#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA12	26154	genome.wustl.edu	37	2	215818665	215818665	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:215818665C>T	ENST00000272895.7	-	44	6779	c.6560G>A	c.(6559-6561)gGt>gAt	p.G2187D	AC072062.1_ENST00000607412.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.G1869D	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2187					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		AAACATTGCACCTAGTTTATT	0.378																																					Ovarian(66;664 1488 5121 34295)	dbGAP											0													110.0	101.0	104.0					2																	215818665		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6560G>A	2.37:g.215818665C>T	ENSP00000272895:p.Gly2187Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G2187D	ENST00000272895.7	37	c.6560	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	C	22.9	4.344141	0.82022	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.91894	-2.93;-2.9	5.66	5.66	0.87406	.	0.167110	0.42821	D	0.000648	D	0.96473	0.8849	M	0.87097	2.86	0.80722	D	1	D;D	0.89917	0.993;1.0	D;D	0.78314	0.928;0.991	D	0.96707	0.9522	10	0.87932	D	0	.	16.5996	0.84810	0.0:0.8615:0.1385:0.0	.	2187;1869	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	D	2187;1869	ENSP00000272895:G2187D;ENSP00000374312:G1869D	ENSP00000272895:G2187D	G	-	2	0	ABCA12	215526910	1.000000	0.71417	0.964000	0.40570	0.937000	0.57800	5.585000	0.67497	2.831000	0.97527	0.650000	0.86243	GGT	ABCA12	-	NULL	ENSG00000144452		0.378	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	32	0.00	0	C	NM_173076		215818665	215818665	-1	no_errors	ENST00000272895	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	0.999	T
ABCA6	23460	genome.wustl.edu	37	17	67119401	67119401	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:67119401A>C	ENST00000284425.2	-	10	1589	c.1415T>G	c.(1414-1416)tTc>tGc	p.F472C		NM_080284.2	NP_525023.2	Q8N139	ABCA6_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 6	472					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(6)|endometrium(5)|kidney(17)|large_intestine(18)|lung(20)|ovary(3)|prostate(2)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	82	Breast(10;5.65e-12)					TTTTCCTTGGAATTCAGGAGC	0.328																																						dbGAP											0													92.0	91.0	91.0					17																	67119401		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66680	CCDS11683.1	17q21	2012-03-14			ENSG00000154262	ENSG00000154262		"""ATP binding cassette transporters / subfamily A"""	36	protein-coding gene	gene with protein product		612504				8894702	Standard	NM_080284		Approved	EST155051	uc002jhw.1	Q8N139		ENST00000284425.2:c.1415T>G	17.37:g.67119401A>C	ENSP00000284425:p.Phe472Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSH9|Q8N856|Q8WWZ6	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.F472C	ENST00000284425.2	37	c.1415	CCDS11683.1	17	.	.	.	.	.	.	.	.	.	.	A	18.15	3.560784	0.65538	.	.	ENSG00000154262	ENST00000284425	D	0.93547	-3.24	4.91	2.54	0.30619	.	0.274240	0.25750	N	0.028552	D	0.95487	0.8534	M	0.73962	2.25	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.94141	0.7397	10	0.87932	D	0	.	9.0884	0.36596	0.6975:0.0:0.0:0.3025	.	472	Q8N139	ABCA6_HUMAN	C	472	ENSP00000284425:F472C	ENSP00000284425:F472C	F	-	2	0	ABCA6	64630996	1.000000	0.71417	0.998000	0.56505	0.964000	0.63967	4.852000	0.62904	0.366000	0.24427	0.519000	0.50382	TTC	ABCA6	-	NULL	ENSG00000154262		0.328	ABCA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA6	HGNC	protein_coding	OTTHUMT00000450463.1	33	0.00	0	A	NM_080284		67119401	67119401	-1	no_errors	ENST00000284425	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	C
ABCB1	5243	genome.wustl.edu	37	7	87214944	87214944	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:87214944G>C	ENST00000265724.3	-	5	587	c.170C>G	c.(169-171)gCt>gGt	p.A57G	ABCB1_ENST00000543898.1_Missense_Mutation_p.A57G	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	57	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	GATGATGGCAGCCAAAGTTCC	0.393																																						dbGAP											0													85.0	87.0	87.0					7																	87214944		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.170C>G	7.37:g.87214944G>C	ENSP00000265724:p.Ala57Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K294|B5AK60|Q12755|Q14812	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.A57G	ENST00000265724.3	37	c.170	CCDS5608.1	7	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295870	0.40594	.	.	ENSG00000085563	ENST00000265724;ENST00000543898	T;T	0.80393	-1.37;-1.37	5.72	5.72	0.89469	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.366821	0.33161	N	0.005220	T	0.78960	0.4366	L	0.39245	1.2	0.29118	N	0.880411	B;B	0.27166	0.0;0.17	B;B	0.40228	0.001;0.323	T	0.70831	-0.4765	10	0.24483	T	0.36	-17.7885	15.3886	0.74723	0.0:0.0:1.0:0.0	.	57;57	B5AK60;P08183	.;MDR1_HUMAN	G	57	ENSP00000265724:A57G;ENSP00000444095:A57G	ENSP00000265724:A57G	A	-	2	0	ABCB1	87052880	0.067000	0.21026	0.932000	0.37286	0.989000	0.77384	2.501000	0.45389	2.700000	0.92200	0.563000	0.77884	GCT	ABCB1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000085563		0.393	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	34	0.00	0	G	NM_000927		87214944	87214944	-1	no_errors	ENST00000265724	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.942	C
ADAM7	8756	genome.wustl.edu	37	8	24324444	24324444	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr8:24324444T>G	ENST00000175238.6	+	6	605	c.522T>G	c.(520-522)aaT>aaG	p.N174K	ADAM7_ENST00000441335.2_Missense_Mutation_p.N174K|ADAM7_ENST00000380789.1_Missense_Mutation_p.N174K|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000519689.1_RNA	NM_003817.3	NP_003808.2	Q9H2U9	ADAM7_HUMAN	ADAM metallopeptidase domain 7	174						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|endometrium(5)|kidney(1)|large_intestine(17)|lung(24)|ovary(1)|skin(15)	64		Prostate(55;0.0181)		Colorectal(74;0.0199)|COAD - Colon adenocarcinoma(73;0.0754)|BRCA - Breast invasive adenocarcinoma(99;0.182)		CAGAGCTTAATTTTACCAGAA	0.363																																						dbGAP											0													99.0	105.0	103.0					8																	24324444		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF090327	CCDS6045.1	8p21.2	2005-08-18	2005-08-18		ENSG00000069206	ENSG00000069206		"""ADAM metallopeptidase domain containing"""	214	protein-coding gene	gene with protein product		607310	"""a disintegrin and metalloproteinase domain 7"""				Standard	NM_003817		Approved	GP-83, EAPI	uc003xeb.3	Q9H2U9	OTTHUMG00000097859	ENST00000175238.6:c.522T>G	8.37:g.24324444T>G	ENSP00000175238:p.Asn174Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8X7|O75959|Q6PEJ6	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.N174K	ENST00000175238.6	37	c.522	CCDS6045.1	8	.	.	.	.	.	.	.	.	.	.	T	10.95	1.494390	0.26774	.	.	ENSG00000069206	ENST00000441335;ENST00000175238;ENST00000380789	T;T;T	0.28666	2.31;1.61;1.6	5.2	0.348	0.16026	.	0.115441	0.38959	N	0.001517	T	0.31136	0.0787	L	0.27053	0.805	0.58432	D	0.999998	D;D	0.89917	0.999;1.0	D;D	0.68765	0.927;0.96	T	0.09684	-1.0663	10	0.17369	T	0.5	.	7.2059	0.25907	0.0:0.3707:0.0:0.6293	.	174;174	Q9H2U9;Q6PEJ6	ADAM7_HUMAN;.	K	174	ENSP00000393073:N174K;ENSP00000175238:N174K;ENSP00000370166:N174K	ENSP00000175238:N174K	N	+	3	2	ADAM7	24380334	0.990000	0.36364	0.719000	0.30619	0.049000	0.14656	0.732000	0.26072	0.178000	0.19917	-0.290000	0.09829	AAT	ADAM7	-	NULL	ENSG00000069206		0.363	ADAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM7	HGNC	protein_coding	OTTHUMT00000215150.1	51	0.00	0	T	NM_003817		24324444	24324444	+1	no_errors	ENST00000175238	ensembl	human	known	69_37n	missense	46	16.36	9	SNP	0.826	G
ADAM9	8754	genome.wustl.edu	37	8	38913139	38913139	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr8:38913139G>T	ENST00000487273.2	+	14	1517	c.1439G>T	c.(1438-1440)tGt>tTt	p.C480F		NM_003816.2	NP_003807.1	Q13443	ADAM9_HUMAN	ADAM metallopeptidase domain 9	480	Disintegrin. {ECO:0000255|PROSITE- ProRule:PRU00068}.				activation of MAPKK activity (GO:0000186)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to lipopolysaccharide (GO:0071222)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|keratinocyte differentiation (GO:0030216)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte activation (GO:0042117)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|positive regulation of protein secretion (GO:0050714)|response to calcium ion (GO:0051592)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to laminar fluid shear stress (GO:0034616)|response to manganese ion (GO:0010042)|response to tumor necrosis factor (GO:0034612)|transforming growth factor beta receptor signaling pathway (GO:0007179)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of external side of plasma membrane (GO:0031233)	collagen binding (GO:0005518)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|protein kinase C binding (GO:0005080)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_lung(54;0.00292)|Lung NSC(58;0.0115)|Hepatocellular(245;0.0153)	LUSC - Lung squamous cell carcinoma(45;2.74e-07)			ACCAGTGAGTGTGATGTTCCA	0.373																																						dbGAP											0													192.0	180.0	184.0					8																	38913139		2203	4300	6503	-	-	-	SO:0001583	missense	0			U41766	CCDS6112.1	8p11.23	2011-03-18	2010-06-24		ENSG00000168615	ENSG00000168615		"""ADAM metallopeptidase domain containing"""	216	protein-coding gene	gene with protein product	"""meltrin gamma"""	602713	"""a disintegrin and metalloproteinase domain 9 (meltrin gamma)"", ""cone rod dystrophy 9"""	CORD9		8647900, 11581183, 19409519	Standard	NR_027638		Approved	MDC9, KIAA0021, MCMP, Mltng	uc003xmr.3	Q13443	OTTHUMG00000159783	ENST00000487273.2:c.1439G>T	8.37:g.38913139G>T	ENSP00000419446:p.Cys480Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLN7|Q10718|Q8NFM6	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.C480F	ENST00000487273.2	37	c.1439	CCDS6112.1	8	.	.	.	.	.	.	.	.	.	.	G	26.1	4.707751	0.89018	.	.	ENSG00000168615	ENST00000487273	T	0.21932	1.98	5.81	5.81	0.92471	Blood coagulation inhibitor, Disintegrin (5);	0.000000	0.85682	D	0.000000	T	0.67850	0.2937	H	0.98866	4.355	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81614	-0.0853	10	0.87932	D	0	.	20.0784	0.97758	0.0:0.0:1.0:0.0	.	480	Q13443	ADAM9_HUMAN	F	480	ENSP00000419446:C480F	ENSP00000369249:C480F	C	+	2	0	ADAM9	39032296	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.579000	0.98204	2.736000	0.93811	0.655000	0.94253	TGT	ADAM9	-	pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin	ENSG00000168615		0.373	ADAM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM9	HGNC	protein_coding	OTTHUMT00000357291.2	81	0.00	0	G			38913139	38913139	+1	no_errors	ENST00000487273	ensembl	human	known	69_37n	missense	78	16.13	15	SNP	1.000	T
ADAM5	255926	genome.wustl.edu	37	8	39181728	39181728	+	RNA	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr8:39181728C>T	ENST00000505455.1	+	0	392							Q6NVV9	ADAM5_HUMAN	ADAM metallopeptidase domain 5, pseudogene								metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)										GGAATTGAACCGATGGAGGCT	0.318																																						dbGAP											0																																										-	-	-			0			BC047448		8p11.23	2012-08-22	2010-03-12	2012-08-22	ENSG00000196115	ENSG00000196115		"""ADAM metallopeptidase domain containing"""	212	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 5"""	ADAM5P		8786143, 10417343	Standard	NR_001448		Approved	tMDCII	uc003xnb.3	Q6NVV9	OTTHUMG00000154982		8.37:g.39181728C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MW71|Q4G196	RNA	SNP	-	NULL	ENST00000505455.1	37	NULL		8																																																																																			ADAM5	-	-	ENSG00000196115		0.318	ADAM5-006	KNOWN	basic	processed_transcript	ADAM5	HGNC	pseudogene	OTTHUMT00000337882.1	35	0.00	0	C	NR_001448		39181728	39181728	+1	no_errors	ENST00000359790	ensembl	human	known	69_37n	rna	36	14.29	6	SNP	0.976	T
ADAMTS7	11173	genome.wustl.edu	37	15	79051801	79051801	+	Missense_Mutation	SNP	C	C	A	rs201472223		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr15:79051801C>A	ENST00000388820.4	-	24	5233	c.5023G>T	c.(5023-5025)Gcc>Tcc	p.A1675S		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1675					cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						CGGGAGGGGGCGCCGTGGCTG	0.721																																						dbGAP											0													7.0	9.0	9.0					15																	79051801		2082	4133	6215	-	-	-	SO:0001583	missense	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.5023G>T	15.37:g.79051801C>A	ENSP00000373472:p.Ala1675Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14F51|Q6P7J9	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.A1675S	ENST00000388820.4	37	c.5023	CCDS32303.1	15	.	.	.	.	.	.	.	.	.	.	c	1.406	-0.576936	0.03854	.	.	ENSG00000136378	ENST00000388820	T	0.59502	0.26	2.92	0.947	0.19555	.	2.418420	0.02155	U	0.058341	T	0.39627	0.1085	N	0.19112	0.55	0.09310	N	1	B	0.25007	0.116	B	0.23150	0.044	T	0.16600	-1.0397	10	0.09590	T	0.72	.	6.0212	0.19630	0.0:0.7622:0.0:0.2378	.	1675	Q9UKP4	ATS7_HUMAN	S	1675	ENSP00000373472:A1675S	ENSP00000373472:A1675S	A	-	1	0	ADAMTS7	76838856	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	0.624000	0.24462	0.111000	0.17947	-2.153000	0.00332	GCC	ADAMTS7	-	NULL	ENSG00000136378		0.721	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	14	0.00	0	C	NM_014272		79051801	79051801	-1	no_errors	ENST00000388820	ensembl	human	known	69_37n	missense	4	55.56	5	SNP	0.001	A
ADGB	79747	genome.wustl.edu	37	6	147122366	147122366	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr6:147122366C>T	ENST00000397944.3	+	34	4661	c.4585C>T	c.(4585-4587)Cga>Tga	p.R1529*	ADGB_ENST00000367488.1_3'UTR|KATNBL1P6_ENST00000562413.2_RNA|ADGB_ENST00000367493.3_3'UTR	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1529					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						AACATCTCCACGACTTATTCG	0.313																																						dbGAP											0													157.0	143.0	147.0					6																	147122366		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4585C>T	6.37:g.147122366C>T	ENSP00000381036:p.Arg1529*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T402|Q5T904|Q5T905	Nonsense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.R1529*	ENST00000397944.3	37	c.4585		6	.	.	.	.	.	.	.	.	.	.	C	12.88	2.070750	0.36566	.	.	ENSG00000118492	ENST00000397944;ENST00000367490;ENST00000326916	.	.	.	3.7	1.85	0.25348	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	6.4114	0.21692	0.2118:0.5834:0.2048:0.0	.	.	.	.	X	1529;487;252	.	ENSP00000323839:R252X	R	+	1	2	C6orf103	147164059	0.023000	0.18921	0.159000	0.22649	0.115000	0.19883	1.004000	0.29822	0.515000	0.28320	-0.282000	0.10007	CGA	ADGB	-	NULL	ENSG00000118492		0.313	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	33	0.00	0	C	NM_024694		147122366	147122366	+1	no_errors	ENST00000397944	ensembl	human	known	69_37n	nonsense	23	20.69	6	SNP	0.273	T
AGAP1	116987	genome.wustl.edu	37	2	236761396	236761396	+	Intron	SNP	C	C	T	rs13006916	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:236761396C>T	ENST00000304032.8	+	10	1630				AGAP1_ENST00000409457.1_Missense_Mutation_p.R373C|AGAP1_ENST00000409538.1_Intron|AGAP1_ENST00000336665.5_Intron|AGAP1_ENST00000428334.2_Intron	NM_001037131.2	NP_001032208.1	Q9UPQ3	AGAP1_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 1						protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|phospholipid binding (GO:0005543)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						AGCCCGTGCCCGTCAGTCCTC	0.587													C|||	2402	0.479633	0.0968	0.6499	5008	,	,		15278	0.7688		0.5179	False		,,,				2504	0.5389					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF413078	CCDS2514.1, CCDS33408.1, CCDS58756.1	2q37	2013-01-10	2008-09-22	2008-09-22	ENSG00000157985	ENSG00000157985		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16922	protein-coding gene	gene with protein product		608651	"""centaurin, gamma 2"""	CENTG2			Standard	NM_001037131		Approved	KIAA1099, GGAP1	uc002vvs.3	Q9UPQ3	OTTHUMG00000133293	ENST00000304032.8:c.1051-30593C>T	2.37:g.236761396C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX7|Q541S5|Q6P9D7|Q9NV93	Missense_Mutation	SNP	pfam_MIRO-like,pfam_Small_GTPase,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,prints_Small_GTPase	p.R373C	ENST00000304032.8	37	c.1117	CCDS33408.1	2	1127	0.5160256410256411	65	0.13211382113821138	217	0.5994475138121547	445	0.777972027972028	400	0.5277044854881267	C	10.78	1.447041	0.25987	.	.	ENSG00000157985	ENST00000409457	D	0.87491	-2.26	5.28	3.43	0.39272	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.09310	P	0.999999999999999	.	.	.	.	.	.	T	0.46119	-0.9214	5	0.87932	D	0	.	10.554	0.45105	0.1506:0.7048:0.1446:0.0	rs13006916;rs13006916	.	.	.	C	373	ENSP00000387174:R373C	ENSP00000387174:R373C	R	+	1	0	AGAP1	236426135	0.462000	0.25791	0.379000	0.26080	0.855000	0.48748	0.726000	0.25984	0.587000	0.29643	0.655000	0.94253	CGT	AGAP1	-	NULL	ENSG00000157985		0.587	AGAP1-001	KNOWN	basic|CCDS	protein_coding	AGAP1	HGNC	protein_coding	OTTHUMT00000257076.2	46	0.00	0	C	NM_014914		236761396	236761396	+1	no_errors	ENST00000409457	ensembl	human	novel	69_37n	missense	26	13.33	4	SNP	0.903	T
AGAP4	119016	genome.wustl.edu	37	10	51225623	51225623	+	Silent	SNP	A	A	G	rs200187422	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr10:51225623A>G	ENST00000425119.2	-	7	1484	c.1359T>C	c.(1357-1359)aaT>aaC	p.N453N	AGAP8_ENST00000602930.1_Silent_p.N437N	NM_001077686.1|NM_001276344.1	NP_001071154.1|NP_001263273.1	Q5SRD3	AGAP8_HUMAN		453	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(2)|ovary(2)	6						CACAGTGGGCATTCCCACGCA	0.547													g|||	4108	0.820288	0.8616	0.8084	5008	,	,		7521	0.9147		0.6879	False		,,,				2504	0.8119					dbGAP											0													13.0	17.0	16.0					10																	51225623		721	1824	2545	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000425119.2:c.1359T>C	10.37:g.51225623A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP	p.N453	ENST00000425119.2	37	c.1359	CCDS41522.1	10																																																																																			AGAP8	-	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	ENSG00000174194		0.547	AGAP8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGAP8	HGNC	protein_coding	OTTHUMT00000048022.2	31	0.00	0	A			51225623	51225623	-1	no_errors	ENST00000425119	ensembl	human	known	69_37n	silent	12	25.00	4	SNP	0.990	G
AHNAK	79026	genome.wustl.edu	37	11	62293880	62293880	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:62293880G>A	ENST00000378024.4	-	5	8283	c.8009C>T	c.(8008-8010)tCa>tTa	p.S2670L	AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000530124.1_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2670					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTTGGGTCCTGAGACATCAAT	0.483																																						dbGAP											0													170.0	171.0	170.0					11																	62293880		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.8009C>T	11.37:g.62293880G>A	ENSP00000367263:p.Ser2670Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S2670L	ENST00000378024.4	37	c.8009	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	g	13.59	2.282260	0.40394	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.19250	2.16	4.31	4.31	0.51392	.	.	.	.	.	T	0.55641	0.1933	M	0.91972	3.26	0.09310	N	1	D	0.64830	0.994	D	0.73708	0.981	T	0.55192	-0.8179	9	0.54805	T	0.06	-0.7733	16.4116	0.83717	0.0:0.0:1.0:0.0	.	2670	Q09666	AHNK_HUMAN	L	759;2670	ENSP00000367263:S2670L	ENSP00000244934:S759L	S	-	2	0	AHNAK	62050456	0.004000	0.15560	0.008000	0.14137	0.413000	0.31143	1.164000	0.31810	1.950000	0.56595	0.479000	0.44913	TCA	AHNAK	-	NULL	ENSG00000124942		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	125	0.00	0	G	NM_024060		62293880	62293880	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	61	28.24	24	SNP	0.127	A
AHNAK2	113146	genome.wustl.edu	37	14	105412344	105412344	+	Silent	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr14:105412344G>A	ENST00000333244.5	-	7	9563	c.9444C>T	c.(9442-9444)ttC>ttT	p.F3148F	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	3148						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ACGGCATCTTGAACTTGGGCA	0.602																																						dbGAP											0													197.0	141.0	159.0					14																	105412344		1920	4064	5984	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.9444C>T	14.37:g.105412344G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.F3148	ENST00000333244.5	37	c.9444	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.602	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	122	0.00	0	G	NM_138420		105412344	105412344	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	47	20.34	12	SNP	0.771	A
ALG13	79868	genome.wustl.edu	37	X	110964851	110964851	+	Silent	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:110964851G>A	ENST00000394780.3	+	12	1359	c.1347G>A	c.(1345-1347)aaG>aaA	p.K449K	ALG13_ENST00000251943.4_Silent_p.K345K	NM_001099922.2|NM_001257231.1	NP_001093392.1|NP_001244160.1	Q9NP73	ALG13_HUMAN	ALG13, UDP-N-acetylglucosaminyltransferase subunit	449					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|lipid glycosylation (GO:0030259)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)	carbohydrate binding (GO:0030246)|cysteine-type peptidase activity (GO:0008234)|N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase activity (GO:0004577)|poly(A) RNA binding (GO:0044822)			endometrium(2)|lung(10)|skin(1)	13						ATCCATCAAAGATGCCCTTCC	0.363																																						dbGAP											0													83.0	68.0	72.0					X																	110964851		1567	3582	5149	-	-	-	SO:0001819	synonymous_variant	0			AF220051	CCDS14559.1, CCDS55477.1, CCDS59173.1, CCDS76011.1, CCDS76012.1, CCDS76013.1	Xq23	2014-02-24	2013-02-21	2006-11-07	ENSG00000101901	ENSG00000101901	2.4.1.141	"""Tudor domain containing"", ""OTU domain containing"""	30881	protein-coding gene	gene with protein product	"""tudor domain containing 13"", ""N-acetylglucosaminyldiphosphodolichol N-acetylglucosaminyltransferase"""	300776	"""glycosyltransferase 28 domain containing 1"", ""chromosome X open reading frame 45"", ""asparagine-linked glycosylation 13 homolog (S. cerevisiae)"""	GLT28D1, CXorf45		12477932	Standard	NM_018466		Approved	MDS031, YGL047W, FLJ23018, TDRD13	uc011msy.2	Q9NP73	OTTHUMG00000022209	ENST00000394780.3:c.1347G>A	X.37:g.110964851G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKD6|B1AKM1|B2R5L5|B7Z6J0|B7Z804|B7Z847|B7Z9A8|B7ZAJ1|B7ZB57|Q17RC3|Q5JXY9|Q9H5U8	Silent	SNP	pfam_OTU,pfscan_OTU,pfscan_Tudor	p.K345	ENST00000394780.3	37	c.1035	CCDS55477.1	X																																																																																			ALG13	-	NULL	ENSG00000101901		0.363	ALG13-011	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ALG13	HGNC	protein_coding	OTTHUMT00000272895.1	64	0.00	0	G	NM_018466		110964851	110964851	+1	no_errors	ENST00000251943	ensembl	human	known	69_37n	silent	41	32.79	20	SNP	1.000	A
ALS2CR11	151254	genome.wustl.edu	37	2	202402194	202402194	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:202402194G>A	ENST00000286195.3	-	12	1215	c.1171C>T	c.(1171-1173)Ctt>Ttt	p.L391F	ALS2CR11_ENST00000450242.1_Missense_Mutation_p.L391F|ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000439140.1_Missense_Mutation_p.L391F	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11	391										NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						TCATTTACAAGAGGGATATCT	0.244																																						dbGAP											0													32.0	32.0	32.0					2																	202402194		2193	4269	6462	-	-	-	SO:0001583	missense	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1171C>T	2.37:g.202402194G>A	ENSP00000286195:p.Leu391Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.L391F	ENST00000286195.3	37	c.1171	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	G	0.493	-0.874595	0.02550	.	.	ENSG00000155754	ENST00000286195;ENST00000439140;ENST00000450242	T;T;T	0.44083	0.93;0.93;0.93	4.24	-4.03	0.04021	.	1.171060	0.06647	N	0.762097	T	0.16385	0.0394	N	0.12182	0.205	0.09310	N	1	B;B	0.18013	0.011;0.025	B;B	0.15052	0.005;0.012	T	0.19976	-1.0289	10	0.09084	T	0.74	.	0.8822	0.01236	0.1825:0.2944:0.1773:0.3457	.	391;391	E9PGG4;Q53TS8	.;AL2SA_HUMAN	F	391	ENSP00000286195:L391F;ENSP00000409937:L391F;ENSP00000399016:L391F	ENSP00000286195:L391F	L	-	1	0	ALS2CR11	202110439	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.633000	0.05483	-0.778000	0.04566	-1.137000	0.01932	CTT	ALS2CR11	-	NULL	ENSG00000155754		0.244	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	144	0.00	0	G	NM_152525		202402194	202402194	-1	no_errors	ENST00000286195	ensembl	human	known	69_37n	missense	79	23.08	24	SNP	0.000	A
ARL11	115761	genome.wustl.edu	37	13	50206328	50206328	+	3'UTR	SNP	G	G	C	rs1535467	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr13:50206328G>C	ENST00000282026.1	+	0	2080				ARL11_ENST00000490932.1_3'UTR	NM_138450.5	NP_612459.1	Q969Q4	ARL11_HUMAN	ADP-ribosylation factor-like 11						hematopoietic progenitor cell differentiation (GO:0002244)|small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			kidney(1)|large_intestine(4)|ovary(1)	6		Lung NSC(96;2.1e-05)|Breast(56;0.00015)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.119)|Kidney(9;0.169)	GBM - Glioblastoma multiforme(99;1.67e-09)		CATATCTTTCGTTAAAGATCA	0.284													C|||	1282	0.25599	0.0809	0.3963	5008	,	,		17811	0.1865		0.4911	False		,,,				2504	0.2229					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF441378	CCDS9419.1	13q14.12	2014-05-09			ENSG00000152213	ENSG00000152213		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	24046	protein-coding gene	gene with protein product		609351				12477932	Standard	NM_138450		Approved	ARLTS1, FLJ33930	uc001vdf.2	Q969Q4	OTTHUMG00000016919	ENST00000282026.1:c.*1154G>C	13.37:g.50206328G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000282026.1	37	NULL	CCDS9419.1	13																																																																																			ARL11	-	-	ENSG00000152213		0.284	ARL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL11	HGNC	protein_coding	OTTHUMT00000044929.2	21	0.00	0	G	NM_138450		50206328	50206328	+1	no_errors	ENST00000490932	ensembl	human	known	69_37n	rna	11	21.43	3	SNP	0.039	C
ATAD3A	55210	genome.wustl.edu	37	1	1447922	1447922	+	Intron	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:1447922C>G	ENST00000378755.5	+	1	299				ATAD3A_ENST00000536055.1_5'UTR|ATAD3A_ENST00000378756.3_Intron	NM_018188.3	NP_060658.3	Q9NVI7	ATD3A_HUMAN	ATPase family, AAA domain containing 3A						cell growth (GO:0016049)|negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(4)|kidney(6)|large_intestine(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	20	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;1.12e-36)|OV - Ovarian serous cystadenocarcinoma(86;2.18e-22)|Colorectal(212;0.000164)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00233)|BRCA - Breast invasive adenocarcinoma(365;0.00469)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0347)|Lung(427;0.147)		GAGCCCTGGCCCTTGCCGCTC	0.811																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK025865	CCDS31.1, CCDS53259.1, CCDS53260.1	1p36.33	2010-04-21		2007-02-08	ENSG00000197785	ENSG00000197785		"""ATPases / AAA-type"""	25567	protein-coding gene	gene with protein product		612316				12477932	Standard	NM_018188		Approved	FLJ10709	uc001afz.2	Q9NVI7	OTTHUMG00000000575	ENST00000378755.5:c.205+69C>G	1.37:g.1447922C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPB3|D2K8Q1|G3V1I6|Q5SV23|Q8N275|Q96A50	Missense_Mutation	SNP	pfam_DUF3523,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.P5A	ENST00000378755.5	37	c.13	CCDS31.1	1	.	.	.	.	.	.	.	.	.	.	c	7.904	0.734966	0.15574	.	.	ENSG00000197785	ENST00000339113	.	.	.	2.12	-0.206	0.13193	.	.	.	.	.	T	0.24044	0.0582	.	.	.	0.20703	N	0.999864	.	.	.	.	.	.	T	0.26677	-1.0096	4	.	.	.	.	5.005	0.14284	0.2354:0.5342:0.2304:0.0	.	.	.	.	A	5	.	.	P	+	1	0	ATAD3A	1437785	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	-0.514000	0.06298	-0.189000	0.10482	0.455000	0.32223	CCT	ATAD3A	-	NULL	ENSG00000197785		0.811	ATAD3A-003	KNOWN	basic|CCDS	protein_coding	ATAD3A	HGNC	protein_coding	OTTHUMT00000001365.1	10	0.00	0	C	NM_018188		1447922	1447922	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000339113	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	0.003	G
ATP6V1B1	525	genome.wustl.edu	37	2	71189937	71189937	+	Silent	SNP	G	G	T	rs372478273		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:71189937G>T	ENST00000234396.4	+	9	889	c.816G>T	c.(814-816)gcG>gcT	p.A272A	ATP6V1B1_ENST00000412314.1_Silent_p.A272A|AC007040.11_ENST00000606025.1_Intron|RN7SL160P_ENST00000468558.2_RNA	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1	272					ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						CGCGCCTGGCGCTGACCACTG	0.582																																						dbGAP											0													127.0	111.0	116.0					2																	71189937		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.816G>T	2.37:g.71189937G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FY0|Q6P4H6	Silent	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_F1/V1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/A1-cplx_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,tigrfam_ATPase_V1-cplx_bsu	p.A272	ENST00000234396.4	37	c.816	CCDS1912.1	2																																																																																			ATP6V1B1	-	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,tigrfam_ATPase_V1-cplx_bsu	ENSG00000116039		0.582	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1B1	HGNC	protein_coding	OTTHUMT00000251920.2	31	0.00	0	G	NM_001692		71189937	71189937	+1	no_errors	ENST00000234396	ensembl	human	known	69_37n	silent	29	25.64	10	SNP	0.868	T
BCR	613	genome.wustl.edu	37	22	23654993	23654993	+	Intron	SNP	A	A	G	rs180805	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr22:23654993A>G	ENST00000305877.8	+	20	4073				BCR_ENST00000436990.2_Intron|BCR_ENST00000359540.3_Intron	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	TGGCAGGGACAGTGCTTTAGC	0.577			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""								.|||	2346	0.46845	0.4894	0.4092	5008	,	,		19556	0.6339		0.3797	False		,,,				2504	0.4029					dbGAP		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0																																										-	-	-	SO:0001627	intron_variant	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.3323-81A>G	22.37:g.23654993A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P78501|Q12842|Q4LE80|Q6NZI3	RNA	SNP	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			BCR	-	-	ENSG00000186716		0.577	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	77	0.00	0	A	NM_004327		23654993	23654993	+1	no_errors	ENST00000458056	ensembl	human	known	69_37n	rna	48	11.11	6	SNP	0.000	G
BLMH	642	genome.wustl.edu	37	17	28612499	28612499	+	Splice_Site	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:28612499C>G	ENST00000261714.6	-	6	727		c.e6-1		BLMH_ENST00000582669.1_5'UTR|BLMH_ENST00000394819.3_Splice_Site|RNU6-1267P_ENST00000410747.1_RNA	NM_000386.3	NP_000377.1	Q13867	BLMH_HUMAN	bleomycin hydrolase						antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|carboxypeptidase activity (GO:0004180)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(2)|ovary(1)|prostate(1)|stomach(1)	13					Bleomycin(DB00290)	ATTCTCTCATCTATGACAGAA	0.433																																					Pancreas(127;628 1772 12912 33293 36203)	dbGAP											0													115.0	102.0	106.0					17																	28612499		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X92106	CCDS32604.1	17q11.2	2004-02-16				ENSG00000108578			1059	protein-coding gene	gene with protein product		602403				9407121, 9331073	Standard	NM_000386		Approved	BH	uc002hez.2	Q13867		ENST00000261714.6:c.553-1G>C	17.37:g.28612499C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R796|Q53F86|Q9UER9	Splice_Site	SNP	-	e6-1	ENST00000261714.6	37	c.553-1	CCDS32604.1	17	.	.	.	.	.	.	.	.	.	.	C	23.1	4.375242	0.82682	.	.	ENSG00000108578	ENST00000261714;ENST00000394819	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.335	0.94312	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	BLMH	25636625	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.788000	0.75105	2.890000	0.99128	0.650000	0.86243	.	BLMH	-	-	ENSG00000108578		0.433	BLMH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLMH	HGNC	protein_coding	OTTHUMT00000447940.1	61	0.00	0	C	NM_000386	Intron	28612499	28612499	-1	no_errors	ENST00000261714	ensembl	human	known	69_37n	splice_site	63	16.00	12	SNP	1.000	G
BPGM	669	genome.wustl.edu	37	7	134346825	134346825	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:134346825G>A	ENST00000393132.2	+	3	1055	c.566G>A	c.(565-567)gGa>gAa	p.G189E	BPGM_ENST00000344924.3_Missense_Mutation_p.G189E|BPGM_ENST00000418040.1_Missense_Mutation_p.G189E	NM_199186.2	NP_954655.1	P07738	PMGE_HUMAN	2,3-bisphosphoglycerate mutase	189	2,3-bisphospho-D-glycerate binding.				carbohydrate metabolic process (GO:0005975)|erythrocyte development (GO:0048821)|glycolytic process (GO:0006096)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)			breast(1)|endometrium(1)|lung(2)|stomach(1)	5						TCTGCTCATGGAAATAGCAGT	0.418																																						dbGAP											0													72.0	71.0	71.0					7																	134346825		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017050	CCDS5833.1	7q33	2012-10-02			ENSG00000172331	ENSG00000172331	5.4.2.4		1093	protein-coding gene	gene with protein product		613896					Standard	NM_199186		Approved		uc003vrw.3	P07738	OTTHUMG00000155380	ENST00000393132.2:c.566G>A	7.37:g.134346825G>A	ENSP00000376840:p.Gly189Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N9	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	p.G189E	ENST00000393132.2	37	c.566	CCDS5833.1	7	.	.	.	.	.	.	.	.	.	.	G	31	5.086056	0.94100	.	.	ENSG00000172331	ENST00000344924;ENST00000418040;ENST00000393132	D;D;D	0.84944	-1.92;-1.92;-1.92	6.02	6.02	0.97574	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.93671	0.7978	M	0.85859	2.78	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.93594	0.6924	10	0.87932	D	0	-22.72	20.5373	0.99239	0.0:0.0:1.0:0.0	.	189	P07738	PMGE_HUMAN	E	189	ENSP00000342032:G189E;ENSP00000399838:G189E;ENSP00000376840:G189E	ENSP00000342032:G189E	G	+	2	0	BPGM	133997365	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.807000	0.99171	2.857000	0.98124	0.650000	0.86243	GGA	BPGM	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	ENSG00000172331		0.418	BPGM-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BPGM	HGNC	protein_coding	OTTHUMT00000339763.1	39	0.00	0	G	NM_001724		134346825	134346825	+1	no_errors	ENST00000344924	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	A
CCM2L	140706	genome.wustl.edu	37	20	30605928	30605928	+	Silent	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr20:30605928G>T	ENST00000300415.8	+	4	442	c.429G>T	c.(427-429)ctG>ctT	p.L143L	CCM2L_ENST00000262659.8_Silent_p.L143L			Q9NUG4	CCM2L_HUMAN	cerebral cavernous malformation 2-like	143																	CCTCCTACCTGCAGGACGACG	0.731																																						dbGAP											0													16.0	14.0	15.0					20																	30605928		2189	4279	6468	-	-	-	SO:0001819	synonymous_variant	0			AL031658	CCDS13195.1	20q11.21	2012-10-30	2012-10-30	2012-10-30	ENSG00000101331	ENSG00000101331			16153	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 160"""	C20orf160			Standard	NM_080625		Approved	dJ310O13.5	uc002wxf.2	Q9NUG4	OTTHUMG00000032197	ENST00000300415.8:c.429G>T	20.37:g.30605928G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYR9|Q8N5F1|Q8N6G8|Q96MD5	Silent	SNP	NULL	p.L143	ENST00000300415.8	37	c.429		20																																																																																			C20orf160	-	NULL	ENSG00000101331		0.731	CCM2L-201	KNOWN	basic|appris_candidate_longest	protein_coding	C20orf160	HGNC	protein_coding		15	0.00	0	G	NM_080625		30605928	30605928	+1	no_errors	ENST00000300415	ensembl	human	known	69_37n	silent	31	26.19	11	SNP	1.000	T
C3orf49	132200	genome.wustl.edu	37	3	63817430	63817430	+	Missense_Mutation	SNP	G	G	C	rs2291533	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr3:63817430G>C	ENST00000295896.8	+	5	869	c.759G>C	c.(757-759)caG>caC	p.Q253H				Q96BT1	CC049_HUMAN	chromosome 3 open reading frame 49	253										breast(2)	2						AGCTTCAACAGTGTGAGTTTC	0.388													G|||	742	0.148163	0.0734	0.2176	5008	,	,		17888	0.1458		0.2008	False		,,,				2504	0.1483					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC015210		3p14.1	2013-01-15			ENSG00000163632	ENSG00000163632			25190	other	unknown						12477932	Standard	NR_026866		Approved		uc003dls.4	Q96BT1	OTTHUMG00000158761	ENST00000295896.8:c.759G>C	3.37:g.63817430G>C	ENSP00000295896:p.Gln253His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q253H	ENST00000295896.8	37	c.759		3	353	0.16163003663003664	28	0.056910569105691054	75	0.20718232044198895	97	0.16958041958041958	153	0.20184696569920843	G	10.98	1.505205	0.26949	.	.	ENSG00000163632	ENST00000295896	.	.	.	6.16	1.05	0.20165	.	0.367200	0.25747	N	0.028563	T	0.00039	0.0001	.	.	.	0.42351	P	0.007624999999999993	B	0.06786	0.001	B	0.09377	0.004	T	0.09422	-1.0675	7	0.66056	D	0.02	-2.4719	9.0832	0.36565	0.1313:0.3622:0.5065:0.0	rs2291533;rs17655796;rs56495918;rs2291533	253	Q96BT1	CC049_HUMAN	H	253	.	ENSP00000295896:Q253H	Q	+	3	2	C3orf49	63792470	1.000000	0.71417	0.999000	0.59377	0.921000	0.55340	0.279000	0.18771	0.455000	0.26910	0.650000	0.86243	CAG	C3orf49	-	NULL	ENSG00000163632		0.388	C3orf49-001	KNOWN	basic|appris_principal	protein_coding	C3orf49	HGNC	protein_coding	OTTHUMT00000352067.1	45	0.00	0	G	NR_026866		63817430	63817430	+1	no_errors	ENST00000295896	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	C
C8orf31	286122	genome.wustl.edu	37	8	144126072	144126072	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr8:144126072C>T	ENST00000395172.1	+	4	545	c.193C>T	c.(193-195)Ccc>Tcc	p.P65S	C8orf31_ENST00000517653.1_3'UTR	NM_173687.2	NP_775958.1	Q8N9H6	CH031_HUMAN	chromosome 8 open reading frame 31	65										breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	10	all_cancers(97;1.89e-10)|all_epithelial(106;8.73e-09)|Lung NSC(106;0.000161)|all_lung(105;0.000447)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CCAGAACCTGCCCTCTGCCCT	0.627																																						dbGAP											0													67.0	57.0	60.0					8																	144126072		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6395.1	8q24.3	2012-04-11			ENSG00000177335	ENSG00000177335			26731	protein-coding gene	gene with protein product							Standard	NM_173687		Approved	FLJ37131	uc003yxp.1	Q8N9H6	OTTHUMG00000164771	ENST00000395172.1:c.193C>T	8.37:g.144126072C>T	ENSP00000378601:p.Pro65Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GMU7	Missense_Mutation	SNP	NULL	p.P65S	ENST00000395172.1	37	c.193	CCDS6395.1	8	.	.	.	.	.	.	.	.	.	.	c	6.506	0.461521	0.12342	.	.	ENSG00000177335	ENST00000395172	T	0.57273	0.41	1.37	-1.12	0.09808	.	.	.	.	.	T	0.26122	0.0637	N	0.08118	0	0.09310	N	1	B	0.23540	0.087	B	0.14023	0.01	T	0.15549	-1.0433	9	0.87932	D	0	.	3.152	0.06492	0.0:0.4059:0.3681:0.2259	.	65	Q8N9H6	CH031_HUMAN	S	65	ENSP00000378601:P65S	ENSP00000378601:P65S	P	+	1	0	C8orf31	144197447	0.004000	0.15560	0.001000	0.08648	0.011000	0.07611	-0.114000	0.10757	-0.305000	0.08831	-0.436000	0.05848	CCC	C8orf31	-	NULL	ENSG00000177335		0.627	C8orf31-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf31	HGNC	protein_coding	OTTHUMT00000380167.1	28	0.00	0	C	NM_173687		144126072	144126072	+1	no_errors	ENST00000395172	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	0.007	T
CCM2	83605	genome.wustl.edu	37	7	45115773	45115773	+	3'UTR	SNP	T	T	C	rs7804	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:45115773T>C	ENST00000258781.6	+	0	1601				CCM2_ENST00000541586.1_3'UTR|CCM2_ENST00000475551.1_3'UTR|CCM2_ENST00000381112.3_3'UTR|CCM2_ENST00000461377.1_3'UTR|CCM2_ENST00000474617.1_3'UTR|CCM2_ENST00000544363.1_3'UTR	NM_031443.3	NP_113631.1	Q9BSQ5	CCM2_HUMAN	cerebral cavernous malformation 2						blood vessel endothelial cell differentiation (GO:0060837)|cell-cell junction organization (GO:0045216)|endothelial cell development (GO:0001885)|endothelial tube morphogenesis (GO:0061154)|in utero embryonic development (GO:0001701)|inner ear development (GO:0048839)|integrin-mediated signaling pathway (GO:0007229)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|stress-activated MAPK cascade (GO:0051403)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)	cytoplasm (GO:0005737)|protein complex (GO:0043234)				NS(1)|endometrium(3)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19						AGGCGCCCGGTGCAGATGGCC	0.677													C|||	1339	0.267372	0.2398	0.402	5008	,	,		14755	0.1329		0.3579	False		,,,				2504	0.2546					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC004903	CCDS5500.1, CCDS34630.1, CCDS55108.1, CCDS55109.1	7p13	2014-09-17	2004-02-13	2004-02-18	ENSG00000136280	ENSG00000136280			21708	protein-coding gene	gene with protein product	"""malcavernin"""	607929	"""chromosome 7 open reading frame 22"""	C7orf22		9811928	Standard	NM_001029835		Approved	MGC4607	uc003tms.3	Q9BSQ5	OTTHUMG00000129246	ENST00000258781.6:c.*117T>C	7.37:g.45115773T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2L4|B3KUV0|D3DVL4|E9PDJ3|F5H0E1|F5H551|Q71RE5|Q8TAT4	RNA	SNP	-	NULL	ENST00000258781.6	37	NULL	CCDS5500.1	7																																																																																			CCM2	-	-	ENSG00000136280		0.677	CCM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCM2	HGNC	protein_coding	OTTHUMT00000251348.1	53	0.00	0	T	NM_031443		45115773	45115773	+1	no_errors	ENST00000461377	ensembl	human	known	69_37n	rna	41	10.64	5	SNP	0.000	C
CD200R1	131450	genome.wustl.edu	37	3	112648230	112648230	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr3:112648230T>A	ENST00000471858.1	-	3	490	c.258A>T	c.(256-258)aaA>aaT	p.K86N	CD200R1_ENST00000295863.4_Missense_Mutation_p.K64N|CD200R1_ENST00000440122.2_Missense_Mutation_p.K109N|CD200R1_ENST00000490004.1_Missense_Mutation_p.K86N|CD200R1_ENST00000308611.3_Missense_Mutation_p.K109N	NM_170780.2	NP_740750.1	Q8TD46	MO2R1_HUMAN	CD200 receptor 1	86	Ig-like V-type.				regulation of immune response (GO:0050776)|viral process (GO:0016032)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	26						TCTTGTAGGCTTTTGTGCAGG	0.428																																						dbGAP											0													143.0	140.0	141.0					3																	112648230		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK126349	CCDS2969.1, CCDS2970.1, CCDS46889.1, CCDS54623.1	3q13	2014-05-15	2004-08-31	2004-09-01	ENSG00000163606	ENSG00000163606		"""Immunoglobulin superfamily / C2-set domain containing"""	24235	protein-coding gene	gene with protein product		607546	"""MOX2 receptor"""	MOX2R		10981966, 11133863	Standard	NM_138806		Approved	OX2R, HCRTR2, CD200R	uc003dzj.1	Q8TD46	OTTHUMG00000159298	ENST00000471858.1:c.258A>T	3.37:g.112648230T>A	ENSP00000418928:p.Lys86Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWZ9|E9PCM9|Q52LJ7|Q6IS95|Q6UW94|Q6WHB8|Q8TD44|Q8TD45|Q8TD52	Missense_Mutation	SNP	pfam_CD80_C2-set,pfscan_Ig-like	p.K109N	ENST00000471858.1	37	c.327	CCDS2970.1	3	.	.	.	.	.	.	.	.	.	.	T	15.60	2.882242	0.51908	.	.	ENSG00000163606	ENST00000471858;ENST00000308611;ENST00000295863;ENST00000440122;ENST00000490004	T;T;T;T;T	0.65178	1.57;1.57;1.57;-0.14;-0.14	5.36	-3.55	0.04639	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	1.502220	0.03729	N	0.253168	T	0.59676	0.2211	L	0.36672	1.1	0.09310	N	1	P;P;P;P;D	0.56968	0.883;0.764;0.867;0.652;0.978	B;B;B;B;P	0.56343	0.306;0.307;0.336;0.079;0.796	T	0.54296	-0.8315	10	0.38643	T	0.18	.	3.3799	0.07251	0.3914:0.2369:0.0:0.3716	.	64;86;109;86;109	B4E2U2;Q8TD46-3;Q8TD46-2;Q8TD46;Q8TD46-4	.;.;.;MO2R1_HUMAN;.	N	86;109;64;109;86	ENSP00000418928:K86N;ENSP00000311035:K109N;ENSP00000295863:K64N;ENSP00000405733:K109N;ENSP00000418801:K86N	ENSP00000295863:K64N	K	-	3	2	CD200R1	114130920	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-0.043000	0.12043	-0.246000	0.09611	0.455000	0.32223	AAA	CD200R1	-	NULL	ENSG00000163606		0.428	CD200R1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD200R1	HGNC	protein_coding	OTTHUMT00000354467.1	52	0.00	0	T	NM_138806		112648230	112648230	-1	no_errors	ENST00000308611	ensembl	human	known	69_37n	missense	56	11.11	7	SNP	0.000	A
CDC42BPA	8476	genome.wustl.edu	37	1	227221077	227221077	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:227221077A>T	ENST00000366769.3	-	26	4702	c.3411T>A	c.(3409-3411)gaT>gaA	p.D1137E	CDC42BPA_ENST00000334218.5_Missense_Mutation_p.D1137E|CDC42BPA_ENST00000366766.2_Missense_Mutation_p.D1172E|CDC42BPA_ENST00000366765.3_Missense_Mutation_p.D1150E|CDC42BPA_ENST00000535525.1_Missense_Mutation_p.D1117E|CDC42BPA_ENST00000366767.3_Missense_Mutation_p.D1056E|CDC42BPA_ENST00000366764.2_Missense_Mutation_p.D1109E	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CATGGATAACATCAGAAGCCA	0.353																																						dbGAP											0													92.0	83.0	86.0					1																	227221077		2203	4300	6503	-	-	-	SO:0001583	missense	0			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.3411T>A	1.37:g.227221077A>T	ENSP00000355731:p.Asp1137Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Pkinase_C,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,superfamily_WD40_repeat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.D1137E	ENST00000366769.3	37	c.3411	CCDS1558.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	22.3|22.3	4.274424|4.274424	0.80580|0.80580	.|.	.|.	ENSG00000143776|ENSG00000143776	ENST00000448940;ENST00000442054;ENST00000429440;ENST00000441725|ENST00000366769;ENST00000366767;ENST00000334218;ENST00000366766;ENST00000366764;ENST00000366762;ENST00000535525;ENST00000366765	.|T;T;T;T;T;T;T	.|0.43688	.|0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.54|5.54	5.54|5.54	0.83059|0.83059	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.68081|0.68081	0.2962|0.2962	M|M	0.82716|0.82716	2.605|2.605	0.54753|0.54753	D|D	0.999985|0.999985	.|D;D;D;D;D;D;D;D	.|0.89917	.|0.999;1.0;1.0;0.995;0.996;0.994;0.994;0.996	.|D;D;D;D;D;D;D;D	.|0.87578	.|0.995;0.998;0.983;0.968;0.997;0.961;0.961;0.992	T|T	0.73600|0.73600	-0.3931|-0.3931	5|10	.|0.87932	.|D	.|0	.|.	15.9597|15.9597	0.79918|0.79918	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|1117;1109;452;34;1056;1137;1172;339	.|F5H5N0;Q5VT25-4;E9PEF7;Q5T7A7;Q5VT25-3;Q5VT25-5;Q5VT25-2;Q5T799	.|.;.;.;.;.;.;.;.	S|E	340;466;35;362|1137;1056;1137;1172;1109;452;1117;1150	.|ENSP00000355731:D1137E;ENSP00000355729:D1056E;ENSP00000335341:D1137E;ENSP00000355728:D1172E;ENSP00000355726:D1109E;ENSP00000443275:D1117E;ENSP00000355727:D1150E	.|ENSP00000335341:D1137E	C|D	-|-	1|3	0|2	CDC42BPA|CDC42BPA	225287700|225287700	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.967000|0.967000	0.64934|0.64934	2.723000|2.723000	0.47277|0.47277	2.226000|2.226000	0.72624|0.72624	0.482000|0.482000	0.46254|0.46254	TGT|GAT	CDC42BPA	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000143776		0.353	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1	33	0.00	0	A	NM_014826		227221077	227221077	-1	no_errors	ENST00000334218	ensembl	human	known	69_37n	missense	14	75.44	43	SNP	1.000	T
CNKSR2	22866	genome.wustl.edu	37	X	21670489	21670489	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:21670489A>C	ENST00000379510.3	+	22	2991	c.2955A>C	c.(2953-2955)gaA>gaC	p.E985D	CNKSR2_ENST00000425654.2_Missense_Mutation_p.E955D	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	985					regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						CATCTAAAGAATTCCAACAAT	0.393																																						dbGAP											0													142.0	120.0	127.0					X																	21670489		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2955A>C	X.37:g.21670489A>C	ENSP00000368824:p.Glu985Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	Missense_Mutation	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.E985D	ENST00000379510.3	37	c.2955	CCDS14198.1	X	.	.	.	.	.	.	.	.	.	.	A	8.330	0.826206	0.16749	.	.	ENSG00000149970	ENST00000425654;ENST00000379510	T;T	0.15017	2.46;2.47	5.8	4.59	0.56863	.	0.235349	0.42964	D	0.000640	T	0.10508	0.0257	N	0.17082	0.46	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.15093	-1.0449	10	0.25751	T	0.34	-25.0917	11.3259	0.49448	0.6911:0.3089:0.0:0.0	.	955;985	B7ZLJ1;Q8WXI2	.;CNKR2_HUMAN	D	955;985	ENSP00000397906:E955D;ENSP00000368824:E985D	ENSP00000368824:E985D	E	+	3	2	CNKSR2	21580410	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	2.301000	0.43628	1.948000	0.56530	0.441000	0.28932	GAA	CNKSR2	-	NULL	ENSG00000149970		0.393	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	75	0.00	0	A	NM_014927		21670489	21670489	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	missense	63	19.23	15	SNP	1.000	C
CNTN6	27255	genome.wustl.edu	37	3	1445058	1445058	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr3:1445058G>A	ENST00000446702.2	+	23	3670	c.3043G>A	c.(3043-3045)Gtc>Atc	p.V1015I	CNTN6_ENST00000539053.1_Missense_Mutation_p.V943I|CNTN6_ENST00000350110.2_Missense_Mutation_p.V1015I			Q9UQ52	CNTN6_HUMAN	contactin 6	1015					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		TCTTTCCATTGTCATTGTGAT	0.289																																						dbGAP											0													88.0	85.0	86.0					3																	1445058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.3043G>A	3.37:g.1445058G>A	ENSP00000407822:p.Val1015Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V1015I	ENST00000446702.2	37	c.3043	CCDS2557.1	3	.	.	.	.	.	.	.	.	.	.	G	6.363	0.435007	0.12045	.	.	ENSG00000134115	ENST00000446702;ENST00000539053;ENST00000350110	T;T;T	0.61392	0.11;0.13;0.11	5.0	0.962	0.19643	.	1.474710	0.04545	N	0.388893	T	0.30070	0.0753	N	0.04090	-0.28	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.19811	-1.0294	10	0.08381	T	0.77	.	4.1768	0.10356	0.339:0.0:0.5083:0.1527	.	1015	Q9UQ52	CNTN6_HUMAN	I	1015;943;1015	ENSP00000407822:V1015I;ENSP00000442791:V943I;ENSP00000341882:V1015I	ENSP00000341882:V1015I	V	+	1	0	CNTN6	1420058	0.000000	0.05858	0.000000	0.03702	0.228000	0.25075	0.732000	0.26072	0.165000	0.19558	0.650000	0.86243	GTC	CNTN6	-	NULL	ENSG00000134115		0.289	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	53	0.00	0	G	NM_014461		1445058	1445058	+1	no_errors	ENST00000350110	ensembl	human	known	69_37n	missense	36	25.00	12	SNP	0.000	A
COL18A1	80781	genome.wustl.edu	37	21	46925149	46925149	+	Silent	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr21:46925149A>C	ENST00000359759.4	+	34	4236	c.4215A>C	c.(4213-4215)ccA>ccC	p.P1405P	SLC19A1_ENST00000567670.1_Intron|COL18A1_ENST00000400337.2_Silent_p.P990P|COL18A1_ENST00000355480.5_Silent_p.P1170P			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1	1405	Triple-helical region 9 (COL9).				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCGGCCCCCCAGGCCCCCCAG	0.731																																						dbGAP											0													8.0	13.0	12.0					21																	46925149		1732	3972	5704	-	-	-	SO:0001819	synonymous_variant	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.4215A>C	21.37:g.46925149A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Silent	SNP	pfam_Collagenase_NC10/endostatin,pfam_DUF959_COL18_N,pfam_Collagen,pfam_Frizzled_dom,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl,superfamily_Frizzled_dom,smart_Frizzled_dom,smart_Laminin_G,pfscan_Frizzled_dom	p.P1405	ENST00000359759.4	37	c.4215		21																																																																																			COL18A1	-	NULL	ENSG00000182871		0.731	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	COL18A1	HGNC	protein_coding	OTTHUMT00000206827.1	24	0.00	0	A			46925149	46925149	+1	no_errors	ENST00000359759	ensembl	human	known	69_37n	silent	2	80.00	8	SNP	0.498	C
CYP24A1	1591	genome.wustl.edu	37	20	52774666	52774666	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr20:52774666C>G	ENST00000216862.3	-	9	1588	c.1195G>C	c.(1195-1197)Gac>Cac	p.D399H	CYP24A1_ENST00000395955.3_Missense_Mutation_p.D399H|CYP24A1_ENST00000460643.1_5'Flank|CYP24A1_ENST00000395954.3_Missense_Mutation_p.D257H	NM_000782.4	NP_000773.2	Q07973	CP24A_HUMAN	cytochrome P450, family 24, subfamily A, polypeptide 1	399					osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|response to vitamin D (GO:0033280)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D catabolic process (GO:0042369)|vitamin D metabolic process (GO:0042359)|vitamin D receptor signaling pathway (GO:0070561)|vitamin metabolic process (GO:0006766)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)	1-alpha,25-dihydroxyvitamin D3 24-hydroxylase activity (GO:0030342)|25-hydroxycholecalciferol-24-hydroxylase activity (GO:0008403)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)	p.D399N(1)		breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(4;1.08e-05)|all_lung(4;2.7e-05)		STAD - Stomach adenocarcinoma(23;0.206)		Calcidiol(DB00146)|Calcipotriol(DB02300)|Calcitriol(DB00136)|Corticotropin(DB01285)|Ergocalciferol(DB00153)|Paricalcitol(DB00910)	GTTGCCTTGTCAAGAGTCCGA	0.378																																						dbGAP											1	Substitution - Missense(1)	lung(1)											89.0	86.0	87.0					20																	52774666		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60669	CCDS33491.1, CCDS46616.1	20q13.2-q13.3	2003-02-28	2003-02-14	2003-02-28	ENSG00000019186	ENSG00000019186		"""Cytochrome P450s"""	2602	protein-coding gene	gene with protein product		126065	"""cytochrome P450, subfamily XXIV (vitamin D 24-hydroxylase)"""	CYP24			Standard	NM_000782		Approved	CP24, P450-CC24	uc002xwv.2	Q07973	OTTHUMG00000032773	ENST00000216862.3:c.1195G>C	20.37:g.52774666C>G	ENSP00000216862:p.Asp399His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15807|Q32ML3|Q5I2W7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_CYP24A_mit,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450	p.D399H	ENST00000216862.3	37	c.1195	CCDS33491.1	20	.	.	.	.	.	.	.	.	.	.	C	26.5	4.746942	0.89663	.	.	ENSG00000019186	ENST00000216862;ENST00000395955;ENST00000395954	T;T;T	0.68331	-0.32;-0.32;-0.32	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.81264	0.4786	M	0.66439	2.03	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.992;0.996;0.996	T	0.81389	-0.0955	10	0.54805	T	0.06	-22.0998	18.6106	0.91284	0.0:1.0:0.0:0.0	.	399;399;257	Q32ML3;Q07973;Q5I2W7	.;CP24A_HUMAN;.	H	399;399;257	ENSP00000216862:D399H;ENSP00000379285:D399H;ENSP00000379284:D257H	ENSP00000216862:D399H	D	-	1	0	CYP24A1	52208073	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.581000	0.60949	2.630000	0.89119	0.655000	0.94253	GAC	CYP24A1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000019186		0.378	CYP24A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP24A1	HGNC	protein_coding	OTTHUMT00000079769.2	17	0.00	0	C			52774666	52774666	-1	no_errors	ENST00000216862	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	1.000	G
Unknown	0	genome.wustl.edu	37	2	159719127	159719127	+	IGR	SNP	T	T	C	rs145953089	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:159719127T>C								DAPL1 (8833 upstream) : RNU2-21P (73182 downstream)																							AGCAGAGTCATCTCCTATGCA	0.512													T|||	449	0.0896565	0.0106	0.1225	5008	,	,		23291	0.0278		0.2217	False		,,,				2504	0.1012					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															2.37:g.159719127T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.H144		37	c.432		2																																																																																			DAPL1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000163331	0	0.512					DAPL1	HGNC			74	0.00	0	T			159719127	159719127	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000343761	ensembl	human	putative	69_37n	silent	36	10.00	4	SNP	0.092	C
DCDC1	341019	genome.wustl.edu	37	11	31327864	31327864	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:31327864A>C	ENST00000452803.1	-	5	707	c.506T>G	c.(505-507)cTt>cGt	p.L169R	DCDC1_ENST00000597505.1_Missense_Mutation_p.L169R|RP1-296L11.1_ENST00000528872.1_RNA	NM_181807.3	NP_861523.2	P59894	DCDC1_HUMAN	doublecortin domain containing 1	169	Doublecortin. {ECO:0000255|PROSITE- ProRule:PRU00072}.				intracellular signal transduction (GO:0035556)					central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(17)|pancreas(2)|prostate(1)|skin(1)|stomach(1)	31	Lung SC(675;0.225)					TCTTGGTTGAAGTTTGTGTCT	0.373																																						dbGAP											0													120.0	115.0	116.0					11																	31327864		2202	4299	6501	-	-	-	SO:0001583	missense	0			AY247970	CCDS7872.1	11p14.1	2013-05-22			ENSG00000170959	ENSG00000170959			20625	protein-coding gene	gene with protein product		608062				12820024	Standard	NM_181807		Approved		uc001msv.3	P59894	OTTHUMG00000150144	ENST00000452803.1:c.506T>G	11.37:g.31327864A>C	ENSP00000389792:p.Leu169Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVL6|B7WNX6|Q6ZU04	Missense_Mutation	SNP	superfamily_Doublecortin_dom,pfscan_Doublecortin_dom	p.L169R	ENST00000452803.1	37	c.506	CCDS7872.1	11	.	.	.	.	.	.	.	.	.	.	A	3.527	-0.096484	0.07010	.	.	ENSG00000188682	ENST00000452803	D	0.93426	-3.22	5.95	-1.48	0.08745	Doublecortin domain (1);	1.003840	0.08026	N	0.992796	D	0.83376	0.5241	N	0.22421	0.69	0.09310	N	1	B	0.21147	0.052	B	0.21151	0.033	T	0.69041	-0.5250	10	0.13470	T	0.59	.	1.8923	0.03250	0.2512:0.313:0.0771:0.3587	.	169	P59894	DCDC1_HUMAN	R	169	ENSP00000389792:L169R	ENSP00000343496:L169R	L	-	2	0	DCDC1	31284440	0.796000	0.28864	0.719000	0.30619	0.970000	0.65996	-0.003000	0.12901	0.102000	0.17638	0.528000	0.53228	CTT	DCDC1	-	superfamily_Doublecortin_dom	ENSG00000188682		0.373	DCDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCDC1	HGNC	protein_coding	OTTHUMT00000316531.1	40	0.00	0	A	NM_181807		31327864	31327864	-1	no_errors	ENST00000452803	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.001	C
DCDC2C	728597	genome.wustl.edu	37	2	3817000	3817000	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:3817000A>G	ENST00000399143.3	+	5	449	c.449A>G	c.(448-450)cAg>cGg	p.Q150R	DCDC2C_ENST00000537457.1_3'UTR			A8MYV0	DCD2C_HUMAN	doublecortin domain containing 2C	318	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				intracellular signal transduction (GO:0035556)					breast(1)	1						CCTGTGGACCAGGTGGGTGTC	0.582																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AC010907	CCDS74481.1	2p25.3	2010-09-24	2010-09-24		ENSG00000214866	ENSG00000214866			32696	protein-coding gene	gene with protein product			"""doublecortin domain containing 2C pseudogene"""				Standard	NM_001287444		Approved			A8MYV0	OTTHUMG00000151490	ENST00000399143.3:c.449A>G	2.37:g.3817000A>G	ENSP00000382097:p.Gln150Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,pfscan_Doublecortin_dom	p.Q150R	ENST00000399143.3	37	c.449		2	.	.	.	.	.	.	.	.	.	.	A	15.60	2.881558	0.51908	.	.	ENSG00000214866	ENST00000423741;ENST00000399143	T;T	0.70164	-0.42;-0.46	4.01	4.01	0.46588	.	.	.	.	.	T	0.71459	0.3342	M	0.62723	1.935	0.23681	N	0.997125	.	.	.	.	.	.	T	0.80547	-0.1334	6	0.87932	D	0	-9.1941	9.6112	0.39663	1.0:0.0:0.0:0.0	.	.	.	.	R	281;150	ENSP00000403984:Q281R;ENSP00000382097:Q150R	ENSP00000382097:Q150R	Q	+	2	0	DCDC2C	3794875	1.000000	0.71417	0.998000	0.56505	0.277000	0.26821	3.679000	0.54634	2.038000	0.60285	0.379000	0.24179	CAG	DCDC2C	-	NULL	ENSG00000214866		0.582	DCDC2C-201	KNOWN	basic	protein_coding	DCDC2C	HGNC	protein_coding		61	0.00	0	A	XM_001715903		3817000	3817000	+1	no_start_codon:no_stop_codon	ENST00000399143	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	0.999	G
DCSTAMP	81501	genome.wustl.edu	37	8	105361290	105361290	+	Silent	SNP	C	C	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr8:105361290C>A	ENST00000297581.2	+	2	559	c.510C>A	c.(508-510)acC>acA	p.T170T	DCSTAMP_ENST00000517991.1_Silent_p.T170T|DPYS_ENST00000521601.1_Intron	NM_030788.3	NP_110415.1	Q9H295	DCSTP_HUMAN	dendrocyte expressed seven transmembrane protein	170					cellular response to interleukin-4 (GO:0071353)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to tumor necrosis factor (GO:0071356)|membrane fusion (GO:0061025)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cell growth (GO:0030308)|osteoclast differentiation (GO:0030316)|osteoclast fusion (GO:0072675)|positive regulation of bone resorption (GO:0045780)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of monocyte differentiation (GO:0045657)	cell surface (GO:0009986)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)		p.T170T(1)									GGAACCAGACCCTGGCAGTCT	0.453																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											94.0	93.0	93.0					8																	105361290		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF305068	CCDS6301.1, CCDS59111.1	8q22.3	2012-08-10	2012-03-27	2012-03-27	ENSG00000164935	ENSG00000164935			18549	protein-coding gene	gene with protein product	"""Dendritic cells (DC)-specific transmembrane protein"", ""IL-Four INDuced"""	605933	"""transmembrane 7 superfamily member 4"""	TM7SF4		11169400, 11345591	Standard	NM_030788		Approved	DC-STAMP, FIND	uc003ylx.2	Q9H295	OTTHUMG00000164890	ENST00000297581.2:c.510C>A	8.37:g.105361290C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZVW2|E7ESG0|Q2M2D5	Silent	SNP	pfam_DC_STAMP-like,superfamily_ABC_transptrTM_dom_typ1	p.T170	ENST00000297581.2	37	c.510	CCDS6301.1	8																																																																																			DCSTAMP	-	NULL	ENSG00000164935		0.453	DCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCSTAMP	HGNC	protein_coding	OTTHUMT00000380810.1	31	0.00	0	C	NM_030788		105361290	105361290	+1	no_errors	ENST00000297581	ensembl	human	known	69_37n	silent	37	13.95	6	SNP	0.000	A
DHRS4L2	317749	genome.wustl.edu	37	14	24470241	24470241	+	Splice_Site	SNP	G	G	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr14:24470241G>C	ENST00000335125.6	+	5	605		c.e5-1		DHRS4L2_ENST00000543805.1_Intron|DHRS4L2_ENST00000382755.4_Splice_Site|DHRS4L2_ENST00000534993.1_Intron|DHRS4L2_ENST00000537912.1_Intron|DHRS4L2_ENST00000558753.1_Intron|DHRS4L2_ENST00000545240.1_Intron|DHRS4L2_ENST00000397071.1_Intron	NM_198083.3	NP_932349.2	Q6PKH6	DR4L2_HUMAN	dehydrogenase/reductase (SDR family) member 4 like 2							extracellular region (GO:0005576)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|lung(2)|ovary(1)|skin(2)|stomach(1)	10				GBM - Glioblastoma multiforme(265;0.00962)		TCTTTTTCCAGAGGCGGCTCA	0.562																																						dbGAP											0													169.0	168.0	168.0					14																	24470241		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS9606.2, CCDS73621.1	14q11.2	2011-09-14			ENSG00000187630	ENSG00000187630	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 1"""	19731	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 25C, member 3"""	615196					Standard	NM_001193635		Approved	SDR25C3	uc001wlf.3	Q6PKH6	OTTHUMG00000028778	ENST00000335125.6:c.480-1G>C	14.37:g.24470241G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3YLD4	Splice_Site	SNP	-	e5-1	ENST00000335125.6	37	c.474-1	CCDS9606.2	14	.	.	.	.	.	.	.	.	.	.	g	11.71	1.719401	0.30503	.	.	ENSG00000187630	ENST00000348916;ENST00000335125;ENST00000382755	.	.	.	3.95	3.95	0.45737	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.5366	0.50641	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DHRS4L2	23540081	1.000000	0.71417	0.213000	0.23690	0.015000	0.08874	7.017000	0.76399	1.764000	0.52075	0.194000	0.17425	.	DHRS4L2	-	-	ENSG00000187630		0.562	DHRS4L2-001	KNOWN	basic|CCDS	protein_coding	DHRS4L2	HGNC	protein_coding	OTTHUMT00000071858.4	37	0.00	0	G		Intron	24470241	24470241	+1	no_errors	ENST00000382755	ensembl	human	known	69_37n	splice_site	41	12.77	6	SNP	0.969	C
DLX6	1750	genome.wustl.edu	37	7	96635448	96635450	+	In_Frame_Del	DEL	GCA	GCA	-	rs563784519	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	GCA	GCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:96635448_96635450delGCA	ENST00000518156.2	+	1	589_591	c.159_161delGCA	c.(157-162)ccgcag>ccg	p.Q54del	DLX6_ENST00000555308.1_5'Flank|DLX6-AS1_ENST00000430404.2_RNA|DLX6-AS1_ENST00000452769.2_RNA|DLX6_ENST00000007660.5_Intron|DLX6-AS1_ENST00000430027.3_RNA|DLX6-AS2_ENST00000606174.1_RNA|DLX6-AS1_ENST00000431497.2_RNA|DLX6-AS1_ENST00000605417.1_RNA|DLX6-AS1_ENST00000458352.2_RNA|DLX6-AS1_ENST00000437331.2_RNA|DLX6-AS1_ENST00000437541.1_RNA			P56179	DLX6_HUMAN	distal-less homeobox 6	0					anatomical structure formation involved in morphogenesis (GO:0048646)|embryonic limb morphogenesis (GO:0030326)|epithelial cell differentiation (GO:0030855)|head development (GO:0060322)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|palate development (GO:0060021)|positive regulation of epithelial cell proliferation (GO:0050679)|skeletal system development (GO:0001501)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(4)|ovary(2)|urinary_tract(1)	12	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					cgccgccgccgcagccgcACTCG	0.739																																						dbGAP											0										94,1156		39,16,570						1.9	1.0			2	288,3392		98,92,1650	no	coding	DLX6	NM_005222.3		137,108,2220	A1A1,A1R,RR		7.8261,7.52,7.7485				382,4548				-	-	-	SO:0001651	inframe_deletion	0				CCDS47647.1, CCDS47647.2	7q21.3	2011-06-20	2005-12-22		ENSG00000006377	ENSG00000006377		"""Homeoboxes / ANTP class : NKL subclass"""	2919	protein-coding gene	gene with protein product		600030	"""distal-less homeo box 6"""			7907794	Standard	NM_005222		Approved		uc022ahu.1	P56179	OTTHUMG00000154201	ENST00000518156.2:c.159_161delGCA	7.37:g.96635448_96635450delGCA	ENSP00000428480:p.Gln54del	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1I2|B3KSQ0|J3KR92|Q3ZAR6|Q9UPL2	In_Frame_Del	DEL	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa,pfscan_Homeodomain	p.Q54in_frame_del	ENST00000518156.2	37	c.159_161	CCDS47647.2	7																																																																																			DLX6	-	NULL	ENSG00000006377		0.739	DLX6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLX6	HGNC	protein_coding	OTTHUMT00000334373.4	20	0.00	0	GCA	NM_005222		96635448	96635450	+1	no_errors	ENST00000518156	ensembl	human	known	69_37n	in_frame_del	6	33.33	3	DEL	0.992:0.996:0.995	-
DOCK11	139818	genome.wustl.edu	37	X	117809965	117809965	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:117809965A>C	ENST00000276202.7	+	47	5329	c.5266A>C	c.(5266-5268)Aaa>Caa	p.K1756Q	DOCK11_ENST00000276204.6_Missense_Mutation_p.K1756Q	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1756	DHR-2.				blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TATGCATACAAAAAAGAGACT	0.303																																						dbGAP											0													41.0	40.0	40.0					X																	117809965		2202	4295	6497	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.5266A>C	X.37:g.117809965A>C	ENSP00000276202:p.Lys1756Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.K1756Q	ENST00000276202.7	37	c.5266	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	A	13.59	2.283655	0.40394	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.16457	2.34;2.34	5.57	5.57	0.84162	.	0.099558	0.64402	D	0.000001	T	0.10165	0.0249	N	0.12961	0.28	0.28813	N	0.898125	B;B	0.16603	0.018;0.018	B;B	0.20184	0.028;0.028	T	0.14172	-1.0482	10	0.32370	T	0.25	-0.1843	8.5238	0.33293	0.9133:0.0:0.0867:0.0	.	1756;1756	A6NIW2;Q5JSL3	.;DOC11_HUMAN	Q	1756	ENSP00000276204:K1756Q;ENSP00000276202:K1756Q	ENSP00000276202:K1756Q	K	+	1	0	DOCK11	117693993	1.000000	0.71417	0.978000	0.43139	0.970000	0.65996	3.947000	0.56652	1.857000	0.53885	0.486000	0.48141	AAA	DOCK11	-	NULL	ENSG00000147251		0.303	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	90	0.00	0	A	NM_144658		117809965	117809965	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	67	28.72	27	SNP	0.971	C
EXOSC5	56915	genome.wustl.edu	37	19	41897822	41897822	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr19:41897822T>A	ENST00000221233.4	-	3	458	c.308A>T	c.(307-309)gAg>gTg	p.E103V	CTC-435M10.3_ENST00000604424.1_Intron|EXOSC5_ENST00000596905.1_Missense_Mutation_p.E65V|BCKDHA_ENST00000595085.1_Intron|CTC-435M10.3_ENST00000540732.1_Intron	NM_020158.3	NP_064543.3	Q9NQT4	EXOS5_HUMAN	exosome component 5	103					defense response to virus (GO:0051607)|DNA deamination (GO:0045006)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|transcriptionally active chromatin (GO:0035327)	3'-5'-exoribonuclease activity (GO:0000175)|RNA binding (GO:0003723)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|urinary_tract(1)	7						CACCACCGCCTCGCACGTGTT	0.602																																						dbGAP											0													80.0	79.0	80.0					19																	41897822		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285785	CCDS12580.1	19q13.1	2008-02-05				ENSG00000077348			24662	protein-coding gene	gene with protein product	"""exosome component Rrp46"""	606492				11110791, 11812149	Standard	NM_020158		Approved	hRrp46p, Rrp46p, RRP46, RRP41B, MGC12901, p12B	uc002oqo.3	Q9NQT4		ENST00000221233.4:c.308A>T	19.37:g.41897822T>A	ENSP00000221233:p.Glu103Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32Q81|Q8NG16|Q96I89	Missense_Mutation	SNP	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2	p.E103V	ENST00000221233.4	37	c.308	CCDS12580.1	19	.	.	.	.	.	.	.	.	.	.	T	19.96	3.923887	0.73213	.	.	ENSG00000077348	ENST00000221233	T	0.50548	0.74	5.36	5.36	0.76844	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.000000	0.85682	D	0.000000	T	0.67335	0.2882	M	0.78456	2.415	0.80722	D	1	D	0.64830	0.994	D	0.64042	0.921	T	0.72211	-0.4359	10	0.87932	D	0	-33.3288	14.4723	0.67523	0.0:0.0:0.0:1.0	.	103	Q9NQT4	EXOS5_HUMAN	V	103	ENSP00000221233:E103V	ENSP00000221233:E103V	E	-	2	0	EXOSC5	46589662	1.000000	0.71417	0.951000	0.38953	0.597000	0.36814	6.272000	0.72575	2.239000	0.73571	0.533000	0.62120	GAG	EXOSC5	-	pfam_ExoRNase_PH_dom1,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000077348		0.602	EXOSC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC5	HGNC	protein_coding	OTTHUMT00000463492.1	34	0.00	0	T	NM_020158		41897822	41897822	-1	no_errors	ENST00000221233	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	1.000	A
EYA4	2070	genome.wustl.edu	37	6	133846230	133846230	+	Intron	SNP	G	G	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr6:133846230G>C	ENST00000367895.5	+	19	2202				EYA4_ENST00000525849.1_Missense_Mutation_p.D583H|EYA4_ENST00000355167.3_Missense_Mutation_p.D606H|EYA4_ENST00000355286.6_Intron|RP3-323P13.2_ENST00000607033.1_RNA|EYA4_ENST00000531901.1_Intron|EYA4_ENST00000430974.2_Missense_Mutation_p.D558H|EYA4_ENST00000452339.2_Missense_Mutation_p.D552H|EYA4_ENST00000431403.2_Missense_Mutation_p.D606H	NM_004100.4	NP_004091.3	O95677	EYA4_HUMAN	EYA transcriptional coactivator and phosphatase 4						anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA repair (GO:0006281)|inner ear development (GO:0048839)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(25)|skin(1)	48	Colorectal(23;0.221)			GBM - Glioblastoma multiforme(68;0.00457)|OV - Ovarian serous cystadenocarcinoma(155;0.0152)		AGATGGCCGAGATGAGGAGCA	0.403																																					Melanoma(57;398 1237 3528 4702 7415)	dbGAP											0													157.0	146.0	150.0					6																	133846230		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			Y17114	CCDS5165.1, CCDS5166.1, CCDS43506.1, CCDS75521.1, CCDS75523.1	6q23	2014-09-17	2014-06-19		ENSG00000112319	ENSG00000112319		"""Protein tyrosine phosphatases / Asp-based PTPs"""	3522	protein-coding gene	gene with protein product		603550	"""eyes absent (Drosophila) homolog 4"", ""eyes absent homolog 4 (Drosophila)"""	DFNA10, CMD1J		9887327, 11159937	Standard	NM_004100		Approved		uc003qed.4	O95677	OTTHUMG00000015602	ENST00000367895.5:c.1739-62G>C	6.37:g.133846230G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7F7|O95464|O95679|Q8IW39|Q9NTR7	Missense_Mutation	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_EYA	p.D606H	ENST00000367895.5	37	c.1816	CCDS5165.1	6	.	.	.	.	.	.	.	.	.	.	G	26.9	4.781782	0.90282	.	.	ENSG00000112319	ENST00000452339;ENST00000430974;ENST00000355167;ENST00000525849;ENST00000431403	D;D;D;D;D	0.89746	-2.56;-2.56;-2.56;-2.56;-2.56	5.8	5.8	0.92144	.	.	.	.	.	D	0.91734	0.7386	M	0.63843	1.955	0.80722	D	1	B;D;P	0.56287	0.365;0.975;0.822	P;P;P	0.56960	0.668;0.81;0.736	D	0.91923	0.5549	9	0.87932	D	0	.	20.0706	0.97721	0.0:0.0:1.0:0.0	.	558;552;606	E7ESD5;E7EN58;O95677-4	.;.;.	H	552;558;606;583;606	ENSP00000395916:D552H;ENSP00000388670:D558H;ENSP00000347294:D606H;ENSP00000433219:D583H;ENSP00000404558:D606H	ENSP00000347294:D606H	D	+	1	0	EYA4	133887923	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.744000	0.94065	0.655000	0.94253	GAT	EYA4	-	superfamily_HAD-like_dom,tigrfam_EYA	ENSG00000112319		0.403	EYA4-001	KNOWN	basic|CCDS	protein_coding	EYA4	HGNC	protein_coding	OTTHUMT00000042282.2	72	0.00	0	G	NM_004100		133846230	133846230	+1	no_errors	ENST00000355167	ensembl	human	known	69_37n	missense	43	20.37	11	SNP	1.000	C
FAM185A	222234	genome.wustl.edu	37	7	102427889	102427889	+	Missense_Mutation	SNP	C	C	T	rs116082009	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:102427889C>T	ENST00000413034.2	+	7	1039	c.1039C>T	c.(1039-1041)Cgt>Tgt	p.R347C	FAM185A_ENST00000409231.3_Missense_Mutation_p.R230C	NM_001145268.1	NP_001138740	Q8N0U4	F185A_HUMAN	family with sequence similarity 185, member A	347										kidney(1)	1						GGCTGAAGTTCGTAAAGATGA	0.403													C|||	590	0.117812	0.1407	0.1542	5008	,	,		19248	0.0119		0.1948	False		,,,				2504	0.091					dbGAP											0													191.0	152.0	164.0					7																	102427889		692	1591	2283	-	-	-	SO:0001583	missense	0			BC029175	CCDS47676.1, CCDS47677.1	7q22.1	2009-07-09			ENSG00000222011	ENSG00000222011			22412	protein-coding gene	gene with protein product							Standard	NM_001145268		Approved	MGC35361	uc011klf.2	Q8N0U4	OTTHUMG00000154140	ENST00000413034.2:c.1039C>T	7.37:g.102427889C>T	ENSP00000395340:p.Arg347Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUR7|B4DQD3|C9IZ91	Missense_Mutation	SNP	NULL	p.R347C	ENST00000413034.2	37	c.1039	CCDS47676.1	7	292	0.1336996336996337	64	0.13008130081300814	66	0.18232044198895028	5	0.008741258741258742	157	0.20712401055408972	C	12.82	2.052152	0.36181	.	.	ENSG00000222011	ENST00000432852;ENST00000409231;ENST00000413034	T;T	0.45668	0.89;0.93	4.09	2.16	0.27623	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.0	T	0.13710	-1.0499	8	0.52906	T	0.07	0.6665	6.9447	0.24512	0.0:0.771:0.0:0.229	rs17842496;rs17842496	247;230;347	B4DMG7;Q8N0U4-3;Q8N0U4	.;.;F185A_HUMAN	C	247;230;347	ENSP00000387066:R230C;ENSP00000395340:R347C	ENSP00000387066:R230C	R	+	1	0	FAM185A	102215125	0.000000	0.05858	0.001000	0.08648	0.863000	0.49368	0.422000	0.21296	0.883000	0.36040	0.536000	0.68110	CGT	FAM185A	-	NULL	ENSG00000222011		0.403	FAM185A-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM185A	HGNC	protein_coding	OTTHUMT00000349482.1	79	0.00	0	C	NM_001145268		102427889	102427889	+1	no_errors	ENST00000413034	ensembl	human	known	69_37n	missense	72	12.20	10	SNP	0.001	T
FAM21A	387680	genome.wustl.edu	37	10	51853633	51853633	+	Missense_Mutation	SNP	C	C	T	rs199520696	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr10:51853633C>T	ENST00000282633.5	+	13	1181	c.1136C>T	c.(1135-1137)aCg>aTg	p.T379M	FAM21A_ENST00000314664.7_Missense_Mutation_p.T379M|FAM21A_ENST00000351071.6_Missense_Mutation_p.T379M|FAM21A_ENST00000399339.2_Missense_Mutation_p.T291M	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	379					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						GACCTCTTCACGGAAGCCCCC	0.488																																						dbGAP											0													1.0	1.0	1.0					10																	51853633		353	936	1289	-	-	-	SO:0001583	missense	0			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1136C>T	10.37:g.51853633C>T	ENSP00000282633:p.Thr379Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	NULL	p.T379M	ENST00000282633.5	37	c.1136	CCDS41527.1	10	.	.	.	.	.	.	.	.	.	.	C	6.414	0.444490	0.12164	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.88	-5.37	0.02681	.	0.781535	0.12699	N	0.446536	T	0.14527	0.0351	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.29253	0.05;0.02;0.005;0.02;0.239	B;B;B;B;B	0.16722	0.013;0.013;0.003;0.013;0.016	T	0.05767	-1.0865	9	0.42905	T	0.14	2.3495	2.2948	0.04147	0.3714:0.2592:0.2739:0.0955	.	379;379;291;379;273	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	M	379;379;273;379;291	.	ENSP00000282633:T379M	T	+	2	0	FAM21A	51523639	0.024000	0.19004	0.096000	0.21009	0.033000	0.12548	-0.884000	0.04166	-1.796000	0.01253	-1.109000	0.02080	ACG	FAM21A	-	NULL	ENSG00000099290		0.488	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM21A	HGNC	protein_coding	OTTHUMT00000276917.2	14	0.00	0	C	NM_001005751		51853633	51853633	+1	no_errors	ENST00000282633	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.370	T
FAM47B	170062	genome.wustl.edu	37	X	34962126	34962126	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:34962126G>A	ENST00000329357.5	+	1	1214	c.1178G>A	c.(1177-1179)cGg>cAg	p.R393Q		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	393								p.R393Q(1)		breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						TTTGAGAGTCGGATGCCCCAT	0.587																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											56.0	51.0	53.0					X																	34962126		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.1178G>A	X.37:g.34962126G>A	ENSP00000328307:p.Arg393Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	NULL	p.R393Q	ENST00000329357.5	37	c.1178	CCDS14236.1	X	.	.	.	.	.	.	.	.	.	.	G	1.343	-0.593584	0.03771	.	.	ENSG00000189132	ENST00000329357	T	0.15372	2.43	0.703	-0.729	0.11158	.	.	.	.	.	T	0.08626	0.0214	L	0.31120	0.905	0.09310	N	1	B	0.25235	0.121	B	0.12156	0.007	T	0.41538	-0.9503	8	0.09590	T	0.72	.	.	.	.	.	393	Q8NA70	FA47B_HUMAN	Q	393	ENSP00000328307:R393Q	ENSP00000328307:R393Q	R	+	2	0	FAM47B	34872047	0.007000	0.16637	0.000000	0.03702	0.003000	0.03518	-0.644000	0.05415	-0.345000	0.08325	0.418000	0.28097	CGG	FAM47B	-	NULL	ENSG00000189132		0.587	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	HGNC	protein_coding	OTTHUMT00000056211.1	43	0.00	0	G	NM_152631		34962126	34962126	+1	no_errors	ENST00000329357	ensembl	human	known	69_37n	missense	18	58.70	27	SNP	0.001	A
FAM71F1	84691	genome.wustl.edu	37	7	128364895	128364895	+	Intron	SNP	A	A	G	rs6952563	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:128364895A>G	ENST00000315184.5	+	4	862				FAM71F1_ENST00000485070.1_Intron|FAM71F1_ENST00000469348.1_3'UTR	NM_001282788.1|NM_032599.2	NP_001269717.1|NP_115988.1	Q96KD3	F71F1_HUMAN	family with sequence similarity 71, member F1											NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	18						TAAACTGAAAACCAGTACAGC	0.473													A|||	1356	0.270767	0.3132	0.2219	5008	,	,		20148	0.4315		0.167	False		,,,				2504	0.1892					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF367470	CCDS5804.1, CCDS64763.1	7q32.1	2007-11-20	2007-11-20	2007-11-20	ENSG00000135248	ENSG00000135248			30704	protein-coding gene	gene with protein product			"""family with sequence similarity 137, member A"""	FAM137A		12477932	Standard	XM_005250645		Approved	NYD-SP18	uc003vno.1	Q96KD3	OTTHUMG00000158276	ENST00000315184.5:c.809+1523A>G	7.37:g.128364895A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IY75|Q8NA48	RNA	SNP	-	NULL	ENST00000315184.5	37	NULL	CCDS5804.1	7																																																																																			FAM71F1	-	-	ENSG00000135248		0.473	FAM71F1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71F1	HGNC	protein_coding	OTTHUMT00000350544.2	14	0.00	0	A	NM_032599		128364895	128364895	+1	no_errors	ENST00000469348	ensembl	human	known	69_37n	rna	11	31.25	5	SNP	0.009	G
SPATA31A6	389730	genome.wustl.edu	37	9	43626751	43626751	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr9:43626751C>G	ENST00000332857.6	-	4	1964	c.1936G>C	c.(1936-1938)Ggt>Cgt	p.G646R	SPATA31A6_ENST00000496386.1_5'Flank	NM_001145196.1	NP_001138668.1	Q5VVP1	S31A6_HUMAN	SPATA31 subfamily A, member 6	646					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CTGCTTTCACCTGTGGACGTG	0.557																																						dbGAP											0													6.0	5.0	6.0					9																	43626751		452	1114	1566	-	-	-	SO:0001583	missense	0				CCDS75837.1	9p11.2	2012-10-15	2012-10-12	2012-10-12	ENSG00000185775	ENSG00000185775			32006	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A6"""	FAM75A6		20850414	Standard	NM_001145196		Approved	OTTHUMG00000013224	uc011lrb.2	Q5VVP1	OTTHUMG00000013224	ENST00000332857.6:c.1936G>C	9.37:g.43626751C>G	ENSP00000329825:p.Gly646Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G646R	ENST00000332857.6	37	c.1936	CCDS47973.1	9	.	.	.	.	.	.	.	.	.	.	C	11.68	1.710756	0.30322	.	.	ENSG00000185775	ENST00000332857	T	0.08458	3.09	2.44	1.52	0.23074	.	0.517116	0.16644	N	0.205494	T	0.20780	0.0500	M	0.72353	2.195	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.04078	-1.0979	10	0.39692	T	0.17	-2.432	5.1022	0.14766	0.0:0.8272:0.0:0.1728	.	646	Q5VVP1	F75A6_HUMAN	R	646	ENSP00000329825:G646R	ENSP00000329825:G646R	G	-	1	0	FAM75A6	43566747	0.000000	0.05858	0.001000	0.08648	0.030000	0.12068	0.396000	0.20867	0.605000	0.29947	0.383000	0.25322	GGT	FAM75A6	-	NULL	ENSG00000185775		0.557	SPATA31A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75A6	HGNC	protein_coding	OTTHUMT00000036987.1	110	0.90	1	C	NM_001145196		43626751	43626751	-1	no_errors	ENST00000332857	ensembl	human	known	69_37n	missense	115	16.06	22	SNP	0.001	G
FLI1	2313	genome.wustl.edu	37	11	128680489	128680489	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:128680489G>A	ENST00000527786.2	+	9	1454	c.965G>A	c.(964-966)gGc>gAc	p.G322D	FLI1_ENST00000534087.2_Missense_Mutation_p.G289D|FLI1_ENST00000281428.8_Missense_Mutation_p.G256D|FLI1_ENST00000525560.1_Missense_Mutation_p.G129D|FLI1_ENST00000344954.6_Missense_Mutation_p.G289D	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	322					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		AGGCGCTGGGGCGAGCGGAAA	0.557			T	EWSR1	Ewing sarcoma																																	dbGAP		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	0													30.0	35.0	34.0					11																	128680489		2195	4297	6492	-	-	-	SO:0001583	missense	0			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.965G>A	11.37:g.128680489G>A	ENSP00000433488:p.Gly322Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.G322D	ENST00000527786.2	37	c.965	CCDS44768.1	11	.	.	.	.	.	.	.	.	.	.	G	22.3	4.271633	0.80469	.	.	ENSG00000151702	ENST00000525560;ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	D;D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88;-1.88	5.2	5.2	0.72013	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.199818	0.52532	D	0.000065	D	0.95680	0.8595	H	0.97940	4.11	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97152	0.9832	10	0.87932	D	0	.	18.9143	0.92499	0.0:0.0:1.0:0.0	.	322;129;256	Q01543;B4DFV4;Q01543-2	FLI1_HUMAN;.;.	D	129;289;322;289;256	ENSP00000437124:G129D;ENSP00000339627:G289D;ENSP00000399985:G322D;ENSP00000432950:G289D;ENSP00000281428:G256D	ENSP00000281428:G256D	G	+	2	0	FLI1	128185699	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.657000	0.98554	2.703000	0.92315	0.650000	0.86243	GGC	FLI1	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	ENSG00000151702		0.557	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLI1	HGNC	protein_coding	OTTHUMT00000386226.2	28	0.00	0	G	NM_002017		128680489	128680489	+1	no_errors	ENST00000429175	ensembl	human	known	69_37n	missense	6	68.42	13	SNP	1.000	A
FMO3	2328	genome.wustl.edu	37	1	171086310	171086310	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:171086310G>T	ENST00000367755.4	+	9	1438	c.1327G>T	c.(1327-1329)Gca>Tca	p.A443S	FMO3_ENST00000392085.2_Missense_Mutation_p.A443S|FMO3_ENST00000538429.1_Missense_Mutation_p.A380S|FMO3_ENST00000542847.1_Missense_Mutation_p.A423S	NM_001002294.2	NP_001002294.1	P31513	FMO3_HUMAN	flavin containing monooxygenase 3	443					drug metabolic process (GO:0017144)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	amino acid binding (GO:0016597)|flavin adenine dinucleotide binding (GO:0050660)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)|trimethylamine monooxygenase activity (GO:0034899)			endometrium(1)|kidney(1)|large_intestine(12)|lung(12)|skin(1)|stomach(2)|urinary_tract(2)	31	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Almotriptan(DB00918)|Cimetidine(DB00501)|Clozapine(DB00363)|Dapsone(DB00250)|Dasatinib(DB01254)|Olanzapine(DB00334)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	CTTCATTGGGGCAAAGCCCAA	0.483																																						dbGAP											0													107.0	102.0	104.0					1																	171086310		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032016	CCDS1292.1	1q24.3	2013-10-01			ENSG00000007933	ENSG00000007933	2.6.1.16		3771	protein-coding gene	gene with protein product		136132				8486388, 9417913	Standard	NM_001002294		Approved		uc001ghh.3	P31513	OTTHUMG00000035505	ENST00000367755.4:c.1327G>T	1.37:g.171086310G>T	ENSP00000356729:p.Ala443Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R816|Q14854|Q8N5N5	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_3,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.A443S	ENST00000367755.4	37	c.1327	CCDS1292.1	1	.	.	.	.	.	.	.	.	.	.	G	15.42	2.826980	0.50739	.	.	ENSG00000007933	ENST00000367755;ENST00000392085;ENST00000542847;ENST00000538429	T;T;T;T	0.56444	0.46;0.46;0.46;0.46	5.34	4.43	0.53597	.	0.491680	0.22194	N	0.063340	T	0.38081	0.1027	M	0.73598	2.24	0.09310	N	1	P;B;B	0.44521	0.837;0.173;0.033	B;B;B	0.43536	0.423;0.187;0.192	T	0.33574	-0.9863	10	0.54805	T	0.06	-1.1798	8.403	0.32597	0.0783:0.0:0.7678:0.1539	.	380;423;443	F5H261;F5GZZ8;P31513	.;.;FMO3_HUMAN	S	443;443;423;380	ENSP00000356729:A443S;ENSP00000375935:A443S;ENSP00000444073:A423S;ENSP00000439500:A380S	ENSP00000356729:A443S	A	+	1	0	FMO3	169352934	0.748000	0.28294	0.907000	0.35723	0.858000	0.48976	4.096000	0.57734	1.225000	0.43566	0.655000	0.94253	GCA	FMO3	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase_2	ENSG00000007933		0.483	FMO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO3	HGNC	protein_coding	OTTHUMT00000086219.1	39	0.00	0	G	NM_006894		171086310	171086310	+1	no_errors	ENST00000367755	ensembl	human	known	69_37n	missense	52	14.75	9	SNP	0.110	T
FREM3	166752	genome.wustl.edu	37	4	144619797	144619797	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr4:144619797C>T	ENST00000329798.5	-	1	2031	c.2032G>A	c.(2032-2034)Gat>Aat	p.D678N	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	678					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						TCATGGTCATCCTGCACATGG	0.498																																						dbGAP											0													46.0	40.0	42.0					4																	144619797		692	1591	2283	-	-	-	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.2032G>A	4.37:g.144619797C>T	ENSP00000332886:p.Asp678Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D678N	ENST00000329798.5	37	c.2032	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	C	22.9	4.351361	0.82132	.	.	ENSG00000183090	ENST00000329798	T	0.34859	1.34	4.01	4.01	0.46588	.	0.000000	0.85682	D	0.000000	T	0.59514	0.2199	M	0.85197	2.74	0.58432	D	0.999997	.	.	.	.	.	.	T	0.66006	-0.6030	8	0.48119	T	0.1	-11.6153	15.042	0.71799	0.0:1.0:0.0:0.0	.	.	.	.	N	678	ENSP00000332886:D678N	ENSP00000332886:D678N	D	-	1	0	FREM3	144839247	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.275000	0.65575	2.066000	0.61787	0.655000	0.94253	GAT	FREM3	-	NULL	ENSG00000183090		0.498	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	82	0.00	0	C	XM_094074		144619797	144619797	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	missense	44	27.87	17	SNP	1.000	T
FSIP2	401024	genome.wustl.edu	37	2	186664963	186664963	+	Missense_Mutation	SNP	C	C	A	rs10931200	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:186664963C>A	ENST00000424728.1	+	17	10930	c.10930C>A	c.(10930-10932)Ctt>Att	p.L3644I	AC008174.3_ENST00000436557.1_RNA|FSIP2_ENST00000343098.5_Missense_Mutation_p.L3733I|AC008174.3_ENST00000429929.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	3644										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						TAGTGTACCCCTTTGCAACAA	0.323													A|||	2707	0.540535	0.5582	0.4928	5008	,	,		16694	0.4702		0.5099	False		,,,				2504	0.6544					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.10930C>A	2.37:g.186664963C>A	ENSP00000401306:p.Leu3644Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.L3733I	ENST00000424728.1	37	c.11197		2	1108	0.5073260073260073	275	0.5589430894308943	185	0.511049723756906	268	0.46853146853146854	380	0.5013192612137203	A	4.864	0.160655	0.09287	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.42513	0.97;0.97	4.94	-6.95	0.01628	.	1.752200	0.02812	N	0.124513	T	0.00012	0.0000	N	0.00413	-1.525	0.80722	P	0.0	.	.	.	.	.	.	T	0.33701	-0.9858	7	0.02654	T	1	.	2.2103	0.03946	0.4066:0.2086:0.2827:0.1021	rs10931200;rs52830649;rs58226950;rs10931200	.	.	.	I	3733;3644	ENSP00000344403:L3733I;ENSP00000401306:L3644I	ENSP00000344403:L3733I	L	+	1	0	FSIP2	186373208	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.533000	0.02215	-1.421000	0.02007	-3.373000	0.00041	CTT	FSIP2	-	NULL	ENSG00000188738		0.323	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	53	0.00	0	C	NM_173651		186664963	186664963	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.000	A
FSIP2	401024	genome.wustl.edu	37	2	186665824	186665824	+	Missense_Mutation	SNP	A	A	G	rs11695215	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:186665824A>G	ENST00000424728.1	+	17	11791	c.11791A>G	c.(11791-11793)Aac>Gac	p.N3931D	AC008174.3_ENST00000436557.1_RNA|FSIP2_ENST00000343098.5_Missense_Mutation_p.N4020D|AC008174.3_ENST00000429929.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	3931										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AGCACCATTTAACAAGCATTG	0.373													G|||	2707	0.540535	0.5582	0.4928	5008	,	,		19677	0.4702		0.5099	False		,,,				2504	0.6544					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.11791A>G	2.37:g.186665824A>G	ENSP00000401306:p.Asn3931Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.N4020D	ENST00000424728.1	37	c.12058		2	1108	0.5073260073260073	275	0.5589430894308943	185	0.511049723756906	268	0.46853146853146854	380	0.5013192612137203	G	2.951	-0.216701	0.06101	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.42513	0.97;0.97	4.24	3.36	0.38483	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	T	0.43180	-0.9407	6	0.28530	T	0.3	.	6.8496	0.24008	0.2084:0.0:0.7916:0.0	rs11695215;rs17229615;rs61410861;rs11695215	.	.	.	D	4020;3931	ENSP00000344403:N4020D;ENSP00000401306:N3931D	ENSP00000344403:N4020D	N	+	1	0	FSIP2	186374069	1.000000	0.71417	0.963000	0.40424	0.188000	0.23474	0.788000	0.26872	0.743000	0.32719	-0.368000	0.07277	AAC	FSIP2	-	NULL	ENSG00000188738		0.373	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	23	0.00	0	A	NM_173651		186665824	186665824	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	0.997	G
GABRB2	2561	genome.wustl.edu	37	5	160886759	160886759	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr5:160886759C>T	ENST00000393959.1	-	4	328	c.329G>A	c.(328-330)aGa>aAa	p.R110K	GABRB2_ENST00000353437.6_Missense_Mutation_p.R110K|GABRB2_ENST00000274547.2_Missense_Mutation_p.R110K|GABRB2_ENST00000517901.1_Missense_Mutation_p.R47K|GABRB2_ENST00000517547.1_Intron|GABRB2_ENST00000520240.1_Missense_Mutation_p.R110K			P47870	GBRB2_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 2	110					cellular response to histamine (GO:0071420)|chloride transmembrane transport (GO:1902476)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|GABA-A receptor activity (GO:0004890)|inhibitory extracellular ligand-gated ion channel activity (GO:0005237)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|liver(1)|lung(9)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	26	Renal(175;0.00259)	Medulloblastoma(196;0.021)|all_neural(177;0.0463)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Fospropofol(DB06716)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GTCTGCCACTCTGTTGTCCAG	0.433																																						dbGAP											0													90.0	83.0	85.0					5																	160886759		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4354.1, CCDS4355.1	5q34	2012-06-22			ENSG00000145864	ENSG00000145864		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4082	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 2"""	600232				7851879	Standard	NM_000813		Approved		uc003lys.1	P47870	OTTHUMG00000130349	ENST00000393959.1:c.329G>A	5.37:g.160886759C>T	ENSP00000377531:p.Arg110Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K115|A8K1A0|D1LYT0|D1LYT1|Q16323|Q4FZB2	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,prints_GABAAa_rcpt,tigrfam_Neur_channel	p.R110K	ENST00000393959.1	37	c.329	CCDS4355.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.581888	0.96578	.	.	ENSG00000145864	ENST00000393959;ENST00000274547;ENST00000353437;ENST00000520240;ENST00000517901	T;T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17;-1.17	4.97	4.97	0.65823	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.83505	0.5269	L	0.41632	1.29	0.80722	D	1	D;D;P;D	0.89917	1.0;0.974;0.756;0.982	D;D;P;D	0.91635	0.999;0.946;0.627;0.954	T	0.81154	-0.1062	10	0.29301	T	0.29	.	18.6117	0.91288	0.0:1.0:0.0:0.0	.	110;47;110;110	B7Z4P0;E7EV50;P47870;P47870-1	.;.;GBRB2_HUMAN;.	K	110;110;110;110;47	ENSP00000377531:R110K;ENSP00000274547:R110K;ENSP00000274546:R110K;ENSP00000429320:R110K;ENSP00000430532:R47K	ENSP00000274547:R110K	R	-	2	0	GABRB2	160819337	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.684000	0.84104	2.455000	0.83008	0.655000	0.94253	AGA	GABRB2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000145864		0.433	GABRB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB2	HGNC	protein_coding	OTTHUMT00000252704.1	49	0.00	0	C			160886759	160886759	-1	no_errors	ENST00000274547	ensembl	human	known	69_37n	missense	27	32.50	13	SNP	1.000	T
GLI1	2735	genome.wustl.edu	37	12	57865641	57865641	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr12:57865641C>T	ENST00000228682.2	+	12	3209	c.3118C>T	c.(3118-3120)Ctt>Ttt	p.L1040F	GLI1_ENST00000543426.1_Missense_Mutation_p.L912F|GLI1_ENST00000546141.1_Missense_Mutation_p.L999F	NM_005269.2	NP_005260.1	P08151	GLI1_HUMAN	GLI family zinc finger 1	1040	Asp/Glu-rich (acidic).				cerebellar cortex morphogenesis (GO:0021696)|digestive tract morphogenesis (GO:0048546)|dorsal/ventral pattern formation (GO:0009953)|epidermal cell differentiation (GO:0009913)|lung development (GO:0030324)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|notochord regression (GO:0060032)|osteoblast differentiation (GO:0001649)|pituitary gland development (GO:0021983)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proximal/distal pattern formation (GO:0009954)|regulation of smoothened signaling pathway (GO:0008589)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in regulation of cerebellar granule cell precursor cell proliferation (GO:0021938)|spermatogenesis (GO:0007283)|ventral midline development (GO:0007418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|primary cilium (GO:0072372)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(8)|lung(22)|ovary(6)|pancreas(2)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	69			GBM - Glioblastoma multiforme(3;3.99e-32)			CCTGGACTCTCTTGATCTTGA	0.587																																					Pancreas(157;841 1936 10503 41495 50368)	dbGAP											0													159.0	150.0	153.0					12																	57865641		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8940.1, CCDS53806.1, CCDS53807.1	12q13.2-q13.3	2013-01-25	2009-03-05	2005-01-14		ENSG00000111087		"""Zinc fingers, C2H2-type"""	4317	protein-coding gene	gene with protein product		165220	"""glioma-associated oncogene homolog 1 (zinc finger protein)"", ""glioma-associated oncogene family zinc finger 1"""	GLI		2850480	Standard	NM_005269		Approved		uc001snx.3	P08151		ENST00000228682.2:c.3118C>T	12.37:g.57865641C>T	ENSP00000228682:p.Leu1040Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D0EUY3|E9PQQ9|F5H6H8|Q8TDN9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L1040F	ENST00000228682.2	37	c.3118	CCDS8940.1	12	.	.	.	.	.	.	.	.	.	.	C	17.87	3.494388	0.64186	.	.	ENSG00000111087	ENST00000543426;ENST00000228682;ENST00000546141;ENST00000528467;ENST00000443131	T;T;T;T	0.39787	1.1;1.06;1.16;1.16	5.04	5.04	0.67666	.	0.000000	0.41500	D	0.000869	T	0.60792	0.2296	L	0.54323	1.7	0.49483	D	0.999793	D	0.89917	1.0	D	0.85130	0.997	T	0.58205	-0.7677	10	0.46703	T	0.11	.	17.6965	0.88282	0.0:1.0:0.0:0.0	.	1040	P08151	GLI1_HUMAN	F	912;1040;999;999;508	ENSP00000437607:L912F;ENSP00000228682:L1040F;ENSP00000441006:L999F;ENSP00000434408:L999F	ENSP00000228682:L1040F	L	+	1	0	GLI1	56151908	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.284000	0.43478	2.793000	0.96121	0.655000	0.94253	CTT	GLI1	-	NULL	ENSG00000111087		0.587	GLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI1	HGNC	protein_coding	OTTHUMT00000394197.1	54	0.00	0	C	NM_005269		57865641	57865641	+1	no_errors	ENST00000228682	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	T
GOLGA6L2	283685	genome.wustl.edu	37	15	23685625	23685625	+	Missense_Mutation	SNP	T	T	C	rs372736971		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr15:23685625T>C	ENST00000567107.1	-	8	2049	c.1997A>G	c.(1996-1998)gAa>gGa	p.E666G	GOLGA6L2_ENST00000345070.5_Intron|GOLGA6L2_ENST00000312015.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						tcccacatcttctcctcctgc	0.582																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.1997A>G	15.37:g.23685625T>C	ENSP00000454407:p.Glu666Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	Missense_Mutation	SNP	NULL	p.E666G	ENST00000567107.1	37	c.1997		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.582	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	103	0.96	1	T	NM_182561		23685625	23685625	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	missense	48	10.71	6	SNP	0.002	C
GPR37	2861	genome.wustl.edu	37	7	124404828	124404828	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:124404828C>T	ENST00000303921.2	-	1	853	c.203G>A	c.(202-204)cGa>cAa	p.R68Q		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	68					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						TGCTCGGGCTCGCAGAACGTC	0.682																																						dbGAP											0													22.0	26.0	25.0					7																	124404828		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.203G>A	7.37:g.124404828C>T	ENSP00000306449:p.Arg68Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_GPR37_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.R68Q	ENST00000303921.2	37	c.203	CCDS5792.1	7	.	.	.	.	.	.	.	.	.	.	C	9.210	1.030789	0.19590	.	.	ENSG00000170775	ENST00000303921	T	0.08458	3.09	4.69	0.534	0.17127	.	0.551000	0.15227	N	0.273611	T	0.04182	0.0116	N	0.14661	0.345	0.09310	N	1	B	0.31040	0.305	B	0.25759	0.063	T	0.41466	-0.9507	10	0.34782	T	0.22	2.184	7.4226	0.27081	0.3874:0.4695:0.1431:0.0	.	68	O15354	GPR37_HUMAN	Q	68	ENSP00000306449:R68Q	ENSP00000306449:R68Q	R	-	2	0	GPR37	124192064	0.000000	0.05858	0.000000	0.03702	0.151000	0.21798	-0.934000	0.03955	0.076000	0.16826	0.655000	0.94253	CGA	GPR37	-	NULL	ENSG00000170775		0.682	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	HGNC	protein_coding	OTTHUMT00000347873.1	54	0.00	0	C	NM_005302		124404828	124404828	-1	no_errors	ENST00000303921	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	0.001	T
GPR98	84059	genome.wustl.edu	37	5	89925087	89925087	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr5:89925087G>A	ENST00000405460.2	+	9	1666	c.1570G>A	c.(1570-1572)Gaa>Aaa	p.E524K		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	524					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TTTTCCTATGGAAAACCAGAA	0.363																																						dbGAP											0													74.0	71.0	72.0					5																	89925087		1860	4095	5955	-	-	-	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.1570G>A	5.37:g.89925087G>A	ENSP00000384582:p.Glu524Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.E524K	ENST00000405460.2	37	c.1570	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.74|17.74	3.463293|3.463293	0.63513|0.63513	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619;ENST00000399043|ENST00000504142	T|.	0.34072|.	1.38|.	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	0.098661|.	0.64402|.	D|.	0.000001|.	T|T	0.77579|0.77579	0.4151|0.4151	M|M	0.73598|0.73598	2.24|2.24	0.80722|0.80722	D|D	1|1	P|.	0.43750|.	0.816|.	B|.	0.35039|.	0.194|.	T|T	0.76024|0.76024	-0.3110|-0.3110	10|5	0.33940|.	T|.	0.23|.	.|.	19.7826|19.7826	0.96422|0.96422	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	524|.	Q8WXG9|.	GPR98_HUMAN|.	K|E	524|112	ENSP00000384582:E524K|.	ENSP00000296619:E524K|.	E|G	+|+	1|2	0|0	GPR98|GPR98	89960843|89960843	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	6.008000|6.008000	0.70739|0.70739	2.680000|2.680000	0.91292|0.91292	0.655000|0.655000	0.94253|0.94253	GAA|GGA	GPR98	-	NULL	ENSG00000164199		0.363	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	27	0.00	0	G	NM_032119		89925087	89925087	+1	no_errors	ENST00000405460	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	1.000	A
GPRASP1	9737	genome.wustl.edu	37	X	101911239	101911239	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:101911239G>T	ENST00000361600.5	+	5	3199	c.2398G>T	c.(2398-2400)Gaa>Taa	p.E800*	RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000444152.1_Nonsense_Mutation_p.E800*|GPRASP1_ENST00000415986.1_Nonsense_Mutation_p.E800*|GPRASP1_ENST00000537097.1_Nonsense_Mutation_p.E800*	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	800	Glu-rich.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						GACTAGAGAAGAAGACAGGCT	0.522																																						dbGAP											0													116.0	117.0	116.0					X																	101911239		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.2398G>T	X.37:g.101911239G>T	ENSP00000355146:p.Glu800*	Somatic		WXS	Illumina GAIIx	Phase_IV	O43168|Q96LA1	Nonsense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.E800*	ENST00000361600.5	37	c.2398	CCDS35352.1	X	.	.	.	.	.	.	.	.	.	.	G	43	10.407397	0.99399	.	.	ENSG00000198932	ENST00000415986;ENST00000444152;ENST00000361600;ENST00000537097	.	.	.	2.86	-1.86	0.07760	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-0.0244	13.0742	0.59077	0.0:0.6294:0.3706:0.0	.	.	.	.	X	800	.	ENSP00000355146:E800X	E	+	1	0	GPRASP1	101797895	0.762000	0.28451	0.000000	0.03702	0.119000	0.20118	0.191000	0.17076	-0.574000	0.05990	0.190000	0.17370	GAA	GPRASP1	-	NULL	ENSG00000198932		0.522	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP1	HGNC	protein_coding	OTTHUMT00000057634.2	51	0.00	0	G	NM_014710		101911239	101911239	+1	no_errors	ENST00000361600	ensembl	human	known	69_37n	nonsense	33	17.50	7	SNP	0.001	T
GRB14	2888	genome.wustl.edu	37	2	165424837	165424837	+	Intron	SNP	A	A	G	rs17437781	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:165424837A>G	ENST00000263915.3	-	3	863				GRB14_ENST00000543549.1_Silent_p.I17I	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14						blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TTTTCTGTAGAATTATTGGCG	0.368													A|||	1364	0.272364	0.2269	0.3732	5008	,	,		17923	0.0169		0.5189	False		,,,				2504	0.272					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.325-20511T>C	2.37:g.165424837A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7F9|Q7Z6I1	Silent	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.I17	ENST00000263915.3	37	c.51	CCDS2222.1	2																																																																																			GRB14	-	NULL	ENSG00000115290		0.368	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB14	HGNC	protein_coding	OTTHUMT00000255180.2	53	0.00	0	A			165424837	165424837	-1	no_errors	ENST00000543549	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.999	G
GRIN2A	2903	genome.wustl.edu	37	16	9858054	9858054	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr16:9858054T>G	ENST00000396573.2	-	14	3656	c.3347A>C	c.(3346-3348)aAg>aCg	p.K1116T	GRIN2A_ENST00000404927.2_Missense_Mutation_p.K1116T|GRIN2A_ENST00000330684.3_Missense_Mutation_p.K1116T|GRIN2A_ENST00000396575.2_Missense_Mutation_p.K1116T|GRIN2A_ENST00000562109.1_Missense_Mutation_p.K1116T|GRIN2A_ENST00000535259.1_Missense_Mutation_p.K959T	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1116					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	AGTGTAGATCTTGTCTCTAGG	0.498																																						dbGAP											0													138.0	135.0	136.0					16																	9858054		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3347A>C	16.37:g.9858054T>G	ENSP00000379818:p.Lys1116Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.K1116T	ENST00000396573.2	37	c.3347	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	T	18.09	3.546000	0.65198	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.17054	2.3;2.32;2.34;2.3;2.3	5.33	5.33	0.75918	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.046405	0.85682	D	0.000000	T	0.37348	0.1000	M	0.71581	2.175	0.54753	D	0.999989	P;D;P	0.53745	0.953;0.962;0.643	P;P;P	0.60286	0.798;0.872;0.565	T	0.08953	-1.0697	9	.	.	.	.	14.4921	0.67657	0.0:0.0:0.0:1.0	.	959;1116;1116	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	T	1116;1116;959;1116;1116	ENSP00000379818:K1116T;ENSP00000385872:K1116T;ENSP00000441572:K959T;ENSP00000332549:K1116T;ENSP00000379820:K1116T	.	K	-	2	0	GRIN2A	9765555	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.603000	0.82811	2.020000	0.59435	0.477000	0.44152	AAG	GRIN2A	-	pfam_NMDAR2_C	ENSG00000183454		0.498	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	41	0.00	0	T			9858054	9858054	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	G
GRIN3A	116443	genome.wustl.edu	37	9	104449360	104449360	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr9:104449360C>A	ENST00000361820.3	-	2	1422	c.822G>T	c.(820-822)tgG>tgT	p.W274C		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	274					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CGGTGATGTTCCAGTCTTCCT	0.453																																						dbGAP											0													138.0	125.0	129.0					9																	104449360		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.822G>T	9.37:g.104449360C>A	ENSP00000355155:p.Trp274Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.W274C	ENST00000361820.3	37	c.822	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	C	19.77	3.890040	0.72524	.	.	ENSG00000198785	ENST00000361820	D	0.86230	-2.09	5.82	5.82	0.92795	.	0.257045	0.39020	N	0.001492	D	0.90229	0.6945	L	0.56769	1.78	0.80722	D	1	D	0.57257	0.979	P	0.53313	0.723	D	0.88941	0.3380	10	0.41790	T	0.15	.	20.1178	0.97943	0.0:1.0:0.0:0.0	.	274	Q8TCU5	NMD3A_HUMAN	C	274	ENSP00000355155:W274C	ENSP00000355155:W274C	W	-	3	0	GRIN3A	103489181	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.664000	0.83830	2.759000	0.94783	0.557000	0.71058	TGG	GRIN3A	-	NULL	ENSG00000198785		0.453	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	39	0.00	0	C			104449360	104449360	-1	no_errors	ENST00000361820	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	A
GRIPAP1	56850	genome.wustl.edu	37	X	48839761	48839761	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:48839761C>T	ENST00000376441.1	-	16	1398	c.1364G>A	c.(1363-1365)cGt>cAt	p.R455H	GRIPAP1_ENST00000376425.3_Missense_Mutation_p.R424H|GRIPAP1_ENST00000473581.1_5'UTR|GRIPAP1_ENST00000376423.4_Missense_Mutation_p.R402H|GRIPAP1_ENST00000376444.3_Missense_Mutation_p.R410H	NM_020137.3	NP_064522.3	Q4V328	GRAP1_HUMAN	GRIP1 associated protein 1	455						blood microparticle (GO:0072562)|endosome (GO:0005768)				breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)	10						ATGCCGTAGACGAACTGCTCC	0.602																																						dbGAP											0													127.0	94.0	105.0					X																	48839761		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032993	CCDS35248.1	Xp11.23	2008-02-05			ENSG00000068400	ENSG00000068400			18706	protein-coding gene	gene with protein product		300408				10896157	Standard	NM_020137		Approved	GRASP-1, GRASP1, KIAA1167, MPMGp800B12492Q3, DKFZp434P0630	uc004dly.1	Q4V328	OTTHUMG00000033192	ENST00000376441.1:c.1364G>A	X.37:g.48839761C>T	ENSP00000365624:p.Arg455His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL78|Q3MJ75|Q4V327|Q4V330|Q5HYG1|Q6N046|Q96DH8|Q9NQ43|Q9ULQ3	Missense_Mutation	SNP	superfamily_Prefoldin	p.R455H	ENST00000376441.1	37	c.1364	CCDS35248.1	X	.	.	.	.	.	.	.	.	.	.	-	11.12	1.545556	0.27652	.	.	ENSG00000068400	ENST00000376425;ENST00000376444;ENST00000376441;ENST00000537291;ENST00000376423	T;T;T;T	0.25414	1.8;1.8;1.8;1.8	4.26	2.4	0.29515	.	0.183599	0.32935	N	0.005472	T	0.31606	0.0802	L	0.34521	1.04	0.09310	N	1	D;B;D	0.89917	0.999;0.061;1.0	P;B;D	0.69824	0.884;0.013;0.966	T	0.08848	-1.0702	10	0.66056	D	0.02	0.1576	4.3916	0.11343	0.18:0.6188:0.0:0.2012	.	402;345;455	Q4V328-2;Q4V328-3;Q4V328	.;.;GRAP1_HUMAN	H	424;410;455;424;402	ENSP00000365608:R424H;ENSP00000365627:R410H;ENSP00000365624:R455H;ENSP00000365606:R402H	ENSP00000365606:R402H	R	-	2	0	GRIPAP1	48724705	0.004000	0.15560	0.051000	0.19133	0.166000	0.22503	0.525000	0.22956	0.144000	0.18951	-0.473000	0.04963	CGT	GRIPAP1	-	NULL	ENSG00000068400		0.602	GRIPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIPAP1	HGNC	protein_coding	OTTHUMT00000080970.2	60	0.00	0	C	NM_207672		48839761	48839761	-1	no_errors	ENST00000376441	ensembl	human	known	69_37n	missense	25	37.50	15	SNP	0.002	T
GRM3	2913	genome.wustl.edu	37	7	86415916	86415916	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:86415916C>T	ENST00000361669.2	+	3	1907	c.808C>T	c.(808-810)Cgc>Tgc	p.R270C	GRM3_ENST00000394720.2_Missense_Mutation_p.R268C|GRM3_ENST00000536043.1_Missense_Mutation_p.R142C|AC005009.2_ENST00000418031.1_RNA|GRM3_ENST00000546348.1_Intron|GRM3_ENST00000439827.1_Missense_Mutation_p.R270C|AC005009.2_ENST00000452471.1_RNA	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	270					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					GCCCAACGCGCGCGTCGTGGT	0.652																																					GBM(52;969 1098 3139 52280)	dbGAP											0													45.0	50.0	49.0					7																	86415916		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.808C>T	7.37:g.86415916C>T	ENSP00000355316:p.Arg270Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	p.R270C	ENST00000361669.2	37	c.808	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	C	22.2	4.253629	0.80135	.	.	ENSG00000198822	ENST00000361669;ENST00000454217;ENST00000536043;ENST00000439827;ENST00000394720	D;D;D;D;D	0.87256	-2.23;-2.23;-2.23;-2.23;-2.23	6.07	6.07	0.98685	Extracellular ligand-binding receptor (1);	0.103081	0.64402	D	0.000004	D	0.93789	0.8014	M	0.91406	3.205	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.998	P;P;P	0.61397	0.874;0.888;0.879	D	0.94390	0.7613	10	0.87932	D	0	.	13.1068	0.59252	0.2494:0.7506:0.0:0.0	.	142;270;270	F5GYZ2;G5E9K2;Q14832	.;.;GRM3_HUMAN	C	270;142;142;270;268	ENSP00000355316:R270C;ENSP00000405427:R142C;ENSP00000441407:R142C;ENSP00000398767:R270C;ENSP00000378209:R268C	ENSP00000355316:R270C	R	+	1	0	GRM3	86253852	0.950000	0.32346	0.992000	0.48379	0.999000	0.98932	3.233000	0.51311	2.885000	0.99019	0.655000	0.94253	CGC	GRM3	-	pfam_ANF_lig-bd_rcpt	ENSG00000198822		0.652	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	25	0.00	0	C			86415916	86415916	+1	no_errors	ENST00000361669	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	0.985	T
HAUS5	23354	genome.wustl.edu	37	19	36110619	36110619	+	Silent	SNP	C	C	T	rs560042186		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr19:36110619C>T	ENST00000203166.5	+	15	1390	c.1365C>T	c.(1363-1365)ccC>ccT	p.P455P	HAUS5_ENST00000379045.2_3'UTR	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	455					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						GGCATTTGCCCCACATTCTGT	0.642													c|||	1	0.000199681	0.0	0.0	5008	,	,		13228	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													22.0	25.0	24.0					19																	36110619		2125	4233	6358	-	-	-	SO:0001819	synonymous_variant	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.1365C>T	19.37:g.36110619C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Silent	SNP	NULL	p.P455	ENST00000203166.5	37	c.1365	CCDS42550.1	19																																																																																			HAUS5	-	NULL	ENSG00000249115		0.642	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2	26	0.00	0	C			36110619	36110619	+1	no_errors	ENST00000203166	ensembl	human	known	69_37n	silent	5	37.50	3	SNP	0.008	T
HUWE1	10075	genome.wustl.edu	37	X	53563167	53563167	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:53563167C>T	ENST00000342160.3	-	79	12929	c.12472G>A	c.(12472-12474)Gtt>Att	p.V4158I	HUWE1_ENST00000262854.6_Missense_Mutation_p.V4158I			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	4158	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						AGCAGATAAACCAGACCTTGG	0.453																																						dbGAP											0													186.0	128.0	148.0					X																	53563167		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.12472G>A	X.37:g.53563167C>T	ENSP00000340648:p.Val4158Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.V4158I	ENST00000342160.3	37	c.12472	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.94|14.94	2.685216|2.685216	0.47991|0.47991	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052;ENST00000426907|ENST00000342160;ENST00000262854	.|T;T	.|0.57436	.|0.4;0.4	5.57|5.57	5.57|5.57	0.84162|0.84162	.|HECT (4);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.60521|0.60521	0.2275|0.2275	L|L	0.31065|0.31065	0.9|0.9	0.80722|0.80722	D|D	1|1	.|P;D	.|0.59357	.|0.88;0.985	.|P;D	.|0.67382	.|0.895;0.951	T|T	0.55373|0.55373	-0.8151|-0.8151	5|10	.|0.26408	.|T	.|0.33	.|.	17.4833|17.4833	0.87680|0.87680	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|4158;4142	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	D|I	3191;980|4158	.|ENSP00000340648:V4158I;ENSP00000262854:V4158I	.|ENSP00000262854:V4158I	G|V	-|-	2|1	0|0	HUWE1|HUWE1	53579892|53579892	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.526000|0.526000	0.34562|0.34562	7.231000|7.231000	0.78106|0.78106	2.485000|2.485000	0.83878|0.83878	0.594000|0.594000	0.82650|0.82650	GGT|GTT	HUWE1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000086758		0.453	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	42	0.00	0	C	XM_497119		53563167	53563167	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	33	29.79	14	SNP	1.000	T
ILDR2	387597	genome.wustl.edu	37	1	166904565	166904565	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:166904565T>G	ENST00000271417.3	-	6	908	c.853A>C	c.(853-855)Agt>Cgt	p.S285R	ILDR2_ENST00000529071.1_Missense_Mutation_p.S266R|ILDR2_ENST00000526687.1_Intron|ILDR2_ENST00000469934.2_Missense_Mutation_p.S285R|ILDR2_ENST00000528703.1_Intron|ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000525740.1_Intron	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	285					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						GTGGAGTCACTTGGTGCCAAG	0.587																																						dbGAP											0													99.0	90.0	93.0					1																	166904565		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.853A>C	1.37:g.166904565T>G	ENSP00000271417:p.Ser285Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub	p.S285R	ENST00000271417.3	37	c.853	CCDS1256.1	1	.	.	.	.	.	.	.	.	.	.	T	17.22	3.334183	0.60853	.	.	ENSG00000143195	ENST00000271417;ENST00000469934;ENST00000529071	T;T;T	0.55760	0.51;0.53;0.5	5.67	5.67	0.87782	.	0.295899	0.40640	N	0.001043	T	0.63046	0.2478	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.64901	-0.6298	10	0.48119	T	0.1	-8.39	15.909	0.79456	0.0:0.0:0.0:1.0	.	285	Q71H61	ILDR2_HUMAN	R	285;285;266	ENSP00000271417:S285R;ENSP00000437008:S285R;ENSP00000436882:S266R	ENSP00000271417:S285R	S	-	1	0	ILDR2	165171189	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.616000	0.54174	2.155000	0.67459	0.459000	0.35465	AGT	ILDR2	-	NULL	ENSG00000143195		0.587	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILDR2	HGNC	protein_coding	OTTHUMT00000082880.2	35	0.00	0	T	NM_199351		166904565	166904565	-1	no_errors	ENST00000271417	ensembl	human	known	69_37n	missense	34	18.60	8	SNP	1.000	G
IQCA1P1	392843	genome.wustl.edu	37	7	150893629	150893629	+	RNA	SNP	T	T	C	rs310586	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:150893629T>C	ENST00000602518.1	-	0	0							A6NCM1	IQCAL_HUMAN	IQ motif containing with AAA domain 1 pseudogene 1								ATP binding (GO:0005524)										TCACACCGGTTCTTCCATGTA	0.537													T|||	1841	0.367612	0.3185	0.3718	5008	,	,		21618	0.1538		0.5298	False		,,,				2504	0.4847					dbGAP											0																																										-	-	-			0					7q36.1	2014-04-09	2011-04-28	2011-04-28	ENSG00000183016	ENSG00000278685			22831	other	unknown			"""IQ motif containing with AAA domain 1-like"""	IQCA1L			Standard	XR_426269		Approved	TCAG_9762		A6NCM1	OTTHUMG00000156140		7.37:g.150893629T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000602518.1	37	NULL		7																																																																																			IQCA1P1	-	-	ENSG00000183016		0.537	IQCA1P1-004	KNOWN	basic	processed_transcript	IQCA1P1	HGNC	pseudogene	OTTHUMT00000467767.1	59	0.00	0	T			150893629	150893629	-1	no_errors	ENST00000453127	ensembl	human	known	69_37n	rna	36	12.20	5	SNP	0.871	C
ITGB2	3689	genome.wustl.edu	37	21	46328026	46328026	+	Intron	SNP	G	G	A	rs3746973	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr21:46328026G>A	ENST00000397850.2	-	5	600				ITGB2_ENST00000397854.3_Intron|ITGB2_ENST00000355153.4_Intron|ITGB2_ENST00000397846.3_Silent_p.P73P|ITGB2_ENST00000397852.1_Intron|ITGB2_ENST00000302347.5_Intron|ITGB2_ENST00000397857.1_Intron|ITGB2_ENST00000523126.1_5'Flank			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)						apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GAGGACAGACGGGAGCCACCC	0.627													A|||	959	0.191494	0.177	0.2522	5008	,	,		11476	0.2183		0.2097	False		,,,				2504	0.1217					dbGAP											0													4.0	4.0	4.0					21																	46328026		832	1895	2727	-	-	-	SO:0001627	intron_variant	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.148-1016C>T	21.37:g.46328026G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Silent	SNP	superfamily_Plexin-like_fold	p.P73	ENST00000397850.2	37	c.219	CCDS13716.1	21																																																																																			ITGB2	-	NULL	ENSG00000160255		0.627	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	52	0.00	0	G	NM_000211		46328026	46328026	-1	no_errors	ENST00000520389	ensembl	human	known	69_37n	silent	49	10.71	6	SNP	0.004	A
KIAA1462	57608	genome.wustl.edu	37	10	30317873	30317873	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr10:30317873G>A	ENST00000375377.1	-	3	1305	c.1204C>T	c.(1204-1206)Cgc>Tgc	p.R402C		NM_020848.2	NP_065899.1	Q9P266	JCAD_HUMAN	KIAA1462	402	Pro-rich.				cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)				breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(23)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	75						TGAGGCAAGCGGGGGCTCACA	0.592																																						dbGAP											0													62.0	68.0	66.0					10																	30317873		1954	4136	6090	-	-	-	SO:0001583	missense	0			AB040895	CCDS41500.1	10p12.1	2013-04-23			ENSG00000165757	ENSG00000165757			29283	protein-coding gene	gene with protein product	"""junctional protein associated with coronary artery disease"""	614398				10819331, 21884682	Standard	NM_020848		Approved	JCAD	uc001iux.3	Q9P266	OTTHUMG00000017885	ENST00000375377.1:c.1204C>T	10.37:g.30317873G>A	ENSP00000364526:p.Arg402Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HYA7|Q5T992|Q86WZ9|Q9BYJ2	Missense_Mutation	SNP	NULL	p.R402C	ENST00000375377.1	37	c.1204	CCDS41500.1	10	.	.	.	.	.	.	.	.	.	.	G	11.18	1.564156	0.27915	.	.	ENSG00000165757	ENST00000375377	T	0.12039	2.72	5.28	-3.77	0.04346	.	1.047670	0.07427	N	0.895065	T	0.06690	0.0171	N	0.17674	0.51	0.09310	N	1	B	0.18310	0.027	B	0.08055	0.003	T	0.39881	-0.9592	10	0.33940	T	0.23	-0.674	2.8771	0.05635	0.2086:0.3271:0.3567:0.1075	.	402	Q9P266	K1462_HUMAN	C	402	ENSP00000364526:R402C	ENSP00000364526:R402C	R	-	1	0	KIAA1462	30357879	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.201000	0.09464	-0.339000	0.08401	-0.215000	0.12644	CGC	KIAA1462	-	NULL	ENSG00000165757		0.592	KIAA1462-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1462	HGNC	protein_coding	OTTHUMT00000047409.1	30	0.00	0	G	NM_020848		30317873	30317873	-1	no_errors	ENST00000375377	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	0.000	A
KIF26B	55083	genome.wustl.edu	37	1	245849196	245849196	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:245849196G>C	ENST00000407071.2	+	12	3351	c.2911G>C	c.(2911-2913)Gca>Cca	p.A971P	KIF26B_ENST00000366518.4_Missense_Mutation_p.A590P	NM_018012.3	NP_060482.2	Q2KJY2	KI26B_HUMAN	kinesin family member 26B	971					establishment of cell polarity (GO:0030010)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|ureteric bud invasion (GO:0072092)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	51	all_cancers(71;3.86e-05)|all_epithelial(71;0.000121)|Ovarian(71;0.0412)|all_lung(81;0.0498)|Lung NSC(105;0.0708)|Breast(184;0.127)		OV - Ovarian serous cystadenocarcinoma(106;0.022)			AGCAGCGGGGGCAAGCCCACT	0.592																																						dbGAP											0													20.0	25.0	24.0					1																	245849196		1966	4147	6113	-	-	-	SO:0001583	missense	0			AK001019	CCDS44342.1	1q44	2008-02-05			ENSG00000162849	ENSG00000162849		"""Kinesins"""	25484	protein-coding gene	gene with protein product		614026					Standard	NM_018012		Approved	FLJ10157	uc001ibf.1	Q2KJY2	OTTHUMG00000040079	ENST00000407071.2:c.2911G>C	1.37:g.245849196G>C	ENSP00000385545:p.Ala971Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQR9|Q6ZUZ0|Q8IUN3|Q8IVR1|Q9NWB4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A971P	ENST00000407071.2	37	c.2911	CCDS44342.1	1	.	.	.	.	.	.	.	.	.	.	G	8.921	0.961074	0.18583	.	.	ENSG00000162849	ENST00000407071;ENST00000366518;ENST00000413001	T;T	0.77750	-1.12;-1.12	5.44	0.957	0.19613	.	.	.	.	.	T	0.53786	0.1818	N	0.02539	-0.55	0.19775	N	0.99996	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.32025	-0.9922	9	0.23891	T	0.37	.	14.3704	0.66836	0.0725:0.65:0.2775:0.0	.	590;971	B7WPD9;Q2KJY2	.;KI26B_HUMAN	P	971;590;587	ENSP00000385545:A971P;ENSP00000355475:A590P	ENSP00000355475:A590P	A	+	1	0	KIF26B	243915819	0.970000	0.33590	0.194000	0.23346	0.751000	0.42716	0.391000	0.20784	0.186000	0.20125	0.561000	0.74099	GCA	KIF26B	-	NULL	ENSG00000162849		0.592	KIF26B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF26B	HGNC	protein_coding	OTTHUMT00000381037.1	38	0.00	0	G	XM_371354		245849196	245849196	+1	no_errors	ENST00000407071	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	0.207	C
KRT16P3	644945	genome.wustl.edu	37	17	20405802	20405802	+	RNA	SNP	T	T	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:20405802T>C	ENST00000580113.1	-	0	1012									keratin 16 pseudogene 3																		TCTGGTCCCATCCTGAGAAAA	0.498																																						dbGAP											0																																										-	-	-			0			BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20405802T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000580113.1	37	NULL		17																																																																																			KRT16P3	-	-	ENSG00000214822		0.498	KRT16P3-004	KNOWN	basic	processed_transcript	KRT16P3	HGNC	pseudogene	OTTHUMT00000443764.1	46	0.00	0	T	NR_029393		20405802	20405802	-1	no_errors	ENST00000580621	ensembl	human	known	69_37n	rna	21	12.50	3	SNP	0.000	C
LAMA2	3908	genome.wustl.edu	37	6	129612789	129612789	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr6:129612789C>G	ENST00000421865.2	+	20	2829	c.2780C>G	c.(2779-2781)tCt>tGt	p.S927C		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	927	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GGCTCTTTCTCTGAGGTTTGC	0.453																																						dbGAP											0													89.0	81.0	83.0					6																	129612789		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2780C>G	6.37:g.129612789C>G	ENSP00000400365:p.Ser927Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.S927C	ENST00000421865.2	37	c.2780	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695105	0.88830	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	T	0.63744	-0.06	5.78	5.78	0.91487	EGF-like, laminin (3);	0.000000	0.64402	D	0.000001	D	0.85588	0.5731	H	0.95917	3.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	D	0.88702	0.3216	10	0.72032	D	0.01	.	20.3754	0.98918	0.0:1.0:0.0:0.0	.	927;927	A6NF00;P24043	.;LAMA2_HUMAN	C	927	ENSP00000400365:S927C	ENSP00000346769:S927C	S	+	2	0	LAMA2	129654482	1.000000	0.71417	0.972000	0.41901	0.739000	0.42172	7.484000	0.81180	2.894000	0.99253	0.591000	0.81541	TCT	LAMA2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000196569		0.453	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	34	0.00	0	C			129612789	129612789	+1	no_errors	ENST00000421865	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	1.000	G
LAMA2	3908	genome.wustl.edu	37	6	129612819	129612819	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr6:129612819G>C	ENST00000421865.2	+	20	2859	c.2810G>C	c.(2809-2811)tGt>tCt	p.C937S		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	937	Laminin EGF-like 9. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		ACTGGACAGTGTGAGTGCAGA	0.473																																						dbGAP											0													104.0	89.0	94.0					6																	129612819		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.2810G>C	6.37:g.129612819G>C	ENSP00000400365:p.Cys937Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.C937S	ENST00000421865.2	37	c.2810	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	G	18.27	3.586449	0.66105	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865	D	0.94280	-3.39	5.56	5.56	0.83823	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.98507	0.9502	H	0.99143	4.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.99497	1.0952	10	0.87932	D	0	.	19.8892	0.96923	0.0:0.0:1.0:0.0	.	937;937	A6NF00;P24043	.;LAMA2_HUMAN	S	937	ENSP00000400365:C937S	ENSP00000346769:C937S	C	+	2	0	LAMA2	129654512	1.000000	0.71417	0.984000	0.44739	0.048000	0.14542	9.438000	0.97539	2.777000	0.95525	0.591000	0.81541	TGT	LAMA2	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000196569		0.473	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	35	0.00	0	G			129612819	129612819	+1	no_errors	ENST00000421865	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	C
LRCH2	57631	genome.wustl.edu	37	X	114419069	114419069	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:114419069G>T	ENST00000317135.8	-	3	556	c.526C>A	c.(526-528)Cta>Ata	p.L176I	LRCH2_ENST00000538422.1_Missense_Mutation_p.L176I	NM_020871.3	NP_065922.3	Q5VUJ6	LRCH2_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 2	176										breast(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	19						AGATCAAATAGGTATTTTGGC	0.313																																						dbGAP											0													58.0	54.0	56.0					X																	114419069		1808	4058	5866	-	-	-	SO:0001583	missense	0			AB040928	CCDS48155.1, CCDS59175.1	Xq24	2008-02-05			ENSG00000130224	ENSG00000130224			29292	protein-coding gene	gene with protein product						10819331	Standard	NM_020871		Approved	KIAA1495	uc010nqe.3	Q5VUJ6	OTTHUMG00000022233	ENST00000317135.8:c.526C>A	X.37:g.114419069G>T	ENSP00000325091:p.Leu176Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H2T1|Q08AD5|Q9HA88|Q9P233	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,superfamily_CH-domain,superfamily_NA-bd_OB-fold-like,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.L176I	ENST00000317135.8	37	c.526	CCDS48155.1	X	.	.	.	.	.	.	.	.	.	.	G	13.93	2.382890	0.42207	.	.	ENSG00000130224	ENST00000317135;ENST00000538422	T;T	0.27720	1.65;2.02	5.67	1.61	0.23674	.	0.166320	0.40064	N	0.001183	T	0.22589	0.0545	N	0.03238	-0.38	0.58432	D	0.999996	D;D	0.89917	0.993;1.0	D;D	0.87578	0.987;0.998	T	0.14671	-1.0464	10	0.02654	T	1	-8.1409	9.5753	0.39454	0.3302:0.0:0.6698:0.0	.	176;176	Q5VUJ6;F5H2T1	LRCH2_HUMAN;.	I	176	ENSP00000325091:L176I;ENSP00000439366:L176I	ENSP00000325091:L176I	L	-	1	2	LRCH2	114325325	1.000000	0.71417	0.991000	0.47740	0.925000	0.55904	0.613000	0.24299	0.124000	0.18369	0.468000	0.43344	CTA	LRCH2	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000130224		0.313	LRCH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRCH2	HGNC	protein_coding	OTTHUMT00000057971.2	69	0.00	0	G	NM_020871		114419069	114419069	-1	no_errors	ENST00000317135	ensembl	human	known	69_37n	missense	86	14.71	15	SNP	0.987	T
LRRC37A	9884	genome.wustl.edu	37	17	44374710	44374710	+	Silent	SNP	A	A	G	rs62073222	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:44374710A>G	ENST00000320254.5	+	1	2214	c.2211A>G	c.(2209-2211)ccA>ccG	p.P737P	ARL17B_ENST00000570618.1_Intron|LRRC37A_ENST00000393465.3_Silent_p.P737P|LRRC37A_ENST00000496930.1_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	737						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		AGGTTAAACCATCTCCAACCA	0.517													.|||	3389	0.676717	0.3147	0.7046	5008	,	,		21665	0.8909		0.6789	False		,,,				2504	0.9233					dbGAP											0													1.0	1.0	1.0					17																	44374710		79	123	202	-	-	-	SO:0001819	synonymous_variant	0			BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.2211A>G	17.37:g.44374710A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DY2|Q8IWC7	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P737	ENST00000320254.5	37	c.2211	CCDS11504.2	17																																																																																			LRRC37A	-	NULL	ENSG00000176681		0.517	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC37A	HGNC	protein_coding	OTTHUMT00000313519.3	30	0.00	0	A	NM_014834		44374710	44374710	+1	no_errors	ENST00000320254	ensembl	human	known	69_37n	silent	25	21.88	7	SNP	0.000	G
LRRC63	220416	genome.wustl.edu	37	13	46802177	46802177	+	Missense_Mutation	SNP	A	A	G	rs6561303	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr13:46802177A>G	ENST00000595396.1	+	2	616	c.616A>G	c.(616-618)Atg>Gtg	p.M206V	LRRC63_ENST00000446175.1_Missense_Mutation_p.M206V			Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	206			M -> V (in dbSNP:rs6561303).							lung(1)|ovary(1)	2						CCCTCCACCTATGACTGTATC	0.423													A|||	715	0.142772	0.149	0.1527	5008	,	,		19301	0.2054		0.0746	False		,,,				2504	0.1329					dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000595396.1:c.616A>G	13.37:g.46802177A>G	ENSP00000469337:p.Met206Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBN0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.M206V	ENST00000595396.1	37	c.616		13	289	0.13232600732600733	76	0.15447154471544716	48	0.13259668508287292	110	0.19230769230769232	55	0.07255936675461741	A	8.481	0.859794	0.17178	.	.	ENSG00000173988	ENST00000378805;ENST00000446175	T;T	0.01203	5.18;5.23	5.0	-2.07	0.07276	.	1.093350	0.06935	N	0.811709	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.43097	-0.9412	9	0.31617	T	0.26	-2.5504	4.6267	0.12481	0.4418:0.3008:0.2574:0.0	rs6561303;rs17647790;rs59018799;rs6561303	206	Q05C16	LRC63_HUMAN	V	206	ENSP00000368082:M206V;ENSP00000408828:M206V	ENSP00000368082:M206V	M	+	1	0	LRRC63	45700178	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.000000	0.12993	-0.393000	0.07739	-0.389000	0.06534	ATG	LRRC63	-	NULL	ENSG00000173988		0.423	LRRC63-002	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LRRC63	HGNC	protein_coding	OTTHUMT00000463266.1	37	0.00	0	A	XM_001718341		46802177	46802177	+1	no_errors	ENST00000446175	ensembl	human	known	69_37n	missense	24	13.79	4	SNP	0.000	G
LY9	4063	genome.wustl.edu	37	1	160769718	160769718	+	Silent	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:160769718C>G	ENST00000263285.6	+	2	330	c.300C>G	c.(298-300)gtC>gtG	p.V100V	LY9_ENST00000392203.4_Silent_p.V100V|LY9_ENST00000368041.2_Silent_p.V60V|LY9_ENST00000471816.1_3'UTR|LY9_ENST00000368040.1_5'UTR|LY9_ENST00000368039.2_Silent_p.V100V|LY9_ENST00000341032.4_Silent_p.V100V|LY9_ENST00000368037.5_Silent_p.V100V			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	100	Ig-like V-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			CCATTATGGTCAAAAGCTACC	0.448																																						dbGAP											0													104.0	104.0	104.0					1																	160769718		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.300C>G	1.37:g.160769718C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Silent	SNP	smart_Ig_sub,pfscan_Ig-like	p.V100	ENST00000263285.6	37	c.300	CCDS30916.1	1																																																																																			LY9	-	smart_Ig_sub	ENSG00000122224		0.448	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LY9	HGNC	protein_coding	OTTHUMT00000060457.3	38	0.00	0	C	NM_002348		160769718	160769718	+1	no_errors	ENST00000263285	ensembl	human	known	69_37n	silent	52	16.13	10	SNP	0.003	G
MAGEE1	57692	genome.wustl.edu	37	X	75650039	75650039	+	Silent	SNP	A	A	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:75650039A>G	ENST00000361470.2	+	1	1994	c.1716A>G	c.(1714-1716)ttA>ttG	p.L572L		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	572	MAGE 1. {ECO:0000255|PROSITE- ProRule:PRU00127}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						TTGAAGGGTTAGAAGAGAGCC	0.468																																						dbGAP											0													32.0	29.0	30.0					X																	75650039		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.1716A>G	X.37:g.75650039A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Silent	SNP	pfam_MAGE,pfscan_MAGE	p.L572	ENST00000361470.2	37	c.1716	CCDS14433.1	X																																																																																			MAGEE1	-	pfam_MAGE,pfscan_MAGE	ENSG00000198934		0.468	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	53	0.00	0	A	NM_020932		75650039	75650039	+1	no_errors	ENST00000361470	ensembl	human	known	69_37n	silent	31	31.11	14	SNP	0.013	G
MAST1	22983	genome.wustl.edu	37	19	12969421	12969421	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr19:12969421C>A	ENST00000251472.4	+	12	1273	c.1234C>A	c.(1234-1236)Ctc>Atc	p.L412I	MAST1_ENST00000591495.1_Missense_Mutation_p.L408I	NM_014975.2	NP_055790.1			microtubule associated serine/threonine kinase 1											NS(1)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(20)|ovary(5)|prostate(5)|skin(3)	56						GAACTTGATCCTCCGCAACCA	0.597																																						dbGAP											0													96.0	82.0	87.0					19																	12969421		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023190	CCDS32921.1	19p13.2	2008-02-05				ENSG00000105613			19034	protein-coding gene	gene with protein product		612256					Standard	NM_014975		Approved	SAST, KIAA0973	uc002mvm.3	Q9Y2H9		ENST00000251472.4:c.1234C>A	19.37:g.12969421C>A	ENSP00000251472:p.Leu412Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.L412I	ENST00000251472.4	37	c.1234	CCDS32921.1	19	.	.	.	.	.	.	.	.	.	.	C	20.5	3.998278	0.74818	.	.	ENSG00000105613	ENST00000251472;ENST00000542153	T	0.24723	1.84	4.75	2.62	0.31277	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000005	T	0.28167	0.0695	N	0.16478	0.41	0.45439	D	0.998412	D;B	0.55605	0.972;0.008	P;B	0.61874	0.895;0.028	T	0.04427	-1.0952	10	0.72032	D	0.01	-20.6154	9.1525	0.36971	0.0:0.8184:0.0:0.1816	.	412;412	Q9Y2H9;F5H2S9	MAST1_HUMAN;.	I	412	ENSP00000251472:L412I	ENSP00000251472:L412I	L	+	1	0	MAST1	12830421	0.117000	0.22190	0.985000	0.45067	0.986000	0.74619	0.728000	0.26013	0.556000	0.29098	0.561000	0.74099	CTC	MAST1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000105613		0.597	MAST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST1	HGNC	protein_coding	OTTHUMT00000451733.2	41	0.00	0	C	NM_014975		12969421	12969421	+1	no_errors	ENST00000251472	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	1.000	A
MCF2L	23263	genome.wustl.edu	37	13	113708697	113708697	+	Intron	SNP	C	C	T	rs7319791	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr13:113708697C>T	ENST00000375608.3	+	6	517				MCF2L_ENST00000421756.1_Intron|MCF2L_ENST00000375597.4_Intron|MCF2L_ENST00000423482.2_Intron|MCF2L_ENST00000535094.2_Intron|MCF2L_ENST00000375604.2_Intron|MCF2L_ENST00000442652.2_Intron|MCF2L_ENST00000397030.1_Intron|MCF2L_ENST00000434480.2_Intron|MCF2L_ENST00000375601.3_Intron			O15068	MCF2L_HUMAN	MCF.2 cell line derived transforming sequence-like						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular space (GO:0005615)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			kidney(1)|large_intestine(5)|ovary(1)|stomach(1)	8	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_cancers(25;0.118)|all_lung(25;0.0368)|all_epithelial(44;0.0396)|Lung NSC(25;0.129)|Breast(118;0.188)				GATGGCCTCACGCACACGGCA	0.552													C|||	1488	0.297125	0.3177	0.3429	5008	,	,		16650	0.128		0.3757	False		,,,				2504	0.3303					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB002360	CCDS9527.2, CCDS45070.1, CCDS9527.3, CCDS45070.2	13q34	2013-01-10			ENSG00000126217	ENSG00000126217		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14576	protein-coding gene	gene with protein product		609499				9205841	Standard	NM_001112732		Approved	KIAA0362, DBS, OST, ARHGEF14	uc010tjr.2	O15068	OTTHUMG00000017377	ENST00000375608.3:c.460-6210C>T	13.37:g.113708697C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2X1|A2A2X2|A2A3G6|A2A3G8|B4DHD6|B4DIL6|E9PDN8|Q5JU56|Q5VXT1|Q6ZWD4|Q765G8|Q765G9|Q8N679	RNA	SNP	-	NULL	ENST00000375608.3	37	NULL		13																																																																																			MCF2L	-	-	ENSG00000126217		0.552	MCF2L-001	KNOWN	basic	protein_coding	MCF2L	HGNC	protein_coding	OTTHUMT00000045849.4	51	0.00	0	C			113708697	113708697	+1	no_errors	ENST00000494043	ensembl	human	known	69_37n	rna	40	11.11	5	SNP	0.002	T
MEIS1	4211	genome.wustl.edu	37	2	66667033	66667033	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:66667033A>C	ENST00000272369.9	+	3	755	c.298A>C	c.(298-300)Acc>Ccc	p.T100P	MEIS1_ENST00000398506.2_Missense_Mutation_p.T98P|MEIS1_ENST00000495021.2_Missense_Mutation_p.T35P|MEIS1_ENST00000444274.2_Missense_Mutation_p.T68P|MEIS1_ENST00000560281.2_Missense_Mutation_p.T100P|MEIS1_ENST00000407092.2_Missense_Mutation_p.T100P|MEIS1-AS2_ENST00000439433.1_RNA|MEIS1_ENST00000488550.1_Missense_Mutation_p.T100P|MEIS1-AS1_ENST00000454595.1_RNA	NM_002398.2	NP_002389.1	O00470	MEIS1_HUMAN	Meis homeobox 1	100					angiogenesis (GO:0001525)|definitive hemopoiesis (GO:0060216)|lens morphogenesis in camera-type eye (GO:0002089)|megakaryocyte development (GO:0035855)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of neuron differentiation (GO:0045665)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			breast(1)|endometrium(1)|kidney(2)|large_intestine(6)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	24						AGCTACTTGTACCCCCCGCGA	0.483																																						dbGAP											0													64.0	58.0	60.0					2																	66667033		1809	4073	5882	-	-	-	SO:0001583	missense	0				CCDS46309.1	2p14	2011-06-20	2007-02-15		ENSG00000143995	ENSG00000143995		"""Homeoboxes / TALE class"""	7000	protein-coding gene	gene with protein product		601739	"""Meis1 (mouse) homolog"", ""Meis1, myeloid ecotropic viral integration site 1 homolog (mouse)"""			7565694	Standard	NM_002398		Approved		uc002sdu.3	O00470	OTTHUMG00000150714	ENST00000272369.9:c.298A>C	2.37:g.66667033A>C	ENSP00000272369:p.Thr100Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV50	Missense_Mutation	SNP	pfam_Homeodomain,pfam_Homeobox_KN_domain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.T100P	ENST00000272369.9	37	c.298	CCDS46309.1	2	.	.	.	.	.	.	.	.	.	.	A	26.6	4.749006	0.89753	.	.	ENSG00000143995	ENST00000272369;ENST00000407092;ENST00000398506;ENST00000444274;ENST00000495021	T;T;T;T;T	0.32753	1.44;1.44;1.44;1.44;1.44	5.38	5.38	0.77491	.	0.104975	0.64402	D	0.000006	T	0.46386	0.1390	M	0.68593	2.085	0.58432	D	0.999998	P;B;P;P	0.52316	0.952;0.255;0.865;0.554	P;P;P;P	0.52909	0.713;0.454;0.501;0.454	T	0.49551	-0.8928	10	0.87932	D	0	.	15.2365	0.73436	1.0:0.0:0.0:0.0	.	35;98;100;100	F5GYS8;O00470-2;O00470;F8W8U3	.;.;MEIS1_HUMAN;.	P	100;100;98;68;35	ENSP00000272369:T100P;ENSP00000384461:T100P;ENSP00000381518:T98P;ENSP00000403206:T68P;ENSP00000440571:T35P	ENSP00000272369:T100P	T	+	1	0	MEIS1	66520537	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	9.105000	0.94246	2.254000	0.74563	0.533000	0.62120	ACC	MEIS1	-	NULL	ENSG00000143995		0.483	MEIS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEIS1	HGNC	protein_coding	OTTHUMT00000319725.4	41	0.00	0	A	NM_002398		66667033	66667033	+1	no_errors	ENST00000407092	ensembl	human	known	69_37n	missense	15	51.43	18	SNP	1.000	C
MIEN1	84299	genome.wustl.edu	37	17	37885932	37885935	+	Intron	DEL	ACTC	ACTC	-			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	ACTC	ACTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:37885932_37885935delACTC	ENST00000394231.3	-	3	556				ERBB2_ENST00000584888.1_Intron|MIEN1_ENST00000474210.1_Intron|MIEN1_ENST00000577810.1_Frame_Shift_Del_p.VS89fs			Q9BRT3	MIEN1_HUMAN	migration and invasion enhancer 1						apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell migration (GO:0030335)|positive regulation of filopodium assembly (GO:0051491)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	selenium binding (GO:0008430)										CGCTGTAAATACTCACATCTTTCT	0.485																																						dbGAP											0										24,4240		12,0,2120						4.6	0.8			193	33,8221		16,1,4110	no	intron	MIEN1	NM_032339.3		28,1,6230	A1A1,A1R,RR		0.3998,0.5629,0.4553				57,12461				-	-	-	SO:0001627	intron_variant	0			AJ308025	CCDS11344.1	17q12	2011-09-21	2011-09-21	2011-09-21	ENSG00000141741	ENSG00000141741			28230	protein-coding gene	gene with protein product		611802	"""chromosome 17 open reading frame 37"""	C17orf37		17121940, 12739007, 17503775, 21628459	Standard	NM_032339		Approved	MGC14832, ORB3, XTP4, C35, Rdx12	uc002hsq.3	Q9BRT3	OTTHUMG00000133252	ENST00000394231.3:c.264+2GAGT>-	17.37:g.37885932_37885935delACTC		Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Selenoprotein_Rdx-typ,superfamily_Thioredoxin-like_fold,tigrfam_Selenoprotein_Rdx-typ	p.S90fs	ENST00000394231.3	37	c.270_267	CCDS11344.1	17																																																																																			MIEN1	-	NULL	ENSG00000141741		0.485	MIEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIEN1	HGNC	protein_coding	OTTHUMT00000257020.3	46	0.00	0	ACTC	NM_032339		37885932	37885935	-1	no_errors	ENST00000577810	ensembl	human	putative	69_37n	frame_shift_del	51	11.86	7	DEL	0.998:1.000:1.000:1.000	-
MCM7	4176	genome.wustl.edu	37	7	99691263	99691263	+	Intron	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:99691263G>T	ENST00000303887.5	-	14	2494				MCM7_ENST00000354230.3_Intron|MIR25_ENST00000384816.1_RNA|MIR106B_ENST00000385301.1_RNA|MIR93_ENST00000385024.1_RNA|MCM7_ENST00000343023.6_Intron	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7						cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCTCAACACTGGCCAGTCCCG	0.617																																						dbGAP											0													61.0	65.0	64.0					7																	99691263		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1849-239C>A	7.37:g.99691263G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	RNA	SNP	-	NULL	ENST00000303887.5	37	NULL	CCDS5683.1	7																																																																																			MIR25	-	-	ENSG00000207547		0.617	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR25	HGNC	protein_coding	OTTHUMT00000336534.3	31	0.00	0	G			99691263	99691263	-1	no_errors	ENST00000384816	ensembl	human	known	69_37n	rna	37	19.15	9	SNP	1.000	T
MUC15	143662	genome.wustl.edu	37	11	26587134	26587134	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:26587134G>A	ENST00000455601.2	-	2	390	c.272C>T	c.(271-273)tCa>tTa	p.S91L	ANO3_ENST00000525139.1_Intron|MUC15_ENST00000529533.1_Missense_Mutation_p.S118L|ANO3_ENST00000531568.1_Intron|ANO3_ENST00000537978.1_Intron|MUC15_ENST00000436318.2_Missense_Mutation_p.S118L|MUC15_ENST00000281268.8_Missense_Mutation_p.S118L|MUC15_ENST00000527569.1_Missense_Mutation_p.S118L|ANO3_ENST00000256737.3_Intron	NM_145650.3	NP_663625.2	Q8N387	MUC15_HUMAN	mucin 15, cell surface associated	91					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.S91L(1)		breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25						CTCTGCTGATGAGTTACTGGA	0.433																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											158.0	142.0	148.0					11																	26587134		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ417818	CCDS7859.1, CCDS44556.1, CCDS44557.1	11p14.3	2007-01-17	2006-03-14					"""Mucins"""	14956	protein-coding gene	gene with protein product		608566				12047385	Standard	NM_145650		Approved		uc001mqw.3	Q8N387		ENST00000455601.2:c.272C>T	11.37:g.26587134G>A	ENSP00000397339:p.Ser91Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY00|E9PII6|F8W945|Q6UWS3|Q8IXI8|Q8WW41	Missense_Mutation	SNP	NULL	p.S118L	ENST00000455601.2	37	c.353	CCDS7859.1	11	.	.	.	.	.	.	.	.	.	.	G	0.994	-0.693171	0.03303	.	.	ENSG00000169550	ENST00000455601;ENST00000436318;ENST00000281268;ENST00000529533;ENST00000527569	T;T;T;T;T	0.21543	2.03;2.02;2.0;2.02;2.0	4.75	-2.59	0.06209	.	3.067170	0.01188	N	0.007246	T	0.06188	0.0160	N	0.01576	-0.805	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.32587	-0.9901	10	0.02654	T	1	-8.8862	4.8358	0.13464	0.4747:0.2828:0.2425:0.0	.	118;91;118	F8W945;Q8N387;E9PII6	.;MUC15_HUMAN;.	L	91;118;118;118;118	ENSP00000397339:S91L;ENSP00000416753:S118L;ENSP00000281268:S118L;ENSP00000431983:S118L;ENSP00000431945:S118L	ENSP00000281268:S118L	S	-	2	0	MUC15	26543710	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.066000	0.14489	-0.516000	0.06470	-1.000000	0.02509	TCA	MUC15	-	NULL	ENSG00000169550		0.433	MUC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC15	HGNC	protein_coding	OTTHUMT00000387866.1	71	0.00	0	G	NM_145650		26587134	26587134	-1	no_errors	ENST00000436318	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	0.000	A
MUC19	283463	genome.wustl.edu	37	12	40825459	40825459	+	Missense_Mutation	SNP	G	G	A	rs144344916	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr12:40825459G>A	ENST00000454784.4	+	15	1545	c.812G>A	c.(811-813)cGt>cAt	p.R271H	RP11-115F18.1_ENST00000552757.1_RNA			Q7Z5P9	MUC19_HUMAN	mucin 19, oligomeric	271	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				lung(2)	2						GTTGAGCTCCGTCCGTGCCCA	0.333													G|||	3	0.000599042	0.0	0.0	5008	,	,		18357	0.0		0.003	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY236870		12q12	2012-04-20	2006-03-14		ENSG00000205592	ENSG00000205592		"""Mucins"""	14362	protein-coding gene	gene with protein product		612170				12882755	Standard	NM_173600		Approved	FLJ35746	uc021qxa.1	Q7Z5P9	OTTHUMG00000060732	ENST00000454784.4:c.812G>A	12.37:g.40825459G>A	ENSP00000476404:p.Arg271His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA85	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_VWF_type-D,smart_VWC_out,smart_Unchr_dom_Cys-rich	p.R500H	ENST00000454784.4	37	c.1499		12	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	14.71	2.615303	0.46631	.	.	ENSG00000205592	ENST00000425730	.	.	.	5.57	3.32	0.38043	.	.	.	.	.	T	0.53997	0.1831	L	0.41632	1.29	0.80722	D	1	.	.	.	.	.	.	T	0.48328	-0.9045	6	0.44086	T	0.13	.	8.4306	0.32755	0.2173:0.0:0.7827:0.0	.	.	.	.	H	500	.	ENSP00000395253:R500H	R	+	2	0	MUC19	39111726	1.000000	0.71417	0.981000	0.43875	0.950000	0.60333	1.060000	0.30530	0.464000	0.27142	0.460000	0.39030	CGT	MUC19	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000205592		0.333	MUC19-001	NOVEL	non_canonical_conserved|non_canonical_genome_sequence_error|basic|appris_principal	protein_coding	MUC19	HGNC	protein_coding	OTTHUMT00000384257.6	29	0.00	0	G	XM_003403524		40825459	40825459	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000425730	ensembl	human	novel	69_37n	missense	23	28.12	9	SNP	1.000	A
NBPF10	100132406	genome.wustl.edu	37	1	145323656	145323656	+	Missense_Mutation	SNP	A	A	T	rs75252120	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:145323656A>T	ENST00000342960.5	+	27	3528	c.3493A>T	c.(3493-3495)Att>Ttt	p.I1165F	NBPF10_ENST00000369339.3_Intron|NBPF10_ENST00000369338.1_Intron	NM_001039703.4	NP_001034792.4	Q6P3W6	NBPFA_HUMAN	neuroblastoma breakpoint family, member 10	752						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.I1165F(3)		NS(3)|breast(1)|central_nervous_system(3)|endometrium(12)|kidney(23)|lung(15)|ovary(1)|prostate(7)|skin(6)|urinary_tract(2)	73	all_hematologic(923;0.032)			Colorectal(1306;1.36e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00258)		TATTGCAGGAATTAAAAAGGA	0.473																																						dbGAP											3	Substitution - Missense(3)	endometrium(2)|kidney(1)																																								-	-	-	SO:0001583	missense	0			BC021111		1q21.1	2013-01-17			ENSG00000163386	ENSG00000271425		"""neuroblastoma breakpoint family"""	31992	protein-coding gene	gene with protein product		614000				16079250	Standard	NM_001039703		Approved	AG1		Q6P3W6	OTTHUMG00000013757	ENST00000342960.5:c.3493A>T	1.37:g.145323656A>T	ENSP00000345684:p.Ile1165Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5RHC0|Q9NWN6	Missense_Mutation	SNP	pfam_NBPF_dom	p.I1165F	ENST00000342960.5	37	c.3493	CCDS53355.1	1	.	.	.	.	.	.	.	.	.	.	.	7.524	0.657305	0.14580	.	.	ENSG00000163386	ENST00000342960	T	0.03441	3.93	.	.	.	.	.	.	.	.	T	0.02342	0.0072	M	0.67953	2.075	0.09310	N	1	.	.	.	.	.	.	T	0.44065	-0.9352	5	0.28530	T	0.3	.	.	.	.	.	.	.	.	F	1165	ENSP00000345684:I1165F	ENSP00000345684:I1165F	I	+	1	0	NBPF10	144035013	0.353000	0.24904	0.005000	0.12908	0.123000	0.20343	1.122000	0.31295	0.386000	0.24997	0.128000	0.15822	ATT	NBPF10	-	NULL	ENSG00000163386		0.473	NBPF10-201	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF10	HGNC	protein_coding		76	0.00	0	A	NM_001039703		145323656	145323656	+1	no_errors	ENST00000342960	ensembl	human	known	69_37n	missense	76	15.56	14	SNP	0.007	T
NCAN	1463	genome.wustl.edu	37	19	19359553	19359553	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr19:19359553G>A	ENST00000252575.6	+	14	3781	c.3682G>A	c.(3682-3684)Ggt>Agt	p.G1228S	NCAN_ENST00000538881.1_Missense_Mutation_p.G679S	NM_004386.2	NP_004377.2	O14594	NCAN_HUMAN	neurocan	1228	Sushi. {ECO:0000255|PROSITE- ProRule:PRU00302}.				axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|regulation of synapse structural plasticity (GO:0051823)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(32)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	64			Epithelial(12;0.00544)		Hyaluronan(DB08818)	CTCACTCATCGGTGCCCGCAA	0.552																																						dbGAP											0													108.0	76.0	87.0					19																	19359553		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF026547	CCDS12397.1	19p12	2014-01-30	2007-02-15	2007-02-15	ENSG00000130287	ENSG00000130287		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"", ""Endogenous ligands"""	2465	protein-coding gene	gene with protein product	"""neurocan proteoglycan"""	600826	"""chondroitin sulfate proteoglycan 3"""	CSPG3		1326557, 21353194	Standard	NM_004386		Approved		uc002nlz.3	O14594		ENST00000252575.6:c.3682G>A	19.37:g.19359553G>A	ENSP00000252575:p.Gly1228Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UPK6	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_Ig_V-set,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like_Ca-bd,smart_EGF-like,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like	p.G1228S	ENST00000252575.6	37	c.3682	CCDS12397.1	19	.	.	.	.	.	.	.	.	.	.	G	26.4	4.737167	0.89482	.	.	ENSG00000130287	ENST00000539499;ENST00000252575;ENST00000538881	T;T	0.62364	0.03;0.03	4.54	4.54	0.55810	Complement control module (2);Sushi/SCR/CCP (3);	0.462394	0.16124	N	0.228496	T	0.72803	0.3506	L	0.42487	1.325	0.49299	D	0.999777	D	0.89917	1.0	D	0.97110	1.0	T	0.73350	-0.4010	10	0.56958	D	0.05	.	14.8924	0.70620	0.0:0.0:1.0:0.0	.	1228	O14594	NCAN_HUMAN	S	1242;1228;679	ENSP00000252575:G1228S;ENSP00000442202:G679S	ENSP00000252575:G1228S	G	+	1	0	NCAN	19220553	1.000000	0.71417	0.293000	0.24932	0.890000	0.51754	7.747000	0.85070	2.372000	0.80975	0.536000	0.68110	GGT	NCAN	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000130287		0.552	NCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAN	HGNC	protein_coding	OTTHUMT00000460111.2	39	0.00	0	G	NM_004386		19359553	19359553	+1	no_errors	ENST00000252575	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.995	A
NGLY1	55768	genome.wustl.edu	37	3	25770771	25770771	+	Silent	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr3:25770771C>T	ENST00000280700.5	-	10	1624	c.1464G>A	c.(1462-1464)aaG>aaA	p.K488K	NGLY1_ENST00000396649.3_Silent_p.K488K|NGLY1_ENST00000428257.1_Silent_p.K470K|NGLY1_ENST00000467224.1_5'UTR|NGLY1_ENST00000422724.2_3'UTR|NGLY1_ENST00000417874.2_Silent_p.K446K	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	488	PAW. {ECO:0000255|PROSITE- ProRule:PRU00731}.				glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						GTTTAGAAATCTTCTCATTTT	0.313																																						dbGAP											0													58.0	52.0	54.0					3																	25770771		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.1464G>A	3.37:g.25770771C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Silent	SNP	pfam_PUB_domain,pfam_Transglutaminase-like,pfam_Rad4/PNGase_transGLS-fold,pfam_Peptide_N_glycanase_PAW_dom,superfamily_Galactose-bd-like,smart_PUG-dom,smart_Transglutaminase-like,smart_Peptide_N_glycanase_PAW_dom	p.K488	ENST00000280700.5	37	c.1464	CCDS33719.1	3																																																																																			NGLY1	-	superfamily_Galactose-bd-like,smart_Peptide_N_glycanase_PAW_dom	ENSG00000151092		0.313	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGLY1	HGNC	protein_coding	OTTHUMT00000340832.2	39	0.00	0	C			25770771	25770771	-1	no_errors	ENST00000280700	ensembl	human	known	69_37n	silent	29	14.71	5	SNP	0.994	T
NOX1	27035	genome.wustl.edu	37	X	100105271	100105271	+	Silent	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:100105271G>T	ENST00000372966.3	-	9	1207	c.1002C>A	c.(1000-1002)ctC>ctA	p.L334L	NOX1_ENST00000372960.4_Silent_p.L297L|NOX1_ENST00000372964.1_Intron|NOX1_ENST00000217885.5_Silent_p.L334L	NM_007052.4|NM_013955.2	NP_008983.2|NP_039249.1	Q9Y5S8	NOX1_HUMAN	NADPH oxidase 1	334	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				angiogenesis (GO:0001525)|cell migration (GO:0016477)|cellular response to hyperoxia (GO:0071455)|cellular stress response to acidic pH (GO:1990451)|extracellular matrix organization (GO:0030198)|hydrogen peroxide metabolic process (GO:0042743)|inflammatory response (GO:0006954)|intracellular pH elevation (GO:0051454)|NADP metabolic process (GO:0006739)|oxidation-reduction process (GO:0055114)|oxygen metabolic process (GO:0072592)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of JNK cascade (GO:0046330)|positive regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902177)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation vascular endothelial growth factor production (GO:0010575)|proton transport (GO:0015992)|regulation of blood pressure (GO:0008217)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|respiratory burst (GO:0045730)|signal transduction (GO:0007165)|superoxide anion generation (GO:0042554)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|early endosome (GO:0005769)|integral component of membrane (GO:0016021)|invadopodium membrane (GO:0071438)|NADPH oxidase complex (GO:0043020)	metal ion binding (GO:0046872)|NADP binding (GO:0050661)|Rac GTPase binding (GO:0048365)|superoxide-generating NADPH oxidase activity (GO:0016175)|voltage-gated proton channel activity (GO:0030171)			cervix(1)|lung(3)|ovary(1)|skin(2)	7						GCCATTCCAGGAGAGAGATTG	0.458																																						dbGAP											0													61.0	56.0	58.0					X																	100105271		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF127763	CCDS14474.1, CCDS14475.1, CCDS65298.1	Xq22	2008-08-01			ENSG00000007952	ENSG00000007952			7889	protein-coding gene	gene with protein product	"""mitogenic oxidase (pyridine nucleotide-dependent superoxide-generating)"", ""NADPH oxidase homolog-1"", ""NADPH oxidase 1 variant NOH-1L"""	300225				10485709, 10615049	Standard	NM_007052		Approved	NOH1, NOH-1, MOX1, GP91-2	uc004egj.3	Q9Y5S8	OTTHUMG00000022007	ENST00000372966.3:c.1002C>A	X.37:g.100105271G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K836|O95691|Q2PP02	Missense_Mutation	SNP	pfam_FAD-bd_8,pfam_Fe_red_NAD-bd_6,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.P19T	ENST00000372966.3	37	c.55	CCDS14474.1	X	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.640715	0.00799	.	.	ENSG00000007952	ENST00000427768	.	.	.	3.54	2.67	0.31697	.	.	.	.	.	T	0.54854	0.1884	.	.	.	0.41730	D	0.989551	.	.	.	.	.	.	T	0.48525	-0.9028	4	.	.	.	4.0151	6.6006	0.22699	0.1148:0.1957:0.6894:0.0	.	.	.	.	T	19	.	.	P	-	1	0	NOX1	99991927	0.088000	0.21588	0.160000	0.22671	0.040000	0.13550	0.350000	0.20079	0.663000	0.31027	-0.444000	0.05651	CCT	NOX1	-	pfam_FAD-bd_8,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl	ENSG00000007952		0.458	NOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX1	HGNC	protein_coding	OTTHUMT00000057495.1	44	0.00	0	G	NM_007052		100105271	100105271	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000427768	ensembl	human	known	69_37n	missense	15	66.67	30	SNP	0.610	T
ODF2	4957	genome.wustl.edu	37	9	131260563	131260563	+	Intron	SNP	T	T	C	rs10819391	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr9:131260563T>C	ENST00000434106.3	+	19	2375				ODF2_ENST00000372807.5_Intron|ODF2_ENST00000604420.1_Intron|ODF2_ENST00000444119.2_Intron|ODF2_ENST00000351030.3_Intron|ODF2_ENST00000393527.3_Intron	NM_153433.1	NP_702911.1	Q5BJF6	ODFP2_HUMAN	outer dense fiber of sperm tails 2						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|regulation of cilium assembly (GO:1902017)|spermatid development (GO:0007286)	centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)|primary cilium (GO:0072372)	Rab GTPase binding (GO:0017137)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(7)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(8)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	37						CTTTGGCTTATTCCTGTGGCT	0.552													T|||	2810	0.561102	0.3079	0.7205	5008	,	,		21390	0.5218		0.7416	False		,,,				2504	0.6452					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF012549	CCDS6902.1, CCDS56585.1, CCDS56586.1, CCDS56587.1, CCDS56588.1, CCDS56589.1, CCDS56590.1	9q34	2010-04-23	2002-10-21		ENSG00000136811	ENSG00000136811			8114	protein-coding gene	gene with protein product	"""cancer/testis antigen 134"""	602015	"""outer dense fibre of sperm tails 2"""			9045620, 10072582	Standard	NM_153435		Approved	ODF84, CT134	uc004bvc.3	Q5BJF6	OTTHUMG00000020748	ENST00000434106.3:c.2013-129T>C	9.37:g.131260563T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AND3|B4DRK4|B4DX73|B4DZ02|E7EWL2|F5H6J4|O14721|O60631|Q1W2J6|Q6UN26|Q7Z5I6|Q96FN2	RNA	SNP	-	NULL	ENST00000434106.3	37	NULL	CCDS56588.1	9																																																																																			ODF2	-	-	ENSG00000136811		0.552	ODF2-011	KNOWN	basic|CCDS	protein_coding	ODF2	HGNC	protein_coding	OTTHUMT00000054449.3	22	0.00	0	T			131260563	131260563	+1	no_errors	ENST00000488909	ensembl	human	known	69_37n	rna	13	18.75	3	SNP	0.555	C
OR2J1	442185	genome.wustl.edu	37	6	29069016	29069016	+	Silent	SNP	G	G	A	rs3131088	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr6:29069016G>A	ENST00000377171.3	+	1	631	c.297G>A	c.(295-297)acG>acA	p.T99T				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	99						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						CTGGTTGTACGGTTCAACTTT	0.488													G|||	1687	0.336861	0.0454	0.4323	5008	,	,		20306	0.3512		0.5815	False		,,,				2504	0.3967					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.297G>A	6.37:g.29069016G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2AAS1|B0V1T2|Q9GZK1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T99	ENST00000377171.3	37	c.297		6																																																																																			OR2J1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000204702		0.488	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	107	0.00	0	G	NG_004683		29069016	29069016	+1	no_errors	ENST00000377171	ensembl	human	known	69_37n	silent	61	10.29	7	SNP	0.016	A
OR2J1	442185	genome.wustl.edu	37	6	29069299	29069299	+	Nonsense_Mutation	SNP	C	C	T	rs2394517	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr6:29069299C>T	ENST00000377171.3	+	1	914	c.580C>T	c.(580-582)Cag>Tag	p.Q194*				Q9GZK6	OR2J1_HUMAN	olfactory receptor, family 2, subfamily J, member 1 (gene/pseudogene)	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|lung(6)	7						TGTTGATACCCAGGCAAATGA	0.473													C|||	1688	0.337061	0.0461	0.4323	5008	,	,		21451	0.3512		0.5815	False		,,,				2504	0.3967					dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0					6p22.2-p21.31	2012-08-09	2011-08-30	2004-05-28	ENSG00000204702	ENSG00000204702		"""GPCR / Class A : Olfactory receptors"""	8259	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily J, member 1 pseudogene"", ""olfactory receptor, family 2, subfamily J, member 1"""	OR2J1P			Standard	NG_004683		Approved	OR6-5, hs6M1-4, dJ80I19.2		Q9GZK6	OTTHUMG00000031280	ENST00000377171.3:c.580C>T	6.37:g.29069299C>T	ENSP00000366376:p.Gln194*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2AAS1|B0V1T2|Q9GZK1	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q194*	ENST00000377171.3	37	c.580		6	843	0.385989010989011	25	0.0508130081300813	157	0.43370165745856354	197	0.34440559440559443	464	0.6121372031662269	C	25.3	4.625129	0.87560	.	.	ENSG00000204702	ENST00000377171	.	.	.	2.55	0.285	0.15705	.	.	.	.	.	.	.	.	.	.	.	0.09310	P	0.999999999628524	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	1.2514	0.01983	0.1841:0.4211:0.1818:0.213	rs2394517;rs7748793;rs52793851;rs2394517	.	.	.	X	194	.	ENSP00000366376:Q194X	Q	+	1	0	OR2J1	29177278	0.000000	0.05858	0.013000	0.15412	0.857000	0.48899	-2.230000	0.01207	0.357000	0.24183	0.591000	0.81541	CAG	OR2J1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000204702		0.473	OR2J1-001	KNOWN	basic|appris_principal	protein_coding	OR2J1	HGNC	protein_coding	OTTHUMT00000076612.2	115	0.00	0	C	NG_004683		29069299	29069299	+1	no_errors	ENST00000377171	ensembl	human	known	69_37n	nonsense	85	10.42	10	SNP	0.000	T
OR3A4P	390756	genome.wustl.edu	37	17	3214016	3214016	+	RNA	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:3214016C>T	ENST00000573491.1	-	0	359																											CTACAGCAGCCGCATGAGCTG	0.552																																						dbGAP											0													82.0	87.0	85.0					17																	3214016		2203	4300	6503	-	-	-			0																															17.37:g.3214016C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000573491.1	37	NULL		17																																																																																			OR3A4P	-	-	ENSG00000180068		0.552	RP11-64J4.2-001	KNOWN	basic	sense_overlapping	OR3A4P	HGNC	sense_overlapping	OTTHUMT00000438371.1	82	0.00	0	C			3214016	3214016	+1	no_errors	ENST00000323164	ensembl	human	known	69_37n	rna	15	64.29	27	SNP	0.000	T
OR5L2	26338	genome.wustl.edu	37	11	55594726	55594726	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:55594726A>G	ENST00000378397.1	+	1	32	c.32A>G	c.(31-33)gAg>gGg	p.E11G		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E11V(1)		breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				ACTGTGGCTGAGTTCATTCTC	0.428										HNSCC(27;0.073)																												dbGAP											1	Substitution - Missense(1)	lung(1)											206.0	194.0	198.0					11																	55594726		2200	4294	6494	-	-	-	SO:0001583	missense	0			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.32A>G	11.37:g.55594726A>G	ENSP00000367650:p.Glu11Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF66|Q96RB2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.E11G	ENST00000378397.1	37	c.32	CCDS31511.1	11	.	.	.	.	.	.	.	.	.	.	.	13.55	2.271099	0.40194	.	.	ENSG00000205030	ENST00000378397	T	0.01126	5.3	5.31	5.31	0.75309	.	0.273172	0.25912	N	0.027485	T	0.01800	0.0057	L	0.49126	1.545	0.09310	N	1	P	0.45594	0.862	B	0.41440	0.357	T	0.48055	-0.9068	10	0.72032	D	0.01	-9.1107	10.6794	0.45804	0.8398:0.1602:0.0:0.0	.	11	Q8NGL0	OR5L2_HUMAN	G	11	ENSP00000367650:E11G	ENSP00000367650:E11G	E	+	2	0	OR5L2	55351302	0.007000	0.16637	0.799000	0.32177	0.520000	0.34377	1.998000	0.40796	2.173000	0.68751	0.509000	0.49947	GAG	OR5L2	-	NULL	ENSG00000205030		0.428	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	63	0.00	0	A	NM_001004739		55594726	55594726	+1	no_errors	ENST00000378397	ensembl	human	known	69_37n	missense	56	11.11	7	SNP	0.020	G
OR6X1	390260	genome.wustl.edu	37	11	123624976	123624976	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:123624976A>C	ENST00000327930.2	-	1	277	c.251T>G	c.(250-252)gTa>gGa	p.V84G		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TCTTGCCACTACAAAGGTTCC	0.473																																						dbGAP											0													150.0	145.0	147.0					11																	123624976		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.251T>G	11.37:g.123624976A>C	ENSP00000333724:p.Val84Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGW9|Q6IFA0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V84G	ENST00000327930.2	37	c.251	CCDS31695.1	11	.	.	.	.	.	.	.	.	.	.	A	13.54	2.267741	0.40095	.	.	ENSG00000221931	ENST00000327930	T	0.00976	5.48	4.19	4.19	0.49359	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.01695	0.0054	L	0.50333	1.59	0.52099	D	0.999942	D	0.53885	0.963	P	0.46796	0.527	T	0.69476	-0.5135	9	0.45353	T	0.12	-3.5562	11.2403	0.48966	1.0:0.0:0.0:0.0	.	84	Q8NH79	OR6X1_HUMAN	G	84	ENSP00000333724:V84G	ENSP00000333724:V84G	V	-	2	0	OR6X1	123130186	0.004000	0.15560	0.489000	0.27452	0.927000	0.56198	2.256000	0.43231	1.771000	0.52183	0.528000	0.53228	GTA	OR6X1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221931		0.473	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6X1	HGNC	protein_coding	OTTHUMT00000387436.1	70	0.00	0	A	NM_001005188		123624976	123624976	-1	no_errors	ENST00000327930	ensembl	human	known	69_37n	missense	56	12.50	8	SNP	0.905	C
PAM	5066	genome.wustl.edu	37	5	102355495	102355495	+	Splice_Site	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr5:102355495A>C	ENST00000438793.3	+	22	2903	c.2433A>C	c.(2431-2433)aaA>aaC	p.K811N	PAM_ENST00000455264.2_Splice_Site_p.K811N|PAM_ENST00000346918.2_Splice_Site_p.K811N|PAM_ENST00000304400.7_Splice_Site_p.K811N|PAM_ENST00000274392.9_Splice_Site_p.K714N|PAM_ENST00000348126.2_Splice_Site_p.K704N|PAM_ENST00000379787.4_Splice_Site_p.K191N	NM_000919.3|NM_001177306.1|NM_138766.2	NP_000910.2|NP_001170777.1|NP_620121.1	P19021	AMD_HUMAN	peptidylglycine alpha-amidating monooxygenase	811	Peptidyl-alpha-hydroxyglycine alpha- amidating lyase. {ECO:0000250}.				central nervous system development (GO:0007417)|heart development (GO:0007507)|lactation (GO:0007595)|limb development (GO:0060173)|long-chain fatty acid metabolic process (GO:0001676)|maternal process involved in female pregnancy (GO:0060135)|odontogenesis (GO:0042476)|ovulation cycle process (GO:0022602)|peptide amidation (GO:0001519)|protein amidation (GO:0018032)|protein homooligomerization (GO:0051260)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of protein secretion (GO:0050708)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to copper ion (GO:0046688)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to pH (GO:0009268)|toxin metabolic process (GO:0009404)	cell surface (GO:0009986)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|secretory granule membrane (GO:0030667)|trans-Golgi network (GO:0005802)	calcium ion binding (GO:0005509)|copper ion binding (GO:0005507)|L-ascorbic acid binding (GO:0031418)|peptidylamidoglycolate lyase activity (GO:0004598)|peptidylglycine monooxygenase activity (GO:0004504)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	25		all_cancers(142;3.12e-07)|all_epithelial(76;3.48e-10)|Prostate(80;0.00914)|Lung NSC(167;0.0213)|Ovarian(225;0.024)|Colorectal(57;0.0251)|all_lung(232;0.0284)		Epithelial(69;1.1e-13)|COAD - Colon adenocarcinoma(37;0.0127)	Vitamin C(DB00126)	TTGTTACAGAATTGGAACATC	0.333																																						dbGAP											0													104.0	107.0	106.0					5																	102355495		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB095007	CCDS4092.1, CCDS4093.1, CCDS4094.1, CCDS43348.1, CCDS54885.1	5q	2008-02-05			ENSG00000145730	ENSG00000145730	1.14.17.3		8596	protein-coding gene	gene with protein product	"""peptidyl-alpha-hydroxyglycine alpha-amidating lyase"", ""peptidylglycine alpha-hydroxylating monooxygenase"""	170270				2357221	Standard	NM_000919		Approved	PAL, PHM	uc003knt.3	P19021	OTTHUMG00000128729	ENST00000438793.3:c.2432-1A>C	5.37:g.102355495A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMR0|A8K293|O43211|O95080|Q16252|Q16253|Q54A45|Q86U53|Q8WVC7|Q9UCG0	Missense_Mutation	SNP	pfam_NHL_repeat,pfam_Cu2_ascorb_mOase_N,superfamily_PHM/PNGase_F_dom,pfscan_NHL_repeat_subgr,prints_Pep_amidat_mOase	p.K811N	ENST00000438793.3	37	c.2433	CCDS54885.1	5	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	12.50|12.50|12.50	1.957391|1.957391|1.957391	0.34565|0.34565|0.34565	.|.|.	.|.|.	ENSG00000145730|ENSG00000145730|ENSG00000145730	ENST00000379799|ENST00000438793;ENST00000346918;ENST00000348126;ENST00000379787;ENST00000304400;ENST00000274392;ENST00000455264|ENST00000504691	.|T;T;T;T;T;T;T|.	.|0.61980|.	.|0.94;0.8;0.78;0.37;0.94;0.06;0.75|.	6.17|6.17|6.17	5.01|5.01|5.01	0.66863|0.66863|0.66863	.|Six-bladed beta-propeller, TolB-like (1);|.	.|0.680076|.	.|0.16399|.	.|N|.	.|0.216109|.	T|T|T	0.42539|0.42539|0.42539	0.1207|0.1207|0.1207	L|L|L	0.27053|0.27053|0.27053	0.805|0.805|0.805	0.39659|0.39659|0.39659	D|D|D	0.970588|0.970588|0.970588	.|B;B;B;B;B;B;B|.	.|0.13594|.	.|0.004;0.005;0.002;0.008;0.002;0.002;0.002|.	.|B;B;B;B;B;B;B|.	.|0.15870|.	.|0.006;0.005;0.002;0.011;0.014;0.006;0.003|.	T|T|T	0.35226|0.35226|0.35226	-0.9797|-0.9797|-0.9797	5|10|5	.|0.23302|.	.|T|.	.|0.38|.	.|.|.	6.8213|6.8213|6.8213	0.23859|0.23859|0.23859	0.7434:0.1276:0.129:0.0|0.7434:0.1276:0.129:0.0|0.7434:0.1276:0.129:0.0	.|.|.	.|714;191;811;811;811;811;704|.	.|F8WE90;A6NMH0;P19021;P19021-4;P19021-3;P19021-5;P19021-2|.	.|.;.;AMD_HUMAN;.;.;.;.|.	L|N|T	584|811;811;704;191;811;714;811|106	.|ENSP00000396493:K811N;ENSP00000282992:K811N;ENSP00000314638:K704N;ENSP00000369113:K191N;ENSP00000306100:K811N;ENSP00000274392:K714N;ENSP00000403461:K811N|.	.|ENSP00000274392:K714N|.	I|K|N	+|+|+	1|3|2	0|2|0	PAM|PAM|PAM	102383394|102383394|102383394	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.569000|0.569000|0.569000	0.35902|0.35902|0.35902	2.865000|2.865000|2.865000	0.48412|0.48412|0.48412	2.371000|2.371000|2.371000	0.80710|0.80710|0.80710	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	ATT|AAA|AAT	PAM	-	NULL	ENSG00000145730		0.333	PAM-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PAM	HGNC	protein_coding	OTTHUMT00000250640.2	31	0.00	0	A	NM_000919	Missense_Mutation	102355495	102355495	+1	no_errors	ENST00000304400	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.999	C
PAOX	196743	genome.wustl.edu	37	10	135193582	135193582	+	Silent	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr10:135193582C>T	ENST00000278060.5	+	2	344	c.261C>T	c.(259-261)taC>taT	p.Y87Y	PAOX_ENST00000480071.2_Silent_p.Y87Y|PAOX_ENST00000368535.2_3'UTR|PAOX_ENST00000368539.4_Intron|PAOX_ENST00000357296.3_Silent_p.Y87Y|AL360181.1_ENST00000597657.1_5'Flank	NM_152911.2	NP_690875.1	Q6QHF9	PAOX_HUMAN	polyamine oxidase (exo-N4-amino)	225					cellular nitrogen compound metabolic process (GO:0034641)|oxidation-reduction process (GO:0055114)|polyamine biosynthetic process (GO:0006596)|polyamine catabolic process (GO:0006598)|polyamine metabolic process (GO:0006595)|positive regulation of spermidine biosynthetic process (GO:1901307)|putrescine biosynthetic process (GO:0009446)|putrescine catabolic process (GO:0009447)|small molecule metabolic process (GO:0044281)|spermidine catabolic process (GO:0046203)|spermine catabolic process (GO:0046208)|xenobiotic metabolic process (GO:0006805)	peroxisomal matrix (GO:0005782)	N(1),N(12)-diacetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052899)|N1-acetylspermidine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052904)|N1-acetylspermine:oxygen oxidoreductase (3-acetamidopropanal-forming) activity (GO:0052903)|polyamine oxidase activity (GO:0046592)|receptor binding (GO:0005102)|spermidine:oxygen oxidoreductase (3-aminopropanal-forming) activity (GO:0052902)|spermine:oxygen oxidoreductase (spermidine-forming) activity (GO:0052901)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|urinary_tract(2)	23		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		all cancers(32;4.39e-07)|OV - Ovarian serous cystadenocarcinoma(35;1.21e-06)|Epithelial(32;1.94e-06)		CTGCTGAGTACGGGCTGCTGG	0.697																																						dbGAP											0													30.0	34.0	33.0					10																	135193582		2193	4299	6492	-	-	-	SO:0001819	synonymous_variant	0			BC032778	CCDS7682.1, CCDS7683.1, CCDS7684.1	10q26.3	2003-11-13			ENSG00000148832	ENSG00000148832			20837	protein-coding gene	gene with protein product		615853				12660232	Standard	NM_207127		Approved	PAO	uc001lmv.3	Q6QHF9	OTTHUMG00000019318	ENST00000278060.5:c.261C>T	10.37:g.135193582C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXI6|Q5VWY0|Q6QHF5|Q6QHF6|Q6QHF7|Q6QHF8|Q6QHG0|Q6QHG1|Q6QHG2|Q6QHG3|Q6QHG4|Q6QHG5|Q6QHG6|Q86WP9|Q8N555|Q8NCX3	Silent	SNP	pfam_Amino_oxidase	p.Y87	ENST00000278060.5	37	c.261	CCDS7683.1	10																																																																																			PAOX	-	pfam_Amino_oxidase	ENSG00000148832		0.697	PAOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAOX	HGNC	protein_coding	OTTHUMT00000051146.2	151	0.00	0	C	NM_152911		135193582	135193582	+1	no_errors	ENST00000278060	ensembl	human	known	69_37n	silent	33	47.62	30	SNP	0.804	T
PAPPA	5069	genome.wustl.edu	37	9	119097240	119097240	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr9:119097240C>A	ENST00000328252.3	+	13	3867	c.3498C>A	c.(3496-3498)ttC>ttA	p.F1166L	PAPPA_ENST00000534838.1_Missense_Mutation_p.F204L	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	1166					cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						GTGTGAGCTTCAGTTCGCCCC	0.617																																						dbGAP											0													116.0	95.0	102.0					9																	119097240		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.3498C>A	9.37:g.119097240C>A	ENSP00000330658:p.Phe1166Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF9|Q08371|Q68G52|Q9UDK7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.F1166L	ENST00000328252.3	37	c.3498	CCDS6813.1	9	.	.	.	.	.	.	.	.	.	.	C	17.13	3.311161	0.60414	.	.	ENSG00000182752	ENST00000328252;ENST00000534838	T;T	0.04360	4.45;3.64	5.86	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.18383	0.0441	M	0.76002	2.32	0.53688	D	0.999976	D;D	0.71674	0.998;0.998	D;D	0.76071	0.987;0.98	T	0.00014	-1.2404	10	0.72032	D	0.01	-25.2759	9.9503	0.41634	0.0:0.8001:0.0:0.1999	.	204;1166	F5GZ19;Q13219	.;PAPP1_HUMAN	L	1166;204	ENSP00000330658:F1166L;ENSP00000441461:F204L	ENSP00000330658:F1166L	F	+	3	2	PAPPA	118137061	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.257000	0.43240	2.775000	0.95449	0.655000	0.94253	TTC	PAPPA	-	NULL	ENSG00000182752		0.617	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	21	0.00	0	C	NM_002581		119097240	119097240	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	1.000	A
PHC2	1912	genome.wustl.edu	37	1	33837947	33837947	+	Silent	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:33837947C>T	ENST00000257118.5	-	2	329	c.276G>A	c.(274-276)gcG>gcA	p.A92A	PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000431992.1_Silent_p.A92A|PHC2_ENST00000419414.2_Silent_p.A92A	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	92	Gln-rich.				multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				GCTGCTGGAGCGCCGCGGTCT	0.662																																						dbGAP											0													35.0	35.0	35.0					1																	33837947		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.276G>A	1.37:g.33837947C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.A92	ENST00000257118.5	37	c.276	CCDS378.1	1																																																																																			PHC2	-	NULL	ENSG00000134686		0.662	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1	49	0.00	0	C	NM_198040		33837947	33837947	-1	no_errors	ENST00000419414	ensembl	human	known	69_37n	silent	44	22.81	13	SNP	0.134	T
PHLPP2	23035	genome.wustl.edu	37	16	71715711	71715711	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr16:71715711T>C	ENST00000568954.1	-	6	1211	c.833A>G	c.(832-834)aAc>aGc	p.N278S	PHLPP2_ENST00000393524.2_Missense_Mutation_p.N278S|PHLPP2_ENST00000567016.1_Missense_Mutation_p.N313S|PHLPP2_ENST00000356272.3_Missense_Mutation_p.N278S|PHLPP2_ENST00000360429.3_Missense_Mutation_p.N278S			Q6ZVD8	PHLP2_HUMAN	PH domain and leucine rich repeat protein phosphatase 2	278					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment membrane (GO:0042622)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37						GTGTCGCAAGTTGAGGTAGGT	0.478																																						dbGAP											0													138.0	129.0	132.0					16																	71715711		2198	4300	6498	-	-	-	SO:0001583	missense	0			BX647823	CCDS32479.1, CCDS73910.1	16q22.2	2013-01-11	2009-05-26	2009-05-26	ENSG00000040199	ENSG00000040199		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"", ""Pleckstrin homology (PH) domain containing"""	29149	protein-coding gene	gene with protein product		611066	"""PH domain and leucine rich repeat protein phosphatase-like"""	PHLPPL		17386267	Standard	NM_001289003		Approved	KIAA0931	uc002fax.3	Q6ZVD8		ENST00000568954.1:c.833A>G	16.37:g.71715711T>C	ENSP00000457991:p.Asn278Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L374|Q9NV17|Q9Y2E3	Missense_Mutation	SNP	pfam_PP2C-like,pfam_Leu-rich_rpt,superfamily_PP2C-like,smart_Leu-rich_rpt_typical-subtyp,smart_PP2C-like	p.N278S	ENST00000568954.1	37	c.833	CCDS32479.1	16	.	.	.	.	.	.	.	.	.	.	T	31	5.084356	0.94100	.	.	ENSG00000040199	ENST00000299971;ENST00000360429;ENST00000356272;ENST00000393524;ENST00000538126	T;T;T	0.24151	1.87;2.26;1.87	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.48607	0.1509	M	0.66560	2.04	0.58432	D	0.999999	D;D	0.76494	0.999;0.997	D;D	0.81914	0.995;0.985	T	0.35301	-0.9794	10	0.31617	T	0.26	-22.5291	15.4767	0.75485	0.0:0.0:0.0:1.0	.	278;278	Q6ZVD8-3;Q6ZVD8	.;PHLP2_HUMAN	S	85;278;278;278;278	ENSP00000353610:N278S;ENSP00000348611:N278S;ENSP00000377159:N278S	ENSP00000299971:N85S	N	-	2	0	PHLPP2	70273212	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.948000	0.87774	2.304000	0.77564	0.528000	0.53228	AAC	PHLPP2	-	NULL	ENSG00000040199		0.478	PHLPP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHLPP2	HGNC	protein_coding	OTTHUMT00000434139.1	46	0.00	0	T	NM_015020		71715711	71715711	-1	no_errors	ENST00000356272	ensembl	human	known	69_37n	missense	10	52.38	11	SNP	1.000	C
PIEZO1	9780	genome.wustl.edu	37	16	88798229	88798229	+	Silent	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr16:88798229G>A	ENST00000301015.9	-	22	3327	c.3081C>T	c.(3079-3081)acC>acT	p.T1027T	RP5-1142A6.2_ENST00000440406.2_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1027					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						GGTGCCTGCGGGTGAGGATGG	0.647																																						dbGAP											0													18.0	28.0	25.0					16																	88798229		689	1578	2267	-	-	-	SO:0001819	synonymous_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.3081C>T	16.37:g.88798229G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_DUF3595	p.P543L	ENST00000301015.9	37	c.1628	CCDS54058.1	16	.	.	.	.	.	.	.	.	.	.	g	8.857	0.945928	0.18356	.	.	ENSG00000103335	ENST00000451779	.	.	.	4.27	-2.08	0.07254	.	.	.	.	.	T	0.42743	0.1216	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32161	-0.9917	4	.	.	.	-35.2032	3.8913	0.09120	0.324:0.0:0.2991:0.3769	.	.	.	.	S	973	.	.	P	-	1	0	FAM38A	87325730	0.000000	0.05858	0.996000	0.52242	0.681000	0.39784	-2.077000	0.01371	-0.173000	0.10761	0.305000	0.20034	CCG	PIEZO1	-	NULL	ENSG00000103335		0.647	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	57	0.00	0	G	NM_014745		88798229	88798229	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451779	ensembl	human	putative	69_37n	missense	36	30.77	16	SNP	0.979	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	26	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	10	77.27	34	SNP	1.000	G
PKNOX2	63876	genome.wustl.edu	37	11	125255462	125255462	+	Silent	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:125255462G>A	ENST00000298282.9	+	6	514	c.243G>A	c.(241-243)ccG>ccA	p.P81P	PKNOX2_ENST00000530517.1_3'UTR|PKNOX2_ENST00000542175.1_Silent_p.P17P	NM_022062.2	NP_071345.2	Q96KN3	PKNX2_HUMAN	PBX/knotted 1 homeobox 2	81					regulation of transcription from RNA polymerase II promoter (GO:0006357)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(14)|ovary(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	29		Breast(109;0.00234)|all_lung(97;0.0191)|Lung NSC(97;0.0196)|Medulloblastoma(222;0.0447)|all_neural(223;0.116)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.117)		CTCTTTTCCCGCTCCTGACGC	0.582																																						dbGAP											0													120.0	122.0	121.0					11																	125255462		2099	4241	6340	-	-	-	SO:0001819	synonymous_variant	0			AK023136	CCDS41730.1	11q24.2	2014-09-04			ENSG00000165495	ENSG00000165495		"""Homeoboxes / TALE class"""	16714	protein-coding gene	gene with protein product		613066				11549286	Standard	NM_022062		Approved		uc001qbu.3	Q96KN3	OTTHUMG00000165884	ENST00000298282.9:c.243G>A	11.37:g.125255462G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5I5|F5GZ15|Q63HL6|Q86XD1	Missense_Mutation	SNP	NULL	p.A35T	ENST00000298282.9	37	c.103	CCDS41730.1	11																																																																																			PKNOX2	-	NULL	ENSG00000165495		0.582	PKNOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKNOX2	HGNC	protein_coding	OTTHUMT00000386866.3	38	0.00	0	G			125255462	125255462	+1	no_errors	ENST00000532623	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	0.997	A
PLCB1	23236	genome.wustl.edu	37	20	8678316	8678316	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr20:8678316A>T	ENST00000338037.6	+	11	1080	c.1053A>T	c.(1051-1053)caA>caT	p.Q351H	PLCB1_ENST00000378637.2_Missense_Mutation_p.Q351H|PLCB1_ENST00000378641.3_Missense_Mutation_p.Q351H	NM_015192.2	NP_056007.1	Q9NQ66	PLCB1_HUMAN	phospholipase C, beta 1 (phosphoinositide-specific)	351	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of meiosis involved in egg activation (GO:0060466)|cerebral cortex development (GO:0021987)|fat cell differentiation (GO:0045444)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G2/M transition of mitotic cell cycle (GO:0000086)|glutamate receptor signaling pathway (GO:0007215)|inositol phosphate metabolic process (GO:0043647)|insulin-like growth factor receptor signaling pathway (GO:0048009)|interleukin-1-mediated signaling pathway (GO:0070498)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-15-mediated signaling pathway (GO:0035723)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|memory (GO:0007613)|negative regulation of monocyte extravasation (GO:2000438)|negative regulation of transcription, DNA-templated (GO:0045892)|phosphatidylinositol metabolic process (GO:0046488)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of CD24 biosynthetic process (GO:2000560)|positive regulation of developmental growth (GO:0048639)|positive regulation of embryonic development (GO:0040019)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of GTPase activity (GO:0043547)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fertilization (GO:0080154)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein homodimerization activity (GO:0042803)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(11)|liver(2)|lung(41)|ovary(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	95						TGTATCGCCAAGTGCTCCTGT	0.522																																						dbGAP											0													239.0	208.0	219.0					20																	8678316		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011153	CCDS13102.1, CCDS13103.1	20p12	2008-03-18			ENSG00000182621	ENSG00000182621	3.1.4.11		15917	protein-coding gene	gene with protein product		607120				10760467, 11118617	Standard	NM_015192		Approved	KIAA0581, PLC-I, PLC154	uc002wnb.4	Q9NQ66	OTTHUMG00000031849	ENST00000338037.6:c.1053A>T	20.37:g.8678316A>T	ENSP00000338185:p.Gln351His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW12|D3DW13|O60325|Q17RQ6|Q5TFF7|Q5TGC9|Q8IV93|Q9BQW2|Q9H4H2|Q9H8H5|Q9NQ65|Q9NQH9|Q9NTH4|Q9UJP6|Q9UM26	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLC-beta_C,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.Q351H	ENST00000338037.6	37	c.1053	CCDS13102.1	20	.	.	.	.	.	.	.	.	.	.	A	22.5	4.296192	0.81025	.	.	ENSG00000182621	ENST00000378641;ENST00000338037;ENST00000378637;ENST00000441163;ENST00000535719	T;T;T	0.65549	-0.16;-0.16;-0.16	5.65	3.37	0.38596	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.054132	0.85682	D	0.000000	T	0.76407	0.3983	M	0.78916	2.43	0.50039	D	0.999849	P;D	0.89917	0.872;1.0	P;D	0.91635	0.808;0.999	T	0.77656	-0.2506	10	0.87932	D	0	.	9.6706	0.40011	0.7904:0.0:0.2096:0.0	.	351;351	Q9NQ66;Q9NQ66-2	PLCB1_HUMAN;.	H	351;351;351;271;271	ENSP00000367908:Q351H;ENSP00000338185:Q351H;ENSP00000367904:Q351H	ENSP00000338185:Q351H	Q	+	3	2	PLCB1	8626316	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.732000	0.55021	0.984000	0.38629	0.533000	0.62120	CAA	PLCB1	-	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000182621		0.522	PLCB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCB1	HGNC	protein_coding	OTTHUMT00000077938.3	71	0.00	0	A			8678316	8678316	+1	no_errors	ENST00000338037	ensembl	human	known	69_37n	missense	60	23.08	18	SNP	1.000	T
PLCB4	5332	genome.wustl.edu	37	20	9460235	9460235	+	3'UTR	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr20:9460235A>C	ENST00000378493.1	+	0	4142				PLCB4_ENST00000278655.4_3'UTR|PLCB4_ENST00000334005.3_3'UTR|PLCB4_ENST00000378473.3_3'UTR|PLCB4_ENST00000378501.2_3'UTR|PLCB4_ENST00000492632.1_3'UTR			Q15147	PLCB4_HUMAN	phospholipase C, beta 4						inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)|smooth endoplasmic reticulum (GO:0005790)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(2)|breast(4)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(11)|liver(4)|lung(34)|ovary(3)|pancreas(1)|prostate(1)|skin(19)|upper_aerodigestive_tract(1)	87						ACAATAGAAAAATAGAGCAGT	0.358																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS13104.1, CCDS13105.1, CCDS54447.1	20p12	2008-03-18			ENSG00000101333	ENSG00000101333	3.1.4.11		9059	protein-coding gene	gene with protein product		600810				8530101	Standard	NM_000933		Approved		uc021wam.1	Q15147	OTTHUMG00000031853	ENST00000378493.1:c.*599A>C	20.37:g.9460235A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLK6|E2QRH8|Q17R56|Q5JYS8|Q5JYS9|Q5JYT0|Q5JYT3|Q5JYT4|Q9BQW5|Q9BQW6|Q9BQW8|Q9UJQ2	RNA	SNP	-	NULL	ENST00000378493.1	37	NULL	CCDS13105.1	20																																																																																			PLCB4	-	-	ENSG00000101333		0.358	PLCB4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCB4	HGNC	protein_coding	OTTHUMT00000077948.2	56	0.00	0	A			9460235	9460235	+1	no_errors	ENST00000464199	ensembl	human	known	69_37n	rna	46	25.81	16	SNP	0.009	C
PLEKHM1P	440456	genome.wustl.edu	37	17	62811354	62811354	+	RNA	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:62811354C>T	ENST00000582986.1	-	0	614				RN7SL409P_ENST00000579918.1_RNA	NR_024386.1		Q69YJ1	PKHMP_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1 pseudogene						intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)										TGCTGAATTCCAACAATACCA	0.498																																						dbGAP											0																																										-	-	-			0					17q24.1	2012-10-03			ENSG00000214176	ENSG00000214176			35411	pseudogene	pseudogene							Standard	NR_024386		Approved	LOC440456	uc002jew.4	Q69YJ1	OTTHUMG00000179296		17.37:g.62811354C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000582986.1	37	NULL		17																																																																																			PLEKHM1P	-	-	ENSG00000214176		0.498	PLEKHM1P-002	KNOWN	basic	processed_transcript	PLEKHM1P	HGNC	pseudogene	OTTHUMT00000445598.1	53	0.00	0	C	NR_024386		62811354	62811354	-1	no_errors	ENST00000580919	ensembl	human	known	69_37n	rna	50	34.21	26	SNP	0.997	T
POTEE	445582	genome.wustl.edu	37	2	131976163	131976163	+	Missense_Mutation	SNP	A	A	C	rs147909369		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:131976163A>C	ENST00000356920.5	+	1	282	c.188A>C	c.(187-189)aAg>aCg	p.K63T	PLEKHB2_ENST00000303908.3_Intron|PLEKHB2_ENST00000404460.1_Intron|POTEE_ENST00000358087.5_Missense_Mutation_p.K63T	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	63					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											AAGATGGGCAAGTGGTGCCAC	0.592																																						dbGAP											0													172.0	164.0	167.0					2																	131976163		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.188A>C	2.37:g.131976163A>C	ENSP00000439189:p.Lys63Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6S8J4|Q6S8J5|Q6S8J8	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.K63T	ENST00000356920.5	37	c.188	CCDS46414.1	2	.	.	.	.	.	.	.	.	.	.	.	7.506	0.653688	0.14580	.	.	ENSG00000188219	ENST00000356920;ENST00000358087	T;T	0.80653	-1.4;1.22	.	.	.	.	.	.	.	.	T	0.70954	0.3283	L	0.29908	0.895	0.09310	N	1	P	0.39094	0.659	B	0.42959	0.403	T	0.62072	-0.6931	7	0.87932	D	0	.	.	.	.	.	63	Q6S8J3	POTEE_HUMAN	T	63	ENSP00000439189:K63T;ENSP00000443049:K63T	ENSP00000439189:K63T	K	+	2	0	AC131180.1	131692633	0.006000	0.16342	0.029000	0.17559	0.031000	0.12232	0.311000	0.19380	0.138000	0.18790	0.136000	0.15936	AAG	AC131180.1	-	NULL	ENSG00000188219		0.592	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	Clone_based_ensembl_gene	protein_coding		196	0.00	0	A	NM_001083538		131976163	131976163	+1	no_errors	ENST00000356920	ensembl	human	known	69_37n	missense	110	10.40	13	SNP	0.032	C
PNKD	25953	genome.wustl.edu	37	2	219206859	219206859	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:219206859C>T	ENST00000273077.4	+	7	824	c.773C>T	c.(772-774)tCt>tTt	p.S258F	PNKD_ENST00000258362.3_Missense_Mutation_p.S234F|AC021016.8_ENST00000411433.1_RNA|PNKD_ENST00000436005.2_Missense_Mutation_p.S198F	NM_015488.4	NP_056303.3	Q8N490	PNKD_HUMAN	paroxysmal nonkinesigenic dyskinesia	258					glutathione biosynthetic process (GO:0006750)|neuromuscular process controlling posture (GO:0050884)|regulation of dopamine metabolic process (GO:0042053)|regulation of synaptic transmission, dopaminergic (GO:0032225)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydroxyacylglutathione hydrolase activity (GO:0004416)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)	10		Renal(207;0.0474)		Epithelial(149;7.33e-07)|all cancers(144;0.000133)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CTCTTCCTCTCTGGCTGTGGT	0.597																																						dbGAP											0													46.0	45.0	46.0					2																	219206859		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2411.1, CCDS2413.1, CCDS42816.1	2q35	2011-01-21	2007-07-12		ENSG00000127838	ENSG00000127838			9153	protein-coding gene	gene with protein product	"""myofibrillogenesis regulator 1"""	609023	"""paroxysmal nonkinesiogenic dyskinesia"""			8659518	Standard	NM_015488		Approved	DYT8, PDC, DKFZp564N1362, FPD1, MR-1, BRP17, FKSG19, TAHCCP2, KIAA1184, KIPP1184, MGC31943, PKND1	uc002vhn.3	Q8N490	OTTHUMG00000133110	ENST00000273077.4:c.773C>T	2.37:g.219206859C>T	ENSP00000273077:p.Ser258Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F2|Q96A48|Q9BU26|Q9NSX4|Q9ULN6|Q9Y4T1	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like,tigrfam_Hydroxyacylglutathione_Hdrlase	p.S258F	ENST00000273077.4	37	c.773	CCDS2411.1	2	.	.	.	.	.	.	.	.	.	.	c	16.45	3.126130	0.56721	.	.	ENSG00000127838	ENST00000273077;ENST00000258362;ENST00000436005	D;D;D	0.95885	-3.84;-3.84;-3.84	4.9	4.03	0.46877	Beta-lactamase-like (2);	0.263116	0.39274	N	0.001414	D	0.91908	0.7438	L	0.37630	1.12	0.44359	D	0.997257	B;B	0.12630	0.006;0.0	B;B	0.15484	0.013;0.003	D	0.88831	0.3305	10	0.54805	T	0.06	-2.4462	13.1234	0.59340	0.0:0.9216:0.0:0.0784	.	234;258	Q8N490-3;Q8N490	.;PNKD_HUMAN	F	258;234;198	ENSP00000273077:S258F;ENSP00000258362:S234F;ENSP00000414400:S198F	ENSP00000258362:S234F	S	+	2	0	PNKD	218915103	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.648000	0.67930	1.278000	0.44430	0.556000	0.70494	TCT	PNKD	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like,tigrfam_Hydroxyacylglutathione_Hdrlase	ENSG00000127838		0.597	PNKD-001	KNOWN	basic|CCDS	protein_coding	PNKD	HGNC	protein_coding	OTTHUMT00000256775.2	67	0.00	0	C			219206859	219206859	+1	no_errors	ENST00000273077	ensembl	human	known	69_37n	missense	53	20.90	14	SNP	1.000	T
PPFIA2	8499	genome.wustl.edu	37	12	81688618	81688618	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr12:81688618C>T	ENST00000549396.1	-	24	3081	c.2921G>A	c.(2920-2922)cGa>cAa	p.R974Q	PPFIA2_ENST00000548586.1_Missense_Mutation_p.R974Q|PPFIA2_ENST00000541017.1_Missense_Mutation_p.R191Q|PPFIA2_ENST00000550584.2_Missense_Mutation_p.R974Q|PPFIA2_ENST00000549325.1_Missense_Mutation_p.R959Q|PPFIA2_ENST00000545296.2_Intron|PPFIA2_ENST00000541570.2_Missense_Mutation_p.R541Q|PPFIA2_ENST00000552948.1_Missense_Mutation_p.R974Q|PPFIA2_ENST00000443686.3_Missense_Mutation_p.R875Q|RP11-121G22.3_ENST00000549161.1_lincRNA|PPFIA2_ENST00000407050.4_Missense_Mutation_p.R900Q|PPFIA2_ENST00000333447.7_Missense_Mutation_p.R959Q|PPFIA2_ENST00000550359.2_Missense_Mutation_p.R821Q	NM_001220476.1|NM_001282536.1|NM_003625.3	NP_001207405.1|NP_001269465.1|NP_003616.2	O75334	LIPA2_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 2	974					cell-matrix adhesion (GO:0007160)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|presynaptic active zone (GO:0048786)				NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(37)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)	85						ACTCACAGTTCGAGATGTTGG	0.453																																						dbGAP											0													97.0	94.0	95.0					12																	81688618		1987	4170	6157	-	-	-	SO:0001583	missense	0			AF034799	CCDS55850.1, CCDS55851.1, CCDS55852.1, CCDS55853.1, CCDS55854.1, CCDS55855.1, CCDS55856.1, CCDS55857.1, CCDS59236.1, CCDS73503.1	12q21.31	2013-01-10						"""Sterile alpha motif (SAM) domain containing"""	9246	protein-coding gene	gene with protein product	"""Liprin-alpha2"""	603143				9624153	Standard	NM_003625		Approved		uc031qis.1	O75334		ENST00000549396.1:c.2921G>A	12.37:g.81688618C>T	ENSP00000450337:p.Arg974Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVT5|B3KXA0|B7Z2A6|B7Z3U9|B7Z663|B7ZKZ5|E7ERB8|E7ETG6|F8VP68|Q2M3G8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.R974Q	ENST00000549396.1	37	c.2921	CCDS55857.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.8|28.8	4.949481|4.949481	0.92660|0.92660	.|.	.|.	ENSG00000139220|ENSG00000139220	ENST00000550018|ENST00000549396;ENST00000549325;ENST00000541570;ENST00000541017;ENST00000407050;ENST00000541501;ENST00000333447;ENST00000548586;ENST00000443686;ENST00000552948	.|T;T;T;T;T;T;T;T;T	.|0.38077	.|1.17;1.28;1.69;1.34;1.63;1.29;1.21;1.16;1.89	5.62|5.62	5.62|5.62	0.85841|0.85841	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.56247|0.56247	0.1972|0.1972	M|M	0.79475|0.79475	2.455|2.455	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|P	.|0.53360	.|0.724	T|T	0.61874|0.61874	-0.6973|-0.6973	5|10	.|0.87932	.|D	.|0	-9.6634|-9.6634	19.6517|19.6517	0.95819|0.95819	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|974	.|O75334	.|LIPA2_HUMAN	K|Q	108|974;959;541;191;900;985;959;974;875;974	.|ENSP00000450337:R974Q;ENSP00000450298:R959Q;ENSP00000438337:R541Q;ENSP00000445532:R191Q;ENSP00000385093:R900Q;ENSP00000327416:R959Q;ENSP00000449338:R974Q;ENSP00000388373:R875Q;ENSP00000447868:R974Q	.|ENSP00000327416:R959Q	E|R	-|-	1|2	0|0	PPFIA2|PPFIA2	80212749|80212749	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.965000|0.965000	0.64279|0.64279	7.818000|7.818000	0.86416|0.86416	2.662000|2.662000	0.90505|0.90505	0.655000|0.655000	0.94253|0.94253	GAA|CGA	PPFIA2	-	NULL	ENSG00000139220		0.453	PPFIA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA2	HGNC	protein_coding	OTTHUMT00000408030.1	40	0.00	0	C			81688618	81688618	-1	no_errors	ENST00000549396	ensembl	human	known	69_37n	missense	20	28.57	8	SNP	1.000	T
PSG11	5680	genome.wustl.edu	37	19	43519282	43519282	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr19:43519282G>T	ENST00000401740.1	-	4	1053	c.950C>A	c.(949-951)aCa>aAa	p.T317K	PSG11_ENST00000595312.1_5'Flank|PSG11_ENST00000306322.7_Missense_Mutation_p.T195K|PSG11_ENST00000403486.1_Missense_Mutation_p.T195K|PSG11_ENST00000320078.7_Missense_Mutation_p.T317K			Q00887	PSG9_HUMAN	pregnancy specific beta-1-glycoprotein 11	410	Ig-like C2-type 2.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(15)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	26		Prostate(69;0.00682)				GACTCTGATTGTCAAGGATGT	0.443																																						dbGAP											0													140.0	133.0	135.0					19																	43519282		2199	4298	6497	-	-	-	SO:0001583	missense	0			U25988	CCDS12614.2, CCDS12615.2	19q13.2	2013-01-29			ENSG00000243130	ENSG00000243130		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9516	protein-coding gene	gene with protein product	"""pregnancy specific beta-1-glycoprotein 13"""	176401		PSG13, PSG14		7794280	Standard	NM_001113410		Approved	MGC22484	uc002ovm.1	Q9UQ72	OTTHUMG00000151546	ENST00000401740.1:c.950C>A	19.37:g.43519282G>T	ENSP00000384995:p.Thr317Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R869|Q15227|Q15236|Q15237|Q8WW78|Q9UQ73	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T317K	ENST00000401740.1	37	c.950	CCDS12614.2	19	.	.	.	.	.	.	.	.	.	.	g	2.754	-0.259450	0.05791	.	.	ENSG00000243130	ENST00000320078;ENST00000403486;ENST00000306322;ENST00000401740	T;T;T;T	0.12465	2.68;2.68;2.68;2.68	0.976	-0.769	0.11009	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.16811	0.0404	M	0.78637	2.42	0.09310	N	1	B;B	0.10296	0.003;0.002	B;B	0.25884	0.016;0.064	T	0.31336	-0.9947	9	0.44086	T	0.13	.	5.4037	0.16310	0.0:0.3408:0.6592:0.0	.	195;317	Q9UQ72-2;Q9UQ72	.;PSG11_HUMAN	K	317;195;195;317	ENSP00000319140:T317K;ENSP00000385427:T195K;ENSP00000304913:T195K;ENSP00000384995:T317K	ENSP00000304913:T195K	T	-	2	0	PSG11	48211122	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.691000	0.01920	-1.389000	0.02090	-1.271000	0.01417	ACA	PSG11	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000243130		0.443	PSG11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PSG11	HGNC	protein_coding	OTTHUMT00000323079.1	176	0.00	0	G	NM_002785		43519282	43519282	-1	no_errors	ENST00000320078	ensembl	human	known	69_37n	missense	47	49.46	46	SNP	0.001	T
RBMX	27316	genome.wustl.edu	37	X	135960146	135960147	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:135960146_135960147insAA	ENST00000320676.7	-	4	469_470	c.315_316insTT	c.(313-318)cctccafs	p.P106fs	SNORD61_ENST00000384252.1_RNA|RBMX_ENST00000562646.1_Frame_Shift_Ins_p.P106fs|RBMX_ENST00000565438.1_5'UTR|RBMX_ENST00000570135.1_Intron|RBMX_ENST00000431446.3_Intron	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked	106					cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P106fs*32(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					AGACCTCTTGGAGGGCCTCTAC	0.535																																						dbGAP											1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001589	frameshift_variant	0				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.315_316insTT	X.37:g.135960146_135960147insAA	ENSP00000359645:p.Pro106fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.P105fs	ENST00000320676.7	37	c.316_315	CCDS14661.1	X																																																																																			RBMX	-	NULL	ENSG00000147274		0.535	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	HGNC	protein_coding	OTTHUMT00000058507.1	47	0.00	0	-	NM_002139		135960146	135960147	-1	no_errors	ENST00000320676	ensembl	human	known	69_37n	frame_shift_ins	62	10.14	7	INS	1.000:1.000	AA
RGPD4	285190	genome.wustl.edu	37	2	108499296	108499296	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:108499296G>A	ENST00000408999.3	+	22	5310	c.5233G>A	c.(5233-5235)Gaa>Aaa	p.E1745K	RGPD4_ENST00000354986.4_Missense_Mutation_p.E1745K	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1745	GRIP. {ECO:0000255|PROSITE- ProRule:PRU00250}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						GCTCAGCCCTGAAGAAAAGGG	0.433																																						dbGAP											0													83.0	67.0	72.0					2																	108499296		692	1578	2270	-	-	-	SO:0001583	missense	0			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.5233G>A	2.37:g.108499296G>A	ENSP00000386810:p.Glu1745Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E1745K	ENST00000408999.3	37	c.5233	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	18.67	3.674020	0.67928	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.42131	0.99;0.98	0.854	0.854	0.19007	GRIP (3);	.	.	.	.	T	0.35537	0.0935	L	0.52823	1.66	0.31889	N	0.617472	P	0.45212	0.853	B	0.39419	0.299	T	0.51458	-0.8703	9	0.87932	D	0	-36.5819	9.0795	0.36542	0.0:0.0:1.0:0.0	.	1745	Q7Z3J3	RGPD4_HUMAN	K	1745;1745;1112	ENSP00000347081:E1745K;ENSP00000386810:E1745K	ENSP00000347081:E1745K	E	+	1	0	RGPD4	107865728	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	6.757000	0.74924	0.767000	0.33267	0.398000	0.26397	GAA	RGPD4	-	pfam_GRIP,superfamily_GRIP,smart_GRIP,pfscan_GRIP	ENSG00000196862		0.433	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	91	0.00	0	G	XM_496581		108499296	108499296	+1	no_errors	ENST00000354986	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	1.000	A
RIMS2	9699	genome.wustl.edu	37	8	104898096	104898096	+	Silent	SNP	T	T	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr8:104898096T>G	ENST00000436393.2	+	2	844	c.603T>G	c.(601-603)tcT>tcG	p.S201S	RIMS2_ENST00000507740.1_Silent_p.S231S|RIMS2_ENST00000262231.10_Silent_p.S231S|RIMS2_ENST00000406091.3_Silent_p.S423S			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	454					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)	p.S231S(3)|p.S459S(2)|p.S201S(2)		NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GACCAAGTTCTTATGCACAAA	0.478										HNSCC(12;0.0054)																												dbGAP											7	Substitution - coding silent(7)	large_intestine(7)											85.0	80.0	81.0					8																	104898096		1935	4137	6072	-	-	-	SO:0001819	synonymous_variant	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.603T>G	8.37:g.104898096T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Silent	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.S423	ENST00000436393.2	37	c.1269		8																																																																																			RIMS2	-	NULL	ENSG00000176406		0.478	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	25	0.00	0	T	NM_001100117		104898096	104898096	+1	no_errors	ENST00000406091	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.998	G
RNF128	79589	genome.wustl.edu	37	X	105970246	105970246	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:105970246G>A	ENST00000255499.2	+	1	353	c.103G>A	c.(103-105)Ggt>Agt	p.G35S	RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase	35					negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						GCAGGCACCCGGTTCCCGGGG	0.697																																						dbGAP											0													13.0	11.0	12.0					X																	105970246		2181	4252	6433	-	-	-	SO:0001583	missense	0			AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.103G>A	X.37:g.105970246G>A	ENSP00000255499:p.Gly35Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.G35S	ENST00000255499.2	37	c.103	CCDS14521.1	X	.	.	.	.	.	.	.	.	.	.	g	5.197	0.221845	0.09863	.	.	ENSG00000133135	ENST00000255499	T	0.11604	2.76	4.08	3.18	0.36537	.	0.734065	0.12977	N	0.423641	T	0.05364	0.0142	N	0.14661	0.345	0.09310	N	1	B	0.12013	0.005	B	0.08055	0.003	T	0.42749	-0.9433	10	0.07030	T	0.85	.	8.0089	0.30342	0.0:0.0:0.757:0.243	.	35	Q8TEB7	RN128_HUMAN	S	35	ENSP00000255499:G35S	ENSP00000255499:G35S	G	+	1	0	RNF128	105856902	0.040000	0.19996	0.209000	0.23619	0.404000	0.30871	0.284000	0.18864	0.809000	0.34255	0.509000	0.49947	GGT	RNF128	-	NULL	ENSG00000133135		0.697	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF128	HGNC	protein_coding	OTTHUMT00000057804.1	38	0.00	0	G	NM_024539		105970246	105970246	+1	no_errors	ENST00000255499	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	0.080	A
RNF145	153830	genome.wustl.edu	37	5	158584471	158584471	+	3'UTR	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr5:158584471C>T	ENST00000424310.2	-	0	3558				RNF145_ENST00000274542.2_3'UTR|RNF145_ENST00000519865.1_3'UTR|RNF145_ENST00000518284.1_5'UTR	NM_001199383.1	NP_001186312.1	Q96MT1	RN145_HUMAN	ring finger protein 145							integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			endometrium(7)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	30	Renal(175;0.00196)	Medulloblastoma(196;0.0523)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CAGTCTACATCCAAATTTGCT	0.289																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC042684	CCDS4344.1, CCDS56390.1, CCDS56391.1, CCDS56392.1, CCDS56393.1	5q33.3	2013-01-09			ENSG00000145860	ENSG00000145860		"""RING-type (C3HC4) zinc fingers"""	20853	protein-coding gene	gene with protein product							Standard	NM_001199380		Approved	FLJ31951	uc003lxo.2	Q96MT1	OTTHUMG00000130306	ENST00000424310.2:c.*1207G>A	5.37:g.158584471C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z903|B7Z949|E7EVI7|Q8IVP7	RNA	SNP	-	NULL	ENST00000424310.2	37	NULL	CCDS56390.1	5																																																																																			RNF145	-	-	ENSG00000145860		0.289	RNF145-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF145	HGNC	protein_coding	OTTHUMT00000374048.1	32	0.00	0	C	NM_144726		158584471	158584471	-1	no_errors	ENST00000518284	ensembl	human	known	69_37n	rna	11	26.67	4	SNP	1.000	T
RNF41	10193	genome.wustl.edu	37	12	56600315	56600315	+	Silent	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr12:56600315G>A	ENST00000345093.4	-	7	1239	c.870C>T	c.(868-870)gcC>gcT	p.A290A	RNF41_ENST00000394013.2_Silent_p.A219A|RNF41_ENST00000552656.1_Silent_p.A290A	NM_005785.3|NM_194359.2	NP_005776.1|NP_919340.1	Q9H4P4	RNF41_HUMAN	ring finger protein 41, E3 ubiquitin protein ligase	290					extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|proteasomal protein catabolic process (GO:0010498)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|regulation of establishment of cell polarity (GO:2000114)|regulation of lymphocyte differentiation (GO:0045619)|regulation of MAPK cascade (GO:0043408)|regulation of myeloid cell differentiation (GO:0045637)|regulation of protein kinase B signaling (GO:0051896)|regulation of reactive oxygen species metabolic process (GO:2000377)	cytosol (GO:0005829)	acid-amino acid ligase activity (GO:0016881)|protein tag (GO:0031386)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(2)|urinary_tract(1)	11						GGTTCTCACAGGCCATCACGA	0.537											OREG0021921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													209.0	171.0	184.0					12																	56600315		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF077599	CCDS8909.1, CCDS8910.1	12q13.13	2014-03-24	2014-03-24		ENSG00000181852	ENSG00000181852		"""RING-type (C3HC4) zinc fingers"""	18401	protein-coding gene	gene with protein product			"""ring finger protein 41"""				Standard	NM_005785		Approved	SBBI03, NRDP1	uc001skg.2	Q9H4P4	OTTHUMG00000170328	ENST00000345093.4:c.870C>T	12.37:g.56600315G>A		Somatic	1016	WXS	Illumina GAIIx	Phase_IV	A6NFW0|B2RBT8|O75598	Silent	SNP	pfam_USP8_interacting,pfam_Znf_C3HC4_RING-type,pfam_Ubox_domain,superfamily_TRAF-like,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_SIAH	p.A290	ENST00000345093.4	37	c.870	CCDS8909.1	12																																																																																			RNF41	-	pfam_USP8_interacting	ENSG00000181852		0.537	RNF41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF41	HGNC	protein_coding	OTTHUMT00000408525.1	39	0.00	0	G	NM_005785		56600315	56600315	-1	no_errors	ENST00000345093	ensembl	human	known	69_37n	silent	12	36.84	7	SNP	1.000	A
ROBO4	54538	genome.wustl.edu	37	11	124763622	124763622	+	Silent	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:124763622C>T	ENST00000306534.3	-	10	1994	c.1509G>A	c.(1507-1509)ctG>ctA	p.L503L	ROBO4_ENST00000526899.1_5'Flank|ROBO4_ENST00000533054.1_Silent_p.L358L	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	503					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		TATATCTGTACAGACCTGGGA	0.547																																						dbGAP											0													153.0	131.0	139.0					11																	124763622		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.1509G>A	11.37:g.124763622C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L503	ENST00000306534.3	37	c.1509	CCDS8455.1	11																																																																																			ROBO4	-	NULL	ENSG00000154133		0.547	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO4	HGNC	protein_coding	OTTHUMT00000387111.1	58	0.00	0	C	NM_019055		124763622	124763622	-1	no_errors	ENST00000306534	ensembl	human	known	69_37n	silent	31	11.43	4	SNP	0.998	T
RYR2	6262	genome.wustl.edu	37	1	237995857	237995857	+	Silent	SNP	T	T	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:237995857T>G	ENST00000366574.2	+	105	15131	c.14814T>G	c.(14812-14814)tcT>tcG	p.S4938S	RYR2_ENST00000542537.1_Silent_p.S4922S|RYR2_ENST00000360064.6_Silent_p.S4944S	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4938					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TGCAGGAATCTTATGTCTGGA	0.398																																						dbGAP											0													87.0	84.0	85.0					1																	237995857		1865	4131	5996	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.14814T>G	1.37:g.237995857T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.S4944	ENST00000366574.2	37	c.14832	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.398	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	73	0.00	0	T	NM_001035		237995857	237995857	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	62	11.43	8	SNP	0.976	G
RYR3	6263	genome.wustl.edu	37	15	34042201	34042201	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr15:34042201G>C	ENST00000389232.4	+	56	8291	c.8221G>C	c.(8221-8223)Gag>Cag	p.E2741Q	RYR3_ENST00000415757.3_Missense_Mutation_p.E2741Q	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2741	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		GGTCGTGGCTGAGAACTATCA	0.512																																						dbGAP											0													111.0	116.0	114.0					15																	34042201		1997	4191	6188	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.8221G>C	15.37:g.34042201G>C	ENSP00000373884:p.Glu2741Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E2741Q	ENST00000389232.4	37	c.8221	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	32	5.153314	0.94645	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.94931	-3.56;-3.56	5.37	5.37	0.77165	Ryanodine receptor Ryr (1);	0.000000	0.85682	D	0.000000	D	0.97558	0.9200	M	0.85197	2.74	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.99	D	0.98010	1.0365	10	0.87932	D	0	.	19.4788	0.95000	0.0:0.0:1.0:0.0	.	2741;2741	Q15413-2;Q15413	.;RYR3_HUMAN	Q	2741	ENSP00000373884:E2741Q;ENSP00000399610:E2741Q	ENSP00000354735:E2741Q	E	+	1	0	RYR3	31829493	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.676000	0.91093	0.655000	0.94253	GAG	RYR3	-	pfam_Ryanodine_rcpt,superfamily_ARM-type_fold	ENSG00000198838		0.512	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	54	0.00	0	G			34042201	34042201	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	1.000	C
SCG2	7857	genome.wustl.edu	37	2	224462621	224462621	+	Silent	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:224462621C>T	ENST00000305409.2	-	2	1612	c.1380G>A	c.(1378-1380)gaG>gaA	p.E460E		NM_003469.4	NP_003460.2	O00255	MEN1_HUMAN	secretogranin II	0					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA repair (GO:0006281)|embryonic skeletal system morphogenesis (GO:0048704)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|histone lysine methylation (GO:0034968)|leukocyte homeostasis (GO:0001776)|MAPK cascade (GO:0000165)|maternal process involved in female pregnancy (GO:0060135)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of JNK cascade (GO:0046329)|negative regulation of organ growth (GO:0046621)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoblast development (GO:0002076)|osteoblast fate commitment (GO:0002051)|palate development (GO:0060021)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell division (GO:0051781)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of histone methylation (GO:0031062)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of activin receptor signaling pathway (GO:0032925)|response to gamma radiation (GO:0010332)|response to UV (GO:0009411)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	chromatin (GO:0000785)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|four-way junction DNA binding (GO:0000400)|protein binding, bridging (GO:0030674)|protein N-terminus binding (GO:0047485)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(1)|kidney(6)|large_intestine(10)|liver(1)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	44		Renal(207;0.0112)|Lung NSC(271;0.0185)|all_lung(227;0.0271)		Epithelial(121;8.16e-11)|all cancers(144;4.66e-08)|Lung(261;0.00714)|LUSC - Lung squamous cell carcinoma(224;0.008)		GCAGAACTTTCTCCTGGTTAT	0.448																																						dbGAP											0													111.0	111.0	111.0					2																	224462621		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M25756	CCDS2457.1	2q35-q36	2010-04-27	2010-04-27		ENSG00000171951	ENSG00000171951			10575	protein-coding gene	gene with protein product	"""secretoneurin"", ""chromogranin C"""	118930				8617499, 16101435	Standard	NM_003469		Approved	CHGC, SgII, SN	uc002vnm.3	P13521	OTTHUMG00000133166	ENST00000305409.2:c.1380G>A	2.37:g.224462621C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5HBC6|A5HBC7|A5HBC8|A5HBC9|A5HBD0|A5HBD1|A5HBD2|O00632|Q9BUF0|Q9BUK2	Silent	SNP	pfam_Granin	p.E460	ENST00000305409.2	37	c.1380	CCDS2457.1	2																																																																																			SCG2	-	pfam_Granin	ENSG00000171951		0.448	SCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG2	HGNC	protein_coding	OTTHUMT00000256870.2	53	0.00	0	C	NM_003469		224462621	224462621	-1	no_errors	ENST00000305409	ensembl	human	known	69_37n	silent	31	38.00	19	SNP	0.970	T
SH2B1	25970	genome.wustl.edu	37	16	28883119	28883119	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr16:28883119C>G	ENST00000322610.8	+	8	1767	c.1328C>G	c.(1327-1329)tCa>tGa	p.S443*	SH2B1_ENST00000545570.1_Nonsense_Mutation_p.S133*|SH2B1_ENST00000395532.4_Nonsense_Mutation_p.S443*|SH2B1_ENST00000359285.5_Nonsense_Mutation_p.S443*|SH2B1_ENST00000563674.1_Intron|SH2B1_ENST00000538342.1_Nonsense_Mutation_p.S107*|SH2B1_ENST00000337120.5_Nonsense_Mutation_p.S443*			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	443	Interaction with JAK2 (low-affinity binding; independent of JAK2 phosphorylation). {ECO:0000250}.				blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						GGGGGCCTCTCAGACCGCCCC	0.582																																						dbGAP											0													43.0	47.0	46.0					16																	28883119		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1328C>G	16.37:g.28883119C>G	ENSP00000321221:p.Ser443*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Nonsense_Mutation	SNP	pfam_Phe_ZIP,pfam_Pleckstrin_homology,pfam_SH2,superfamily_Phe_ZIP,smart_Pleckstrin_homology,smart_SH2,prints_SH2,pfscan_SH2	p.S443*	ENST00000322610.8	37	c.1328	CCDS53996.1	16	.	.	.	.	.	.	.	.	.	.	C	40	8.124817	0.98665	.	.	ENSG00000178188	ENST00000322610;ENST00000545570;ENST00000359285;ENST00000538342;ENST00000395532;ENST00000337120	.	.	.	5.14	5.14	0.70334	.	0.367123	0.21930	N	0.067025	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-22.0383	11.6376	0.51213	0.0:0.9135:0.0:0.0865	.	.	.	.	X	443;133;443;107;443;443	.	ENSP00000321221:S443X	S	+	2	0	SH2B1	28790620	0.390000	0.25213	1.000000	0.80357	0.968000	0.65278	2.211000	0.42825	2.389000	0.81357	0.591000	0.81541	TCA	SH2B1	-	NULL	ENSG00000178188		0.582	SH2B1-001	KNOWN	basic|CCDS	protein_coding	SH2B1	HGNC	protein_coding	OTTHUMT00000432666.1	43	0.00	0	C	NM_015503		28883119	28883119	+1	no_errors	ENST00000322610	ensembl	human	known	69_37n	nonsense	20	16.67	4	SNP	1.000	G
SLC22A16	85413	genome.wustl.edu	37	6	110777688	110777688	+	Intron	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr6:110777688G>A	ENST00000368919.3	-	2	600				SLC22A16_ENST00000330550.4_Intron|SLC22A16_ENST00000461487.1_5'UTR|SLC22A16_ENST00000439654.1_Intron|SLC22A16_ENST00000456137.2_Intron	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16						acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)			breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	AAGAAAACCAGATAGGAAAAT	0.348																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.533+52C>T	6.37:g.110777688G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	RNA	SNP	-	NULL	ENST00000368919.3	37	NULL	CCDS5084.1	6																																																																																			SLC22A16	-	-	ENSG00000004809		0.348	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A16	HGNC	protein_coding	OTTHUMT00000043428.1	42	0.00	0	G	NM_033125		110777688	110777688	-1	no_errors	ENST00000461487	ensembl	human	known	69_37n	rna	22	24.14	7	SNP	0.001	A
SLC37A2	219855	genome.wustl.edu	37	11	124946652	124946652	+	Splice_Site	SNP	G	G	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:124946652G>T	ENST00000403796.2	+	2	360		c.e2-1		SLC37A2_ENST00000407458.1_Splice_Site|SLC37A2_ENST00000298280.5_Splice_Site|SLC37A2_ENST00000308074.4_Splice_Site	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2						carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		CCTTCCTGCAGGTTCCGAGGC	0.602																																					Melanoma(11;373 620 21213 26083 47768)	dbGAP											0													176.0	125.0	142.0					11																	124946652		2201	4299	6500	-	-	-	SO:0001630	splice_region_variant	0			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.60-1G>T	11.37:g.124946652G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Splice_Site	SNP	-	e2-1	ENST00000403796.2	37	c.60-1	CCDS44757.1	11	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584805	0.46110	.	.	ENSG00000134955	ENST00000403796;ENST00000407458;ENST00000298280;ENST00000308074	.	.	.	5.52	5.52	0.82312	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0405	0.92997	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC37A2	124451862	1.000000	0.71417	1.000000	0.80357	0.148000	0.21650	9.665000	0.98609	2.586000	0.87340	0.655000	0.94253	.	SLC37A2	-	-	ENSG00000134955		0.602	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC37A2	HGNC	protein_coding	OTTHUMT00000386837.1	66	0.00	0	G	XM_166184	Intron	124946652	124946652	+1	no_errors	ENST00000308074	ensembl	human	known	69_37n	splice_site	23	45.24	19	SNP	1.000	T
SMURF2	64750	genome.wustl.edu	37	17	62542418	62542418	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:62542418C>T	ENST00000262435.9	-	18	2297	c.2110G>A	c.(2110-2112)Gat>Aat	p.D704N		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	704	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			GTGCAGGCATCAATCTGGTGT	0.443																																						dbGAP											0													132.0	112.0	119.0					17																	62542418		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.2110G>A	17.37:g.62542418C>T	ENSP00000262435:p.Asp704Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LL1|Q9H260	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.D704N	ENST00000262435.9	37	c.2110	CCDS32707.1	17	.	.	.	.	.	.	.	.	.	.	C	14.30	2.493684	0.44352	.	.	ENSG00000108854	ENST00000262435	T	0.58210	0.35	5.71	4.73	0.59995	HECT (4);	0.000000	0.85682	D	0.000000	T	0.57814	0.2079	L	0.53729	1.69	0.80722	D	1	B	0.23937	0.094	B	0.38458	0.274	T	0.59316	-0.7477	10	0.56958	D	0.05	.	16.1751	0.81845	0.1343:0.8657:0.0:0.0	.	704	Q9HAU4	SMUF2_HUMAN	N	704	ENSP00000262435:D704N	ENSP00000262435:D704N	D	-	1	0	SMURF2	59972880	1.000000	0.71417	1.000000	0.80357	0.156000	0.22039	7.729000	0.84864	1.401000	0.46761	-0.310000	0.09108	GAT	SMURF2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000108854		0.443	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMURF2	HGNC	protein_coding	OTTHUMT00000445227.1	52	0.00	0	C	NM_022739		62542418	62542418	-1	no_errors	ENST00000262435	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	1.000	T
SNAP91	9892	genome.wustl.edu	37	6	84290235	84290235	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr6:84290235G>C	ENST00000439399.2	-	24	2549	c.2233C>G	c.(2233-2235)Cct>Gct	p.P745A	SNAP91_ENST00000519133.1_5'Flank|SNAP91_ENST00000521743.1_Missense_Mutation_p.P745A|SNAP91_ENST00000195649.6_Missense_Mutation_p.P740A|SNAP91_ENST00000520302.1_Missense_Mutation_p.P715A|SNAP91_ENST00000521485.1_Missense_Mutation_p.P740A|SNAP91_ENST00000428679.2_Missense_Mutation_p.P745A|SNAP91_ENST00000437520.1_Missense_Mutation_p.P438A|SNAP91_ENST00000369694.2_Missense_Mutation_p.P745A|SNAP91_ENST00000520213.1_Missense_Mutation_p.P438A	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	745					clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		GCCATTGCAGGACTGGGTGGT	0.453																																						dbGAP											0													101.0	106.0	105.0					6																	84290235		1990	4160	6150	-	-	-	SO:0001583	missense	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.2233C>G	6.37:g.84290235G>C	ENSP00000400459:p.Pro745Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	pfam_ANTH,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.P745A	ENST00000439399.2	37	c.2233	CCDS47455.1	6	.	.	.	.	.	.	.	.	.	.	G	13.73	2.323944	0.41096	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000523448;ENST00000521931	T;T;T;T;T;T;T;T;T;T;T	0.31510	2.61;2.61;2.61;2.61;2.63;2.54;2.64;2.61;2.54;2.05;1.49	5.52	3.63	0.41609	.	0.776425	0.12851	N	0.433910	T	0.10594	0.0259	N	0.04508	-0.205	0.35739	D	0.818554	B;P;D;B;P	0.53745	0.009;0.952;0.962;0.039;0.918	B;P;P;B;P	0.52909	0.003;0.713;0.626;0.018;0.526	T	0.05886	-1.0858	10	0.27082	T	0.32	-5.9031	8.2498	0.31710	0.0722:0.0:0.661:0.2668	.	621;438;715;745;743	B7Z2N2;O60641-3;E5RI02;O60641;E1P549	.;.;.;AP180_HUMAN;.	A	740;745;745;740;745;438;715;745;438;86;558	ENSP00000429776:P740A;ENSP00000358708:P745A;ENSP00000400459:P745A;ENSP00000195649:P740A;ENSP00000412492:P745A;ENSP00000413277:P438A;ENSP00000428511:P715A;ENSP00000428215:P745A;ENSP00000428026:P438A;ENSP00000430255:P86A;ENSP00000430071:P558A	ENSP00000195649:P740A	P	-	1	0	SNAP91	84346954	0.827000	0.29292	0.989000	0.46669	0.970000	0.65996	0.328000	0.19681	1.330000	0.45394	0.655000	0.94253	CCT	SNAP91	-	NULL	ENSG00000065609		0.453	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	57	0.00	0	G			84290235	84290235	-1	no_errors	ENST00000369694	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.933	C
SPAG16	79582	genome.wustl.edu	37	2	214160807	214160807	+	Silent	SNP	A	A	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:214160807A>T	ENST00000331683.5	+	2	251	c.156A>T	c.(154-156)gcA>gcT	p.A52A	SPAG16_ENST00000414961.2_3'UTR|SPAG16_ENST00000432529.2_Silent_p.A52A|SPAG16_ENST00000413312.1_Intron|SPAG16_ENST00000272898.7_Silent_p.A52A|SPAG16_ENST00000374309.3_5'Flank|SPAG16_ENST00000447990.1_Silent_p.A52A	NM_024532.4	NP_078808.3	Q8N0X2	SPG16_HUMAN	sperm associated antigen 16	52					cilium assembly (GO:0042384)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|microtubule cytoskeleton (GO:0015630)|motile cilium (GO:0031514)|nucleus (GO:0005634)				endometrium(4)|kidney(1)|large_intestine(15)|lung(27)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	56		Renal(323;0.00461)		UCEC - Uterine corpus endometrioid carcinoma (47;0.0525)|Epithelial(149;7.07e-07)|all cancers(144;7.96e-05)|Lung(261;0.00255)|LUSC - Lung squamous cell carcinoma(224;0.00599)		TAACTGAAGCATCTGAAGATG	0.269																																						dbGAP											0													94.0	102.0	99.0					2																	214160807		2202	4290	6492	-	-	-	SO:0001819	synonymous_variant	0			AF310672	CCDS2396.1, CCDS46508.1	2q34	2013-05-21			ENSG00000144451	ENSG00000144451		"""WD repeat domain containing"""	23225	protein-coding gene	gene with protein product		612173				12391165, 11867345	Standard	NM_024532		Approved	PF20, FLJ22724, DKFZp666P1710, WDR29	uc002veq.4	Q8N0X2	OTTHUMG00000133015	ENST00000331683.5:c.156A>T	2.37:g.214160807A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q498B7|Q658W1|Q68DB3|Q6I9Z6|Q8N9C7|Q9H601	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A52	ENST00000331683.5	37	c.156	CCDS2396.1	2																																																																																			SPAG16	-	NULL	ENSG00000144451		0.269	SPAG16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPAG16	HGNC	protein_coding	OTTHUMT00000256601.2	47	0.00	0	A	NM_024532		214160807	214160807	+1	no_errors	ENST00000331683	ensembl	human	known	69_37n	silent	31	27.27	12	SNP	0.997	T
SPEG	10290	genome.wustl.edu	37	2	220356570	220356570	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr2:220356570C>T	ENST00000312358.7	+	39	9572	c.9440C>T	c.(9439-9441)gCg>gTg	p.A3147V	AC053503.11_ENST00000429882.1_RNA|SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	3147	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		ATCTGGGGAGCGGGTGTGCTC	0.612																																						dbGAP											0													66.0	75.0	72.0					2																	220356570		2033	4182	6215	-	-	-	SO:0001583	missense	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.9440C>T	2.37:g.220356570C>T	ENSP00000311684:p.Ala3147Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A3147V	ENST00000312358.7	37	c.9440	CCDS42824.1	2	.	.	.	.	.	.	.	.	.	.	C	10.47	1.359264	0.24598	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.38077	1.16	4.46	-5.89	0.02282	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.201008	0.24657	N	0.036665	T	0.12390	0.0301	N	0.04705	-0.18	0.29811	N	0.831629	B	0.06786	0.001	B	0.04013	0.001	T	0.31336	-0.9947	10	0.02654	T	1	.	14.0355	0.64642	0.0:0.1803:0.0:0.8197	.	3147	Q15772	SPEG_HUMAN	V	3147	ENSP00000311684:A3147V	ENSP00000265327:A3147V	A	+	2	0	SPEG	220064814	0.025000	0.19082	0.172000	0.22920	0.913000	0.54294	0.279000	0.18771	-1.376000	0.02126	-1.202000	0.01658	GCG	SPEG	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000072195		0.612	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	24	0.00	0	C	NM_005876		220356570	220356570	+1	no_errors	ENST00000312358	ensembl	human	novel	69_37n	missense	6	50.00	6	SNP	0.087	T
SRCIN1	80725	genome.wustl.edu	37	17	36760753	36760753	+	Intron	SNP	G	G	T	rs12952883	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:36760753G>T	ENST00000264659.7	-	1	247				CTB-58E17.2_ENST00000583075.1_RNA|SRCIN1_ENST00000578925.1_Intron	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1						exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						CGGCCCCCAGGGTCCCTCGGT	0.701													G|||	920	0.183706	0.2375	0.3199	5008	,	,		14186	0.0169		0.1839	False		,,,				2504	0.1861					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.22+1183C>A	17.37:g.36760753G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q75T46|Q8N4W8	Missense_Mutation	SNP	pfam_AIP3_C	p.P35T	ENST00000264659.7	37	c.103	CCDS45660.1	17																																																																																			SRCIN1	-	NULL	ENSG00000017373		0.701	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	HGNC	protein_coding	OTTHUMT00000441878.4	46	0.00	0	G	NM_025248		36760753	36760753	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000584266	ensembl	human	putative	69_37n	missense	34	10.53	4	SNP	0.754	T
STPG1	90529	genome.wustl.edu	37	1	24718079	24718079	+	Missense_Mutation	SNP	C	C	A	rs560219	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:24718079C>A	ENST00000374409.1	-	3	415	c.161G>T	c.(160-162)aGt>aTt	p.S54I	STPG1_ENST00000337248.4_Missense_Mutation_p.S54I|STPG1_ENST00000468303.1_5'UTR|STPG1_ENST00000003583.8_Intron|STPG1_ENST00000440416.1_Intron	NM_001199012.1	NP_001185941.1	Q5TH74	STPG1_HUMAN	sperm-tail PG-rich repeat containing 1	54					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)|nucleus (GO:0005634)											CTTGGCTTGACTATTGAATCC	0.403											OREG0013240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	1173	0.234225	0.1906	0.2248	5008	,	,		18080	0.3145		0.2416	False		,,,				2504	0.2096					dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC047705	CCDS253.1, CCDS55581.1	1p36.11	2012-10-31	2012-07-30	2012-07-30	ENSG00000001460	ENSG00000001460			28070	protein-coding gene	gene with protein product	"""O6-methylguanine-induced apoptosis 2"""	615826	"""chromosome 1 open reading frame 201"""	C1orf201		23028632	Standard	NM_001199012		Approved	FLJ33340, MAPO2	uc001bjc.3	Q5TH74	OTTHUMG00000003297	ENST00000374409.1:c.161G>T	1.37:g.24718079C>A	ENSP00000363530:p.Ser54Ile	Somatic	773	WXS	Illumina GAIIx	Phase_IV	Q49AP0|Q6P3R4|Q86VU9|Q8WVQ3	Missense_Mutation	SNP	NULL	p.S54I	ENST00000374409.1	37	c.161	CCDS55581.1	1	544|544	0.2490842490842491|0.2490842490842491	103|103	0.20934959349593496|0.20934959349593496	88|88	0.2430939226519337|0.2430939226519337	176|176	0.3076923076923077|0.3076923076923077	177|177	0.23350923482849603|0.23350923482849603	C|C	14.40|14.40	2.522665|2.522665	0.44866|0.44866	.|.	.|.	ENSG00000001460|ENSG00000001460	ENST00000374409;ENST00000337248;ENST00000437986|ENST00000435187	.|.	.|.	.|.	5.39|5.39	4.47|4.47	0.54385|0.54385	.|.	0.342231|.	0.29286|.	N|.	0.012599|.	T|T	0.00012|0.00012	0.0000|0.0000	M|M	0.74881|0.74881	2.28|2.28	0.09310|0.09310	P|P	0.9999999999999184|0.9999999999999184	B|.	0.12630|.	0.006|.	B|.	0.09377|.	0.004|.	T|T	0.04840|0.04840	-1.0923|-1.0923	8|4	0.59425|.	D|.	0.04|.	-2.4253|-2.4253	11.8682|11.8682	0.52505|0.52505	0.1747:0.8253:0.0:0.0|0.1747:0.8253:0.0:0.0	rs560219;rs1064840;rs3170834;rs560219|rs560219;rs1064840;rs3170834;rs560219	54|.	Q5TH74|.	CA201_HUMAN|.	I|F	54|31	.|.	ENSP00000337461:S54I|.	S|V	-|-	2|1	0|0	C1orf201|C1orf201	24590666|24590666	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.922000|0.922000	0.55478|0.55478	2.445000|2.445000	0.44899|0.44899	1.404000|1.404000	0.46819|0.46819	-0.169000|-0.169000	0.13324|0.13324	AGT|GTC	STPG1	-	NULL	ENSG00000001460		0.403	STPG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STPG1	HGNC	protein_coding	OTTHUMT00000009172.1	80	0.00	0	C	NM_178122		24718079	24718079	-1	no_errors	ENST00000337248	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	1.000	A
SUOX	6821	genome.wustl.edu	37	12	56396419	56396419	+	Missense_Mutation	SNP	A	A	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr12:56396419A>T	ENST00000394109.3	+	2	867	c.143A>T	c.(142-144)gAt>gTt	p.D48V	SUOX_ENST00000550478.1_3'UTR|SUOX_ENST00000551841.2_Missense_Mutation_p.D48V|SUOX_ENST00000394115.2_Missense_Mutation_p.D48V|SUOX_ENST00000266971.3_Missense_Mutation_p.D48V|SUOX_ENST00000356124.4_Missense_Mutation_p.D48V|SUOX_ENST00000548274.1_Missense_Mutation_p.D48V			P51687	SUOX_HUMAN	sulfite oxidase	48					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	mitochondrial matrix (GO:0005759)	electron carrier activity (GO:0009055)|heme binding (GO:0020037)|molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|sulfite oxidase activity (GO:0008482)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)	15			UCEC - Uterine corpus endometrioid carcinoma (6;0.0471)|OV - Ovarian serous cystadenocarcinoma(18;0.119)			TTCTCTGGTGATAACTCCAGC	0.537																																						dbGAP											0													128.0	117.0	121.0					12																	56396419		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC065193	CCDS8901.2	12q13.13	2011-02-10			ENSG00000139531	ENSG00000139531	1.8.3.1		11460	protein-coding gene	gene with protein product		606887				7599189	Standard	XM_005269112		Approved		uc001siz.3	P51687	OTTHUMG00000128503	ENST00000394109.3:c.143A>T	12.37:g.56396419A>T	ENSP00000377668:p.Asp48Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_OxRdtase_Mopterin-bd_dom,pfam_MoCF_OxRdtse_dimer,pfam_Cyt_B5,superfamily_OxRdtase_Mopterin-bd_dom,superfamily_Ig_E-set,superfamily_Cyt_B5,pfscan_Cyt_B5,prints_Mopterin_OxRdtase_euk,prints_Cyt_B5	p.D48V	ENST00000394109.3	37	c.143	CCDS8901.2	12	.	.	.	.	.	.	.	.	.	.	A	7.815	0.716512	0.15306	.	.	ENSG00000139531	ENST00000356124;ENST00000266971;ENST00000394115;ENST00000552258;ENST00000548274;ENST00000546833;ENST00000551841;ENST00000394109	D;D;D;D;D	0.92149	-2.98;-2.98;-2.98;-2.98;-2.98	4.91	-1.21	0.09524	.	0.622471	0.16762	N	0.200564	D	0.83783	0.5329	L	0.29908	0.895	0.09310	N	0.999998	B	0.19817	0.039	B	0.14023	0.01	T	0.71444	-0.4591	10	0.38643	T	0.18	-0.1407	8.548	0.33433	0.5041:0.0:0.4959:0.0	.	48	P51687	SUOX_HUMAN	V	48	ENSP00000348440:D48V;ENSP00000266971:D48V;ENSP00000377674:D48V;ENSP00000450245:D48V;ENSP00000377668:D48V	ENSP00000266971:D48V	D	+	2	0	SUOX	54682686	0.000000	0.05858	0.002000	0.10522	0.090000	0.18270	-0.283000	0.08433	-0.077000	0.12752	0.477000	0.44152	GAT	SUOX	-	NULL	ENSG00000139531		0.537	SUOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUOX	HGNC	protein_coding	OTTHUMT00000250309.1	18	0.00	0	A	NM_000456		56396419	56396419	+1	no_errors	ENST00000266971	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	0.000	T
STX2	2054	genome.wustl.edu	37	12	131297512	131297512	+	Silent	SNP	G	G	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr12:131297512G>C	ENST00000392373.2	-	4	364	c.270C>G	c.(268-270)gcC>gcG	p.A90A	STX2_ENST00000261653.6_Silent_p.A90A|RP11-989F5.1_ENST00000546264.1_lincRNA|RP11-989F5.3_ENST00000542821.1_lincRNA|snoU13_ENST00000459050.1_RNA	NM_194356.2	NP_919337.1	P32856	STX2_HUMAN	syntaxin 2	90					acrosome reaction (GO:0007340)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|intracellular protein transport (GO:0006886)|organ morphogenesis (GO:0009887)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)|signal transduction (GO:0007165)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane raft (GO:0045121)	calcium-dependent protein binding (GO:0048306)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)	16	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.79e-06)|all cancers(50;5.27e-05)|Epithelial(86;5.29e-05)		CCTTTAACTTGGCTCGAATTT	0.244																																						dbGAP											0													88.0	94.0	92.0					12																	131297512		2202	4294	6496	-	-	-	SO:0001819	synonymous_variant	0			D14582	CCDS9269.1, CCDS9270.1	12q24	2008-02-05	2006-04-25	2006-04-25	ENSG00000111450	ENSG00000111450			3403	protein-coding gene	gene with protein product		132350	"""epimorphin"""	STX2B, STX2C, STX2A, EPIM		8938452, 15943887	Standard	NM_001980		Approved	EPM	uc001uio.4	P32856	OTTHUMG00000168365	ENST00000392373.2:c.270C>G	12.37:g.131297512G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VW8	Missense_Mutation	SNP	pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N	p.Q75E	ENST00000392373.2	37	c.223	CCDS9270.1	12																																																																																			STX2	-	pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N	ENSG00000111450		0.244	STX2-002	KNOWN	basic|CCDS	protein_coding	STX2	HGNC	protein_coding	OTTHUMT00000399455.2	94	0.00	0	G	NM_194356		131297512	131297512	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000344271	ensembl	human	known	69_37n	missense	170	20.47	44	SNP	0.987	C
SZT2	23334	genome.wustl.edu	37	1	43868973	43868973	+	Splice_Site	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:43868973G>A	ENST00000562955.1	+	2	153	c.153G>A	c.(151-153)ctG>ctA	p.L51L	SZT2_ENST00000310739.4_Splice_Site_p.L51L|SZT2_ENST00000372450.4_Splice_Site_p.L51L	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	51					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						AGGAGATGCTGGTGAGGCTTA	0.498																																						dbGAP											0													58.0	55.0	56.0					1																	43868973		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.153+1G>A	1.37:g.43868973G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Silent	SNP	NULL	p.L51	ENST00000562955.1	37	c.153	CCDS30694.2	1																																																																																			SZT2	-	NULL	ENSG00000198198		0.498	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	20	0.00	0	G	NM_015284	Silent	43868973	43868973	+1	no_errors	ENST00000562955	ensembl	human	known	69_37n	silent	12	20.00	3	SNP	1.000	A
TAF1L	138474	genome.wustl.edu	37	9	32631935	32631935	+	Missense_Mutation	SNP	G	G	A	rs140751314		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr9:32631935G>A	ENST00000242310.4	-	1	3732	c.3643C>T	c.(3643-3645)Cgc>Tgc	p.R1215C	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1215					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		GTCCGTATGCGCACATAGGCA	0.428																																						dbGAP											0													170.0	151.0	157.0					9																	32631935		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.3643C>T	9.37:g.32631935G>A	ENSP00000418379:p.Arg1215Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R1215C	ENST00000242310.4	37	c.3643	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	11.41	1.629212	0.28978	.	.	ENSG00000122728	ENST00000242310	T	0.60548	0.18	0.479	0.479	0.16796	.	0.096028	0.64402	D	0.000001	T	0.51466	0.1676	M	0.75615	2.305	0.80722	D	1	B	0.18968	0.032	B	0.15052	0.012	T	0.53041	-0.8494	10	0.87932	D	0	.	6.6915	0.23174	2.0E-4:0.0:0.9998:0.0	.	1215	Q8IZX4	TAF1L_HUMAN	C	1215	ENSP00000418379:R1215C	ENSP00000418379:R1215C	R	-	1	0	TAF1L	32621935	1.000000	0.71417	0.977000	0.42913	0.500000	0.33767	1.621000	0.36986	0.507000	0.28148	0.195000	0.17529	CGC	TAF1L	-	pirsf_TAF1_animal	ENSG00000122728		0.428	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	58	0.00	0	G			32631935	32631935	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	missense	51	27.14	19	SNP	0.994	A
TAS2R43	259289	genome.wustl.edu	37	12	11244166	11244166	+	Silent	SNP	G	G	C	rs35720106	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr12:11244166G>C	ENST00000531678.1	-	1	746	c.663C>G	c.(661-663)acC>acG	p.T221T	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	221					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)	p.T221T(1)		endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TGTGGACCTTGGTGCTGGGAT	0.398													.|||	3199	0.638778	0.1218	0.7205	5008	,	,		13366	0.9405		0.7793	False		,,,				2504	0.8241					dbGAP											1	Substitution - coding silent(1)	prostate(1)											130.0	112.0	118.0					12																	11244166		2176	4249	6425	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.663C>G	12.37:g.11244166G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.T221	ENST00000531678.1	37	c.663	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.398	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	26	0.00	0	G	NM_176884		11244166	11244166	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	24	14.29	4	SNP	0.185	C
TBC1D14	57533	genome.wustl.edu	37	4	6956059	6956059	+	Intron	SNP	T	T	C	rs11732887	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr4:6956059T>C	ENST00000409757.4	+	3	846				TBC1D14_ENST00000448507.1_Intron|AC092463.1_ENST00000580502.1_RNA|TBC1D14_ENST00000410031.1_Missense_Mutation_p.M11T	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14						negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						CTCCTGTTCATGGACAGGTTT	0.562													T|||	1500	0.299521	0.3041	0.3818	5008	,	,		18539	0.2708		0.3151	False		,,,				2504	0.2485					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.723-12972T>C	4.37:g.6956059T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.M11T	ENST00000409757.4	37	c.32	CCDS3394.2	4	676	0.30952380952380953	164	0.3333333333333333	113	0.31215469613259667	163	0.28496503496503495	236	0.3113456464379947	T	4.734	0.136532	0.09032	.	.	ENSG00000132405	ENST00000410031	T	0.04706	3.57	3.98	-1.51	0.08664	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.23056	P	0.99836453	.	.	.	.	.	.	T	0.48725	-0.9010	5	0.44086	T	0.13	.	4.0251	0.09683	0.0:0.3121:0.1838:0.5042	rs11732887	.	.	.	T	11	ENSP00000386343:M11T	ENSP00000386343:M11T	M	+	2	0	TBC1D14	7006960	0.166000	0.22962	0.061000	0.19648	0.268000	0.26511	0.094000	0.15107	-0.328000	0.08539	-0.399000	0.06403	ATG	TBC1D14	-	NULL	ENSG00000132405		0.562	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D14	HGNC	protein_coding	OTTHUMT00000206981.3	141	0.70	1	T	NM_020773		6956059	6956059	+1	no_errors	ENST00000410031	ensembl	human	putative	69_37n	missense	61	14.08	10	SNP	0.101	C
TBCD	6904	genome.wustl.edu	37	17	80882913	80882913	+	Silent	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:80882913C>T	ENST00000355528.4	+	27	2489	c.2359C>T	c.(2359-2361)Ctg>Ttg	p.L787L	TBCD_ENST00000539345.2_Silent_p.L787L	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	787					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			AGGCTTCCTTCTGAAAGGCCG	0.652																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.2359C>T	17.37:g.80882913C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Silent	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.L787	ENST00000355528.4	37	c.2359	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	C	0.159	-1.083250	0.01888	.	.	ENSG00000141556	ENST00000536182	.	.	.	5.14	2.08	0.27032	.	.	.	.	.	T	0.35219	0.0924	.	.	.	0.28030	N	0.934168	.	.	.	.	.	.	T	0.25502	-1.0130	4	.	.	.	.	8.3279	0.32169	0.0:0.7371:0.0:0.2629	.	.	.	.	F	725	.	.	S	+	2	0	TBCD	78476202	0.653000	0.27358	0.008000	0.14137	0.043000	0.13939	0.591000	0.23969	0.580000	0.29522	-0.827000	0.03088	TCT	TBCD	-	superfamily_ARM-type_fold	ENSG00000141556		0.652	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	40	0.00	0	C	NM_005993		80882913	80882913	+1	no_errors	ENST00000355528	ensembl	human	known	69_37n	silent	58	13.43	9	SNP	0.018	T
TLL2	7093	genome.wustl.edu	37	10	98170190	98170190	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr10:98170190C>T	ENST00000357947.3	-	9	1315	c.1090G>A	c.(1090-1092)Gca>Aca	p.A364T	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	364	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		AAACCAGGTGCAGAAAAGTTT	0.562																																						dbGAP											0													100.0	89.0	92.0					10																	98170190		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1090G>A	10.37:g.98170190C>T	ENSP00000350630:p.Ala364Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.A364T	ENST00000357947.3	37	c.1090	CCDS7449.1	10	.	.	.	.	.	.	.	.	.	.	C	24.9	4.578380	0.86645	.	.	ENSG00000095587	ENST00000357947	T	0.31510	1.49	5.4	5.4	0.78164	CUB (5);	0.000000	0.45361	D	0.000372	T	0.33585	0.0868	N	0.03000	-0.44	0.58432	D	0.999994	D	0.76494	0.999	D	0.79784	0.993	T	0.54146	-0.8337	10	0.54805	T	0.06	.	18.5289	0.90984	0.0:1.0:0.0:0.0	.	364	Q9Y6L7	TLL2_HUMAN	T	364	ENSP00000350630:A364T	ENSP00000350630:A364T	A	-	1	0	TLL2	98160180	0.995000	0.38212	0.965000	0.40720	0.995000	0.86356	3.197000	0.51028	2.711000	0.92665	0.561000	0.74099	GCA	TLL2	-	pfam_CUB,superfamily_CUB,smart_CUB,pirsf_BMP_1/tolloid-like,pfscan_CUB	ENSG00000095587		0.562	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1	48	0.00	0	C			98170190	98170190	-1	no_errors	ENST00000357947	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	0.997	T
TP53	7157	genome.wustl.edu	37	17	7577121	7577121	+	Missense_Mutation	SNP	G	G	A	rs121913343		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr17:7577121G>A	ENST00000269305.4	-	8	1006	c.817C>T	c.(817-819)Cgt>Tgt	p.R273C	TP53_ENST00000413465.2_Intron|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000455263.2_Missense_Mutation_p.R273C|TP53_ENST00000445888.2_Missense_Mutation_p.R273C|TP53_ENST00000420246.2_Missense_Mutation_p.R273C|TP53_ENST00000359597.4_Missense_Mutation_p.R273C	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	273	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> C (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:7887414, ECO:0000269|PubMed:9450901}.|R -> G (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation; abolishes sequence-specific DNA binding; does not induce SNAI1 degradation; dbSNP:rs28934576). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:1565144, ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1699228, ECO:0000269|PubMed:1868473, ECO:0000269|PubMed:7682763, ECO:0000269|Ref.14}.|R -> L (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> N (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).|R -> S (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R273C(481)|p.R273S(16)|p.R273G(9)|p.0?(8)|p.?(2)|p.R273fs*72(2)|p.R273fs*33(2)|p.R273fs*32(2)|p.V272>?(2)|p.F270fs*72(1)|p.R273_C275delRVC(1)|p.L265_K305del41(1)|p.S269fs*21(1)|p.E258fs*71(1)|p.R273fs*71(1)|p.F270_D281del12(1)|p.E271_R273delEVR(1)|p.V272_K292del21(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCACAAACACGCACCTCAAAG	0.542	R273C(8MGBA_CENTRAL_NERVOUS_SYSTEM)|R273C(BL70_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(EFO27_OVARY)|R273C(KARPAS299_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(MFE319_ENDOMETRIUM)|R273C(NCIH1048_LUNG)|R273C(PANC0213_PANCREAS)|R273C(PF382_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(RDES_BONE)|R273C(RH30_SOFT_TISSUE)|R273C(RPMI8402_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SH10TC_STOMACH)|R273C(SJRH30_SOFT_TISSUE)|R273C(SUDHL4_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R273C(SW1710_URINARY_TRACT)|R273C(SW1783_CENTRAL_NERVOUS_SYSTEM)|R273C(TT2609C02_THYROID)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	533	Substitution - Missense(506)|Whole gene deletion(8)|Deletion - Frameshift(8)|Deletion - In frame(5)|Insertion - Frameshift(2)|Unknown(2)|Complex(2)	central_nervous_system(117)|large_intestine(108)|ovary(32)|haematopoietic_and_lymphoid_tissue(31)|upper_aerodigestive_tract(30)|stomach(25)|urinary_tract(23)|lung(21)|breast(21)|liver(20)|endometrium(17)|oesophagus(17)|bone(16)|pancreas(15)|prostate(8)|skin(7)|cervix(6)|biliary_tract(6)|kidney(3)|thyroid(3)|vulva(2)|genital_tract(1)|penis(1)|adrenal_gland(1)|salivary_gland(1)|small_intestine(1)	GRCh37	CM010471|CM010473|CM951233	TP53	M	rs121913343						65.0	56.0	59.0					17																	7577121		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.817C>T	17.37:g.7577121G>A	ENSP00000269305:p.Arg273Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R273C	ENST00000269305.4	37	c.817	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400216	0.62177	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.92	3.95	0.45737	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99851	0.9931	M	0.90759	3.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.998;0.999;0.996	D	0.96877	0.9643	10	0.87932	D	0	-11.9995	11.2235	0.48869	0.0895:0.0:0.9105:0.0	.	273;273;273;273	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	C	273;273;273;273;273;262;141	ENSP00000352610:R273C;ENSP00000269305:R273C;ENSP00000398846:R273C;ENSP00000391127:R273C;ENSP00000391478:R273C;ENSP00000425104:R141C	ENSP00000269305:R273C	R	-	1	0	TP53	7517846	1.000000	0.71417	0.066000	0.19879	0.723000	0.41478	4.540000	0.60664	1.299000	0.44798	0.462000	0.41574	CGT	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	34	0.00	0	G	NM_000546		7577121	7577121	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	2	90.91	20	SNP	0.830	A
TRIM49C	642612	genome.wustl.edu	37	11	89774444	89774444	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:89774444G>A	ENST00000448984.1	+	8	1414	c.1085G>A	c.(1084-1086)cGg>cAg	p.R362Q	TRIM49C_ENST00000432771.1_Intron	NM_001195234.1	NP_001182163.1	P0CI26	TR49C_HUMAN	tripartite motif containing 49C	362	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|lung(4)	8						AATATGTATCGGAAGGAGAAG	0.448																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC126470	CCDS53694.1	11q14.3	2014-02-17	2012-05-18	2012-05-18	ENSG00000204449	ENSG00000204449		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	38877	protein-coding gene	gene with protein product			"""tripartite motif containing 49-like 2"""	TRIM49L2			Standard	NM_001195234		Approved		uc010rua.2	P0CI26		ENST00000448984.1:c.1085G>A	11.37:g.89774444G>A	ENSP00000388299:p.Arg362Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R362Q	ENST00000448984.1	37	c.1085	CCDS53694.1	11	.	.	.	.	.	.	.	.	.	.	G	5.692	0.312260	0.10789	.	.	ENSG00000204449	ENST00000448984	T	0.60920	0.15	0.823	0.823	0.18812	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	.	.	.	.	T	0.41305	0.1153	L	0.36672	1.1	0.09310	N	1	B	0.15141	0.012	B	0.17098	0.017	T	0.23976	-1.0173	8	.	.	.	.	4.9575	0.14050	0.0:0.0:1.0:0.0	.	362	P0CI26	T49L2_HUMAN	Q	362	ENSP00000388299:R362Q	.	R	+	2	0	TRIM49L2	89414092	0.000000	0.05858	0.002000	0.10522	0.003000	0.03518	0.026000	0.13599	0.742000	0.32697	0.305000	0.20034	CGG	TRIM49C	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000204449		0.448	TRIM49C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM49C	HGNC	protein_coding	OTTHUMT00000395455.1	154	0.00	0	G	NM_001195234		89774444	89774444	+1	no_errors	ENST00000448984	ensembl	human	known	69_37n	missense	89	11.88	12	SNP	0.013	A
TRIML2	205860	genome.wustl.edu	37	4	189012538	189012538	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr4:189012538C>A	ENST00000512729.1	-	7	1527	c.1153G>T	c.(1153-1155)Gtt>Ttt	p.V385F	TRIML2_ENST00000326754.3_Missense_Mutation_p.V410F	NM_173553.1	NP_775824.1	Q8N7C3	TRIMM_HUMAN	tripartite motif family-like 2	385					protein ubiquitination (GO:0016567)|response to retinoic acid (GO:0032526)		ligase activity (GO:0016874)			central_nervous_system(2)|kidney(1)|large_intestine(7)|lung(25)|prostate(3)|urinary_tract(1)	39		all_cancers(14;3.11e-44)|all_epithelial(14;7.86e-31)|all_lung(41;4.3e-13)|Lung NSC(41;9.69e-13)|Melanoma(20;7.86e-05)|Breast(6;0.000148)|all_hematologic(60;0.0202)|Hepatocellular(41;0.0218)|Renal(120;0.0376)|Prostate(90;0.0513)		OV - Ovarian serous cystadenocarcinoma(60;1.79e-11)|BRCA - Breast invasive adenocarcinoma(30;4.52e-06)|GBM - Glioblastoma multiforme(59;1.62e-05)|STAD - Stomach adenocarcinoma(60;0.000279)|LUSC - Lung squamous cell carcinoma(40;0.0091)|READ - Rectum adenocarcinoma(43;0.163)		TAAGGGCTAACAGTAGCATCA	0.428																																						dbGAP											0													127.0	121.0	123.0					4																	189012538		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098667	CCDS3850.1	4q35.2	2014-02-12	2007-12-14		ENSG00000179046	ENSG00000179046			26378	protein-coding gene	gene with protein product	"""SPRY domain containing 6"""						Standard	NM_173553		Approved	FLJ25801, SPRYD6	uc003izl.2	Q8N7C3	OTTHUMG00000160225	ENST00000512729.1:c.1153G>T	4.37:g.189012538C>A	ENSP00000422581:p.Val385Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6J6	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	p.V385F	ENST00000512729.1	37	c.1153	CCDS3850.1	4	.	.	.	.	.	.	.	.	.	.	C	15.25	2.776771	0.49786	.	.	ENSG00000179046	ENST00000512729;ENST00000326754	T;T	0.60797	0.37;0.16	5.18	1.52	0.23074	.	2.581270	0.01718	N	0.028143	T	0.44477	0.1295	N	0.22421	0.69	0.09310	N	1	B;B	0.23185	0.081;0.081	B;B	0.20384	0.029;0.029	T	0.33574	-0.9863	10	0.62326	D	0.03	.	4.1999	0.10460	0.1517:0.4721:0.2937:0.0824	.	410;385	B7ZLC3;Q8N7C3	.;TRIMM_HUMAN	F	385;410	ENSP00000422581:V385F;ENSP00000317498:V410F	ENSP00000317498:V410F	V	-	1	0	TRIML2	189249532	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.559000	0.05971	0.134000	0.18681	0.655000	0.94253	GTT	TRIML2	-	NULL	ENSG00000179046		0.428	TRIML2-001	KNOWN	basic|CCDS	protein_coding	TRIML2	HGNC	protein_coding	OTTHUMT00000359733.1	28	0.00	0	C	NM_173553		189012538	189012538	-1	no_errors	ENST00000512729	ensembl	human	known	69_37n	missense	5	50.00	6	SNP	0.000	A
TRPC5	7224	genome.wustl.edu	37	X	111095577	111095577	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:111095577C>T	ENST00000262839.2	-	5	2244	c.1326G>A	c.(1324-1326)atG>atA	p.M442I		NM_012471.2	NP_036603.1	Q9UL62	TRPC5_HUMAN	transient receptor potential cation channel, subfamily C, member 5	442					axon guidance (GO:0007411)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|nervous system development (GO:0007399)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			biliary_tract(1)|breast(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(38)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	62						AGAGGGAGTTCATTGCAAAAT	0.423																																						dbGAP											0													159.0	130.0	140.0					X																	111095577		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054568	CCDS14561.1	Xq23	2014-06-13			ENSG00000072315	ENSG00000072315		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12337	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 159"""	300334				10493832, 16382100	Standard	NM_012471		Approved	PPP1R159	uc004epl.1	Q9UL62	OTTHUMG00000022212	ENST00000262839.2:c.1326G>A	X.37:g.111095577C>T	ENSP00000262839:p.Met442Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP53|O75233|Q5JXY8|Q9Y514	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC5_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.M442I	ENST00000262839.2	37	c.1326	CCDS14561.1	X	.	.	.	.	.	.	.	.	.	.	C	32	5.110571	0.94292	.	.	ENSG00000072315	ENST00000262839	D	0.98060	-4.69	5.84	5.84	0.93424	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97983	0.9336	L	0.52206	1.635	0.80722	D	1	P;D	0.54207	0.776;0.965	P;P	0.61533	0.673;0.89	D	0.98233	1.0484	10	0.45353	T	0.12	-14.1128	19.057	0.93069	0.0:1.0:0.0:0.0	.	443;442	Q59G51;Q9UL62	.;TRPC5_HUMAN	I	442	ENSP00000262839:M442I	ENSP00000262839:M442I	M	-	3	0	TRPC5	110982233	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.449000	0.82847	0.600000	0.82982	ATG	TRPC5	-	pfam_Ion_trans_dom,tigrfam_TRP_channel	ENSG00000072315		0.423	TRPC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC5	HGNC	protein_coding	OTTHUMT00000057945.1	36	0.00	0	C	NM_012471		111095577	111095577	-1	no_errors	ENST00000262839	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	1.000	T
TSSC2	650368	genome.wustl.edu	37	11	3430168	3430168	+	RNA	SNP	C	C	T	rs7123578	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:3430168C>T	ENST00000529482.1	+	0	2297									tumor suppressing subtransferable candidate 2 pseudogene																		GAAATGATGGCAGTAGTGCCA	0.547													N|||	323	0.0644968	0.1475	0.0562	5008	,	,		17580	0.0		0.0666	False		,,,				2504	0.0225					dbGAP											0																																										-	-	-			0					11p15.4	2014-06-05	2008-06-30		ENSG00000223756	ENSG00000223756			12384	pseudogene	pseudogene	"""tumor-supressing STF cDNA 2"", ""asparagine-linked glycosylation 1 homolog (yeast, beta-1,4-mannosyltransferase) (ALG1) pseudogene"""	608999	"""tumor suppressing subtransferable candidate 2"""			9403053	Standard	NR_024248		Approved				OTTHUMG00000011705		11.37:g.3430168C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000529482.1	37	NULL		11																																																																																			TSSC2	-	-	ENSG00000223756		0.547	TSSC2-003	KNOWN	basic	processed_transcript	TSSC2	HGNC	pseudogene	OTTHUMT00000392020.1	57	0.00	0	C			3430168	3430168	+1	no_errors	ENST00000529482	ensembl	human	known	69_37n	rna	34	12.82	5	SNP	0.004	T
UBE3B	89910	genome.wustl.edu	37	12	109972557	109972557	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr12:109972557C>G	ENST00000342494.3	+	28	3772	c.3177C>G	c.(3175-3177)atC>atG	p.I1059M	UBE3B_ENST00000434735.2_Missense_Mutation_p.I1059M	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	1059	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						GCTACGCCATCAGCATGAACA	0.637																																						dbGAP											0													107.0	93.0	98.0					12																	109972557		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.3177C>G	12.37:g.109972557C>G	ENSP00000340596:p.Ile1059Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.I1059M	ENST00000342494.3	37	c.3177	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.419040	0.83559	.	.	ENSG00000151148	ENST00000434735;ENST00000342494	T;T	0.60920	0.15;0.15	5.3	4.36	0.52297	HECT (4);	0.049894	0.85682	D	0.000000	T	0.78027	0.4219	M	0.87038	2.855	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82194	-0.0578	10	0.87932	D	0	-21.5725	13.8287	0.63366	0.1534:0.8466:0.0:0.0	.	1059	Q7Z3V4	UBE3B_HUMAN	M	1059	ENSP00000391529:I1059M;ENSP00000340596:I1059M	ENSP00000340596:I1059M	I	+	3	3	UBE3B	108456940	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.639000	0.67868	2.474000	0.83562	0.563000	0.77884	ATC	UBE3B	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000151148		0.637	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	42	0.00	0	C	NM_183415		109972557	109972557	+1	no_errors	ENST00000342494	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	1.000	G
USH2A	7399	genome.wustl.edu	37	1	215914804	215914804	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:215914804A>C	ENST00000307340.3	-	60	12010	c.11624T>G	c.(11623-11625)cTt>cGt	p.L3875R	USH2A_ENST00000366943.2_Missense_Mutation_p.L3875R	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	3875	Fibronectin type-III 24. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CAGTGCCTTAAGAACAGGAGA	0.398										HNSCC(13;0.011)																												dbGAP											0													123.0	124.0	124.0					1																	215914804		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.11624T>G	1.37:g.215914804A>C	ENSP00000305941:p.Leu3875Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L3875R	ENST00000307340.3	37	c.11624	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	A	13.06	2.125511	0.37533	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.56611	0.45;0.45	5.38	5.38	0.77491	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.393432	0.18464	N	0.140434	T	0.65974	0.2743	M	0.85630	2.765	0.09310	N	1	P	0.47409	0.895	P	0.47470	0.548	T	0.65825	-0.6074	10	0.72032	D	0.01	.	15.566	0.76294	1.0:0.0:0.0:0.0	.	3875	O75445	USH2A_HUMAN	R	3875	ENSP00000305941:L3875R;ENSP00000355910:L3875R	ENSP00000305941:L3875R	L	-	2	0	USH2A	213981427	0.383000	0.25156	0.101000	0.21167	0.092000	0.18411	5.271000	0.65553	2.254000	0.74563	0.533000	0.62120	CTT	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.398	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	44	0.00	0	A	NM_007123		215914804	215914804	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	0.056	C
VWCE	220001	genome.wustl.edu	37	11	61058851	61058851	+	Intron	SNP	A	A	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr11:61058851A>G	ENST00000335613.5	-	3	592					NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains							extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						CAGGTGAGACACGAGGAACTG	0.617																																						dbGAP											0													40.0	45.0	43.0					11																	61058851		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.206-26T>C	11.37:g.61058851A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	NULL	p.V103A	ENST00000335613.5	37	c.308	CCDS8002.1	11																																																																																			VWCE	-	NULL	ENSG00000167992		0.617	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	28	0.00	0	A	NM_152718		61058851	61058851	-1	no_errors	ENST00000535599	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.000	G
WHSC1L1	54904	genome.wustl.edu	37	8	38172997	38172997	+	Silent	SNP	C	C	T			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr8:38172997C>T	ENST00000317025.8	-	11	2569	c.2052G>A	c.(2050-2052)caG>caA	p.Q684Q	WHSC1L1_ENST00000433384.2_Silent_p.Q684Q|WHSC1L1_ENST00000525081.1_5'Flank|WHSC1L1_ENST00000527502.1_Silent_p.Q684Q	NM_023034.1	NP_075447.1	Q9BZ95	NSD3_HUMAN	Wolf-Hirschhorn syndrome candidate 1-like 1	684					histone lysine methylation (GO:0034968)|histone methylation (GO:0016571)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	24	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.065)	Epithelial(3;3.12e-43)|all cancers(3;1.72e-38)|BRCA - Breast invasive adenocarcinoma(5;2.84e-27)|LUSC - Lung squamous cell carcinoma(2;2.79e-25)|Lung(2;5.03e-23)|COAD - Colon adenocarcinoma(9;0.0511)			AATCCATGGACTGCACATCAG	0.418			T	NUP98	AML																																	dbGAP		Dom	yes		8	8p12	54904	Wolf-Hirschhorn syndrome candidate 1-like 1 (NSD3)		L	0													174.0	160.0	165.0					8																	38172997		1929	4142	6071	-	-	-	SO:0001819	synonymous_variant	0			AF332469	CCDS6105.1, CCDS43729.1	8p11.2	2013-05-20			ENSG00000147548	ENSG00000147548			12767	protein-coding gene	gene with protein product		607083				10802047, 23269674	Standard	NM_023034		Approved	FLJ20353, NSD3	uc003xli.3	Q9BZ95		ENST00000317025.8:c.2052G>A	8.37:g.38172997C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL11|D3DSX1|Q1RMD3|Q3B796|Q6ZSA5|Q9BYU8|Q9BYU9|Q9H2M8|Q9H9W9|Q9NXA6	Silent	SNP	pfam_PWWP,pfam_SET_dom,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.Q684	ENST00000317025.8	37	c.2052	CCDS43729.1	8																																																																																			WHSC1L1	-	superfamily_Znf_FYVE_PHD	ENSG00000147548		0.418	WHSC1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WHSC1L1	HGNC	protein_coding	OTTHUMT00000381924.3	35	0.00	0	C	NM_023034		38172997	38172997	-1	no_errors	ENST00000317025	ensembl	human	known	69_37n	silent	30	44.44	24	SNP	1.000	T
WIZ	58525	genome.wustl.edu	37	19	15547904	15547904	+	Missense_Mutation	SNP	C	C	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr19:15547904C>A	ENST00000389282.4	-	4	2522	c.2309G>T	c.(2308-2310)cGc>cTc	p.R770L	WIZ_ENST00000263381.7_Missense_Mutation_p.R81L			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	770					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						GAAGTCACAGCGCATCAGGCT	0.652																																						dbGAP											0													30.0	37.0	35.0					19																	15547904		2147	4244	6391	-	-	-	SO:0001583	missense	0			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.2309G>T	19.37:g.15547904C>A	ENSP00000373933:p.Arg770Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R770L	ENST00000389282.4	37	c.2309		19	.	.	.	.	.	.	.	.	.	.	C	15.34	2.804639	0.50315	.	.	ENSG00000011451	ENST00000389282;ENST00000263381	T;T	0.27402	1.67;1.68	4.26	4.26	0.50523	.	0.232441	0.35525	N	0.003158	T	0.28566	0.0707	.	.	.	0.80722	D	1	B	0.30634	0.288	B	0.29524	0.103	T	0.15578	-1.0432	9	0.54805	T	0.06	-26.1989	15.6849	0.77402	0.0:1.0:0.0:0.0	.	81	O95785-2	.	L	770;81	ENSP00000373933:R770L;ENSP00000263381:R81L	ENSP00000263381:R81L	R	-	2	0	WIZ	15408904	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.326000	0.65875	2.215000	0.71742	0.449000	0.29647	CGC	WIZ	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000011451		0.652	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		47	0.00	0	C	NM_021241		15547904	15547904	-1	no_errors	ENST00000389282	ensembl	human	known	69_37n	missense	16	55.56	20	SNP	1.000	A
XPNPEP2	7512	genome.wustl.edu	37	X	128880270	128880270	+	Silent	SNP	T	T	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:128880270T>C	ENST00000371106.3	+	5	549	c.357T>C	c.(355-357)acT>acC	p.T119T	XPNPEP2_ENST00000371105.3_Silent_p.T119T	NM_003399.5	NP_003390.4	O43895	XPP2_HUMAN	X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound	119						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			endometrium(3)|kidney(3)|large_intestine(5)|liver(1)|lung(20)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	37						GCTACTGGACTCAGGCTGAGC	0.552																																						dbGAP											0													59.0	47.0	51.0					X																	128880270		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U90724	CCDS14613.1	Xq25	2008-02-05			ENSG00000122121	ENSG00000122121	3.4.11.9		12823	protein-coding gene	gene with protein product		300145				9375790, 9628831	Standard	NM_003399		Approved		uc004eut.1	O43895	OTTHUMG00000022373	ENST00000371106.3:c.357T>C	X.37:g.128880270T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV16|O75994	Silent	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.T119	ENST00000371106.3	37	c.357	CCDS14613.1	X																																																																																			XPNPEP2	-	pfam_Creatinase	ENSG00000122121		0.552	XPNPEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPNPEP2	HGNC	protein_coding	OTTHUMT00000058210.1	37	0.00	0	T	NM_003399		128880270	128880270	+1	no_errors	ENST00000371106	ensembl	human	known	69_37n	silent	32	13.51	5	SNP	1.000	C
ZAN	7455	genome.wustl.edu	37	7	100392955	100392955	+	RNA	SNP	C	C	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr7:100392955C>G	ENST00000348028.3	+	0	8154				ZAN_ENST00000427578.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000349350.6_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TCCCAGAAAGCCAGGTGAGGG	0.537																																						dbGAP											0													32.0	36.0	35.0					7																	100392955		1981	4148	6129	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100392955C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.P2663A	ENST00000348028.3	37	c.7987		7	.	.	.	.	.	.	.	.	.	.	C	13.73	2.325536	0.41197	.	.	ENSG00000146839	ENST00000546292;ENST00000546213	T;T	0.22743	2.43;1.94	4.37	-1.01	0.10169	.	0.719794	0.11465	N	0.561339	T	0.07728	0.0194	.	.	.	0.09310	N	1	P;P;P	0.42908	0.793;0.793;0.689	B;B;B	0.37692	0.256;0.256;0.13	T	0.19451	-1.0305	9	0.09843	T	0.71	.	2.7222	0.05204	0.303:0.3501:0.0:0.347	.	1126;2663;2755	F5GX59;F5H0T8;Q9Y493	.;.;ZAN_HUMAN	A	2663;1126	ENSP00000445943:P2663A;ENSP00000441117:P1126A	ENSP00000441117:P1126A	P	+	1	0	ZAN	100230891	0.678000	0.27586	0.066000	0.19879	0.057000	0.15508	0.153000	0.16323	-0.066000	0.12998	-0.345000	0.07892	CCA	ZAN	-	NULL	ENSG00000146839		0.537	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	34	0.00	0	C	NM_003386		100392955	100392955	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	20	58.33	28	SNP	0.090	G
ZCWPW2	152098	genome.wustl.edu	37	3	28566064	28566064	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr3:28566064A>C	ENST00000383768.2	+	10	1144	c.956A>C	c.(955-957)aAc>aCc	p.N319T	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.N319T			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	319							zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						CTGTTTGAAAACCACTATGAA	0.328																																						dbGAP											0													117.0	132.0	127.0					3																	28566064		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.956A>C	3.37:g.28566064A>C	ENSP00000373278:p.Asn319Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP,pfscan_PWWP,pfscan_Znf_CW	p.N319T	ENST00000383768.2	37	c.956	CCDS33723.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	8.055|8.055	0.766874|0.766874	0.15983|0.15983	.|.	.|.	ENSG00000206559|ENSG00000206559	ENST00000419130|ENST00000383768;ENST00000421010	.|T;T	.|0.41400	.|1.0;1.0	6.03|6.03	2.33|2.33	0.28932|0.28932	.|.	.|0.305675	.|0.28442	.|N	.|0.015325	T|T	0.24967|0.24967	0.0606|0.0606	L|L	0.32530|0.32530	0.975|0.975	0.09310|0.09310	N|N	1|1	.|P	.|0.35077	.|0.483	.|B	.|0.30943	.|0.122	T|T	0.18713|0.18713	-1.0328|-1.0328	5|10	.|0.62326	.|D	.|0.03	-0.9877|-0.9877	3.2186|3.2186	0.06707|0.06707	0.5425:0.0:0.1632:0.2944|0.5425:0.0:0.1632:0.2944	.|.	.|319	.|Q504Y3	.|ZCPW2_HUMAN	N|T	203|319	.|ENSP00000373278:N319T;ENSP00000412386:N319T	.|ENSP00000373278:N319T	K|N	+|+	3|2	2|0	ZCWPW2|ZCWPW2	28541068|28541068	0.848000|0.848000	0.29623|0.29623	0.000000|0.000000	0.03702|0.03702	0.088000|0.088000	0.18126|0.18126	0.920000|0.920000	0.28705|0.28705	0.160000|0.160000	0.19432|0.19432	0.533000|0.533000	0.62120|0.62120	AAA|AAC	ZCWPW2	-	NULL	ENSG00000206559		0.328	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCWPW2	HGNC	protein_coding	OTTHUMT00000341318.1	64	0.00	0	A	XM_087384		28566064	28566064	+1	no_errors	ENST00000383768	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	0.007	C
ZDHHC11	79844	genome.wustl.edu	37	5	712139	712139	+	Intron	SNP	T	T	A	rs111351502	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr5:712139T>A	ENST00000424784.2	-	14	1931				ZDHHC11B_ENST00000508859.2_3'UTR|ZDHHC11B_ENST00000522356.1_5'UTR			Q9H8X9	ZDH11_HUMAN	zinc finger, DHHC-type containing 11							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(10)|pancreas(1)|prostate(5)|skin(2)|urinary_tract(1)	21			Epithelial(17;0.000445)|all cancers(22;0.00176)|OV - Ovarian serous cystadenocarcinoma(19;0.00227)|Lung(60;0.0863)			GCAGCCCATCTTCCTGGAGAT	0.562													t|||	2442	0.48762	0.5522	0.4683	5008	,	,		24038	0.5248		0.4911	False		,,,				2504	0.3722					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK023215	CCDS3857.1	5p15.2	2011-02-09			ENSG00000188818	ENSG00000188818		"""Zinc fingers, DHHC-type"""	19158	protein-coding gene	gene with protein product							Standard	NM_024786		Approved	ZNF399, FLJ13153	uc011cma.1	Q9H8X9	OTTHUMG00000090319	ENST00000424784.2:c.1237-1140A>T	5.37:g.712139T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWR9	RNA	SNP	-	NULL	ENST00000424784.2	37	NULL	CCDS3857.1	5																																																																																			ZDHHC11B	-	-	ENSG00000206077		0.562	ZDHHC11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC11B	HGNC	protein_coding		23	0.00	0	T	NM_024786		712139	712139	-1	no_errors	ENST00000522356	ensembl	human	known	69_37n	rna	26	21.21	7	SNP	0.000	A
ZDHHC8P1	150244	genome.wustl.edu	37	22	23736213	23736213	+	RNA	SNP	T	T	C	rs7290316	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr22:23736213T>C	ENST00000255890.4	-	0	1263									zinc finger, DHHC-type containing 8 pseudogene 1																		GGGCAGGGGCTGGGCCAGCTG	0.617													.|||	1019	0.203474	0.1422	0.2522	5008	,	,		12981	0.003		0.3499	False		,,,				2504	0.3078					dbGAP											0																																										-	-	-			0					22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23736213T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000255890.4	37	NULL		22																																																																																			ZDHHC8P1	-	-	ENSG00000133519		0.617	ZDHHC8P1-001	KNOWN	basic	processed_transcript	ZDHHC8P1	HGNC	pseudogene	OTTHUMT00000319397.1	56	0.00	0	T	NR_003950		23736213	23736213	-1	no_errors	ENST00000420968	ensembl	human	known	69_37n	rna	19	17.39	4	SNP	0.000	C
ZNF41	7592	genome.wustl.edu	37	X	47307460	47307460	+	Missense_Mutation	SNP	T	T	G			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:47307460T>G	ENST00000377065.4	-	5	2348	c.1709A>C	c.(1708-1710)cAg>cCg	p.Q570P	ZNF41_ENST00000465311.1_5'Flank|ZNF41_ENST00000313116.7_Missense_Mutation_p.Q570P|ZNF41_ENST00000397050.2_Missense_Mutation_p.Q580P	NM_153380.2	NP_700359.1	P51814	ZNF41_HUMAN	zinc finger protein 41	612					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|upper_aerodigestive_tract(2)	24		all_lung(315;0.000129)				ATGAGATTTCTGATGTATTTT	0.428																																						dbGAP											0													84.0	70.0	74.0					X																	47307460		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60155	CCDS14279.1	Xp11.23	2013-01-08			ENSG00000147124	ENSG00000147124		"""Zinc fingers, C2H2-type"", ""-"""	13107	protein-coding gene	gene with protein product		314995				2037297	Standard	NM_007130		Approved	MGC8941, MRX89	uc004dhy.4	P51814	OTTHUMG00000021448	ENST00000377065.4:c.1709A>C	X.37:g.47307460T>G	ENSP00000366265:p.Gln570Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V6|B4DH01|Q96LE8|Q9UMC4|Q9UMV5|Q9UMV6|Q9UMV7|Q9UMV8|Q9UMV9|Q9UMW0|Q9UMW1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q580P	ENST00000377065.4	37	c.1739	CCDS14279.1	X	.	.	.	.	.	.	.	.	.	.	T	14.73	2.622473	0.46840	.	.	ENSG00000147124	ENST00000313116;ENST00000377065;ENST00000397050	T;T;T	0.07567	3.18;3.18;3.18	3.98	3.98	0.46160	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.33401	N	0.004960	T	0.33323	0.0859	M	0.91038	3.17	0.25583	N	0.986778	D;D;D;D;D	0.65815	0.977;0.977;0.995;0.991;0.984	P;P;D;P;P	0.77004	0.786;0.786;0.989;0.845;0.704	T	0.19614	-1.0300	10	0.87932	D	0	.	10.3222	0.43773	0.0:0.0:0.0:1.0	.	570;572;580;604;612	P51814-6;P51814-2;P51814-3;P51814-5;P51814	.;.;.;.;ZNF41_HUMAN	P	570;570;580	ENSP00000315173:Q570P;ENSP00000366265:Q570P;ENSP00000380243:Q580P	ENSP00000315173:Q570P	Q	-	2	0	ZNF41	47192404	0.861000	0.29849	1.000000	0.80357	0.997000	0.91878	1.113000	0.31184	1.798000	0.52647	0.486000	0.48141	CAG	ZNF41	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000147124		0.428	ZNF41-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF41	HGNC	protein_coding	OTTHUMT00000056429.1	33	0.00	0	T	NM_153380		47307460	47307460	-1	no_errors	ENST00000397050	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	1.000	G
ZMYM3	9203	genome.wustl.edu	37	X	70460278	70460278	+	3'UTR	SNP	T	T	A			TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chrX:70460278T>A	ENST00000353904.2	-	0	4788				ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000314425.5_3'UTR|ZMYM3_ENST00000373988.1_3'UTR|ZMYM3_ENST00000373984.3_3'UTR|ZMYM3_ENST00000373998.1_3'UTR	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3						cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TCATTGTTTATTTCTTACCTT	0.468																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.*488A>T	X.37:g.70460278T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVV3|O15089|Q96E26	RNA	SNP	-	NULL	ENST00000353904.2	37	NULL	CCDS14409.1	X																																																																																			ZMYM3	-	-	ENSG00000147130		0.468	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	41	0.00	0	T	NM_201599		70460278	70460278	-1	no_errors	ENST00000489332	ensembl	human	known	69_37n	rna	36	25.00	12	SNP	0.001	A
ZNF625	90589	genome.wustl.edu	37	19	12253327	12253327	+	Intron	SNP	C	C	T	rs3760779	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr19:12253327C>T	ENST00000542938.1	-	5	1423				ZNF20_ENST00000334213.5_5'Flank|ZNF625-ZNF20_ENST00000430024.1_Intron|ZNF20_ENST00000600335.1_5'Flank|CTC-359D24.3_ENST00000472362.1_RNA			Q96I27	ZN625_HUMAN	zinc finger protein 625						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(6)|lung(4)|skin(2)	14						GGTTCATCTGCCCATGAGTTC	0.448													C|||	954	0.190495	0.2995	0.1311	5008	,	,		16522	0.2024		0.1292	False		,,,				2504	0.136					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC007868	CCDS12269.1, CCDS12269.2	19p13.2	2013-01-08			ENSG00000257591	ENSG00000257591		"""Zinc fingers, C2H2-type"", ""-"""	30571	protein-coding gene	gene with protein product						12477932	Standard	NM_145233		Approved		uc010dyo.2	Q96I27	OTTHUMG00000156407	ENST00000542938.1:c.918+128G>A	19.37:g.12253327C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU45|I3L0E9	Silent	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.G91	ENST00000542938.1	37	c.273		19																																																																																			ZNF625	-	NULL	ENSG00000257591		0.448	ZNF625-202	KNOWN	basic	protein_coding	ZNF625	Clone_based_vega_gene	protein_coding		103	0.00	0	C	NM_145233		12253327	12253327	-1	no_start_codon	ENST00000414892	ensembl	human	putative	69_37n	silent	53	11.67	7	SNP	0.998	T
ZNF701	55762	genome.wustl.edu	37	19	53086598	53086598	+	Missense_Mutation	SNP	G	G	A	rs3745102	byFrequency	TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr19:53086598G>A	ENST00000540331.1	+	5	1709	c.1484G>A	c.(1483-1485)cGt>cAt	p.R495H	CTD-3099C6.7_ENST00000599222.1_RNA|ZNF701_ENST00000391785.3_Missense_Mutation_p.R429H|ZNF701_ENST00000301093.2_Missense_Mutation_p.R495H	NM_001172655.1	NP_001166126.1	Q9NV72	ZN701_HUMAN	zinc finger protein 701	495			R -> H (in dbSNP:rs67702454). {ECO:0000269|PubMed:14702039}.		regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(5)|kidney(1)|large_intestine(2)|lung(6)	14				OV - Ovarian serous cystadenocarcinoma(262;0.0105)|GBM - Glioblastoma multiforme(134;0.0402)		GCATGTCATCGTAGACTTCAT	0.363													g|||	1417	0.282947	0.0522	0.2839	5008	,	,		22708	0.3373		0.3598	False		,,,				2504	0.4591				NSCLC(89;451 1475 9611 20673 52284)	dbGAP											0													50.0	41.0	44.0					19																	53086598		2203	4291	6494	-	-	-	SO:0001583	missense	0			AK001753	CCDS33092.1, CCDS54311.1	19q13.41	2013-01-08				ENSG00000167562		"""Zinc fingers, C2H2-type"", ""-"""	25597	protein-coding gene	gene with protein product							Standard	NM_018260		Approved	FLJ10891	uc021uyw.1	Q9NV72		ENST00000540331.1:c.1484G>A	19.37:g.53086598G>A	ENSP00000444339:p.Arg495His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM8|B9EGF2|F5GZM6|Q66K42	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R495H	ENST00000540331.1	37	c.1484	CCDS54311.1	19	581	0.266025641025641	27	0.054878048780487805	106	0.292817679558011	182	0.3181818181818182	266	0.35092348284960423	N	4.277	0.050616	0.08243	.	.	ENSG00000167562	ENST00000391785;ENST00000301093;ENST00000540331	T;T;T	0.18502	2.21;2.21;2.21	1.98	-2.21	0.06973	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00012	0.0000	L	0.42487	1.325	0.80722	P	0.0	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.47275	-0.9130	8	0.24483	T	0.36	.	7.8679	0.29547	0.4668:0.0:0.5332:0.0	rs3745102	495;429	F5GZM6;Q9NV72	.;ZN701_HUMAN	H	429;495;495	ENSP00000375662:R429H;ENSP00000301093:R495H;ENSP00000444339:R495H	ENSP00000301093:R495H	R	+	2	0	ZNF701	57778410	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.539000	0.02202	-0.969000	0.03573	-0.598000	0.04106	CGT	ZNF701	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167562		0.363	ZNF701-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF701	HGNC	protein_coding	OTTHUMT00000463467.1	50	0.00	0	G	NM_018260		53086598	53086598	+1	no_errors	ENST00000301093	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.000	A
ZYG11B	79699	genome.wustl.edu	37	1	53255692	53255692	+	Silent	SNP	C	C	T	rs370774638		TCGA-EW-A1PC-01B-11D-A21Q-09	TCGA-EW-A1PC-10A-01D-A21Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	1c0e384f-7254-4afe-93c0-b3fc6c6a7894	58ddddd4-cb14-4081-ac9f-c291dcddc24d	g.chr1:53255692C>T	ENST00000294353.6	+	6	1432	c.1287C>T	c.(1285-1287)ctC>ctT	p.L429L	ZYG11B_ENST00000443756.2_Silent_p.L429L|ZYG11B_ENST00000545132.1_Silent_p.L429L	NM_024646.2	NP_078922.1	Q9C0D3	ZY11B_HUMAN	zyg-11 family member B, cell cycle regulator	429										breast(1)|endometrium(1)|kidney(6)|large_intestine(5)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	30						AGAATTGCCTCCTTTCACTTT	0.328																																						dbGAP											0													95.0	102.0	100.0					1																	53255692		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051517	CCDS30717.1	1p32.3	2013-01-17	2012-12-10	2005-07-11	ENSG00000162378	ENSG00000162378		"""ZYG11 cell cycle regulator family"""	25820	protein-coding gene	gene with protein product			"""zyg-11 homolog (C. elegans)"", ""zyg-11 homolog B (C. elegans)"""	ZYG11		11214970	Standard	NM_024646		Approved	FLJ13456	uc001cuj.3	Q9C0D3	OTTHUMG00000008938	ENST00000294353.6:c.1287C>T	1.37:g.53255692C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2X3|Q9H8L8	Silent	SNP	superfamily_ARM-type_fold	p.L429	ENST00000294353.6	37	c.1287	CCDS30717.1	1																																																																																			ZYG11B	-	superfamily_ARM-type_fold	ENSG00000162378		0.328	ZYG11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11B	HGNC	protein_coding	OTTHUMT00000024749.1	21	0.00	0	C	NM_024646		53255692	53255692	+1	no_errors	ENST00000294353	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	0.973	T
