#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB4	5244	genome.wustl.edu	37	7	87069137	87069137	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:87069137A>C	ENST00000265723.4	-	14	1688	c.1577T>G	c.(1576-1578)gTt>gGt	p.V526G	ABCB4_ENST00000545634.1_Missense_Mutation_p.V526G|ABCB4_ENST00000453593.1_Missense_Mutation_p.V526G|ABCB4_ENST00000358400.3_Missense_Mutation_p.V526G|ABCB4_ENST00000359206.3_Missense_Mutation_p.V526G	NM_000443.3|NM_018849.2	NP_000434.1|NP_061337.1	P21439	MDR3_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 4	526	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular lipid metabolic process (GO:0044255)|lipid metabolic process (GO:0006629)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|xenobiotic-transporting ATPase activity (GO:0008559)			breast(5)|endometrium(7)|kidney(2)|large_intestine(15)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				Colchicine(DB01394)|Etravirine(DB06414)|Silodosin(DB06207)	TCTCTCTCCAACCAGGGTGTC	0.473																																						dbGAP											0													87.0	84.0	85.0					7																	87069137		2203	4300	6503	-	-	-	SO:0001583	missense	0			M23234	CCDS5605.1, CCDS5606.1, CCDS5607.1	7q21	2012-03-14			ENSG00000005471	ENSG00000005471		"""ATP binding cassette transporters / subfamily B"""	45	protein-coding gene	gene with protein product		171060		PGY3, MDR3		2892668, 11313316	Standard	NM_018850		Approved	MDR2, PFIC-3, GBD1	uc003uiv.1	P21439	OTTHUMG00000023396	ENST00000265723.4:c.1577T>G	7.37:g.87069137A>C	ENSP00000265723:p.Val526Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A2V7|A4D1D3|A4D1D4|A4D1D5|D6W5P3|D6W5P4|Q14813	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,pfam_Zeta_toxin_domain,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.V526G	ENST00000265723.4	37	c.1577	CCDS5606.1	7	.	.	.	.	.	.	.	.	.	.	A	24.8	4.567853	0.86439	.	.	ENSG00000005471	ENST00000359206;ENST00000358400;ENST00000265723;ENST00000453593;ENST00000545634	D;D;D;D;D	0.92805	-3.11;-3.11;-3.11;-3.11;-3.11	5.61	5.61	0.85477	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96346	0.8808	M	0.84846	2.72	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.997	D	0.96980	0.9714	10	0.87932	D	0	-22.25	15.8104	0.78557	1.0:0.0:0.0:0.0	.	526;526;526	A4D1D5;P21439-2;P21439	.;.;MDR3_HUMAN	G	526	ENSP00000352135:V526G;ENSP00000351172:V526G;ENSP00000265723:V526G;ENSP00000392983:V526G;ENSP00000437465:V526G	ENSP00000265723:V526G	V	-	2	0	ABCB4	86907073	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.335000	0.96500	2.125000	0.65367	0.533000	0.62120	GTT	ABCB4	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000005471		0.473	ABCB4-002	KNOWN	basic|CCDS	protein_coding	ABCB4	HGNC	protein_coding	OTTHUMT00000336083.1	55	0.00	0	A	NM_000443		87069137	87069137	-1	no_errors	ENST00000265723	ensembl	human	known	69_37n	missense	58	26.58	21	SNP	1.000	C
ACAA2	10449	genome.wustl.edu	37	18	47311649	47311649	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr18:47311649C>T	ENST00000285093.10	-	9	1502	c.1027G>A	c.(1027-1029)Gtg>Atg	p.V343M	ACAA2_ENST00000587994.1_Missense_Mutation_p.V340M|ACAA2_ENST00000589432.1_Missense_Mutation_p.V288M	NM_006111.2	NP_006102.2	P42765	THIM_HUMAN	acetyl-CoA acyltransferase 2	343					cellular response to hypoxia (GO:0071456)|cholesterol biosynthetic process (GO:0006695)|fatty acid metabolic process (GO:0006631)|negative regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902109)|negative regulation of mitochondrial outer membrane permeabilization involved in apoptotic signaling pathway (GO:1901029)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	acetyl-CoA C-acyltransferase activity (GO:0003988)|poly(A) RNA binding (GO:0044822)			large_intestine(2)|lung(7)|ovary(1)	10						CCTCCATTCACATTGGTTTTA	0.418																																						dbGAP											0													86.0	76.0	79.0					18																	47311649		2203	4300	6503	-	-	-	SO:0001583	missense	0			D16294	CCDS11939.1	18q21	2010-04-30	2010-04-30		ENSG00000167315	ENSG00000167315	2.3.1.16		83	protein-coding gene	gene with protein product	"""mitochondrial 3-oxoacyl-Coenzyme A thiolase"""	604770	"""acetyl-Coenzyme A acyltransferase 2"""			8241273	Standard	NM_006111		Approved	DSAEC	uc002ldw.4	P42765	OTTHUMG00000132667	ENST00000285093.10:c.1027G>A	18.37:g.47311649C>T	ENSP00000285093:p.Val343Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUT6	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.V343M	ENST00000285093.10	37	c.1027	CCDS11939.1	18	.	.	.	.	.	.	.	.	.	.	C	17.50	3.405234	0.62288	.	.	ENSG00000167315	ENST00000285093	D	0.94138	-3.36	5.58	3.8	0.43715	Thiolase-like, subgroup (1);Thiolase-like (1);Thiolase, conserved site (1);Thiolase, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.95056	0.8399	M	0.80508	2.5	0.80722	D	1	P;P	0.45986	0.87;0.462	P;B	0.52672	0.706;0.257	D	0.94459	0.7674	10	0.87932	D	0	-13.9562	11.9104	0.52735	0.0:0.86:0.0:0.14	.	343;343	B2RB23;P42765	.;THIM_HUMAN	M	343	ENSP00000285093:V343M	ENSP00000285093:V343M	V	-	1	0	ACAA2	45565647	1.000000	0.71417	0.977000	0.42913	0.995000	0.86356	4.622000	0.61240	0.716000	0.32124	0.655000	0.94253	GTG	ACAA2	-	pfam_Thiolase_C,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	ENSG00000167315		0.418	ACAA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACAA2	HGNC	protein_coding	OTTHUMT00000255921.2	45	0.00	0	C	NM_006111		47311649	47311649	-1	no_errors	ENST00000285093	ensembl	human	known	69_37n	missense	56	29.11	23	SNP	1.000	T
ADCK2	90956	genome.wustl.edu	37	7	140389402	140389402	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:140389402G>C	ENST00000072869.4	+	6	1741	c.1563G>C	c.(1561-1563)caG>caC	p.Q521H	NDUFB2_ENST00000482954.1_5'Flank|ADCK2_ENST00000476491.1_Missense_Mutation_p.Q521H	NM_052853.3	NP_443085.2	Q7Z695	ADCK2_HUMAN	aarF domain containing kinase 2	521	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|skin(4)	15	Melanoma(164;0.00956)					TCCAGGGCCAGAGAGTGGCTG	0.592																																						dbGAP											0													64.0	60.0	62.0					7																	140389402		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF131745	CCDS5861.1	7q34	2003-07-21			ENSG00000133597	ENSG00000133597			19039	protein-coding gene	gene with protein product							Standard	NM_052853		Approved	MGC20727	uc003vvy.1	Q7Z695	OTTHUMG00000157409	ENST00000072869.4:c.1563G>C	7.37:g.140389402G>C	ENSP00000072869:p.Gln521His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96CN6|Q9Y6T5	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.Q521H	ENST00000072869.4	37	c.1563	CCDS5861.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.245|9.245	1.039336|1.039336	0.19669|0.19669	.|.	.|.	ENSG00000133597|ENSG00000133597	ENST00000483369|ENST00000072869;ENST00000476491	.|T;T	.|0.29142	.|1.58;1.58	5.08|5.08	-10.2|-10.2	0.00374|0.00374	.|.	.|0.313100	.|0.28748	.|N	.|0.014269	T|T	0.07954|0.07954	0.0199|0.0199	N|N	0.04297|0.04297	-0.235|-0.235	0.27165|0.27165	N|N	0.961077|0.961077	.|B;B	.|0.06786	.|0.0;0.001	.|B;B	.|0.06405	.|0.002;0.002	T|T	0.06516|0.06516	-1.0822|-1.0822	5|10	.|0.27785	.|T	.|0.31	-11.6501|-11.6501	5.1555|5.1555	0.15032|0.15032	0.2358:0.2609:0.4252:0.0781|0.2358:0.2609:0.4252:0.0781	.|.	.|521;521	.|C9JE15;Q7Z695	.|.;ADCK2_HUMAN	Q|H	359|521	.|ENSP00000072869:Q521H;ENSP00000420512:Q521H	.|ENSP00000072869:Q521H	E|Q	+|+	1|3	0|2	ADCK2|ADCK2	140035871|140035871	0.065000|0.065000	0.20965|0.20965	0.193000|0.193000	0.23327|0.23327	0.576000|0.576000	0.36127|0.36127	-0.466000|-0.466000	0.06672|0.06672	-1.922000|-1.922000	0.01067|0.01067	-0.378000|-0.378000	0.06908|0.06908	GAG|CAG	ADCK2	-	NULL	ENSG00000133597		0.592	ADCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK2	HGNC	protein_coding	OTTHUMT00000348734.1	36	0.00	0	G	NM_052853		140389402	140389402	+1	no_errors	ENST00000072869	ensembl	human	known	69_37n	missense	54	18.18	12	SNP	0.607	C
ANKRD12	23253	genome.wustl.edu	37	18	9257247	9257247	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr18:9257247G>T	ENST00000262126.4	+	9	4222	c.3982G>T	c.(3982-3984)Gaa>Taa	p.E1328*	ANKRD12_ENST00000383440.2_Nonsense_Mutation_p.E1305*|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000400020.3_Nonsense_Mutation_p.E1305*	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1328						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AACAATATCAGAAGAGAGCAA	0.398																																						dbGAP											0													133.0	128.0	130.0					18																	9257247		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.3982G>T	18.37:g.9257247G>T	ENSP00000262126:p.Glu1328*	Somatic		WXS	Illumina GAIIx	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1328*	ENST00000262126.4	37	c.3982	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	43	10.301322	0.99379	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	.	.	.	5.75	5.75	0.90469	.	0.068524	0.64402	D	0.000020	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.4497	19.949	0.97192	0.0:0.0:1.0:0.0	.	.	.	.	X	1305;1328	.	ENSP00000262126:E1328X	E	+	1	0	ANKRD12	9247247	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.744000	0.62118	2.706000	0.92434	0.655000	0.94253	GAA	ANKRD12	-	NULL	ENSG00000101745		0.398	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	35	0.00	0	G	NM_015208		9257247	9257247	+1	no_errors	ENST00000262126	ensembl	human	known	69_37n	nonsense	43	20.37	11	SNP	1.000	T
ARHGEF11	9826	genome.wustl.edu	37	1	156915883	156915883	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:156915883G>A	ENST00000361409.2	-	28	3388	c.2646C>T	c.(2644-2646)ctC>ctT	p.L882L	ARHGEF11_ENST00000368194.3_Silent_p.L922L|ARHGEF11_ENST00000487682.1_5'Flank|ARHGEF11_ENST00000315174.8_Silent_p.L298L	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	882	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGTACTTGGTGAGCCGCTGCA	0.617																																						dbGAP											0													36.0	33.0	34.0					1																	156915883		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.2646C>T	1.37:g.156915883G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,pfam_Regulat_G_prot_signal,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_DH-domain	p.L922	ENST00000361409.2	37	c.2766	CCDS1162.1	1																																																																																			ARHGEF11	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000132694		0.617	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	9	0.00	0	G	NM_198236		156915883	156915883	-1	no_errors	ENST00000368194	ensembl	human	known	69_37n	silent	21	32.26	10	SNP	0.998	A
ASXL3	80816	genome.wustl.edu	37	18	31325407	31325407	+	Silent	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr18:31325407C>T	ENST00000269197.5	+	12	5595	c.5595C>T	c.(5593-5595)atC>atT	p.I1865I		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	1865					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GTTCCGGCATCAGTCAGCTAG	0.468																																						dbGAP											0													202.0	204.0	203.0					18																	31325407		2062	4191	6253	-	-	-	SO:0001819	synonymous_variant	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.5595C>T	18.37:g.31325407C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	superfamily_Znf_FYVE_PHD	p.I1865	ENST00000269197.5	37	c.5595	CCDS45847.1	18																																																																																			ASXL3	-	NULL	ENSG00000141431		0.468	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	24	0.00	0	C			31325407	31325407	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	silent	34	15.00	6	SNP	0.417	T
BBX	56987	genome.wustl.edu	37	3	107451818	107451818	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:107451818G>C	ENST00000325805.8	+	7	904	c.617G>C	c.(616-618)gGa>gCa	p.G206A	BBX_ENST00000415149.2_Missense_Mutation_p.G206A|BBX_ENST00000416476.2_Missense_Mutation_p.G206A|BBX_ENST00000402543.1_Missense_Mutation_p.G206A|BBX_ENST00000406780.1_Missense_Mutation_p.G206A			Q8WY36	BBX_HUMAN	bobby sox homolog (Drosophila)	206					bone development (GO:0060348)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(18)|ovary(4)|pancreas(1)|skin(2)	49			OV - Ovarian serous cystadenocarcinoma(3;0.112)			ACTCAAATGGGAGGCCTGAGT	0.423																																						dbGAP											0													191.0	158.0	169.0					3																	107451818		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF168718	CCDS2950.1, CCDS46881.1, CCDS63712.1	3q13.1	2008-07-18			ENSG00000114439	ENSG00000114439			14422	protein-coding gene	gene with protein product	"""x 001 protein"""					11680820	Standard	NM_001142568		Approved	MDS001, HSPC339, HBP2	uc010hpr.4	Q8WY36	OTTHUMG00000150360	ENST00000325805.8:c.617G>C	3.37:g.107451818G>C	ENSP00000319974:p.Gly206Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM7|Q2TAJ1|Q7L3J8|Q7LBY8|Q8NDB0|Q8WY35|Q9H0J6	Missense_Mutation	SNP	pfam_TF_HMG_box_BBX_DUF2028,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.G206A	ENST00000325805.8	37	c.617	CCDS46881.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.138290	0.94560	.	.	ENSG00000114439	ENST00000415149;ENST00000325767;ENST00000402543;ENST00000325805;ENST00000416476;ENST00000402163;ENST00000406780	D;D;D;D;D;D	0.99150	-4.97;-4.99;-4.99;-5.25;-5.49;-4.97	5.67	5.67	0.87782	HMG box transcription factor BBX, domain of unknown function DUF2028 (1);	0.000000	0.85682	D	0.000000	D	0.99184	0.9717	M	0.67953	2.075	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.996	D	0.99890	1.1133	10	0.87932	D	0	-14.4303	19.7686	0.96352	0.0:0.0:1.0:0.0	.	206;206;206;206	C9JA69;Q8WY36;A2RRM7;Q8WY36-2	.;BBX_HUMAN;.;.	A	206;57;206;206;206;206;206	ENSP00000408358:G206A;ENSP00000385317:G206A;ENSP00000319974:G206A;ENSP00000403860:G206A;ENSP00000385518:G206A;ENSP00000385530:G206A	ENSP00000319742:G57A	G	+	2	0	BBX	108934508	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.870000	0.92336	2.665000	0.90641	0.591000	0.81541	GGA	BBX	-	pfam_TF_HMG_box_BBX_DUF2028	ENSG00000114439		0.423	BBX-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBX	HGNC	protein_coding	OTTHUMT00000317820.1	92	0.00	0	G	NM_020235		107451818	107451818	+1	no_errors	ENST00000325805	ensembl	human	known	69_37n	missense	116	23.03	35	SNP	1.000	C
BCORL1	63035	genome.wustl.edu	37	X	129149215	129149215	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chrX:129149215C>G	ENST00000218147.7	+	4	2664	c.2467C>G	c.(2467-2469)Cct>Gct	p.P823A	BCORL1_ENST00000303743.5_Missense_Mutation_p.P823A|BCORL1_ENST00000359304.2_Missense_Mutation_p.P823A|BCORL1_ENST00000540052.1_Missense_Mutation_p.P823A			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	823					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						CAATGGGAAACCTACCAGCAC	0.592																																						dbGAP											0													51.0	56.0	54.0					X																	129149215		2202	4300	6502	-	-	-	SO:0001583	missense	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.2467C>G	X.37:g.129149215C>G	ENSP00000218147:p.Pro823Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P823A	ENST00000218147.7	37	c.2467	CCDS14616.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.906|9.906	1.208177|1.208177	0.22205|0.22205	.|.	.|.	ENSG00000085185|ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822|ENST00000441294	T;T;T;T;T|.	0.54866|.	0.59;1.03;0.55;0.59;1.12|.	5.09|5.09	3.24|3.24	0.37175|0.37175	.|.	0.225617|.	0.22886|.	N|.	0.054448|.	T|T	0.52500|0.52500	0.1738|0.1738	L|L	0.29908|0.29908	0.895|0.895	0.40178|0.40178	D|D	0.977251|0.977251	P;B|.	0.35155|.	0.487;0.058|.	B;B|.	0.35470|.	0.203;0.028|.	T|T	0.42137|0.42137	-0.9469|-0.9469	10|5	0.39692|.	T|.	0.17|.	-4.5956|-4.5956	14.2257|14.2257	0.65858|0.65858	0.0:0.7095:0.2905:0.0|0.0:0.7095:0.2905:0.0	.|.	823;823|.	Q5H9F3-2;Q5H9F3|.	.;BCORL_HUMAN|.	A|S	823;823;823;823;423|258	ENSP00000218147:P823A;ENSP00000307541:P823A;ENSP00000352253:P823A;ENSP00000437775:P823A;ENSP00000399483:P423A|.	ENSP00000218147:P823A|.	P|T	+|+	1|2	0|0	BCORL1|BCORL1	128976896|128976896	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.993000|0.993000	0.82548|0.82548	1.597000|1.597000	0.36729|0.36729	0.330000|0.330000	0.23485|0.23485	0.529000|0.529000	0.55759|0.55759	CCT|ACC	BCORL1	-	NULL	ENSG00000085185		0.592	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	16	0.00	0	C	NM_021946		129149215	129149215	+1	no_errors	ENST00000303743	ensembl	human	known	69_37n	missense	8	52.94	9	SNP	1.000	G
BIRC3	330	genome.wustl.edu	37	11	102206908	102206909	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:102206908_102206909delCT	ENST00000263464.3	+	7	4286_4287	c.1536_1537delCT	c.(1534-1539)aactctfs	p.S513fs	BIRC3_ENST00000532808.1_Frame_Shift_Del_p.S513fs	NM_001165.4	NP_001156.1	Q13489	BIRC3_HUMAN	baculoviral IAP repeat containing 3	513	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of necroptotic process (GO:0060546)|negative regulation of phosphorylation (GO:0042326)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|NIK/NF-kappaB signaling (GO:0038061)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of protein ubiquitination (GO:0031398)|protein heterooligomerization (GO:0051291)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cysteine-type endopeptidase activity (GO:2000116)|regulation of inflammatory response (GO:0050727)|regulation of innate immune response (GO:0045088)|regulation of necroptotic process (GO:0060544)|regulation of nucleotide-binding oligomerization domain containing signaling pathway (GO:0070424)|regulation of RIG-I signaling pathway (GO:0039535)|regulation of toll-like receptor signaling pathway (GO:0034121)|spermatogenesis (GO:0007283)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(7)|lung(5)|ovary(3)|skin(1)	21	all_cancers(8;0.00044)|all_epithelial(12;0.00348)|Lung NSC(15;0.227)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0093)	Lung(13;0.109)|LUSC - Lung squamous cell carcinoma(19;0.151)	BRCA - Breast invasive adenocarcinoma(274;0.0146)		TATTCAGAAACTCTCTGCAAGA	0.312			T	MALT1	MALT																																	dbGAP		Dom	yes		11	11q22-q23	330	baculoviral IAP repeat-containing 3		L	0																																										-	-	-	SO:0001589	frameshift_variant	0			L49432	CCDS8315.1	11q22	2011-01-25	2011-01-25			ENSG00000023445		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	591	protein-coding gene	gene with protein product	"""apoptosis inhibitor 2"", ""TNFR2-TRAF signaling complex protein"", ""mammalian IAP homolog C"", ""inhibitor of apoptosis protein 1"""	601721	"""baculoviral IAP repeat-containing 3"""	API2		8552191, 8548810	Standard	NM_001165		Approved	cIAP2, hiap-1, MIHC, RNF49, MALT2, c-IAP2	uc001pgx.3	Q13489		ENST00000263464.3:c.1536_1537delCT	11.37:g.102206912_102206913delCT	ENSP00000263464:p.Ser513fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16628|Q9HC27|Q9UP46	Frame_Shift_Del	DEL	pfam_BIR,pfam_CARD,superfamily_DEATH-like,smart_BIR,smart_CARD,smart_Znf_RING,pfscan_CARD,pfscan_BIR,pfscan_Znf_RING	p.L514fs	ENST00000263464.3	37	c.1536_1537	CCDS8315.1	11																																																																																			BIRC3	-	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	ENSG00000023445		0.312	BIRC3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BIRC3	HGNC	protein_coding	OTTHUMT00000394159.1	33	0.00	0	CT	NM_001165		102206908	102206909	+1	no_errors	ENST00000263464	ensembl	human	known	69_37n	frame_shift_del	29	14.71	5	DEL	0.997:0.997	-
BMP1	649	genome.wustl.edu	37	8	22052371	22052371	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr8:22052371G>A	ENST00000306385.5	+	12	2248	c.1578G>A	c.(1576-1578)tgG>tgA	p.W526*	BMP1_ENST00000397814.3_Nonsense_Mutation_p.W526*|BMP1_ENST00000306349.8_Nonsense_Mutation_p.W526*|BMP1_ENST00000354870.5_3'UTR|BMP1_ENST00000397816.3_Nonsense_Mutation_p.W526*	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1	526	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		GCCGCCTCTGGCTCAAGTTCG	0.582																																						dbGAP											0													92.0	92.0	92.0					8																	22052371		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.1578G>A	8.37:g.22052371G>A	ENSP00000305714:p.Trp526*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Nonsense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,prints_Peptidase_M12A,pfscan_CUB,pfscan_EG-like_dom	p.W526*	ENST00000306385.5	37	c.1578	CCDS6026.1	8	.	.	.	.	.	.	.	.	.	.	G	38	6.905927	0.97924	.	.	ENSG00000168487	ENST00000306385;ENST00000397816;ENST00000306349;ENST00000397814	.	.	.	5.25	5.25	0.73442	.	0.000000	0.36303	U	0.002662	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.6068	0.88040	0.0:0.0:1.0:0.0	.	.	.	.	X	526	.	ENSP00000306121:W526X	W	+	3	0	BMP1	22108316	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.869000	0.99810	2.438000	0.82558	0.462000	0.41574	TGG	BMP1	-	pfam_CUB,superfamily_CUB,smart_CUB,pirsf_BMP_1/tolloid-like,pfscan_CUB	ENSG00000168487		0.582	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP1	HGNC	protein_coding	OTTHUMT00000214995.2	22	0.00	0	G	NM_006132		22052371	22052371	+1	no_errors	ENST00000306385	ensembl	human	known	69_37n	nonsense	27	30.77	12	SNP	1.000	A
BMPR2	659	genome.wustl.edu	37	2	203420345	203420345	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:203420345C>G	ENST00000374580.4	+	12	2496	c.1957C>G	c.(1957-1959)Cct>Gct	p.P653A	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	653					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						TGGGCCAACCCCTGTCTGCTT	0.438																																						dbGAP											0													75.0	76.0	76.0					2																	203420345		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1957C>G	2.37:g.203420345C>G	ENSP00000363708:p.Pro653Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P653A	ENST00000374580.4	37	c.1957	CCDS33361.1	2	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112641	0.77210	.	.	ENSG00000204217	ENST00000374580	D	0.89552	-2.53	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.88695	0.6506	L	0.27053	0.805	0.80722	D	1	D	0.60575	0.988	P	0.52343	0.696	D	0.89291	0.3619	10	0.56958	D	0.05	.	20.0175	0.97485	0.0:1.0:0.0:0.0	.	653	Q13873	BMPR2_HUMAN	A	653	ENSP00000363708:P653A	ENSP00000363708:P653A	P	+	1	0	BMPR2	203128590	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.818000	0.86416	2.730000	0.93505	0.650000	0.86243	CCT	BMPR2	-	NULL	ENSG00000204217		0.438	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	HGNC	protein_coding	OTTHUMT00000257743.1	25	0.00	0	C	NM_001204		203420345	203420345	+1	no_errors	ENST00000374580	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	1.000	G
BRD4	23476	genome.wustl.edu	37	19	15350784	15350784	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:15350784C>G	ENST00000263377.2	-	15	3440	c.3219G>C	c.(3217-3219)atG>atC	p.M1073I		NM_058243.2	NP_490597.1	O60885	BRD4_HUMAN	bromodomain containing 4	1073	C-terminal (CTD) region.				cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|chromosome segregation (GO:0007059)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|inner cell mass cell proliferation (GO:0001833)|negative regulation of DNA damage checkpoint (GO:2000002)|positive regulation of DNA binding (GO:0043388)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|regulation of phosphorylation of RNA polymerase II C-terminal domain (GO:1901407)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|urinary_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(3;3.02e-24)|Epithelial(3;4.71e-20)|all cancers(3;2.26e-18)			GGAACTGTGACATCTGGGGGG	0.582			T	C15orf55	lethal midline carcinoma of young people																																	dbGAP		Dom	yes		19	19p13.1	23476	bromodomain containing 4		E	0													62.0	62.0	62.0					19																	15350784		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y12059	CCDS12328.1, CCDS46004.1	19p13.12	2013-09-20	2002-01-14		ENSG00000141867	ENSG00000141867			13575	protein-coding gene	gene with protein product	"""chromosome-associated protein"""	608749	"""bromodomain-containing 4"""			10938129	Standard	NM_058243		Approved	HUNKI, MCAP, CAP, HUNK1	uc002nar.3	O60885	OTTHUMG00000183252	ENST00000263377.2:c.3219G>C	19.37:g.15350784C>G	ENSP00000263377:p.Met1073Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O60433|Q4G0X8|Q86YS8|Q96PD3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.M1073I	ENST00000263377.2	37	c.3219	CCDS12328.1	19	.	.	.	.	.	.	.	.	.	.	C	10.25	1.299237	0.23650	.	.	ENSG00000141867	ENST00000263377	T	0.29397	1.57	4.41	2.25	0.28309	.	0.199393	0.35096	N	0.003445	T	0.14485	0.0350	N	0.19112	0.55	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.11446	-1.0587	10	0.12430	T	0.62	-1.2326	4.931	0.13917	0.1671:0.6476:0.0:0.1853	.	1073	O60885	BRD4_HUMAN	I	1073	ENSP00000263377:M1073I	ENSP00000263377:M1073I	M	-	3	0	BRD4	15211784	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	0.724000	0.25954	0.303000	0.22785	0.561000	0.74099	ATG	BRD4	-	NULL	ENSG00000141867		0.582	BRD4-001	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	BRD4	HGNC	protein_coding	OTTHUMT00000465800.3	38	0.00	0	C	NM_058243		15350784	15350784	-1	no_errors	ENST00000263377	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	1.000	G
C1orf140	400804	genome.wustl.edu	37	1	221509249	221509249	+	lincRNA	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:221509249G>C	ENST00000439004.1	-	0	389					NR_024236.1																						GGCATCTCTGGGAAGCCATCA	0.498																																						dbGAP											0													69.0	67.0	67.0					1																	221509249		692	1591	2283	-	-	-			0																															1.37:g.221509249G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000439004.1	37	NULL		1																																																																																			RP11-421L10.1	-	-	ENSG00000234754		0.498	RP11-421L10.1-001	KNOWN	basic	lincRNA	C1orf140	Clone_based_vega_gene	lincRNA	OTTHUMT00000091116.2	38	0.00	0	G			221509249	221509249	-1	no_errors	ENST00000434398	ensembl	human	putative	69_37n	rna	32	25.58	11	SNP	0.000	C
CACNA2D1	781	genome.wustl.edu	37	7	81714138	81714138	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:81714138G>A	ENST00000356253.5	-	7	860	c.605C>T	c.(604-606)tCa>tTa	p.S202L	CACNA2D1_ENST00000423588.1_Missense_Mutation_p.S202L|CACNA2D1_ENST00000356860.3_Missense_Mutation_p.S202L			P54289	CA2D1_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 1	202					calcium ion transport (GO:0006816)|regulation of calcium ion transport (GO:0051924)	extracellular vesicular exosome (GO:0070062)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(15)|liver(1)|lung(42)|ovary(6)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	81					Amlodipine(DB00381)|Cyclandelate(DB04838)|Felodipine(DB01023)|Gabapentin(DB00996)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CCACAATAATGAAGGGTCTTC	0.408																																						dbGAP											0													110.0	108.0	109.0					7																	81714138		2203	4300	6503	-	-	-	SO:0001583	missense	0			M76559	CCDS5598.1	7q21-q22	2014-09-17			ENSG00000153956	ENSG00000153956		"""Calcium channel subunits"""	1399	protein-coding gene	gene with protein product		114204	"""long intergenic non-protein coding RNA 1112"""	CACNL2A, CACNA2, MHS3, LINC01112		8188232	Standard	XM_005250570		Approved	lncRNA-N3	uc003uhr.1	P54289	OTTHUMG00000023622	ENST00000356253.5:c.605C>T	7.37:g.81714138G>A	ENSP00000348589:p.Ser202Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17R45|Q9UD80|Q9UD81|Q9UD82	Missense_Mutation	SNP	pfam_VDCC_a2/dsu,pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.S202L	ENST00000356253.5	37	c.605		7	.	.	.	.	.	.	.	.	.	.	G	22.4	4.284316	0.80803	.	.	ENSG00000153956	ENST00000356860;ENST00000284088;ENST00000356253;ENST00000423588	T;T;T	0.25414	3.13;3.13;1.8	5.96	5.96	0.96718	.	0.384119	0.28166	N	0.016341	T	0.42743	0.1216	M	0.67397	2.05	0.80722	D	1	B	0.33044	0.395	B	0.43413	0.419	T	0.26710	-1.0095	10	0.87932	D	0	-7.1456	20.0142	0.97474	0.0:0.0:1.0:0.0	.	202	P54289-2	.	L	202	ENSP00000349320:S202L;ENSP00000348589:S202L;ENSP00000405395:S202L	ENSP00000284088:S202L	S	-	2	0	CACNA2D1	81552074	1.000000	0.71417	0.274000	0.24659	0.951000	0.60555	9.678000	0.98647	2.831000	0.97527	0.650000	0.86243	TCA	CACNA2D1	-	pfam_VWA_N	ENSG00000153956		0.408	CACNA2D1-201	KNOWN	basic	protein_coding	CACNA2D1	HGNC	protein_coding		46	0.00	0	G			81714138	81714138	-1	no_errors	ENST00000356253	ensembl	human	known	69_37n	missense	79	20.00	20	SNP	0.631	A
CCDC130	81576	genome.wustl.edu	37	19	13870017	13870017	+	Silent	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:13870017C>T	ENST00000586600.1	+	9	1007	c.504C>T	c.(502-504)caC>caT	p.H168H	CCDC130_ENST00000587019.1_3'UTR|CCDC130_ENST00000221554.8_Silent_p.H168H			P13994	CC130_HUMAN	coiled-coil domain containing 130	168					response to virus (GO:0009615)					endometrium(2)|kidney(1)|large_intestine(3)|ovary(1)|skin(2)|urinary_tract(1)	10			OV - Ovarian serous cystadenocarcinoma(19;6.02e-23)|Epithelial(5;2.58e-18)			CACTGAGCCACATCCAGGAGG	0.647																																						dbGAP											0													33.0	33.0	33.0					19																	13870017		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF250306	CCDS12296.1	19p13.13	2008-02-05				ENSG00000104957			28118	protein-coding gene	gene with protein product						3203696	Standard	NM_030818		Approved	MGC10471	uc002mxc.1	P13994		ENST00000586600.1:c.504C>T	19.37:g.13870017C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQ72	Missense_Mutation	SNP	pfam_CWC16	p.T140I	ENST00000586600.1	37	c.419	CCDS12296.1	19																																																																																			CCDC130	-	NULL	ENSG00000104957		0.647	CCDC130-001	KNOWN	alternative_5_UTR|upstream_uORF|basic|appris_principal|CCDS	protein_coding	CCDC130	HGNC	protein_coding	OTTHUMT00000453216.2	8	0.00	0	C	NM_030818		13870017	13870017	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000588809	ensembl	human	putative	69_37n	missense	11	38.89	7	SNP	1.000	T
CCNH	902	genome.wustl.edu	37	5	86703897	86703897	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr5:86703897C>G	ENST00000256897.4	-	4	645	c.421G>C	c.(421-423)Gaa>Caa	p.E141Q	CCNH_ENST00000508855.1_Missense_Mutation_p.E67Q|CCNH_ENST00000513499.1_Intron|CCNH_ENST00000504878.1_Missense_Mutation_p.E67Q	NM_001239.3	NP_001230.1	P51946	CCNH_HUMAN	cyclin H	141					7-methylguanosine mRNA capping (GO:0006370)|ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cyclin-dependent protein kinase activating kinase holoenzyme complex (GO:0019907)|holo TFIIH complex (GO:0005675)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|TFIIK complex (GO:0070985)	cyclin-dependent protein serine/threonine kinase regulator activity (GO:0016538)|kinase activity (GO:0016301)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(2)	15		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;9.01e-39)|Epithelial(54;5.08e-33)|all cancers(79;4.28e-28)		AGTATCTGTTCAAGTGCCTTC	0.418								Direct reversal of damage;Direct reversal of damage;Nucleotide excision repair (NER)																														dbGAP											0													133.0	129.0	130.0					5																	86703897		2203	4300	6503	-	-	-	SO:0001583	missense	0			U12685	CCDS4064.1	5q13.3-q14	2014-03-28			ENSG00000134480	ENSG00000134480		"""General transcription factor IIH complex subunits"""	1594	protein-coding gene	gene with protein product	"""CDK-activating kinase complex subunit"", ""cyclin-dependent kinase-activating kinase complex subunit"", ""MO15-associated protein"", ""CAK complex subunit"""	601953				9465303	Standard	NM_001239		Approved	p34, p37, CycH	uc003kjb.3	P51946	OTTHUMG00000119077	ENST00000256897.4:c.421G>C	5.37:g.86703897C>G	ENSP00000256897:p.Glu141Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X72|Q8TBL9	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_C/H,tigrfam_Cyclin_H	p.E141Q	ENST00000256897.4	37	c.421	CCDS4064.1	5	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307704	0.81247	.	.	ENSG00000134480	ENST00000508855;ENST00000256897;ENST00000504878	T;T;T	0.18174	2.23;2.23;2.23	5.14	5.14	0.70334	Cyclin, N-terminal (1);Cyclin-like (3);	0.095200	0.64402	D	0.000001	T	0.36054	0.0953	L	0.49126	1.545	0.80722	D	1	D;D	0.76494	0.999;0.996	D;P	0.66847	0.947;0.899	T	0.01972	-1.1237	10	0.35671	T	0.21	-17.2016	18.5912	0.91214	0.0:1.0:0.0:0.0	.	141;88	P51946;E9PDB6	CCNH_HUMAN;.	Q	67;141;67	ENSP00000426454:E67Q;ENSP00000256897:E141Q;ENSP00000426075:E67Q	ENSP00000256897:E141Q	E	-	1	0	CCNH	86739653	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	5.700000	0.68318	2.398000	0.81561	0.655000	0.94253	GAA	CCNH	-	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_C/H,tigrfam_Cyclin_H	ENSG00000134480		0.418	CCNH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNH	HGNC	protein_coding	OTTHUMT00000239291.3	39	0.00	0	C	NM_001239		86703897	86703897	-1	no_errors	ENST00000256897	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	1.000	G
CD248	57124	genome.wustl.edu	37	11	66082230	66082230	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:66082230C>G	ENST00000311330.3	-	1	2285	c.2269G>C	c.(2269-2271)Gtg>Ctg	p.V757L	RP11-867G23.13_ENST00000534065.1_RNA	NM_020404.2	NP_065137.1	Q9HCU0	CD248_HUMAN	CD248 molecule, endosialin	757					anatomical structure regression (GO:0060033)|cell migration (GO:0016477)|lymph node development (GO:0048535)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|extracellular matrix binding (GO:0050840)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	26						CCCCATCACACGCTGGTTCTG	0.657																																						dbGAP											0													18.0	17.0	17.0					11																	66082230		2137	4158	6295	-	-	-	SO:0001583	missense	0			AF279142	CCDS8134.1	11q13	2006-04-12	2006-03-28	2005-02-11	ENSG00000174807	ENSG00000174807		"""CD molecules"""	18219	protein-coding gene	gene with protein product	"""endosialin"", ""tumor endothelial marker 1"""	606064	"""CD164 sialomucin-like 1"", ""CD248 antigen, endosialin"""	CD164L1		10947988, 11084048	Standard	NM_020404		Approved	TEM1	uc001ohm.1	Q9HCU0	OTTHUMG00000167073	ENST00000311330.3:c.2269G>C	11.37:g.66082230C>G	ENSP00000308117:p.Val757Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2V5|Q3SX55|Q96KB6	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_EGF-like_Ca-bd,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_C-type_lectin	p.V757L	ENST00000311330.3	37	c.2269	CCDS8134.1	11	.	.	.	.	.	.	.	.	.	.	C	17.35	3.366641	0.61513	.	.	ENSG00000174807	ENST00000311330	D	0.90563	-2.69	3.55	2.63	0.31362	.	1.334800	0.05637	U	0.582699	D	0.83552	0.5279	N	0.08118	0	0.27880	N	0.939726	D	0.53312	0.959	P	0.46299	0.511	T	0.76293	-0.3012	10	0.87932	D	0	.	6.9421	0.24498	0.0:0.8696:0.0:0.1304	.	757	Q9HCU0	CD248_HUMAN	L	757	ENSP00000308117:V757L	ENSP00000308117:V757L	V	-	1	0	CD248	65838806	1.000000	0.71417	0.996000	0.52242	0.924000	0.55760	1.829000	0.39121	0.836000	0.34901	0.491000	0.48974	GTG	CD248	-	NULL	ENSG00000174807		0.657	CD248-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD248	HGNC	protein_coding	OTTHUMT00000392922.2	10	0.00	0	C	NM_020404		66082230	66082230	-1	no_errors	ENST00000311330	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	0.996	G
CDC40	51362	genome.wustl.edu	37	6	110531945	110531945	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:110531945G>C	ENST00000368932.1	+	7	767	c.666G>C	c.(664-666)aaG>aaC	p.K222N	CDC40_ENST00000368930.1_Missense_Mutation_p.K222N|CDC40_ENST00000307731.1_Missense_Mutation_p.K222N			O60508	PRP17_HUMAN	cell division cycle 40	222					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(1)|skin(1)	18		all_cancers(87;6.23e-06)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.00159)|Colorectal(196;0.0488)		Epithelial(106;0.0221)|all cancers(137;0.0314)|OV - Ovarian serous cystadenocarcinoma(136;0.034)		TCACAGCAAAGAGGCAGAAAA	0.323																																						dbGAP											0													92.0	99.0	97.0					6																	110531945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF015044	CCDS5081.1	6q22.1	2013-01-17	2013-01-17		ENSG00000168438	ENSG00000168438		"""WD repeat domain containing"""	17350	protein-coding gene	gene with protein product		605585	"""cell division cycle 40 homolog (yeast)"", ""cell division cycle 40 homolog (S. cerevisiae)"""			9769104, 9830021	Standard	NM_015891		Approved	PRP17, EHB3, PRPF17, FLJ10564	uc003pua.3	O60508	OTTHUMG00000015358	ENST00000368932.1:c.666G>C	6.37:g.110531945G>C	ENSP00000357928:p.Lys222Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBC5|O75471|Q5SRN0|Q9UPG1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K222N	ENST00000368932.1	37	c.666	CCDS5081.1	6	.	.	.	.	.	.	.	.	.	.	G	24.5	4.538293	0.85917	.	.	ENSG00000168438	ENST00000368932;ENST00000368933;ENST00000368930;ENST00000307731	T;T;T;T	0.64803	0.03;-0.12;-0.12;0.03	5.92	5.92	0.95590	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.66577	0.2803	M	0.80508	2.5	0.80722	D	1	P	0.51057	0.941	P	0.52514	0.701	T	0.68337	-0.5435	10	0.42905	T	0.14	-17.3799	13.5183	0.61553	0.071:0.0:0.929:0.0	.	222	O60508	PRP17_HUMAN	N	222	ENSP00000357928:K222N;ENSP00000357929:K222N;ENSP00000357926:K222N;ENSP00000304370:K222N	ENSP00000304370:K222N	K	+	3	2	CDC40	110638638	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.324000	0.59228	2.810000	0.96702	0.585000	0.79938	AAG	CDC40	-	NULL	ENSG00000168438		0.323	CDC40-005	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC40	HGNC	protein_coding	OTTHUMT00000041791.1	60	0.00	0	G	NM_015891		110531945	110531945	+1	no_errors	ENST00000307731	ensembl	human	known	69_37n	missense	51	39.29	33	SNP	1.000	C
CDRT1	374286	genome.wustl.edu	37	17	15522583	15522583	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr17:15522583C>T	ENST00000395906.3	-	1	243	c.244G>A	c.(244-246)Gga>Aga	p.G82R	RP11-385D13.1_ENST00000455584.2_Intron	NM_006382.3	NP_006373.2	O95170	CDRT1_HUMAN	CMT1A duplicated region transcript 1	82										endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|stomach(1)|upper_aerodigestive_tract(1)	10				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(2;1.36e-05)|BRCA - Breast invasive adenocarcinoma(8;0.0541)		AAATCCTTTCCCTGTGTGGTC	0.398																																						dbGAP											0													83.0	89.0	87.0					17																	15522583		2201	4297	6498	-	-	-	SO:0001583	missense	0			U65652	CCDS45619.1, CCDS73996.1	17p11	2013-01-10			ENSG00000241322	ENSG00000241322		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	14379	protein-coding gene	gene with protein product		604596	"""F-box and WD repeat domain containing 10 pseudogene 1"", ""F-box and WD-40 domain protein 10 pseudogene 1"""	FBXW10P1		9787083, 11381029	Standard	NM_006382		Approved	HREP, SM25H2, FBXW10B		O95170	OTTHUMG00000059074	ENST00000395906.3:c.244G>A	17.37:g.15522583C>T	ENSP00000379242:p.Gly82Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O43848|O95611	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.G82R	ENST00000395906.3	37	c.244	CCDS45619.1	17	.	.	.	.	.	.	.	.	.	.	.	16.95	3.262530	0.59431	.	.	ENSG00000251537	ENST00000261644;ENST00000395906	T	0.26067	1.76	4.92	4.92	0.64577	.	.	.	.	.	T	0.44891	0.1315	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.28235	-1.0050	9	0.49607	T	0.09	.	11.5517	0.50725	0.0:0.9118:0.0:0.0882	.	82	O95170	CDRT1_HUMAN	R	82	ENSP00000379242:G82R	ENSP00000261644:G82R	G	-	1	0	RP11-385D13.1	15463308	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	3.106000	0.50322	2.441000	0.82636	0.484000	0.47621	GGA	CDRT1	-	NULL	ENSG00000241322		0.398	CDRT1-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CDRT1	HGNC	protein_coding	OTTHUMT00000448127.1	93	0.00	0	C	NM_006382		15522583	15522583	-1	no_errors	ENST00000395906	ensembl	human	known	69_37n	missense	52	35.00	28	SNP	0.916	T
CHRM2	1129	genome.wustl.edu	37	7	136699784	136699784	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:136699784A>T	ENST00000445907.2	+	3	700	c.172A>T	c.(172-174)Aac>Tac	p.N58Y	CHRM2_ENST00000320658.5_Missense_Mutation_p.N58Y|hsa-mir-490_ENST00000586239.1_RNA|CHRM2_ENST00000402486.3_Missense_Mutation_p.N58Y|CHRM2_ENST00000453373.1_Missense_Mutation_p.N58Y|CHRM2_ENST00000397608.3_Missense_Mutation_p.N58Y|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000425981.2_RNA|hsa-mir-490_ENST00000598184.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|CHRM2_ENST00000401861.1_Missense_Mutation_p.N58Y	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	58					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CCAGACCGTCAACAATTACTT	0.453																																						dbGAP											0													209.0	176.0	187.0					7																	136699784		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.172A>T	7.37:g.136699784A>T	ENSP00000399745:p.Asn58Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VBK6|Q9P1X9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_M2_rcpt,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	p.N58Y	ENST00000445907.2	37	c.172	CCDS5843.1	7	.	.	.	.	.	.	.	.	.	.	A	18.29	3.591138	0.66219	.	.	ENSG00000181072	ENST00000445907;ENST00000453373;ENST00000320658;ENST00000397608;ENST00000402486;ENST00000401861	T;T;T;T;T;T	0.19532	2.14;2.14;2.14;2.14;2.14;2.14	5.32	5.32	0.75619	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.52549	0.1741	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61491	-0.7052	10	0.72032	D	0.01	.	15.3257	0.74160	1.0:0.0:0.0:0.0	.	58	P08172	ACM2_HUMAN	Y	58	ENSP00000399745:N58Y;ENSP00000415386:N58Y;ENSP00000319984:N58Y;ENSP00000380733:N58Y;ENSP00000384937:N58Y;ENSP00000384401:N58Y	ENSP00000319984:N58Y	N	+	1	0	CHRM2	136350324	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.243000	0.95416	2.025000	0.59659	0.477000	0.44152	AAC	CHRM2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000181072		0.453	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	95	0.00	0	A			136699784	136699784	+1	no_errors	ENST00000320658	ensembl	human	known	69_37n	missense	101	23.48	31	SNP	1.000	T
CHRNA4	1137	genome.wustl.edu	37	20	61982113	61982113	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr20:61982113G>C	ENST00000370263.4	-	5	871	c.650C>G	c.(649-651)aCc>aGc	p.T217S	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	217					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GGTGTTGTAGGTGCCCACGGC	0.592																																						dbGAP											0													181.0	139.0	153.0					20																	61982113		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.650C>G	20.37:g.61982113G>C	ENSP00000359285:p.Thr217Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.T217S	ENST00000370263.4	37	c.650	CCDS13517.1	20	.	.	.	.	.	.	.	.	.	.	G	11.05	1.524069	0.27299	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	T	0.79141	-1.24	4.77	1.29	0.21616	Neurotransmitter-gated ion-channel ligand-binding (3);	0.194672	0.52532	N	0.000066	T	0.55049	0.1896	N	0.16166	0.38	0.31452	N	0.670686	B;B	0.31125	0.309;0.04	B;B	0.31946	0.138;0.052	T	0.52779	-0.8530	10	0.12103	T	0.63	.	7.7652	0.28976	0.0:0.1084:0.3368:0.5547	.	146;217	Q4VAQ5;P43681	.;ACHA4_HUMAN	S	123;217;146	ENSP00000359285:T217S	ENSP00000359280:T123S	T	-	2	0	CHRNA4	61452557	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.164000	0.42387	0.353000	0.24079	0.561000	0.74099	ACC	CHRNA4	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000101204		0.592	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	HGNC	protein_coding	OTTHUMT00000080508.3	60	0.00	0	G			61982113	61982113	-1	no_errors	ENST00000370263	ensembl	human	known	69_37n	missense	70	23.91	22	SNP	1.000	C
CLPTM1	1209	genome.wustl.edu	37	19	45494525	45494525	+	Silent	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:45494525C>G	ENST00000337392.5	+	12	1599	c.1449C>G	c.(1447-1449)ctC>ctG	p.L483L	CLPTM1_ENST00000546079.1_Silent_p.L381L|CLPTM1_ENST00000541297.2_Silent_p.L469L	NM_001282175.1|NM_001282176.1|NM_001294.2	NP_001269104.1|NP_001269105.1|NP_001285.1	O96005	CLPT1_HUMAN	cleft lip and palate associated transmembrane protein 1	483					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of T cell differentiation in thymus (GO:0033081)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00354)|Epithelial(262;0.187)		CCTGGATCCTCTTCCCGCTCC	0.637																																						dbGAP											0													243.0	205.0	218.0					19																	45494525		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF037339	CCDS12651.1, CCDS74394.1, CCDS74395.1	19q13.3	2008-02-05				ENSG00000104853			2087	protein-coding gene	gene with protein product		604783				9828125	Standard	NM_001294		Approved		uc002pai.3	O96005		ENST00000337392.5:c.1449C>G	19.37:g.45494525C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQH2|B4DDS3|B4E2X9|B7Z9X9|F5H8J3|Q53ET6|Q9BSS5	Silent	SNP	pfam_CLPTM1	p.L483	ENST00000337392.5	37	c.1449	CCDS12651.1	19																																																																																			CLPTM1	-	pfam_CLPTM1	ENSG00000104853		0.637	CLPTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1	HGNC	protein_coding	OTTHUMT00000453267.1	42	0.00	0	C	NM_001294		45494525	45494525	+1	no_errors	ENST00000337392	ensembl	human	known	69_37n	silent	48	36.00	27	SNP	1.000	G
CNTN6	27255	genome.wustl.edu	37	3	1444013	1444013	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:1444013G>A	ENST00000446702.2	+	22	3456	c.2829G>A	c.(2827-2829)cgG>cgA	p.R943R	CNTN6_ENST00000350110.2_Silent_p.R943R|CNTN6_ENST00000539053.1_Silent_p.R871R			Q9UQ52	CNTN6_HUMAN	contactin 6	943	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TTCTGTACCGGCAAAACAGAC	0.348																																						dbGAP											0													79.0	82.0	81.0					3																	1444013		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.2829G>A	3.37:g.1444013G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM2	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R943	ENST00000446702.2	37	c.2829	CCDS2557.1	3																																																																																			CNTN6	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134115		0.348	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	29	0.00	0	G	NM_014461		1444013	1444013	+1	no_errors	ENST00000350110	ensembl	human	known	69_37n	silent	31	31.11	14	SNP	1.000	A
COL7A1	1294	genome.wustl.edu	37	3	48613091	48613091	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:48613091C>A	ENST00000328333.8	-	72	6054	c.5947G>T	c.(5947-5949)Gac>Tac	p.D1983Y	COL7A1_ENST00000454817.1_Missense_Mutation_p.D1951Y	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1983	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		TCGCCTGAGTCCCCCTTGGGG	0.647																																						dbGAP											0													53.0	55.0	55.0					3																	48613091		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.5947G>T	3.37:g.48613091C>A	ENSP00000332371:p.Asp1983Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14054|Q16507	Missense_Mutation	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.D1983Y	ENST00000328333.8	37	c.5947	CCDS2773.1	3	.	.	.	.	.	.	.	.	.	.	C	6.597	0.478522	0.12521	.	.	ENSG00000114270	ENST00000328333;ENST00000454817	D;D	0.93426	-3.22;-3.22	4.19	3.31	0.37934	.	0.160475	0.28203	N	0.016211	D	0.95771	0.8624	M	0.73430	2.235	0.36755	D	0.882959	D	0.71674	0.998	D	0.73708	0.981	D	0.96950	0.9694	10	0.62326	D	0.03	.	12.1679	0.54141	0.0:0.9161:0.0:0.0839	.	1983	Q02388	CO7A1_HUMAN	Y	1983;1951	ENSP00000332371:D1983Y;ENSP00000412569:D1951Y	ENSP00000332371:D1983Y	D	-	1	0	COL7A1	48588095	0.933000	0.31639	0.895000	0.35142	0.062000	0.15995	2.709000	0.47160	1.104000	0.41587	0.563000	0.77884	GAC	COL7A1	-	pfam_Collagen	ENSG00000114270		0.647	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	16	0.00	0	C	NM_000094		48613091	48613091	-1	no_errors	ENST00000328333	ensembl	human	known	69_37n	missense	5	58.33	7	SNP	0.989	A
CREB3L3	84699	genome.wustl.edu	37	19	4157065	4157065	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:4157065C>T	ENST00000078445.2	+	3	377	c.230C>T	c.(229-231)tCc>tTc	p.S77F	CREB3L3_ENST00000602257.1_Missense_Mutation_p.S77F|CREB3L3_ENST00000595923.1_Missense_Mutation_p.S76F|CREB3L3_ENST00000602147.1_Missense_Mutation_p.S77F|CREB3L3_ENST00000252587.3_Missense_Mutation_p.S67F	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	77					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		CTGCCCAGCTCCCCACTCTGG	0.662																																						dbGAP											0													71.0	57.0	62.0					19																	4157065		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.230C>T	19.37:g.4157065C>T	ENSP00000078445:p.Ser77Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.S77F	ENST00000078445.2	37	c.230	CCDS12121.1	19	.	.	.	.	.	.	.	.	.	.	C	19.69	3.873979	0.72180	.	.	ENSG00000060566	ENST00000078445;ENST00000381943;ENST00000252587	D;D	0.87887	-2.31;-2.31	5.27	5.27	0.74061	.	0.346287	0.29987	N	0.010684	D	0.92799	0.7710	M	0.75264	2.295	0.49582	D	0.999801	D;D;D;D	0.89917	1.0;0.999;1.0;0.999	D;D;D;D	0.91635	0.999;0.997;0.999;0.997	D	0.93312	0.6685	10	0.72032	D	0.01	-31.418	14.4304	0.67246	0.0:1.0:0.0:0.0	.	77;77;76;77	Q68CJ9-3;B7ZL69;Q68CJ9-2;Q68CJ9	.;.;.;CR3L3_HUMAN	F	77;77;67	ENSP00000078445:S77F;ENSP00000252587:S67F	ENSP00000078445:S77F	S	+	2	0	CREB3L3	4108065	1.000000	0.71417	0.714000	0.30535	0.687000	0.40016	5.350000	0.66016	2.478000	0.83669	0.537000	0.68136	TCC	CREB3L3	-	NULL	ENSG00000060566		0.662	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB3L3	HGNC	protein_coding	OTTHUMT00000457922.1	35	0.00	0	C	NM_032607		4157065	4157065	+1	no_errors	ENST00000078445	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	T
CYP8B1	1582	genome.wustl.edu	37	3	42917067	42917067	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:42917067A>C	ENST00000316161.4	-	1	566	c.242T>G	c.(241-243)aTg>aGg	p.M81R	CYP8B1_ENST00000437102.1_Missense_Mutation_p.M81R|KRBOX1_ENST00000426937.1_Intron|RP11-141M3.5_ENST00000471537.1_RNA	NM_004391.2	NP_004382.2	Q9UNU6	CP8B1_HUMAN	cytochrome P450, family 8, subfamily B, polypeptide 1	81					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	7alpha-hydroxycholest-4-en-3-one 12alpha-hydroxylase activity (GO:0033778)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)|sterol 12-alpha-hydroxylase activity (GO:0008397)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(5)|ovary(2)|prostate(2)|skin(5)	23				KIRC - Kidney renal clear cell carcinoma(284;0.213)|Kidney(284;0.249)		GAGGGGGTCCATGACGAAGGT	0.483																																						dbGAP											0													75.0	70.0	72.0					3																	42917067		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090318	CCDS2707.1	3p22.1	2004-02-27	2003-01-14		ENSG00000180432	ENSG00000180432		"""Cytochrome P450s"""	2653	protein-coding gene	gene with protein product		602172	"""cytochrome P450, subfamily VIIIB (sterol 12-alpha-hydroxylase), polypeptide 1"""			10051404	Standard	NM_004391		Approved	CYP12	uc003cmh.3	Q9UNU6	OTTHUMG00000133047	ENST00000316161.4:c.242T>G	3.37:g.42917067A>C	ENSP00000318867:p.Met81Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCY3|O75958|Q6NWT2|Q6NWT3	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.M81R	ENST00000316161.4	37	c.242	CCDS2707.1	3	.	.	.	.	.	.	.	.	.	.	A	16.31	3.087650	0.55968	.	.	ENSG00000180432	ENST00000437102;ENST00000316161	T;T	0.01246	5.11;5.11	5.04	3.88	0.44766	.	0.235140	0.42172	D	0.000743	T	0.03520	0.0101	M	0.65498	2.005	0.35905	D	0.830657	P;P	0.48230	0.907;0.907	P;P	0.51170	0.661;0.579	T	0.25152	-1.0140	10	0.87932	D	0	-41.4134	6.8095	0.23796	0.8466:0.0:0.1534:0.0	.	81;81	C9JFR9;Q9UNU6	.;CP8B1_HUMAN	R	81	ENSP00000404499:M81R;ENSP00000318867:M81R	ENSP00000318867:M81R	M	-	2	0	CYP8B1	42892071	1.000000	0.71417	1.000000	0.80357	0.830000	0.47004	3.075000	0.50073	2.124000	0.65301	0.459000	0.35465	ATG	CYP8B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000180432		0.483	CYP8B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP8B1	HGNC	protein_coding	OTTHUMT00000256653.1	32	0.00	0	A	NM_004391		42917067	42917067	-1	no_errors	ENST00000316161	ensembl	human	known	69_37n	missense	22	42.11	16	SNP	1.000	C
DDI1	414301	genome.wustl.edu	37	11	103907921	103907921	+	Missense_Mutation	SNP	G	G	A	rs138287051		TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:103907921G>A	ENST00000302259.3	+	1	614	c.371G>A	c.(370-372)cGg>cAg	p.R124Q	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	124							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		GCTGCCCAGCGGTCACAGGGC	0.672																																						dbGAP											0													49.0	51.0	50.0					11																	103907921		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.371G>A	11.37:g.103907921G>A	ENSP00000302805:p.Arg124Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	pfam_Peptidase_aspartic_euk-pred,pfam_Ubiquitin,pfam_RVP_2,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.R124Q	ENST00000302259.3	37	c.371	CCDS31660.1	11	.	.	.	.	.	.	.	.	.	.	G	2.017	-0.425559	0.04701	.	.	ENSG00000170967	ENST00000302259	T	0.21734	1.99	4.8	-5.85	0.02311	.	1.050080	0.07393	N	0.889407	T	0.03651	0.0104	N	0.00677	-1.265	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.32745	-0.9895	10	0.05620	T	0.96	-6.0679	3.3427	0.07124	0.1843:0.1174:0.468:0.2303	.	124	Q8WTU0	DDI1_HUMAN	Q	124	ENSP00000302805:R124Q	ENSP00000302805:R124Q	R	+	2	0	DDI1	103413131	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.721000	0.04963	-1.020000	0.03354	-0.961000	0.02630	CGG	DDI1	-	NULL	ENSG00000170967		0.672	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDI1	HGNC	protein_coding	OTTHUMT00000387326.1	13	0.00	0	G	NM_001001711		103907921	103907921	+1	no_errors	ENST00000302259	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.000	A
DES	1674	genome.wustl.edu	37	2	220283541	220283541	+	Silent	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:220283541C>T	ENST00000373960.3	+	1	443	c.357C>T	c.(355-357)ttC>ttT	p.F119F		NM_001927.3	NP_001918.3	P17661	DESM_HUMAN	desmin	119	Coil 1A.|Rod.			FANYI -> SPIYM (in Ref. 1 and 2; AAA99221). {ECO:0000305}.	cytoskeleton organization (GO:0007010)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart contraction (GO:0008016)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intermediate filament (GO:0005882)|neuromuscular junction (GO:0031594)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|identical protein binding (GO:0042802)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)	18		Renal(207;0.0183)		Epithelial(149;5.25e-07)|all cancers(144;0.000103)|Lung(261;0.00533)|LUSC - Lung squamous cell carcinoma(224;0.008)		ATGACCGCTTCGCCAACTACA	0.652																																						dbGAP											0													31.0	27.0	28.0					2																	220283541		2197	4293	6490	-	-	-	SO:0001819	synonymous_variant	0			AF521879	CCDS33383.1	2q35	2014-09-17			ENSG00000175084	ENSG00000175084		"""Intermediate filaments type III"""	2770	protein-coding gene	gene with protein product	"""intermediate filament protein"""	125660				2673923, 9736733	Standard	NM_001927		Approved	CMD1I, CSM1, CSM2	uc002vll.3	P17661	OTTHUMG00000058924	ENST00000373960.3:c.357C>T	2.37:g.220283541C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15787|Q549R7|Q549R8|Q549R9|Q8IZR1|Q8IZR6|Q8NES2|Q8NEU6|Q8TAC4|Q8TCX2|Q8TD99|Q9UHN5|Q9UJ80	Silent	SNP	pfam_F,pfam_Intermed_filament_DNA-bd,superfamily_Prefoldin	p.F119	ENST00000373960.3	37	c.357	CCDS33383.1	2																																																																																			DES	-	pfam_F,superfamily_Prefoldin	ENSG00000175084		0.652	DES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DES	HGNC	protein_coding	OTTHUMT00000130240.1	12	0.00	0	C	NM_001927		220283541	220283541	+1	no_errors	ENST00000373960	ensembl	human	known	69_37n	silent	10	41.18	7	SNP	1.000	T
DIDO1	11083	genome.wustl.edu	37	20	61522371	61522371	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr20:61522371A>C	ENST00000266070.4	-	15	3807	c.3482T>G	c.(3481-3483)cTg>cGg	p.L1161R	DIDO1_ENST00000395343.1_Missense_Mutation_p.L1161R|DIDO1_ENST00000395335.2_Missense_Mutation_p.L1161R|DIDO1_ENST00000395340.1_Missense_Mutation_p.L1161R	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	1161					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					CAGCGGGATCAGGTAGAGGTC	0.567																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	dbGAP											0													107.0	103.0	104.0					20																	61522371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3482T>G	20.37:g.61522371A>C	ENSP00000266070:p.Leu1161Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.L1161R	ENST00000266070.4	37	c.3482	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	A	17.84	3.488403	0.64074	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	T;T;T;T	0.32023	1.76;1.76;1.47;1.47	5.24	4.14	0.48551	Spen paralogue and orthologue SPOC, C-terminal (1);	0.000000	0.33691	N	0.004660	T	0.56572	0.1994	M	0.84326	2.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.61098	-0.7131	10	0.87932	D	0	-26.3997	11.2639	0.49099	0.9277:0.0:0.0723:0.0	.	1161;1161	Q9BTC0-1;Q9BTC0	.;DIDO1_HUMAN	R	1161	ENSP00000266070:L1161R;ENSP00000378752:L1161R;ENSP00000378749:L1161R;ENSP00000378744:L1161R	ENSP00000266070:L1161R	L	-	2	0	DIDO1	60992816	1.000000	0.71417	0.978000	0.43139	0.403000	0.30841	9.100000	0.94213	0.929000	0.37192	0.533000	0.62120	CTG	DIDO1	-	pfam_SPOC_C	ENSG00000101191		0.567	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	49	0.00	0	A	NM_080796		61522371	61522371	-1	no_errors	ENST00000266070	ensembl	human	known	69_37n	missense	54	28.95	22	SNP	1.000	C
DNAH10	196385	genome.wustl.edu	37	12	124281372	124281372	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr12:124281372G>T	ENST00000409039.3	+	12	1827	c.1802G>T	c.(1801-1803)gGa>gTa	p.G601V		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	601	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		AGTGATCGAGGACAGGAGGTA	0.443																																						dbGAP											0													128.0	118.0	121.0					12																	124281372		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1802G>T	12.37:g.124281372G>T	ENSP00000386770:p.Gly601Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.G601V	ENST00000409039.3	37	c.1802	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	24.7	4.555939	0.86231	.	.	ENSG00000197653	ENST00000409039	T	0.61274	0.12	5.35	5.35	0.76521	Dynein heavy chain, domain-1 (1);	0.219612	0.28465	N	0.015242	T	0.80374	0.4611	M	0.88241	2.94	0.80722	D	1	D;D;D	0.69078	0.995;0.992;0.997	D;D;D	0.73708	0.981;0.969;0.978	T	0.82084	-0.0632	10	0.45353	T	0.12	.	19.0759	0.93161	0.0:0.0:1.0:0.0	.	601;476;601	Q8IVF4-2;C4IXU6;Q8IVF4	.;.;DYH10_HUMAN	V	601	ENSP00000386770:G601V	ENSP00000386770:G601V	G	+	2	0	DNAH10	122847325	1.000000	0.71417	0.138000	0.22173	0.285000	0.27093	7.134000	0.77268	2.506000	0.84524	0.650000	0.86243	GGA	DNAH10	-	pfam_Dynein_heavy_dom-1	ENSG00000197653		0.443	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	37	0.00	0	G			124281372	124281372	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	42	27.59	16	SNP	0.994	T
DNAI2	64446	genome.wustl.edu	37	17	72308231	72308231	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr17:72308231G>A	ENST00000311014.6	+	12	1651	c.1584G>A	c.(1582-1584)agG>agA	p.R528R	DNAI2_ENST00000307504.5_Intron|DNAI2_ENST00000579490.1_Silent_p.R585R|DNAI2_ENST00000582036.1_Silent_p.R516R|DNAI2_ENST00000446837.2_Silent_p.R528R|RP11-647F2.2_ENST00000585167.1_RNA			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	528					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						CGGAGGGCAGGGATGAGGAGC	0.617									Kartagener syndrome																													dbGAP											0													80.0	63.0	69.0					17																	72308231		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.1584G>A	17.37:g.72308231G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.R528	ENST00000311014.6	37	c.1584	CCDS11697.1	17																																																																																			DNAI2	-	NULL	ENSG00000171595		0.617	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DNAI2	HGNC	protein_coding	OTTHUMT00000442537.1	26	0.00	0	G	NM_023036		72308231	72308231	+1	no_errors	ENST00000311014	ensembl	human	known	69_37n	silent	27	27.03	10	SNP	0.372	A
DNTTIP1	116092	genome.wustl.edu	37	20	44429777	44429777	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr20:44429777T>A	ENST00000372622.3	+	5	505	c.437T>A	c.(436-438)aTa>aAa	p.I146K		NM_052951.2	NP_443183.1	Q9H147	TDIF1_HUMAN	deoxynucleotidyltransferase, terminal, interacting protein 1	146						nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)	9		Myeloproliferative disorder(115;0.0122)				CTTCCAGGAATAAAGGTCAGA	0.483																																						dbGAP											0													132.0	125.0	128.0					20																	44429777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035676	CCDS13369.1	20q13.12	2003-09-10	2003-09-10	2003-09-12	ENSG00000101457	ENSG00000101457			16160	protein-coding gene	gene with protein product	"""novel protein similar to synaptotagmin 1 (SYT1, P65) (isoform 1)"", ""TdT binding protein"""	611388	"""chromosome 20 open reading frame 167"""	C20orf167		11473582	Standard	NM_052951		Approved	dJ447F3.4, Tdif1	uc002xpk.3	Q9H147	OTTHUMG00000032610	ENST00000372622.3:c.437T>A	20.37:g.44429777T>A	ENSP00000361705:p.Ile146Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA18|Q96DE3|Q9BQP2|Q9H148	Missense_Mutation	SNP	NULL	p.I146K	ENST00000372622.3	37	c.437	CCDS13369.1	20	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	T|T|T	14.37|14.37|14.37	2.516611|2.516611|2.516611	0.44763|0.44763|0.44763	.|.|.	.|.|.	ENSG00000101457|ENSG00000101457|ENSG00000101457	ENST00000372622;ENST00000415790|ENST00000456939|ENST00000435014	T;T|.|.	0.49139|.|.	0.79;0.82|.|.	5.77|5.77|5.77	4.61|4.61|4.61	0.57282|0.57282|0.57282	.|.|.	0.292376|.|.	0.37393|.|.	N|.|.	0.002112|.|.	T|T|.	0.45478|0.45478|.	0.1344|0.1344|.	L|L|L	0.38531|0.38531|0.38531	1.155|1.155|1.155	0.48040|0.48040|0.48040	D|D|D	0.999579|0.999579|0.999579	P|.|.	0.36909|.|.	0.573|.|.	B|.|.	0.32289|.|.	0.143|.|.	T|T|.	0.37731|0.37731|.	-0.9693|-0.9693|.	10|5|.	0.19147|.|.	T|.|.	0.46|.|.	-22.4638|-22.4638|-22.4638	5.4854|5.4854|5.4854	0.16747|0.16747|0.16747	0.0:0.0867:0.1766:0.7367|0.0:0.0867:0.1766:0.7367|0.0:0.0867:0.1766:0.7367	.|.|.	146|.|.	Q9H147|.|.	TDIF1_HUMAN|.|.	K|K|K	146;106|96|73	ENSP00000361705:I146K;ENSP00000392509:I106K|.|.	ENSP00000361705:I146K|.|.	I|N|X	+|+|+	2|3|1	0|2|0	DNTTIP1|DNTTIP1|DNTTIP1	43863184|43863184|43863184	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.968000|0.968000|0.968000	0.65278|0.65278|0.65278	1.554000|1.554000|1.554000	0.36266|0.36266|0.36266	2.203000|2.203000|2.203000	0.70933|0.70933|0.70933	0.477000|0.477000|0.477000	0.44152|0.44152|0.44152	ATA|AAT|TAA	DNTTIP1	-	NULL	ENSG00000101457		0.483	DNTTIP1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNTTIP1	HGNC	protein_coding	OTTHUMT00000079502.1	43	0.00	0	T	NM_052951		44429777	44429777	+1	no_errors	ENST00000372622	ensembl	human	known	69_37n	missense	62	20.51	16	SNP	1.000	A
DOCK4	9732	genome.wustl.edu	37	7	111395657	111395657	+	Splice_Site	SNP	T	T	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:111395657T>A	ENST00000437633.1	-	41	4559	c.4303A>T	c.(4303-4305)Agt>Tgt	p.S1435C	DOCK4_ENST00000428084.1_Splice_Site_p.S1444C|DOCK4_ENST00000494651.2_Splice_Site_p.S318C	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	1435	DHR-2.				cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				ACCCAGAGACTCTACAAAACA	0.453																																						dbGAP											0													116.0	108.0	110.0					7																	111395657		1925	4130	6055	-	-	-	SO:0001630	splice_region_variant	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.4303-1A>T	7.37:g.111395657T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O14584|O94824|Q8NB45	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_SH3_domain,pfscan_SH3_domain	p.S1444C	ENST00000437633.1	37	c.4330	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	25.0|25.0	4.592181|4.592181	0.86953|0.86953	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000423057;ENST00000445943|ENST00000352877;ENST00000428084;ENST00000494651;ENST00000437633;ENST00000342288	.|T;T;T	.|0.19105	.|2.17;2.17;2.17	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.075491	.|0.85682	.|D	.|0.000000	T|T	0.50257|0.50257	0.1605|0.1605	M|M	0.83223|0.83223	2.63|2.63	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.85130	.|0.997;0.993;0.997;0.996;0.996	T|T	0.57522|0.57522	-0.7797|-0.7797	5|10	.|0.87932	.|D	.|0	.|.	15.0906|15.0906	0.72192|0.72192	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|342;318;1480;1435;1444	.|B7Z2K9;F5GXW1;Q149N5;Q8N1I0;Q8N1I0-2	.|.;.;.;DOCK4_HUMAN;.	S|C	895;1467|1423;1444;318;1435;1432	.|ENSP00000410746:S1444C;ENSP00000440944:S318C;ENSP00000404179:S1435C	.|ENSP00000345432:S1432C	R|S	-|-	3|1	2|0	DOCK4|DOCK4	111182893|111182893	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.930000|0.930000	0.56654|0.56654	7.868000|7.868000	0.87116|0.87116	2.146000|2.146000	0.66826|0.66826	0.529000|0.529000	0.55759|0.55759	AGA|AGT	DOCK4	-	pfam_DOCK	ENSG00000128512		0.453	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	43	0.00	0	T	NM_014705	Missense_Mutation	111395657	111395657	-1	no_errors	ENST00000428084	ensembl	human	known	69_37n	missense	41	46.75	36	SNP	1.000	A
ELF2	1998	genome.wustl.edu	37	4	139980675	139980675	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr4:139980675G>A	ENST00000394235.2	-	10	1710	c.1208C>T	c.(1207-1209)gCa>gTa	p.A403V	ELF2_ENST00000515489.1_Intron|ELF2_ENST00000379550.1_Missense_Mutation_p.A415V|ELF2_ENST00000379549.2_Missense_Mutation_p.A326V|ELF2_ENST00000510408.1_Missense_Mutation_p.A343V|ELF2_ENST00000358635.3_Missense_Mutation_p.A355V|ELF2_ENST00000265495.4_Missense_Mutation_p.A403V	NM_001276458.1	NP_001263387.1			E74-like factor 2 (ets domain transcription factor)											endometrium(1)|kidney(4)|large_intestine(5)|lung(7)|ovary(1)|skin(1)	19	all_hematologic(180;0.162)					TGGTGCACCTGCATTAACTGA	0.433																																						dbGAP											0													87.0	82.0	84.0					4																	139980675		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF256222	CCDS3744.1, CCDS3745.1, CCDS64062.1, CCDS64063.1	4q28	2008-02-05			ENSG00000109381	ENSG00000109381			3317	protein-coding gene	gene with protein product						8756667	Standard	NM_201999		Approved	EU32, NERF, NERF-2, NERF-1A, NERF-1B	uc003ihm.2	Q15723	OTTHUMG00000133383	ENST00000394235.2:c.1208C>T	4.37:g.139980675G>A	ENSP00000377782:p.Ala403Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.A415V	ENST00000394235.2	37	c.1244	CCDS3744.1	4	.	.	.	.	.	.	.	.	.	.	G	11.42	1.632356	0.29068	.	.	ENSG00000109381	ENST00000358635;ENST00000394235;ENST00000379550;ENST00000265495;ENST00000379549;ENST00000540754;ENST00000510408	T;T;T;T;T;T	0.12255	2.7;2.91;2.9;2.91;2.91;2.71	5.6	5.6	0.85130	.	0.104778	0.64402	D	0.000004	T	0.09862	0.0242	N	0.14661	0.345	0.37404	D	0.912956	B;B;B;B;B	0.31548	0.005;0.328;0.009;0.007;0.063	B;B;B;B;B	0.28011	0.002;0.085;0.006;0.004;0.033	T	0.31251	-0.9950	9	.	.	.	.	19.6057	0.95580	0.0:0.0:1.0:0.0	.	218;403;326;343;355	B7Z8R4;Q15723-1;E9PCX3;B7Z720;Q15723-3	.;.;.;.;.	V	355;403;415;403;326;218;343	ENSP00000351458:A355V;ENSP00000377782:A403V;ENSP00000368868:A415V;ENSP00000265495:A403V;ENSP00000368867:A326V;ENSP00000426997:A343V	.	A	-	2	0	ELF2	140200125	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.904000	0.92590	2.629000	0.89072	0.650000	0.86243	GCA	ELF2	-	NULL	ENSG00000109381		0.433	ELF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF2	HGNC	protein_coding	OTTHUMT00000257233.2	32	0.00	0	G	NM_006874		139980675	139980675	-1	no_errors	ENST00000379550	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	1.000	A
EPHX3	79852	genome.wustl.edu	37	19	15342092	15342092	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:15342092C>G	ENST00000221730.3	-	3	665	c.445G>C	c.(445-447)Gac>Cac	p.D149H	EPHX3_ENST00000602233.1_Missense_Mutation_p.D149H|EPHX3_ENST00000435261.1_Missense_Mutation_p.D149H	NM_024794.2	NP_079070.1	Q9H6B9	EPHX3_HUMAN	epoxide hydrolase 3	149						extracellular region (GO:0005576)	hydrolase activity (GO:0016787)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)|skin(1)	7						AGCAGCAGGTCGATTGTGTAG	0.602																																						dbGAP											0													102.0	98.0	99.0					19																	15342092		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026061	CCDS12327.1	19p13.13	2011-10-05	2009-04-06	2009-04-06	ENSG00000105131	ENSG00000105131		"""Abhydrolase domain containing"""	23760	protein-coding gene	gene with protein product			"""abhydrolase domain containing 9"""	ABHD9			Standard	NM_024794		Approved	FLJ22408	uc002nap.3	Q9H6B9		ENST00000221730.3:c.445G>C	19.37:g.15342092C>G	ENSP00000221730:p.Asp149His	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KMR3	Missense_Mutation	SNP	pfam_AB_hydrolase_1,prints_Epox_hydrolase-like,prints_AB_hydrolase_1	p.D149H	ENST00000221730.3	37	c.445	CCDS12327.1	19	.	.	.	.	.	.	.	.	.	.	C	10.21	1.286318	0.23478	.	.	ENSG00000105131	ENST00000221730;ENST00000435261	T;T	0.68025	-0.3;-0.3	4.24	3.21	0.36854	.	0.293174	0.28109	N	0.016562	T	0.75503	0.3858	M	0.64630	1.985	0.20074	N	0.999933	D	0.89917	1.0	D	0.78314	0.991	T	0.64175	-0.6469	10	0.66056	D	0.02	-20.1173	7.8488	0.29442	0.0:0.8869:0.0:0.1131	.	149	Q9H6B9	EPHX3_HUMAN	H	149	ENSP00000221730:D149H;ENSP00000410323:D149H	ENSP00000221730:D149H	D	-	1	0	EPHX3	15203092	0.997000	0.39634	0.614000	0.29051	0.002000	0.02628	3.904000	0.56325	1.014000	0.39417	-0.379000	0.06801	GAC	EPHX3	-	pfam_AB_hydrolase_1	ENSG00000105131		0.602	EPHX3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EPHX3	HGNC	protein_coding	OTTHUMT00000465797.1	35	0.00	0	C	NM_024794		15342092	15342092	-1	no_errors	ENST00000221730	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	0.156	G
ERMAP	114625	genome.wustl.edu	37	1	43296767	43296767	+	Silent	SNP	C	C	A	rs528295732		TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:43296767C>A	ENST00000372517.2	+	4	658	c.414C>A	c.(412-414)acC>acA	p.T138T	ERMAP_ENST00000328249.3_Silent_p.T48T|ERMAP_ENST00000487556.1_Intron|ERMAP_ENST00000372514.3_Silent_p.T138T	NM_001017922.1	NP_001017922.1	Q96PL5	ERMAP_HUMAN	erythroblast membrane-associated protein (Scianna blood group)	138	Ig-like V-type.		Missing (in Sc-3 allele).			cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				AAGAGGACACCGTGATCCTGC	0.498																																						dbGAP											0													91.0	81.0	84.0					1																	43296767		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF311284	CCDS475.1	1p34	2014-07-19	2006-02-23		ENSG00000164010	ENSG00000164010		"""Blood group antigens"", ""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	15743	protein-coding gene	gene with protein product		609017	"""Radin blood group"", ""Scianna blood group"", ""erythroblast membrane-associated protein"", ""erythroblast membrane-associated protein (RD and SC blood groups)"""	RD, SC		11549310	Standard	XM_005270415		Approved	BTN5	uc001cie.1	Q96PL5	OTTHUMG00000007619	ENST00000372517.2:c.414C>A	1.37:g.43296767C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPW8|Q5VV53|Q6DUE0|Q7Z3X0|Q8NCV8|Q8NCW2|Q8NCW3|Q96PL6	Silent	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.T138	ENST00000372517.2	37	c.414	CCDS475.1	1																																																																																			ERMAP	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000164010		0.498	ERMAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERMAP	HGNC	protein_coding	OTTHUMT00000020180.1	32	0.00	0	C	NM_018538		43296767	43296767	+1	no_errors	ENST00000372514	ensembl	human	known	69_37n	silent	34	22.73	10	SNP	0.356	A
F12	2161	genome.wustl.edu	37	5	176829562	176829562	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr5:176829562C>A	ENST00000253496.3	-	13	1717	c.1669G>T	c.(1669-1671)Gat>Tat	p.D557Y	F12_ENST00000514943.1_5'Flank|PFN3_ENST00000358571.2_5'Flank	NM_000505.3	NP_000496.2	P00748	FA12_HUMAN	coagulation factor XII (Hageman factor)	557	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|Factor XII activation (GO:0002542)|fibrinolysis (GO:0042730)|innate immune response (GO:0045087)|plasma kallikrein-kinin cascade (GO:0002353)|positive regulation of blood coagulation (GO:0030194)|positive regulation of fibrinolysis (GO:0051919)|positive regulation of plasminogen activation (GO:0010756)|protein autoprocessing (GO:0016540)|protein processing (GO:0016485)|response to misfolded protein (GO:0051788)|zymogen activation (GO:0031638)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	misfolded protein binding (GO:0051787)|serine-type aminopeptidase activity (GO:0070009)|serine-type endopeptidase activity (GO:0004252)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|skin(1)|urinary_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Ethanolamine Oleate(DB06689)	TGGCACGCATCGGTGCCGCCC	0.672									Hereditary Angioedema																													dbGAP											0													26.0	27.0	27.0					5																	176829562		2196	4296	6492	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HAE, type I-III, Hereditary Angioneurotic Edema, HANE,	M31315	CCDS34302.1	5q35.3	2014-09-17			ENSG00000131187	ENSG00000131187	3.4.21.38		3530	protein-coding gene	gene with protein product		610619					Standard	NM_000505		Approved		uc003mgo.4	P00748	OTTHUMG00000163403	ENST00000253496.3:c.1669G>T	5.37:g.176829562C>A	ENSP00000253496:p.Asp557Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	P78339	Missense_Mutation	SNP	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1_S6,pfam_Kringle,pfam_FN_type2_col-bd,pfam_EGF-like_dom,pfam_Fibronectin_type1,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1_S6,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.D557Y	ENST00000253496.3	37	c.1669	CCDS34302.1	5	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672354	0.88348	.	.	ENSG00000131187	ENST00000253496	T	0.66815	-0.23	5.65	5.65	0.86999	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.139314	0.32655	N	0.005804	D	0.88171	0.6365	H	0.96547	3.84	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91482	0.5205	10	0.87932	D	0	.	18.4976	0.90870	0.0:1.0:0.0:0.0	.	557	P00748	FA12_HUMAN	Y	557	ENSP00000253496:D557Y	ENSP00000253496:D557Y	D	-	1	0	F12	176762168	1.000000	0.71417	0.646000	0.29493	0.791000	0.44710	4.929000	0.63455	2.667000	0.90743	0.561000	0.74099	GAT	F12	-	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000131187		0.672	F12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F12	HGNC	protein_coding	OTTHUMT00000373217.1	10	0.00	0	C			176829562	176829562	-1	no_errors	ENST00000253496	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.997	A
UBALD2	283991	genome.wustl.edu	37	17	74262032	74262034	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr17:74262032_74262034delCCA	ENST00000327490.6	+	2	469_471	c.165_167delCCA	c.(163-168)agccac>agc	p.H59del	UBALD2_ENST00000589240.1_5'UTR	NM_182565.3	NP_872371.1	Q8IYN6	UBAD2_HUMAN	UBA-like domain containing 2	59																	TTCCCAACAGCCACCACCACCAC	0.7																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS11742.1	17q25.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000185262	ENSG00000185262			28438	protein-coding gene	gene with protein product			"""family with sequence similarity 100, member B"""	FAM100B			Standard	NM_182565		Approved	MGC29814	uc010wsy.1	Q8IYN6	OTTHUMG00000132666	ENST00000327490.6:c.165_167delCCA	17.37:g.74262041_74262043delCCA	ENSP00000331298:p.His59del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	superfamily_UBA-like	p.H59in_frame_del	ENST00000327490.6	37	c.165_167	CCDS11742.1	17																																																																																			FAM100B	-	NULL	ENSG00000185262		0.700	UBALD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM100B	HGNC	protein_coding	OTTHUMT00000255920.1	26	0.00	0	CCA	NM_182565		74262032	74262034	+1	no_errors	ENST00000327490	ensembl	human	known	69_37n	in_frame_del	7	22.22	2	DEL	0.998:1.000:1.000	-
FAM131B	9715	genome.wustl.edu	37	7	143055977	143055977	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:143055977C>G	ENST00000409408.1	-	4	2033	c.325G>C	c.(325-327)Gat>Cat	p.D109H	FAM131B_ENST00000409346.1_Missense_Mutation_p.D109H|FAM131B_ENST00000443739.2_Missense_Mutation_p.D137H|FAM131B_ENST00000409578.1_Missense_Mutation_p.D125H|FAM131B_ENST00000409222.3_Missense_Mutation_p.D109H			Q86XD5	F131B_HUMAN	family with sequence similarity 131, member B	109										breast(1)|endometrium(4)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24	Melanoma(164;0.205)					GCATCCGTATCCCTGCGCACG	0.587																																						dbGAP											0													101.0	85.0	90.0					7																	143055977		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045611	CCDS5882.1, CCDS47734.1	7q34	2007-03-20			ENSG00000159784	ENSG00000159784			22202	protein-coding gene	gene with protein product							Standard	NM_014690		Approved	KIAA0773	uc010lpa.3	Q86XD5	OTTHUMG00000152697	ENST00000409408.1:c.325G>C	7.37:g.143055977C>G	ENSP00000387017:p.Asp109His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2H6|A6NDW3|A8K605|B8ZZN2|D3DXE3|J3KQX2|Q7L0D6|Q86T97	Missense_Mutation	SNP	NULL	p.D137H	ENST00000409408.1	37	c.409	CCDS5882.1	7	.	.	.	.	.	.	.	.	.	.	C	18.33	3.600312	0.66332	.	.	ENSG00000159784	ENST00000443739;ENST00000409578;ENST00000409346;ENST00000452076;ENST00000409408;ENST00000409222	T;T;T;T;T	0.25749	1.78;1.78;1.78;1.78;1.78	5.26	5.26	0.73747	.	0.050303	0.85682	D	0.000000	T	0.41673	0.1169	L	0.40543	1.245	0.58432	D	0.999997	D;D	0.69078	0.997;0.986	D;P	0.66847	0.947;0.66	T	0.10451	-1.0629	10	0.41790	T	0.15	0.1635	17.0334	0.86467	0.0:1.0:0.0:0.0	.	125;109	Q86XD5-2;Q86XD5	.;F131B_HUMAN	H	137;125;109;113;109;109	ENSP00000410603:D137H;ENSP00000386568:D125H;ENSP00000386984:D109H;ENSP00000387017:D109H;ENSP00000387147:D109H	ENSP00000387147:D109H	D	-	1	0	FAM131B	142766099	1.000000	0.71417	0.994000	0.49952	0.282000	0.26991	7.269000	0.78482	2.442000	0.82660	0.561000	0.74099	GAT	FAM131B	-	NULL	ENSG00000159784		0.587	FAM131B-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	FAM131B	HGNC	protein_coding	OTTHUMT00000328057.1	27	0.00	0	C	NM_014690		143055977	143055977	-1	no_errors	ENST00000443739	ensembl	human	known	69_37n	missense	63	13.70	10	SNP	1.000	G
FAM83E	54854	genome.wustl.edu	37	19	49107072	49107072	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:49107072G>A	ENST00000263266.3	-	4	1044	c.855C>T	c.(853-855)taC>taT	p.Y285Y	SPACA4_ENST00000321762.1_5'Flank	NM_017708.3	NP_060178.2	Q2M2I3	FA83E_HUMAN	family with sequence similarity 83, member E	285										NS(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(2)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		AGGAGGCCGCGTACAGCGTCC	0.692																																						dbGAP											0													25.0	27.0	26.0					19																	49107072		2165	4246	6411	-	-	-	SO:0001819	synonymous_variant	0			AK000207	CCDS42587.1	19q13.33	2013-10-24			ENSG00000105523	ENSG00000105523			25972	protein-coding gene	gene with protein product							Standard	NM_017708		Approved	FLJ20200	uc002pjn.2	Q2M2I3	OTTHUMG00000183315	ENST00000263266.3:c.855C>T	19.37:g.49107072G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NXK1	Silent	SNP	pfam_DUF1669,superfamily_Acyl_CoA_acyltransferase	p.Y285	ENST00000263266.3	37	c.855	CCDS42587.1	19																																																																																			FAM83E	-	pfam_DUF1669	ENSG00000105523		0.692	FAM83E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83E	HGNC	protein_coding	OTTHUMT00000466145.1	8	0.00	0	G	NM_017708		49107072	49107072	-1	no_errors	ENST00000263266	ensembl	human	known	69_37n	silent	5	44.44	4	SNP	0.990	A
FASTKD1	79675	genome.wustl.edu	37	2	170428450	170428450	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:170428450T>A	ENST00000453153.2	-	2	436	c.90A>T	c.(88-90)caA>caT	p.Q30H	FASTKD1_ENST00000453929.2_Missense_Mutation_p.Q30H	NM_024622.3	NP_078898.3	Q53R41	FAKD1_HUMAN	FAST kinase domains 1	30					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(5)|large_intestine(10)|lung(9)|ovary(4)|prostate(3)	37						TGGGTCGAAATTGAAACACTC	0.343																																						dbGAP											0													70.0	67.0	68.0					2																	170428450		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832058	CCDS33318.1, CCDS63051.1	2q31.1	2008-02-05			ENSG00000138399	ENSG00000138399			26150	protein-coding gene	gene with protein product						11347906	Standard	NM_024622		Approved	FLJ21901	uc002uev.4	Q53R41	OTTHUMG00000154953	ENST00000453153.2:c.90A>T	2.37:g.170428450T>A	ENSP00000400513:p.Gln30His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N583|Q8TEA9|Q96JM5|Q96N71|Q9H6T4	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.Q30H	ENST00000453153.2	37	c.90	CCDS33318.1	2	.	.	.	.	.	.	.	.	.	.	T	2.191	-0.385301	0.04966	.	.	ENSG00000138399	ENST00000453153;ENST00000453929;ENST00000438035;ENST00000445210	T;T	0.17691	2.27;2.26	5.07	-10.1	0.00402	.	0.236971	0.43747	N	0.000530	T	0.06508	0.0167	N	0.22421	0.69	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.13407	0.004;0.009;0.004	T	0.07443	-1.0772	10	0.25751	T	0.34	-23.4768	6.08	0.19936	0.3116:0.4591:0.0736:0.1558	.	30;30;30	D3DPC4;Q53R41-2;Q53R41	.;.;FAKD1_HUMAN	H	30	ENSP00000400513:Q30H;ENSP00000403229:Q30H	ENSP00000396769:Q30H	Q	-	3	2	FASTKD1	170136696	0.000000	0.05858	0.007000	0.13788	0.338000	0.28826	-4.448000	0.00232	-3.074000	0.00252	-1.314000	0.01303	CAA	FASTKD1	-	NULL	ENSG00000138399		0.343	FASTKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FASTKD1	HGNC	protein_coding	OTTHUMT00000337788.2	40	0.00	0	T	NM_024622		170428450	170428450	-1	no_errors	ENST00000453153	ensembl	human	known	69_37n	missense	62	22.50	18	SNP	0.000	A
G3BP1	10146	genome.wustl.edu	37	5	151179507	151179507	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr5:151179507C>G	ENST00000394123.3	+	9	1046	c.901C>G	c.(901-903)Caa>Gaa	p.Q301E	G3BP1_ENST00000356245.3_Missense_Mutation_p.Q301E|G3BP1_ENST00000543466.1_Missense_Mutation_p.Q119E			Q13283	G3BP1_HUMAN	GTPase activating protein (SH3 domain) binding protein 1	301					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|Ras protein signal transduction (GO:0007265)|transport (GO:0006810)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|skin(3)|urinary_tract(2)	29		all_hematologic(541;0.0338)|Medulloblastoma(196;0.091)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)			TCAGCGGGATCAAAGAGTGCG	0.458																																						dbGAP											0													45.0	47.0	46.0					5																	151179507		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006997	CCDS4319.1	5q33.1	2013-02-12	2006-11-01		ENSG00000145907	ENSG00000145907		"""RNA binding motif (RRM) containing"""	30292	protein-coding gene	gene with protein product	"""Ras-GTPase-activating protein SH3-domain-binding protein"""	608431				8649363, 9889278	Standard	NM_005754		Approved	HDH-VIII, G3BP	uc003lum.3	Q13283	OTTHUMG00000130123	ENST00000394123.3:c.901C>G	5.37:g.151179507C>G	ENSP00000377681:p.Gln301Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HYE9	Missense_Mutation	SNP	pfam_NTF2,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Nuclear_transport_factor_2_euk	p.Q301E	ENST00000394123.3	37	c.901	CCDS4319.1	5	.	.	.	.	.	.	.	.	.	.	C	17.56	3.419794	0.62622	.	.	ENSG00000145907	ENST00000394123;ENST00000543466;ENST00000356245;ENST00000274596	T;T;T	0.74315	-0.66;-0.83;-0.66	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.74589	0.3736	M	0.77820	2.39	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.71807	-0.4481	10	0.25106	T	0.35	-5.5614	17.4366	0.87554	0.0:1.0:0.0:0.0	.	301	Q13283	G3BP1_HUMAN	E	301;119;301;143	ENSP00000377681:Q301E;ENSP00000445035:Q119E;ENSP00000348578:Q301E	ENSP00000274596:Q143E	Q	+	1	0	G3BP1	151159700	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.961000	0.63681	2.415000	0.81967	0.650000	0.86243	CAA	G3BP1	-	NULL	ENSG00000145907		0.458	G3BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	G3BP1	HGNC	protein_coding	OTTHUMT00000252431.1	29	0.00	0	C	NM_005754		151179507	151179507	+1	no_errors	ENST00000356245	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	1.000	G
GALNT3	2591	genome.wustl.edu	37	2	166611525	166611525	+	Nonsense_Mutation	SNP	G	G	A	rs137853089		TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:166611525G>A	ENST00000392701.3	-	8	2216	c.1441C>T	c.(1441-1443)Cag>Tag	p.Q481*	GALNT3_ENST00000409882.1_Nonsense_Mutation_p.Q219*	NM_004482.3	NP_004473.2	Q14435	GALT3_HUMAN	polypeptide N-acetylgalactosaminyltransferase 3	481				Q -> R (in Ref. 1; CAA63371). {ECO:0000305}.	carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via serine (GO:0018242)|protein O-linked glycosylation via threonine (GO:0018243)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|manganese ion binding (GO:0030145)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|skin(1)	20						TTTTTACACTGAAGGCGGTGT	0.328																																						dbGAP											0			GRCh37	CM073082	GALNT3	M	rs137853089						69.0	70.0	70.0					2																	166611525		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0				CCDS2226.1	2q24-q31	2014-03-13	2014-03-13		ENSG00000115339	ENSG00000115339	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4125	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 3"""	601756	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 3 (GalNAc-T3)"""			9592121, 15133511	Standard	NM_004482		Approved	GalNAc-T3, HHS, HFTC	uc010fph.1	Q14435	OTTHUMG00000132157	ENST00000392701.3:c.1441C>T	2.37:g.166611525G>A	ENSP00000376465:p.Gln481*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TG9|Q7Z476	Nonsense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.Q481*	ENST00000392701.3	37	c.1441	CCDS2226.1	2	.	.	.	.	.	.	.	.	.	.	G	34	5.368855	0.95900	.	.	ENSG00000115339	ENST00000392701;ENST00000409882	.	.	.	5.56	5.56	0.83823	.	0.106859	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.5169	0.95169	0.0:0.0:1.0:0.0	.	.	.	.	X	481;219	.	ENSP00000376465:Q481X	Q	-	1	0	GALNT3	166319771	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.535000	0.67173	2.631000	0.89168	0.655000	0.94253	CAG	GALNT3	-	NULL	ENSG00000115339		0.328	GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT3	HGNC	protein_coding	OTTHUMT00000255205.2	41	0.00	0	G	NM_004482		166611525	166611525	-1	no_errors	ENST00000392701	ensembl	human	known	69_37n	nonsense	62	24.39	20	SNP	1.000	A
GLP2R	9340	genome.wustl.edu	37	17	9764490	9764490	+	Silent	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr17:9764490C>T	ENST00000262441.5	+	8	1473	c.960C>T	c.(958-960)ttC>ttT	p.F320F	GLP2R_ENST00000574745.1_Silent_p.F140F	NM_004246.1	NP_004237.1	O95838	GLP2R_HUMAN	glucagon-like peptide 2 receptor	320					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|positive regulation of cell proliferation (GO:0008284)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|glucagon receptor activity (GO:0004967)	p.F320F(1)		endometrium(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	44					Glucagon recombinant(DB00040)|Teduglutide(DB08900)	CCTGGGGTTTCGCCCGTGCAC	0.502																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											208.0	188.0	195.0					17																	9764490		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF105367	CCDS11150.1	17p13.3	2012-08-10			ENSG00000065325	ENSG00000065325		"""GPCR / Class B : Glucagon receptors"""	4325	protein-coding gene	gene with protein product		603659				9990065	Standard	NM_004246		Approved		uc002gmd.1	O95838	OTTHUMG00000130269	ENST00000262441.5:c.960C>T	17.37:g.9764490C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAT3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S173L	ENST00000262441.5	37	c.518	CCDS11150.1	17	.	.	.	.	.	.	.	.	.	.	C	0.233	-1.019612	0.02078	.	.	ENSG00000065325	ENST00000458005	.	.	.	5.24	-10.5	0.00291	.	.	.	.	.	T	0.24275	0.0588	.	.	.	0.19300	N	0.999971	.	.	.	.	.	.	T	0.18304	-1.0341	4	.	.	.	.	7.8231	0.29298	0.1137:0.6089:0.1426:0.1348	.	.	.	.	L	173	.	.	S	+	2	0	GLP2R	9705215	0.000000	0.05858	0.000000	0.03702	0.163000	0.22366	-3.935000	0.00331	-4.256000	0.00061	-1.851000	0.00568	TCG	GLP2R	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	ENSG00000065325		0.502	GLP2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLP2R	HGNC	protein_coding	OTTHUMT00000252601.4	63	0.00	0	C			9764490	9764490	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458005	ensembl	human	putative	69_37n	missense	58	20.55	15	SNP	0.000	T
GPATCH1	55094	genome.wustl.edu	37	19	33602732	33602732	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:33602732C>A	ENST00000170564.2	+	12	2002	c.1688C>A	c.(1687-1689)tCg>tAg	p.S563*		NM_018025.2	NP_060495.2	Q9BRR8	GPTC1_HUMAN	G patch domain containing 1	563					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)	nucleic acid binding (GO:0003676)			breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|prostate(4)|skin(4)	40	Esophageal squamous(110;0.137)					TCTTCCCATTCGACCTTGTCC	0.592																																					Pancreas(67;88 1713 4567 18227)	dbGAP											0													127.0	107.0	114.0					19																	33602732		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF434677	CCDS12428.1	19q13.12	2013-01-28		2006-12-13		ENSG00000076650		"""G patch domain containing"""	24658	protein-coding gene	gene with protein product	"""evolutionarily conserved G patch domain containing"""			GPATC1		12477932	Standard	NM_018025		Approved	ECGP, FLJ10206, FLJ38686	uc002nug.1	Q9BRR8		ENST00000170564.2:c.1688C>A	19.37:g.33602732C>A	ENSP00000170564:p.Ser563*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IZV6|Q8N3B7|Q9NW94	Nonsense_Mutation	SNP	pfam_DUF1604,pfam_G_patch_dom,superfamily_C-type_lectin_fold,pfscan_G_patch_dom	p.S563*	ENST00000170564.2	37	c.1688	CCDS12428.1	19	.	.	.	.	.	.	.	.	.	.	C	41	9.067815	0.99055	.	.	ENSG00000076650	ENST00000170564	.	.	.	5.73	5.73	0.89815	.	0.174883	0.52532	D	0.000063	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.1414	18.9062	0.92462	0.0:1.0:0.0:0.0	.	.	.	.	X	563	.	ENSP00000170564:S563X	S	+	2	0	GPATCH1	38294572	0.997000	0.39634	0.147000	0.22382	0.680000	0.39746	6.729000	0.74775	2.714000	0.92807	0.650000	0.86243	TCG	GPATCH1	-	NULL	ENSG00000076650		0.592	GPATCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPATCH1	HGNC	protein_coding	OTTHUMT00000450834.1	32	0.00	0	C	NM_018025		33602732	33602732	+1	no_errors	ENST00000170564	ensembl	human	known	69_37n	nonsense	39	25.93	14	SNP	0.964	A
GRHL1	29841	genome.wustl.edu	37	2	10126310	10126310	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:10126310G>A	ENST00000324907.9	+	9	1305	c.1169G>A	c.(1168-1170)gGg>gAg	p.G390E	GRHL1_ENST00000324883.5_Missense_Mutation_p.G201E|GRHL1_ENST00000405379.2_Missense_Mutation_p.G390E	NM_198182.2	NP_937825.2	Q9NZI5	GRHL1_HUMAN	grainyhead-like 1 (Drosophila)	390					cellular lipid metabolic process (GO:0044255)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(1)	17	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.172)|OV - Ovarian serous cystadenocarcinoma(76;0.246)		GGAGTGAAGGGGTTGCCTCTT	0.483																																						dbGAP											0													208.0	212.0	211.0					2																	10126310		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF198489	CCDS33144.1, CCDS33144.2	2p25.2	2008-02-05	2005-07-11	2005-07-11	ENSG00000134317	ENSG00000134317			17923	protein-coding gene	gene with protein product		609786	"""transcription factor CP2-like 2"""	TFCP2L2		10644752, 12393799	Standard	NM_198182		Approved	LBP-32, MGR	uc002raa.3	Q9NZI5	OTTHUMG00000151704	ENST00000324907.9:c.1169G>A	2.37:g.10126310G>A	ENSP00000324693:p.Gly390Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLA4|B2R7E4|B5MEC2|Q53T93|Q6NWN7|Q6NWN8|Q6NWN9|Q8NI33	Missense_Mutation	SNP	pfam_CP2	p.G390E	ENST00000324907.9	37	c.1169	CCDS33144.2	2	.	.	.	.	.	.	.	.	.	.	G	32	5.154140	0.94645	.	.	ENSG00000134317	ENST00000405379;ENST00000324883;ENST00000324907	T;T;T	0.62941	-0.01;-0.01;-0.01	5.49	5.49	0.81192	CP2 transcription factor (1);	0.000000	0.85682	D	0.000000	D	0.84334	0.5449	M	0.90922	3.16	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.87592	0.2491	10	0.87932	D	0	-1.7591	19.3675	0.94469	0.0:0.0:1.0:0.0	.	201;390	Q9NZI5-2;Q9NZI5	.;GRHL1_HUMAN	E	390;201;390	ENSP00000384209:G390E;ENSP00000324494:G201E;ENSP00000324693:G390E	ENSP00000324494:G201E	G	+	2	0	GRHL1	10043761	1.000000	0.71417	0.959000	0.39883	0.993000	0.82548	9.869000	0.99810	2.579000	0.87056	0.491000	0.48974	GGG	GRHL1	-	pfam_CP2	ENSG00000134317		0.483	GRHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHL1	HGNC	protein_coding	OTTHUMT00000323543.2	38	0.00	0	G	NM_014552		10126310	10126310	+1	no_errors	ENST00000324907	ensembl	human	known	69_37n	missense	40	27.27	15	SNP	1.000	A
GUCY1A3	2982	genome.wustl.edu	37	4	156634276	156634276	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr4:156634276C>G	ENST00000296518.7	+	7	1322	c.1113C>G	c.(1111-1113)atC>atG	p.I371M	GUCY1A3_ENST00000513574.1_Missense_Mutation_p.I371M|GUCY1A3_ENST00000511108.1_Missense_Mutation_p.I371M|GUCY1A3_ENST00000506455.1_Missense_Mutation_p.I371M|GUCY1A3_ENST00000511507.1_Missense_Mutation_p.I371M|GUCY1A3_ENST00000455639.2_Missense_Mutation_p.I371M|GUCY1A3_ENST00000393832.3_Missense_Mutation_p.I113M			Q02108	GCYA3_HUMAN	guanylate cyclase 1, soluble, alpha 3	371					blood circulation (GO:0008015)|blood coagulation (GO:0007596)|nitric oxide mediated signal transduction (GO:0007263)|positive regulation of cGMP biosynthetic process (GO:0030828)|regulation of blood pressure (GO:0008217)|relaxation of vascular smooth muscle (GO:0060087)|response to defense-related host nitric oxide production (GO:0052565)	guanylate cyclase complex, soluble (GO:0008074)	GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|heme binding (GO:0020037)|receptor activity (GO:0004872)	p.I371M(1)		central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|liver(2)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	all_hematologic(180;0.24)	Renal(120;0.0854)		COAD - Colon adenocarcinoma(41;0.17)		GCCAAATGATCTACATTGTTG	0.423																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											74.0	71.0	72.0					4																	156634276		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34085.1, CCDS54812.1	4q31.3-q33	2008-03-18				ENSG00000164116	4.6.1.2		4685	protein-coding gene	gene with protein product		139396		GUC1A3		1352257	Standard	NM_001130687		Approved	GC-SA3	uc003iow.3	Q02108		ENST00000296518.7:c.1113C>G	4.37:g.156634276C>G	ENSP00000296518:p.Ile371Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP19|D6RDW3|O43843|Q8TAH3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Haem_no_assoc-bd,pfam_Heme_NO-bd,superfamily_A/G_cyclase,superfamily_NO_sig/Golgi_transp_ligand-bd,smart_A/G_cyclase,pfscan_A/G_cyclase	p.I371M	ENST00000296518.7	37	c.1113	CCDS34085.1	4	.	.	.	.	.	.	.	.	.	.	C	16.49	3.139073	0.56936	.	.	ENSG00000164116	ENST00000506455;ENST00000511108;ENST00000511507;ENST00000455639;ENST00000393832;ENST00000296518;ENST00000513574	D;D;D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38;-2.38;-2.38	6.03	4.3	0.51218	Haem NO binding associated (1);	0.182663	0.38381	N	0.001717	D	0.91882	0.7430	L	0.54908	1.71	0.53688	D	0.999976	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.89802	0.3976	10	0.33940	T	0.23	.	11.9418	0.52905	0.0:0.812:0.1227:0.0653	.	371;371	B3KU69;Q02108	.;GCYA3_HUMAN	M	371;371;371;371;113;371;371	ENSP00000424361:I371M;ENSP00000421493:I371M;ENSP00000426968:I371M;ENSP00000412201:I371M;ENSP00000377418:I113M;ENSP00000296518:I371M;ENSP00000426040:I371M	ENSP00000296518:I371M	I	+	3	3	GUCY1A3	156853726	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.300000	0.43620	0.871000	0.35750	-0.175000	0.13238	ATC	GUCY1A3	-	pfam_Haem_no_assoc-bd	ENSG00000164116		0.423	GUCY1A3-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GUCY1A3	HGNC	protein_coding	OTTHUMT00000365786.2	32	0.00	0	C			156634276	156634276	+1	no_errors	ENST00000296518	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	1.000	G
HIST1H2BK	85236	genome.wustl.edu	37	6	27114571	27114571	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:27114571C>T	ENST00000356950.1	-	1	6	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	MIR3143_ENST00000584253.1_RNA|HIST1H2BK_ENST00000396891.4_Missense_Mutation_p.E3K|HIST1H2AH_ENST00000377459.1_5'Flank			O60814	H2B1K_HUMAN	histone cluster 1, H2bk	3					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(1)|skin(1)	13						TTCGCTGGTTCCGGCATGTTG	0.567																																						dbGAP											0													50.0	50.0	50.0					6																	27114571		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223352	CCDS4621.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000197903	ENSG00000197903		"""Histones / Replication-dependent"""	13954	protein-coding gene	gene with protein product		615045	"""H2B histone family, member T"", ""histone 1, H2bk"""	H2BFT		12408966	Standard	NM_080593		Approved	H2BFAiii	uc003nix.2	O60814	OTTHUMG00000014473	ENST00000356950.1:c.7G>A	6.37:g.27114571C>T	ENSP00000349430:p.Glu3Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P7|Q2VPI7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E3K	ENST00000356950.1	37	c.7	CCDS4621.1	6	.	.	.	.	.	.	.	.	.	.	C	24.8	4.574787	0.86542	.	.	ENSG00000197903	ENST00000396891;ENST00000356950	T;T	0.17691	2.26;2.26	4.05	4.05	0.47172	.	.	.	.	.	T	0.13030	0.0316	M	0.77820	2.39	0.45676	D	0.998591	B	0.28760	0.221	B	0.22601	0.04	T	0.04128	-1.0975	9	0.56958	D	0.05	.	14.5252	0.67884	0.0:1.0:0.0:0.0	.	3	O60814	H2B1K_HUMAN	K	3	ENSP00000380100:E3K;ENSP00000349430:E3K	ENSP00000349430:E3K	E	-	1	0	HIST1H2BK	27222550	1.000000	0.71417	0.427000	0.26684	0.054000	0.15201	6.688000	0.74557	2.196000	0.70406	0.650000	0.86243	GAA	HIST1H2BK	-	NULL	ENSG00000197903		0.567	HIST1H2BK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BK	HGNC	protein_coding	OTTHUMT00000040141.1	41	0.00	0	C	NM_080593		27114571	27114571	-1	no_errors	ENST00000356950	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	0.998	T
HOMER2	9455	genome.wustl.edu	37	15	83523419	83523419	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr15:83523419C>T	ENST00000304231.8	-	6	853	c.661G>A	c.(661-663)Gag>Aag	p.E221K	HOMER2_ENST00000399166.2_Intron|HOMER2_ENST00000450735.2_Missense_Mutation_p.E210K|HOMER2_ENST00000426485.1_Intron	NM_199330.2	NP_955362.1	Q9NSB8	HOME2_HUMAN	homer homolog 2 (Drosophila)	221					behavioral response to cocaine (GO:0048148)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|chemical homeostasis within a tissue (GO:0048875)|G-protein coupled glutamate receptor signaling pathway (GO:0007216)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				cervix(1)|endometrium(2)|lung(6)	9						CGGTCATTCTCATCACGGCAG	0.622																																						dbGAP											0													48.0	53.0	51.0					15																	83523419		2170	4272	6442	-	-	-	SO:0001583	missense	0			AF093264	CCDS45334.1, CCDS45336.1	15q24.3	2008-02-05				ENSG00000103942			17513	protein-coding gene	gene with protein product		604799				9808459, 9808458	Standard	NM_199330		Approved	CPD, Cupidin, Vesl-2, HOMER-2B, HOMER-2, HOMER-2A	uc002bjg.3	Q9NSB8		ENST00000304231.8:c.661G>A	15.37:g.83523419C>T	ENSP00000305632:p.Glu221Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95269|O95349|Q9NSB6|Q9NSB7|Q9UNT7	Missense_Mutation	SNP	pfam_EVH1,smart_EVH1,pfscan_EVH1	p.E221K	ENST00000304231.8	37	c.661	CCDS45334.1	15	.	.	.	.	.	.	.	.	.	.	C	20.2	3.952287	0.73787	.	.	ENSG00000103942	ENST00000304231;ENST00000450735	T;T	0.78003	1.56;-1.14	5.73	4.81	0.61882	.	0.000000	0.85682	D	0.000000	D	0.88948	0.6576	M	0.86502	2.82	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.90342	0.4360	10	0.59425	D	0.04	.	14.0242	0.64575	0.0:0.9275:0.0:0.0725	.	210;221	Q9NSB8-2;Q9NSB8	.;HOME2_HUMAN	K	221;210	ENSP00000305632:E221K;ENSP00000407634:E210K	ENSP00000305632:E221K	E	-	1	0	HOMER2	81320473	1.000000	0.71417	0.863000	0.33907	0.107000	0.19398	7.378000	0.79679	1.431000	0.47355	0.655000	0.94253	GAG	HOMER2	-	NULL	ENSG00000103942		0.622	HOMER2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HOMER2	HGNC	protein_coding	OTTHUMT00000418689.1	24	0.00	0	C			83523419	83523419	-1	no_errors	ENST00000304231	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	0.998	T
HOXA6	3203	genome.wustl.edu	37	7	27186870	27186870	+	Intron	SNP	T	T	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:27186870T>C	ENST00000222728.3	-	1	467				RP1-170O19.23_ENST00000498652.1_RNA|HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS3_ENST00000521197.1_RNA|HOXA-AS3_ENST00000521231.1_RNA|HOXA-AS3_ENST00000518947.2_RNA|RP1-170O19.22_ENST00000467897.2_RNA|HOXA-AS3_ENST00000524304.1_RNA|HOXA6_ENST00000521478.1_Intron	NM_024014.3	NP_076919.1	P31267	HXA6_HUMAN	homeobox A6						anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(5)|lung(3)|ovary(1)	10						cctccttctttctttctttTC	0.453																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS5407.1	7p15.2	2011-06-20	2005-12-22		ENSG00000106006	ENSG00000106006		"""Homeoboxes / ANTP class : HOXL subclass"""	5107	protein-coding gene	gene with protein product		142951	"""homeo box A6"""	HOX1B, HOX1		1973146, 1358459	Standard	NM_024014		Approved		uc003syo.2	P31267	OTTHUMG00000023216	ENST00000222728.3:c.442+56A>G	7.37:g.27186870T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D192|Q2M3G3|Q9UPM0	RNA	SNP	-	NULL	ENST00000222728.3	37	NULL	CCDS5407.1	7																																																																																			HOXA-AS3	-	-	ENSG00000254369		0.453	HOXA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA-AS3	HGNC	protein_coding	OTTHUMT00000358697.1	15	0.00	0	T			27186870	27186870	+1	no_errors	ENST00000518947	ensembl	human	known	69_37n	rna	30	33.33	15	SNP	0.993	C
HOXC6	3223	genome.wustl.edu	37	12	54422706	54422709	+	Splice_Site	DEL	GTGA	GTGA	-			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	GTGA	GTGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr12:54422706_54422709delGTGA	ENST00000243108.4	+	1	564		c.e1+1		RP11-834C11.12_ENST00000513209.1_Intron|HOXC4_ENST00000303406.4_Intron|RP11-834C11.14_ENST00000512206.1_RNA|HOXC6_ENST00000394331.3_Splice_Site	NM_004503.3	NP_004494.1	P09630	HXC6_HUMAN	homeobox C6						anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|multicellular organismal development (GO:0007275)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TCGCACAGTGGTGAGTTTTACAGC	0.475																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS8871.1, CCDS41792.1	12q13.13	2011-06-20	2005-12-22		ENSG00000197757	ENSG00000197757		"""Homeoboxes / ANTP class : HOXL subclass"""	5128	protein-coding gene	gene with protein product		142972	"""homeo box C6"""	HOX3C, HOX3		1973146, 1358459	Standard	NM_153693		Approved		uc001sev.3	P09630	OTTHUMG00000160027	ENST00000243108.4:c.400+1GTGA>-	12.37:g.54422706_54422709delGTGA		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV2|Q6DK09	Frame_Shift_Del	DEL	NULL	p.G52fs	ENST00000243108.4	37	c.155	CCDS8871.1	12																																																																																			HOXC6	-	NULL	ENSG00000197757		0.475	HOXC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC6	HGNC	protein_coding	OTTHUMT00000358943.2	18	0.00	0	GTGA		Intron	54422706	54422709	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000504315	ensembl	human	known	69_37n	frame_shift_del	14	40.00	10	DEL	1.000	-
HSP90AB1	3326	genome.wustl.edu	37	6	44219554	44219554	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:44219554G>A	ENST00000371554.1	+	9	1609	c.1395G>A	c.(1393-1395)gaG>gaA	p.E465E	HSP90AB1_ENST00000371646.5_Silent_p.E465E|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000495706.1_5'Flank|HSP90AB1_ENST00000353801.3_Silent_p.E465E			P08238	HS90B_HUMAN	heat shock protein 90kDa alpha (cytosolic), class B member 1	465					axon guidance (GO:0007411)|cellular response to interleukin-4 (GO:0071353)|cellular response to organic cyclic compound (GO:0071407)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|placenta development (GO:0001890)|positive regulation of cell size (GO:0045793)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein binding (GO:0032092)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein folding (GO:0006457)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to salt stress (GO:0009651)|response to unfolded protein (GO:0006986)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|CTP binding (GO:0002135)|dATP binding (GO:0032564)|double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|MHC class II protein complex binding (GO:0023026)|nitric-oxide synthase regulator activity (GO:0030235)|poly(A) RNA binding (GO:0044822)|TPR domain binding (GO:0030911)|UTP binding (GO:0002134)			NS(1)|breast(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(12)|prostate(2)|skin(2)|urinary_tract(2)	33	all_cancers(18;1.7e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CTGGAGATGAGATGACATCTC	0.507																																						dbGAP											0													117.0	115.0	116.0					6																	44219554		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF275719	CCDS4909.1	6p12	2011-09-02	2006-02-24	2006-02-24	ENSG00000096384	ENSG00000096384		"""Heat shock proteins / HSPC"""	5258	protein-coding gene	gene with protein product		140572	"""heat shock 90kD protein 1, beta"", ""heat shock 90kDa protein 1, beta"""	HSPC2, HSPCB		2768249, 16269234	Standard	NM_001271969		Approved		uc031sor.1	P08238	OTTHUMG00000014761	ENST00000371554.1:c.1395G>A	6.37:g.44219554G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5P0|Q5T9W7|Q9NQW0|Q9NTK6	Missense_Mutation	SNP	pfam_Hsp90,superfamily_Ribosomal_S5_D2-typ_fold	p.R91K	ENST00000371554.1	37	c.272	CCDS4909.1	6	.	.	.	.	.	.	.	.	.	.	G	9.627	1.135456	0.21123	.	.	ENSG00000096384	ENST00000435812;ENST00000415133;ENST00000428822	.	.	.	4.84	3.89	0.44902	.	.	.	.	.	T	0.49864	0.1582	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49615	-0.8921	4	.	.	.	-20.6023	11.5299	0.50601	0.0974:0.0:0.9026:0.0	.	.	.	.	K	91	.	.	R	+	2	0	HSP90AB1	44327532	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.796000	0.47869	0.912000	0.36772	0.650000	0.86243	AGA	HSP90AB1	-	pfam_Hsp90,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000096384		0.507	HSP90AB1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HSP90AB1	HGNC	protein_coding	OTTHUMT00000040730.1	51	0.00	0	G	NM_007355		44219554	44219554	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000435812	ensembl	human	known	69_37n	missense	31	53.73	36	SNP	1.000	A
ICK	22858	genome.wustl.edu	37	6	52876589	52876589	+	Silent	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:52876589C>T	ENST00000350082.5	-	11	1816	c.1470G>A	c.(1468-1470)ttG>ttA	p.L490L	ICK_ENST00000356971.3_Silent_p.L490L	NM_014920.3	NP_055735.1	Q9UPZ9	ICK_HUMAN	intestinal cell (MAK-like) kinase	490					intracellular signal transduction (GO:0035556)|multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(3)|stomach(1)	31	Lung NSC(77;0.103)					GAGAGTGCTTCAAATAGTGCT	0.478																																						dbGAP											0													115.0	119.0	117.0					6																	52876589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023153	CCDS4949.1	6p12.3-p11.2	2008-02-05			ENSG00000112144	ENSG00000112144			21219	protein-coding gene	gene with protein product		612325				12103360	Standard	NM_014920		Approved	MRK, LCK2, KIAA0936, MGC46090	uc003pbi.2	Q9UPZ9	OTTHUMG00000014870	ENST00000350082.5:c.1470G>A	6.37:g.52876589C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD41|O75985|Q5THL2|Q8IYH8|Q9BX17|Q9NYX3	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L490	ENST00000350082.5	37	c.1470	CCDS4949.1	6																																																																																			ICK	-	NULL	ENSG00000112144		0.478	ICK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICK	HGNC	protein_coding	OTTHUMT00000040952.1	27	0.00	0	C	NM_016513		52876589	52876589	-1	no_errors	ENST00000350082	ensembl	human	known	69_37n	silent	33	21.43	9	SNP	1.000	T
ILF3	3609	genome.wustl.edu	37	19	10795141	10795141	+	Intron	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:10795141G>C	ENST00000590261.1	+	16	2059				ILF3_ENST00000407004.3_Nonstop_Mutation_p.*707Y|ILF3_ENST00000420083.1_Intron|ILF3_ENST00000588657.1_Intron|ILF3_ENST00000589998.1_Nonstop_Mutation_p.*703Y|ILF3_ENST00000250241.8_Intron|ILF3_ENST00000449870.1_Intron|ILF3_ENST00000592763.1_3'UTR|ILF3_ENST00000318511.3_Intron			Q12906	ILF3_HUMAN	interleukin enhancer binding factor 3, 90kDa						defense response to virus (GO:0051607)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|negative regulation of viral genome replication (GO:0045071)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31			Epithelial(33;6.86e-06)|all cancers(31;1.65e-05)			GGTCTTCCTAGAGCGTCTAAA	0.423																																						dbGAP											0													114.0	112.0	113.0					19																	10795141		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U10324	CCDS12246.1, CCDS12247.1, CCDS45965.1, CCDS45966.1, CCDS45967.1	19p13.2	2012-08-10	2002-08-29		ENSG00000129351	ENSG00000129351			6038	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 4"""	603182	"""interleukin enhancer binding factor 3, 90kD"""			7519613, 8885239	Standard	NM_012218		Approved	NF90, MPHOSPH4, MPP4, DRBP76, NFAR-1	uc002mpo.3	Q12906		ENST00000590261.1:c.2059+495G>C	19.37:g.10795141G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F2|G5E9M5|O43409|Q6P1X1|Q86XY7|Q99544|Q99545|Q9BZH4|Q9BZH5|Q9NQ95|Q9NQ96|Q9NQ97|Q9NQ98|Q9NQ99|Q9NQA0|Q9NQA1|Q9NQA2|Q9NRN2|Q9NRN3|Q9NRN4|Q9UMZ9|Q9UN00|Q9UN84|Q9UNA2	Nonstop_Mutation	SNP	pfam_DZF,pfam_Ds-RNA-bd,smart_DZF,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd	p.*707Y	ENST00000590261.1	37	c.2121	CCDS12246.1	19	.	.	.	.	.	.	.	.	.	.	G	14.39	2.520634	0.44866	.	.	ENSG00000129351	ENST00000407004;ENST00000250241	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1451	0.93461	0.0:0.0:1.0:0.0	.	.	.	.	Y	707;703	.	.	X	+	3	2	ILF3	10656141	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.315000	0.65810	2.820000	0.97059	0.650000	0.86243	TAG	ILF3	-	NULL	ENSG00000129351		0.423	ILF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF3	HGNC	protein_coding	OTTHUMT00000452074.1	62	0.00	0	G			10795141	10795141	+1	no_errors	ENST00000407004	ensembl	human	known	69_37n	nonstop	90	29.13	37	SNP	1.000	C
IFNL3	282617	genome.wustl.edu	37	19	39734335	39734335	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:39734335G>A	ENST00000413851.2	-	5	566	c.528C>T	c.(526-528)ttC>ttT	p.F176F		NM_172139.2	NP_742151.2	Q8IZI9	IFNL3_HUMAN	interferon, lambda 3	176					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of viral genome replication (GO:0045071)|positive regulation of immune response (GO:0050778)	extracellular space (GO:0005615)											GGAAGAGGTTGAAGGTGACAG	0.602																																						dbGAP											0													30.0	30.0	30.0					19																	39734335		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AY129149	CCDS12530.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000197110	ENSG00000197110		"""Interferons"""	18365	protein-coding gene	gene with protein product		607402	"""interleukin 28B"", ""interleukin 28B (interferon, lambda 3)"""	IL28B			Standard	NM_172139		Approved	IL-28B, IL28C	uc010xut.2	Q8IZI9	OTTHUMG00000182805	ENST00000413851.2:c.528C>T	19.37:g.39734335G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDE1|Q6VN56|Q7Z4J3|Q8IWL6	Silent	SNP	NULL	p.F176	ENST00000413851.2	37	c.528	CCDS12530.1	19																																																																																			IL28B	-	NULL	ENSG00000197110		0.602	IFNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL28B	HGNC	protein_coding	OTTHUMT00000463832.1	58	0.00	0	G	NM_172139		39734335	39734335	-1	no_errors	ENST00000413851	ensembl	human	known	69_37n	silent	51	27.14	19	SNP	0.997	A
IQGAP2	10788	genome.wustl.edu	37	5	75969810	75969810	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr5:75969810G>A	ENST00000274364.6	+	26	3540	c.3243G>A	c.(3241-3243)aaG>aaA	p.K1081K	IQGAP2_ENST00000396234.3_Silent_p.K577K|IQGAP2_ENST00000379730.3_Silent_p.K583K|IQGAP2_ENST00000502745.1_Silent_p.K577K	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	1081	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		AAGTACTGAAGAATTCGATCC	0.378																																						dbGAP											0													106.0	104.0	104.0					5																	75969810		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.3243G>A	5.37:g.75969810G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V1|B7Z8A4|J3KR91	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.K1081	ENST00000274364.6	37	c.3243	CCDS34188.1	5																																																																																			IQGAP2	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000145703		0.378	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	47	0.00	0	G	NM_006633		75969810	75969810	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	silent	54	31.65	25	SNP	1.000	A
KCND3	3752	genome.wustl.edu	37	1	112329593	112329593	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:112329593C>G	ENST00000315987.2	-	3	1721	c.1242G>C	c.(1240-1242)caG>caC	p.Q414H	KCND3_ENST00000302127.4_Missense_Mutation_p.Q414H|KCND3_ENST00000369697.1_Missense_Mutation_p.Q414H	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	414					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TATCAGCTCTCTGATTCTGGT	0.557																																						dbGAP											0													140.0	125.0	130.0					1																	112329593		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.1242G>C	1.37:g.112329593C>G	ENSP00000319591:p.Gln414His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.3,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.Q414H	ENST00000315987.2	37	c.1242	CCDS843.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986038	0.74589	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.97352	-4.34;-4.35;-4.34	4.84	3.92	0.45320	.	0.000000	0.85682	D	0.000000	D	0.97551	0.9198	M	0.78456	2.415	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.97842	1.0269	10	0.72032	D	0.01	.	10.4183	0.44335	0.0:0.8381:0.0:0.1619	.	414;414	Q14D71;Q9UK17	.;KCND3_HUMAN	H	414	ENSP00000358711:Q414H;ENSP00000319591:Q414H;ENSP00000306923:Q414H	ENSP00000306923:Q414H	Q	-	3	2	KCND3	112131116	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.099000	0.57755	1.171000	0.42768	-0.258000	0.10820	CAG	KCND3	-	prints_K_chnl_volt-dep_Kv4	ENSG00000171385		0.557	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	HGNC	protein_coding	OTTHUMT00000033144.1	33	0.00	0	C	NM_172198		112329593	112329593	-1	no_errors	ENST00000315987	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	1.000	G
KCTD19	146212	genome.wustl.edu	37	16	67325347	67325347	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr16:67325347G>C	ENST00000304372.5	-	14	2485	c.2430C>G	c.(2428-2430)ttC>ttG	p.F810L		NM_001100915.1	NP_001094385.1	Q17RG1	KCD19_HUMAN	potassium channel tetramerization domain containing 19	810					protein homooligomerization (GO:0051260)					endometrium(3)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)	23		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0311)|Epithelial(162;0.0906)		AGGACAGAGAGAAACTCAGGA	0.502																																						dbGAP											0													54.0	54.0	54.0					16																	67325347		1957	4145	6102	-	-	-	SO:0001583	missense	0			AK097481	CCDS42179.1	16q22.1	2013-06-20	2013-06-20			ENSG00000168676			24753	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 19"""				Standard	NM_001100915		Approved	FLJ40162	uc002esu.2	Q17RG1		ENST00000304372.5:c.2430C>G	16.37:g.67325347G>C	ENSP00000305702:p.Phe810Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ49|Q8N804	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold	p.F810L	ENST00000304372.5	37	c.2430	CCDS42179.1	16	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287558	0.40494	.	.	ENSG00000168676	ENST00000304372	T	0.55052	0.54	5.63	5.63	0.86233	.	0.000000	0.64402	D	0.000019	T	0.34571	0.0902	N	0.14661	0.345	0.34978	D	0.753845	B	0.06786	0.001	B	0.04013	0.001	T	0.39663	-0.9603	10	0.39692	T	0.17	-13.4631	10.7131	0.45995	0.087:0.0:0.913:0.0	.	810	Q17RG1	KCD19_HUMAN	L	810	ENSP00000305702:F810L	ENSP00000305702:F810L	F	-	3	2	KCTD19	65882848	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.997000	0.40786	2.671000	0.90904	0.455000	0.32223	TTC	KCTD19	-	NULL	ENSG00000168676		0.502	KCTD19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD19	HGNC	protein_coding	OTTHUMT00000422061.1	31	0.00	0	G	XM_085367		67325347	67325347	-1	no_errors	ENST00000304372	ensembl	human	known	69_37n	missense	26	40.91	18	SNP	1.000	C
KDM2A	22992	genome.wustl.edu	37	11	66999259	66999259	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:66999259G>A	ENST00000529006.2	+	12	1753	c.1307G>A	c.(1306-1308)gGa>gAa	p.G436E	KDM2A_ENST00000398645.2_Missense_Mutation_p.G436E|KDM2A_ENST00000526258.1_3'UTR	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	436					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						TCCCACAATGGACAAGTGTGG	0.522																																						dbGAP											0													81.0	81.0	81.0					11																	66999259		1925	4116	6041	-	-	-	SO:0001583	missense	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.1307G>A	11.37:g.66999259G>A	ENSP00000432786:p.Gly436Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.G436E	ENST00000529006.2	37	c.1307	CCDS44657.1	11	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322336	0.23994	.	.	ENSG00000173120	ENST00000398645;ENST00000529006	T;T	0.38887	1.11;1.11	5.52	5.52	0.82312	.	0.702878	0.14241	N	0.332053	T	0.26412	0.0645	N	0.14661	0.345	0.80722	D	1	B	0.14438	0.01	B	0.12156	0.007	T	0.05954	-1.0854	10	0.02654	T	1	-18.0973	16.9512	0.86246	0.0:0.0:1.0:0.0	.	436	Q9Y2K7	KDM2A_HUMAN	E	436	ENSP00000381640:G436E;ENSP00000432786:G436E	ENSP00000381640:G436E	G	+	2	0	KDM2A	66755835	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.597000	0.61062	2.761000	0.94854	0.643000	0.83706	GGA	KDM2A	-	NULL	ENSG00000173120		0.522	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	26	0.00	0	G	NM_012308		66999259	66999259	+1	no_errors	ENST00000529006	ensembl	human	known	69_37n	missense	39	32.76	19	SNP	1.000	A
KIAA1324	57535	genome.wustl.edu	37	1	109743374	109743374	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:109743374C>G	ENST00000369939.3	+	21	3008	c.2825C>G	c.(2824-2826)tCc>tGc	p.S942C	KIAA1324_ENST00000369938.1_3'UTR|KIAA1324_ENST00000529753.1_Missense_Mutation_p.S855C	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	942					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)	p.S942F(1)		NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		TACAAGTACTCCAAGCTGGTG	0.483											OREG0013630	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - Missense(1)	lung(1)											97.0	89.0	92.0					1																	109743374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.2825C>G	1.37:g.109743374C>G	ENSP00000358955:p.Ser942Cys	Somatic	1422	WXS	Illumina GAIIx	Phase_IV	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt	p.S942C	ENST00000369939.3	37	c.2825	CCDS794.1	1	.	.	.	.	.	.	.	.	.	.	C	28.0	4.879596	0.91740	.	.	ENSG00000116299	ENST00000369939;ENST00000457623;ENST00000529753	T;T;T	0.15718	2.61;2.4;2.61	5.84	5.84	0.93424	.	0.000000	0.85682	D	0.000000	T	0.37892	0.1020	M	0.74881	2.28	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.10086	-1.0645	10	0.66056	D	0.02	-26.9636	18.9226	0.92530	0.0:1.0:0.0:0.0	.	942;855;942;942	Q6UXG2-4;Q6UXG2-3;C9J810;Q6UXG2	.;.;.;K1324_HUMAN	C	942;892;855	ENSP00000358955:S942C;ENSP00000393964:S892C;ENSP00000434595:S855C	ENSP00000358955:S942C	S	+	2	0	KIAA1324	109544897	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.713000	0.84693	2.778000	0.95560	0.655000	0.94253	TCC	KIAA1324	-	NULL	ENSG00000116299		0.483	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1324	HGNC	protein_coding	OTTHUMT00000032389.2	30	0.00	0	C	NM_020775		109743374	109743374	+1	no_errors	ENST00000369939	ensembl	human	known	69_37n	missense	46	29.23	19	SNP	1.000	G
KIAA2018	205717	genome.wustl.edu	37	3	113379916	113379916	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:113379916C>G	ENST00000478658.1	-	5	630	c.613G>C	c.(613-615)Gaa>Caa	p.E205Q	KIAA2018_ENST00000316407.4_Missense_Mutation_p.E205Q|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	205						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						GGCTTGTTTTCAGAAGGGTAA	0.458																																						dbGAP											0													86.0	89.0	88.0					3																	113379916		1928	4144	6072	-	-	-	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.613G>C	3.37:g.113379916C>G	ENSP00000420721:p.Glu205Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.E205Q	ENST00000478658.1	37	c.613	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	C	17.51	3.408618	0.62399	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.18657	2.2;2.2	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000015	T	0.36635	0.0974	L	0.27053	0.805	0.46437	D	0.999045	D	0.89917	1.0	D	0.69307	0.963	T	0.07654	-1.0761	10	0.72032	D	0.01	-8.5191	20.3854	0.98941	0.0:1.0:0.0:0.0	.	205	Q68DE3	K2018_HUMAN	Q	205	ENSP00000320794:E205Q;ENSP00000420721:E205Q	ENSP00000320794:E205Q	E	-	1	0	KIAA2018	114862606	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.343000	0.59348	2.825000	0.97269	0.655000	0.94253	GAA	KIAA2018	-	NULL	ENSG00000176542		0.458	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	56	0.00	0	C	NM_001009899		113379916	113379916	-1	no_errors	ENST00000316407	ensembl	human	known	69_37n	missense	90	24.37	29	SNP	1.000	G
LDHC	3948	genome.wustl.edu	37	11	18434280	18434280	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:18434280G>C	ENST00000541669.1	+	2	127	c.16G>C	c.(16-18)Gag>Cag	p.E6Q	LDHC_ENST00000536880.1_Missense_Mutation_p.E6Q|LDHC_ENST00000280704.4_Missense_Mutation_p.E6Q|LDHC_ENST00000546146.1_Missense_Mutation_p.E6Q|LDHC_ENST00000535809.1_Missense_Mutation_p.E6Q|LDHC_ENST00000537486.1_Missense_Mutation_p.E6Q|LDHC_ENST00000544105.1_Missense_Mutation_p.E6Q			P07864	LDHC_HUMAN	lactate dehydrogenase C	6					ATP biosynthetic process (GO:0006754)|cellular carbohydrate metabolic process (GO:0044262)|lactate biosynthetic process from pyruvate (GO:0019244)|lactate oxidation (GO:0019516)|sperm motility (GO:0030317)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|motile cilium (GO:0031514)|nucleus (GO:0005634)	L-lactate dehydrogenase activity (GO:0004459)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						AACTGTCAAGGAGCAGCTAAT	0.393																																						dbGAP											0													133.0	129.0	130.0					11																	18434280		2199	4293	6492	-	-	-	SO:0001583	missense	0			AY286300	CCDS7840.1	11p15.1	2012-10-02			ENSG00000166796	ENSG00000166796	1.1.1.27		6544	protein-coding gene	gene with protein product	"""cancer/testis antigen 32"""	150150					Standard	NM_002301		Approved	CT32	uc001mom.4	P07864	OTTHUMG00000167722	ENST00000541669.1:c.16G>C	11.37:g.18434280G>C	ENSP00000437783:p.Glu6Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQY4|Q6GSG8|Q7Z7J4	Missense_Mutation	SNP	pfam_Lactate/malate_DH_N,pfam_Lactate/malate_DH_C,superfamily_Lactate_DH/Glyco_Ohase_4_C,pirsf_L-lactate/malate_DH,prints_L-lactate/malate_DH,tigrfam_L-lactate_DH	p.E6Q	ENST00000541669.1	37	c.16	CCDS7840.1	11	.	.	.	.	.	.	.	.	.	.	G	12.43	1.935676	0.34189	.	.	ENSG00000166796	ENST00000541669;ENST00000280704;ENST00000546146;ENST00000536880;ENST00000537486;ENST00000544105;ENST00000535809	D;D;D;D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72;-2.72;-2.72;-2.72	5.38	4.45	0.53987	NAD(P)-binding domain (1);	0.117651	0.56097	D	0.000026	D	0.82314	0.5010	L	0.28556	0.865	0.45250	D	0.998251	B;B	0.28350	0.006;0.208	B;B	0.19148	0.024;0.022	T	0.77935	-0.2401	10	0.31617	T	0.26	-24.1607	10.1274	0.42658	0.0914:0.0:0.9086:0.0	.	6;6	G3XAP5;P07864	.;LDHC_HUMAN	Q	6	ENSP00000437783:E6Q;ENSP00000280704:E6Q;ENSP00000443414:E6Q;ENSP00000439555:E6Q;ENSP00000441478:E6Q;ENSP00000439060:E6Q;ENSP00000443997:E6Q	ENSP00000280704:E6Q	E	+	1	0	LDHC	18390856	1.000000	0.71417	1.000000	0.80357	0.606000	0.37113	3.200000	0.51051	2.793000	0.96121	0.655000	0.94253	GAG	LDHC	-	NULL	ENSG00000166796		0.393	LDHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LDHC	HGNC	protein_coding	OTTHUMT00000395892.1	46	0.00	0	G	NM_017448		18434280	18434280	+1	no_errors	ENST00000280704	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	1.000	C
LIG1	3978	genome.wustl.edu	37	19	48653045	48653045	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:48653045G>C	ENST00000263274.7	-	9	1170	c.751C>G	c.(751-753)Cca>Gca	p.P251A	LIG1_ENST00000599165.1_5'Flank|CTC-453G23.4_ENST00000594589.1_RNA|LIG1_ENST00000536218.1_Missense_Mutation_p.P183A|LIG1_ENST00000427526.2_Missense_Mutation_p.P220A	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	251					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	TCCTTTCCTGGAGCCCCTGGC	0.562								Nucleotide excision repair (NER)																														dbGAP											0													66.0	56.0	59.0					19																	48653045		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.751C>G	19.37:g.48653045G>C	ENSP00000263274:p.Pro251Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAI8|Q2TB12|Q32P23	Missense_Mutation	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_ATP-dep_C,superfamily_DNA_ligase_ATP-dep_N,superfamily_NA-bd_OB-fold-like,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.P251A	ENST00000263274.7	37	c.751	CCDS12711.1	19	.	.	.	.	.	.	.	.	.	.	G	0.748	-0.773878	0.02951	.	.	ENSG00000105486	ENST00000263274;ENST00000544761;ENST00000427526;ENST00000536218;ENST00000542460	T;T;T;T	0.56444	0.56;0.46;0.51;3.03	3.89	0.367	0.16140	.	2.062450	0.01990	N	0.045436	T	0.39226	0.1070	L	0.36672	1.1	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.0;0.001;0.0	T	0.12268	-1.0554	10	0.07325	T	0.83	0.4394	5.9989	0.19509	0.1119:0.4221:0.4659:0.0	.	220;183;251	B4DTU4;F5GZ28;P18858	.;.;DNLI1_HUMAN	A	251;282;220;183;219	ENSP00000263274:P251A;ENSP00000442841:P220A;ENSP00000441531:P183A;ENSP00000445928:P219A	ENSP00000263274:P251A	P	-	1	0	LIG1	53344857	0.001000	0.12720	0.000000	0.03702	0.016000	0.09150	0.598000	0.24074	0.191000	0.20236	0.462000	0.41574	CCA	LIG1	-	NULL	ENSG00000105486		0.562	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	HGNC	protein_coding	OTTHUMT00000465575.1	38	0.00	0	G	NM_000234		48653045	48653045	-1	no_errors	ENST00000263274	ensembl	human	known	69_37n	missense	33	42.11	24	SNP	0.000	C
LILRA4	23547	genome.wustl.edu	37	19	54848304	54848304	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:54848304G>A	ENST00000291759.4	-	6	1119	c.1063C>T	c.(1063-1065)Ctg>Ttg	p.L355L	AC008984.2_ENST00000507363.1_RNA	NM_012276.3	NP_036408.3	P59901	LIRA4_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 4	355	Ig-like C2-type 4.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	32	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0565)		TCCTTGGTCAGAAGGAAAGTG	0.587																																						dbGAP											0													127.0	120.0	123.0					19																	54848304		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF041261	CCDS12890.1	19q13.4	2013-01-11			ENSG00000239961	ENSG00000239961		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	15503	protein-coding gene	gene with protein product		607517				10941842	Standard	NM_012276		Approved	ILT7, CD85g	uc002qfj.3	P59901	OTTHUMG00000065355	ENST00000291759.4:c.1063C>T	19.37:g.54848304G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32MC4	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.L355	ENST00000291759.4	37	c.1063	CCDS12890.1	19																																																																																			LILRA4	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	ENSG00000239961		0.587	LILRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LILRA4	HGNC	protein_coding	OTTHUMT00000140229.2	63	0.00	0	G	NM_012276		54848304	54848304	-1	no_errors	ENST00000291759	ensembl	human	known	69_37n	silent	51	30.14	22	SNP	0.154	A
LOXHD1	125336	genome.wustl.edu	37	18	44125353	44125353	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr18:44125353C>G	ENST00000398722.4	-	16	2711	c.2712G>C	c.(2710-2712)aaG>aaC	p.K904N	LOXHD1_ENST00000300591.6_Missense_Mutation_p.K71N|LOXHD1_ENST00000441551.2_Missense_Mutation_p.K976N|LOXHD1_ENST00000441893.2_Missense_Mutation_p.K115N|LOXHD1_ENST00000582408.1_Missense_Mutation_p.K71N|LOXHD1_ENST00000536736.1_Missense_Mutation_p.K1182N|LOXHD1_ENST00000579038.1_5'UTR			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	904	PLAT 7. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TAACCCCAGTCTTTATGGTCA	0.433																																						dbGAP											0													263.0	209.0	225.0					18																	44125353		692	1591	2283	-	-	-	SO:0001583	missense	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.2712G>C	18.37:g.44125353C>G	ENSP00000381707:p.Lys904Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Missense_Mutation	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.K1182N	ENST00000398722.4	37	c.3546		18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.86|12.86	2.064882|2.064882	0.36470|0.36470	.|.	.|.	ENSG00000167210|ENSG00000167210	ENST00000441551|ENST00000300591;ENST00000398722;ENST00000536736;ENST00000441893;ENST00000335730;ENST00000536111;ENST00000420097	.|T;T;T;T;T	.|0.66815	.|-0.23;-0.23;-0.23;-0.23;-0.23	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.208574	.|0.49916	.|D	.|0.000132	T|T	0.79528|0.79528	0.4461|0.4461	M|M	0.78223|0.78223	2.4|2.4	0.45452|0.45452	D|D	0.998424|0.998424	.|D;D;D	.|0.69078	.|0.995;0.997;0.997	.|D;D;D	.|0.83275	.|0.969;0.996;0.996	T|T	0.77019|0.77019	-0.2743|-0.2743	5|10	.|0.28530	.|T	.|0.3	.|.	10.968|10.968	0.47424|0.47424	0.0:0.888:0.0:0.112|0.0:0.888:0.0:0.112	.|.	.|1182;115;904	.|F5GZB4;F8WA52;Q8IVV2-2	.|.;.;.	H|N	1163|71;904;1182;115;904;84;84	.|ENSP00000300591:K71N;ENSP00000381707:K904N;ENSP00000444586:K1182N;ENSP00000409062:K115N;ENSP00000440060:K84N	.|ENSP00000300591:K71N	D|K	-|-	1|3	0|2	LOXHD1|LOXHD1	42379351|42379351	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	1.637000|1.637000	0.37155|0.37155	2.713000|2.713000	0.92767|0.92767	0.655000|0.655000	0.94253|0.94253	GAC|AAG	LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000167210		0.433	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		67	0.00	0	C	NM_144612		44125353	44125353	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	missense	102	24.44	33	SNP	1.000	G
MANSC4	100287284	genome.wustl.edu	37	12	27916222	27916222	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr12:27916222C>T	ENST00000381273.3	-	3	471	c.472G>A	c.(472-474)Gat>Aat	p.D158N		NM_001146221.1	NP_001139693.1	A6NHS7	MANS4_HUMAN	MANSC domain containing 4	158						integral component of membrane (GO:0016021)				kidney(1)	1						GTTTGTTTATCTAAATTCATA	0.398																																						dbGAP											0													262.0	221.0	233.0					12																	27916222		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS53770.1	12p11.22	2011-05-05			ENSG00000205693	ENSG00000205693			40023	protein-coding gene	gene with protein product							Standard	NM_001146221		Approved		uc010sjs.1	A6NHS7	OTTHUMG00000169216	ENST00000381273.3:c.472G>A	12.37:g.27916222C>T	ENSP00000370673:p.Asp158Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MANSC_N,smart_MANSC_N,pfscan_MANSC	p.D158N	ENST00000381273.3	37	c.472	CCDS53770.1	12	.	.	.	.	.	.	.	.	.	.	C	19.27	3.794480	0.70452	.	.	ENSG00000205693	ENST00000381273	T	0.44482	0.92	5.41	2.48	0.30137	.	0.479943	0.19482	N	0.113182	T	0.23054	0.0557	L	0.27053	0.805	0.09310	N	1	B	0.11235	0.004	B	0.10450	0.005	T	0.15752	-1.0426	10	0.23891	T	0.37	-1.6889	2.0394	0.03547	0.1619:0.5031:0.1571:0.178	.	158	A6NHS7	MANS4_HUMAN	N	158	ENSP00000370673:D158N	ENSP00000370673:D158N	D	-	1	0	MANSC4	27807489	0.594000	0.26849	0.005000	0.12908	0.779000	0.44077	2.022000	0.41030	0.221000	0.20879	0.563000	0.77884	GAT	MANSC4	-	NULL	ENSG00000205693		0.398	MANSC4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	MANSC4	HGNC	protein_coding	OTTHUMT00000402902.1	59	0.00	0	C			27916222	27916222	-1	no_errors	ENST00000381273	ensembl	human	novel	69_37n	missense	61	32.97	30	SNP	0.010	T
MIR7-3HG	284424	genome.wustl.edu	37	19	4770765	4770765	+	lincRNA	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:4770765G>A	ENST00000586721.1	+	0	509				MIR7-3_ENST00000384898.1_RNA			Q8N6C7	PGSF1_HUMAN	MIR7-3 host gene (non-protein coding)																		AGTCACAGCCGGCCTCATAGC	0.557																																						dbGAP											0													205.0	192.0	196.0					19																	4770765		1568	3582	5150	-	-	-			0			AB058892		19p13.3	2014-03-17	2011-09-01	2011-09-01	ENSG00000176840	ENSG00000176840		"""Long non-coding RNAs"""	30049	non-coding RNA	RNA, long non-coding	"""pituitary gland specific factor 1a"", ""pituitary gland specific factor 1b"""		"""chromosome 19 open reading frame 30"", ""non-protein coding RNA 306"", ""long intergenic non-protein coding RNA 306"""	C19orf30, NCRNA00306, LINC00306		11854097	Standard	NR_027148		Approved	PGSF1, PGSF1a, PGSF1b, Huh7, uc002mbe.2	uc010xii.2	Q8N6C7	OTTHUMG00000150589		19.37:g.4770765G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W630|Q17RJ9|Q8N6C6	RNA	SNP	-	NULL	ENST00000586721.1	37	NULL		19																																																																																			MIR7-3	-	-	ENSG00000207630		0.557	MIR7-3HG-002	KNOWN	basic	lincRNA	MIR7-3	HGNC	lincRNA	OTTHUMT00000459345.1	96	0.00	0	G	NR_027148		4770765	4770765	+1	no_errors	ENST00000384898	ensembl	human	known	69_37n	rna	109	24.83	36	SNP	0.999	A
MLLT10	8028	genome.wustl.edu	37	10	21962594	21962594	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr10:21962594C>G	ENST00000307729.7	+	11	1545	c.1367C>G	c.(1366-1368)tCt>tGt	p.S456C	MLLT10_ENST00000377072.3_Missense_Mutation_p.S456C|MLLT10_ENST00000446906.2_Missense_Mutation_p.S456C|MLLT10_ENST00000377059.3_Missense_Mutation_p.S456C			P55197	AF10_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10	456	DNA-binding.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	6						GCTCAAACTTCTGGCATAGAA	0.408			T	"""MLL, PICALM, CDK6"""	AL																																	dbGAP		Dom	yes		10	10p12	8028	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 10 (AF10)"""		L	0													119.0	131.0	127.0					10																	21962594		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13948	CCDS7135.1, CCDS55706.1, CCDS55707.1, CCDS55708.1	10p12	2013-01-28	2001-11-28		ENSG00000078403	ENSG00000078403		"""Zinc fingers, PHD-type"""	16063	protein-coding gene	gene with protein product		602409	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 10"""			7888665	Standard	NM_004641		Approved	AF10	uc021pny.1	P55197	OTTHUMG00000017799	ENST00000307729.7:c.1367C>G	10.37:g.21962594C>G	ENSP00000307411:p.Ser456Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANA8|Q5JT37|Q5VX90|Q66K63	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.S456C	ENST00000307729.7	37	c.1367	CCDS55708.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	4.007670|4.007670	0.75046|0.75046	.|.	.|.	ENSG00000078403|ENSG00000078403	ENST00000420525|ENST00000377072;ENST00000446906;ENST00000307729;ENST00000396529;ENST00000377059;ENST00000438473;ENST00000538639	.|T;T;T;T	.|0.16597	.|2.33;2.33;2.34;2.33	5.36|5.36	5.36|5.36	0.76844|0.76844	.|.	.|0.108415	.|0.64402	.|D	.|0.000006	T|T	0.38374|0.38374	0.1038|0.1038	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.71674	.|0.996;0.997;0.997;0.998	.|P;P;D;P	.|0.73708	.|0.855;0.817;0.981;0.861	T|T	0.04991|0.04991	-1.0913|-1.0913	5|10	.|0.54805	.|T	.|0.06	.|.	19.076|19.076	0.93161|0.93161	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|302;456;456;456	.|F5H541;E9PBP4;Q5VX90;P55197	.|.;.;.;AF10_HUMAN	V|C	30|456;456;456;302;456;99;98	.|ENSP00000366272:S456C;ENSP00000401406:S456C;ENSP00000307411:S456C;ENSP00000366258:S456C	.|ENSP00000307411:S456C	L|S	+|+	1|2	2|0	MLLT10|MLLT10	22002600|22002600	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.892000|0.892000	0.51952|0.51952	6.013000|6.013000	0.70776|0.70776	2.530000|2.530000	0.85305|0.85305	0.585000|0.585000	0.79938|0.79938	CTG|TCT	MLLT10	-	NULL	ENSG00000078403		0.408	MLLT10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLLT10	HGNC	protein_coding	OTTHUMT00000047136.1	30	0.00	0	C			21962594	21962594	+1	no_errors	ENST00000307729	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	1.000	G
MTIF2	4528	genome.wustl.edu	37	2	55470655	55470655	+	Silent	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:55470655C>T	ENST00000263629.4	-	12	1776	c.1461G>A	c.(1459-1461)aaG>aaA	p.K487K	MTIF2_ENST00000403721.1_Silent_p.K487K|MTIF2_ENST00000394600.3_Silent_p.K487K	NM_002453.2	NP_002444.2	P46199	IF2M_HUMAN	mitochondrial translational initiation factor 2	487					formation of translation initiation complex (GO:0001732)|regulation of translational initiation (GO:0006446)|ribosome disassembly (GO:0032790)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|ribosomal small subunit binding (GO:0043024)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	24						TTGATCTCTTCTTCCACAGTA	0.363																																						dbGAP											0													183.0	179.0	181.0					2																	55470655		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L34600	CCDS1853.1	2p16.1	2008-02-05			ENSG00000085760	ENSG00000085760			7441	protein-coding gene	gene with protein product		603766				9925935, 7829522	Standard	XM_005264335		Approved	IF-2mt	uc002ryo.3	P46199	OTTHUMG00000129338	ENST00000263629.4:c.1461G>A	2.37:g.55470655C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5D0	Silent	SNP	pfam_ProtSyn_GTP-bd,pfam_TIF_IF2_dom3,pfam_Transl_elong_EFTu/EF1A_2,pfam_MIRO-like,pfam_GTP_binding_domain,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,superfamily_TIF_IF2_dom3,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Small_GTP-bd_dom	p.K487	ENST00000263629.4	37	c.1461	CCDS1853.1	2																																																																																			MTIF2	-	NULL	ENSG00000085760		0.363	MTIF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTIF2	HGNC	protein_coding	OTTHUMT00000251486.4	114	0.00	0	C	NM_002453		55470655	55470655	-1	no_errors	ENST00000263629	ensembl	human	known	69_37n	silent	149	23.98	47	SNP	1.000	T
MUC5B	727897	genome.wustl.edu	37	11	1272209	1272209	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:1272209C>T	ENST00000529681.1	+	31	14157	c.14099C>T	c.(14098-14100)cCa>cTa	p.P4700L	MUC5B_ENST00000447027.1_Missense_Mutation_p.P4703L|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	4700	23 X approximate tandem repeats, Ser/Thr- rich.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		tcctcaactccagggacaaca	0.632																																						dbGAP											0													121.0	145.0	137.0					11																	1272209		2110	4200	6310	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.14099C>T	11.37:g.1272209C>T	ENSP00000436812:p.Pro4700Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.P4703L	ENST00000529681.1	37	c.14108	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	-	4.576	0.107087	0.08780	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000535652	T;T	0.18502	2.21;2.4	1.5	-1.28	0.09318	.	.	.	.	.	T	0.17238	0.0414	M	0.76328	2.33	0.09310	N	1	B	0.28933	0.228	B	0.19666	0.026	T	0.17107	-1.0380	9	0.87932	D	0	.	5.9269	0.19118	0.0:0.5638:0.0:0.4362	.	4703	E9PBJ0	.	L	4700;4703;4644;473	ENSP00000436812:P4700L;ENSP00000415793:P4703L	ENSP00000343037:P4644L	P	+	2	0	MUC5B	1228785	0.388000	0.25197	0.000000	0.03702	0.038000	0.13279	0.878000	0.28126	-0.615000	0.05679	0.194000	0.17425	CCA	MUC5B	-	NULL	ENSG00000117983		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	151	0.00	0	C	XM_001126093		1272209	1272209	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	136	30.96	61	SNP	0.002	T
MUT	4594	genome.wustl.edu	37	6	49426879	49426879	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:49426879T>C	ENST00000274813.3	-	2	428	c.301A>G	c.(301-303)Acc>Gcc	p.T101A		NM_000255.3	NP_000246.2	P22033	MUTA_HUMAN	methylmalonyl CoA mutase	101					cellular lipid metabolic process (GO:0044255)|cobalamin metabolic process (GO:0009235)|fatty acid beta-oxidation (GO:0006635)|homocysteine metabolic process (GO:0050667)|post-embryonic development (GO:0009791)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)|metal ion binding (GO:0046872)|methylmalonyl-CoA mutase activity (GO:0004494)|modified amino acid binding (GO:0072341)			endometrium(2)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	30	Lung NSC(77;0.0376)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGCCTAAAGGTATACATGGTA	0.413																																						dbGAP											0													117.0	110.0	112.0					6																	49426879		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4924.1	6p21	2012-10-02	2010-04-30		ENSG00000146085	ENSG00000146085	5.4.99.2		7526	protein-coding gene	gene with protein product		609058	"""methylmalonyl Coenzyme A mutase"""			2907507, 9503014	Standard	NM_000255		Approved		uc003ozg.4	P22033	OTTHUMG00000014814	ENST00000274813.3:c.301A>G	6.37:g.49426879T>C	ENSP00000274813:p.Thr101Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K953|Q5SYZ3|Q96B11|Q9UD64	Missense_Mutation	SNP	pfam_MeMalonylCoA_mutase_a/b_cat,pfam_Cobalamin-bd,superfamily_Cbl-dep_enz_cat,superfamily_Cobalamin-bd,tigrfam_MMCoA_mutase_a_cat,tigrfam_Acid_CoA_mut_C	p.T101A	ENST00000274813.3	37	c.301	CCDS4924.1	6	.	.	.	.	.	.	.	.	.	.	T	1.950	-0.441459	0.04604	.	.	ENSG00000146085	ENST00000274813	D	0.98150	-4.75	5.61	4.41	0.53225	Cobalamin (vitamin B12)-dependent enzyme, catalytic (1);Cobalamin (vitamin B12)-dependent enzyme, catalytic subdomain (1);Methylmalonyl-CoA mutase, alpha/beta chain, catalytic (1);Methylmalonyl-CoA mutase, alpha chain, catalytic (1);	0.047237	0.85682	D	0.000000	D	0.89012	0.6594	L	0.31578	0.945	0.80722	D	1	B	0.06786	0.001	B	0.15870	0.014	D	0.83516	0.0083	10	0.06236	T	0.91	-13.84	12.1744	0.54178	0.0:0.0:0.1431:0.8569	.	101	P22033	MUTA_HUMAN	A	101	ENSP00000274813:T101A	ENSP00000274813:T101A	T	-	1	0	MUT	49534838	1.000000	0.71417	0.969000	0.41365	0.367000	0.29736	5.833000	0.69349	1.020000	0.39573	0.528000	0.53228	ACC	MUT	-	pfam_MeMalonylCoA_mutase_a/b_cat,superfamily_Cbl-dep_enz_cat,tigrfam_MMCoA_mutase_a_cat	ENSG00000146085		0.413	MUT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUT	HGNC	protein_coding	OTTHUMT00000040854.1	73	0.00	0	T			49426879	49426879	-1	no_errors	ENST00000274813	ensembl	human	known	69_37n	missense	47	29.85	20	SNP	1.000	C
MYH7B	57644	genome.wustl.edu	37	20	33568430	33568430	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr20:33568430C>A	ENST00000262873.7	+	6	610	c.518C>A	c.(517-519)cCa>cAa	p.P173Q	MYH7B_ENST00000481922.1_3'UTR	NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	131	Myosin motor.					membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			AAATGGCTCCCAGTCTATACG	0.517																																						dbGAP											0													134.0	144.0	141.0					20																	33568430		2194	4299	6493	-	-	-	SO:0001583	missense	0			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.518C>A	20.37:g.33568430C>A	ENSP00000262873:p.Pro173Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.P173Q	ENST00000262873.7	37	c.518	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902236	0.92035	.	.	ENSG00000078814	ENST00000262873	T	0.73897	-0.79	4.46	4.46	0.54185	Myosin head, motor domain (3);	0.000000	0.37483	N	0.002062	D	0.89403	0.6705	M	0.92268	3.29	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92192	0.5760	10	0.87932	D	0	.	17.6559	0.88177	0.0:1.0:0.0:0.0	.	131	A7E2Y1	MYH7B_HUMAN	Q	173	ENSP00000262873:P173Q	ENSP00000262873:P173Q	P	+	2	0	MYH7B	33032091	1.000000	0.71417	0.984000	0.44739	0.949000	0.60115	7.651000	0.83577	2.472000	0.83506	0.655000	0.94253	CCA	MYH7B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	ENSG00000078814		0.517	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	53	0.00	0	C	NM_020884		33568430	33568430	+1	no_errors	ENST00000262873	ensembl	human	novel	69_37n	missense	60	13.04	9	SNP	1.000	A
MYLK	4638	genome.wustl.edu	37	3	123376021	123376021	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:123376021C>A	ENST00000475616.1	-	21	4239	c.4240G>T	c.(4240-4242)Gag>Tag	p.E1414*	MYLK_ENST00000354792.5_Nonsense_Mutation_p.E214*|MYLK_ENST00000359169.1_Nonsense_Mutation_p.E1414*|MYLK_ENST00000360304.3_Nonsense_Mutation_p.E1414*|MYLK_ENST00000346322.5_Nonsense_Mutation_p.E1345*|MYLK_ENST00000360772.3_Nonsense_Mutation_p.E1414*			Q15746	MYLK_HUMAN	myosin light chain kinase	1414	Actin-binding (calcium/calmodulin- insensitive). {ECO:0000250}.|Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		TGGCTTGGCTCACTGGTTCCA	0.517																																						dbGAP											0													174.0	157.0	163.0					3																	123376021		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.4240G>T	3.37:g.123376021C>A	ENSP00000418335:p.Glu1414*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E1414*	ENST00000475616.1	37	c.4240	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	C	45	11.553969	0.99575	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000354792;ENST00000475616;ENST00000508240	.	.	.	5.25	5.25	0.73442	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	.	19.1913	0.93667	0.0:1.0:0.0:0.0	.	.	.	.	X	1414;1414;1414;1345;214;1414;214	.	ENSP00000320622:E1345X	E	-	1	0	MYLK	124858711	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.967000	0.70403	2.624000	0.88883	0.561000	0.74099	GAG	MYLK	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000065534		0.517	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	51	0.00	0	C	NM_053025		123376021	123376021	-1	no_errors	ENST00000360304	ensembl	human	known	69_37n	nonsense	61	31.46	28	SNP	1.000	A
MYPN	84665	genome.wustl.edu	37	10	69881600	69881600	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr10:69881600delA	ENST00000358913.5	+	2	893	c.405delA	c.(403-405)gcafs	p.A135fs	MYPN_ENST00000540630.1_Frame_Shift_Del_p.A135fs|MYPN_ENST00000354393.2_Intron|MYPN_ENST00000373675.3_Frame_Shift_Del_p.A135fs	NM_001256267.1|NM_032578.3	NP_001243196.1|NP_115967.2	Q86TC9	MYPN_HUMAN	myopalladin	135	Interaction with CARP.				sarcomere organization (GO:0045214)	I band (GO:0031674)|nucleus (GO:0005634)|Z disc (GO:0030018)	cytoskeletal protein binding (GO:0008092)|muscle alpha-actinin binding (GO:0051371)|SH3 domain binding (GO:0017124)			breast(2)|central_nervous_system(1)|endometrium(13)|kidney(6)|large_intestine(13)|liver(1)|lung(43)|ovary(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(5)	94						CCCAGGAGGCAAAAAGGCCAC	0.433																																						dbGAP											0													44.0	43.0	44.0					10																	69881600		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AL834247	CCDS7275.1, CCDS73142.1	10q22.1	2014-09-17			ENSG00000138347	ENSG00000138347		"""Immunoglobulin superfamily / I-set domain containing"""	23246	protein-coding gene	gene with protein product	"""sarcomeric protein myopalladin, 145 kDa"""	608517				11309420, 12482578	Standard	NM_032578		Approved	MYOP	uc001jnm.5	Q86TC9	OTTHUMG00000018344	ENST00000358913.5:c.405delA	10.37:g.69881600delA	ENSP00000351790:p.Ala135fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV35|Q5VV36|Q86T37|Q8N3L4|Q96K90|Q96KF5	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R137fs	ENST00000358913.5	37	c.405	CCDS7275.1	10																																																																																			MYPN	-	NULL	ENSG00000138347		0.433	MYPN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYPN	HGNC	protein_coding	OTTHUMT00000048307.1	16	0.00	0	A	NM_032578		69881600	69881600	+1	no_errors	ENST00000358913	ensembl	human	known	69_37n	frame_shift_del	14	12.50	2	DEL	0.221	-
MYT1	4661	genome.wustl.edu	37	20	62868702	62868702	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr20:62868702A>T	ENST00000328439.1	+	21	3416	c.3052A>T	c.(3052-3054)Aac>Tac	p.N1018Y	MYT1_ENST00000536311.1_Missense_Mutation_p.N1045Y	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GAACGAGTCCAACTCGGAGAT	0.582																																					GBM(59;481 1041 20555 21139 33705)	dbGAP											0													64.0	51.0	55.0					20																	62868702		2202	4296	6498	-	-	-	SO:0001583	missense	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.3052A>T	20.37:g.62868702A>T	ENSP00000327465:p.Asn1018Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.N1045Y	ENST00000328439.1	37	c.3133	CCDS13558.1	20	.	.	.	.	.	.	.	.	.	.	A	19.53	3.844592	0.71488	.	.	ENSG00000196132	ENST00000328439;ENST00000536311	T;T	0.59638	0.28;0.25	5.77	5.77	0.91146	.	0.000000	0.85682	D	0.000000	T	0.77765	0.4179	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81075	-0.1097	10	0.87932	D	0	-40.0694	16.0977	0.81139	1.0:0.0:0.0:0.0	.	1045;1018	F5H7M8;Q01538	.;MYT1_HUMAN	Y	1018;1045	ENSP00000327465:N1018Y;ENSP00000442412:N1045Y	ENSP00000327465:N1018Y	N	+	1	0	MYT1	62339146	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.204000	0.95041	2.215000	0.71742	0.459000	0.35465	AAC	MYT1	-	NULL	ENSG00000196132		0.582	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1	35	0.00	0	A	NM_004535		62868702	62868702	+1	no_errors	ENST00000536311	ensembl	human	known	69_37n	missense	20	41.18	14	SNP	1.000	T
NALCN	259232	genome.wustl.edu	37	13	101777015	101777015	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr13:101777015G>A	ENST00000251127.6	-	18	2217	c.2136C>T	c.(2134-2136)ttC>ttT	p.F712F		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	712					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CCCTGATGCTGAAAACAGACT	0.343																																						dbGAP											0													134.0	128.0	130.0					13																	101777015		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.2136C>T	13.37:g.101777015G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	pfam_Ion_trans_dom	p.F712	ENST00000251127.6	37	c.2136	CCDS9498.1	13																																																																																			NALCN	-	NULL	ENSG00000102452		0.343	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	51	0.00	0	G	NM_052867		101777015	101777015	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	silent	96	22.58	28	SNP	1.000	A
NAMPTL	646309	genome.wustl.edu	37	10	36813126	36813126	+	5'Flank	SNP	T	T	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr10:36813126T>A	ENST00000543053.1	-	0	0									nicotinamide phosphoribosyltransferase-like											biliary_tract(1)|breast(3)|lung(9)|stomach(1)	14						GAATAAACTTTGCTTGTGTTG	0.478																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0					10p11.21	2013-03-27	2008-11-06	2008-11-06	ENSG00000229644	ENSG00000229644			17633	other	unknown			"""pre-B-cell colony enhancing factor 2"""	PBEF2		8289818	Standard	NG_005593		Approved	bA92J19.4			OTTHUMG00000017964		10.37:g.36813126T>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nicotinamide_PRibTrfase	p.K13*	ENST00000543053.1	37	c.37		10	.	.	.	.	.	.	.	.	.	.	t	14.87	2.665194	0.47677	.	.	ENSG00000229644	ENST00000440465	.	.	.	1.51	1.51	0.23008	.	0.043514	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.22109	T	0.4	-20.4175	6.8721	0.24127	0.0:0.0:0.0:1.0	.	.	.	.	X	13	.	ENSP00000407952:K13X	K	-	1	0	NAMPTL	36853132	1.000000	0.71417	0.824000	0.32777	0.287000	0.27160	5.376000	0.66178	0.743000	0.32719	0.225000	0.17782	AAA	NAMPTL	-	pirsf_Nicotinamide_PRibTrfase	ENSG00000229644		0.478	NAMPTL-201	KNOWN	basic|appris_principal	protein_coding	NAMPTL	HGNC	protein_coding		103	0.00	0	T	NG_005593		36813126	36813126	-1	no_start_codon	ENST00000440465	ensembl	human	known	69_37n	nonsense	130	20.73	34	SNP	1.000	A
NAPA	8775	genome.wustl.edu	37	19	47996232	47996232	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:47996232C>G	ENST00000263354.3	-	7	846	c.547G>C	c.(547-549)Gac>Cac	p.D183H	NAPA_ENST00000593785.1_5'Flank|NAPA-AS1_ENST00000593284.1_RNA|NAPA_ENST00000595227.1_Missense_Mutation_p.D144H|NAPA-AS1_ENST00000594367.1_RNA	NM_003827.3	NP_003818.2	P54920	SNAA_HUMAN	N-ethylmaleimide-sensitive factor attachment protein, alpha	183					apical protein localization (GO:0045176)|brain development (GO:0007420)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|membrane organization (GO:0061024)|neuron differentiation (GO:0030182)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of synaptic vesicle priming (GO:0010807)|SNARE complex disassembly (GO:0035494)|synaptic transmission, glutamatergic (GO:0035249)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|synaptobrevin 2-SNAP-25-syntaxin-1a complex (GO:0070044)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)	11		all_cancers(25;1.55e-10)|all_epithelial(76;3.4e-08)|all_lung(116;1.73e-07)|Lung NSC(112;3.95e-07)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		OV - Ovarian serous cystadenocarcinoma(262;0.000466)|all cancers(93;0.000739)|Epithelial(262;0.0168)|GBM - Glioblastoma multiforme(486;0.049)		TCGTAGATGTCAATGGCCTTC	0.607																																					Ovarian(185;1135 2042 27703 31345 42493)	dbGAP											0													115.0	103.0	107.0					19																	47996232		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39412	CCDS12702.1	19q13.33	2012-08-16			ENSG00000105402	ENSG00000105402			7641	protein-coding gene	gene with protein product	"""alpha SNAP"""	603215				9269766	Standard	NM_003827		Approved		uc002pha.2	P54920		ENST00000263354.3:c.547G>C	19.37:g.47996232C>G	ENSP00000263354:p.Asp183His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K879|Q96IK3|Q9BVJ3	Missense_Mutation	SNP	prints_NSF_attach	p.D183H	ENST00000263354.3	37	c.547	CCDS12702.1	19	.	.	.	.	.	.	.	.	.	.	C	15.45	2.836041	0.50951	.	.	ENSG00000105402	ENST00000263354	T	0.77620	-1.11	5.16	5.16	0.70880	Tetratricopeptide-like helical (1);	0.050713	0.85682	D	0.000000	T	0.71013	0.3290	L	0.32530	0.975	0.58432	D	0.999999	B	0.12013	0.005	B	0.15484	0.013	T	0.68315	-0.5441	10	0.87932	D	0	-16.8684	17.5684	0.87927	0.0:1.0:0.0:0.0	.	183	P54920	SNAA_HUMAN	H	183	ENSP00000263354:D183H	ENSP00000263354:D183H	D	-	1	0	NAPA	52688044	1.000000	0.71417	0.996000	0.52242	0.487000	0.33371	7.376000	0.79658	2.686000	0.91538	0.609000	0.83330	GAC	NAPA	-	prints_NSF_attach	ENSG00000105402		0.607	NAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAPA	HGNC	protein_coding	OTTHUMT00000466048.2	40	0.00	0	C	NM_003827		47996232	47996232	-1	no_errors	ENST00000263354	ensembl	human	known	69_37n	missense	29	36.17	17	SNP	1.000	G
NBAS	51594	genome.wustl.edu	37	2	15374818	15374818	+	Missense_Mutation	SNP	C	C	G	rs146811814	byFrequency	TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:15374818C>G	ENST00000281513.5	-	46	6022	c.5997G>C	c.(5995-5997)gaG>gaC	p.E1999D	NBAS_ENST00000441750.1_Missense_Mutation_p.E1879D	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1999					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						CATGAAGTTTCTCTTTTTCTG	0.408																																						dbGAP											0													101.0	97.0	98.0					2																	15374818		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5997G>C	2.37:g.15374818C>G	ENSP00000281513:p.Glu1999Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.E1999D	ENST00000281513.5	37	c.5997	CCDS1685.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	2.628|2.628	-0.287101|-0.287101	0.05605|0.05605	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000441750;ENST00000281513;ENST00000417461|ENST00000442506	T;T;T|.	0.46451|.	2.97;3.14;0.87|.	5.57|5.57	3.65|3.65	0.41850|0.41850	.|.	0.780762|.	0.12661|.	N|.	0.449595|.	T|T	0.24661|0.24661	0.0598|0.0598	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B|.	0.24963|.	0.115;0.001|.	B;B|.	0.18561|.	0.022;0.002|.	T|T	0.17289|0.17289	-1.0374|-1.0374	10|5	0.87932|.	D|.	0|.	.|.	8.0217|8.0217	0.30412|0.30412	0.0:0.5834:0.2171:0.1995|0.0:0.5834:0.2171:0.1995	.|.	1879;1999|.	A2RRP1-2;A2RRP1|.	.;NBAS_HUMAN|.	D|T	1879;1999;91|1047	ENSP00000413201:E1879D;ENSP00000281513:E1999D;ENSP00000392421:E91D|.	ENSP00000281513:E1999D|.	E|R	-|-	3|2	2|0	NBAS|NBAS	15292269|15292269	0.073000|0.073000	0.21202|0.21202	0.029000|0.029000	0.17559|0.17559	0.692000|0.692000	0.40212|0.40212	0.378000|0.378000	0.20569|0.20569	1.352000|1.352000	0.45808|0.45808	0.650000|0.650000	0.86243|0.86243	GAG|AGA	NBAS	-	NULL	ENSG00000151779		0.408	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	22	0.00	0	C	NM_015909		15374818	15374818	-1	no_errors	ENST00000281513	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	0.010	G
NBEAL2	23218	genome.wustl.edu	37	3	47045824	47045824	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:47045824C>T	ENST00000450053.3	+	37	6318	c.6139C>T	c.(6139-6141)Caa>Taa	p.Q2047*	NBEAL2_ENST00000292309.5_Nonsense_Mutation_p.Q1863*|NBEAL2_ENST00000383740.2_Nonsense_Mutation_p.Q326*	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2047					blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GCCCCCCTCTCAAGGCTACCT	0.657																																						dbGAP											0													33.0	37.0	36.0					3																	47045824		1937	4131	6068	-	-	-	SO:0001587	stop_gained	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.6139C>T	3.37:g.47045824C>T	ENSP00000415034:p.Gln2047*	Somatic		WXS	Illumina GAIIx	Phase_IV	O60288|Q6P994|Q6UX91|Q8NAC9	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q2047*	ENST00000450053.3	37	c.6139	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	46|46	12.463068|12.463068	0.99670|0.99670	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053|ENST00000443829	.|T	.|0.77750	.|-1.12	4.98|4.98	4.98|4.98	0.66077|0.66077	.|.	1.638140|.	0.02893|.	N|.	0.134385|.	.|D	.|0.84129	.|0.5404	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|D	.|0.84225	.|0.0463	.|4	0.30854|.	T|.	0.27|.	.|.	16.985|16.985	0.86338|0.86338	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	1863;326;2047|415	.|ENSP00000414560:S415L	ENSP00000292309:Q1863X|.	Q|S	+|+	1|2	0|0	NBEAL2|NBEAL2	47020828|47020828	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.795000|0.795000	0.44927|0.44927	4.517000|4.517000	0.60503|0.60503	2.606000|2.606000	0.88127|0.88127	0.491000|0.491000	0.48974|0.48974	CAA|TCA	NBEAL2	-	superfamily_BEACH_dom	ENSG00000160796		0.657	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	12	0.00	0	C	XM_291064		47045824	47045824	+1	no_errors	ENST00000450053	ensembl	human	known	69_37n	nonsense	6	50.00	6	SNP	1.000	T
NEB	4703	genome.wustl.edu	37	2	152435968	152435968	+	Intron	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:152435968C>G	ENST00000172853.10	-	78	11749				NEB_ENST00000397345.3_Missense_Mutation_p.E5530Q|NEB_ENST00000427231.2_Missense_Mutation_p.E5530Q|NEB_ENST00000603639.1_Missense_Mutation_p.E5530Q|NEB_ENST00000604864.1_Missense_Mutation_p.E5530Q|NEB_ENST00000409198.1_Intron			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GCCTGACCTTCTTTGGCAGCG	0.517																																						dbGAP											0													23.0	45.0	38.0					2																	152435968		685	1553	2238	-	-	-	SO:0001627	intron_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11602-3100G>C	2.37:g.152435968C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.E5530Q	ENST00000172853.10	37	c.16588		2	.	.	.	.	.	.	.	.	.	.	C	11.69	1.714587	0.30413	.	.	ENSG00000183091	ENST00000397345;ENST00000427231;ENST00000413693	T;T;T	0.32515	1.45;1.45;1.45	4.73	4.73	0.59995	.	.	.	.	.	T	0.21347	0.0514	L	0.27053	0.805	0.80722	D	1	B	0.19706	0.038	B	0.22601	0.04	T	0.05115	-1.0905	9	0.46703	T	0.11	.	8.4285	0.32744	0.0:0.7614:0.1568:0.0818	.	260	Q14215	.	Q	5530;5530;260	ENSP00000380505:E5530Q;ENSP00000416578:E5530Q;ENSP00000410961:E260Q	ENSP00000380505:E5530Q	E	-	1	0	NEB	152144214	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	3.677000	0.54619	2.616000	0.88540	0.514000	0.50259	GAA	NEB	-	smart_Nebulin_35r-motif	ENSG00000183091		0.517	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		124	0.00	0	C	NM_004543		152435968	152435968	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	185	20.94	49	SNP	1.000	G
NEXN	91624	genome.wustl.edu	37	1	78395103	78395103	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:78395103G>C	ENST00000334785.7	+	9	1151	c.967G>C	c.(967-969)Gaa>Caa	p.E323Q	NEXN_ENST00000330010.8_Missense_Mutation_p.E259Q|NEXN_ENST00000457030.1_Missense_Mutation_p.E309Q	NM_144573.3	NP_653174.3			nexilin (F actin binding protein)											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				Colorectal(170;0.114)		gcaaagaagagaagatgaaaa	0.388																																						dbGAP											0													79.0	78.0	79.0					1																	78395103		1845	4085	5930	-	-	-	SO:0001583	missense	0			AK057954	CCDS41351.1, CCDS53335.1	1p31.1	2014-09-17			ENSG00000162614	ENSG00000162614		"""Immunoglobulin superfamily / I-set domain containing"""	29557	protein-coding gene	gene with protein product		613121				12053183, 8227983	Standard	NM_144573		Approved	nexilin, NELIN	uc001dic.4	Q0ZGT2	OTTHUMG00000040533	ENST00000334785.7:c.967G>C	1.37:g.78395103G>C	ENSP00000333938:p.Glu323Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.E323Q	ENST00000334785.7	37	c.967	CCDS41351.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.87|15.87	2.960880|2.960880	0.53400|0.53400	.|.	.|.	ENSG00000162614|ENSG00000162614	ENST00000342754|ENST00000401035;ENST00000457030;ENST00000330010;ENST00000334785;ENST00000440324	.|T;T;T;T;T	.|0.70399	.|-0.44;-0.23;-0.14;-0.06;-0.48	4.98|4.98	4.06|4.06	0.47325|0.47325	.|.	0.266978|0.266978	0.25663|0.25663	N|N	0.029135|0.029135	T|T	0.63546|0.63546	0.2520|0.2520	M|M	0.76727|0.76727	2.345|2.345	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.32526	.|0.159;0.374;0.258;0.159	.|B;B;B;B	.|0.40602	.|0.224;0.334;0.179;0.179	T|T	0.67341|0.67341	-0.5695|-0.5695	6|10	.|0.48119	.|T	.|0.1	-1.5209|-1.5209	11.622|11.622	0.51124|0.51124	0.0848:0.0:0.9152:0.0|0.0848:0.0:0.9152:0.0	.|.	.|259;309;323;259	.|D3DQ79;Q0ZGT2-2;Q0ZGT2;B4DPZ7	.|.;.;NEXN_HUMAN;.	D|Q	222|259;309;259;323;309	.|ENSP00000383814:E259Q;ENSP00000388048:E309Q;ENSP00000327363:E259Q;ENSP00000333938:E323Q;ENSP00000411902:E309Q	.|ENSP00000327363:E259Q	E|E	+|+	3|1	2|0	NEXN|NEXN	78167691|78167691	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.899000|0.899000	0.52679|0.52679	6.671000|6.671000	0.74472|0.74472	1.234000|1.234000	0.43709|0.43709	0.591000|0.591000	0.81541|0.81541	GAG|GAA	NEXN	-	NULL	ENSG00000162614		0.388	NEXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEXN	HGNC	protein_coding	OTTHUMT00000097549.1	52	0.00	0	G	NM_144573		78395103	78395103	+1	no_errors	ENST00000334785	ensembl	human	known	69_37n	missense	65	21.69	18	SNP	1.000	C
NLRP4	147945	genome.wustl.edu	37	19	56370171	56370171	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:56370171A>T	ENST00000301295.6	+	3	1834	c.1412A>T	c.(1411-1413)gAt>gTt	p.D471V	NLRP4_ENST00000346986.5_Missense_Mutation_p.D471V|NLRP4_ENST00000587891.1_Missense_Mutation_p.D396V	NM_134444.4	NP_604393.2	Q96MN2	NALP4_HUMAN	NLR family, pyrin domain containing 4	471	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(3)|ovary(6)|pancreas(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(8)	42		Colorectal(82;0.0002)|Ovarian(87;0.221)		GBM - Glioblastoma multiforme(193;0.0606)		AGCCACCTTGATCATCCTCAC	0.473																																						dbGAP											0													140.0	139.0	139.0					19																	56370171		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF479747	CCDS12936.1	19q13.43	2009-03-27	2006-12-08	2006-12-08				"""Nucleotide-binding domain and leucine rich repeat containing"""	22943	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 4"", ""cancer/testis antigen 58"""	609645	"""NACHT, leucine rich repeat and PYD containing 4"""	NALP4		12563287, 12019269	Standard	NM_134444		Approved	PYPAF4, FLJ32126, PAN2, RNH2, CLR19.5, CT58	uc002qmd.4	Q96MN2		ENST00000301295.6:c.1412A>T	19.37:g.56370171A>T	ENSP00000301295:p.Asp471Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W87|Q96AY6	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D471V	ENST00000301295.6	37	c.1412	CCDS12936.1	19	.	.	.	.	.	.	.	.	.	.	A	8.423	0.846787	0.16963	.	.	ENSG00000160505	ENST00000301295;ENST00000346986	D;D	0.84800	-1.9;-1.9	3.97	1.75	0.24633	.	.	.	.	.	D	0.83170	0.5196	L	0.60067	1.865	0.09310	N	0.999991	P;P;P	0.45531	0.86;0.681;0.553	P;B;B	0.47044	0.535;0.198;0.09	T	0.71994	-0.4424	9	0.51188	T	0.08	.	5.7312	0.18040	0.6588:0.174:0.0:0.1672	.	471;396;471	Q96MN2-2;Q96MN2-3;Q96MN2	.;.;NALP4_HUMAN	V	471	ENSP00000301295:D471V;ENSP00000344787:D471V	ENSP00000301295:D471V	D	+	2	0	NLRP4	61061983	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.200000	0.17257	0.166000	0.19597	-0.490000	0.04691	GAT	NLRP4	-	NULL	ENSG00000160505		0.473	NLRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP4	HGNC	protein_coding	OTTHUMT00000457367.2	60	0.00	0	A	NM_134444		56370171	56370171	+1	no_errors	ENST00000301295	ensembl	human	known	69_37n	missense	48	32.39	23	SNP	0.000	T
NT5DC3	51559	genome.wustl.edu	37	12	104200107	104200107	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr12:104200107C>G	ENST00000392876.3	-	4	557	c.517G>C	c.(517-519)Gtc>Ctc	p.V173L		NM_001031701.2	NP_001026871.1	Q86UY8	NT5D3_HUMAN	5'-nucleotidase domain containing 3	173						cytosol (GO:0005829)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)	hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(15)|ovary(2)|skin(1)|stomach(2)	30						TACCTGTAGACAGTTCCCAGC	0.363																																						dbGAP											0													109.0	101.0	103.0					12																	104200107		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032786	CCDS41824.1	12q22-q23.1	2006-02-03			ENSG00000111696	ENSG00000111696			30826	protein-coding gene	gene with protein product		611076					Standard	NM_001031701		Approved	TU12B1-TY, FLJ11266	uc010swe.1	Q86UY8	OTTHUMG00000157017	ENST00000392876.3:c.517G>C	12.37:g.104200107C>G	ENSP00000376615:p.Val173Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NUM7|Q9P2T2|Q9P2T3	Missense_Mutation	SNP	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl	p.V173L	ENST00000392876.3	37	c.517	CCDS41824.1	12	.	.	.	.	.	.	.	.	.	.	C	34	5.399195	0.96030	.	.	ENSG00000111696	ENST00000392876	T	0.24151	1.87	5.39	5.39	0.77823	HAD-like domain (1);	0.000000	0.85682	D	0.000000	T	0.55016	0.1894	M	0.82823	2.61	0.80722	D	1	D	0.61697	0.99	D	0.63957	0.92	T	0.59354	-0.7470	10	0.62326	D	0.03	-41.7604	19.5308	0.95228	0.0:1.0:0.0:0.0	.	173	Q86UY8	NT5D3_HUMAN	L	173	ENSP00000376615:V173L	ENSP00000376615:V173L	V	-	1	0	NT5DC3	102724237	1.000000	0.71417	0.976000	0.42696	0.988000	0.76386	7.385000	0.79763	2.684000	0.91462	0.650000	0.86243	GTC	NT5DC3	-	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom,pirsf_Pur_nucleotidase,tigrfam_HAD-SF_hydro_IG_5-nucl	ENSG00000111696		0.363	NT5DC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5DC3	HGNC	protein_coding	OTTHUMT00000347118.2	49	0.00	0	C	NM_016575		104200107	104200107	-1	no_errors	ENST00000392876	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	G
OIP5	11339	genome.wustl.edu	37	15	41624735	41624735	+	Missense_Mutation	SNP	G	G	C	rs568464492		TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr15:41624735G>C	ENST00000220514.3	-	1	84	c.25C>G	c.(25-27)Cgc>Ggc	p.R9G	NUSAP1_ENST00000560177.1_5'Flank|NUSAP1_ENST00000450592.2_5'Flank|NUSAP1_ENST00000559596.1_5'Flank|NUSAP1_ENST00000450318.1_5'Flank|NUSAP1_ENST00000560747.1_5'Flank|NUSAP1_ENST00000414849.2_5'Flank|NUSAP1_ENST00000260359.6_5'Flank	NM_007280.1	NP_009211.1	O43482	MS18B_HUMAN	Opa interacting protein 5	9					cell communication (GO:0007154)|CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	Cajal body (GO:0015030)|chromatin (GO:0000785)|chromocenter (GO:0010369)|chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(3)|lung(1)|urinary_tract(1)	5		all_cancers(109;4.16e-14)|all_epithelial(112;7.09e-12)|Lung NSC(122;1.14e-09)|all_lung(180;2.56e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)		OV - Ovarian serous cystadenocarcinoma(18;1.49e-16)|GBM - Glioblastoma multiforme(113;1.29e-06)|BRCA - Breast invasive adenocarcinoma(123;0.163)		CAACGTGAGCGATGCCGCAGC	0.632																																						dbGAP											0													54.0	65.0	61.0					15																	41624735		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF025441	CCDS10074.1	15q14	2011-02-23			ENSG00000104147	ENSG00000104147			20300	protein-coding gene	gene with protein product	"""MIS18 kinetochore protein homolog B (S. pombe)"", ""cancer/testis antigen 86"""	606020				9466265, 17199038	Standard	NM_007280		Approved	MIS18B, hMIS18beta, CT86	uc001znp.3	O43482	OTTHUMG00000130251	ENST00000220514.3:c.25C>G	15.37:g.41624735G>C	ENSP00000220514:p.Arg9Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BX7	Missense_Mutation	SNP	NULL	p.R9G	ENST00000220514.3	37	c.25	CCDS10074.1	15	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788654	0.31685	.	.	ENSG00000104147	ENST00000220514	.	.	.	5.65	-8.68	0.00859	.	0.979355	0.08343	N	0.960528	T	0.27098	0.0664	L	0.51422	1.61	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.28996	-1.0026	9	0.44086	T	0.13	2.4486	3.7229	0.08463	0.1763:0.0893:0.1893:0.5451	.	9	O43482	MS18B_HUMAN	G	9	.	ENSP00000220514:R9G	R	-	1	0	OIP5	39412027	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.374000	0.01072	-1.453000	0.01928	-0.899000	0.02877	CGC	OIP5	-	NULL	ENSG00000104147		0.632	OIP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OIP5	HGNC	protein_coding	OTTHUMT00000252576.2	15	0.00	0	G	NM_007280		41624735	41624735	-1	no_errors	ENST00000220514	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	0.000	C
OR10J5	127385	genome.wustl.edu	37	1	159505696	159505696	+	Silent	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:159505696G>C	ENST00000334857.2	-	1	146	c.102C>G	c.(100-102)gtC>gtG	p.V34V		NM_001004469.1	NP_001004469.1	Q8NHC4	O10J5_HUMAN	olfactory receptor, family 10, subfamily J, member 5	34						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	22	all_hematologic(112;0.0429)					TTAAAATGTAGACAGTTAGGA	0.388																																						dbGAP											0													121.0	111.0	115.0					1																	159505696		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS30910.1	1q23.2	2012-08-09			ENSG00000184155	ENSG00000184155		"""GPCR / Class A : Olfactory receptors"""	14993	protein-coding gene	gene with protein product							Standard	NM_001004469		Approved		uc010piw.2	Q8NHC4	OTTHUMG00000022738	ENST00000334857.2:c.102C>G	1.37:g.159505696G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH35|Q6IFH2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V34	ENST00000334857.2	37	c.102	CCDS30910.1	1																																																																																			OR10J5	-	prints_7TM_GPCR_Rhodpsn	ENSG00000184155		0.388	OR10J5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10J5	HGNC	protein_coding	OTTHUMT00000059021.1	22	0.00	0	G	NM_001004469		159505696	159505696	-1	no_errors	ENST00000334857	ensembl	human	known	69_37n	silent	39	22.00	11	SNP	0.713	C
OTOF	9381	genome.wustl.edu	37	2	26688938	26688938	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:26688938C>G	ENST00000272371.2	-	37	4633	c.4507G>C	c.(4507-4509)Gac>Cac	p.D1503H	OTOF_ENST00000402415.3_Missense_Mutation_p.D813H|OTOF_ENST00000338581.6_Missense_Mutation_p.D736H|OTOF_ENST00000339598.3_Missense_Mutation_p.D736H|OTOF_ENST00000403946.3_Missense_Mutation_p.D1503H	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1503	C2 4. {ECO:0000255|PROSITE- ProRule:PRU00041}.				membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)			NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGTGCAGGTCCGTGGCCTGG	0.597																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											0													183.0	149.0	160.0					2																	26688938		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.4507G>C	2.37:g.26688938C>G	ENSP00000272371:p.Asp1503His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.D1503H	ENST00000272371.2	37	c.4507	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	C	24.9	4.576680	0.86645	.	.	ENSG00000115155	ENST00000338581;ENST00000339598;ENST00000402415;ENST00000272371;ENST00000403946	D;D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55;-1.55	5.6	4.73	0.59995	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.089831	0.85682	D	0.000000	D	0.89283	0.6671	M	0.65498	2.005	0.58432	D	0.999999	D;P;D;P	0.89917	0.983;0.746;1.0;0.877	D;B;D;B	0.80764	0.954;0.43;0.994;0.43	D	0.88836	0.3309	10	0.42905	T	0.14	-27.2781	14.0697	0.64852	0.0:0.9269:0.0:0.0731	.	1503;736;813;736	Q9HC10;Q9HC10-2;Q9HC10-3;Q9HC10-4	OTOF_HUMAN;.;.;.	H	736;736;813;1503;1503	ENSP00000345137:D736H;ENSP00000344521:D736H;ENSP00000383906:D813H;ENSP00000272371:D1503H;ENSP00000385255:D1503H	ENSP00000272371:D1503H	D	-	1	0	OTOF	26542442	1.000000	0.71417	0.912000	0.35992	0.906000	0.53458	6.086000	0.71352	1.382000	0.46385	0.561000	0.74099	GAC	OTOF	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000115155		0.597	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	82	0.00	0	C			26688938	26688938	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	missense	111	18.98	26	SNP	1.000	G
PCDHGB4	8641	genome.wustl.edu	37	5	140767563	140767563	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr5:140767563C>A	ENST00000519479.1	+	1	112	c.112C>A	c.(112-114)Ccc>Acc	p.P38T	PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	38	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTACAGGATTCCCGAGGAAAT	0.627																																						dbGAP											0													3.0	4.0	4.0					5																	140767563		1579	3626	5205	-	-	-	SO:0001583	missense	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.112C>A	5.37:g.140767563C>A	ENSP00000428288:p.Pro38Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P38T	ENST00000519479.1	37	c.112	CCDS54928.1	5	.	.	.	.	.	.	.	.	.	.	.	21.1	4.098958	0.76870	.	.	ENSG00000253953	ENST00000519479	T	0.40476	1.03	4.99	4.99	0.66335	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.69958	0.3169	M	0.92026	3.265	0.25809	N	0.984419	D;D	0.71674	0.983;0.998	D;D	0.74674	0.959;0.984	T	0.65541	-0.6143	9	0.72032	D	0.01	.	12.0722	0.53624	0.0:0.9207:0.0:0.0793	.	38;38	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	T	38	ENSP00000428288:P38T	ENSP00000428288:P38T	P	+	1	0	PCDHGB4	140747747	0.027000	0.19231	0.999000	0.59377	0.995000	0.86356	2.612000	0.46343	2.468000	0.83385	0.655000	0.94253	CCC	PCDHGB4	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000253953		0.627	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	14	0.00	0	C	NM_003736		140767563	140767563	+1	no_errors	ENST00000519479	ensembl	human	known	69_37n	missense	14	46.15	12	SNP	0.999	A
PDE10A	10846	genome.wustl.edu	37	6	165827098	165827098	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:165827098C>G	ENST00000366882.1	-	14	1293	c.1139G>C	c.(1138-1140)gGt>gCt	p.G380A	PDE10A_ENST00000354448.4_Missense_Mutation_p.G380A|PDE10A_ENST00000539869.2_Missense_Mutation_p.G390A			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	380	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	CTGCACCACACCTATCACGCT	0.478																																					Esophageal Squamous(22;308 615 5753 12038 40624)	dbGAP											0													115.0	97.0	103.0					6																	165827098		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.1139G>C	6.37:g.165827098C>G	ENSP00000355847:p.Gly380Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.G390A	ENST00000366882.1	37	c.1169		6	.	.	.	.	.	.	.	.	.	.	C	25.0	4.591372	0.86851	.	.	ENSG00000112541	ENST00000366882;ENST00000539869;ENST00000343842;ENST00000354448;ENST00000392126	D;D	0.92099	-2.97;-2.97	5.63	5.63	0.86233	GAF (2);	0.000000	0.85682	D	0.000000	D	0.94285	0.8164	L	0.49256	1.55	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.996	D	0.93341	0.6710	10	0.45353	T	0.12	.	19.7096	0.96089	0.0:1.0:0.0:0.0	.	390;380	Q9ULW9;Q9Y233	.;PDE10_HUMAN	A	380;408;390;380;379	ENSP00000355847:G380A;ENSP00000346435:G380A	ENSP00000341187:G390A	G	-	2	0	PDE10A	165747088	1.000000	0.71417	0.445000	0.26908	0.818000	0.46254	7.329000	0.79170	2.652000	0.90054	0.655000	0.94253	GGT	PDE10A	-	pfam_GAF,smart_GAF	ENSG00000112541		0.478	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	54	0.00	0	C			165827098	165827098	-1	no_errors	ENST00000539869	ensembl	human	known	69_37n	missense	45	25.00	15	SNP	1.000	G
PDE10A	10846	genome.wustl.edu	37	6	165832134	165832134	+	Silent	SNP	G	G	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:165832134G>T	ENST00000366882.1	-	12	1111	c.957C>A	c.(955-957)acC>acA	p.T319T	PDE10A_ENST00000354448.4_Silent_p.T319T|PDE10A_ENST00000539869.2_Silent_p.T329T			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	319	GAF 2.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TTATCTCTTTGGTCTTCTTGA	0.428																																					Esophageal Squamous(22;308 615 5753 12038 40624)	dbGAP											0													146.0	129.0	135.0					6																	165832134		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.957C>A	6.37:g.165832134G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.T329	ENST00000366882.1	37	c.987		6																																																																																			PDE10A	-	pfam_GAF,smart_GAF	ENSG00000112541		0.428	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	29	0.00	0	G			165832134	165832134	-1	no_errors	ENST00000539869	ensembl	human	known	69_37n	silent	26	38.10	16	SNP	1.000	T
PEX11G	92960	genome.wustl.edu	37	19	7547069	7547069	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:7547069G>T	ENST00000221480.1	-	3	286	c.278C>A	c.(277-279)tCc>tAc	p.S93Y	PEX11G_ENST00000599519.1_5'UTR|PEX11G_ENST00000593942.1_Missense_Mutation_p.S23Y	NM_001270539.1|NM_080662.3	NP_001257468.1|NP_542393.1	Q96HA9	PX11C_HUMAN	peroxisomal biogenesis factor 11 gamma	93					peroxisome fission (GO:0016559)|regulation of peroxisome size (GO:0044375)	integral component of peroxisomal membrane (GO:0005779)|intrinsic component of peroxisomal membrane (GO:0031231)|peroxisome (GO:0005777)|protein complex (GO:0043234)		p.S93>?(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|lung(1)|ovary(1)|prostate(1)|skin(1)	7						CCCTAGGACGGAGACACAGCG	0.637																																						dbGAP											1	Complex(1)	skin(1)											36.0	32.0	33.0					19																	7547069		2196	4290	6486	-	-	-	SO:0001583	missense	0			BC008780	CCDS12178.1	19p13.2	2008-02-05				ENSG00000104883			20208	protein-coding gene	gene with protein product		607583				12417726	Standard	NM_080662		Approved		uc002mgk.2	Q96HA9		ENST00000221480.1:c.278C>A	19.37:g.7547069G>T	ENSP00000221480:p.Ser93Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDM0	Missense_Mutation	SNP	pfam_PEX11	p.S93Y	ENST00000221480.1	37	c.278	CCDS12178.1	19	.	.	.	.	.	.	.	.	.	.	G	15.03	2.713698	0.48517	.	.	ENSG00000104883	ENST00000221480	T	0.47177	0.85	4.76	3.71	0.42584	.	0.055934	0.85682	D	0.000000	T	0.63768	0.2539	M	0.81239	2.535	0.58432	D	0.999998	D	0.58620	0.983	P	0.60682	0.878	T	0.68032	-0.5516	10	0.66056	D	0.02	-15.333	10.3172	0.43745	0.0968:0.0:0.9032:0.0	.	93	Q96HA9	PX11C_HUMAN	Y	93	ENSP00000221480:S93Y	ENSP00000221480:S93Y	S	-	2	0	PEX11G	7453069	1.000000	0.71417	0.463000	0.27130	0.028000	0.11728	7.014000	0.76380	2.335000	0.79485	0.561000	0.74099	TCC	PEX11G	-	pfam_PEX11	ENSG00000104883		0.637	PEX11G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11G	HGNC	protein_coding	OTTHUMT00000458965.1	15	0.00	0	G	NM_080662		7547069	7547069	-1	no_errors	ENST00000221480	ensembl	human	known	69_37n	missense	11	38.89	7	SNP	0.995	T
PIGM	93183	genome.wustl.edu	37	1	160000705	160000705	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:160000705G>C	ENST00000368090.2	-	1	1078	c.825C>G	c.(823-825)ttC>ttG	p.F275L		NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M	275					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ACAGCATGTAGAAGTACGGAG	0.458																																						dbGAP											0													130.0	133.0	132.0					1																	160000705		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081	ENST00000368090.2:c.825C>G	1.37:g.160000705G>C	ENSP00000357069:p.Phe275Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mannosyltransferase_DXD	p.F275L	ENST00000368090.2	37	c.825	CCDS1192.1	1	.	.	.	.	.	.	.	.	.	.	G	22.1	4.245475	0.80024	.	.	ENSG00000143315	ENST00000368090	T	0.49720	0.77	4.96	3.1	0.35709	.	0.187964	0.47455	D	0.000240	T	0.64875	0.2638	M	0.93062	3.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.71130	-0.4682	9	.	.	.	-14.6286	9.2299	0.37430	0.1763:0.0:0.8237:0.0	.	275	Q9H3S5	PIGM_HUMAN	L	275	ENSP00000357069:F275L	.	F	-	3	2	PIGM	158267329	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.127000	0.64727	0.695000	0.31675	0.462000	0.41574	TTC	PIGM	-	pfam_Mannosyltransferase_DXD	ENSG00000143315		0.458	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGM	HGNC	protein_coding	OTTHUMT00000060643.2	21	0.00	0	G	NM_145167		160000705	160000705	-1	no_errors	ENST00000368090	ensembl	human	known	69_37n	missense	38	30.91	17	SNP	1.000	C
PLA2R1	22925	genome.wustl.edu	37	2	160825803	160825803	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:160825803G>C	ENST00000283243.7	-	19	2934	c.2728C>G	c.(2728-2730)Cag>Gag	p.Q910E	PLA2R1_ENST00000392771.1_Missense_Mutation_p.Q910E	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	910	C-type lectin 5. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						CTCTGGCTCTGATTATTCACA	0.368																																						dbGAP											0													121.0	116.0	117.0					2																	160825803		2203	4300	6503	-	-	-	SO:0001583	missense	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2728C>G	2.37:g.160825803G>C	ENSP00000283243:p.Gln910Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.Q910E	ENST00000283243.7	37	c.2728	CCDS33309.1	2	.	.	.	.	.	.	.	.	.	.	G	7.325	0.617799	0.14129	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.16597	2.33;2.33	5.8	4.92	0.64577	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.284102	0.35207	N	0.003380	T	0.11196	0.0273	L	0.27944	0.81	0.31712	N	0.639339	B;B;B	0.11235	0.001;0.004;0.002	B;B;B	0.13407	0.008;0.009;0.007	T	0.15435	-1.0437	10	0.02654	T	1	.	14.1618	0.65452	0.0:0.1502:0.8498:0.0	.	910;910;910	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	E	910	ENSP00000283243:Q910E;ENSP00000376524:Q910E	ENSP00000283243:Q910E	Q	-	1	0	PLA2R1	160534049	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	3.115000	0.50391	1.441000	0.47550	0.650000	0.86243	CAG	PLA2R1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000153246		0.368	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1	43	0.00	0	G			160825803	160825803	-1	no_errors	ENST00000283243	ensembl	human	known	69_37n	missense	83	25.00	28	SNP	1.000	C
PLAC9	219348	genome.wustl.edu	37	10	81901933	81901933	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr10:81901933G>C	ENST00000372263.3	+	2	202	c.160G>C	c.(160-162)Gag>Cag	p.E54Q	PLAC9_ENST00000372267.2_Missense_Mutation_p.E54Q|PLAC9_ENST00000372270.2_Missense_Mutation_p.E12Q	NM_001012973.1	NP_001012991.1	Q5JTB6	PLAC9_HUMAN	placenta-specific 9	54						extracellular region (GO:0005576)				kidney(1)|ovary(1)	2	Prostate(51;0.0095)|all_epithelial(25;0.175)		Colorectal(32;0.109)			TGTCATGGAGGAGGTAACAGG	0.542																																						dbGAP											0													135.0	93.0	107.0					10																	81901933		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31232.1	10q23.2	2008-02-04			ENSG00000189129	ENSG00000189129			19255	protein-coding gene	gene with protein product		612857					Standard	NM_001012973		Approved		uc001kbp.1	Q5JTB6	OTTHUMG00000018596	ENST00000372263.3:c.160G>C	10.37:g.81901933G>C	ENSP00000361337:p.Glu54Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E54Q	ENST00000372263.3	37	c.160	CCDS31232.1	10	.	.	.	.	.	.	.	.	.	.	G	11.87	1.767204	0.31320	.	.	ENSG00000189129	ENST00000372270;ENST00000372267;ENST00000372263	.	.	.	3.74	3.74	0.42951	.	0.000000	0.40908	D	0.000995	T	0.64505	0.2604	.	.	.	0.27442	N	0.953681	D	0.76494	0.999	D	0.80764	0.994	T	0.57481	-0.7804	8	0.87932	D	0	.	11.39	0.49809	0.0:0.0:1.0:0.0	.	54	Q5JTB6	PLAC9_HUMAN	Q	12;54;54	.	ENSP00000361337:E54Q	E	+	1	0	PLAC9	81891913	1.000000	0.71417	0.984000	0.44739	0.447000	0.32167	3.538000	0.53597	2.394000	0.81467	0.537000	0.68136	GAG	PLAC9	-	NULL	ENSG00000189129		0.542	PLAC9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLAC9	HGNC	protein_coding	OTTHUMT00000049019.1	36	0.00	0	G	NM_001012973		81901933	81901933	+1	no_errors	ENST00000372263	ensembl	human	known	69_37n	missense	27	35.71	15	SNP	0.987	C
PLEKHM3	389072	genome.wustl.edu	37	2	208811101	208811101	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:208811101G>C	ENST00000427836.2	-	4	2171	c.1682C>G	c.(1681-1683)tCa>tGa	p.S561*	PLEKHM3_ENST00000457206.1_Nonsense_Mutation_p.S561*|PLEKHM3_ENST00000389247.4_Nonsense_Mutation_p.S561*	NM_001080475.2	NP_001073944.1	Q6ZWE6	PKHM3_HUMAN	pleckstrin homology domain containing, family M, member 3	561					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CTTATACTTTGAAGTATCCCA	0.403																																						dbGAP											0													131.0	130.0	130.0					2																	208811101		1902	4122	6024	-	-	-	SO:0001587	stop_gained	0			AK057612	CCDS42808.1	2q33.3	2013-01-10	2008-04-03	2008-04-03	ENSG00000178385	ENSG00000178385		"""Pleckstrin homology (PH) domain containing"""	34006	protein-coding gene	gene with protein product	"""differentiation associated protein"""		"""pleckstrin homology domain containing, family M, member 1-like"""	PLEKHM1L		19028694	Standard	NM_001080475		Approved	DAPR	uc002vcl.2	Q6ZWE6	OTTHUMG00000154781	ENST00000427836.2:c.1682C>G	2.37:g.208811101G>C	ENSP00000417003:p.Ser561*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EKV2|Q8WW68	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S561*	ENST00000427836.2	37	c.1682	CCDS42808.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	42|42	9.581624|9.581624	0.99211|0.99211	.|.	.|.	ENSG00000178385|ENSG00000178385	ENST00000447645|ENST00000427836;ENST00000389247;ENST00000457206	.|.	.|.	.|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.333405	.|0.30840	.|N	.|0.008762	T|.	0.81781|.	0.4895|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.82853|.	-0.0252|.	3|.	.|0.72032	.|D	.|0.01	.|.	19.6982|19.6982	0.96039|0.96039	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	L|X	312|561	.|.	.|ENSP00000373899:S561X	F|S	-|-	3|2	2|0	PLEKHM3|PLEKHM3	208519346|208519346	1.000000|1.000000	0.71417|0.71417	0.993000|0.993000	0.49108|0.49108	0.858000|0.858000	0.48976|0.48976	3.335000|3.335000	0.52105|0.52105	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	TTC|TCA	PLEKHM3	-	NULL	ENSG00000178385		0.403	PLEKHM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM3	HGNC	protein_coding	OTTHUMT00000337036.1	45	0.00	0	G	NM_001080475		208811101	208811101	-1	no_errors	ENST00000427836	ensembl	human	known	69_37n	nonsense	44	25.42	15	SNP	0.977	C
POLR3D	661	genome.wustl.edu	37	8	22107968	22107968	+	Silent	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr8:22107968C>T	ENST00000397802.4	+	8	1349	c.1134C>T	c.(1132-1134)caC>caT	p.H378H	POLR3D_ENST00000306433.4_Silent_p.H378H			P05423	RPC4_HUMAN	polymerase (RNA) III (DNA directed) polypeptide D, 44kDa	378					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)	13				Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)		TCCTGGGACACGTGAAGCACA	0.542																																						dbGAP											0													218.0	182.0	194.0					8																	22107968		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M17754	CCDS34858.1	8q21	2013-01-21	2003-04-01	2003-04-04	ENSG00000168495	ENSG00000168495		"""RNA polymerase subunits"""	1080	protein-coding gene	gene with protein product		187280	"""BN51 (BHK21) temperature sensitivity complementing"""	BN51T		12391170, 11279001	Standard	NM_001722		Approved	TSBN51, RPC4	uc003xbl.3	P05423	OTTHUMG00000163778	ENST00000397802.4:c.1134C>T	8.37:g.22107968C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FI28|Q9BPV7|Q9BPZ1|Q9BXB3	Silent	SNP	pfam_RNA_pol_III_Rpc4	p.H378	ENST00000397802.4	37	c.1134	CCDS34858.1	8																																																																																			POLR3D	-	pfam_RNA_pol_III_Rpc4	ENSG00000168495		0.542	POLR3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3D	HGNC	protein_coding	OTTHUMT00000375434.2	64	0.00	0	C	NM_001722		22107968	22107968	+1	no_errors	ENST00000397802	ensembl	human	known	69_37n	silent	79	21.00	21	SNP	0.918	T
PPM1B	5495	genome.wustl.edu	37	2	44428733	44428733	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:44428733C>G	ENST00000282412.4	+	2	807	c.395C>G	c.(394-396)tCa>tGa	p.S132*	PPM1B_ENST00000409432.3_Nonsense_Mutation_p.S132*|PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000345249.4_Intron|PPM1B_ENST00000378551.2_Nonsense_Mutation_p.S132*|PPM1B_ENST00000409895.4_Nonsense_Mutation_p.S132*	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B	132					cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AGGAGTGGTTCAACTGCAGTG	0.393																																						dbGAP											0													146.0	143.0	144.0					2																	44428733		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.395C>G	2.37:g.44428733C>G	ENSP00000282412:p.Ser132*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	Nonsense_Mutation	SNP	pfam_PP2C-like,pfam_PP2C_C,superfamily_PP2C-like,superfamily_PP2C_C,smart_PP2C-like	p.S132*	ENST00000282412.4	37	c.395	CCDS1817.1	2	.	.	.	.	.	.	.	.	.	.	C	41	8.837521	0.98972	.	.	ENSG00000138032	ENST00000419807;ENST00000409895;ENST00000409432;ENST00000282412;ENST00000378551;ENST00000409473	.	.	.	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-10.0139	19.8632	0.96793	0.0:1.0:0.0:0.0	.	.	.	.	X	132	.	ENSP00000282412:S132X	S	+	2	0	PPM1B	44282237	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.818000	0.86416	2.699000	0.92147	0.655000	0.94253	TCA	PPM1B	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000138032		0.393	PPM1B-001	KNOWN	basic|CCDS	protein_coding	PPM1B	HGNC	protein_coding	OTTHUMT00000250672.1	60	0.00	0	C	NM_002706		44428733	44428733	+1	no_errors	ENST00000282412	ensembl	human	known	69_37n	nonsense	68	20.93	18	SNP	1.000	G
PPP2R5D	5528	genome.wustl.edu	37	6	42976473	42976473	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:42976473C>G	ENST00000485511.1	+	10	1248	c.1069C>G	c.(1069-1071)Ctg>Gtg	p.L357V	PPP2R5D_ENST00000394110.3_Missense_Mutation_p.L325V|PPP2R5D_ENST00000472118.1_Missense_Mutation_p.L349V|PPP2R5D_ENST00000461010.1_Missense_Mutation_p.L251V	NM_001270476.1|NM_006245.3	NP_001257405.1|NP_006236.1	Q14738	2A5D_HUMAN	protein phosphatase 2, regulatory subunit B', delta	357					carbohydrate metabolic process (GO:0005975)|dephosphorylation (GO:0016311)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of catalytic activity (GO:0050790)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)|protein serine/threonine phosphatase activity (GO:0004722)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	25			Colorectal(64;0.00237)|all cancers(41;0.00411)|COAD - Colon adenocarcinoma(64;0.00473)|OV - Ovarian serous cystadenocarcinoma(102;0.0664)|KIRC - Kidney renal clear cell carcinoma(15;0.133)|Kidney(15;0.188)			GGAGAGCAGTCTGACTGAGCC	0.552																																					Melanoma(63;587 1613 29742 31770)	dbGAP											0													73.0	65.0	68.0					6																	42976473		2203	4300	6503	-	-	-	SO:0001583	missense	0			L76702	CCDS4878.1, CCDS43464.1, CCDS55002.1	6p21.1	2010-06-18	2010-04-14		ENSG00000112640	ENSG00000112640		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9312	protein-coding gene	gene with protein product		601646	"""protein phosphatase 2, regulatory subunit B (B56), delta isoform"", ""protein phosphatase 2, regulatory subunit B', delta isoform"""			7592815	Standard	NM_006245		Approved	B56D	uc003oth.4	Q14738	OTTHUMG00000014716	ENST00000485511.1:c.1069C>G	6.37:g.42976473C>G	ENSP00000417963:p.Leu357Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3I9|B5BUA6|O00494|O00696|Q15171|Q5TC39	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.L357V	ENST00000485511.1	37	c.1069	CCDS4878.1	6	.	.	.	.	.	.	.	.	.	.	C	17.10	3.303815	0.60305	.	.	ENSG00000112640	ENST00000485511;ENST00000394110;ENST00000472118;ENST00000461010	T;T;T;T	0.59083	0.29;0.3;0.31;0.37	5.27	4.33	0.51752	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73426	0.3585	M	0.91300	3.195	0.58432	D	0.999999	D;D;D	0.69078	0.995;0.997;0.987	P;D;P	0.64687	0.787;0.928;0.893	T	0.78193	-0.2299	10	0.87932	D	0	-17.9061	11.2863	0.49224	0.0:0.8746:0.0:0.1254	.	251;357;325	Q14738-3;Q14738;Q14738-2	.;2A5D_HUMAN;.	V	357;325;349;251	ENSP00000417963:L357V;ENSP00000377669:L325V;ENSP00000420550:L349V;ENSP00000420674:L251V	ENSP00000377669:L325V	L	+	1	2	PPP2R5D	43084451	0.987000	0.35691	1.000000	0.80357	0.998000	0.95712	2.586000	0.46119	2.758000	0.94735	0.561000	0.74099	CTG	PPP2R5D	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000112640		0.552	PPP2R5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP2R5D	HGNC	protein_coding	OTTHUMT00000040573.3	34	0.00	0	C	NM_006245		42976473	42976473	+1	no_errors	ENST00000485511	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.997	G
PREX1	57580	genome.wustl.edu	37	20	47309237	47309237	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr20:47309237C>A	ENST00000371941.3	-	8	1031	c.1009G>T	c.(1009-1011)Gag>Tag	p.E337*	PREX1_ENST00000396220.1_Nonsense_Mutation_p.E337*	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	337	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			TTCTCCACCTCCATGACTTCA	0.567																																						dbGAP											0													186.0	146.0	159.0					20																	47309237		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1009G>T	20.37:g.47309237C>A	ENSP00000361009:p.Glu337*	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E337*	ENST00000371941.3	37	c.1009	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	C	38	7.060059	0.98036	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	.	.	.	5.22	5.22	0.72569	.	0.000000	0.56097	U	0.000039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.1774	0.93607	0.0:1.0:0.0:0.0	.	.	.	.	X	337	.	ENSP00000361009:E337X	E	-	1	0	PREX1	46742644	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.818000	0.86416	2.601000	0.87937	0.650000	0.86243	GAG	PREX1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000124126		0.567	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	68	0.00	0	C	NM_020820		47309237	47309237	-1	no_errors	ENST00000371941	ensembl	human	known	69_37n	nonsense	52	36.59	30	SNP	1.000	A
PRICKLE4	29964	genome.wustl.edu	37	6	41753249	41753249	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:41753249C>G	ENST00000394260.1	+	3	433	c.433C>G	c.(433-435)Ctg>Gtg	p.L145V	PRICKLE4_ENST00000458694.1_Missense_Mutation_p.L185V|PRICKLE4_ENST00000394259.1_Missense_Mutation_p.L145V|TOMM6_ENST00000398884.3_5'Flank|TOMM6_ENST00000398881.3_5'Flank|PRICKLE4_ENST00000394263.1_Missense_Mutation_p.L185V|PRICKLE4_ENST00000359201.5_Missense_Mutation_p.L185V			Q2TBC4	PRIC4_HUMAN	prickle homolog 4 (Drosophila)	145	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.					nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	13	Ovarian(28;0.0355)|Colorectal(47;0.121)		Epithelial(12;8.38e-05)|STAD - Stomach adenocarcinoma(11;0.000204)|Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)			TGCAGAGTTGCTGCGCCCGCG	0.602																																						dbGAP											0													37.0	38.0	38.0					6																	41753249		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF216754	CCDS34449.1	6p21.1	2010-08-05	2007-09-18	2007-09-18	ENSG00000124593	ENSG00000124593			16805	protein-coding gene	gene with protein product		611389	"""chromosome 6 open reading frame 49"""	C6orf49		15702247	Standard	NM_013397		Approved	OEBT, DKFZp761H221	uc011duf.1	Q2TBC4	OTTHUMG00000014685	ENST00000394260.1:c.433C>G	6.37:g.41753249C>G	ENSP00000377803:p.Leu145Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3M0|A6PVU1|B3KQ15|Q5T3D4|Q9NSV1	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PET_domain,smart_Znf_LIM,pfscan_Znf_LIM	p.L185V	ENST00000394260.1	37	c.553		6	.	.	.	.	.	.	.	.	.	.	C	15.36	2.809460	0.50421	.	.	ENSG00000124593	ENST00000458694;ENST00000359201;ENST00000394263;ENST00000394259;ENST00000394260	D;D;D;D;D	0.87412	-2.25;-2.25;-2.25;-2.25;-2.25	4.71	0.924	0.19418	.	0.000000	0.36409	N	0.002615	T	0.79209	0.4407	L	0.56199	1.76	0.28634	N	0.907493	P	0.45044	0.849	P	0.52823	0.71	T	0.72877	-0.4159	10	0.56958	D	0.05	-11.9941	4.4493	0.11612	0.1469:0.4476:0.0:0.4056	.	185	Q2TBC4-3	.	V	185;185;185;145;145	ENSP00000404911:L185V;ENSP00000352128:L185V;ENSP00000377806:L185V;ENSP00000377802:L145V;ENSP00000377803:L145V	ENSP00000335185:L185V	L	+	1	2	PRICKLE4	41861227	0.869000	0.29996	0.390000	0.26220	0.800000	0.45204	0.631000	0.24568	-0.016000	0.14127	0.561000	0.74099	CTG	PRICKLE4	-	pfscan_Znf_LIM	ENSG00000124593		0.602	PRICKLE4-007	KNOWN	basic	protein_coding	PRICKLE4	HGNC	protein_coding	OTTHUMT00000303948.1	16	0.00	0	C	NM_013397		41753249	41753249	+1	no_errors	ENST00000335515	ensembl	human	known	69_37n	missense	9	47.06	8	SNP	0.837	G
PRKAR1B	5575	genome.wustl.edu	37	7	720286	720286	+	Silent	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:720286G>C	ENST00000406797.1	-	3	429	c.255C>G	c.(253-255)acC>acG	p.T85T	PRKAR1B_ENST00000360274.4_Silent_p.T85T|PRKAR1B_ENST00000544935.1_Silent_p.T85T|PRKAR1B_ENST00000537384.1_Silent_p.T85T|PRKAR1B_ENST00000403562.1_Silent_p.T85T	NM_001164761.1	NP_001158233.1	P31321	KAP1_HUMAN	protein kinase, cAMP-dependent, regulatory, type I, beta	85	Dimerization and phosphorylation.				activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|learning or memory (GO:0007611)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cAMP-dependent protein kinase complex (GO:0005952)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)			endometrium(4)|large_intestine(1)|liver(1)|lung(10)|prostate(1)	17		Ovarian(82;0.0779)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|Epithelial(4;5.75e-19)|OV - Ovarian serous cystadenocarcinoma(56;2.01e-18)|all cancers(6;3.96e-16)|BRCA - Breast invasive adenocarcinoma(126;0.152)		GGTTCGGGGGGGTGGGCGACA	0.617																																						dbGAP											0													63.0	61.0	62.0					7																	720286		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M65066	CCDS34579.1	7p22.3	2013-09-19			ENSG00000188191	ENSG00000188191	2.7.11.1		9390	protein-coding gene	gene with protein product		176911				1358799, 3479018	Standard	NM_002735		Approved		uc003siw.2	P31321	OTTHUMG00000151411	ENST00000406797.1:c.255C>G	7.37:g.720286G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N422	Silent	SNP	pfam_cNMP-bd_dom,pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cNMP-bd-like,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	p.T85	ENST00000406797.1	37	c.255	CCDS34579.1	7																																																																																			PRKAR1B	-	pirsf_cAMP_dep_PK_reg_su	ENSG00000188191		0.617	PRKAR1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PRKAR1B	HGNC	protein_coding	OTTHUMT00000322525.1	13	0.00	0	G			720286	720286	-1	no_errors	ENST00000360274	ensembl	human	known	69_37n	silent	5	66.67	10	SNP	0.006	C
PRMT7	54496	genome.wustl.edu	37	16	68382280	68382280	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr16:68382280C>G	ENST00000339507.5	+	14	2189	c.1359C>G	c.(1357-1359)aaC>aaG	p.N453K	PRMT7_ENST00000441236.1_Missense_Mutation_p.N403K|PRMT7_ENST00000449359.3_Missense_Mutation_p.N403K|PRMT7_ENST00000348497.4_Intron			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	453	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		ATAAAATTAACATCATAGAGA	0.403																																						dbGAP											0													77.0	79.0	78.0					16																	68382280		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.1359C>G	16.37:g.68382280C>G	ENSP00000343103:p.Asn453Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pirsf_Arg_MeTrfase_PRMT7	p.N453K	ENST00000339507.5	37	c.1359	CCDS10866.1	16	.	.	.	.	.	.	.	.	.	.	C	2.188	-0.386039	0.04966	.	.	ENSG00000132600	ENST00000449359;ENST00000441236;ENST00000339507	T;T;T	0.20463	2.07;2.07;2.07	6.06	-2.31	0.06765	.	0.370557	0.34906	N	0.003590	T	0.06188	0.0160	N	0.03608	-0.345	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.38650	-0.9651	10	0.11794	T	0.64	-8.6049	7.1411	0.25556	0.0:0.4108:0.1291:0.4601	.	403;453	Q9NVM4-3;Q9NVM4	.;ANM7_HUMAN	K	403;403;453	ENSP00000414716:N403K;ENSP00000409324:N403K;ENSP00000343103:N453K	ENSP00000343103:N453K	N	+	3	2	PRMT7	66939781	0.068000	0.21057	0.166000	0.22797	0.979000	0.70002	-0.530000	0.06179	-0.323000	0.08602	-0.312000	0.09012	AAC	PRMT7	-	pirsf_Arg_MeTrfase_PRMT7	ENSG00000132600		0.403	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT7	HGNC	protein_coding	OTTHUMT00000268892.3	48	0.00	0	C	NM_019023		68382280	68382280	+1	no_errors	ENST00000339507	ensembl	human	known	69_37n	missense	16	36.00	9	SNP	0.023	G
PRPF4B	8899	genome.wustl.edu	37	6	4037783	4037783	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:4037783G>A	ENST00000337659.6	+	3	1491	c.1391G>A	c.(1390-1392)aGa>aAa	p.R464K	PRPF4B_ENST00000538861.1_Missense_Mutation_p.R450K	NM_003913.4	NP_003904.3	Q13523	PRP4B_HUMAN	pre-mRNA processing factor 4B	464	Arg/Lys-rich (basic).				mRNA splicing, via spliceosome (GO:0000398)|protein phosphorylation (GO:0006468)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|chromosome (GO:0005694)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(3)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	22	Ovarian(93;0.0925)	all_hematologic(90;0.0895)				CCAAGAAGAAGAAGCAGATCT	0.453																																						dbGAP											0													97.0	80.0	86.0					6																	4037783		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48736	CCDS4488.1	6p24.2	2013-10-03	2013-10-03		ENSG00000112739	ENSG00000112739			17346	protein-coding gene	gene with protein product		602338	"""PRP4 pre-mRNA processing factor 4 homolog B (yeast)"""			9628581, 11418604	Standard	XR_241936		Approved	Prp4, PR4H, KIAA0536	uc003mvv.3	Q13523	OTTHUMG00000014157	ENST00000337659.6:c.1391G>A	6.37:g.4037783G>A	ENSP00000337194:p.Arg464Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5C9|Q5D0F6|Q5TAY8|Q8IVC3|Q8TDP2|Q96QT7|Q9UEE6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R464K	ENST00000337659.6	37	c.1391	CCDS4488.1	6	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874820	0.72180	.	.	ENSG00000112739	ENST00000337659;ENST00000538861	T;T	0.69561	-0.41;-0.41	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.64918	0.2642	L	0.58810	1.83	0.52501	D	0.999954	P	0.44690	0.841	P	0.54210	0.745	T	0.62315	-0.6880	10	0.12103	T	0.63	.	18.4896	0.90842	0.0:0.0:1.0:0.0	.	464	Q13523	PRP4B_HUMAN	K	464;450	ENSP00000337194:R464K;ENSP00000439331:R450K	ENSP00000337194:R464K	R	+	2	0	PRPF4B	3982782	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.106000	0.89555	2.342000	0.79632	0.561000	0.74099	AGA	PRPF4B	-	NULL	ENSG00000112739		0.453	PRPF4B-011	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF4B	HGNC	protein_coding	OTTHUMT00000314018.2	27	0.00	0	G			4037783	4037783	+1	no_errors	ENST00000337659	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	1.000	A
ZNF512B	57473	genome.wustl.edu	37	20	62616368	62616368	+	Intron	SNP	A	A	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr20:62616368A>C	ENST00000450537.1	-	2	56				PRPF6_ENST00000535781.1_Missense_Mutation_p.K117Q|ZNF512B_ENST00000217130.3_Intron			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGAAAGAAGAAAAGAAAGACG	0.423																																						dbGAP											0													73.0	70.0	71.0					20																	62616368		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-17060T>G	20.37:g.62616368A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AK9|Q9ULM4	Missense_Mutation	SNP	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.K117Q	ENST00000450537.1	37	c.349	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	A	17.44	3.390237	0.62066	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.81078	-1.43;-1.45	4.9	4.9	0.64082	PRP1 splicing factor, N-terminal (1);	0.098827	0.64402	D	0.000002	D	0.86083	0.5848	M	0.75777	2.31	0.80722	D	1	P;P	0.48350	0.538;0.909	B;P	0.54210	0.273;0.745	D	0.86891	0.2048	10	0.48119	T	0.1	.	14.8845	0.70557	1.0:0.0:0.0:0.0	.	117;117	O94906-2;O94906	.;PRP6_HUMAN	Q	117	ENSP00000266079:K117Q;ENSP00000446216:K117Q	ENSP00000266079:K117Q	K	+	1	0	PRPF6	62086812	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.158000	0.94723	1.979000	0.57680	0.477000	0.44152	AAA	PRPF6	-	pfam_PRP1_N	ENSG00000101161		0.423	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	HGNC	protein_coding	OTTHUMT00000080246.1	32	0.00	0	A	NM_020713		62616368	62616368	+1	no_errors	ENST00000266079	ensembl	human	known	69_37n	missense	58	20.55	15	SNP	1.000	C
RBBP8	5932	genome.wustl.edu	37	18	20581659	20581659	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr18:20581659G>C	ENST00000399722.2	+	15	2605	c.2254G>C	c.(2254-2256)Gag>Cag	p.E752Q	RBBP8_ENST00000360790.5_Missense_Mutation_p.E757Q|RBBP8_ENST00000399725.2_Missense_Mutation_p.E752Q|RBBP8_ENST00000327155.5_Missense_Mutation_p.E752Q|RN7SL745P_ENST00000484900.2_RNA	NM_203291.1	NP_976036.1	Q99708	COM1_HUMAN	retinoblastoma binding protein 8	752	Poly-Glu.				blastocyst hatching (GO:0001835)|cell cycle checkpoint (GO:0000075)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing involved in repair via single-strand annealing (GO:0010792)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|G1/S transition of mitotic cell cycle (GO:0000082)|G2 DNA damage checkpoint (GO:0031572)|meiotic nuclear division (GO:0007126)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	damaged DNA binding (GO:0003684)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			central_nervous_system(1)|cervix(2)|endometrium(5)|large_intestine(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	24	all_cancers(21;4.34e-05)|all_epithelial(16;8.3e-07)|Lung NSC(20;0.0107)|Colorectal(14;0.0202)|all_lung(20;0.0291)|Ovarian(20;0.19)		OV - Ovarian serous cystadenocarcinoma(1;0.00196)			AGATGAAGAGGAGGAATTGTC	0.368								Homologous recombination																														dbGAP											0													123.0	127.0	125.0					18																	20581659		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043431	CCDS11874.1, CCDS11875.1	18q11.2	2012-11-05	2001-11-28		ENSG00000101773	ENSG00000101773			9891	protein-coding gene	gene with protein product	"""CTBP-interacting protein"""	604124	"""retinoblastoma-binding protein 8"", ""Seckel syndrome 2"""	SCKL2		9721205, 17965729, 21998596	Standard	NM_002894		Approved	CtIP, RIM, COM1	uc002ktw.3	Q99708	OTTHUMG00000131769	ENST00000399722.2:c.2254G>C	18.37:g.20581659G>C	ENSP00000382628:p.Glu752Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKN2|A8K8W6|E7ETY1|O75371|Q8NHQ3	Missense_Mutation	SNP	pfam_CtIP_N,pfam_DNA-repair_Sae2/CtIP	p.E752Q	ENST00000399722.2	37	c.2254	CCDS11875.1	18	.	.	.	.	.	.	.	.	.	.	G	10.02	1.236062	0.22626	.	.	ENSG00000101773	ENST00000327155;ENST00000399725;ENST00000399722;ENST00000399721;ENST00000360790	T;T;T;T	0.35605	1.34;1.3;1.34;1.35	5.72	1.73	0.24493	.	0.475840	0.22349	N	0.061236	T	0.27765	0.0683	L	0.51422	1.61	0.26115	N	0.980639	B;P;B	0.35433	0.1;0.501;0.361	B;B;B	0.30495	0.074;0.116;0.116	T	0.11203	-1.0597	10	0.48119	T	0.1	-2.2432	8.9033	0.35507	0.498:0.0:0.502:0.0	.	757;752;752	E7ETY1;A6NKN2;Q99708	.;.;COM1_HUMAN	Q	752;752;752;752;757	ENSP00000323050:E752Q;ENSP00000382630:E752Q;ENSP00000382628:E752Q;ENSP00000354024:E757Q	ENSP00000323050:E752Q	E	+	1	0	RBBP8	18835657	1.000000	0.71417	0.381000	0.26106	0.468000	0.32798	1.728000	0.38105	0.304000	0.22809	0.644000	0.83932	GAG	RBBP8	-	NULL	ENSG00000101773		0.368	RBBP8-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RBBP8	HGNC	protein_coding	OTTHUMT00000446387.1	53	0.00	0	G	NM_203291		20581659	20581659	+1	no_errors	ENST00000327155	ensembl	human	known	69_37n	missense	61	20.78	16	SNP	0.057	C
RGPD4	285190	genome.wustl.edu	37	2	108487221	108487221	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:108487221G>C	ENST00000408999.3	+	20	2838	c.2761G>C	c.(2761-2763)Gat>Cat	p.D921H	RGPD4_ENST00000354986.4_Missense_Mutation_p.D921H	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	921					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TGTGTCTGCTGATGGATTTAA	0.383																																						dbGAP											0													22.0	25.0	24.0					2																	108487221		692	1584	2276	-	-	-	SO:0001583	missense	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.2761G>C	2.37:g.108487221G>C	ENSP00000386810:p.Asp921His	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.D921H	ENST00000408999.3	37	c.2761	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	11.56	1.674919	0.29783	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.39997	1.05;1.05	2.33	2.33	0.28932	.	.	.	.	.	T	0.43722	0.1260	L	0.54323	1.7	0.25290	N	0.989363	P	0.47762	0.9	P	0.48873	0.593	T	0.20974	-1.0259	9	0.42905	T	0.14	-19.8326	8.2916	0.31960	0.0:0.2471:0.7529:0.0	.	921	Q7Z3J3	RGPD4_HUMAN	H	921;921;679	ENSP00000347081:D921H;ENSP00000386810:D921H	ENSP00000347081:D921H	D	+	1	0	RGPD4	107853653	1.000000	0.71417	1.000000	0.80357	0.607000	0.37147	4.590000	0.61013	1.303000	0.44873	0.162000	0.16502	GAT	RGPD4	-	NULL	ENSG00000196862		0.383	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	73	0.00	0	G	XM_496581		108487221	108487221	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	missense	78	33.33	39	SNP	1.000	C
RIN3	79890	genome.wustl.edu	37	14	93118024	93118024	+	Silent	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr14:93118024C>G	ENST00000216487.7	+	6	789	c.630C>G	c.(628-630)ctC>ctG	p.L210L	RIN3_ENST00000418924.2_3'UTR	NM_024832.3	NP_079108.3	Q8TB24	RIN3_HUMAN	Ras and Rab interactor 3	210					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|signal transduction (GO:0007165)	cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)	GTPase activator activity (GO:0005096)|Rab GTPase binding (GO:0017137)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			endometrium(4)|kidney(2)|large_intestine(7)|lung(19)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	36		all_cancers(154;0.0701)				TCTCCAGCCTCAGGCCCACAG	0.572																																						dbGAP											0													71.0	73.0	73.0					14																	93118024		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025248	CCDS32144.1	14q32.13	2008-08-29				ENSG00000100599			18751	protein-coding gene	gene with protein product		610223				11733506	Standard	NM_024832		Approved	FLJ22439	uc001yap.3	Q8TB24		ENST00000216487.7:c.630C>G	14.37:g.93118024C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q76LB3|Q8NF30|Q8TEE8|Q8WYP4|Q9H6A5|Q9HAG1	Silent	SNP	pfam_VPS9,smart_SH2,smart_VPS9_subgr,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.L210	ENST00000216487.7	37	c.630	CCDS32144.1	14																																																																																			RIN3	-	NULL	ENSG00000100599		0.572	RIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN3	HGNC	protein_coding	OTTHUMT00000412269.1	24	0.00	0	C			93118024	93118024	+1	no_errors	ENST00000216487	ensembl	human	known	69_37n	silent	24	27.27	9	SNP	0.340	G
RNF128	79589	genome.wustl.edu	37	X	105937522	105937522	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chrX:105937522G>A	ENST00000324342.3	+	1	455	c.290G>A	c.(289-291)aGa>aAa	p.R97K		NM_024539.3	NP_078815.3	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	122	PA.				negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						CTGATAGAAAGAGGTAATTGT	0.413																																						dbGAP											0													85.0	76.0	79.0					X																	105937522		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000324342.3:c.290G>A	X.37:g.105937522G>A	ENSP00000316127:p.Arg97Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.R97K	ENST00000324342.3	37	c.290	CCDS14520.1	X	.	.	.	.	.	.	.	.	.	.	G	17.82	3.482528	0.63962	.	.	ENSG00000133135	ENST00000418562;ENST00000324342	T;T	0.11821	2.74;2.74	5.8	5.8	0.92144	.	.	.	.	.	T	0.46521	0.1397	M	0.91612	3.225	0.80722	D	1	D	0.56521	0.976	D	0.66979	0.948	T	0.54139	-0.8338	9	0.49607	T	0.09	.	17.4311	0.87539	0.0:0.0:1.0:0.0	.	97	Q8TEB7-2	.	K	70;97	ENSP00000412610:R70K;ENSP00000316127:R97K	ENSP00000316127:R97K	R	+	2	0	RNF128	105824178	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.786000	0.62425	2.435000	0.82474	0.594000	0.82650	AGA	RNF128	-	pfam_Protease-assoc_domain	ENSG00000133135		0.413	RNF128-002	KNOWN	basic|CCDS	protein_coding	RNF128	HGNC	protein_coding	OTTHUMT00000057805.1	34	0.00	0	G	NM_024539		105937522	105937522	+1	no_errors	ENST00000324342	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	A
SALL1	6299	genome.wustl.edu	37	16	51175790	51175790	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr16:51175790C>G	ENST00000251020.4	-	2	376	c.343G>C	c.(343-345)Gaa>Caa	p.E115Q	SALL1_ENST00000562674.1_5'Flank|SALL1_ENST00000541611.1_Intron|SALL1_ENST00000566102.1_Intron|SALL1_ENST00000440970.1_Missense_Mutation_p.E18Q	NM_002968.2	NP_002959.2	Q9NSC2	SALL1_HUMAN	spalt-like transcription factor 1	115					adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|embryonic digestive tract development (GO:0048566)|embryonic digit morphogenesis (GO:0042733)|forelimb morphogenesis (GO:0035136)|gonad development (GO:0008406)|heart development (GO:0007507)|hindlimb morphogenesis (GO:0035137)|histone deacetylation (GO:0016575)|inductive cell-cell signaling (GO:0031129)|kidney development (GO:0001822)|kidney epithelium development (GO:0072073)|limb development (GO:0060173)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|olfactory bulb interneuron differentiation (GO:0021889)|olfactory bulb mitral cell layer development (GO:0061034)|olfactory nerve development (GO:0021553)|outer ear morphogenesis (GO:0042473)|pituitary gland development (GO:0021983)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neural precursor cell proliferation (GO:2000177)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)|ureteric bud invasion (GO:0072092)|ventricular septum development (GO:0003281)	chromocenter (GO:0010369)|cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(2)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(25)|lung(61)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	126		all_cancers(37;0.0322)	COAD - Colon adenocarcinoma(2;0.24)			CCGTTGTGTTCTGAAAGGTCG	0.547																																					GBM(103;1352 1446 1855 4775 8890)	dbGAP											0													112.0	115.0	114.0					16																	51175790		2198	4300	6498	-	-	-	SO:0001583	missense	0			X98833	CCDS10747.1, CCDS45483.1	16q12.1	2014-09-17	2013-10-17		ENSG00000103449	ENSG00000103449		"""Zinc fingers, C2H2-type"""	10524	protein-coding gene	gene with protein product		602218	"""sal (Drosophila)-like 1"", ""sal-like 1 (Drosophila)"""	TBS		9425907	Standard	NM_002968		Approved	Hsal1, ZNF794	uc021tie.1	Q9NSC2	OTTHUMG00000133176	ENST00000251020.4:c.343G>C	16.37:g.51175790C>G	ENSP00000251020:p.Glu115Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99881|Q9NSC3|Q9P1R0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E115Q	ENST00000251020.4	37	c.343	CCDS10747.1	16	.	.	.	.	.	.	.	.	.	.	C	13.03	2.115954	0.37339	.	.	ENSG00000103449	ENST00000251020;ENST00000440970	T;T	0.10573	2.86;3.12	5.21	4.23	0.50019	.	0.137700	0.64402	N	0.000004	T	0.14270	0.0345	L	0.59436	1.845	0.54753	D	0.999982	B	0.06786	0.001	B	0.10450	0.005	T	0.02307	-1.1179	10	0.42905	T	0.14	.	15.455	0.75305	0.0:0.8605:0.1394:0.0	.	115	Q9NSC2	SALL1_HUMAN	Q	115;18	ENSP00000251020:E115Q;ENSP00000407914:E18Q	ENSP00000251020:E115Q	E	-	1	0	SALL1	49733291	1.000000	0.71417	0.794000	0.32065	0.930000	0.56654	4.949000	0.63596	1.125000	0.41998	0.555000	0.69702	GAA	SALL1	-	NULL	ENSG00000103449		0.547	SALL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL1	HGNC	protein_coding	OTTHUMT00000256883.2	91	0.00	0	C	NM_002968		51175790	51175790	-1	no_errors	ENST00000251020	ensembl	human	known	69_37n	missense	59	35.16	32	SNP	1.000	G
SERPINE1	5054	genome.wustl.edu	37	7	100773847	100773847	+	Silent	SNP	G	G	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:100773847G>T	ENST00000223095.4	+	3	574	c.417G>T	c.(415-417)ctG>ctT	p.L139L	SERPINE1_ENST00000445463.2_Silent_p.L124L	NM_000602.4	NP_000593.1	P05121	PAI1_HUMAN	serpin peptidase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1	139					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cellular response to lipopolysaccharide (GO:0071222)|chronological cell aging (GO:0001300)|defense response to Gram-negative bacterium (GO:0050829)|extracellular matrix organization (GO:0030198)|fibrinolysis (GO:0042730)|gene expression (GO:0010467)|negative regulation of blood coagulation (GO:0030195)|negative regulation of cell adhesion mediated by integrin (GO:0033629)|negative regulation of cell migration (GO:0030336)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of plasminogen activation (GO:0010757)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell-matrix adhesion (GO:2000098)|negative regulation of vascular wound healing (GO:0061044)|negative regulation of wound healing (GO:0061045)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukotriene production involved in inflammatory response (GO:0035491)|positive regulation of monocyte chemotaxis (GO:0090026)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell proliferation (GO:0042127)|regulation of receptor activity (GO:0010469)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	protease binding (GO:0002020)|serine-type endopeptidase inhibitor activity (GO:0004867)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(3)	20	Lung NSC(181;0.136)|all_lung(186;0.182)				Alteplase(DB00009)|Anistreplase(DB00029)|Drotrecogin alfa(DB00055)|Reteplase(DB00015)|Tenecteplase(DB00031)|Urokinase(DB00013)	TCTTCAGGCTGTTCCGGAGCA	0.547																																						dbGAP											0													245.0	225.0	232.0					7																	100773847		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M16006	CCDS5711.1	7q22.1	2014-02-18	2005-08-18		ENSG00000106366	ENSG00000106366		"""Serine (or cysteine) peptidase inhibitors"""	8583	protein-coding gene	gene with protein product	"""plasminogen activator inhibitor, type I"""	173360	"""serine (or cysteine) proteinase inhibitor, clade E (nexin, plasminogen activator inhibitor type 1), member 1"""	PLANH1, PAI1		3097076, 2891140, 24172014	Standard	NM_000602		Approved	PAI	uc003uxt.4	P05121	OTTHUMG00000157107	ENST00000223095.4:c.417G>T	7.37:g.100773847G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4S0|F8WD53	Silent	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.L139	ENST00000223095.4	37	c.417	CCDS5711.1	7																																																																																			SERPINE1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000106366		0.547	SERPINE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINE1	HGNC	protein_coding	OTTHUMT00000347458.1	34	0.00	0	G	NM_000602		100773847	100773847	+1	no_errors	ENST00000223095	ensembl	human	known	69_37n	silent	29	12.12	4	SNP	0.965	T
SHE	126669	genome.wustl.edu	37	1	154473950	154473950	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:154473950C>T	ENST00000304760.2	-	1	639	c.553G>A	c.(553-555)Gag>Aag	p.E185K	TDRD10_ENST00000368482.4_5'Flank|TDRD10_ENST00000368480.3_5'Flank	NM_001010846.2	NP_001010846.1	Q5VZ18	SHE_HUMAN	Src homology 2 domain containing E	185										breast(4)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(2)|pancreas(1)	14	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			TTGTCCAGCTCGGGCCCCAGg	0.592																																						dbGAP											0													101.0	94.0	96.0					1																	154473950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074067	CCDS30877.1	1q21.3	2013-02-14			ENSG00000169291	ENSG00000169291		"""SH2 domain containing"""	27004	protein-coding gene	gene with protein product		610482				9315092	Standard	NM_001010846		Approved		uc001ffb.3	Q5VZ18	OTTHUMG00000036072	ENST00000304760.2:c.553G>A	1.37:g.154473950C>T	ENSP00000307369:p.Glu185Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEQ5	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.E185K	ENST00000304760.2	37	c.553	CCDS30877.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.387781	0.82902	.	.	ENSG00000169291	ENST00000304760	T	0.31769	1.48	4.86	4.86	0.63082	.	0.658638	0.15501	N	0.259027	T	0.28333	0.0700	L	0.50333	1.59	0.39138	D	0.961995	D	0.67145	0.996	P	0.52189	0.692	T	0.01853	-1.1260	10	0.41790	T	0.15	-10.0252	13.3547	0.60621	0.0:1.0:0.0:0.0	.	185	Q5VZ18	SHE_HUMAN	K	185	ENSP00000307369:E185K	ENSP00000307369:E185K	E	-	1	0	SHE	152740574	0.913000	0.31002	0.909000	0.35828	0.948000	0.59901	3.963000	0.56773	2.507000	0.84556	0.561000	0.74099	GAG	SHE	-	NULL	ENSG00000169291		0.592	SHE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHE	HGNC	protein_coding	OTTHUMT00000087910.2	36	0.00	0	C	NM_001010846		154473950	154473950	-1	no_errors	ENST00000304760	ensembl	human	known	69_37n	missense	48	29.41	20	SNP	0.982	T
SLC15A2	6565	genome.wustl.edu	37	3	121658238	121658238	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:121658238C>G	ENST00000489711.1	+	20	2192	c.1804C>G	c.(1804-1806)Cca>Gca	p.P602A	SLC15A2_ENST00000295605.2_Missense_Mutation_p.P571A	NM_021082.3	NP_066568.3	Q16348	S15A2_HUMAN	solute carrier family 15 (oligopeptide transporter), member 2	602					drug transport (GO:0015893)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	antibiotic transporter activity (GO:0042895)|dipeptide transporter activity (GO:0042936)|high-affinity oligopeptide transporter activity (GO:0015334)|peptide:proton symporter activity (GO:0015333)			NS(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(17)|skin(6)|upper_aerodigestive_tract(2)	36				GBM - Glioblastoma multiforme(114;0.0967)	Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Fosinopril(DB00492)|Glyburide(DB01016)|Moexipril(DB00691)|Nateglinide(DB00731)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Tranexamic Acid(DB00302)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TGAAGACATTCCAGCCAACAA	0.433																																						dbGAP											0													156.0	146.0	149.0					3																	121658238		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC044572	CCDS3007.1, CCDS54631.1	3q21.1	2013-07-18	2013-07-18		ENSG00000163406	ENSG00000163406		"""Solute carriers"""	10921	protein-coding gene	gene with protein product		602339	"""solute carrier family 15 (H+/peptide transporter), member 2"""			7756356	Standard	NM_021082		Approved	PEPT2	uc003eep.2	Q16348	OTTHUMG00000159423	ENST00000489711.1:c.1804C>G	3.37:g.121658238C>G	ENSP00000417085:p.Pro602Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A5|B4E2A7	Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	p.P602A	ENST00000489711.1	37	c.1804	CCDS3007.1	3	.	.	.	.	.	.	.	.	.	.	C	9.348	1.064891	0.20067	.	.	ENSG00000163406	ENST00000489711;ENST00000542599;ENST00000295605	T;T	0.02974	4.38;4.09	5.8	3.61	0.41365	.	0.572571	0.20063	N	0.100026	T	0.03305	0.0096	L	0.57536	1.79	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.41161	-0.9524	10	0.20046	T	0.44	-0.0316	5.4063	0.16323	0.2073:0.6321:0.0:0.1606	.	571;602	B4E2A7;Q16348	.;S15A2_HUMAN	A	602;564;571	ENSP00000417085:P602A;ENSP00000295605:P571A	ENSP00000295605:P571A	P	+	1	0	SLC15A2	123140928	0.000000	0.05858	0.257000	0.24404	0.685000	0.39939	0.479000	0.22228	1.377000	0.46286	0.655000	0.94253	CCA	SLC15A2	-	tigrfam_Pep_H_symport	ENSG00000163406		0.433	SLC15A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A2	HGNC	protein_coding	OTTHUMT00000355239.1	53	0.00	0	C	NM_021082		121658238	121658238	+1	no_errors	ENST00000489711	ensembl	human	known	69_37n	missense	88	25.42	30	SNP	0.027	G
SMAP1	60682	genome.wustl.edu	37	6	71546704	71546704	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:71546704G>C	ENST00000370455.3	+	7	885	c.637G>C	c.(637-639)Gag>Cag	p.E213Q	SMAP1_ENST00000316999.5_Missense_Mutation_p.E186Q|SMAP1_ENST00000370452.3_Missense_Mutation_p.E186Q	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	213					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						AAAAGCTGCGGAGCCCACTGT	0.333																																						dbGAP											0													34.0	38.0	37.0					6																	71546704		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.637G>C	6.37:g.71546704G>C	ENSP00000359484:p.Glu213Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Missense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,prints_ArfGAP,pfscan_ArfGAP	p.E213Q	ENST00000370455.3	37	c.637	CCDS43478.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.92|12.92	2.083443|2.083443	0.36758|0.36758	.|.	.|.	ENSG00000112305|ENSG00000112305	ENST00000370452;ENST00000316999;ENST00000370455;ENST00000370442|ENST00000439432	T;T;T|.	0.24151|.	2.17;2.23;1.87|.	5.12|5.12	5.12|5.12	0.69794|0.69794	.|.	3.457300|.	0.05175|.	N|.	0.500280|.	T|T	0.63988|0.63988	0.2558|0.2558	L|L	0.55743|0.55743	1.74|1.74	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;0.999;0.996;1.0|.	D;D;D;D|.	0.85130|.	0.997;0.996;0.991;0.975|.	T|T	0.61441|0.61441	-0.7062|-0.7062	10|5	0.34782|.	T|.	0.22|.	-19.331|-19.331	18.494|18.494	0.90858|0.90858	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	213;186;186;213|.	A8K333;Q8IYB5-3;Q8IYB5-2;Q8IYB5|.	.;.;.;SMAP1_HUMAN|.	Q|A	186;186;213;125|87	ENSP00000359481:E186Q;ENSP00000313382:E186Q;ENSP00000359484:E213Q|.	ENSP00000313382:E186Q|.	E|G	+|+	1|2	0|0	SMAP1|SMAP1	71603425|71603425	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.029000|0.029000	0.11900|0.11900	6.859000|6.859000	0.75467|0.75467	2.531000|2.531000	0.85337|0.85337	0.655000|0.655000	0.94253|0.94253	GAG|GGA	SMAP1	-	NULL	ENSG00000112305		0.333	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAP1	HGNC	protein_coding	OTTHUMT00000041149.1	45	0.00	0	G	NM_001044305		71546704	71546704	+1	no_errors	ENST00000370455	ensembl	human	known	69_37n	missense	37	38.33	23	SNP	1.000	C
SMC6	79677	genome.wustl.edu	37	2	17896164	17896164	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:17896164G>A	ENST00000448223.2	-	16	1963	c.1694C>T	c.(1693-1695)tCt>tTt	p.S565F	SMC6_ENST00000402989.1_Missense_Mutation_p.S565F|SMC6_ENST00000351948.4_Missense_Mutation_p.S565F|SMC6_ENST00000381272.4_Missense_Mutation_p.S591F	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	565	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CCGAAACTCAGAAACTATTAT	0.398																																						dbGAP											0													101.0	99.0	100.0					2																	17896164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1694C>T	2.37:g.17896164G>A	ENSP00000404092:p.Ser565Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	NULL	p.S591F	ENST00000448223.2	37	c.1772	CCDS1690.1	2	.	.	.	.	.	.	.	.	.	.	G	19.65	3.867509	0.72065	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.35789	2.34;2.34;2.34;2.34;1.29	6.16	6.16	0.99307	RecF/RecN/SMC (1);	0.129691	0.64402	D	0.000001	T	0.54663	0.1872	M	0.64170	1.965	0.48135	D	0.999596	D;P;D	0.89917	1.0;0.881;1.0	D;P;D	0.79784	0.984;0.614;0.993	T	0.54377	-0.8303	10	0.59425	D	0.04	.	10.3493	0.43924	0.0:0.1178:0.6469:0.2353	.	591;591;565	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	F	565;565;591;565;591	ENSP00000404092:S565F;ENSP00000323439:S565F;ENSP00000370672:S591F;ENSP00000384539:S565F;ENSP00000408644:S591F	ENSP00000323439:S565F	S	-	2	0	SMC6	17759645	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.747000	0.38298	2.937000	0.99478	0.650000	0.86243	TCT	SMC6	-	NULL	ENSG00000163029		0.398	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC6	HGNC	protein_coding	OTTHUMT00000207359.1	37	0.00	0	G	NM_024624		17896164	17896164	-1	no_errors	ENST00000381272	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	0.978	A
SMEK2	57223	genome.wustl.edu	37	2	55806833	55806833	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr2:55806833C>T	ENST00000345102.5	-	9	1751	c.1450G>A	c.(1450-1452)Gaa>Aaa	p.E484K	SMEK2_ENST00000407823.3_Missense_Mutation_p.E484K|SMEK2_ENST00000272313.5_Missense_Mutation_p.E484K	NM_001122964.1	NP_001116436	Q5MIZ7	P4R3B_HUMAN	SMEK homolog 2, suppressor of mek1 (Dictyostelium)	484					positive regulation of gluconeogenesis (GO:0045722)|protein dephosphorylation (GO:0006470)|regulation of lipid metabolic process (GO:0019216)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)				kidney(1)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			CATTTGTCTTCTGAAGTATTG	0.308																																						dbGAP											0													101.0	104.0	103.0					2																	55806833		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB037808	CCDS1855.1, CCDS46289.1, CCDS62913.1	2p16.1	2008-09-15			ENSG00000138041				29267	protein-coding gene	gene with protein product		610352				16085932, 18614045	Standard	NM_001122964		Approved	PSY2, FLFL2, KIAA1387, FLJ31474	uc002rzc.3	Q5MIZ7	OTTHUMG00000129336	ENST00000345102.5:c.1450G>A	2.37:g.55806833C>T	ENSP00000339769:p.Glu484Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P9B0|Q86XB8|Q9BQJ0|Q9BRK2|Q9H913|Q9P2G0	Missense_Mutation	SNP	pfam_DUF625,superfamily_ARM-type_fold	p.E484K	ENST00000345102.5	37	c.1450	CCDS46289.1	2	.	.	.	.	.	.	.	.	.	.	C	14.40	2.523248	0.44866	.	.	ENSG00000138041	ENST00000272313;ENST00000407823;ENST00000345102	T;T;T	0.42900	1.57;0.96;0.96	5.62	4.75	0.60458	Armadillo-like helical (1);Armadillo-type fold (1);	0.205916	0.51477	N	0.000084	T	0.32224	0.0822	L	0.35288	1.05	0.40978	D	0.984759	B;B;B;B	0.23249	0.0;0.0;0.082;0.001	B;B;B;B	0.16289	0.003;0.003;0.015;0.003	T	0.08534	-1.0717	10	0.23302	T	0.38	-5.1177	14.8251	0.70104	0.0:0.9308:0.0:0.0692	.	484;484;484;484	Q5MIZ7-2;Q5MIZ7;Q5MIZ7-3;B4DKA9	.;P4R3B_HUMAN;.;.	K	484	ENSP00000272313:E484K;ENSP00000385912:E484K;ENSP00000339769:E484K	ENSP00000272313:E484K	E	-	1	0	SMEK2	55660337	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	6.240000	0.72363	1.400000	0.46741	-0.219000	0.12488	GAA	SMEK2	-	superfamily_ARM-type_fold	ENSG00000138041		0.308	SMEK2-002	NOVEL	basic|CCDS	protein_coding	SMEK2	HGNC	protein_coding	OTTHUMT00000251483.1	77	0.00	0	C	NM_020463		55806833	55806833	-1	no_errors	ENST00000272313	ensembl	human	known	69_37n	missense	108	14.96	19	SNP	1.000	T
SNX15	29907	genome.wustl.edu	37	11	64803125	64803125	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:64803125C>A	ENST00000377244.3	+	6	784	c.654C>A	c.(652-654)ttC>ttA	p.F218L	RP11-399J13.3_ENST00000301886.3_3'UTR|SNX15_ENST00000352068.5_Missense_Mutation_p.F218L	NM_013306.4|NM_147777.3	NP_037438.2|NP_680086.2	Q9NRS6	SNX15_HUMAN	sorting nexin 15	218					intracellular protein transport (GO:0006886)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	phosphatidylinositol binding (GO:0035091)	p.F218L(1)		endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	14						TCGACCCCTTCTCCAAGGAAG	0.637																																					Esophageal Squamous(56;269 1304 3324 8253)	dbGAP											1	Substitution - Missense(1)	lung(1)											60.0	60.0	60.0					11																	64803125		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF175267	CCDS8089.1, CCDS8090.1	11q12	2008-05-22			ENSG00000110025	ENSG00000110025		"""Sorting nexins"""	14978	protein-coding gene	gene with protein product		605964				11208079	Standard	NM_013306		Approved			Q9NRS6	OTTHUMG00000037387	ENST00000377244.3:c.654C>A	11.37:g.64803125C>A	ENSP00000366452:p.Phe218Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E5KQS6|Q9NRS5	Missense_Mutation	SNP	pfam_MIT,pfam_Phox,superfamily_Phox,smart_Phox,smart_MIT,pfscan_Phox	p.F218L	ENST00000377244.3	37	c.654	CCDS8089.1	11	.	.	.	.	.	.	.	.	.	.	C	14.41	2.528462	0.44969	.	.	ENSG00000110025	ENST00000377244;ENST00000534637;ENST00000352068	T;T;T	0.33438	1.95;1.41;1.93	4.43	3.52	0.40303	.	0.795744	0.11893	N	0.519399	T	0.16811	0.0404	N	0.14661	0.345	0.30166	N	0.801728	B;B;B	0.24483	0.104;0.018;0.104	B;B;B	0.21708	0.036;0.025;0.036	T	0.18681	-1.0329	10	0.27082	T	0.32	-11.8312	6.5991	0.22691	0.0:0.7903:0.0:0.2097	.	218;218;218	E5KQS5;E5KQS6;Q9NRS6	.;.;SNX15_HUMAN	L	218;214;218	ENSP00000366452:F218L;ENSP00000437277:F214L;ENSP00000316410:F218L	ENSP00000316410:F218L	F	+	3	2	SNX15	64559701	1.000000	0.71417	1.000000	0.80357	0.704000	0.40688	3.716000	0.54904	1.093000	0.41377	0.563000	0.77884	TTC	SNX15	-	NULL	ENSG00000110025		0.637	SNX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX15	HGNC	protein_coding	OTTHUMT00000091004.3	30	0.00	0	C			64803125	64803125	+1	no_errors	ENST00000377244	ensembl	human	known	69_37n	missense	28	30.00	12	SNP	1.000	A
SPIC	121599	genome.wustl.edu	37	12	101871392	101871392	+	Silent	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr12:101871392G>C	ENST00000551346.1	+	3	219	c.60G>C	c.(58-60)ctG>ctC	p.L20L	SPIC_ENST00000299272.5_Silent_p.L20L			Q8N5J4	SPIC_HUMAN	Spi-C transcription factor (Spi-1/PU.1 related)	20					blastocyst development (GO:0001824)|cell differentiation (GO:0030154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	22						TTGAGGTTCTGAGGCAACATT	0.418																																						dbGAP											0													138.0	126.0	130.0					12																	101871392		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF518404	CCDS9082.1	12q23	2005-10-18				ENSG00000166211			29549	protein-coding gene	gene with protein product		612568				12459275	Standard	NM_152323		Approved	MGC40611, SPI-C	uc021rcq.1	Q8N5J4	OTTHUMG00000170273	ENST00000551346.1:c.60G>C	12.37:g.101871392G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.L20	ENST00000551346.1	37	c.60	CCDS9082.1	12																																																																																			SPIC	-	NULL	ENSG00000166211		0.418	SPIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIC	HGNC	protein_coding	OTTHUMT00000408260.1	49	0.00	0	G	NM_152323		101871392	101871392	+1	no_errors	ENST00000299272	ensembl	human	known	69_37n	silent	42	30.00	18	SNP	0.980	C
SSRP1	6749	genome.wustl.edu	37	11	57099625	57099625	+	Splice_Site	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:57099625C>A	ENST00000278412.2	-	8	1268		c.e8+1			NM_003146.2	NP_003137.1	Q08945	SSRP1_HUMAN	structure specific recognition protein 1						DNA repair (GO:0006281)|DNA replication (GO:0006260)|gene expression (GO:0010467)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|prostate(4)	23						CACACTCTCACCCTTGGAAGT	0.567																																					Colon(89;1000 1340 6884 23013 41819)	dbGAP											0													98.0	79.0	85.0					11																	57099625		2201	4296	6497	-	-	-	SO:0001630	splice_region_variant	0			M86737	CCDS7952.1	11q12	2008-02-05			ENSG00000149136	ENSG00000149136			11327	protein-coding gene	gene with protein product	"""facilitates chromatin remodeling 80 kDa subunit"""	604328				1372440	Standard	NM_003146		Approved	FACT80	uc001njt.3	Q08945	OTTHUMG00000167024	ENST00000278412.2:c.1001+1G>T	11.37:g.57099625C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BJG8	Splice_Site	SNP	-	e7+1	ENST00000278412.2	37	c.1001+1	CCDS7952.1	11	.	.	.	.	.	.	.	.	.	.	C	22.4	4.282849	0.80692	.	.	ENSG00000149136	ENST00000278412	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6588	0.91465	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SSRP1	56856201	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.217000	0.77982	2.746000	0.94184	0.655000	0.94253	.	SSRP1	-	-	ENSG00000149136		0.567	SSRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSRP1	HGNC	protein_coding	OTTHUMT00000392460.1	29	0.00	0	C	NM_003146	Intron	57099625	57099625	-1	no_errors	ENST00000278412	ensembl	human	known	69_37n	splice_site	37	24.49	12	SNP	1.000	A
STIP1	10963	genome.wustl.edu	37	11	63970680	63970680	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:63970680G>C	ENST00000305218.4	+	12	1513	c.1366G>C	c.(1366-1368)Gac>Cac	p.D456H	STIP1_ENST00000538945.1_Missense_Mutation_p.D432H|STIP1_ENST00000358794.5_Missense_Mutation_p.D503H	NM_006819.2	NP_006810.1	P31948	STIP1_HUMAN	stress-induced phosphoprotein 1	456					response to stress (GO:0006950)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(3)|liver(1)|lung(15)|ovary(2)|prostate(1)|skin(1)	27						GAAGGCGCTAGACCTGGACTC	0.552																																						dbGAP											0													63.0	62.0	63.0					11																	63970680		2201	4297	6498	-	-	-	SO:0001583	missense	0			BC039299	CCDS8058.1, CCDS60827.1, CCDS60828.1	11q13	2014-01-13	2014-01-13		ENSG00000168439	ENSG00000168439		"""Tetratricopeptide (TTC) repeat domain containing"""	11387	protein-coding gene	gene with protein product	"""Hsp70/Hsp90-organizing protein"""	605063	"""stress-induced-phosphoprotein 1"""			1569099	Standard	NM_006819		Approved	HOP, STI1	uc001nyk.1	P31948	OTTHUMG00000167789	ENST00000305218.4:c.1366G>C	11.37:g.63970680G>C	ENSP00000305958:p.Asp456His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM70|F5H0T1|G3XAD8|Q3ZCU9|Q5TZU9	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_STI1_HS-bd,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D456H	ENST00000305218.4	37	c.1366	CCDS8058.1	11	.	.	.	.	.	.	.	.	.	.	G	33	5.224671	0.95173	.	.	ENSG00000168439	ENST00000358794;ENST00000305218;ENST00000538945;ENST00000540887	T;T;T;T	0.63744	-0.06;-0.06;-0.06;0.23	5.45	5.45	0.79879	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.204963	0.50627	D	0.000108	T	0.69984	0.3172	L	0.32530	0.975	0.80722	D	1	P;P	0.40230	0.508;0.708	P;P	0.56398	0.694;0.797	T	0.71324	-0.4627	10	0.72032	D	0.01	-21.5942	18.4343	0.90638	0.0:0.0:1.0:0.0	.	432;456	F5H0T1;P31948	.;STIP1_HUMAN	H	503;456;432;55	ENSP00000351646:D503H;ENSP00000305958:D456H;ENSP00000445957:D432H;ENSP00000443416:D55H	ENSP00000305958:D456H	D	+	1	0	STIP1	63727256	1.000000	0.71417	0.935000	0.37517	0.972000	0.66771	7.071000	0.76770	2.744000	0.94065	0.561000	0.74099	GAC	STIP1	-	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000168439		0.552	STIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STIP1	HGNC	protein_coding	OTTHUMT00000396289.2	23	0.00	0	G	NM_006819		63970680	63970680	+1	no_errors	ENST00000305218	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	C
TCP11L2	255394	genome.wustl.edu	37	12	106729428	106729428	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr12:106729428C>T	ENST00000299045.3	+	7	958	c.784C>T	c.(784-786)Cag>Tag	p.Q262*		NM_152772.1	NP_689985.1	Q8N4U5	T11L2_HUMAN	t-complex 11, testis-specific-like 2	262										endometrium(2)|kidney(2)|large_intestine(5)|ovary(3)|prostate(1)|urinary_tract(2)	15						TGCTCTTGATCAGACTACAGA	0.423																																						dbGAP											0													53.0	56.0	55.0					12																	106729428		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC033617	CCDS9104.1, CCDS66456.1	12q23.3	2014-08-12	2012-09-20		ENSG00000166046	ENSG00000166046			28627	protein-coding gene	gene with protein product			"""t-complex 11 (mouse) like 2"", ""t-complex 11 (mouse)-like 2"""				Standard	XM_005268769		Approved	MGC40368	uc001tln.3	Q8N4U5	OTTHUMG00000170087	ENST00000299045.3:c.784C>T	12.37:g.106729428C>T	ENSP00000299045:p.Gln262*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA65|G3V1Y9	Nonsense_Mutation	SNP	pfam_Tcp11	p.Q262*	ENST00000299045.3	37	c.784	CCDS9104.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.812559	0.96975	.	.	ENSG00000166046	ENST00000299045	.	.	.	6.03	2.94	0.34122	.	0.464250	0.26773	N	0.022566	.	.	.	.	.	.	0.37148	D	0.902001	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-19.5785	14.1492	0.65370	0.1059:0.666:0.228:0.0	.	.	.	.	X	262	.	ENSP00000299045:Q262X	Q	+	1	0	TCP11L2	105253558	0.982000	0.34865	0.988000	0.46212	0.997000	0.91878	1.553000	0.36255	0.826000	0.34661	0.655000	0.94253	CAG	TCP11L2	-	pfam_Tcp11	ENSG00000166046		0.423	TCP11L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCP11L2	HGNC	protein_coding	OTTHUMT00000407206.1	30	0.00	0	C	NM_152772		106729428	106729428	+1	no_errors	ENST00000299045	ensembl	human	known	69_37n	nonsense	16	42.86	12	SNP	0.634	T
TMEM223	79064	genome.wustl.edu	37	11	62558104	62558104	+	Silent	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr11:62558104C>G	ENST00000307366.7	-	2	626	c.600G>C	c.(598-600)cgG>cgC	p.R200R	TMEM223_ENST00000527073.1_Intron|NXF1_ENST00000533048.1_5'Flank|TMEM223_ENST00000525631.1_Intron	NM_001080501.2	NP_001073970.1	A0PJW6	TM223_HUMAN	transmembrane protein 223	200						integral component of membrane (GO:0016021)											TTCACAAGCTCCGGTAGGCAC	0.468																																						dbGAP											0													36.0	35.0	35.0					11																	62558104		1875	4104	5979	-	-	-	SO:0001819	synonymous_variant	0				CCDS44628.1	11q12.3	2008-12-08				ENSG00000168569			28464	protein-coding gene	gene with protein product							Standard	NM_001080501		Approved	MGC3196	uc001nve.2	A0PJW6		ENST00000307366.7:c.600G>C	11.37:g.62558104C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q504S0|Q86YD4|Q8WUC5|Q96HG0	Silent	SNP	NULL	p.R200	ENST00000307366.7	37	c.600	CCDS44628.1	11																																																																																			TMEM223	-	NULL	ENSG00000168569		0.468	TMEM223-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM223	HGNC	protein_coding	OTTHUMT00000395674.1	28	0.00	0	C			62558104	62558104	-1	no_errors	ENST00000307366	ensembl	human	known	69_37n	silent	31	24.39	10	SNP	0.977	G
TMEM68	137695	genome.wustl.edu	37	8	56668876	56668876	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr8:56668876G>A	ENST00000434581.2	-	4	619	c.420C>T	c.(418-420)ttC>ttT	p.F140F	TMEM68_ENST00000334667.2_Silent_p.F140F|TMEM68_ENST00000519784.1_Silent_p.F26F|TMEM68_ENST00000523073.1_Silent_p.F26F			Q96MH6	TMM68_HUMAN	transmembrane protein 68	140						integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			NS(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6			Epithelial(17;0.000361)|all cancers(17;0.00326)			TTTTAGCCATGAAATAGTAAA	0.323																																						dbGAP											0													49.0	53.0	52.0					8																	56668876		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			AK056932	CCDS6161.1, CCDS75740.1, CCDS75741.1, CCDS75742.1	8q12.1	2011-12-12			ENSG00000167904	ENSG00000167904			26510	protein-coding gene	gene with protein product						12477932	Standard	XM_005251150		Approved	FLJ32370	uc003xsh.1	Q96MH6	OTTHUMG00000164293	ENST00000434581.2:c.420C>T	8.37:g.56668876G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q658X6|Q8WUD2	Missense_Mutation	SNP	NULL	p.S79L	ENST00000434581.2	37	c.236		8																																																																																			TMEM68	-	NULL	ENSG00000167904		0.323	TMEM68-002	KNOWN	basic|appris_principal	protein_coding	TMEM68	HGNC	protein_coding	OTTHUMT00000378137.1	30	0.00	0	G	NM_152417		56668876	56668876	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000520061	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	A
TNRC6C	57690	genome.wustl.edu	37	17	76047128	76047128	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr17:76047128G>A	ENST00000588061.1	+	5	2712	c.1985G>A	c.(1984-1986)gGc>gAc	p.G662D	TNRC6C_ENST00000335749.4_Missense_Mutation_p.G662D|TNRC6C_ENST00000588847.1_Missense_Mutation_p.G662D|TNRC6C_ENST00000301624.4_Missense_Mutation_p.G662D|TNRC6C_ENST00000544502.1_Missense_Mutation_p.G662D|TNRC6C_ENST00000541771.1_Missense_Mutation_p.G662D			Q9HCJ0	TNR6C_HUMAN	trinucleotide repeat containing 6C	662	Sufficient for interaction with argonaute family proteins.				embryonic hemopoiesis (GO:0035162)|endoderm formation (GO:0001706)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|regulation of gene silencing by miRNA (GO:0060964)	cytosol (GO:0005829)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(9)|lung(16)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			TTAAAACCTGGCCCCCAACAG	0.537																																						dbGAP											0													32.0	35.0	34.0					17																	76047128		1909	4109	6018	-	-	-	SO:0001583	missense	0			AL834429	CCDS45798.1, CCDS45799.1	17q25.3	2012-10-04			ENSG00000078687	ENSG00000078687		"""Trinucleotide (CAG) repeat containing"""	29318	protein-coding gene	gene with protein product		610741					Standard	NM_018996		Approved	KIAA1582, FLJ20015	uc002juf.2	Q9HCJ0	OTTHUMG00000132642	ENST00000588061.1:c.1985G>A	17.37:g.76047128G>A	ENSP00000468647:p.Gly662Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XAB8|Q86UE5|Q8N3D8|Q96MU9	Missense_Mutation	SNP	pfam_Argonaute_hook_dom,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.G662D	ENST00000588061.1	37	c.1985	CCDS45798.1	17	.	.	.	.	.	.	.	.	.	.	G	12.39	1.924253	0.34002	.	.	ENSG00000078687	ENST00000455761;ENST00000395801;ENST00000335749;ENST00000301624;ENST00000541771;ENST00000544502	T;T;T;T	0.14516	2.5;2.52;2.52;2.5	5.96	4.97	0.65823	.	0.278500	0.40554	N	0.001077	T	0.22627	0.0546	L	0.51422	1.61	0.52501	D	0.999953	P;P;D	0.63880	0.911;0.956;0.993	P;P;P	0.55455	0.571;0.648;0.776	T	0.04294	-1.0962	10	0.10111	T	0.7	-5.8598	15.3133	0.74053	0.0:0.2648:0.7352:0.0	.	662;662;662	G3XAB8;Q9HCJ0-2;Q9HCJ0	.;.;TNR6C_HUMAN	D	662	ENSP00000336783:G662D;ENSP00000301624:G662D;ENSP00000440310:G662D;ENSP00000442421:G662D	ENSP00000301624:G662D	G	+	2	0	TNRC6C	73558723	0.989000	0.36119	0.996000	0.52242	0.980000	0.70556	2.216000	0.42871	1.469000	0.48083	0.655000	0.94253	GGC	TNRC6C	-	NULL	ENSG00000078687		0.537	TNRC6C-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNRC6C	HGNC	protein_coding	OTTHUMT00000395947.1	39	0.00	0	G	NM_018996		76047128	76047128	+1	no_errors	ENST00000335749	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	0.998	A
TOMM6	100188893	genome.wustl.edu	37	6	41757047	41757047	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:41757047C>A	ENST00000398884.3	+	2	242	c.206C>A	c.(205-207)gCa>gAa	p.A69E	RP11-298J23.9_ENST00000594586.1_RNA|TOMM6_ENST00000398881.3_Missense_Mutation_p.A69E	NM_001134493.1	NP_001127965.1	Q96B49	TOM6_HUMAN	translocase of outer mitochondrial membrane 6 homolog (yeast)	69					cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane translocase complex (GO:0005742)|mitochondrion (GO:0005739)											GACCTCATGGCACCTCAGCCA	0.468																																						dbGAP											0													127.0	105.0	112.0					6																	41757047		692	1591	2283	-	-	-	SO:0001583	missense	0			AF216754	CCDS47424.1	6p21.1	2010-08-05			ENSG00000214736	ENSG00000214736			34528	protein-coding gene	gene with protein product	"""over-expressed breast tumor protein"""					18331822	Standard	NM_001134493		Approved	OBTP	uc011dug.1	Q96B49	OTTHUMG00000137505	ENST00000398884.3:c.206C>A	6.37:g.41757047C>A	ENSP00000381859:p.Ala69Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2DG15|Q9UH52	Missense_Mutation	SNP	NULL	p.A69E	ENST00000398884.3	37	c.206	CCDS47424.1	6	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979311	0.92982	.	.	ENSG00000214736	ENST00000398884;ENST00000398881	.	.	.	6.17	6.17	0.99709	.	0.146210	0.27691	U	0.018255	T	0.81456	0.4826	.	.	.	0.45205	D	0.99821	D	0.89917	1.0	D	0.87578	0.998	T	0.82108	-0.0620	8	0.87932	D	0	-7.9942	18.6524	0.91435	0.0:1.0:0.0:0.0	.	69	Q96B49	TOM6_HUMAN	E	69	.	ENSP00000381856:A69E	A	+	2	0	TOMM6	41865025	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.102000	0.64572	2.941000	0.99782	0.655000	0.94253	GCA	TOMM6	-	NULL	ENSG00000214736		0.468	TOMM6-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TOMM6	HGNC	protein_coding	OTTHUMT00000268822.1	48	0.00	0	C			41757047	41757047	+1	no_errors	ENST00000398881	ensembl	human	novel	69_37n	missense	47	33.33	24	SNP	1.000	A
TPP2	7174	genome.wustl.edu	37	13	103281891	103281891	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr13:103281891G>A	ENST00000376065.4	+	9	1112	c.1076G>A	c.(1075-1077)aGt>aAt	p.S359N	TPP2_ENST00000376052.3_Missense_Mutation_p.S359N	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	359	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)			breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TATGTTTCAAGTGCTGGAAAT	0.343																																						dbGAP											0													133.0	120.0	124.0					13																	103281891		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.1076G>A	13.37:g.103281891G>A	ENSP00000365233:p.Ser359Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.S359N	ENST00000376065.4	37	c.1076	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.427707	0.96131	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	T;T	0.59083	0.29;0.29	5.78	5.78	0.91487	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.82093	0.4962	H	0.95114	3.625	0.80722	D	1	D	0.60575	0.988	P	0.58266	0.836	D	0.87100	0.2178	10	0.87932	D	0	.	20.0139	0.97470	0.0:0.0:1.0:0.0	.	359	P29144	TPP2_HUMAN	N	359	ENSP00000365233:S359N;ENSP00000365220:S359N	ENSP00000365220:S359N	S	+	2	0	TPP2	102079892	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.465000	0.97660	2.724000	0.93272	0.563000	0.77884	AGT	TPP2	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000134900		0.343	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	59	0.00	0	G			103281891	103281891	+1	no_errors	ENST00000376065	ensembl	human	known	69_37n	missense	129	15.13	23	SNP	1.000	A
UGT2A1	10941	genome.wustl.edu	37	4	70504739	70504739	+	Intron	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr4:70504739G>C	ENST00000503640.1	-	1	771				UGT2A1_ENST00000512704.1_Intron|UGT2A1_ENST00000286604.4_Intron|UGT2A2_ENST00000457664.2_Nonsense_Mutation_p.S207*|UGT2A1_ENST00000514019.1_Nonsense_Mutation_p.S408*	NM_006798.3	NP_006789.2	Q9Y4X1	UD2A1_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A1, complex locus						cellular glucuronidation (GO:0052695)|detection of chemical stimulus (GO:0009593)|metabolic process (GO:0008152)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(1)|skin(2)	30						AGTGAGCTCTGATAAGGCTGC	0.428																																						dbGAP											0													48.0	49.0	49.0					4																	70504739		1923	4141	6064	-	-	-	SO:0001627	intron_variant	0			AJ006054	CCDS3529.1, CCDS58901.1, CCDS58902.1	4q13	2013-03-28	2010-12-02					"""UDP glucuronosyltransferases"""	12542	protein-coding gene	gene with protein product		604716	"""UDP glycosyltransferase 2 family, polypeptide A1"", ""UDP glucuronosyltransferase 2 family, polypeptide A1"""			10359671	Standard	NM_001252274		Approved		uc011caq.2	Q9Y4X1	OTTHUMG00000184942	ENST00000503640.1:c.715+7908C>G	4.37:g.70504739G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2F4|D3GER1|D3GER2|E9PDM7|J3KNA3	Nonsense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.S207*	ENST00000503640.1	37	c.620	CCDS3529.1	4	.	.	.	.	.	.	.	.	.	.	G	37	6.443005	0.97572	.	.	ENSG00000173610	ENST00000457664;ENST00000514019	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	.	17.9458	0.89038	0.0:0.0:1.0:0.0	.	.	.	.	X	207;408	.	ENSP00000387888:S207X	S	-	2	0	UGT2A1	70539328	0.000000	0.05858	1.000000	0.80357	0.993000	0.82548	0.471000	0.22100	2.838000	0.97847	0.591000	0.81541	TCA	UGT2A1	-	pfam_UDP_glucos_trans	ENSG00000173610		0.428	UGT2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A1	HGNC	protein_coding	OTTHUMT00000251554.3	24	0.00	0	G	NM_006798		70504739	70504739	-1	no_errors	ENST00000457664	ensembl	human	known	69_37n	nonsense	17	50.00	17	SNP	1.000	C
ULK3	25989	genome.wustl.edu	37	15	75131064	75131064	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr15:75131064G>A	ENST00000440863.2	-	10	1113	c.1022C>T	c.(1021-1023)gCt>gTt	p.A341V	ULK3_ENST00000569437.1_Missense_Mutation_p.A341V|ULK3_ENST00000568667.1_Missense_Mutation_p.A352V	NM_001099436.1	NP_001092906	Q6PHR2	ULK3_HUMAN	unc-51 like kinase 3	341	MIT 1.				autophagic vacuole assembly (GO:0000045)|autophagy (GO:0006914)|cellular senescence (GO:0090398)|negative regulation of smoothened signaling pathway (GO:0045879)|positive regulation of smoothened signaling pathway (GO:0045880)|protein autophosphorylation (GO:0046777)|regulation of autophagy (GO:0010506)	ATG1/UKL1 signaling complex (GO:0034273)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)	2						GAGCTCCTCAGCCCGGGACAC	0.617																																						dbGAP											0													31.0	34.0	33.0					15																	75131064		1963	4152	6115	-	-	-	SO:0001583	missense	0			BC048289		15q24.1	2013-07-02	2013-07-02			ENSG00000140474			19703	protein-coding gene	gene with protein product		613472	"""unc-51-like kinase 3 (C. elegans)"""				Standard	XM_005254289		Approved	DKFZP434C131, FLJ90566	uc010bkf.1	Q6PHR2		ENST00000440863.2:c.1022C>T	15.37:g.75131064G>A	ENSP00000400312:p.Ala341Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK3|B4DRQ7|D3DW68|Q9NPN5|Q9UFS4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIT,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_MIT,pfscan_Prot_kinase_cat_dom	p.A341V	ENST00000440863.2	37	c.1022	CCDS45305.1	15	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935081	0.92458	.	.	ENSG00000140474	ENST00000440863;ENST00000418051	T	0.80393	-1.37	5.02	5.02	0.67125	MIT (2);	.	.	.	.	D	0.92306	0.7559	M	0.93808	3.46	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.989;0.999;0.989;0.998	D	0.94323	0.7555	9	0.87932	D	0	-5.1811	16.927	0.86179	0.0:0.0:1.0:0.0	.	352;251;341;341	B4DFT0;B4DFS6;Q6PHR2;Q6PHR2-3	.;.;ULK3_HUMAN;.	V	341;352	ENSP00000400312:A341V	ENSP00000393658:A352V	A	-	2	0	ULK3	72918117	1.000000	0.71417	0.986000	0.45419	0.749000	0.42624	8.859000	0.92264	2.327000	0.79052	0.491000	0.48974	GCT	ULK3	-	pfam_MIT,smart_MIT	ENSG00000140474		0.617	ULK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ULK3	HGNC	protein_coding	OTTHUMT00000421734.4	15	0.00	0	G	NM_015518		75131064	75131064	-1	no_errors	ENST00000440863	ensembl	human	known	69_37n	missense	18	45.45	15	SNP	1.000	A
USP26	83844	genome.wustl.edu	37	X	132160197	132160197	+	Silent	SNP	G	G	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chrX:132160197G>T	ENST00000511190.1	-	6	2521	c.2052C>A	c.(2050-2052)ctC>ctA	p.L684L	USP26_ENST00000406273.1_Silent_p.L684L|USP26_ENST00000370832.1_Silent_p.L684L	NM_031907.1	NP_114113.1	Q9BXU7	UBP26_HUMAN	ubiquitin specific peptidase 26	684	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(11)|liver(2)|lung(18)|ovary(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	60	Acute lymphoblastic leukemia(192;0.000127)					CAACTTTTGAGAGAGGTGTGC	0.413																																					NSCLC(104;342 1621 36940 47097 52632)	dbGAP											0													79.0	76.0	77.0					X																	132160197		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF285593	CCDS14635.1	Xq26.2	2012-07-13	2005-08-08		ENSG00000134588	ENSG00000134588	3.4.19.12	"""Ubiquitin-specific peptidases"""	13485	protein-coding gene	gene with protein product		300309	"""ubiquitin specific protease 26"""			12838346	Standard	NM_031907		Approved		uc011mvf.2	Q9BXU7	OTTHUMG00000022429	ENST00000511190.1:c.2052C>A	X.37:g.132160197G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9WRT6|Q5H9H4	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L684	ENST00000511190.1	37	c.2052	CCDS14635.1	X																																																																																			USP26	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000134588		0.413	USP26-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP26	HGNC	protein_coding	OTTHUMT00000359441.1	40	0.00	0	G	NM_031907		132160197	132160197	-1	no_errors	ENST00000370832	ensembl	human	known	69_37n	silent	31	32.61	15	SNP	0.002	T
UTP20	27340	genome.wustl.edu	37	12	101699730	101699730	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr12:101699730G>A	ENST00000261637.4	+	16	1993	c.1819G>A	c.(1819-1821)Gat>Aat	p.D607N		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	607					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GCTGTTGACTGATCTCTATTA	0.428																																						dbGAP											0													144.0	129.0	134.0					12																	101699730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.1819G>A	12.37:g.101699730G>A	ENSP00000261637:p.Asp607Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.D607N	ENST00000261637.4	37	c.1819	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	27.1	4.801122	0.90538	.	.	ENSG00000120800	ENST00000261637	T	0.67698	-0.28	5.61	5.61	0.85477	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71091	0.3299	M	0.70595	2.14	0.80722	D	1	D	0.54964	0.969	P	0.47528	0.549	T	0.67852	-0.5563	10	0.13853	T	0.58	-22.6118	19.6383	0.95746	0.0:0.0:1.0:0.0	.	607	O75691	UTP20_HUMAN	N	607	ENSP00000261637:D607N	ENSP00000261637:D607N	D	+	1	0	UTP20	100223861	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	8.253000	0.89842	2.631000	0.89168	0.655000	0.94253	GAT	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.428	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	47	0.00	0	G	NM_014503		101699730	101699730	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	29	43.14	22	SNP	1.000	A
UTRN	7402	genome.wustl.edu	37	6	144869832	144869832	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:144869832C>A	ENST00000367545.3	+	46	6652	c.6652C>A	c.(6652-6654)Cag>Aag	p.Q2218K		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	2218					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TATTCCTGTTCAGTCTCATCG	0.393																																						dbGAP											0													99.0	93.0	95.0					6																	144869832		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.6652C>A	6.37:g.144869832C>A	ENSP00000356515:p.Gln2218Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q2218K	ENST00000367545.3	37	c.6652	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	C	11.05	1.524203	0.27299	.	.	ENSG00000152818	ENST00000367545	T	0.59502	0.26	5.38	4.5	0.54988	.	0.782162	0.11151	N	0.594130	T	0.23611	0.0571	L	0.27053	0.805	0.80722	D	1	B	0.11235	0.004	B	0.06405	0.002	T	0.15235	-1.0444	10	0.02654	T	1	.	16.329	0.83001	0.0:0.8675:0.1325:0.0	.	2218	P46939	UTRO_HUMAN	K	2218	ENSP00000356515:Q2218K	ENSP00000356515:Q2218K	Q	+	1	0	UTRN	144911525	0.039000	0.19947	0.002000	0.10522	0.537000	0.34900	2.691000	0.47010	1.382000	0.46385	0.655000	0.94253	CAG	UTRN	-	pirsf_Dystrophin/utrophin	ENSG00000152818		0.393	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	39	0.00	0	C			144869832	144869832	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	0.047	A
WDR72	256764	genome.wustl.edu	37	15	53908000	53908000	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr15:53908000G>A	ENST00000396328.1	-	15	2642	c.2403C>T	c.(2401-2403)tgC>tgT	p.C801C	WDR72_ENST00000360509.5_Silent_p.C801C|WDR72_ENST00000557913.1_Silent_p.C798C|WDR72_ENST00000559418.1_Silent_p.C811C	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	801										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		ATGGCAAAAGGCAAGACAGAA	0.373																																						dbGAP											0													195.0	188.0	190.0					15																	53908000		2194	4293	6487	-	-	-	SO:0001819	synonymous_variant	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2403C>T	15.37:g.53908000G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3I3|Q8N8X2	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C801	ENST00000396328.1	37	c.2403	CCDS10151.1	15																																																																																			WDR72	-	NULL	ENSG00000166415		0.373	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	54	0.00	0	G	NM_182758		53908000	53908000	-1	no_errors	ENST00000360509	ensembl	human	known	69_37n	silent	47	43.37	36	SNP	1.000	A
VPS33B	26276	genome.wustl.edu	37	15	91561082	91561082	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr15:91561082C>G	ENST00000333371.3	-	2	483	c.130G>C	c.(130-132)Gat>Cat	p.D44H	VPS33B_ENST00000535843.1_5'UTR|VPS33B_ENST00000535906.1_Intron|VPS33B_ENST00000557358.1_Intron	NM_018668.3	NP_061138.3	Q9H267	VP33B_HUMAN	vacuolar protein sorting 33 homolog B (yeast)	44					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|membrane fusion (GO:0061025)|platelet alpha granule organization (GO:0070889)|protein transport (GO:0015031)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule (GO:0031091)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)|prostate(2)|stomach(2)	16	Lung NSC(78;0.0987)|all_lung(78;0.175)					CTCATGAGATCTGCCTCAATG	0.488																																						dbGAP											0													132.0	114.0	120.0					15																	91561082		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF201694	CCDS10369.1, CCDS73783.1	15q26.1	2006-12-19	2006-12-19		ENSG00000184056	ENSG00000184056			12712	protein-coding gene	gene with protein product		608552	"""vacuolar protein sorting 33B (yeast homolog)"""			8996080	Standard	XM_005254887		Approved	FLJ14848	uc002bqp.1	Q9H267	OTTHUMG00000149835	ENST00000333371.3:c.130G>C	15.37:g.91561082C>G	ENSP00000327650:p.Asp44His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQF6|Q96K14|Q9NRP6|Q9NSF3	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.D44H	ENST00000333371.3	37	c.130	CCDS10369.1	15	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416369	0.83449	.	.	ENSG00000184056	ENST00000333371	T	0.76839	-1.05	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.83788	0.5330	L	0.47716	1.5	0.80722	D	1	D	0.71674	0.998	D	0.68192	0.956	T	0.80915	-0.1169	10	0.28530	T	0.3	-0.019	17.8351	0.88693	0.0:1.0:0.0:0.0	.	44	Q9H267	VP33B_HUMAN	H	44	ENSP00000327650:D44H	ENSP00000327650:D44H	D	-	1	0	VPS33B	89362086	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.523000	0.67099	2.573000	0.86826	0.462000	0.41574	GAT	VPS33B	-	pfam_Sec1-like,superfamily_Sec1-like	ENSG00000184056		0.488	VPS33B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33B	HGNC	protein_coding	OTTHUMT00000313496.1	36	0.00	0	C	NM_018668		91561082	91561082	-1	no_errors	ENST00000333371	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	0.999	G
XPNPEP2	7512	genome.wustl.edu	37	X	128889307	128889307	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chrX:128889307A>C	ENST00000371106.3	+	13	1447	c.1255A>C	c.(1255-1257)Atc>Ctc	p.I419L		NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	419						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						TTTTGAAACCATCTCTGCTAG	0.527																																						dbGAP											0													128.0	111.0	117.0					X																	128889307		2203	4299	6502	-	-	-	SO:0001583	missense	0			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.1255A>C	X.37:g.128889307A>C	ENSP00000360147:p.Ile419Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV16|O75994	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.I419L	ENST00000371106.3	37	c.1255	CCDS14613.1	X	.	.	.	.	.	.	.	.	.	.	A	21.4	4.142507	0.77888	.	.	ENSG00000122121	ENST00000371106	T	0.80994	-1.44	5.44	5.44	0.79542	Peptidase M24, structural domain (3);	0.000000	0.85682	D	0.000000	D	0.91603	0.7347	M	0.92833	3.35	0.50039	D	0.999843	D	0.89917	1.0	D	0.87578	0.998	D	0.93348	0.6716	10	0.87932	D	0	-28.093	13.4309	0.61055	1.0:0.0:0.0:0.0	.	419	O43895	XPP2_HUMAN	L	419	ENSP00000360147:I419L	ENSP00000360147:I419L	I	+	1	0	XPNPEP2	128716988	1.000000	0.71417	1.000000	0.80357	0.560000	0.35617	7.965000	0.87945	1.813000	0.52934	0.486000	0.48141	ATC	XPNPEP2	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain	ENSG00000122121		0.527	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	HGNC	protein_coding	OTTHUMT00000058210.1	41	0.00	0	A	NM_003399		128889307	128889307	+1	no_errors	ENST00000371106	ensembl	human	known	69_37n	missense	45	40.00	30	SNP	1.000	C
XRN1	54464	genome.wustl.edu	37	3	142095323	142095323	+	Silent	SNP	T	T	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr3:142095323T>C	ENST00000264951.4	-	24	2946	c.2829A>G	c.(2827-2829)agA>agG	p.R943R	XRN1_ENST00000392981.2_Silent_p.R943R	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	943					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						AAACTTACTTTCTCCTAGATC	0.318																																						dbGAP											0													29.0	31.0	30.0					3																	142095323		2197	4295	6492	-	-	-	SO:0001819	synonymous_variant	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.2829A>G	3.37:g.142095323T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	NULL	p.K409E	ENST00000264951.4	37	c.1225	CCDS3123.1	3																																																																																			XRN1	-	NULL	ENSG00000114127		0.318	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	21	0.00	0	T	NM_019001		142095323	142095323	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000498077	ensembl	human	known	69_37n	missense	32	31.91	15	SNP	1.000	C
ZNF277	11179	genome.wustl.edu	37	7	111846820	111846820	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr7:111846820C>T	ENST00000361822.3	+	1	178	c.49C>T	c.(49-51)Cgt>Tgt	p.R17C	DOCK4_ENST00000428084.1_5'Flank|DOCK4_ENST00000476846.1_5'Flank|ZNF277_ENST00000421043.1_Missense_Mutation_p.R17C|DOCK4_ENST00000437633.1_5'Flank|ZNF277_ENST00000450657.1_Missense_Mutation_p.R17C	NM_021994.2	NP_068834.2	Q9NRM2	ZN277_HUMAN	zinc finger protein 277	17					cellular response to hydrogen peroxide (GO:0070301)|regulation of cellular senescence (GO:2000772)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)			breast(4)|endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	15						GCAGGAAGACCGTGATGGGAG	0.642																																						dbGAP											0													40.0	43.0	42.0					7																	111846820		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF209198	CCDS5755.2	7q31.1	2012-10-05	2007-10-23	2007-10-23	ENSG00000198839	ENSG00000198839			13070	protein-coding gene	gene with protein product		605465	"""zinc finger protein (C2H2 type) 277"", ""zinc finger protein 277 pseudogene"""	ZNF277P		10860669, 16213364, 16395595	Standard	NM_021994		Approved	NRIF4	uc003vge.2	Q9NRM2	OTTHUMG00000150209	ENST00000361822.3:c.49C>T	7.37:g.111846820C>T	ENSP00000354501:p.Arg17Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75MZ2|Q75MZ3|Q8WY14	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R17C	ENST00000361822.3	37	c.49	CCDS5755.2	7	.	.	.	.	.	.	.	.	.	.	C	9.974	1.226241	0.22542	.	.	ENSG00000198839	ENST00000361822;ENST00000421043;ENST00000425229;ENST00000450657	T;T	0.32988	1.47;1.43	5.25	-10.5	0.00291	.	3.006330	0.00960	N	0.003093	T	0.12347	0.0300	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.28490	-1.0042	10	0.49607	T	0.09	4.6134	2.0689	0.03609	0.235:0.3487:0.0979:0.3184	.	17;17	Q9NRM2;G5E9M4	ZN277_HUMAN;.	C	17	ENSP00000354501:R17C;ENSP00000402292:R17C	ENSP00000354501:R17C	R	+	1	0	ZNF277	111634056	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.356000	0.00499	-4.984000	0.00025	-0.841000	0.03054	CGT	ZNF277	-	NULL	ENSG00000198839		0.642	ZNF277-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF277	HGNC	protein_coding	OTTHUMT00000316843.2	38	0.00	0	C	NM_021994		111846820	111846820	+1	no_errors	ENST00000361822	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	0.000	T
ZNF292	23036	genome.wustl.edu	37	6	87964520	87964520	+	Silent	SNP	G	G	A			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr6:87964520G>A	ENST00000369577.3	+	8	1216	c.1173G>A	c.(1171-1173)ctG>ctA	p.L391L	ZNF292_ENST00000339907.4_Silent_p.L386L	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	391						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		CTTGTCAACTGAGTGAATTTC	0.368																																						dbGAP											0													124.0	117.0	119.0					6																	87964520		1901	4130	6031	-	-	-	SO:0001819	synonymous_variant	0			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1173G>A	6.37:g.87964520G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L391	ENST00000369577.3	37	c.1173	CCDS47457.1	6																																																																																			ZNF292	-	NULL	ENSG00000188994		0.368	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	62	0.00	0	G	NM_015021		87964520	87964520	+1	no_errors	ENST00000369577	ensembl	human	known	69_37n	silent	64	31.91	30	SNP	1.000	A
ZNF587	84914	genome.wustl.edu	37	19	58370285	58370285	+	Missense_Mutation	SNP	C	C	T	rs201023031		TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr19:58370285C>T	ENST00000339656.5	+	3	687	c.505C>T	c.(505-507)Cca>Tca	p.P169S	ZNF814_ENST00000595295.1_Missense_Mutation_p.A35T|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597652.1_5'Flank|ZNF814_ENST00000596604.1_Intron|ZNF587_ENST00000419854.1_Missense_Mutation_p.P126S|ZNF587_ENST00000423137.1_Missense_Mutation_p.P168S	NM_001204817.1|NM_032828.3	NP_001191746.1|NP_116217.1	Q96SQ5	ZN587_HUMAN	zinc finger protein 587	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	15		Colorectal(82;0.000256)|all_neural(62;0.0577)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0264)		GTCACAGGAGCCATTTGTCTT	0.468																																					Pancreas(59;641 1233 1885 20055 50741)	dbGAP											0													58.0	53.0	55.0					19																	58370285		2056	3982	6038	-	-	-	SO:0001583	missense	0			AF294842	CCDS12964.1, CCDS56110.1	19q13.43	2013-01-08				ENSG00000198466		"""Zinc fingers, C2H2-type"", ""-"""	30955	protein-coding gene	gene with protein product						10520746	Standard	NM_032828		Approved	ZF6, FLJ14710, UBF-fl, FLJ20813	uc002qql.3	Q96SQ5	OTTHUMG00000154901	ENST00000339656.5:c.505C>T	19.37:g.58370285C>T	ENSP00000345479:p.Pro169Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV72|G3V0H5|Q6ZMK8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P169S	ENST00000339656.5	37	c.505	CCDS12964.1	19	58	0.026556776556776556	32	0.06504065040650407	3	0.008287292817679558	15	0.026223776223776224	8	0.010554089709762533	.	4.421	0.077923	0.08485	.	.	ENSG00000198466	ENST00000376209;ENST00000423137;ENST00000339656;ENST00000540851;ENST00000419854	T;T;T	0.06768	3.43;3.43;3.26	2.08	2.08	0.27032	.	.	.	.	.	T	0.00580	0.0019	N	0.17594	0.5	0.24958	N	0.991745	B;P	0.45531	0.25;0.86	B;P	0.48704	0.109;0.587	T	0.31052	-0.9957	8	0.52906	T	0.07	.	10.1539	0.42812	0.0:1.0:0.0:0.0	.	168;169	G3V0H5;Q96SQ5	.;ZN587_HUMAN	S	126;168;169;169;126	ENSP00000393865:P168S;ENSP00000345479:P169S;ENSP00000406999:P126S	ENSP00000345479:P169S	P	+	1	0	ZNF587	63062097	0.000000	0.05858	0.004000	0.12327	0.090000	0.18270	0.127000	0.15790	1.066000	0.40716	0.195000	0.17529	CCA	ZNF587	-	NULL	ENSG00000198466		0.468	ZNF587-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF587	HGNC	protein_coding	OTTHUMT00000337594.2	26	0.00	0	C	NM_032828		58370285	58370285	+1	no_errors	ENST00000339656	ensembl	human	known	69_37n	missense	11	21.43	3	SNP	0.008	T
ZNF678	339500	genome.wustl.edu	37	1	227842649	227842649	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PB-01A-11D-A142-09	TCGA-EW-A1PB-10A-01D-A142-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9ddf2119-a222-4fa5-a9f3-0bec7eeea36b	26aa0f07-c813-4659-88fa-fdbae73a937e	g.chr1:227842649G>C	ENST00000343776.5	+	4	1043	c.698G>C	c.(697-699)gGa>gCa	p.G233A	ZNF678_ENST00000397097.3_Missense_Mutation_p.G288A|ZNF678_ENST00000608949.1_Intron	NM_178549.3	NP_848644.2	Q5SXM1	ZN678_HUMAN	zinc finger protein 678	233					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(7)|pancreas(1)|prostate(1)	24		Prostate(94;0.0885)				ATTCATACTGGAGAGAAACCC	0.373																																						dbGAP											0													61.0	70.0	67.0					1																	227842649		2200	4296	6496	-	-	-	SO:0001583	missense	0			BC042500		1q42.13	2013-01-08			ENSG00000181450	ENSG00000181450		"""Zinc fingers, C2H2-type"", ""-"""	28652	protein-coding gene	gene with protein product	"""hypothetical protein MGC42493"""					12477932	Standard	NM_178549		Approved	MGC42493	uc021pjy.1	Q5SXM1	OTTHUMG00000037700	ENST00000343776.5:c.698G>C	1.37:g.227842649G>C	ENSP00000344828:p.Gly233Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVQ9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G288A	ENST00000343776.5	37	c.863		1	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861838	0.71949	.	.	ENSG00000181450	ENST00000343776;ENST00000397097	T;T	0.26373	1.74;1.74	1.62	1.62	0.23740	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34774	0.0909	L	0.48174	1.505	0.34748	D	0.731473	D	0.60160	0.987	P	0.58660	0.843	T	0.49781	-0.8903	9	0.72032	D	0.01	.	9.1647	0.37043	0.0:0.0:1.0:0.0	.	233	Q5SXM1	ZN678_HUMAN	A	233;288	ENSP00000344828:G233A;ENSP00000440403:G288A	ENSP00000344828:G233A	G	+	2	0	ZNF678	225909272	0.995000	0.38212	0.262000	0.24481	0.817000	0.46193	1.970000	0.40520	0.787000	0.33731	0.603000	0.83216	GGA	ZNF678	-	pfscan_Znf_C2H2	ENSG00000181450		0.373	ZNF678-001	KNOWN	basic	protein_coding	ZNF678	HGNC	protein_coding	OTTHUMT00000091976.2	31	0.00	0	G	NM_178549		227842649	227842649	+1	no_errors	ENST00000397097	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	C
