG	c.(3148-3153)attgacfs	p.D1051fs	BRWD1_ENST00000380800.3_Frame_Shift_Del_p.D1051fs|BRWD1_ENST00000342449.3_Frame_Shift_Del_p.D1051fs	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1051					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				ACAAGAAAGTCAATAACATCTG	0.307																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.3150_3151delTG	21.37:g.40600483_40600484delCA	ENSP00000330753:p.Asp1051fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Frame_Shift_Del	DEL	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D1051fs	ENST00000333229.2	37	c.3151_3150	CCDS13662.1	21																																																																																			BRWD1	-	NULL	ENSG00000185658		0.307	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	23	0.00	0	CA	NM_033656		40600483	40600484	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	frame_shift_del	18	35.71	10	DEL	1.000:1.000	-
CASP7	840	genome.wustl.edu	37	10	115486182	115486182	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr10:115486182C>T	ENST00000345633.4	+	7	1055	c.671C>T	c.(670-672)tCc>tTc	p.S224F	CASP7_ENST00000369321.2_Missense_Mutation_p.S257F|CASP7_ENST00000369318.3_Missense_Mutation_p.S224F|CASP7_ENST00000452490.2_Missense_Mutation_p.S199F|CASP7_ENST00000369315.1_Missense_Mutation_p.S224F|CASP7_ENST00000369331.4_Missense_Mutation_p.P213S	NM_033339.4	NP_203125.1	P55210	CASP7_HUMAN	caspase 7, apoptosis-related cysteine peptidase	224					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway (GO:0097193)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			kidney(1)|large_intestine(1)|lung(5)|ovary(1)	8		Colorectal(252;0.0946)|Breast(234;0.188)		Epithelial(162;0.012)|all cancers(201;0.014)		TTCGCCTATTCCACGGTTCCA	0.493																																						dbGAP											0													170.0	112.0	132.0					10																	115486182		2203	4300	6503	-	-	-	SO:0001583	missense	0			U37448	CCDS7580.1, CCDS7581.1, CCDS7582.1, CCDS58096.1, CCDS73200.1	10q25	2006-02-17	2005-08-17		ENSG00000165806	ENSG00000165806		"""Caspases"""	1508	protein-coding gene	gene with protein product		601761	"""caspase 7, apoptosis-related cysteine protease"""			8521391, 8576161	Standard	NM_033338		Approved	MCH3, CMH-1, ICE-LAP3	uc010qsa.3	P55210	OTTHUMG00000019076	ENST00000345633.4:c.671C>T	10.37:g.115486182C>T	ENSP00000298701:p.Ser224Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQU7|B5BU45|D3DRB8|Q13364|Q53YD5|Q5SVL0|Q5SVL3|Q96BA0	Missense_Mutation	SNP	pfam_Pept_C14_cat,smart_Pept_C14_p45_core,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.S257F	ENST00000345633.4	37	c.770	CCDS7581.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.2|20.2	3.948114|3.948114	0.73787|0.73787	.|.	.|.	ENSG00000165806|ENSG00000165806	ENST00000369331|ENST00000369321;ENST00000345633;ENST00000369318;ENST00000442393;ENST00000369315;ENST00000452490	T|T;T;T;T;T	0.06849|0.58210	3.25|0.35;0.35;0.35;0.35;0.35	5.16|5.16	5.16|5.16	0.70880|0.70880	.|Peptidase C14, caspase catalytic (1);Peptidase C14, caspase non-catalytic subunit p10 (1);Peptidase C14, caspase precursor p45, core (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.74084|0.74084	0.3670|0.3670	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	D|D;D;D;D	0.67145|0.89917	0.996|1.0;1.0;1.0;1.0	P|D;D;D;D	0.61658|0.97110	0.892|1.0;1.0;1.0;1.0	T|T	0.75405|0.75405	-0.3329|-0.3329	7|8	.|.	.|.	.|.	.|.	18.6911|18.6911	0.91583|0.91583	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	213|199;232;257;224	P55210-2|B4DQU7;B4DWA2;P55210-3;P55210	.|.;.;.;CASP7_HUMAN	S|F	213|257;224;224;185;224;199	ENSP00000358337:P213S|ENSP00000358327:S257F;ENSP00000298701:S224F;ENSP00000358324:S224F;ENSP00000358321:S224F;ENSP00000398107:S199F	.|.	P|S	+|+	1|2	0|0	CASP7|CASP7	115476172|115476172	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.284000|0.284000	0.27059|0.27059	7.718000|7.718000	0.84743|0.84743	2.398000|2.398000	0.81561|0.81561	0.563000|0.563000	0.77884|0.77884	CCA|TCC	CASP7	-	pfam_Pept_C14_cat,smart_Pept_C14_p45_core,pfscan_Pept_C14_p10	ENSG00000165806		0.493	CASP7-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP7	HGNC	protein_coding	OTTHUMT00000050439.1	59	0.00	0	C	NM_033338		115486182	115486182	+1	no_errors	ENST00000369321	ensembl	human	known	69_37n	missense	20	44.44	16	SNP	1.000	T
CD9	928	genome.wustl.edu	37	12	6342590	6342590	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr12:6342590C>A	ENST00000382518.1	+	5	722	c.286C>A	c.(286-288)Ctc>Atc	p.L96I	CD9_ENST00000009180.4_Missense_Mutation_p.L96I|CD9_ENST00000481267.1_3'UTR|Y_RNA_ENST00000365448.1_RNA|CD9_ENST00000382515.2_Missense_Mutation_p.L27I			P21926	CD9_HUMAN	CD9 molecule	96					blood coagulation (GO:0007596)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cellular component movement (GO:0006928)|fusion of sperm to egg plasma membrane (GO:0007342)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|oligodendrocyte development (GO:0014003)|paranodal junction assembly (GO:0030913)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|response to water deprivation (GO:0009414)|single fertilization (GO:0007338)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)|vesicle (GO:0031982)				endometrium(2)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|skin(1)|stomach(1)	8						CTTCGGCTTCCTCTTGGTGAT	0.507																																						dbGAP											0													140.0	114.0	123.0					12																	6342590		2203	4300	6503	-	-	-	SO:0001583	missense	0			M38690	CCDS8540.1	12p13	2013-02-14	2006-03-28		ENSG00000010278	ENSG00000010278		"""CD molecules"", ""Tetraspanins"""	1709	protein-coding gene	gene with protein product	"""motility related protein-1"""	143030	"""CD9 antigen (p24)"""	MIC3		6198179	Standard	NM_001769		Approved	BA2, P24, TSPAN29, MRP-1	uc001qnq.2	P21926	OTTHUMG00000044400	ENST00000382518.1:c.286C>A	12.37:g.6342590C>A	ENSP00000371958:p.Leu96Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUQ9|Q5J7W6|Q96ES4	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.L96I	ENST00000382518.1	37	c.286	CCDS8540.1	12	.	.	.	.	.	.	.	.	.	.	C	18.73	3.685830	0.68157	.	.	ENSG00000010278	ENST00000382518;ENST00000536586;ENST00000382519;ENST00000425469;ENST00000543424;ENST00000009180;ENST00000382515	D;D;D;D;D	0.82081	-1.57;-1.57;-1.57;-1.57;-1.57	5.87	5.87	0.94306	.	0.052665	0.85682	D	0.000000	D	0.91489	0.7313	M	0.81112	2.525	0.80722	D	1	D;D	0.76494	0.999;0.99	D;D	0.77557	0.99;0.936	D	0.91673	0.5352	10	0.62326	D	0.03	.	17.6998	0.88291	0.0:1.0:0.0:0.0	.	96;96	B4DK09;P21926	.;CD9_HUMAN	I	96;96;119;96;9;96;27	ENSP00000371958:L96I;ENSP00000440985:L96I;ENSP00000371959:L119I;ENSP00000009180:L96I;ENSP00000371955:L27I	ENSP00000009180:L96I	L	+	1	0	CD9	6212851	1.000000	0.71417	1.000000	0.80357	0.059000	0.15707	3.358000	0.52284	2.785000	0.95823	0.655000	0.94253	CTC	CD9	-	pfam_Tetraspanin/Peripherin,prints_Tetraspanin	ENSG00000010278		0.507	CD9-004	NOVEL	basic|appris_principal|CCDS	protein_coding	CD9	HGNC	protein_coding	OTTHUMT00000103348.1	102	0.00	0	C			6342590	6342590	+1	no_errors	ENST00000009180	ensembl	human	known	69_37n	missense	100	54.95	122	SNP	1.000	A
CELSR3	1951	genome.wustl.edu	37	3	48677877	48677877	+	Nonsense_Mutation	SNP	G	G	C	rs372356484		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr3:48677877G>C	ENST00000164024.4	-	34	9421	c.9141C>G	c.(9139-9141)taC>taG	p.Y3047*	CELSR3_ENST00000544264.1_Nonsense_Mutation_p.Y3052*	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	3047					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		AGATGCGACCGTAAGAGGCAG	0.647																																						dbGAP											0													36.0	40.0	39.0					3																	48677877		2202	4290	6492	-	-	-	SO:0001587	stop_gained	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.9141C>G	3.37:g.48677877G>C	ENSP00000164024:p.Tyr3047*	Somatic		WXS	Illumina GAIIx	Phase_IV	O75092	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.Y3052*	ENST00000164024.4	37	c.9156	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	G	49	15.286081	0.99829	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	.	.	.	4.76	-7.15	0.01521	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	14.4693	0.67504	0.4616:0.0:0.5384:0.0	.	.	.	.	X	3047;3052	.	ENSP00000164024:Y3047X	Y	-	3	2	CELSR3	48652881	0.223000	0.23663	0.463000	0.27130	0.719000	0.41307	-0.364000	0.07583	-1.461000	0.01909	-1.472000	0.01007	TAC	CELSR3	-	NULL	ENSG00000008300		0.647	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	15	0.00	0	G	NM_001407		48677877	48677877	-1	no_errors	ENST00000544264	ensembl	human	known	69_37n	nonsense	6	50.00	6	SNP	0.968	C
CHD6	84181	genome.wustl.edu	37	20	40049505	40049505	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr20:40049505G>A	ENST00000373233.3	-	31	5947	c.5770C>T	c.(5770-5772)Cct>Tct	p.P1924S		NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	1924					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				TGTAGCCCAGGAGTCTGGTTT	0.502																																						dbGAP											0													130.0	121.0	124.0					20																	40049505		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.5770C>T	20.37:g.40049505G>A	ENSP00000362330:p.Pro1924Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1924S	ENST00000373233.3	37	c.5770	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	G	2.637	-0.285089	0.05605	.	.	ENSG00000124177	ENST00000373233	D	0.85088	-1.94	5.64	1.37	0.22104	.	0.710705	0.13204	N	0.405730	T	0.79317	0.4425	L	0.51422	1.61	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.67440	-0.5670	10	0.54805	T	0.06	1.5107	7.9658	0.30098	0.1403:0.3722:0.4875:0.0	.	1924	Q8TD26	CHD6_HUMAN	S	1924	ENSP00000362330:P1924S	ENSP00000362330:P1924S	P	-	1	0	CHD6	39482919	0.005000	0.15991	0.000000	0.03702	0.024000	0.10985	1.232000	0.32636	0.029000	0.15352	-0.175000	0.13238	CCT	CHD6	-	NULL	ENSG00000124177		0.502	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	114	0.00	0	G			40049505	40049505	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	missense	40	62.62	67	SNP	0.000	A
COG3	83548	genome.wustl.edu	37	13	46070345	46070345	+	Silent	SNP	G	G	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr13:46070345G>A	ENST00000349995.5	+	13	1498	c.1386G>A	c.(1384-1386)gaG>gaA	p.E462E	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	462					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		ATGTACAGGAGCGGCTCGTCT	0.453																																					Ovarian(150;1048 1859 18083 21577 42700)	dbGAP											0													85.0	82.0	83.0					13																	46070345		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1386G>A	13.37:g.46070345G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Silent	SNP	pfam_COG_su3,superfamily_Cullin_repeat-like_dom	p.E462	ENST00000349995.5	37	c.1386	CCDS9398.1	13																																																																																			COG3	-	NULL	ENSG00000136152		0.453	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG3	HGNC	protein_coding	OTTHUMT00000044777.2	71	0.00	0	G			46070345	46070345	+1	no_errors	ENST00000349995	ensembl	human	known	69_37n	silent	22	60.00	33	SNP	1.000	A
CRIPAK	285464	genome.wustl.edu	37	4	1388693	1388693	+	Missense_Mutation	SNP	C	C	G	rs78906219	byFrequency	TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr4:1388693C>G	ENST00000324803.4	+	1	3354	c.394C>G	c.(394-396)Cat>Gat	p.H132D		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	132					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.H132D(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CACACGTGCCCATGCGGAGTG	0.697													N|||	864	0.172524	0.112	0.2421	5008	,	,		13504	0.0546		0.2783	False		,,,				2504	0.2178					dbGAP											1	Substitution - Missense(1)	skin(1)											68.0	69.0	68.0					4																	1388693		2197	4291	6488	-	-	-	SO:0001583	missense	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.394C>G	4.37:g.1388693C>G	ENSP00000323978:p.His132Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB03	Missense_Mutation	SNP	smart_Post-SET_dom	p.H132D	ENST00000324803.4	37	c.394	CCDS3349.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	0.898|0.898	-0.723180|-0.723180	0.03158|0.03158	.|.	.|.	ENSG00000179979|ENSG00000179979	ENST00000324803|ENST00000382944	T|.	0.18657|.	2.2|.	0.666|0.666	-0.474|-0.474	0.12108|0.12108	.|.	.|.	.|.	.|.	.|.	T|T	0.12178|0.12178	0.0296|0.0296	N|N	0.08118|0.08118	0|0	0.80722|0.80722	P|P	0.0|0.0	B|.	0.02656|.	0.0|.	B|.	0.01281|.	0.0|.	T|T	0.33929|0.33929	-0.9849|-0.9849	8|5	0.28530|0.05833	T|T	0.3|0.94	.|.	2.4426|2.4426	0.04498|0.04498	0.0:0.4251:0.3263:0.2486|0.0:0.4251:0.3263:0.2486	.|.	132|.	Q8N1N5|.	CRPAK_HUMAN|.	D|R	132|115	ENSP00000323978:H132D|.	ENSP00000323978:H132D|ENSP00000372402:P115R	H|P	+|+	1|2	0|0	CRIPAK|CRIPAK	1378693|1378693	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-1.786000|-1.786000	0.01766|0.01766	-0.170000|-0.170000	0.10816|0.10816	-1.737000|-1.737000	0.00689|0.00689	CAT|CCA	CRIPAK	-	NULL	ENSG00000179979		0.697	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	8	0.00	0	C	NM_175918		1388693	1388693	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	missense	53	45.36	44	SNP	0.000	G
DHRS1	115817	genome.wustl.edu	37	14	24760122	24760122	+	Silent	SNP	C	C	G			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr14:24760122C>G	ENST00000288111.7	-	9	1161	c.885G>C	c.(883-885)ctG>ctC	p.L295L	DHRS1_ENST00000396813.1_Silent_p.L295L|DHRS1_ENST00000559088.1_5'UTR	NM_001136050.2	NP_001129522.1	Q96LJ7	DHRS1_HUMAN	dehydrogenase/reductase (SDR family) member 1	295						endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	6				GBM - Glioblastoma multiforme(265;2.81e-08)|OV - Ovarian serous cystadenocarcinoma(311;0.0442)		GGAAGGAGGGCAGGTAGGAGG	0.557																																						dbGAP											0													113.0	110.0	111.0					14																	24760122		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK058159	CCDS9623.1	14q11.2	2011-09-14			ENSG00000157379	ENSG00000157379	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	16445	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 19C, member 1"""	610410				12153138, 19027726	Standard	NM_138452		Approved	FLJ25430, MGC20204, SDR19C1	uc001wok.3	Q96LJ7	OTTHUMG00000029333	ENST00000288111.7:c.885G>C	14.37:g.24760122C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS71|Q8NDG3|Q96B59|Q96CQ5	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DHB_DH	p.L295	ENST00000288111.7	37	c.885	CCDS9623.1	14																																																																																			DHRS1	-	NULL	ENSG00000157379		0.557	DHRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS1	HGNC	protein_coding	OTTHUMT00000073168.4	61	0.00	0	C	NM_138452		24760122	24760122	-1	no_errors	ENST00000288111	ensembl	human	known	69_37n	silent	40	38.46	25	SNP	0.972	G
GOLGA8DP	100132979	genome.wustl.edu	37	15	22706758	22706758	+	RNA	SNP	T	T	A	rs368931923		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr15:22706758T>A	ENST00000314246.8	-	0	1572				RN7SL545P_ENST00000495815.2_RNA|AC116165.1_ENST00000408073.1_RNA			Q0D2H9	GOG8D_HUMAN	golgin A8 family, member D, pseudogene							Golgi apparatus (GO:0005794)											TGTCCAGATGTTCTCCTCCGT	0.622																																						dbGAP											0																																										-	-	-			0					15q11.2	2014-04-10	2011-04-15	2010-02-12	ENSG00000185182	ENSG00000185182			32376	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8D"""	GOLGA8D		12477932	Standard	NR_027407		Approved		uc010axw.2	Q0D2H9	OTTHUMG00000171882		15.37:g.22706758T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000314246.8	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	7.006	0.555915	0.13436	.	.	ENSG00000185182	ENST00000341390;ENST00000314246	.	.	.	0.128	0.128	0.14733	.	.	.	.	.	T	0.53029	0.1771	.	.	.	0.24195	N	0.995536	D	0.64830	0.994	P	0.60473	0.875	T	0.59526	-0.7438	5	0.22706	T	0.39	.	.	.	.	.	225	F8WBT8	.	D	225	.	ENSP00000327024:E225D	E	-	3	2	AC116165.1	20258122	0.000000	0.05858	0.016000	0.15963	0.158000	0.22134	-1.210000	0.02999	0.243000	0.21327	0.240000	0.17902	GAA	GOLGA8DP	-	-	ENSG00000185182		0.622	GOLGA8DP-002	KNOWN	basic	processed_transcript	GOLGA8DP	HGNC	pseudogene	OTTHUMT00000415613.1	29	0.00	0	T	NR_027407		22706758	22706758	-1	no_errors	ENST00000314246	ensembl	human	known	69_37n	rna	43	12.24	6	SNP	0.928	A
HECTD1	25831	genome.wustl.edu	37	14	31582337	31582337	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr14:31582337A>C	ENST00000399332.1	-	34	6611	c.6123T>G	c.(6121-6123)atT>atG	p.I2041M	HECTD1_ENST00000553700.1_Missense_Mutation_p.I2041M	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2041	K-box.				neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTTTTGTTGTAATTTTTTTGC	0.274																																						dbGAP											0													75.0	71.0	72.0					14																	31582337		1796	4062	5858	-	-	-	SO:0001583	missense	0			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.6123T>G	14.37:g.31582337A>C	ENSP00000382269:p.Ile2041Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Nonsense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.L407*	ENST00000399332.1	37	c.1220	CCDS41939.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.54|15.54	2.862545|2.862545	0.51482|0.51482	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332|ENST00000554882	T;T|.	0.10573|.	2.86;2.86|.	5.76|5.76	1.71|1.71	0.24356|0.24356	.|.	0.000000|.	0.64402|.	U|.	0.000001|.	T|.	0.56470|.	0.1987|.	L|L	0.57536|0.57536	1.79|1.79	0.50467|0.50467	D|D	0.999871|0.999871	P;P|.	0.40476|.	0.718;0.718|.	B;B|.	0.33690|.	0.168;0.118|.	T|.	0.47169|.	-0.9138|.	10|.	0.87932|.	D|.	0|.	-7.3227|-7.3227	6.1019|6.1019	0.20051|0.20051	0.2828:0.0:0.5961:0.1212|0.2828:0.0:0.5961:0.1212	.|.	2041;2041|.	D3DS86;Q9ULT8|.	.;HECD1_HUMAN|.	M|X	2041;2043;2041|407	ENSP00000450697:I2041M;ENSP00000382269:I2041M|.	ENSP00000261312:I2043M|.	I|L	-|-	3|2	3|0	HECTD1|HECTD1	30652088|30652088	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.950000|0.950000	0.60333|0.60333	0.756000|0.756000	0.26419|0.26419	0.072000|0.072000	0.16694|0.16694	-0.973000|-0.973000	0.02599|0.02599	ATT|TTA	HECTD1	-	NULL	ENSG00000092148		0.274	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD1	HGNC	protein_coding	OTTHUMT00000409942.1	116	0.00	0	A			31582337	31582337	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000554882	ensembl	human	novel	69_37n	nonsense	81	50.31	82	SNP	1.000	C
HSP90AB1	3326	genome.wustl.edu	37	6	44218045	44218045	+	Silent	SNP	G	G	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr6:44218045G>A	ENST00000371554.1	+	6	880	c.666G>A	c.(664-666)gaG>gaA	p.E222E	HSP90AB1_ENST00000371646.5_Silent_p.E222E|HSP90AB1_ENST00000353801.3_Silent_p.E222E			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	222					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			aggaacgagagaaggaaatta	0.418																																						dbGAP											0													76.0	81.0	79.0					6																	44218045		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.666G>A	6.37:g.44218045G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Silent	SNP	pfam_Hsp90,pfam_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pirsf_Hsp90,prints_Hsp90_N	p.E222	ENST00000371554.1	37	c.666	CCDS4909.1	6																																																																																			HSP90AB1	-	pfam_Hsp90,superfamily_ATPase-like_ATP-bd,pirsf_Hsp90	ENSG00000096384		0.418	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSP90AB1	HGNC	protein_coding	OTTHUMT00000040730.1	56	0.00	0	G	NM_007355		44218045	44218045	+1	no_errors	ENST00000353801	ensembl	human	known	69_37n	silent	66	37.14	39	SNP	1.000	A
IGKV4-1	28908	genome.wustl.edu	37	2	89185360	89185360	+	RNA	SNP	C	C	T	rs570962248	byFrequency	TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr2:89185360C>T	ENST00000390243.2	+	0	229							P06312	KV401_HUMAN	immunoglobulin kappa variable 4-1						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|plasma membrane (GO:0005886)	antigen binding (GO:0003823)										CTACAGGTGCCTACGGGGACA	0.433													C|||	3	0.000599042	0.0	0.0	5008	,	,		8633	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													76.0	74.0	74.0					2																	89185360		1957	4139	6096	-	-	-			0			Z00023		2p11.2	2012-02-08			ENSG00000211598	ENSG00000211598		"""Immunoglobulins / IGK locus"""	5834	other	immunoglobulin gene							Standard	NG_000834		Approved	IGKV41, B3		P06312	OTTHUMG00000151533		2.37:g.89185360C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.A18	ENST00000390243.2	37	c.54		2																																																																																			IGKV4-1	-	NULL	ENSG00000211598		0.433	IGKV4-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV4-1	HGNC	IG_V_gene	OTTHUMT00000323037.2	69	0.00	0	C	NG_000834		89185360	89185360	+1	no_stop_codon	ENST00000390243	ensembl	human	known	69_37n	silent	58	38.54	37	SNP	0.261	T
ITPR2	3709	genome.wustl.edu	37	12	26640139	26640139	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr12:26640139A>C	ENST00000381340.3	-	40	5832	c.5416T>G	c.(5416-5418)Ttc>Gtc	p.F1806V		NM_002223.2	NP_002214.2	Q14571	ITPR2_HUMAN	inositol 1,4,5-trisphosphate receptor, type 2	1806					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cellular response to cAMP (GO:0071320)|cellular response to ethanol (GO:0071361)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|regulation of insulin secretion (GO:0050796)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	cell cortex (GO:0005938)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet dense tubular network membrane (GO:0031095)|receptor complex (GO:0043235)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|phosphatidylinositol binding (GO:0035091)		ETV6/ITPR2(2)	biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(20)|liver(1)|lung(51)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	125	Colorectal(261;0.0847)				Caffeine(DB00201)	ACTTTAAAGAATTTTTCTGAC	0.338																																						dbGAP											0													78.0	71.0	73.0					12																	26640139		1796	4073	5869	-	-	-	SO:0001583	missense	0			D26350	CCDS41764.1	12p11.23	2014-07-18	2011-04-28		ENSG00000123104	ENSG00000123104		"""Ion channels / Inositol triphosphate receptors"""	6181	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 48"""	600144	"""inositol 1,4,5-triphosphate receptor, type 2"""			8081734	Standard	XM_006719064		Approved	IP3R2, CFAP48	uc001rhg.3	Q14571	OTTHUMG00000169181	ENST00000381340.3:c.5416T>G	12.37:g.26640139A>C	ENSP00000370744:p.Phe1806Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O94773	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ARM-type_fold,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.F1806V	ENST00000381340.3	37	c.5416	CCDS41764.1	12	.	.	.	.	.	.	.	.	.	.	A	21.6	4.169111	0.78339	.	.	ENSG00000123104	ENST00000381340	D	0.94931	-3.56	5.1	3.92	0.45320	.	0.108082	0.64402	D	0.000005	D	0.96673	0.8914	M	0.86343	2.81	0.80722	D	1	D	0.63046	0.992	P	0.60949	0.881	D	0.96218	0.9158	10	0.62326	D	0.03	.	11.1641	0.48533	0.8621:0.0:0.0:0.1379	.	1806	Q14571	ITPR2_HUMAN	V	1806	ENSP00000370744:F1806V	ENSP00000370744:F1806V	F	-	1	0	ITPR2	26531406	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.071000	0.93980	0.914000	0.36822	0.528000	0.53228	TTC	ITPR2	-	superfamily_ARM-type_fold	ENSG00000123104		0.338	ITPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPR2	HGNC	protein_coding	OTTHUMT00000402732.1	99	0.00	0	A	NM_002223		26640139	26640139	-1	no_errors	ENST00000381340	ensembl	human	known	69_37n	missense	153	30.45	67	SNP	1.000	C
KLHL12	59349	genome.wustl.edu	37	1	202862535	202862535	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr1:202862535A>G	ENST00000367261.3	-	11	1630	c.1412T>C	c.(1411-1413)cTg>cCg	p.L471P	KLHL12_ENST00000367259.1_Intron|KLHL12_ENST00000435533.3_Missense_Mutation_p.L509P	NM_021633.2	NP_067646.1	Q53G59	KLH12_HUMAN	kelch-like family member 12	471	Interaction with DVL3.				COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|protein monoubiquitination (GO:0006513)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|ER to Golgi transport vesicle (GO:0030134)|Golgi membrane (GO:0000139)				NS(3)|breast(2)|endometrium(1)|large_intestine(1)|lung(6)|stomach(1)	14			BRCA - Breast invasive adenocarcinoma(75;0.166)			ATGGTCATTCAGCAGGGCTAC	0.433																																						dbGAP											0													143.0	136.0	138.0					1																	202862535		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF190900	CCDS1429.1	1q32.1	2013-01-30	2013-01-30		ENSG00000117153	ENSG00000117153		"""Kelch-like"", ""BTB/POZ domain containing"""	19360	protein-coding gene	gene with protein product		614522	"""kelch-like 12 (Drosophila)"""			12477932	Standard	NM_021633		Approved	C3IP1	uc001gyo.1	Q53G59	OTTHUMG00000041385	ENST00000367261.3:c.1412T>C	1.37:g.202862535A>G	ENSP00000356230:p.Leu471Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEN8|B7Z7B8|Q9HBX5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L509P	ENST00000367261.3	37	c.1526	CCDS1429.1	1	.	.	.	.	.	.	.	.	.	.	A	24.7	4.558088	0.86231	.	.	ENSG00000117153	ENST00000367261;ENST00000435533	T;T	0.80566	-1.39;-1.39	5.68	5.68	0.88126	Galactose oxidase, beta-propeller (1);	0.000000	0.85682	D	0.000000	D	0.92825	0.7718	H	0.95539	3.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.94798	0.7968	10	0.87932	D	0	.	16.2322	0.82352	1.0:0.0:0.0:0.0	.	509;471	B7Z7B8;Q53G59	.;KLH12_HUMAN	P	471;509	ENSP00000356230:L471P;ENSP00000416886:L509P	ENSP00000356230:L471P	L	-	2	0	KLHL12	201129158	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	9.287000	0.95975	2.288000	0.76882	0.528000	0.53228	CTG	KLHL12	-	pfam_Kelch_1,smart_Kelch_1,pirsf_Kelch-like_gigaxonin	ENSG00000117153		0.433	KLHL12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL12	HGNC	protein_coding	OTTHUMT00000099151.1	81	0.00	0	A	NM_021633		202862535	202862535	-1	no_errors	ENST00000435533	ensembl	human	known	69_37n	missense	81	36.72	47	SNP	1.000	G
KRTAP4-11	653240	genome.wustl.edu	37	17	39274161	39274161	+	Missense_Mutation	SNP	T	T	C	rs200329167	byFrequency	TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr17:39274161T>C	ENST00000391413.2	-	1	445	c.407A>G	c.(406-408)cAc>cGc	p.H136R		NM_033059.3	NP_149048.2	Q9BYQ6	KR411_HUMAN	keratin associated protein 4-11	136	27 X 5 AA repeats of C-C-[GIKRQVHEL]- [SPTR]-[STVQRMC].					keratin filament (GO:0045095)				endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(8)|prostate(5)|skin(1)	33		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			gcagctggggtggcagcaggt	0.662													t|||	497	0.0992412	0.174	0.1124	5008	,	,		19473	0.1478		0.0179	False		,,,				2504	0.0225					dbGAP											0													8.0	14.0	12.0					17																	39274161		684	1586	2270	-	-	-	SO:0001583	missense	0			AC025904	CCDS45675.1	17q21.2	2013-06-25			ENSG00000212721	ENSG00000212721		"""Keratin associated proteins"""	18911	protein-coding gene	gene with protein product			"""keratin associated protein 4-14"""	KRTAP4-14			Standard	NM_033059		Approved	KAP4.11, KAP4.14	uc002hvz.3	Q9BYQ6	OTTHUMG00000133586	ENST00000391413.2:c.407A>G	17.37:g.39274161T>C	ENSP00000375232:p.His136Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUY2	Missense_Mutation	SNP	pfam_Keratin-assoc	p.H136R	ENST00000391413.2	37	c.407	CCDS45675.1	17	.	.	.	.	.	.	.	.	.	.	.	6.053	0.378142	0.11466	.	.	ENSG00000212721	ENST00000391413	T	0.01203	5.18	4.43	-4.18	0.03846	.	606.472000	0.01656	U	0.024837	T	0.00241	0.0007	N	0.00030	-2.61	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.53365	-0.8449	10	0.02654	T	1	.	0.2042	0.00148	0.2921:0.2622:0.1441:0.3015	.	136	Q9BYQ6	KR411_HUMAN	R	136	ENSP00000375232:H136R	ENSP00000375232:H136R	H	-	2	0	KRTAP4-11	36527687	0.000000	0.05858	0.005000	0.12908	0.909000	0.53808	-1.036000	0.03560	-0.298000	0.08921	-0.540000	0.04249	CAC	KRTAP4-11	-	NULL	ENSG00000212721		0.662	KRTAP4-11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-11	HGNC	protein_coding	OTTHUMT00000257690.1	19	0.00	0	T			39274161	39274161	-1	no_errors	ENST00000391413	ensembl	human	known	69_37n	missense	19	59.18	29	SNP	0.002	C
KRTAP5-5	439915	genome.wustl.edu	37	11	1651229	1651229	+	Silent	SNP	G	G	A	rs553119014	byFrequency	TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr11:1651229G>A	ENST00000399676.2	+	1	197	c.159G>A	c.(157-159)gcG>gcA	p.A53A		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	53				A -> G (in Ref. 1; BAD20201 and 2; CAF31639). {ECO:0000305}.		keratin filament (GO:0045095)		p.A53A(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ccggctgtgcgggctgtgggg	0.682													g|||	17	0.00339457	0.0045	0.0014	5008	,	,		5663	0.0		0.005	False		,,,				2504	0.0051					dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											35.0	47.0	43.0					11																	1651229		2115	4180	6295	-	-	-	SO:0001819	synonymous_variant	0			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.159G>A	11.37:g.1651229G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWN2	Silent	SNP	NULL	p.A53	ENST00000399676.2	37	c.159	CCDS41592.1	11																																																																																			KRTAP5-5	-	NULL	ENSG00000185940		0.682	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	12	0.00	0	G			1651229	1651229	+1	no_errors	ENST00000399676	ensembl	human	known	69_37n	silent	45	30.77	20	SNP	0.325	A
LRCH4	4034	genome.wustl.edu	37	7	100180051	100180051	+	Silent	SNP	G	G	C	rs200187564		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr7:100180051G>C	ENST00000310300.6	-	2	304	c.252C>G	c.(250-252)ccC>ccG	p.P84P	LRCH4_ENST00000497245.1_5'UTR	NM_002319.3	NP_002310.2	O75427	LRCH4_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 4	84					nervous system development (GO:0007399)	PML body (GO:0016605)				NS(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	23	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACGCCGCCTCGGGCACCTCGG	0.647																																						dbGAP											0													47.0	47.0	47.0					7																	100180051		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF053356	CCDS34706.1	7q22	2008-05-20	2004-05-27	2004-05-28	ENSG00000077454	ENSG00000077454			6691	protein-coding gene	gene with protein product				LRN, LRRN1		9799793	Standard	XM_005250346		Approved		uc003uvj.3	O75427	OTTHUMG00000159544	ENST00000310300.6:c.252C>G	7.37:g.100180051G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2D5|Q8WV85|Q96ID0	Silent	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.P84	ENST00000310300.6	37	c.252	CCDS34706.1	7																																																																																			LRCH4	-	NULL	ENSG00000077454		0.647	LRCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRCH4	HGNC	protein_coding	OTTHUMT00000356110.1	40	0.00	0	G	NM_002319		100180051	100180051	-1	no_errors	ENST00000310300	ensembl	human	known	69_37n	silent	23	60.34	35	SNP	0.005	C
LRRC32	2615	genome.wustl.edu	37	11	76371884	76371884	+	Silent	SNP	C	C	G			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr11:76371884C>G	ENST00000407242.2	-	3	995	c.753G>C	c.(751-753)cgG>cgC	p.R251R	LRRC32_ENST00000404995.1_Silent_p.R251R|LRRC32_ENST00000464145.1_Intron|LRRC32_ENST00000260061.5_Silent_p.R251R|AP001189.4_ENST00000447519.1_RNA	NM_005512.2	NP_005503.1	Q14392	LRC32_HUMAN	leucine rich repeat containing 32	251					negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cytokine secretion (GO:0050710)|positive regulation of gene expression (GO:0010628)	integral component of plasma membrane (GO:0005887)				endometrium(1)|large_intestine(3)|lung(26)|upper_aerodigestive_tract(1)	31						GTTTGTTCTCCCGCAGGTCAA	0.627																																						dbGAP											0													52.0	55.0	54.0					11																	76371884		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			Z24680	CCDS8245.1	11q13.5-q14	2008-02-05	2005-02-25	2005-02-25	ENSG00000137507	ENSG00000137507			4161	protein-coding gene	gene with protein product		137207	"""glycoprotein A repetitions predominant"""	D11S833E, GARP		8180135, 1543912	Standard	NM_005512		Approved		uc001oxq.4	Q14392	OTTHUMG00000133687	ENST00000407242.2:c.753G>C	11.37:g.76371884C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86V06	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_typical-subtyp	p.R251	ENST00000407242.2	37	c.753	CCDS8245.1	11																																																																																			LRRC32	-	NULL	ENSG00000137507		0.627	LRRC32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC32	HGNC	protein_coding	OTTHUMT00000257926.2	42	0.00	0	C	NM_005512		76371884	76371884	-1	no_errors	ENST00000260061	ensembl	human	known	69_37n	silent	39	22.00	11	SNP	0.990	G
MAGEC2	51438	genome.wustl.edu	37	X	141291033	141291033	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chrX:141291033C>G	ENST00000247452.3	-	3	1088	c.741G>C	c.(739-741)gaG>gaC	p.E247D		NM_016249.3	NP_057333.1	Q9UBF1	MAGC2_HUMAN	melanoma antigen family C, 2	247	Interaction with TRIM28.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				cellular protein catabolic process (GO:0044257)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin protein ligase binding (GO:0031625)	p.E247D(1)		NS(2)|breast(3)|endometrium(3)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)	47	Acute lymphoblastic leukemia(192;6.56e-05)					CCCAGATGACCTCCTCAGAGG	0.522										HNSCC(46;0.14)																												dbGAP											1	Substitution - Missense(1)	endometrium(1)											129.0	123.0	125.0					X																	141291033		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116195	CCDS14678.1	Xq27	2009-03-25	2004-06-08	2004-06-09	ENSG00000046774	ENSG00000046774			13574	protein-coding gene	gene with protein product	"""cancer/testis antigen 10"""	300468	"""melanoma antigen, family E, 1, cancer/testis specific"""	MAGEE1		10699956	Standard	NM_016249		Approved	CT10, MAGE-C2	uc004fbu.2	Q9UBF1	OTTHUMG00000022574	ENST00000247452.3:c.741G>C	X.37:g.141291033C>G	ENSP00000354660:p.Glu247Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZ00|Q96D45|Q9P1M6|Q9P1M7	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E247D	ENST00000247452.3	37	c.741	CCDS14678.1	X	.	.	.	.	.	.	.	.	.	.	-	12.22	1.873362	0.33069	.	.	ENSG00000046774	ENST00000247452	T	0.05025	3.51	0.988	-1.33	0.09172	.	0.499877	0.18377	U	0.143067	T	0.12774	0.0310	M	0.62723	1.935	0.09310	N	1	P	0.52170	0.951	P	0.59424	0.857	T	0.09100	-1.0690	10	0.62326	D	0.03	.	4.1509	0.10237	0.0:0.4925:0.0:0.5075	.	247	Q9UBF1	MAGC2_HUMAN	D	247	ENSP00000354660:E247D	ENSP00000354660:E247D	E	-	3	2	MAGEC2	141118699	0.001000	0.12720	0.004000	0.12327	0.292000	0.27327	-0.074000	0.11450	-0.671000	0.05274	-0.739000	0.03532	GAG	MAGEC2	-	pfam_MAGE,pfscan_MAGE	ENSG00000046774		0.522	MAGEC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEC2	HGNC	protein_coding	OTTHUMT00000058611.1	69	0.00	0	C	NM_016249		141291033	141291033	-1	no_errors	ENST00000247452	ensembl	human	known	69_37n	missense	43	57.43	58	SNP	0.004	G
MAMLD1	10046	genome.wustl.edu	37	X	149639325	149639327	+	In_Frame_Del	DEL	CAG	CAG	-	rs374739932|rs374561693		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chrX:149639325_149639327delCAG	ENST00000370401.2	+	4	1790_1792	c.1480_1482delCAG	c.(1480-1482)cagdel	p.Q502del	MAMLD1_ENST00000426613.2_In_Frame_Del_p.Q477del|MAMLD1_ENST00000432680.2_In_Frame_Del_p.Q477del|MAMLD1_ENST00000455522.2_5'UTR|MAMLD1_ENST00000262858.5_In_Frame_Del_p.Q502del			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	502	Poly-Gln.				male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.Q469Q(1)|p.Q494Q(1)|p.Q421Q(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					AAGCcagcaacagcagcagcagc	0.532																																						dbGAP											3	Substitution - coding silent(3)	kidney(3)																																								-	-	-	SO:0001651	inframe_deletion	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1480_1482delCAG	X.37:g.149639334_149639336delCAG	ENSP00000359428:p.Gln502del	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCQ4|B4DG93|B9EGA5	In_Frame_Del	DEL	NULL	p.Q472in_frame_del	ENST00000370401.2	37	c.1405_1407	CCDS14693.2	X																																																																																			MAMLD1	-	NULL	ENSG00000013619		0.532	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2	50	0.00	0	CAG	NM_005491		149639325	149639327	+1	no_errors	ENST00000432680	ensembl	human	known	69_37n	in_frame_del	30	11.76	4	DEL	0.006:0.000:0.000	-
MTF1	4520	genome.wustl.edu	37	1	38323086	38323086	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr1:38323086T>A	ENST00000373036.4	-	2	385	c.245A>T	c.(244-246)cAc>cTc	p.H82L	MTF1_ENST00000468190.1_5'UTR	NM_005955.2	NP_005946.2	Q14872	MTF1_HUMAN	metal-regulatory transcription factor 1	82					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cadmium ion (GO:0046686)|response to metal ion (GO:0010038)|response to oxidative stress (GO:0006979)	nucleus (GO:0005634)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			endometrium(3)|kidney(5)|large_intestine(6)|liver(1)|lung(12)|ovary(2)|pancreas(1)|prostate(1)	31	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)				ATCTATCAGGTGAAAGCCCTC	0.483																																						dbGAP											0													188.0	159.0	169.0					1																	38323086		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014454	CCDS30676.1	1p33	2008-02-05			ENSG00000188786	ENSG00000188786			7428	protein-coding gene	gene with protein product		600172				8065932	Standard	NM_005955		Approved		uc001cce.1	Q14872	OTTHUMG00000004439	ENST00000373036.4:c.245A>T	1.37:g.38323086T>A	ENSP00000362127:p.His82Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAK6|Q96CB1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H82L	ENST00000373036.4	37	c.245	CCDS30676.1	1	.	.	.	.	.	.	.	.	.	.	T	9.606	1.130103	0.21041	.	.	ENSG00000188786	ENST00000373036	T	0.08984	3.03	4.92	4.92	0.64577	.	0.327786	0.33382	N	0.004977	T	0.04452	0.0122	N	0.08118	0	0.38648	D	0.951766	B	0.06786	0.001	B	0.04013	0.001	T	0.44143	-0.9347	10	0.24483	T	0.36	.	9.9073	0.41384	0.152:0.0:0.0:0.848	.	82	Q14872	MTF1_HUMAN	L	82	ENSP00000362127:H82L	ENSP00000362127:H82L	H	-	2	0	MTF1	38095673	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.577000	0.60922	1.831000	0.53308	0.533000	0.62120	CAC	MTF1	-	NULL	ENSG00000188786		0.483	MTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTF1	HGNC	protein_coding	OTTHUMT00000012984.2	125	0.00	0	T	NM_005955		38323086	38323086	-1	no_errors	ENST00000373036	ensembl	human	known	69_37n	missense	153	25.37	52	SNP	1.000	A
NOTCH2	4853	genome.wustl.edu	37	1	120458147	120458147	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr1:120458147G>A	ENST00000256646.2	-	34	7417	c.7198C>T	c.(7198-7200)Cga>Tga	p.R2400*		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	2400					apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.R2400*(4)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTGGGTGTTCGCTCAGCAGCA	0.562			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	4	Substitution - Nonsense(4)	haematopoietic_and_lymphoid_tissue(3)|breast(1)											126.0	109.0	115.0					1																	120458147		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.7198C>T	1.37:g.120458147G>A	ENSP00000256646:p.Arg2400*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Nonsense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R2400*	ENST00000256646.2	37	c.7198	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	48	14.010061	0.99775	.	.	ENSG00000134250	ENST00000256646	.	.	.	5.35	4.43	0.53597	.	0.000000	0.30695	U	0.009069	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	12.2534	0.54611	0.0:0.0:0.6765:0.3235	.	.	.	.	X	2400	.	ENSP00000256646:R2400X	R	-	1	2	NOTCH2	120259670	0.616000	0.27035	1.000000	0.80357	0.996000	0.88848	0.360000	0.20250	1.224000	0.43551	0.591000	0.81541	CGA	NOTCH2	-	pirsf_Notch,pfam_DUF3454_notch	ENSG00000134250		0.562	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	66	0.00	0	G	NM_024408		120458147	120458147	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	nonsense	41	32.79	20	SNP	1.000	A
OR10G4	390264	genome.wustl.edu	37	11	123886542	123886542	+	Silent	SNP	C	C	T	rs529332605		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr11:123886542C>T	ENST00000320891.4	+	1	261	c.261C>T	c.(259-261)agC>agT	p.S87S		NM_001004462.1	NP_001004462.1	Q8NGN3	O10G4_HUMAN	olfactory receptor, family 10, subfamily G, member 4	87						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(1)|skin(4)|stomach(6)|upper_aerodigestive_tract(1)	48		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0401)		TGTCCCCAAGCGGCAGGGCTA	0.527													c|||	1	0.000199681	0.0	0.0014	5008	,	,		23235	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													25.0	23.0	24.0					11																	123886542		2192	4272	6464	-	-	-	SO:0001819	synonymous_variant	0			AB065757	CCDS31702.1	11q24.1	2012-08-09			ENSG00000254737	ENSG00000254737		"""GPCR / Class A : Olfactory receptors"""	14809	protein-coding gene	gene with protein product							Standard	NM_001004462		Approved		uc010sac.2	Q8NGN3	OTTHUMG00000165966	ENST00000320891.4:c.261C>T	11.37:g.123886542C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEW0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S87	ENST00000320891.4	37	c.261	CCDS31702.1	11																																																																																			OR10G4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000254737		0.527	OR10G4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10G4	HGNC	protein_coding	OTTHUMT00000387268.1	99	1.00	1	C	NM_001004462		123886542	123886542	+1	no_errors	ENST00000320891	ensembl	human	known	69_37n	silent	51	26.09	18	SNP	0.000	T
PCNXL2	80003	genome.wustl.edu	37	1	233394715	233394715	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr1:233394715C>G	ENST00000258229.9	-	5	1127	c.893G>C	c.(892-894)cGg>cCg	p.R298P	PCNXL2_ENST00000430153.1_5'UTR	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	298						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				GCTTTGTACCCGTTCCCTTAT	0.552																																						dbGAP											0													70.0	72.0	71.0					1																	233394715		2021	4179	6200	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.893G>C	1.37:g.233394715C>G	ENSP00000258229:p.Arg298Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.R298P	ENST00000258229.9	37	c.893	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	9.691	1.151854	0.21371	.	.	ENSG00000135749	ENST00000258229	T	0.63417	-0.04	4.34	0.294	0.15747	.	.	.	.	.	T	0.39145	0.1067	N	0.08118	0	0.09310	N	0.999995	B	0.25312	0.123	B	0.26416	0.069	T	0.27502	-1.0072	9	0.41790	T	0.15	.	8.4137	0.32659	0.0:0.3584:0.0:0.6416	.	298	A6NKB5	PCX2_HUMAN	P	298	ENSP00000258229:R298P	ENSP00000258229:R298P	R	-	2	0	PCNXL2	231461338	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	-0.634000	0.05477	-0.001000	0.14495	-0.474000	0.04947	CGG	PCNXL2	-	NULL	ENSG00000135749		0.552	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	38	0.00	0	C	NM_014801		233394715	233394715	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	71	19.32	17	SNP	0.001	G
PDILT	204474	genome.wustl.edu	37	16	20387485	20387485	+	Nonsense_Mutation	SNP	G	G	A	rs139247719	byFrequency	TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr16:20387485G>A	ENST00000302451.4	-	4	696	c.448C>T	c.(448-450)Cga>Tga	p.R150*		NM_174924.1	NP_777584.1	Q8N807	PDILT_HUMAN	protein disulfide isomerase-like, testis expressed	150					cell migration (GO:0016477)|cell redox homeostasis (GO:0045454)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|spermatid development (GO:0007286)	endoplasmic reticulum (GO:0005783)	protein disulfide isomerase activity (GO:0003756)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(33)|prostate(3)|skin(1)|urinary_tract(1)	61						CTAATTTGTCGTCTCAACCAA	0.463													G|||	2	0.000399361	0.0015	0.0	5008	,	,		19351	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													120.0	92.0	102.0					16																	20387485		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS10584.1	16p12.3	2011-11-10	2009-02-23		ENSG00000169340	ENSG00000169340		"""Protein disulfide isomerases"""	27338	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 7"", ""protein disulfide isomerase-like protein of the testis"""					15475357	Standard	NM_174924		Approved	PDIA7	uc002dhc.1	Q8N807	OTTHUMG00000131487	ENST00000302451.4:c.448C>T	16.37:g.20387485G>A	ENSP00000305465:p.Arg150*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVQ5	Nonsense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.R150*	ENST00000302451.4	37	c.448	CCDS10584.1	16	.	.	.	.	.	.	.	.	.	.	G	37	6.503133	0.97620	.	.	ENSG00000169340	ENST00000302451	.	.	.	4.65	0.987	0.19790	.	0.089773	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	.	11.2991	0.49295	0.0:0.0:0.4739:0.5261	.	.	.	.	X	150	.	ENSP00000305465:R150X	R	-	1	2	PDILT	20294986	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	3.078000	0.50096	0.041000	0.15688	-0.271000	0.10264	CGA	PDILT	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000169340		0.463	PDILT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDILT	HGNC	protein_coding	OTTHUMT00000254332.1	68	0.00	0	G	NM_174924		20387485	20387485	-1	no_errors	ENST00000302451	ensembl	human	known	69_37n	nonsense	50	31.08	23	SNP	1.000	A
RNA5-8SP6	100873336	genome.wustl.edu	37	Y	10037842	10037842	+	RNA	SNP	A	A	G			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chrY:10037842A>G	ENST00000515896.1	+	0	79									RNA, 5.8S ribosomal pseudogene 6																		GAATTGCAGGACACATTGATC	0.512																																						dbGAP											0																																										-	-	-			0					Yp11.2	2012-08-07	2012-08-07	2012-08-07	ENSG00000251705	ENSG00000251705			41960	pseudogene	RNA, pseudogene			"""RNA, 5.8S ribosomal 6"""	RN5-8S6			Standard	NG_033474		Approved						Y.37:g.10037842A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000515896.1	37	NULL		Y																																																																																			RNA5-8SP6	-	-	ENSG00000251705		0.512	RNA5-8SP6-201	KNOWN	basic	rRNA	RNA5-8SP6	HGNC	rRNA		18	0.00	0	A			10037842	10037842	+1	no_errors	ENST00000515896	ensembl	human	known	69_37n	rna	34	22.73	10	SNP	1.000	G
RNF19A	25897	genome.wustl.edu	37	8	101271360	101271360	+	Silent	SNP	G	G	C			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr8:101271360G>C	ENST00000519449.1	-	11	2257	c.1941C>G	c.(1939-1941)ggC>ggG	p.G647G	RNF19A_ENST00000523255.1_5'UTR|RNF19A_ENST00000341084.2_Silent_p.G647G	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	647					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			TGGATGAACCGCCAGCATGAC	0.473											OREG0018897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													128.0	116.0	120.0					8																	101271360		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1941C>G	8.37:g.101271360G>C		Somatic	1357	WXS	Illumina GAIIx	Phase_IV	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Silent	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.G647	ENST00000519449.1	37	c.1941	CCDS6286.1	8																																																																																			RNF19A	-	NULL	ENSG00000034677		0.473	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF19A	HGNC	protein_coding	OTTHUMT00000380004.1	95	0.00	0	G	NM_015435		101271360	101271360	-1	no_errors	ENST00000341084	ensembl	human	known	69_37n	silent	96	29.41	40	SNP	0.003	C
SGCD	6444	genome.wustl.edu	37	5	156022038	156022038	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr5:156022038G>T	ENST00000435422.3	+	5	963	c.476G>T	c.(475-477)gGa>gTa	p.G159V	SGCD_ENST00000337851.4_Missense_Mutation_p.G160V|SGCD_ENST00000447401.1_Missense_Mutation_p.G160V|SGCD_ENST00000517913.1_Missense_Mutation_p.G160V	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	159					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GTGGTAGTAGGAGCTGAAAGA	0.353																																						dbGAP											0													69.0	65.0	66.0					5																	156022038		1829	4085	5914	-	-	-	SO:0001583	missense	0			BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.476G>T	5.37:g.156022038G>T	ENSP00000403003:p.Gly159Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	pfam_Sarcoglycan	p.G160V	ENST00000435422.3	37	c.479	CCDS47327.1	5	.	.	.	.	.	.	.	.	.	.	G	24.1	4.495818	0.85069	.	.	ENSG00000170624	ENST00000517913;ENST00000435422;ENST00000337851;ENST00000447401	D;D;D;D	0.95447	-3.71;-3.71;-3.71;-3.71	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	D	0.97841	0.9291	M	0.80847	2.515	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;0.999;1.0	D	0.98218	1.0476	10	0.72032	D	0.01	-12.9168	19.7417	0.96234	0.0:0.0:1.0:0.0	.	159;160;160	Q92629;Q92629-2;Q92629-3	SGCD_HUMAN;.;.	V	160;159;160;160	ENSP00000429378:G160V;ENSP00000403003:G159V;ENSP00000338343:G160V;ENSP00000408324:G160V	ENSP00000338343:G160V	G	+	2	0	SGCD	155954616	1.000000	0.71417	0.997000	0.53966	0.976000	0.68499	7.279000	0.78599	2.657000	0.90304	0.650000	0.86243	GGA	SGCD	-	pfam_Sarcoglycan	ENSG00000170624		0.353	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGCD	HGNC	protein_coding	OTTHUMT00000373469.3	70	0.00	0	G			156022038	156022038	+1	no_errors	ENST00000337851	ensembl	human	known	69_37n	missense	41	42.25	30	SNP	1.000	T
SLC9A4	389015	genome.wustl.edu	37	2	103141572	103141572	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr2:103141572G>C	ENST00000295269.4	+	10	2365	c.1908G>C	c.(1906-1908)agG>agC	p.R636S		NM_001011552.3	NP_001011552.2	Q6AI14	SL9A4_HUMAN	solute carrier family 9, subfamily A (NHE4, cation proton antiporter 4), member 4	636					epithelial cell development (GO:0002064)|gastric acid secretion (GO:0001696)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43						ACACCTTAAGGGAGAGCATGA	0.517																																						dbGAP											0													149.0	152.0	151.0					2																	103141572		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33264.1	2q12.1	2013-05-22	2012-03-22		ENSG00000180251	ENSG00000180251		"""Solute carriers"""	11077	protein-coding gene	gene with protein product		600531	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 4"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 4"""			8199403	Standard	NM_001011552		Approved	NHE4	uc002tbz.4	Q6AI14	OTTHUMG00000153093	ENST00000295269.4:c.1908G>C	2.37:g.103141572G>C	ENSP00000295269:p.Arg636Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YK0	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_NaH_exchanger,prints_Na/H_exchanger_2,tigrfam_NaH_exchanger	p.R636S	ENST00000295269.4	37	c.1908	CCDS33264.1	2	.	.	.	.	.	.	.	.	.	.	G	10.86	1.469108	0.26423	.	.	ENSG00000180251	ENST00000295269	T	0.50277	0.75	5.84	-2.08	0.07254	.	0.114793	0.64402	D	0.000005	T	0.43077	0.1231	M	0.69823	2.125	0.34591	D	0.715476	B	0.22983	0.078	B	0.27715	0.082	T	0.44697	-0.9311	10	0.32370	T	0.25	.	11.4631	0.50221	0.4998:0.0:0.5002:0.0	.	636	Q6AI14	SL9A4_HUMAN	S	636	ENSP00000295269:R636S	ENSP00000295269:R636S	R	+	3	2	SLC9A4	102508004	1.000000	0.71417	0.286000	0.24833	0.104000	0.19210	0.912000	0.28597	-0.452000	0.07087	-0.152000	0.13540	AGG	SLC9A4	-	NULL	ENSG00000180251		0.517	SLC9A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A4	HGNC	protein_coding	OTTHUMT00000329498.1	85	0.00	0	G	NM_001011552.3		103141572	103141572	+1	no_errors	ENST00000295269	ensembl	human	known	69_37n	missense	64	59.49	94	SNP	0.906	C
MTCL1	23255	genome.wustl.edu	37	18	8784556	8784556	+	Silent	SNP	G	G	C			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr18:8784556G>C	ENST00000306329.11	+	5	2526	c.2526G>C	c.(2524-2526)gcG>gcC	p.A842A	SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000400050.3_Silent_p.A482A|SOGA2_ENST00000517570.1_Silent_p.A482A|SOGA2_ENST00000359865.3_Silent_p.A482A																							TCCATGATGCGGGGCTGCGGG	0.667																																						dbGAP											0													61.0	71.0	68.0					18																	8784556		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000306329.11:c.2526G>C	18.37:g.8784556G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_DUF3166	p.A482	ENST00000306329.11	37	c.1446		18																																																																																			SOGA2	-	NULL	ENSG00000168502		0.667	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1	13	0.00	0	G			8784556	8784556	+1	no_errors	ENST00000359865	ensembl	human	known	69_37n	silent	11	45.45	10	SNP	0.241	C
SYDE1	85360	genome.wustl.edu	37	19	15223187	15223187	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr19:15223187C>T	ENST00000342784.2	+	7	1640	c.1609C>T	c.(1609-1611)Cgc>Tgc	p.R537C	SYDE1_ENST00000600440.1_Missense_Mutation_p.R470C|SYDE1_ENST00000600252.1_Missense_Mutation_p.R194C	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	537	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						GGACCACCTGCGCCTCGTCTC	0.622																																						dbGAP											0													66.0	48.0	54.0					19																	15223187		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.1609C>T	19.37:g.15223187C>T	ENSP00000341489:p.Arg537Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R537C	ENST00000342784.2	37	c.1609	CCDS12324.1	19	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375167	0.82682	.	.	ENSG00000105137	ENST00000342784	T	0.19806	2.12	5.82	5.82	0.92795	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.060955	0.64402	D	0.000003	T	0.32734	0.0839	L	0.41027	1.25	0.50813	D	0.999891	D;D;D	0.76494	0.995;0.998;0.999	P;P;P	0.62382	0.901;0.795;0.901	T	0.00701	-1.1603	10	0.37606	T	0.19	.	12.5206	0.56056	0.1666:0.8334:0.0:0.0	.	470;470;537	B2RD93;Q6ZW31-2;Q6ZW31	.;.;SYDE1_HUMAN	C	537	ENSP00000341489:R537C	ENSP00000341489:R537C	R	+	1	0	SYDE1	15084187	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.162000	0.71874	2.765000	0.95021	0.591000	0.81541	CGC	SYDE1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000105137		0.622	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE1	HGNC	protein_coding	OTTHUMT00000465666.1	24	0.00	0	C	NM_033025		15223187	15223187	+1	no_errors	ENST00000342784	ensembl	human	known	69_37n	missense	35	32.69	17	SNP	1.000	T
SYDE1	85360	genome.wustl.edu	37	19	15223341	15223341	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr19:15223341A>G	ENST00000342784.2	+	7	1794	c.1763A>G	c.(1762-1764)cAc>cGc	p.H588R	SYDE1_ENST00000600440.1_Missense_Mutation_p.H521R|SYDE1_ENST00000600252.1_Missense_Mutation_p.H245R	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	588	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						GACTTCAAGCACCACATCGAG	0.652																																						dbGAP											0													35.0	27.0	30.0					19																	15223341		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.1763A>G	19.37:g.15223341A>G	ENSP00000341489:p.His588Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.H588R	ENST00000342784.2	37	c.1763	CCDS12324.1	19	.	.	.	.	.	.	.	.	.	.	A	3.876	-0.027008	0.07589	.	.	ENSG00000105137	ENST00000342784	T	0.41065	1.01	5.85	3.74	0.42951	Rho GTPase-activating protein domain (3);Rho GTPase activation protein (1);	0.070468	0.56097	N	0.000021	T	0.13415	0.0325	N	0.01576	-0.805	0.24115	N	0.99582	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.29579	-1.0007	10	0.06757	T	0.87	.	7.979	0.30172	0.2471:0.0:0.7529:0.0	.	521;521;588	B2RD93;Q6ZW31-2;Q6ZW31	.;.;SYDE1_HUMAN	R	588	ENSP00000341489:H588R	ENSP00000341489:H588R	H	+	2	0	SYDE1	15084341	0.990000	0.36364	1.000000	0.80357	0.922000	0.55478	2.078000	0.41567	0.840000	0.34995	-0.344000	0.07964	CAC	SYDE1	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000105137		0.652	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE1	HGNC	protein_coding	OTTHUMT00000465666.1	12	0.00	0	A	NM_033025		15223341	15223341	+1	no_errors	ENST00000342784	ensembl	human	known	69_37n	missense	19	52.50	21	SNP	0.998	G
TMEM150A	129303	genome.wustl.edu	37	2	85827041	85827041	+	Silent	SNP	C	C	G	rs575830260		TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr2:85827041C>G	ENST00000409668.1	-	5	836	c.369G>C	c.(367-369)gcG>gcC	p.A123A	TMEM150A_ENST00000334462.5_Silent_p.A123A|TMEM150A_ENST00000306353.3_Silent_p.A70A			Q86TG1	T150A_HUMAN	transmembrane protein 150A	123					catabolic process (GO:0009056)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|lung(1)|skin(1)	7						CCAAGAGGCCCGCAGCGTTGG	0.592																																						dbGAP											0													105.0	96.0	99.0					2																	85827041		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK098152	CCDS33233.1	2p11.2	2009-06-12	2009-06-12	2009-06-12	ENSG00000168890	ENSG00000168890			24677	protein-coding gene	gene with protein product			"""transmembrane protein 150"""	TMEM150		10858565	Standard	NM_001031738		Approved	TM6P1, FLJ90024	uc002spy.2	Q86TG1	OTTHUMG00000130168	ENST00000409668.1:c.369G>C	2.37:g.85827041C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K764|B7WPQ9|D6W5L2|Q8N2R6	Silent	SNP	pfam_Frag1/DRAM/Sfk1	p.A123	ENST00000409668.1	37	c.369	CCDS33233.1	2																																																																																			TMEM150A	-	pfam_Frag1/DRAM/Sfk1	ENSG00000168890		0.592	TMEM150A-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMEM150A	HGNC	protein_coding	OTTHUMT00000329474.1	56	0.00	0	C	NM_153342		85827041	85827041	-1	no_errors	ENST00000334462	ensembl	human	known	69_37n	silent	50	45.74	43	SNP	0.001	G
TOM1	10043	genome.wustl.edu	37	22	35734720	35734720	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr22:35734720C>T	ENST00000449058.2	+	12	1288	c.1163C>T	c.(1162-1164)gCc>gTc	p.A388V	TOM1_ENST00000447733.1_Missense_Mutation_p.A355V|TOM1_ENST00000411850.1_Missense_Mutation_p.A388V|TOM1_ENST00000382034.5_3'UTR|TOM1_ENST00000425375.1_Missense_Mutation_p.A343V|MIR3909_ENST00000579518.1_RNA|TOM1_ENST00000436462.2_Missense_Mutation_p.A350V	NM_005488.2	NP_005479.1	O60784	TOM1_HUMAN	target of myb1 (chicken)	388					endocytosis (GO:0006897)|endosomal transport (GO:0016197)|intracellular protein transport (GO:0006886)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	clathrin binding (GO:0030276)			NS(1)|breast(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(3)|prostate(2)	19						AAATACGAAGCCCCCCAAGCA	0.637																																						dbGAP											0													36.0	28.0	30.0					22																	35734720		2194	4295	6489	-	-	-	SO:0001583	missense	0			AJ006973	CCDS13913.1, CCDS46696.1, CCDS46697.1, CCDS46698.1	22q13.1	2011-01-31	2001-11-28		ENSG00000100284	ENSG00000100284			11982	protein-coding gene	gene with protein product		604700	"""target of myb1 (chicken) homolog"""			10329004, 15047686	Standard	NM_005488		Approved		uc003anp.3	O60784	OTTHUMG00000150958	ENST00000449058.2:c.1163C>T	22.37:g.35734720C>T	ENSP00000394466:p.Ala388Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEL9|B4DNA1|Q5TIJ6|Q86X74	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.A388V	ENST00000449058.2	37	c.1163	CCDS13913.1	22	.	.	.	.	.	.	.	.	.	.	C	15.52	2.856798	0.51376	.	.	ENSG00000100284	ENST00000447733;ENST00000449058;ENST00000411850;ENST00000425375;ENST00000412456;ENST00000451197;ENST00000436462	T;T;T;T;T	0.25085	1.83;1.85;1.83;1.82;1.83	5.09	2.81	0.32909	.	0.064997	0.64402	D	0.000019	T	0.21468	0.0517	L	0.47716	1.5	0.80722	D	1	P;P;B;P;P	0.47762	0.664;0.839;0.138;0.9;0.565	B;B;B;B;B	0.39258	0.295;0.218;0.065;0.234;0.081	T	0.04915	-1.0918	10	0.48119	T	0.1	-22.9463	12.0513	0.53507	0.6071:0.3929:0.0:0.0	.	343;350;397;388;388	O60784-3;E7EPD0;B4DKQ5;O60784-2;O60784	.;.;.;.;TOM1_HUMAN	V	355;388;388;343;125;397;350	ENSP00000398876:A355V;ENSP00000394466:A388V;ENSP00000413697:A388V;ENSP00000394924:A343V;ENSP00000402556:A350V	ENSP00000413697:A388V	A	+	2	0	TOM1	34064720	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.854000	0.48325	1.063000	0.40649	0.561000	0.74099	GCC	TOM1	-	pirsf_TOM1	ENSG00000100284		0.637	TOM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TOM1	HGNC	protein_coding	OTTHUMT00000320641.1	31	0.00	0	C	NM_005488		35734720	35734720	+1	no_errors	ENST00000411850	ensembl	human	known	69_37n	missense	12	60.00	18	SNP	1.000	T
TUBBP5	643224	genome.wustl.edu	37	9	141069885	141069885	+	RNA	SNP	A	A	C	rs62581043	byFrequency	TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr9:141069885A>C	ENST00000503395.1	+	0	1094									tubulin, beta pseudogene 5									p.Q43P(1)									AGCCACCTGCAGCTGGAGCGC	0.662																																						dbGAP											1	Substitution - Missense(1)	kidney(1)																																								-	-	-			0			AF355123		9q34.3	2012-03-06	2005-11-15		ENSG00000159247	ENSG00000159247			23674	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 5"""			11731935	Standard	NR_027156		Approved		uc010ncq.3		OTTHUMG00000021001		9.37:g.141069885A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000503395.1	37	NULL		9																																																																																			TUBBP5	-	-	ENSG00000159247		0.662	TUBBP5-003	KNOWN	basic	processed_transcript	TUBBP5	HGNC	pseudogene	OTTHUMT00000373087.1	12	0.00	0	A	NR_027156		141069885	141069885	+1	no_errors	ENST00000290377	ensembl	human	known	69_37n	rna	18	25.00	6	SNP	1.000	C
UFL1	23376	genome.wustl.edu	37	6	96971168	96971168	+	Splice_Site	SNP	G	G	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr6:96971168G>A	ENST00000369278.4	+	2	289		c.e2+1		UFL1-AS1_ENST00000430796.1_RNA	NM_015323.4	NP_056138.1	O94874	UFL1_HUMAN	UFM1-specific ligase 1						negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein ubiquitination (GO:0031397)|osteoblast differentiation (GO:0001649)|protein ufmylation (GO:0071569)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|nucleus (GO:0005634)	UFM1 conjugating enzyme activity (GO:0071568)										GTCCGAGGTGGTAGGTAATTC	0.343																																						dbGAP											0													128.0	135.0	132.0					6																	96971168		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC036379	CCDS5034.1	6q16.3	2011-08-18	2011-08-18	2011-08-18	ENSG00000014123	ENSG00000014123			23039	protein-coding gene	gene with protein product	"""novel LZAP-binding protein"", ""Regulator of CDK5RAP3 and DDRGK1"""	613372	"""KIAA0776"""	KIAA0776		20018847, 20164180, 20228063, 20531390	Standard	NM_015323		Approved	NLBP, Maxer, RCAD	uc003por.3	O94874	OTTHUMG00000015238	ENST00000369278.4:c.223+1G>A	6.37:g.96971168G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ53|B4DJ57|C0H5X5|Q8N765|Q9NTQ0	Splice_Site	SNP	-	e2+1	ENST00000369278.4	37	c.223+1	CCDS5034.1	6	.	.	.	.	.	.	.	.	.	.	G	22.2	4.255798	0.80135	.	.	ENSG00000014123	ENST00000369278	.	.	.	5.37	5.37	0.77165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1097	0.89532	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIAA0776	97077889	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	6.624000	0.74243	2.518000	0.84900	0.585000	0.79938	.	UFL1	-	-	ENSG00000014123		0.343	UFL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFL1	HGNC	protein_coding	OTTHUMT00000041557.1	58	0.00	0	G	NM_015323	Intron	96971168	96971168	+1	no_errors	ENST00000369278	ensembl	human	known	69_37n	splice_site	76	32.74	37	SNP	1.000	A
ZNF12	7559	genome.wustl.edu	37	7	6731888	6731888	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr7:6731888C>T	ENST00000405858.1	-	5	1226	c.685G>A	c.(685-687)Gac>Aac	p.D229N	AC073343.13_ENST00000366167.2_RNA|AC073343.2_ENST00000577401.1_RNA|ZNF12_ENST00000404360.1_Missense_Mutation_p.D155N|ZNF12_ENST00000342651.5_Missense_Mutation_p.D191N	NM_006956.2|NM_016265.3	NP_008887.2|NP_057349.2	P17014	ZNF12_HUMAN	zinc finger protein 12	229					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|endometrium(1)|large_intestine(1)|lung(7)|prostate(2)|upper_aerodigestive_tract(3)	16		Ovarian(82;0.0776)		UCEC - Uterine corpus endometrioid carcinoma (126;0.0231)		AAAACAGTGTCCTTTTGGAAG	0.373																																						dbGAP											0													52.0	52.0	52.0					7																	6731888		1938	4173	6111	-	-	-	SO:0001583	missense	0			X52334, AB021643	CCDS47538.1, CCDS47539.1	7p21.1	2013-01-08	2005-06-09		ENSG00000164631	ENSG00000164631		"""Zinc fingers, C2H2-type"", ""-"""	12902	protein-coding gene	gene with protein product		194536	"""zinc finger protein 325"""	ZNF325			Standard	NM_016265		Approved	KOX3, GIOT-3	uc003sqt.1	P17014	OTTHUMG00000151910	ENST00000405858.1:c.685G>A	7.37:g.6731888C>T	ENSP00000385939:p.Asp229Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYC4|A8WFQ8|B2RNQ7|B4DF45|Q6N016|Q8NHZ0|Q9H9P0|Q9ULZ6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D229N	ENST00000405858.1	37	c.685	CCDS47538.1	7	.	.	.	.	.	.	.	.	.	.	C	2.529	-0.308992	0.05458	.	.	ENSG00000164631	ENST00000404360;ENST00000405858;ENST00000342651;ENST00000399476;ENST00000330442	T;T;T	0.59906	0.23;1.67;1.67	4.03	2.19	0.27852	.	0.488831	0.17397	N	0.175720	T	0.19644	0.0472	N	0.00521	-1.4	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.06405	0.002;0.002	T	0.19257	-1.0311	10	0.26408	T	0.33	.	4.7198	0.12913	0.0:0.6212:0.178:0.2008	.	229;191	P17014;P17014-5	ZNF12_HUMAN;.	N	155;229;191;287;193	ENSP00000384405:D155N;ENSP00000385939:D229N;ENSP00000344745:D191N	ENSP00000331039:D193N	D	-	1	0	ZNF12	6698413	0.000000	0.05858	0.002000	0.10522	0.661000	0.39034	-0.074000	0.11450	0.632000	0.30432	0.563000	0.77884	GAC	ZNF12	-	NULL	ENSG00000164631		0.373	ZNF12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF12	HGNC	protein_coding	OTTHUMT00000324373.2	52	0.00	0	C	NM_016265		6731888	6731888	-1	no_errors	ENST00000405858	ensembl	human	known	69_37n	missense	61	31.46	28	SNP	0.000	T
ZNFX1	57169	genome.wustl.edu	37	20	47886966	47886966	+	Silent	SNP	G	G	A			TCGA-EW-A1P8-01A-11D-A142-09	TCGA-EW-A1P8-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e55f338f-97e2-4394-ae23-c92606069485	45c5228f-0317-4c73-a84a-257abfbb5ae8	g.chr20:47886966G>A	ENST00000396105.1	-	3	1629	c.1383C>T	c.(1381-1383)ttC>ttT	p.F461F	ZNFX1_ENST00000371752.1_Silent_p.F461F|ZNFX1_ENST00000371754.4_Silent_p.F461F	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	461							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			GAAATGTCTCGAAGTTGTCCT	0.468																																						dbGAP											0													133.0	129.0	130.0					20																	47886966		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.1383C>T	20.37:g.47886966G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Silent	SNP	superfamily_ARM-type_fold,smart_Znf_NFX1	p.F461	ENST00000396105.1	37	c.1383	CCDS13417.1	20																																																																																			ZNFX1	-	NULL	ENSG00000124201		0.468	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	HGNC	protein_coding	OTTHUMT00000079647.2	73	0.00	0	G	NM_021035		47886966	47886966	-1	no_errors	ENST00000371752	ensembl	human	known	69_37n	silent	21	53.33	24	SNP	1.000	A
