#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB5	340273	genome.wustl.edu	37	7	20687685	20687685	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr7:20687685C>T	ENST00000404938.2	+	11	1842	c.1190C>T	c.(1189-1191)tCa>tTa	p.S397L	ABCB5_ENST00000406935.1_5'UTR|ABCB5_ENST00000477094.1_3'UTR|ABCB5_ENST00000258738.6_5'UTR|ABCB5_ENST00000443026.2_5'UTR	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	397	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						AATTATCCATCAAGACCATCT	0.343																																						dbGAP											0													48.0	45.0	46.0					7																	20687685		1567	3580	5147	-	-	-	SO:0001583	missense	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.1190C>T	7.37:g.20687685C>T	ENSP00000384881:p.Ser397Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S397L	ENST00000404938.2	37	c.1190	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	C	16.73	3.205476	0.58234	.	.	ENSG00000004846	ENST00000404938	D	0.90955	-2.76	5.29	4.4	0.53042	.	.	.	.	.	D	0.92773	0.7702	L	0.44542	1.39	0.80722	D	1	D	0.76494	0.999	D	0.71414	0.973	D	0.93624	0.6950	9	0.87932	D	0	.	14.7398	0.69445	0.1464:0.8536:0.0:0.0	.	397	A7BKA4	.	L	397	ENSP00000384881:S397L	ENSP00000384881:S397L	S	+	2	0	ABCB5	20654210	1.000000	0.71417	1.000000	0.80357	0.233000	0.25261	6.901000	0.75693	1.535000	0.49220	-0.188000	0.12872	TCA	ABCB5	-	superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter-like	ENSG00000004846		0.343	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	31	0.00	0	C	NM_178559		20687685	20687685	+1	no_errors	ENST00000404938	ensembl	human	putative	69_37n	missense	33	32.65	16	SNP	1.000	T
AMPD1	270	genome.wustl.edu	37	1	115217393	115217393	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr1:115217393G>C	ENST00000520113.2	-	13	1894	c.1879C>G	c.(1879-1881)Cat>Gat	p.H627D	AMPD1_ENST00000353928.6_Missense_Mutation_p.H594D|AMPD1_ENST00000369538.3_Missense_Mutation_p.H623D			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	627					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	TTTAGGCCATGAGAGATATCA	0.428																																						dbGAP											0													99.0	96.0	97.0					1																	115217393		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.1879C>G	1.37:g.115217393G>C	ENSP00000430075:p.His627Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.H627D	ENST00000520113.2	37	c.1879	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745137	0.49151	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	D;D;D	0.99800	-6.8;-6.8;-6.8	5.99	5.07	0.68467	Adenosine/AMP deaminase (1);	0.083931	0.85682	D	0.000000	D	0.99843	0.9928	M	0.93197	3.39	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.96452	0.9335	10	0.87932	D	0	-14.2996	16.7333	0.85440	0.0:0.0:0.8697:0.1303	.	623;594	Q5TF02;P23109	.;AMPD1_HUMAN	D	627;623;594	ENSP00000430075:H627D;ENSP00000358551:H623D;ENSP00000316520:H594D	ENSP00000316520:H594D	H	-	1	0	AMPD1	115018916	1.000000	0.71417	0.991000	0.47740	0.001000	0.01503	9.774000	0.98992	1.528000	0.49103	-0.169000	0.13324	CAT	AMPD1	-	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116748		0.428	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	33	0.00	0	G			115217393	115217393	-1	no_errors	ENST00000520113	ensembl	human	known	69_37n	missense	59	28.05	23	SNP	1.000	C
AP1G2	8906	genome.wustl.edu	37	14	24032994	24032994	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr14:24032994G>T	ENST00000308724.5	-	11	1918	c.1163C>A	c.(1162-1164)gCc>gAc	p.A388D	AP1G2_ENST00000556277.1_5'Flank|AP1G2_ENST00000397120.3_Missense_Mutation_p.A388D|RP11-66N24.3_ENST00000555968.1_RNA	NM_003917.2	NP_003908.1	O75843	AP1G2_HUMAN	adaptor-related protein complex 1, gamma 2 subunit	388					intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	AP-1 adaptor complex (GO:0030121)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle (GO:0005798)|membrane (GO:0016020)|transport vesicle (GO:0030133)	protein transporter activity (GO:0008565)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(4)|ovary(1)|pancreas(1)|stomach(1)	28	all_cancers(95;0.000251)			GBM - Glioblastoma multiforme(265;0.00672)		CTCCAGAAAGGCCTGCAGCTC	0.582																																						dbGAP											0													76.0	69.0	72.0					14																	24032994		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015318	CCDS9602.1	14q11.2	2008-07-03			ENSG00000213983	ENSG00000213983			556	protein-coding gene	gene with protein product		603534				9733768, 9762922	Standard	XM_005268167		Approved	G2AD	uc001wkl.2	O75843	OTTHUMG00000028760	ENST00000308724.5:c.1163C>A	14.37:g.24032994G>T	ENSP00000312442:p.Ala388Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS51|O75504	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP1_complex_gsu,pfscan_Clathrin_g-adaptin_app	p.A388D	ENST00000308724.5	37	c.1163	CCDS9602.1	14	.	.	.	.	.	.	.	.	.	.	G	8.330	0.826326	0.16749	.	.	ENSG00000213983	ENST00000308724;ENST00000397120;ENST00000545295;ENST00000535852	T;T	0.25912	1.77;1.77	4.71	2.84	0.33178	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.852673	0.10753	N	0.638098	T	0.11153	0.0272	N	0.05050	-0.12	0.28608	N	0.908798	B;B	0.13145	0.003;0.007	B;B	0.15870	0.005;0.014	T	0.37033	-0.9723	10	0.11485	T	0.65	-2.1149	7.3933	0.26921	0.0:0.3089:0.5695:0.1217	.	388;243	O75843;Q86V28	AP1G2_HUMAN;.	D	388;388;157;243	ENSP00000312442:A388D;ENSP00000380309:A388D	ENSP00000312442:A388D	A	-	2	0	AP1G2	23102834	1.000000	0.71417	0.997000	0.53966	0.780000	0.44128	1.316000	0.33620	0.554000	0.29061	0.557000	0.71058	GCC	AP1G2	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP1_complex_gsu	ENSG00000213983		0.582	AP1G2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G2	HGNC	protein_coding	OTTHUMT00000071812.4	24	0.00	0	G	NM_003917		24032994	24032994	-1	no_errors	ENST00000308724	ensembl	human	known	69_37n	missense	61	19.74	15	SNP	1.000	T
ARFIP2	23647	genome.wustl.edu	37	11	6499366	6499366	+	Silent	SNP	T	T	C			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr11:6499366T>C	ENST00000254584.2	-	6	683	c.600A>G	c.(598-600)ctA>ctG	p.L200L	ARFIP2_ENST00000525235.1_3'UTR|ARFIP2_ENST00000445086.2_Silent_p.L115L|ARFIP2_ENST00000396777.3_Silent_p.L200L|ARFIP2_ENST00000423813.2_Silent_p.L162L	NM_012402.3	NP_036534.1	P53365	ARFP2_HUMAN	ADP-ribosylation factor interacting protein 2	200	AH. {ECO:0000255|PROSITE- ProRule:PRU00294}.				actin cytoskeleton organization (GO:0030036)|cellular component movement (GO:0006928)|lamellipodium assembly (GO:0030032)|ruffle organization (GO:0031529)|small GTPase mediated signal transduction (GO:0007264)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|Rac GTPase binding (GO:0048365)			endometrium(2)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|skin(2)	15		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;3.41e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)		TCACGGCTCCTAGCAGCGTTT	0.483																																					Melanoma(119;796 1674 9049 20480 24794)	dbGAP											0													210.0	180.0	190.0					11																	6499366		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			BC000392	CCDS7765.1, CCDS55739.1, CCDS55740.1, CCDS73250.1	11p15	2008-08-01	2008-08-01		ENSG00000132254	ENSG00000132254			17160	protein-coding gene	gene with protein product	"""arfaptin 2"""	601638				8670882, 9038142	Standard	NM_012402		Approved	POR1	uc010ran.2	P53365	OTTHUMG00000133406	ENST00000254584.2:c.600A>G	11.37:g.6499366T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX86|B4E306|D3DQT5	Nonstop_Mutation	SNP	pfam_Arfaptin_homology_dom	p.*160W	ENST00000254584.2	37	c.479	CCDS7765.1	11																																																																																			ARFIP2	-	NULL	ENSG00000132254		0.483	ARFIP2-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARFIP2	HGNC	protein_coding	OTTHUMT00000387044.1	101	0.00	0	T	NM_012402		6499366	6499366	-1	no_errors	ENST00000531037	ensembl	human	known	69_37n	nonstop	165	18.32	37	SNP	0.911	C
BCOR	54880	genome.wustl.edu	37	X	39931968	39931968	+	Silent	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chrX:39931968G>A	ENST00000378444.4	-	4	2859	c.2631C>T	c.(2629-2631)acC>acT	p.T877T	BCOR_ENST00000397354.3_Silent_p.T877T|BCOR_ENST00000378455.4_Silent_p.T877T|BCOR_ENST00000342274.4_Silent_p.T877T	NM_001123385.1	NP_001116857.1	Q6W2J9	BCOR_HUMAN	BCL6 corepressor	877					heart development (GO:0007507)|histone H2A monoubiquitination (GO:0035518)|negative regulation of bone mineralization (GO:0030502)|negative regulation of histone H3-K36 methylation (GO:0000415)|negative regulation of histone H3-K4 methylation (GO:0051572)|negative regulation of tooth mineralization (GO:0070171)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis (GO:0042476)|palate development (GO:0060021)|specification of axis polarity (GO:0065001)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	heat shock protein binding (GO:0031072)|histone deacetylase binding (GO:0042826)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(4)|central_nervous_system(11)|cervix(1)|endometrium(24)|eye(6)|haematopoietic_and_lymphoid_tissue(33)|kidney(2)|large_intestine(11)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	126						CCTTGCTTACGGTGAAGACTG	0.557			"""F, N, S, T"""	RARA	"""retinoblastoma, AML, APL(translocation)"""		oculo-facio-cardio-dental genetic						G|||	1	0.000264901	0.0	0.0	3775	,	,		14777	0.001		0.0	False		,,,				2504	0.0					dbGAP		Rec	yes		X	Xp11.4	54880	BCL6 corepressor	yes		0													88.0	78.0	81.0					X																	39931968		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF317391	CCDS14250.1, CCDS48092.1, CCDS48093.1	Xp11.4	2014-09-17	2010-06-10		ENSG00000183337	ENSG00000183337		"""Ankyrin repeat domain containing"""	20893	protein-coding gene	gene with protein product		300485	"""BCL6 co-repressor"""			10898795	Standard	NM_017745		Approved	FLJ20285, KIAA1575	uc004den.4	Q6W2J9	OTTHUMG00000024100	ENST00000378444.4:c.2631C>T	X.37:g.39931968G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWB3|D3DWB4|Q29RF6|Q6P4B6|Q7Z2K7|Q8TEB4|Q96DB3|Q9H232|Q9H233|Q9HCJ7|Q9NXF2	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T877	ENST00000378444.4	37	c.2631	CCDS48093.1	X																																																																																			BCOR	-	NULL	ENSG00000183337		0.557	BCOR-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCOR	HGNC	protein_coding	OTTHUMT00000060666.2	70	0.00	0	G	NM_017745		39931968	39931968	-1	no_errors	ENST00000378444	ensembl	human	known	69_37n	silent	15	74.58	44	SNP	0.002	A
CD14	929	genome.wustl.edu	37	5	140012442	140012442	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr5:140012442G>T	ENST00000302014.6	-	2	756	c.127C>A	c.(127-129)Ccc>Acc	p.P43T	CD14_ENST00000401743.2_Missense_Mutation_p.P43T	NM_000591.3	NP_000582.1	P08571	CD14_HUMAN	CD14 molecule	43	Ligand-binding pocket rim.				apoptotic process (GO:0006915)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|phagocytosis (GO:0006909)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endocytosis (GO:0045807)|positive regulation of tumor necrosis factor production (GO:0032760)|response to ethanol (GO:0045471)|response to heat (GO:0009408)|response to magnesium ion (GO:0032026)|response to tumor necrosis factor (GO:0034612)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipoteichoic acid binding (GO:0070891)|opsonin receptor activity (GO:0001847)|peptidoglycan receptor activity (GO:0016019)			endometrium(1)|large_intestine(1)|lung(3)|pancreas(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACCAGTCGGGCTGAGGTTCG	0.597																																						dbGAP											0													55.0	55.0	55.0					5																	140012442		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4232.1	5q31.3	2012-09-20	2006-03-28		ENSG00000170458	ENSG00000170458		"""CD molecules"""	1628	protein-coding gene	gene with protein product		158120	"""CD14 antigen"""			2472171, 2462937	Standard	NM_000591		Approved		uc003lgi.2	P08571	OTTHUMG00000129507	ENST00000302014.6:c.127C>A	5.37:g.140012442G>T	ENSP00000304236:p.Pro43Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XT5|Q96FR6|Q96L99|Q9UNS3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pirsf_Monocyte_diff_Ag_CD14	p.P43T	ENST00000302014.6	37	c.127	CCDS4232.1	5	.	.	.	.	.	.	.	.	.	.	G	15.09	2.729548	0.48833	.	.	ENSG00000170458	ENST00000302014;ENST00000401743;ENST00000498971;ENST00000519715;ENST00000512545	D;D;D;D;D	0.95412	-3.7;-3.7;-3.7;-3.7;-3.7	5.87	4.99	0.66335	.	0.108522	0.41500	D	0.000878	D	0.96673	0.8914	L	0.60455	1.87	0.38241	D	0.941324	D	0.76494	0.999	D	0.76071	0.987	D	0.97292	0.9925	10	0.48119	T	0.1	-30.0661	12.9883	0.58604	0.0:0.162:0.838:0.0	.	43	P08571	CD14_HUMAN	T	43	ENSP00000304236:P43T;ENSP00000385519:P43T;ENSP00000426543:P43T;ENSP00000430884:P43T;ENSP00000425447:P43T	ENSP00000304236:P43T	P	-	1	0	CD14	139992626	0.999000	0.42202	0.851000	0.33527	0.092000	0.18411	2.984000	0.49353	1.469000	0.48083	0.655000	0.94253	CCC	CD14	-	pirsf_Monocyte_diff_Ag_CD14	ENSG00000170458		0.597	CD14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD14	HGNC	protein_coding	OTTHUMT00000251681.2	31	0.00	0	G	NM_000591		140012442	140012442	-1	no_errors	ENST00000302014	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	0.965	T
CEACAM4	1089	genome.wustl.edu	37	19	42126986	42126986	+	Missense_Mutation	SNP	C	C	T	rs375752078		TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr19:42126986C>T	ENST00000221954.2	-	4	667	c.557G>A	c.(556-558)cGt>cAt	p.R186H	CEACAM4_ENST00000600925.1_Missense_Mutation_p.R184H	NM_001817.2	NP_001808.2	O75871	CEAM4_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 4	186						integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				NS(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|skin(3)|urinary_tract(1)	16						CCTGAGGTCACGCTGGATGCT	0.597																																						dbGAP											0													35.0	36.0	36.0					19																	42126986		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90276	CCDS33033.1	19q13.2	2013-01-11			ENSG00000105352	ENSG00000105352		"""Immunoglobulin superfamily / V-set domain containing"""	1816	protein-coding gene	gene with protein product				CGM7		2050678	Standard	XM_005258434		Approved		uc002orh.1	O75871	OTTHUMG00000151065	ENST00000221954.2:c.557G>A	19.37:g.42126986C>T	ENSP00000221954:p.Arg186His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q03715|Q7LDZ7	Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.R186H	ENST00000221954.2	37	c.557	CCDS33033.1	19	.	.	.	.	.	.	.	.	.	.	C	4.544	0.100985	0.08731	.	.	ENSG00000105352	ENST00000221954	T	0.01347	4.99	2.05	-3.83	0.04269	.	.	.	.	.	T	0.00936	0.0031	N	0.20986	0.625	0.09310	N	1	B;B	0.17038	0.02;0.02	B;B	0.01281	0.0;0.0	T	0.46359	-0.9197	9	0.25106	T	0.35	.	3.2923	0.06953	0.21:0.452:0.0:0.3379	.	184;186	E7EMX3;O75871	.;CEAM4_HUMAN	H	186	ENSP00000221954:R186H	ENSP00000221954:R186H	R	-	2	0	CEACAM4	46818826	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-0.738000	0.04871	-1.132000	0.02907	0.195000	0.17529	CGT	CEACAM4	-	NULL	ENSG00000105352		0.597	CEACAM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM4	HGNC	protein_coding	OTTHUMT00000321148.1	24	0.00	0	C	NM_001817		42126986	42126986	-1	no_errors	ENST00000221954	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.000	T
CEP128	145508	genome.wustl.edu	37	14	81329196	81329196	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr14:81329196G>A	ENST00000555265.1	-	9	1042	c.667C>T	c.(667-669)Cgg>Tgg	p.R223W	CEP128_ENST00000216517.6_Missense_Mutation_p.R223W|CEP128_ENST00000281129.3_Missense_Mutation_p.R223W			Q6ZU80	CE128_HUMAN	centrosomal protein 128kDa	223						centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	51						TCCTGAAGCCGCCGCTCCACC	0.473																																						dbGAP											0													65.0	60.0	62.0					14																	81329196		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056756	CCDS32130.1	14q31.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000100629	ENSG00000100629			20359	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 61"", ""chromosome 14 open reading frame 145"""	C14orf61, C14orf145		21399614	Standard	NM_152446		Approved		uc001xux.2	Q6ZU80		ENST00000555265.1:c.667C>T	14.37:g.81329196G>A	ENSP00000451162:p.Arg223Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK52|Q86X97|Q96ML4	Missense_Mutation	SNP	NULL	p.R223W	ENST00000555265.1	37	c.667	CCDS32130.1	14	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831507	0.71258	.	.	ENSG00000100629	ENST00000281129;ENST00000555265;ENST00000393619;ENST00000216517	T;T;T	0.73258	-0.04;-0.04;-0.73	6.08	3.11	0.35812	.	0.000000	0.64402	D	0.000001	D	0.82393	0.5027	M	0.70275	2.135	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.83235	-0.0061	10	0.72032	D	0.01	.	14.7077	0.69203	0.0:0.0:0.3432:0.6568	.	223;104;223	Q6ZU80-3;Q8N3Z7;Q6ZU80	.;.;CE128_HUMAN	W	223	ENSP00000281129:R223W;ENSP00000451162:R223W;ENSP00000216517:R223W	ENSP00000216517:R223W	R	-	1	2	CEP128	80398949	0.989000	0.36119	0.974000	0.42286	0.926000	0.56050	1.690000	0.37711	0.371000	0.24564	0.655000	0.94253	CGG	CEP128	-	NULL	ENSG00000100629		0.473	CEP128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP128	HGNC	protein_coding	OTTHUMT00000413415.1	104	0.00	0	G	NM_152446		81329196	81329196	-1	no_errors	ENST00000281129	ensembl	human	known	69_37n	missense	76	34.75	41	SNP	0.727	A
COL5A1	1289	genome.wustl.edu	37	9	137623972	137623972	+	Splice_Site	SNP	C	C	T	rs201375465		TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr9:137623972C>T	ENST00000371817.3	+	9	1802	c.1388C>T	c.(1387-1389)cCg>cTg	p.P463L		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	463	Interrupted collagenous region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		ATTATCGAGCCGGTGAGGACA	0.587													C|||	1	0.000199681	0.0	0.0	5008	,	,		17181	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													105.0	91.0	96.0					9																	137623972		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1389+1C>T	9.37:g.137623972C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15094|Q5SUX4	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.P463L	ENST00000371817.3	37	c.1388	CCDS6982.1	9	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	16.58	3.162521	0.57368	.	.	ENSG00000130635	ENST00000371817	D	0.97731	-4.51	4.53	4.53	0.55603	.	0.000000	0.85682	U	0.000000	D	0.98419	0.9474	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.99667	1.0995	10	0.66056	D	0.02	.	16.2528	0.82494	0.0:1.0:0.0:0.0	.	463	P20908	CO5A1_HUMAN	L	463	ENSP00000360882:P463L	ENSP00000360882:P463L	P	+	2	0	COL5A1	136763793	1.000000	0.71417	0.995000	0.50966	0.233000	0.25261	6.921000	0.75805	2.044000	0.60594	0.462000	0.41574	CCG	COL5A1	-	NULL	ENSG00000130635		0.587	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	72	0.00	0	C	NM_000093	Missense_Mutation	137623972	137623972	+1	no_errors	ENST00000371817	ensembl	human	known	69_37n	missense	68	33.98	35	SNP	1.000	T
DBX2	440097	genome.wustl.edu	37	12	45444331	45444331	+	Frame_Shift_Del	DEL	C	C	-			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr12:45444331delC	ENST00000332700.6	-	1	551	c.380delG	c.(379-381)tgtfs	p.C127fs	RP11-478B9.1_ENST00000548424.1_RNA	NM_001004329.2	NP_001004329.2	Q6ZNG2	DBX2_HUMAN	developing brain homeobox 2	127					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(3)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	22	Lung SC(27;0.192)	Lung NSC(34;0.142)		GBM - Glioblastoma multiforme(48;0.0515)		CTGGAAGGTACAGTCTCGGTC	0.741																																						dbGAP											0													10.0	14.0	13.0					12																	45444331		2068	4086	6154	-	-	-	SO:0001589	frameshift_variant	0				CCDS31781.1	12q12	2011-06-20				ENSG00000185610		"""Homeoboxes / ANTP class : NKL subclass"""	33186	protein-coding gene	gene with protein product						11239429	Standard	NM_001004329		Approved	FLJ16139	uc001rok.1	Q6ZNG2	OTTHUMG00000169559	ENST00000332700.6:c.380delG	12.37:g.45444331delC	ENSP00000331470:p.Cys127fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.C127fs	ENST00000332700.6	37	c.380	CCDS31781.1	12																																																																																			DBX2	-	NULL	ENSG00000185610		0.741	DBX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBX2	HGNC	protein_coding	OTTHUMT00000404810.1	12	0.00	0	C	NM_001004329		45444331	45444331	-1	no_errors	ENST00000332700	ensembl	human	known	69_37n	frame_shift_del	4	37.50	3	DEL	0.451	-
DKKL1	27120	genome.wustl.edu	37	19	49878066	49878066	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr19:49878066G>A	ENST00000221498.2	+	5	915	c.510G>A	c.(508-510)tgG>tgA	p.W170*	DKKL1_ENST00000594268.1_Nonsense_Mutation_p.W28*|AC010524.2_ENST00000599433.1_RNA	NM_014419.3	NP_055234.1	Q9UK85	DKKL1_HUMAN	dickkopf-like 1	170					anatomical structure morphogenesis (GO:0009653)|positive regulation of fat cell differentiation (GO:0045600)|signal transduction (GO:0007165)	extracellular space (GO:0005615)	signal transducer activity (GO:0004871)			large_intestine(2)|upper_aerodigestive_tract(1)	3		all_lung(116;1.66e-06)|Lung NSC(112;5.89e-06)|all_neural(266;0.0189)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00156)|GBM - Glioblastoma multiforme(486;0.0456)		TGGCCTTCTGGATCATTAAGC	0.652																																						dbGAP											0													31.0	32.0	32.0					19																	49878066		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB047816	CCDS12762.1	19q13.3	2010-10-12	2010-10-12		ENSG00000104901	ENSG00000104901			16528	protein-coding gene	gene with protein product	"""cancer/testis antigen 34"", ""soggy"""	605418	"""dickkopf-like 1 (soggy)"""			10570958	Standard	NM_001197301		Approved	SGY-1, CT34	uc002pnk.3	Q9UK85		ENST00000221498.2:c.510G>A	19.37:g.49878066G>A	ENSP00000221498:p.Trp170*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.W170*	ENST00000221498.2	37	c.510	CCDS12762.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.131202	0.94473	.	.	ENSG00000104901	ENST00000221498	.	.	.	4.0	4.0	0.46444	.	0.000000	0.41500	D	0.000870	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.2742	11.9081	0.52723	0.0:0.0:1.0:0.0	.	.	.	.	X	170	.	ENSP00000221498:W170X	W	+	3	0	DKKL1	54569878	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.912000	0.39946	2.535000	0.85469	0.655000	0.94253	TGG	DKKL1	-	NULL	ENSG00000104901		0.652	DKKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKKL1	HGNC	protein_coding	OTTHUMT00000465454.2	14	0.00	0	G	NM_014419		49878066	49878066	+1	no_errors	ENST00000221498	ensembl	human	known	69_37n	nonsense	10	28.57	4	SNP	1.000	A
DNAH9	1770	genome.wustl.edu	37	17	11597227	11597227	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr17:11597227C>G	ENST00000262442.4	+	21	4725	c.4657C>G	c.(4657-4659)Cta>Gta	p.L1553V	DNAH9_ENST00000454412.2_Missense_Mutation_p.L1553V	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1553	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		CTTTAAAGAGCTAGCTTATGA	0.448																																						dbGAP											0													121.0	116.0	117.0					17																	11597227		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.4657C>G	17.37:g.11597227C>G	ENSP00000262442:p.Leu1553Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.L1553V	ENST00000262442.4	37	c.4657	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	16.81	3.225554	0.58668	.	.	ENSG00000007174	ENST00000262442;ENST00000454412;ENST00000413703	T;T	0.63913	-0.07;-0.07	4.72	1.46	0.22682	Dynein heavy chain, domain-2 (1);	0.091849	0.44285	D	0.000466	T	0.64011	0.2560	L	0.61036	1.89	0.80722	D	1	P	0.34522	0.455	P	0.44811	0.461	T	0.64765	-0.6330	10	0.54805	T	0.06	.	10.2108	0.43138	0.0:0.75:0.0:0.25	.	1553	Q9NYC9	DYH9_HUMAN	V	1553;1553;135	ENSP00000262442:L1553V;ENSP00000414874:L1553V	ENSP00000262442:L1553V	L	+	1	2	DNAH9	11537952	0.983000	0.35010	0.998000	0.56505	0.835000	0.47333	0.665000	0.25083	0.631000	0.30412	0.655000	0.94253	CTA	DNAH9	-	pfam_Dynein_heavy_dom-2	ENSG00000007174		0.448	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	68	0.00	0	C	NM_001372		11597227	11597227	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	163	20.10	41	SNP	1.000	G
DNAJC13	23317	genome.wustl.edu	37	3	132224254	132224254	+	Nonsense_Mutation	SNP	A	A	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr3:132224254A>T	ENST00000260818.6	+	42	5241	c.4993A>T	c.(4993-4995)Aaa>Taa	p.K1665*		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	1665					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						AAACATGATTAAAAAAGTATG	0.308																																						dbGAP											0													31.0	32.0	32.0					3																	132224254		2197	4275	6472	-	-	-	SO:0001587	stop_gained	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.4993A>T	3.37:g.132224254A>T	ENSP00000260818:p.Lys1665*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Nonsense_Mutation	SNP	pfam_DnaJ_N,superfamily_ARM-type_fold,superfamily_GYF,smart_DnaJ_N,pfscan_DnaJ_N	p.K1665*	ENST00000260818.6	37	c.4993	CCDS33857.1	3	.	.	.	.	.	.	.	.	.	.	A	47	13.368248	0.99737	.	.	ENSG00000138246	ENST00000260818;ENST00000538066	.	.	.	6.16	6.16	0.99307	.	0.105434	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.8061	0.85666	1.0:0.0:0.0:0.0	.	.	.	.	X	1665;312	.	ENSP00000260818:K1665X	K	+	1	0	DNAJC13	133706944	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.367000	0.90113	2.367000	0.80283	0.528000	0.53228	AAA	DNAJC13	-	superfamily_ARM-type_fold	ENSG00000138246		0.308	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	16	0.00	0	A	NM_015268		132224254	132224254	+1	no_errors	ENST00000260818	ensembl	human	known	69_37n	nonsense	16	51.52	17	SNP	1.000	T
HOOK1	51361	genome.wustl.edu	37	1	60306040	60306040	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr1:60306040A>G	ENST00000371208.3	+	8	855	c.598A>G	c.(598-600)Aga>Gga	p.R200G	HOOK1_ENST00000395561.2_Missense_Mutation_p.R158G|HOOK1_ENST00000465876.1_3'UTR	NM_015888.4	NP_056972.1	Q9UJC3	HOOK1_HUMAN	hook microtubule-tethering protein 1	200	Sufficient for interaction with microtubules.				early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|endosome to lysosome transport (GO:0008333)|lysosome organization (GO:0007040)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)|spermatid development (GO:0007286)	FHF complex (GO:0070695)|microtubule (GO:0005874)	identical protein binding (GO:0042802)			biliary_tract(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|urinary_tract(1)	29	all_cancers(7;0.000129)					GCTGAGGCAAAGATGTGAAGA	0.343																																						dbGAP											0													74.0	79.0	77.0					1																	60306040		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF044923	CCDS612.1	1p32.1	2013-08-21	2013-08-21		ENSG00000134709	ENSG00000134709			19884	protein-coding gene	gene with protein product		607820	"""hook homolog 1 (Drosophila)"""			9927460	Standard	XM_005270922		Approved	HK1	uc001czo.3	Q9UJC3	OTTHUMG00000008990	ENST00000371208.3:c.598A>G	1.37:g.60306040A>G	ENSP00000360252:p.Arg200Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8E9|A8MU44|B4DX15|O60561|Q5TG44	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin	p.R200G	ENST00000371208.3	37	c.598	CCDS612.1	1	.	.	.	.	.	.	.	.	.	.	A	17.32	3.360696	0.61403	.	.	ENSG00000134709	ENST00000371208;ENST00000395561	T;T	0.24538	1.85;1.85	5.95	3.53	0.40419	.	0.000000	0.85682	D	0.000000	T	0.50086	0.1595	M	0.81497	2.545	0.58432	D	0.999997	D	0.71674	0.998	D	0.72625	0.978	T	0.52185	-0.8609	10	0.41790	T	0.15	.	12.9338	0.58303	0.611:0.389:0.0:0.0	.	200	Q9UJC3	HOOK1_HUMAN	G	200;158	ENSP00000360252:R200G;ENSP00000378928:R158G	ENSP00000360252:R200G	R	+	1	2	HOOK1	60078628	0.777000	0.28628	0.893000	0.35052	0.863000	0.49368	1.571000	0.36450	1.051000	0.40369	0.528000	0.53228	AGA	HOOK1	-	pfam_HOOK,superfamily_Prefoldin	ENSG00000134709		0.343	HOOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOOK1	HGNC	protein_coding	OTTHUMT00000024934.1	62	0.00	0	A	NM_015888		60306040	60306040	+1	no_errors	ENST00000371208	ensembl	human	known	69_37n	missense	74	13.95	12	SNP	0.473	G
KIAA0020	9933	genome.wustl.edu	37	9	2812275	2812275	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr9:2812275G>C	ENST00000397885.2	-	14	1563	c.1357C>G	c.(1357-1359)Cat>Gat	p.H453D		NM_014878.4	NP_055693.4	Q15397	K0020_HUMAN	KIAA0020	453	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.					endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)	21				GBM - Glioblastoma multiforme(50;0.0319)		CGTACTGTATGTGCAGGATCT	0.358																																						dbGAP											0													228.0	203.0	212.0					9																	2812275		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832239	CCDS6448.2	9p24.2	2012-11-29			ENSG00000080608	ENSG00000080608			29676	protein-coding gene	gene with protein product	"""penguin homolog (Drosophila)"", ""minor histocompatibility antigen HA-8"""	609960				7584026, 7584028, 21266351	Standard	NM_014878		Approved	XTP5, PEN, PUF6, hPUF-A, HA-8	uc003zhp.1	Q15397	OTTHUMG00000019450	ENST00000397885.2:c.1357C>G	9.37:g.2812275G>C	ENSP00000380982:p.His453Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K804|Q547G7|Q5SZY9|Q6IB47|Q96B27|Q96L78|Q96L79|Q96L80	Missense_Mutation	SNP	pfam_CPL,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.H453D	ENST00000397885.2	37	c.1357	CCDS6448.2	9	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874114	0.72180	.	.	ENSG00000080608	ENST00000397885	T	0.49720	0.77	5.5	5.5	0.81552	CPL (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.81682	2.555	0.80722	D	1	P;D	0.58970	0.953;0.984	P;P	0.59643	0.808;0.861	T	0.69262	-0.5191	10	0.59425	D	0.04	-0.212	13.996	0.64402	0.0727:0.0:0.9273:0.0	.	313;453	B2RDG4;Q15397	.;K0020_HUMAN	D	453	ENSP00000380982:H453D	ENSP00000380982:H453D	H	-	1	0	KIAA0020	2802275	1.000000	0.71417	0.833000	0.33012	0.986000	0.74619	6.236000	0.72339	2.736000	0.93811	0.591000	0.81541	CAT	KIAA0020	-	pfam_CPL,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	ENSG00000080608		0.358	KIAA0020-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0020	HGNC	protein_coding	OTTHUMT00000051529.3	149	0.00	0	G	NM_014878		2812275	2812275	-1	no_errors	ENST00000397885	ensembl	human	known	69_37n	missense	245	21.97	69	SNP	0.999	C
KIAA1429	25962	genome.wustl.edu	37	8	95500959	95500959	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr8:95500959C>T	ENST00000297591.5	-	24	5489	c.5414G>A	c.(5413-5415)cGt>cAt	p.R1805H	KIAA1429_ENST00000437199.1_3'UTR	NM_015496.4	NP_056311.2	Q69YN4	VIR_HUMAN	KIAA1429	1805					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(16)|lung(28)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	66	Breast(36;3.29e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00185)			GCGTACATGACGACCTCTACC	0.448																																						dbGAP											0													210.0	187.0	195.0					8																	95500959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037850	CCDS34923.1, CCDS47894.1	8q22.1	2008-11-25			ENSG00000164944	ENSG00000164944			24500	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 121"""					10718198	Standard	NM_015496		Approved	DKFZP434I116, fSAP121	uc003ygo.2	Q69YN4	OTTHUMG00000164426	ENST00000297591.5:c.5414G>A	8.37:g.95500959C>T	ENSP00000297591:p.Arg1805His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1N0|Q6AHX9|Q6NT78|Q7Z6C7|Q8IXH4|Q9BTH4|Q9H9C9|Q9NWR3|Q9P2B8|Q9UFW1	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R1805H	ENST00000297591.5	37	c.5414	CCDS34923.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.138344	0.94560	.	.	ENSG00000164944	ENST00000297591	T	0.59364	0.27	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.58892	0.2154	N	0.24115	0.695	0.80722	D	1	D	0.69078	0.997	P	0.53401	0.725	T	0.64127	-0.6480	10	0.87932	D	0	-7.0316	19.5665	0.95395	0.0:1.0:0.0:0.0	.	1805	Q69YN4	VIR_HUMAN	H	1805	ENSP00000297591:R1805H	ENSP00000297591:R1805H	R	-	2	0	KIAA1429	95570135	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.183000	0.72002	2.699000	0.92147	0.655000	0.94253	CGT	KIAA1429	-	NULL	ENSG00000164944		0.448	KIAA1429-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1429	HGNC	protein_coding	OTTHUMT00000378720.2	125	0.00	0	C	NM_015496		95500959	95500959	-1	no_errors	ENST00000297591	ensembl	human	known	69_37n	missense	350	15.46	64	SNP	1.000	T
KIAA1715	80856	genome.wustl.edu	37	2	176802242	176802242	+	Splice_Site	SNP	G	G	C			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr2:176802242G>C	ENST00000272748.4	-	12	1131	c.884C>G	c.(883-885)gCt>gGt	p.A295G	KIAA1715_ENST00000544803.1_Splice_Site_p.A326G|KIAA1715_ENST00000535310.1_Splice_Site_p.A220G	NM_030650.1	NP_085153.1	Q9C0E8	LNP_HUMAN	KIAA1715	295					blood coagulation (GO:0007596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|limb development (GO:0060173)|regulation of chondrocyte differentiation (GO:0032330)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			endometrium(1)|large_intestine(4)|lung(12)|ovary(2)|skin(1)	20			OV - Ovarian serous cystadenocarcinoma(117;0.0793)			ACATCGAAAAGCTGCAGAGAA	0.378																																						dbGAP											0													29.0	31.0	30.0					2																	176802242		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AB051502	CCDS33332.1	2q31	2014-06-27			ENSG00000144320	ENSG00000144320			21610	protein-coding gene	gene with protein product	"""lunapark"", ""limb and neural patterns"""	610236				11214970, 22729086	Standard	NM_030650		Approved	ulnaless, Ul, LNP1, LNP	uc002ukc.1	Q9C0E8	OTTHUMG00000154112	ENST00000272748.4:c.884-1C>G	2.37:g.176802242G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLA8|Q2M2V8|Q2YD99|Q658W8|Q8N5V9|Q96MS5	Missense_Mutation	SNP	pfam_DUF2296	p.A326G	ENST00000272748.4	37	c.977	CCDS33332.1	2	.	.	.	.	.	.	.	.	.	.	G	7.173	0.587971	0.13812	.	.	ENSG00000144320	ENST00000272748;ENST00000536291;ENST00000409660;ENST00000544803;ENST00000535310	.	.	.	5.31	5.31	0.75309	Domain of unknown function DUF2296 (1);	0.000000	0.85682	D	0.000000	T	0.72447	0.3461	L	0.52126	1.63	0.80722	D	1	P;P;P;P	0.46064	0.669;0.592;0.536;0.872	B;P;B;P	0.55615	0.239;0.573;0.278;0.78	T	0.74429	-0.3668	9	0.87932	D	0	.	19.3304	0.94283	0.0:0.0:1.0:0.0	.	297;326;292;295	F5H2Y7;B7ZLA8;B7ZLA9;Q9C0E8	.;.;.;LNP_HUMAN	G	295;297;172;326;220	.	ENSP00000272748:A295G	A	-	2	0	KIAA1715	176510488	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	9.420000	0.97426	2.645000	0.89757	0.591000	0.81541	GCT	KIAA1715	-	pfam_DUF2296	ENSG00000144320		0.378	KIAA1715-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1715	HGNC	protein_coding	OTTHUMT00000333949.3	22	0.00	0	G	XM_042834	Missense_Mutation	176802242	176802242	-1	no_errors	ENST00000544803	ensembl	human	known	69_37n	missense	19	47.22	17	SNP	1.000	C
KRT7	3855	genome.wustl.edu	37	12	52636898	52636898	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr12:52636898G>C	ENST00000331817.5	+	6	1144	c.961G>C	c.(961-963)Gag>Cag	p.E321Q	RP3-416H24.1_ENST00000546686.1_RNA	NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7	321	Coil 2.|Rod.				viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	GCTGCAGGCTGAGATCGACAA	0.597																																						dbGAP											0													80.0	68.0	72.0					12																	52636898		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.961G>C	12.37:g.52636898G>C	ENSP00000329243:p.Glu321Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92676|Q9BUD8|Q9Y3R7	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,superfamily_Chorismate_mutase_type_II,prints_Keratin_II	p.E321Q	ENST00000331817.5	37	c.961	CCDS8822.1	12	.	.	.	.	.	.	.	.	.	.	G	27.2	4.810520	0.90707	.	.	ENSG00000135480	ENST00000331817;ENST00000422319;ENST00000551537	T	0.78924	-1.22	3.94	3.94	0.45596	Prefoldin (1);Filament (1);	0.000000	0.38326	N	0.001737	D	0.88437	0.6436	M	0.82193	2.58	0.80722	D	1	D;D	0.89917	0.98;1.0	D;D	0.79108	0.954;0.992	D	0.90761	0.4665	10	0.87932	D	0	.	16.5614	0.84567	0.0:0.0:1.0:0.0	.	321;321	F8VZY5;P08729	.;K2C7_HUMAN	Q	321;297;321	ENSP00000329243:E321Q	ENSP00000329243:E321Q	E	+	1	0	KRT7	50923165	1.000000	0.71417	0.940000	0.37924	0.948000	0.59901	9.601000	0.98297	2.219000	0.72066	0.561000	0.74099	GAG	KRT7	-	pfam_F,superfamily_Prefoldin,superfamily_Chorismate_mutase_type_II	ENSG00000135480		0.597	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT7	HGNC	protein_coding	OTTHUMT00000404897.1	34	0.00	0	G	NM_005556		52636898	52636898	+1	no_errors	ENST00000331817	ensembl	human	known	69_37n	missense	32	36.00	18	SNP	1.000	C
LAMC1	3915	genome.wustl.edu	37	1	183093958	183093960	+	In_Frame_Del	DEL	AAG	AAG	-			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr1:183093958_183093960delAAG	ENST00000258341.4	+	14	2851_2853	c.2594_2596delAAG	c.(2593-2598)aaagac>aac	p.865_866KD>N		NM_002293.3	NP_002284.3	P11047	LAMC1_HUMAN	laminin, gamma 1 (formerly LAMB2)	865	Laminin EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|endoderm development (GO:0007492)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|positive regulation of epithelial cell proliferation (GO:0050679)|protein complex assembly (GO:0006461)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(27)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	76						GACCGGTGCAAAGACGGATTTTT	0.458																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			J03202	CCDS1351.1	1q31	2013-03-01			ENSG00000135862	ENSG00000135862		"""Laminins"""	6492	protein-coding gene	gene with protein product		150290		LAMB2		3234037	Standard	NM_002293		Approved		uc001gpy.4	P11047	OTTHUMG00000035418	ENST00000258341.4:c.2594_2596delAAG	1.37:g.183093958_183093960delAAG	ENSP00000258341:p.Lys865_Asp866delinsAsn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYE7	In_Frame_Del	DEL	pfam_Laminin_N,pfam_EGF_laminin,pfam_Laminin_B_type_IV,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.KD865in_frame_delN	ENST00000258341.4	37	c.2594_2596	CCDS1351.1	1																																																																																			LAMC1	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EGF-like,pfscan_EGF_laminin	ENSG00000135862		0.458	LAMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC1	HGNC	protein_coding	OTTHUMT00000085954.2	52	0.00	0	AAG	NM_002293		183093958	183093960	+1	no_errors	ENST00000258341	ensembl	human	known	69_37n	in_frame_del	104	17.05	22	DEL	1.000:0.998:0.999	-
LCT	3938	genome.wustl.edu	37	2	136566347	136566347	+	Silent	SNP	A	A	G			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr2:136566347A>G	ENST00000264162.2	-	8	3580	c.3570T>C	c.(3568-3570)acT>acC	p.T1190T	Y_RNA_ENST00000363794.1_RNA	NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1190	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	TCTCTTCCTCAGTGAAGCTTG	0.532																																						dbGAP											0													157.0	135.0	143.0					2																	136566347		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.3570T>C	2.37:g.136566347A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG58	Silent	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.T1190	ENST00000264162.2	37	c.3570	CCDS2178.1	2																																																																																			LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.532	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	88	0.00	0	A	NM_002299		136566347	136566347	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	silent	106	27.40	40	SNP	0.482	G
LGR5	8549	genome.wustl.edu	37	12	71833917	71833917	+	Silent	SNP	G	G	A	rs147257938		TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr12:71833917G>A	ENST00000266674.5	+	1	368	c.57G>A	c.(55-57)gcG>gcA	p.A19A	LGR5_ENST00000536515.1_Silent_p.A19A|LGR5_ENST00000540815.2_Silent_p.A19A|TSPAN8_ENST00000393330.2_Intron			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	19					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)	p.A19A(1)	NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TGCAGCTGGCGACCGGGGGCA	0.682																																						dbGAP											1	Substitution - coding silent(1)	urinary_tract(1)											49.0	48.0	48.0					12																	71833917		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.57G>A	12.37:g.71833917G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Silent	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.A19	ENST00000266674.5	37	c.57	CCDS9000.1	12																																																																																			LGR5	-	NULL	ENSG00000139292		0.682	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	25	0.00	0	G	NM_003667		71833917	71833917	+1	no_errors	ENST00000266674	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	0.981	A
LINGO2	158038	genome.wustl.edu	37	9	27949218	27949218	+	Silent	SNP	G	G	A	rs150860330		TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr9:27949218G>A	ENST00000379992.2	-	6	1901	c.1452C>T	c.(1450-1452)atC>atT	p.I484I	LINGO2_ENST00000308675.3_Silent_p.I484I	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	484	Ig-like C2-type.					integral component of membrane (GO:0016021)		p.I484I(2)		autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CATTGCTAGCGATGCAAACAT	0.493																																						dbGAP											2	Substitution - coding silent(2)	lung(2)											100.0	95.0	97.0					9																	27949218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1452C>T	9.37:g.27949218G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4K7|B2RPM5|Q6ZMD0	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I484	ENST00000379992.2	37	c.1452	CCDS6524.1	9																																																																																			LINGO2	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000174482		0.493	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	64	0.00	0	G	NM_152570		27949218	27949218	-1	no_errors	ENST00000308675	ensembl	human	known	69_37n	silent	92	21.85	26	SNP	0.202	A
LPCAT4	254531	genome.wustl.edu	37	15	34655637	34655637	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr15:34655637C>T	ENST00000314891.6	-	7	909	c.732G>A	c.(730-732)tgG>tgA	p.W244*	LPCAT4_ENST00000562431.1_5'Flank	NM_153613.2	NP_705841.2	Q643R3	LPCT4_HUMAN	lysophosphatidylcholine acyltransferase 4	244					cellular lipid metabolic process (GO:0044255)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	1-acylglycerophosphocholine O-acyltransferase activity (GO:0047184)|1-alkenylglycerophosphoethanolamine O-acyltransferase activity (GO:0047166)|1-alkylglycerophosphocholine O-acetyltransferase activity (GO:0047192)|calcium ion binding (GO:0005509)|lysophospholipid acyltransferase activity (GO:0071617)			NS(1)|breast(1)|large_intestine(2)|lung(5)|prostate(1)	10						CAGGACCCCTCCATGCCCAGC	0.557																																						dbGAP											0													110.0	101.0	104.0					15																	34655637		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			AF542964	CCDS32191.1	15q14	2008-07-02	2008-06-24	2008-06-24		ENSG00000176454			30059	protein-coding gene	gene with protein product	"""lysophosphatidylethanolamine acyltransferase 2"""	612039	"""acyltransferase like 3"", ""1-acylglycerol-3-phosphate O-acyltransferase 7 (lysophosphatidic acid acyltransferase, eta)"""	AYTL3, AGPAT7		8619474, 9110174, 16243729, 18458083	Standard	XR_243087		Approved	FLJ10257, LPAAT-eta, LPEAT2	uc001zig.3	Q643R3		ENST00000314891.6:c.732G>A	15.37:g.34655637C>T	ENSP00000317300:p.Trp244*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2K8|O43412|Q7Z4P4|Q8IUL7|Q8TB38	Nonsense_Mutation	SNP	pfam_Acyltransferase,smart_Acyltransferase	p.W244*	ENST00000314891.6	37	c.732	CCDS32191.1	15	.	.	.	.	.	.	.	.	.	.	C	22.7	4.321530	0.81580	.	.	ENSG00000176454	ENST00000314891	.	.	.	5.19	5.19	0.71726	.	0.248717	0.43579	D	0.000555	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.045	17.8544	0.88758	0.0:1.0:0.0:0.0	.	.	.	.	X	244	.	ENSP00000317300:W244X	W	-	3	0	LPCAT4	32442929	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	3.430000	0.52807	2.575000	0.86900	0.561000	0.74099	TGG	LPCAT4	-	NULL	ENSG00000176454		0.557	LPCAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPCAT4	HGNC	protein_coding	OTTHUMT00000418028.2	54	0.00	0	C	NM_153613		34655637	34655637	-1	no_errors	ENST00000314891	ensembl	human	known	69_37n	nonsense	69	26.60	25	SNP	1.000	T
LRP2	4036	genome.wustl.edu	37	2	170134405	170134405	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr2:170134405G>T	ENST00000263816.3	-	13	1907	c.1622C>A	c.(1621-1623)gCa>gAa	p.A541E	LRP2_ENST00000443831.1_Intron	NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	541					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	ATCCATGAATGCCCTTTCCAG	0.418																																						dbGAP											0													119.0	117.0	117.0					2																	170134405		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.1622C>A	2.37:g.170134405G>T	ENSP00000263816:p.Ala541Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.A541E	ENST00000263816.3	37	c.1622	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629375	0.67015	.	.	ENSG00000081479	ENST00000263816	D	0.91577	-2.87	5.79	4.91	0.64330	Six-bladed beta-propeller, TolB-like (1);	0.048540	0.85682	D	0.000000	D	0.96470	0.8848	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97397	0.9993	10	0.72032	D	0.01	.	16.9913	0.86354	0.0:0.1275:0.8725:0.0	.	541	P98164	LRP2_HUMAN	E	541	ENSP00000263816:A541E	ENSP00000263816:A541E	A	-	2	0	LRP2	169842651	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	9.711000	0.98735	1.441000	0.47550	-0.314000	0.08810	GCA	LRP2	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000081479		0.418	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	53	0.00	0	G	NM_004525		170134405	170134405	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	135	18.67	31	SNP	1.000	T
MMP11	4320	genome.wustl.edu	37	22	24124523	24124523	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr22:24124523G>A	ENST00000215743.3	+	7	1238	c.1186G>A	c.(1186-1188)Gag>Aag	p.E396K	AP000349.1_ENST00000598975.1_Missense_Mutation_p.R231W	NM_005940.3	NP_005931.2	P24347	MMP11_HUMAN	matrix metallopeptidase 11 (stromelysin 3)	396					basement membrane organization (GO:0071711)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|negative regulation of fat cell differentiation (GO:0045599)|proteolysis (GO:0006508)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	27		Medulloblastoma(6;9.86e-08)|all_neural(6;0.000318)			Marimastat(DB00786)	CTGGGGTCCCGAGAAGAACAA	0.647																																						dbGAP											0													72.0	65.0	67.0					22																	24124523		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13816.1	22q11.23	2008-06-11	2005-08-08		ENSG00000099953	ENSG00000099953			7157	protein-coding gene	gene with protein product		185261	"""matrix metalloproteinase 11 (stromelysin 3)"""	STMY3		1639418, 7657606, 12006591	Standard	NM_005940		Approved		uc002zxx.3	P24347	OTTHUMG00000150742	ENST00000215743.3:c.1186G>A	22.37:g.24124523G>A	ENSP00000215743:p.Glu396Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5FX24|Q6PEZ6|Q9UC26	Missense_Mutation	SNP	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.E396K	ENST00000215743.3	37	c.1186	CCDS13816.1	22	.	.	.	.	.	.	.	.	.	.	G	13.16	2.154139	0.38021	.	.	ENSG00000099953	ENST00000215743	T	0.12879	2.64	4.93	3.91	0.45181	Hemopexin/matrixin (2);	0.315698	0.38005	N	0.001850	T	0.11067	0.0270	L	0.43701	1.375	0.46774	D	0.999198	P	0.45212	0.853	B	0.38106	0.265	T	0.17410	-1.0370	10	0.14656	T	0.56	.	12.7567	0.57339	0.0794:0.0:0.9206:0.0	.	396	P24347	MMP11_HUMAN	K	396	ENSP00000215743:E396K	ENSP00000215743:E396K	E	+	1	0	MMP11	22454523	1.000000	0.71417	0.815000	0.32552	0.262000	0.26303	4.053000	0.57427	1.466000	0.48025	0.585000	0.79938	GAG	MMP11	-	pirsf_Pept_M10A_matrix_strom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000099953		0.647	MMP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP11	HGNC	protein_coding	OTTHUMT00000319891.2	37	0.00	0	G	NM_005940		24124523	24124523	+1	no_errors	ENST00000215743	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.984	A
SEPT1	1731	genome.wustl.edu	37	16	30389183	30389183	+	IGR	SNP	T	T	C			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr16:30389183T>C	ENST00000571393.1	-	0	1589				MYLPF_ENST00000322861.7_Missense_Mutation_p.Y158H			Q8WYJ6	SEPT1_HUMAN	septin 1						cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			breast(2)|endometrium(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)|urinary_tract(1)	24			Colorectal(24;0.193)			AAACATCTGCTACGTCATCAC	0.672																																						dbGAP											0													54.0	55.0	55.0					16																	30389183		2197	4300	6497	-	-	-	SO:0001628	intergenic_variant	0			AF308288	CCDS10678.1, CCDS10678.2, CCDS10678.3	16p11.2	2013-01-21		2001-09-10	ENSG00000180096	ENSG00000180096	3.1.5.1	"""Septins"""	2879	protein-coding gene	gene with protein product		612897		DIFF6		8697812	Standard	NM_052838		Approved	PNUTL3	uc002dxy.4	Q8WYJ6	OTTHUMG00000176984		16.37:g.30389183T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVE6|Q658T1|Q8NEZ1|Q96EL4|Q9H285	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.Y158H	ENST00000571393.1	37	c.472		16	.	.	.	.	.	.	.	.	.	.	T	33	5.269531	0.95429	.	.	ENSG00000180209	ENST00000322861	T	0.78364	-1.17	5.58	5.58	0.84498	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.74122	0.3675	L	0.35644	1.08	0.80722	D	1	B	0.27625	0.183	B	0.39185	0.293	T	0.69355	-0.5167	10	0.23302	T	0.38	.	14.7247	0.69336	0.0:0.0:0.0:1.0	.	158	Q96A32	MLRS_HUMAN	H	158	ENSP00000325239:Y158H	ENSP00000325239:Y158H	Y	+	1	0	MYLPF	30296684	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.240000	0.65378	2.110000	0.64415	0.482000	0.46254	TAC	MYLPF	-	NULL	ENSG00000180209		0.672	SEPT1-201	KNOWN	basic	protein_coding	MYLPF	HGNC	protein_coding		17	0.00	0	T	NM_052838		30389183	30389183	+1	no_errors	ENST00000322861	ensembl	human	known	69_37n	missense	12	50.00	12	SNP	1.000	C
PCDH15	65217	genome.wustl.edu	37	10	55582871	55582871	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr10:55582871T>A	ENST00000320301.6	-	33	5009	c.4615A>T	c.(4615-4617)Aat>Tat	p.N1539Y	PCDH15_ENST00000373965.2_Intron|PCDH15_ENST00000395438.1_Intron|PCDH15_ENST00000463095.1_5'UTR|PCDH15_ENST00000395433.1_Missense_Mutation_p.N1516Y|PCDH15_ENST00000437009.1_Missense_Mutation_p.N1470Y|PCDH15_ENST00000395432.2_Missense_Mutation_p.N1499Y|PCDH15_ENST00000395440.1_Intron|PCDH15_ENST00000395446.1_Intron|PCDH15_ENST00000373957.3_Intron|PCDH15_ENST00000361849.3_Missense_Mutation_p.N1541Y|PCDH15_ENST00000395430.1_Missense_Mutation_p.N1536Y|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395445.1_Intron|PCDH15_ENST00000395442.1_Intron|PCDH15_ENST00000414778.1_Intron	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	1539					equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)			NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				ATGTCTGAATTTGTTGATACT	0.378										HNSCC(58;0.16)																												dbGAP											0													86.0	93.0	90.0					10																	55582871		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.4615A>T	10.37:g.55582871T>A	ENSP00000322604:p.Asn1539Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.N1539Y	ENST00000320301.6	37	c.4615	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	T	5.670	0.308236	0.10733	.	.	ENSG00000150275	ENST00000395432;ENST00000361849;ENST00000395433;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009	T;T;T;T;T;T	0.58358	0.37;0.34;0.39;0.35;0.35;0.36	5.91	-1.0	0.10196	.	.	.	.	.	T	0.43122	0.1233	L	0.51422	1.61	0.09310	N	1	B;B;B;B;B;B;B;B	0.33198	0.401;0.173;0.173;0.173;0.28;0.173;0.401;0.173	B;B;B;B;B;B;B;B	0.35813	0.211;0.091;0.091;0.091;0.091;0.067;0.211;0.091	T	0.42932	-0.9422	9	0.87932	D	0	.	4.639	0.12540	0.1048:0.1004:0.4669:0.3279	.	1516;1539;1541;1546;1470;1499;1536;1539	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;Q96QU1	.;.;.;.;.;.;.;PCD15_HUMAN	Y	1499;1541;1516;1539;1536;1546;1470	ENSP00000378820:N1499Y;ENSP00000354950:N1541Y;ENSP00000378821:N1516Y;ENSP00000322604:N1539Y;ENSP00000378818:N1536Y;ENSP00000412628:N1470Y	ENSP00000322604:N1539Y	N	-	1	0	PCDH15	55252877	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.273000	0.18662	-0.160000	0.11002	-0.321000	0.08615	AAT	PCDH15	-	NULL	ENSG00000150275		0.378	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	17	0.00	0	T	NM_033056		55582871	55582871	-1	no_errors	ENST00000320301	ensembl	human	known	69_37n	missense	25	28.57	10	SNP	0.000	A
PDZD2	23037	genome.wustl.edu	37	5	32090922	32090922	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr5:32090922G>C	ENST00000438447.1	+	20	7756	c.7368G>C	c.(7366-7368)atG>atC	p.M2456I	PDZD2_ENST00000282493.3_Missense_Mutation_p.M2456I			O15018	PDZD2_HUMAN	PDZ domain containing 2	2456					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CCCCAACGATGACCCTGGCTT	0.567																																						dbGAP											0													79.0	81.0	80.0					5																	32090922		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.7368G>C	5.37:g.32090922G>C	ENSP00000402033:p.Met2456Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXD4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.M2456I	ENST00000438447.1	37	c.7368	CCDS34137.1	5	.	.	.	.	.	.	.	.	.	.	G	4.688	0.127907	0.08981	.	.	ENSG00000133401	ENST00000438447;ENST00000382161;ENST00000282493	T;T	0.05580	3.42;3.42	5.15	1.35	0.21983	.	1.903240	0.02575	N	0.098200	T	0.04182	0.0116	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.36625	-0.9740	10	0.26408	T	0.33	.	7.0744	0.25197	0.4393:0.0:0.5607:0.0	.	2456	O15018	PDZD2_HUMAN	I	2456;2257;2456	ENSP00000402033:M2456I;ENSP00000282493:M2456I	ENSP00000282493:M2456I	M	+	3	0	PDZD2	32126679	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.051000	0.14141	0.568000	0.29311	-0.258000	0.10820	ATG	PDZD2	-	NULL	ENSG00000133401		0.567	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	38	0.00	0	G			32090922	32090922	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.000	C
PRUNE	58497	genome.wustl.edu	37	1	150998051	150998051	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr1:150998051A>G	ENST00000271620.3	+	5	737	c.581A>G	c.(580-582)gAc>gGc	p.D194G	PRUNE_ENST00000271619.8_Missense_Mutation_p.D35G|PRUNE_ENST00000368936.1_Missense_Mutation_p.D12G|PRUNE_ENST00000368935.1_Intron|PRUNE_ENST00000368937.1_Missense_Mutation_p.D12G|PRUNE_ENST00000467771.1_3'UTR|PRUNE_ENST00000368934.1_Missense_Mutation_p.D12G|RNU6-884P_ENST00000363889.1_RNA	NM_021222.1	NP_067045.1	Q86TP1	PRUNE_HUMAN	prune exopolyphosphatase	194						cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	inorganic diphosphatase activity (GO:0004427)|metal ion binding (GO:0046872)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	14	all_lung(15;1.09e-34)|Lung NSC(24;1.1e-30)|Lung SC(34;0.00202)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			ACCCCAAAGGACAGCAAATAT	0.443																																						dbGAP											0													153.0	140.0	144.0					1																	150998051		2203	4300	6503	-	-	-	SO:0001583	missense	0			U67085	CCDS977.1	1q21.2	2013-04-29	2013-04-29		ENSG00000143363	ENSG00000143363	3.6.1.11		13420	protein-coding gene	gene with protein product			"""prune homolog (Drosophila)"""			10602478, 11687967, 18700747	Standard	NM_021222		Approved	DRES-17, HTCD37	uc001ewh.1	Q86TP1	OTTHUMG00000035062	ENST00000271620.3:c.581A>G	1.37:g.150998051A>G	ENSP00000271620:p.Asp194Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCH8|B4DFL7|Q5SZF9|Q659E5|Q6P4E0|Q8N654|Q96JU5|Q9C071|Q9C072|Q9UIV0	Missense_Mutation	SNP	pfam_DHHA2,pfam_Pesterase_RecJ	p.D194G	ENST00000271620.3	37	c.581	CCDS977.1	1	.	.	.	.	.	.	.	.	.	.	a	27.6	4.842701	0.91197	.	.	ENSG00000143363	ENST00000450884;ENST00000271620;ENST00000302413;ENST00000271619;ENST00000368937;ENST00000431193;ENST00000368936;ENST00000368934	T;T;T;T;T;T	0.57907	2.57;0.77;1.03;0.97;0.37;1.03	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.63792	0.2541	M	0.67953	2.075	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.69285	-0.5185	10	0.87932	D	0	.	13.7122	0.62675	1.0:0.0:0.0:0.0	.	35;194	E9PCU1;Q86TP1	.;PRUNE_HUMAN	G	12;194;127;35;12;12;12;12	ENSP00000271620:D194G;ENSP00000271619:D35G;ENSP00000357933:D12G;ENSP00000392632:D12G;ENSP00000357932:D12G;ENSP00000357930:D12G	ENSP00000271619:D35G	D	+	2	0	PRUNE	149264675	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	7.950000	0.87804	2.127000	0.65507	0.492000	0.49549	GAC	PRUNE	-	NULL	ENSG00000143363		0.443	PRUNE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRUNE	HGNC	protein_coding	OTTHUMT00000084885.1	69	0.00	0	A	NM_021222		150998051	150998051	+1	no_errors	ENST00000271620	ensembl	human	known	69_37n	missense	140	15.15	25	SNP	0.998	G
PROX1	5629	genome.wustl.edu	37	1	214184963	214184963	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr1:214184963G>A	ENST00000366958.4	+	4	2541	c.1933G>A	c.(1933-1935)Gat>Aat	p.D645N	PROX1_ENST00000498508.2_Missense_Mutation_p.D645N|PROX1_ENST00000435016.1_Missense_Mutation_p.D645N|PROX1_ENST00000261454.4_Missense_Mutation_p.D645N	NM_001270616.1	NP_001257545.1	Q92786	PROX1_HUMAN	prospero homeobox 1	645	Prospero-like.				aorta smooth muscle tissue morphogenesis (GO:0060414)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|brain development (GO:0007420)|cell fate determination (GO:0001709)|cerebellar granule cell differentiation (GO:0021707)|dentate gyrus development (GO:0021542)|dorsal spinal cord development (GO:0021516)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocardium formation (GO:0060214)|hepatocyte cell migration (GO:0002194)|hepatocyte differentiation (GO:0070365)|hepatocyte proliferation (GO:0072574)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lens fiber cell morphogenesis (GO:0070309)|liver development (GO:0001889)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|negative regulation of bile acid biosynthetic process (GO:0070858)|negative regulation of cell proliferation (GO:0008285)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral genome replication (GO:0045071)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|optic placode formation involved in camera-type eye formation (GO:0046619)|otic placode formation (GO:0043049)|pancreas development (GO:0031016)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell cycle checkpoint (GO:1901978)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045737)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of forebrain neuron differentiation (GO:2000979)|positive regulation of heart growth (GO:0060421)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of sarcomere organization (GO:0060298)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of circadian rhythm (GO:0042752)|regulation of gene expression (GO:0010468)|regulation of transcription involved in lymphatic endothelial cell fate commitment (GO:0060849)|response to nutrient levels (GO:0031667)|retina morphogenesis in camera-type eye (GO:0060042)|skeletal muscle thin filament assembly (GO:0030240)|venous blood vessel morphogenesis (GO:0048845)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular cardiac myofibril assembly (GO:0055005)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|DBD domain binding (GO:0050692)|DNA binding (GO:0003677)|LBD domain binding (GO:0050693)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(6)|lung(15)|ovary(3)|prostate(2)|skin(4)	47				OV - Ovarian serous cystadenocarcinoma(81;0.0179)|all cancers(67;0.0488)|GBM - Glioblastoma multiforme(131;0.188)|Epithelial(68;0.219)		AGCCATCAACGATGGGGTCAC	0.448																																						dbGAP											0													164.0	142.0	149.0					1																	214184963		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44060	CCDS31021.1	1q41	2011-06-20	2007-06-01		ENSG00000117707	ENSG00000117707		"""Homeoboxes / PROS class"""	9459	protein-coding gene	gene with protein product		601546	"""prospero-related homeobox 1"""			8812486	Standard	NM_002763		Approved		uc001hkg.2	Q92786	OTTHUMG00000036946	ENST00000366958.4:c.1933G>A	1.37:g.214184963G>A	ENSP00000355925:p.Asp645Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK29|A8K2B1|Q5SW76|Q8TB91	Missense_Mutation	SNP	pfam_Prox1,superfamily_Homeodomain-like	p.D645N	ENST00000366958.4	37	c.1933	CCDS31021.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.504972	0.96371	.	.	ENSG00000117707	ENST00000541470;ENST00000498508;ENST00000366958;ENST00000435016;ENST00000261454	T;T;T;T	0.51325	0.71;0.71;0.71;0.71	5.73	5.73	0.89815	Homeo-prospero domain (1);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	T	0.58018	0.2093	M	0.77103	2.36	0.80722	D	1	P	0.44690	0.841	B	0.43331	0.416	T	0.62760	-0.6786	10	0.56958	D	0.05	-4.7228	20.2602	0.98440	0.0:0.0:1.0:0.0	.	645	Q92786	PROX1_HUMAN	N	217;645;645;645;645	ENSP00000420283:D645N;ENSP00000355925:D645N;ENSP00000400694:D645N;ENSP00000261454:D645N	ENSP00000261454:D645N	D	+	1	0	PROX1	212251586	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.813000	0.99286	2.861000	0.98227	0.655000	0.94253	GAT	PROX1	-	pfam_Prox1,superfamily_Homeodomain-like	ENSG00000117707		0.448	PROX1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PROX1	HGNC	protein_coding	OTTHUMT00000089727.6	56	0.00	0	G	NM_002763		214184963	214184963	+1	no_errors	ENST00000261454	ensembl	human	known	69_37n	missense	95	30.94	43	SNP	1.000	A
PXDNL	137902	genome.wustl.edu	37	8	52321996	52321996	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr8:52321996G>T	ENST00000356297.4	-	17	2288	c.2188C>A	c.(2188-2190)Cac>Aac	p.H730N	PXDNL_ENST00000543296.1_Missense_Mutation_p.H730N	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	730					hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				GTGCCGTCGTGGGCGCGGTAC	0.677																																						dbGAP											0													24.0	27.0	26.0					8																	52321996		2098	4200	6298	-	-	-	SO:0001583	missense	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.2188C>A	8.37:g.52321996G>T	ENSP00000348645:p.His730Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.H730N	ENST00000356297.4	37	c.2188	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	4.264	0.048074	0.08243	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.68479	-0.33;-0.33	3.71	1.74	0.24563	.	.	.	.	.	T	0.62258	0.2413	L	0.60904	1.88	0.24705	N	0.993235	P	0.38335	0.627	B	0.39027	0.288	T	0.49771	-0.8904	8	.	.	.	.	11.2183	0.48840	0.0:0.3912:0.6088:0.0	.	730	A1KZ92	PXDNL_HUMAN	N	730	ENSP00000348645:H730N;ENSP00000444865:H730N	.	H	-	1	0	PXDNL	52484549	1.000000	0.71417	0.000000	0.03702	0.013000	0.08279	2.875000	0.48491	0.128000	0.18479	0.555000	0.69702	CAC	PXDNL	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000147485		0.677	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	14	0.00	0	G	NM_144651		52321996	52321996	-1	no_errors	ENST00000356297	ensembl	human	known	69_37n	missense	26	36.59	15	SNP	0.786	T
RALY	22913	genome.wustl.edu	37	20	32664866	32664866	+	Missense_Mutation	SNP	G	G	A	rs11538302	byFrequency	TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr20:32664866G>A	ENST00000246194.3	+	8	1193	c.691G>A	c.(691-693)Ggc>Agc	p.G231S	RALY_ENST00000375114.3_Missense_Mutation_p.G215S	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein	231	Epitope (recognized by BKRF1 antibodies).|Poly-Gly.				mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						Aggtggcgccggcggcggcgg	0.667													A|||	1258	0.251198	0.1278	0.2262	5008	,	,		14733	0.3482		0.2535	False		,,,				2504	0.3333					dbGAP											0													6.0	8.0	7.0					20																	32664866		2101	4140	6241	-	-	-	SO:0001583	missense	0			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.691G>A	20.37:g.32664866G>A	ENSP00000246194:p.Gly231Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.G231S	ENST00000246194.3	37	c.691	CCDS13230.1	20	.	.	.	.	.	.	.	.	.	.	A	5.216	0.225424	0.09916	.	.	ENSG00000125970	ENST00000375114;ENST00000246194;ENST00000333552;ENST00000442805	D;D;T;D	0.86627	-2.15;-2.15;-1.48;-2.15	3.37	-0.383	0.12477	.	1.385570	0.05397	N	0.540016	T	0.74688	0.3749	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.08055	0.003;0.001	T	0.58967	-0.7542	10	0.02654	T	1	0.1138	8.9812	0.35966	0.3078:0.0:0.6922:0.0	rs11538302	215;231	Q9UKM9-2;Q9UKM9	.;RALY_HUMAN	S	215;231;165;215	ENSP00000364255:G215S;ENSP00000246194:G231S;ENSP00000327522:G165S;ENSP00000415973:G215S	ENSP00000246194:G231S	G	+	1	0	RALY	32128527	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.816000	0.04477	-0.425000	0.07371	-2.048000	0.00412	GGC	RALY	-	pirsf_hnRNP_C_Raly	ENSG00000125970		0.667	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RALY	HGNC	protein_coding	OTTHUMT00000078753.1	8	0.00	0	G			32664866	32664866	+1	no_errors	ENST00000246194	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.001	A
RDH14	57665	genome.wustl.edu	37	2	18736520	18736520	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr2:18736520C>G	ENST00000381249.3	-	2	1055	c.948G>C	c.(946-948)atG>atC	p.M316I	RDH14_ENST00000468071.1_5'UTR	NM_020905.3	NP_065956.1	Q9HBH5	RDH14_HUMAN	retinol dehydrogenase 14 (all-trans/9-cis/11-cis)	316					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			breast(2)|endometrium(1)|large_intestine(2)|lung(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)				Vitamin A(DB00162)	CAGATTCATCCATAGCTTTGG	0.418																																						dbGAP											0													154.0	150.0	152.0					2																	18736520		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF237952	CCDS1693.1	2p24.2	2011-09-14	2006-05-09		ENSG00000240857	ENSG00000240857	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19979	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 4"""		"""retinol dehydrogenase 14 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_020905		Approved	PAN2, SDR7C4		Q9HBH5	OTTHUMG00000090705	ENST00000381249.3:c.948G>C	2.37:g.18736520C>G	ENSP00000370648:p.Met316Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.M316I	ENST00000381249.3	37	c.948	CCDS1693.1	2	.	.	.	.	.	.	.	.	.	.	C	13.53	2.265146	0.40095	.	.	ENSG00000240857	ENST00000381249	T	0.61510	0.1	5.82	5.82	0.92795	NAD(P)-binding domain (1);	.	.	.	.	T	0.42223	0.1193	N	0.11427	0.14	0.44728	D	0.997728	B	0.29835	0.258	B	0.24541	0.054	T	0.35025	-0.9805	9	0.46703	T	0.11	.	20.091	0.97817	0.0:1.0:0.0:0.0	.	316	Q9HBH5	RDH14_HUMAN	I	316	ENSP00000370648:M316I	ENSP00000370648:M316I	M	-	3	0	RDH14	18600001	1.000000	0.71417	1.000000	0.80357	0.846000	0.48090	3.711000	0.54868	2.755000	0.94549	0.591000	0.81541	ATG	RDH14	-	NULL	ENSG00000240857		0.418	RDH14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH14	HGNC	protein_coding	OTTHUMT00000207394.1	80	0.00	0	C			18736520	18736520	-1	no_errors	ENST00000381249	ensembl	human	known	69_37n	missense	108	32.30	52	SNP	1.000	G
RFC1	5981	genome.wustl.edu	37	4	39301747	39301747	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr4:39301747T>C	ENST00000381897.1	-	21	2838	c.2705A>G	c.(2704-2706)aAa>aGa	p.K902R	RNU6-32P_ENST00000383948.1_RNA|RFC1_ENST00000349703.2_Missense_Mutation_p.K901R	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	902					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						CAGGTGCTTTTTCATGTCACC	0.512																																					Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	dbGAP											0													106.0	102.0	103.0					4																	39301747		2203	4300	6503	-	-	-	SO:0001583	missense	0			L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.2705A>G	4.37:g.39301747T>C	ENSP00000371321:p.Lys902Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Missense_Mutation	SNP	pfam_DNA_replication_fac_RFC1_C,pfam_BRCT_dom,pfam_ATPase_AAA_core,superfamily_DNA_pol3_clamp-load_cplx_C,superfamily_BRCT_dom,smart_BRCT_dom,smart_AAA+_ATPase,pirsf_DNA_replication_fac_C_lsu,pfscan_BRCT_dom	p.K902R	ENST00000381897.1	37	c.2705	CCDS56329.1	4	.	.	.	.	.	.	.	.	.	.	T	31	5.073896	0.94000	.	.	ENSG00000035928	ENST00000381897;ENST00000349703	T;T	0.40476	1.03;1.03	6.01	6.01	0.97437	DNA polymerase III, clamp loader complex, gamma/delta/delta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.56863	0.2014	L	0.48877	1.53	0.80722	D	1	B;D	0.89917	0.409;1.0	B;D	0.80764	0.253;0.994	T	0.49234	-0.8961	10	0.21014	T	0.42	-24.6272	16.5181	0.84306	0.0:0.0:0.0:1.0	.	902;901	P35251;P35251-2	RFC1_HUMAN;.	R	902;901	ENSP00000371321:K902R;ENSP00000261424:K901R	ENSP00000261424:K901R	K	-	2	0	RFC1	38978142	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.250000	0.72435	2.299000	0.77371	0.496000	0.49642	AAA	RFC1	-	superfamily_DNA_pol3_clamp-load_cplx_C,pirsf_DNA_replication_fac_C_lsu	ENSG00000035928		0.512	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFC1	HGNC	protein_coding	OTTHUMT00000216808.1	59	0.00	0	T	NM_002913		39301747	39301747	-1	no_errors	ENST00000381897	ensembl	human	known	69_37n	missense	43	51.14	45	SNP	1.000	C
RYR2	6262	genome.wustl.edu	37	1	237806646	237806646	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr1:237806646G>A	ENST00000366574.2	+	48	7558	c.7241G>A	c.(7240-7242)gGa>gAa	p.G2414E	RYR2_ENST00000360064.6_Missense_Mutation_p.G2412E|RYR2_ENST00000542537.1_Missense_Mutation_p.G2398E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2414	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GCCGGGAAGGGAGAAGCCATC	0.413																																						dbGAP											0													197.0	186.0	189.0					1																	237806646		1876	4095	5971	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7241G>A	1.37:g.237806646G>A	ENSP00000355533:p.Gly2414Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.G2412E	ENST00000366574.2	37	c.7235	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	23.9	4.475718	0.84640	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.96774	-4.12;-4.12;-4.12	5.61	4.69	0.59074	.	0.000000	0.64402	D	0.000007	D	0.97936	0.9321	M	0.81802	2.56	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98781	1.0732	10	0.87932	D	0	-11.7702	14.7	0.69150	0.07:0.0:0.93:0.0	.	2414	Q92736	RYR2_HUMAN	E	2414;2412;2398	ENSP00000355533:G2414E;ENSP00000353174:G2412E;ENSP00000443798:G2398E	ENSP00000353174:G2412E	G	+	2	0	RYR2	235873269	1.000000	0.71417	0.969000	0.41365	0.944000	0.59088	9.813000	0.99286	1.505000	0.48720	0.655000	0.94253	GGA	RYR2	-	NULL	ENSG00000198626		0.413	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	86	0.00	0	G	NM_001035		237806646	237806646	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	209	17.32	44	SNP	1.000	A
SCN7A	6332	genome.wustl.edu	37	2	167284443	167284443	+	Missense_Mutation	SNP	C	C	T	rs559936352		TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr2:167284443C>T	ENST00000409855.1	-	17	2834	c.2708G>A	c.(2707-2709)cGc>cAc	p.R903H		NM_002976.3	NP_002967.2	Q01118	SCN7A_HUMAN	sodium channel, voltage-gated, type VII, alpha subunit	903					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion homeostasis (GO:0055078)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	glial cell projection (GO:0097386)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(30)|prostate(4)|soft_tissue(1)|urinary_tract(1)	44					Valproic Acid(DB00313)	TGAAGATCCGCGTCTGCAACC	0.383													c|||	1	0.000199681	0.0	0.0	5008	,	,		17396	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													94.0	87.0	89.0					2																	167284443		1856	4097	5953	-	-	-	SO:0001583	missense	0			M91556	CCDS46442.1	2q21-q23	2012-03-05	2012-02-28	2002-06-14	ENSG00000136546	ENSG00000136546		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10594	protein-coding gene	gene with protein product		182392	"""sodium channel, voltage-gated, type VI, alpha"", ""sodium channel, voltage-gated, type VII, alpha"""	SCN6A		10198179	Standard	NM_002976		Approved	Nav2.1, Nav2.2, NaG	uc002udu.2	Q01118	OTTHUMG00000154078	ENST00000409855.1:c.2708G>A	2.37:g.167284443C>T	ENSP00000386796:p.Arg903His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.R903H	ENST00000409855.1	37	c.2708	CCDS46442.1	2	.	.	.	.	.	.	.	.	.	.	c	10.81	1.454153	0.26161	.	.	ENSG00000136546	ENST00000409855;ENST00000259060	D	0.84800	-1.9	5.42	-3.41	0.04839	Sodium ion transport-associated (1);	1.098480	0.06996	N	0.822524	D	0.83335	0.5232	M	0.80616	2.505	0.09310	N	1	B	0.14012	0.009	B	0.12837	0.008	T	0.68815	-0.5309	10	0.42905	T	0.14	.	8.5796	0.33621	0.0:0.2803:0.117:0.6027	.	903	Q01118	SCN7A_HUMAN	H	903	ENSP00000386796:R903H	ENSP00000259060:R903H	R	-	2	0	SCN7A	166992689	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.561000	0.02158	-0.705000	0.05035	-2.181000	0.00316	CGC	SCN7A	-	pfam_Na_trans_assoc	ENSG00000136546		0.383	SCN7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN7A	HGNC	protein_coding	OTTHUMT00000333745.1	85	0.00	0	C			167284443	167284443	-1	no_errors	ENST00000409855	ensembl	human	known	69_37n	missense	187	26.56	68	SNP	0.000	T
SLC38A3	10991	genome.wustl.edu	37	3	50252106	50252106	+	RNA	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr3:50252106G>A	ENST00000420502.1	+	0	358									solute carrier family 38, member 3											breast(1)|cervix(1)|endometrium(1)|lung(3)	6				BRCA - Breast invasive adenocarcinoma(193;0.000275)|KIRC - Kidney renal clear cell carcinoma(197;0.00548)|Kidney(197;0.00615)		GACATCATTCGGGATGTCAGT	0.582																																						dbGAP											0													58.0	55.0	56.0					3																	50252106		2203	4300	6503	-	-	-			0			U49082	CCDS74940.1	3p21.3	2013-05-22			ENSG00000188338	ENSG00000188338		"""Solute carriers"""	18044	protein-coding gene	gene with protein product		604437				10619430, 10823827	Standard	XM_006712954		Approved	G17, SN1	uc003cyn.4	Q99624	OTTHUMG00000156764		3.37:g.50252106G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000420502.1	37	NULL		3																																																																																			SLC38A3	-	-	ENSG00000188338		0.582	SLC38A3-001	KNOWN	sequence_error|basic	processed_transcript	SLC38A3	HGNC	processed_transcript	OTTHUMT00000345635.2	54	0.00	0	G	NM_006841		50252106	50252106	+1	no_errors	ENST00000414604	ensembl	human	known	69_37n	rna	67	29.47	28	SNP	1.000	A
SYBU	55638	genome.wustl.edu	37	8	110655166	110655166	+	Intron	SNP	A	A	G			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr8:110655166A>G	ENST00000422135.1	-	3	540				SYBU_ENST00000424158.2_Missense_Mutation_p.F12S|SYBU_ENST00000440310.1_Intron|SYBU_ENST00000528331.1_Intron|RP11-422N16.3_ENST00000499579.1_5'Flank|SYBU_ENST00000433638.1_Intron|SYBU_ENST00000399066.3_Missense_Mutation_p.F4S|SYBU_ENST00000419099.1_Intron|SYBU_ENST00000533171.1_Intron|SYBU_ENST00000528647.1_Intron|SYBU_ENST00000446070.2_Intron|SYBU_ENST00000533065.1_Intron|SYBU_ENST00000276646.9_Intron|SYBU_ENST00000533895.1_Intron|SYBU_ENST00000408889.3_Intron|SYBU_ENST00000532779.1_Intron|SYBU_ENST00000408908.2_Intron	NM_001099744.1	NP_001093214.1	Q9NX95	SYBU_HUMAN	syntabulin (syntaxin-interacting)						regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|dense body (GO:0097433)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(4)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	30						CTCCTTCTCAAAATTGGACAT	0.438																																						dbGAP											0													68.0	71.0	70.0					8																	110655166		1892	4125	6017	-	-	-	SO:0001627	intron_variant	0			AB040905	CCDS43763.1, CCDS43764.1, CCDS47912.1, CCDS55271.1	8q23.2	2010-08-27				ENSG00000147642			26011	protein-coding gene	gene with protein product	"""syntaphilin-like"""	611568				17611281, 16750881, 16157705, 15656992, 15459722	Standard	NM_001099743		Approved	FLJ20366, GOLSYN, KIAA1472, OCSYN, SNPHL	uc003ynj.4	Q9NX95		ENST00000422135.1:c.25-5T>C	8.37:g.110655166A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K354|B3KQX3|B3KU61|Q5R1T1|Q5R1T2|Q5R1T3|Q5Y2M6|Q8ND49|Q8TCR6|Q96D80|Q9P256	Missense_Mutation	SNP	NULL	p.F4S	ENST00000422135.1	37	c.11	CCDS47912.1	8	.	.	.	.	.	.	.	.	.	.	A	18.47	3.632048	0.67015	.	.	ENSG00000147642	ENST00000424158;ENST00000399066	.	.	.	6.04	2.35	0.29111	.	.	.	.	.	T	0.37812	0.1017	.	.	.	0.80722	D	1	B	0.15473	0.013	B	0.12156	0.007	T	0.07195	-1.0785	6	.	.	.	.	5.9076	0.19010	0.7109:0.1407:0.1484:0.0	.	4	Q9NX95-4	.	S	12;4	.	.	F	-	2	0	SYBU	110724342	0.999000	0.42202	0.854000	0.33618	0.963000	0.63663	1.253000	0.32886	0.170000	0.19704	0.460000	0.39030	TTT	SYBU	-	NULL	ENSG00000147642		0.438	SYBU-204	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYBU	HGNC	protein_coding	OTTHUMT00000385501.1	34	0.00	0	A	NM_017786		110655166	110655166	-1	no_errors	ENST00000399066	ensembl	human	known	69_37n	missense	122	21.79	34	SNP	1.000	G
SYNPO2	171024	genome.wustl.edu	37	4	119952720	119952720	+	Silent	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr4:119952720G>A	ENST00000429713.2	+	4	2972	c.2790G>A	c.(2788-2790)tcG>tcA	p.S930S	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000434046.2_Silent_p.S930S|SYNPO2_ENST00000307142.4_Silent_p.S930S	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	930						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						CTATCCACTCGCCGTCTTACC	0.542																																						dbGAP											0													86.0	82.0	83.0					4																	119952720		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.2790G>A	4.37:g.119952720G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	superfamily_PDZ,pfscan_PDZ	p.A882T	ENST00000429713.2	37	c.2644	CCDS47129.1	4	.	.	.	.	.	.	.	.	.	.	G	3.476	-0.106831	0.06924	.	.	ENSG00000172403	ENST00000504178	.	.	.	5.66	-3.92	0.04155	.	.	.	.	.	T	0.50939	0.1645	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.50389	-0.8834	4	.	.	.	-15.8489	8.0118	0.30357	0.0:0.2245:0.4155:0.3601	.	.	.	.	T	882	.	.	A	+	1	0	SYNPO2	120172168	0.016000	0.18221	0.982000	0.44146	0.702000	0.40608	-1.037000	0.03557	-0.454000	0.07066	-0.133000	0.14855	GCC	SYNPO2	-	NULL	ENSG00000172403		0.542	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	SYNPO2	HGNC	protein_coding	OTTHUMT00000364020.1	37	0.00	0	G			119952720	119952720	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000504178	ensembl	human	novel	69_37n	missense	37	25.49	13	SNP	0.402	A
TP53	7157	genome.wustl.edu	37	17	7577061	7577064	+	Frame_Shift_Del	DEL	CTTT	CTTT	-	rs587780076|rs121912663		TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	CTTT	CTTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr17:7577061_7577064delCTTT	ENST00000269305.4	-	8	1063_1066	c.874_877delAAAG	c.(874-879)aaagggfs	p.KG292fs	TP53_ENST00000413465.2_Intron|TP53_ENST00000445888.2_Frame_Shift_Del_p.KG292fs|TP53_ENST00000420246.2_Frame_Shift_Del_p.KG292fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.KG292fs|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Frame_Shift_Del_p.KG292fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	292	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		K -> E (in sporadic cancers; somatic mutation).|K -> G (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|K -> I (in LFS; germline mutation and in a sporadic cancer; somatic mutation). {ECO:0000269|PubMed:10484981}.|K -> N (in sporadic cancers; somatic mutation).|K -> Q (in a sporadic cancer; somatic mutation).|K -> R (in sporadic cancers; somatic mutation).|K -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.K291fs*48(8)|p.0?(8)|p.E294fs*51(5)|p.K292R(5)|p.G293R(4)|p.K292T(4)|p.G293fs*13(3)|p.K292N(3)|p.K292*(2)|p.?(2)|p.K292E(2)|p.R290fs*12(1)|p.G293fs*1(1)|p.R290fs*50(1)|p.K292fs*13(1)|p.G293W(1)|p.K291fs*12(1)|p.T284_G293del10(1)|p.R290_P295>X(1)|p.E285fs*13(1)|p.L265_K305del41(1)|p.V272_K292del21(1)|p.K292K(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGAGGCTCCCCTTTCTTGCGGAGA	0.574		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	58	Deletion - Frameshift(19)|Substitution - Missense(19)|Whole gene deletion(8)|Deletion - In frame(3)|Insertion - Frameshift(3)|Substitution - Nonsense(2)|Unknown(2)|Complex - deletion inframe(1)|Substitution - coding silent(1)	upper_aerodigestive_tract(16)|urinary_tract(6)|large_intestine(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|stomach(3)|central_nervous_system(3)|lung(3)|breast(3)|ovary(3)|oesophagus(2)|cervix(1)|salivary_gland(1)|kidney(1)|endometrium(1)|thyroid(1)|liver(1)	GRCh37	CM910627|CM994791	TP53	M	rs121912663																																			-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.874_877delAAAG	17.37:g.7577061_7577064delCTTT	ENSP00000269305:p.Lys292fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.K292fs	ENST00000269305.4	37	c.877_874	CCDS11118.1	17																																																																																			TP53	-	NULL	ENSG00000141510		0.574	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	86	0.00	0	CTTT	NM_000546		7577061	7577064	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	35	65.77	73	DEL	0.324:0.411:0.904:0.987	-
USP29	57663	genome.wustl.edu	37	19	57641241	57641241	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr19:57641241G>T	ENST00000254181.4	+	4	1652	c.1198G>T	c.(1198-1200)Gaa>Taa	p.E400*	USP29_ENST00000598197.1_Nonsense_Mutation_p.E400*	NM_020903.2	NP_065954.1	Q9HBJ7	UBP29_HUMAN	ubiquitin specific peptidase 29	400	USP.				ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			breast(3)|endometrium(4)|kidney(3)|large_intestine(15)|lung(47)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	85		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0822)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TACTGGGAAAGAATGTGGGGA	0.393																																						dbGAP											0													92.0	83.0	86.0					19																	57641241		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS33124.1	19q13.4	2008-06-23	2005-08-08			ENSG00000131864		"""Ubiquitin-specific peptidases"""	18563	protein-coding gene	gene with protein product		609546	"""ubiquitin specific protease 29"""			12838346	Standard	NM_020903		Approved		uc002qny.3	Q9HBJ7		ENST00000254181.4:c.1198G>T	19.37:g.57641241G>T	ENSP00000254181:p.Glu400*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.E400*	ENST00000254181.4	37	c.1198	CCDS33124.1	19	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161245	0.78226	.	.	ENSG00000131864	ENST00000254181	.	.	.	2.26	-1.49	0.08718	.	0.622812	0.12718	U	0.444934	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13470	T	0.59	-0.6419	1.531	0.02536	0.2396:0.1592:0.4405:0.1607	.	.	.	.	X	400	.	ENSP00000254181:E400X	E	+	1	0	USP29	62333053	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.189000	0.17037	-0.665000	0.05317	-1.094000	0.02160	GAA	USP29	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000131864		0.393	USP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP29	HGNC	protein_coding	OTTHUMT00000465075.1	27	0.00	0	G			57641241	57641241	+1	no_errors	ENST00000254181	ensembl	human	known	69_37n	nonsense	34	48.48	32	SNP	0.000	T
VPS13D	55187	genome.wustl.edu	37	1	12368636	12368636	+	Silent	SNP	A	A	T			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr1:12368636A>T	ENST00000358136.3	+	27	6718	c.6588A>T	c.(6586-6588)acA>acT	p.T2196T	VPS13D_ENST00000356315.4_Silent_p.T2196T	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TGCGACAGACAGGAGGAAGCC	0.453																																						dbGAP											0													160.0	157.0	158.0					1																	12368636		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.6588A>T	1.37:g.12368636A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.Q1019L	ENST00000358136.3	37	c.3056	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	A	10.76	1.441277	0.25900	.	.	ENSG00000048707	ENST00000011700	.	.	.	5.61	1.92	0.25849	.	.	.	.	.	T	0.51227	0.1662	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.34976	-0.9807	4	.	.	.	.	4.5295	0.11997	0.564:0.0:0.3007:0.1353	.	.	.	.	L	1019	.	.	Q	+	2	0	VPS13D	12291223	0.012000	0.17670	1.000000	0.80357	0.997000	0.91878	-0.671000	0.05250	0.066000	0.16515	0.528000	0.53228	CAG	VPS13D	-	NULL	ENSG00000048707		0.453	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	47	0.00	0	A	NM_015378		12368636	12368636	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000011700	ensembl	human	novel	69_37n	missense	56	32.53	27	SNP	0.988	T
ZBTB9	221504	genome.wustl.edu	37	6	33424124	33424124	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A1PH-01A-11D-A14K-09	TCGA-EW-A1PH-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce860c6f-c87a-4a45-92df-ca34bfb2e8b2	28823da8-d29d-48c6-ae45-0ea4cdc23f52	g.chr6:33424124G>A	ENST00000395064.2	+	2	1515	c.1247G>A	c.(1246-1248)tGc>tAc	p.C416Y		NM_152735.3	NP_689948.1	Q96C00	ZBTB9_HUMAN	zinc finger and BTB domain containing 9	416					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|skin(1)|upper_aerodigestive_tract(2)	11						TGTGGCATCTGCAACAAGCGC	0.582																																						dbGAP											0													79.0	65.0	69.0					6																	33424124		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122644	CCDS4780.1	6p21.31	2013-01-09			ENSG00000213588	ENSG00000213588		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	28323	protein-coding gene	gene with protein product						12477932	Standard	NM_152735		Approved	MGC23166, ZNF919	uc003oeq.3	Q96C00	OTTHUMG00000140180	ENST00000395064.2:c.1247G>A	6.37:g.33424124G>A	ENSP00000378503:p.Cys416Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2AB19	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.C416Y	ENST00000395064.2	37	c.1247	CCDS4780.1	6	.	.	.	.	.	.	.	.	.	.	G	20.3	3.970818	0.74246	.	.	ENSG00000213588	ENST00000395064	T	0.64618	-0.11	5.1	5.1	0.69264	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000015	D	0.87281	0.6138	H	0.99415	4.555	0.58432	D	0.999994	D	0.89917	1.0	D	0.87578	0.998	D	0.92266	0.5821	10	0.87932	D	0	.	16.0648	0.80863	0.0:0.0:1.0:0.0	.	416	Q96C00	ZBTB9_HUMAN	Y	416	ENSP00000378503:C416Y	ENSP00000378503:C416Y	C	+	2	0	ZBTB9	33532102	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.041000	0.93788	2.654000	0.90174	0.655000	0.94253	TGC	ZBTB9	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213588		0.582	ZBTB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB9	HGNC	protein_coding	OTTHUMT00000276533.1	23	0.00	0	G	NM_152735		33424124	33424124	+1	no_errors	ENST00000395064	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	1.000	A
