#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ALMS1	7840	genome.wustl.edu	37	2	73651968	73651968	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:73651968G>C	ENST00000264448.6	+	5	1286	c.1175G>C	c.(1174-1176)cGt>cCt	p.R392P	ALMS1_ENST00000409009.1_Missense_Mutation_p.R350P|ALMS1_ENST00000377715.1_Missense_Mutation_p.R392P	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	392					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GATGCTGCTCGTTCATATGGG	0.358																																						dbGAP											0													78.0	72.0	74.0					2																	73651968		1882	4111	5993	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.1175G>C	2.37:g.73651968G>C	ENSP00000264448:p.Arg392Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.R392P	ENST00000264448.6	37	c.1175	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	G	0.007	-1.970137	0.00457	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.15952	3.28;3.28;2.38	4.17	1.39	0.22231	.	0.550399	0.15361	N	0.266386	T	0.08268	0.0206	N	0.08118	0	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.31998	-0.9923	10	0.37606	T	0.19	.	8.8972	0.35472	0.2758:0.0:0.7242:0.0	.	350;392	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	P	350;392;392	ENSP00000386627:R350P;ENSP00000264448:R392P;ENSP00000366944:R392P	ENSP00000264448:R392P	R	+	2	0	ALMS1	73505476	0.169000	0.23002	0.005000	0.12908	0.004000	0.04260	0.119000	0.15626	0.061000	0.16311	-1.151000	0.01829	CGT	ALMS1	-	NULL	ENSG00000116127		0.358	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	17	0.00	0	G	NM_015120		73651968	73651968	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	23	39.47	15	SNP	0.010	C
ANO7P1	101927546	genome.wustl.edu	37	1	16543736	16543736	+	RNA	SNP	G	G	A	rs114186822	byFrequency	TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr1:16543736G>A	ENST00000475369.1	-	0	87									anoctamin 7 pseudogene 1																		GCGGGGTCTGGAGAGGCTCTC	0.622													G|||	55	0.0109824	0.0393	0.0043	5008	,	,		13321	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0					1p36.13	2014-02-13	2012-10-24	2012-10-24	ENSG00000237276	ENSG00000237276			32248	pseudogene	pseudogene			"""transmembrane protein 16M"", ""chromosome 1 open reading frame 224"", ""anoctamin 7-like 1"""	TMEM16M, C1orf224, ANO7L1			Standard	XM_006711098		Approved				OTTHUMG00000002221		1.37:g.16543736G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000475369.1	37	NULL		1																																																																																			ANO7L1	-	-	ENSG00000237276		0.622	ANO7P1-002	KNOWN	basic	processed_transcript	ANO7L1	HGNC	pseudogene	OTTHUMT00000006295.2	9	0.00	0	G			16543736	16543736	-1	no_errors	ENST00000475369	ensembl	human	known	69_37n	rna	10	28.57	4	SNP	0.000	A
ATG9B	285973	genome.wustl.edu	37	7	150721003	150721003	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr7:150721003C>T	ENST00000377974.2	-	1	583	c.508G>A	c.(508-510)Gag>Aag	p.E170K	ATG9B_ENST00000494791.1_5'UTR|ATG9B_ENST00000605938.1_Missense_Mutation_p.E170K|ATG9B_ENST00000605952.1_Missense_Mutation_p.E170K|ATG9B_ENST00000444312.1_5'UTR			Q674R7	ATG9B_HUMAN	autophagy related 9B	170					autophagic vacuole assembly (GO:0000045)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(4)|prostate(1)	14	all_neural(206;0.219)		OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCTGCTCCTCCCCGTGGATG	0.607																																						dbGAP											0													11.0	13.0	13.0					7																	150721003		1961	4152	6113	-	-	-	SO:0001583	missense	0			AK027791		7q36	2014-02-12	2012-06-06	2005-09-11	ENSG00000181652	ENSG00000181652			21899	protein-coding gene	gene with protein product		612205	"""nitric oxide synthase 3 antisense"", ""ATG9 autophagy related 9 homolog B (S. cerevisiae)"""	NOS3AS		15234981, 15755735	Standard	NM_173681		Approved	FLJ14885, APG9L2, SONE	uc011kvc.2	Q674R7	OTTHUMG00000158634	ENST00000377974.2:c.508G>A	7.37:g.150721003C>T	ENSP00000475005:p.Glu170Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5D3|Q6JRW5|Q8N8I8	RNA	SNP	-	NULL	ENST00000377974.2	37	NULL		7	.	.	.	.	.	.	.	.	.	.	C	11.76	1.734082	0.30684	.	.	ENSG00000248602	ENST00000377974;ENST00000397266;ENST00000545613	.	.	.	4.85	4.85	0.62838	.	0.000000	0.46145	D	0.000303	T	0.41650	0.1168	.	.	.	.	.	.	P	0.36789	0.57	B	0.40602	0.334	T	0.41822	-0.9487	7	0.10636	T	0.68	-0.5125	15.506	0.75743	0.0:1.0:0.0:0.0	.	170	Q674R7	ATG9B_HUMAN	K	170	.	ENSP00000444232:E170K	E	-	1	0	AC010973.1	150351936	0.995000	0.38212	1.000000	0.80357	0.545000	0.35147	3.696000	0.54757	2.505000	0.84491	0.655000	0.94253	GAG	ATG9B	-	-	ENSG00000181652		0.607	ATG9B-201	KNOWN	basic|appris_principal	protein_coding	ATG9B	HGNC	protein_coding		49	0.00	0	C	NM_173681		150721003	150721003	-1	no_errors	ENST00000377974	ensembl	human	known	69_37n	rna	56	42.27	41	SNP	1.000	T
C17orf97	400566	genome.wustl.edu	37	17	263643	263643	+	Missense_Mutation	SNP	C	C	A	rs71369083|rs71145728		TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr17:263643C>A	ENST00000360127.6	+	2	1025	c.1009C>A	c.(1009-1011)Ccc>Acc	p.P337T	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	367	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GGGCTTCCACCCCGACCCCGA	0.697																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1009C>A	17.37:g.263643C>A	ENSP00000353245:p.Pro337Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8T6|Q6NSI2|Q6PFW9	Missense_Mutation	SNP	NULL	p.P337T	ENST00000360127.6	37	c.1009	CCDS32519.2	17	.	.	.	.	.	.	.	.	.	.	c	0.001	-3.987809	0.00002	.	.	ENSG00000187624	ENST00000360127	T	0.31247	1.5	2.05	-4.1	0.03940	.	.	.	.	.	T	0.13329	0.0323	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35400	-0.9790	9	0.13853	T	0.58	.	10.5042	0.44823	0.1779:0.7067:0.1154:0.0	.	337	Q6ZQX7-4	.	T	337	ENSP00000353245:P337T	ENSP00000353245:P337T	P	+	1	0	C17orf97	263989	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.281000	0.00260	-5.715000	0.00010	-5.246000	0.00001	CCC	C17orf97	-	NULL	ENSG00000187624		0.697	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf97	HGNC	protein_coding	OTTHUMT00000255648.4	19	0.00	0	C	NM_001013672		263643	263643	+1	no_errors	ENST00000360127	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.000	A
C17orf97	400566	genome.wustl.edu	37	17	263645	263645	+	Silent	SNP	C	C	T	rs71369083|rs71145728		TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr17:263645C>T	ENST00000360127.6	+	2	1027	c.1011C>T	c.(1009-1011)ccC>ccT	p.P337P	AC108004.3_ENST00000466740.2_RNA|C17orf97_ENST00000571106.1_Intron	NM_001013672.4	NP_001013694.4	Q6ZQX7	CQ097_HUMAN	chromosome 17 open reading frame 97	367	20 X 10 AA approximative tandem repeat of A-L-K-G-F-H-P-D-P-E.									breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)	14						GCTTCCACCCCGACCCCGAGG	0.692																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK128660, BC057385	CCDS32519.2	17p13.3	2008-08-15			ENSG00000187624	ENSG00000187624			33800	protein-coding gene	gene with protein product						12477932	Standard	NM_001013672		Approved	LOC400566	uc021tna.1	Q6ZQX7	OTTHUMG00000132479	ENST00000360127.6:c.1011C>T	17.37:g.263645C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8T6|Q6NSI2|Q6PFW9	Silent	SNP	NULL	p.P337	ENST00000360127.6	37	c.1011	CCDS32519.2	17																																																																																			C17orf97	-	NULL	ENSG00000187624		0.692	C17orf97-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf97	HGNC	protein_coding	OTTHUMT00000255648.4	18	0.00	0	C	NM_001013672		263645	263645	+1	no_errors	ENST00000360127	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	0.000	T
HID1	283987	genome.wustl.edu	37	17	72948429	72948429	+	Silent	SNP	C	C	T	rs146778361	byFrequency	TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr17:72948429C>T	ENST00000425042.2	-	17	2156	c.2079G>A	c.(2077-2079)ccG>ccA	p.P693P		NM_030630.2	NP_085133.1	Q8IV36	HID1_HUMAN	HID1 domain containing	693					intracellular protein transport (GO:0006886)|response to brefeldin A (GO:0031001)	cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi medial cisterna (GO:0005797)|Golgi trans cisterna (GO:0000138)											TGGTCTGCAGCGGCAGCTTCG	0.667																																						dbGAP											0													31.0	34.0	33.0					17																	72948429		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS32726.1	17q25.1	2012-10-10	2012-10-10	2012-10-10	ENSG00000167861	ENSG00000167861			15736	protein-coding gene	gene with protein product	"""downregulated in multiple cancer 1"""	605752	"""chromosome 17 open reading frame 28"""	C17orf28		11281419, 21337012	Standard	NM_030630		Approved	DMC1, HID-1	uc002jmj.4	Q8IV36	OTTHUMG00000166490	ENST00000425042.2:c.2079G>A	17.37:g.72948429C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5L6|Q8TE83|Q9NT34	Silent	SNP	pfam_Dymeclin	p.P693	ENST00000425042.2	37	c.2079	CCDS32726.1	17																																																																																			C17orf28	-	NULL	ENSG00000167861		0.667	HID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf28	HGNC	protein_coding	OTTHUMT00000390011.2	30	0.00	0	C	NM_030630		72948429	72948429	-1	no_errors	ENST00000425042	ensembl	human	known	69_37n	silent	85	22.73	25	SNP	0.783	T
CCDC180	100499483	genome.wustl.edu	37	9	100124574	100124574	+	Intron	SNP	G	G	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr9:100124574G>C	ENST00000357054.1	+	39	4692				MIR1302-8_ENST00000408342.1_RNA|CCDC180_ENST00000375202.2_Missense_Mutation_p.E1295D|CCDC180_ENST00000395220.1_Intron|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.E1295D			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GCAGCAGTGAGGCAGGGGCTG	0.602																																						dbGAP											0													117.0	113.0	114.0					9																	100124574		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3757+41G>C	9.37:g.100124574G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.E1295D	ENST00000357054.1	37	c.3885		9	.	.	.	.	.	.	.	.	.	.	G	4.593	0.110195	0.08780	.	.	ENSG00000197816	ENST00000375202;ENST00000529487	T;T	0.08634	3.07;3.07	4.14	-0.804	0.10882	.	3.198370	0.00855	N	0.001868	T	0.04092	0.0114	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.33059	-0.9883	9	.	.	.	2.8145	1.5979	0.02668	0.1485:0.1067:0.255:0.4898	.	1434	B7ZMG3	.	D	1295	ENSP00000364348:E1295D;ENSP00000434727:E1295D	.	E	+	3	2	C9orf174	99164395	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-1.201000	0.03026	-0.143000	0.11334	-0.181000	0.13052	GAG	C9orf174	-	NULL	ENSG00000197816		0.602	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		35	0.00	0	G	NM_020893		100124574	100124574	+1	no_errors	ENST00000375202	ensembl	human	known	69_37n	missense	17	61.36	27	SNP	0.002	C
CFLAR	8837	genome.wustl.edu	37	2	202005121	202005121	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:202005121G>T	ENST00000309955.3	+	5	1080	c.565G>T	c.(565-567)Gca>Tca	p.A189S	CFLAR_ENST00000341222.6_Missense_Mutation_p.A189S|CFLAR_ENST00000355558.4_Missense_Mutation_p.A189S|CFLAR_ENST00000479953.2_Missense_Mutation_p.A93S|CFLAR-AS1_ENST00000415011.2_RNA|CFLAR-AS1_ENST00000474886.2_RNA|CFLAR_ENST00000340870.5_Missense_Mutation_p.A189S|CFLAR_ENST00000443227.1_Missense_Mutation_p.A93S|RNU7-45P_ENST00000459460.1_RNA|CFLAR_ENST00000494258.1_Missense_Mutation_p.A93S|CFLAR_ENST00000440180.1_Missense_Mutation_p.A189S|CFLAR_ENST00000423241.2_Missense_Mutation_p.A189S|CFLAR_ENST00000341582.6_Missense_Mutation_p.A189S|CFLAR_ENST00000342795.5_Missense_Mutation_p.A189S|CFLAR_ENST00000457277.1_Missense_Mutation_p.A189S	NM_001202515.1|NM_003879.5	NP_001189444.1|NP_003870.4	O15519	CFLAR_HUMAN	CASP8 and FADD-like apoptosis regulator	189	Interaction with FADD.|Interaction with caspase-8 propeptide.|Interaction with caspase-8.|Not proteolytically processed and involved in apoptosis inhibition.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of myoblast fusion (GO:1901740)|positive regulation of catalytic activity (GO:0043085)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of necroptotic process (GO:0060544)|regulation of satellite cell proliferation (GO:0014842)|skeletal muscle atrophy (GO:0014732)|skeletal muscle tissue development (GO:0007519)|skeletal muscle tissue regeneration (GO:0043403)|skeletal myofibril assembly (GO:0014866)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|ripoptosome (GO:0097342)	cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|enzyme activator activity (GO:0008047)|protease binding (GO:0002020)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|stomach(1)	13						TCTCCAAGCAGCAATCCAAAA	0.373																																					Pancreas(16;548 657 22190 32864 42338)	dbGAP											0													131.0	131.0	131.0					2																	202005121		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF005774	CCDS2337.1, CCDS46487.1, CCDS56157.1, CCDS56158.1, CCDS59436.1	2q33-q34	2014-01-30			ENSG00000003402	ENSG00000003402		"""Endogenous ligands"""	1876	protein-coding gene	gene with protein product		603599		CASP8AP1		9208847, 9217161	Standard	NM_003879		Approved	CASH, Casper, CLARP, FLAME, FLIP, I-FLICE, MRIT, c-FLIP	uc002uxb.4	O15519	OTTHUMG00000132819	ENST00000309955.3:c.565G>T	2.37:g.202005121G>T	ENSP00000312455:p.Ala189Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJE0|B7Z9F9|O14673|O14674|O14675|O15137|O15138|O15356|O15510|O43618|O43619|O43620|O60458|O60459|Q53TS6|Q54AF1|Q96TE4|Q9UEW1	Missense_Mutation	SNP	pfam_DED,pfam_Pept_C14_cat,superfamily_DEATH-like,smart_DED,smart_Pept_C14_p45_core,pfscan_DED,pfscan_Pept_C14_ICE_p20	p.A189S	ENST00000309955.3	37	c.565	CCDS2337.1	2	.	.	.	.	.	.	.	.	.	.	G	0.169	-1.073334	0.01918	.	.	ENSG00000003402	ENST00000309955;ENST00000443227;ENST00000341222;ENST00000355558;ENST00000340870;ENST00000343375;ENST00000341582;ENST00000342795;ENST00000423241;ENST00000440180;ENST00000457277	T;T;D;T;T;D;T;T;D;T	0.82255	3.81;3.82;-1.59;1.08;3.7;-1.59;1.08;3.81;-1.59;3.7	4.78	2.39	0.29439	.	0.510047	0.23479	N	0.047724	T	0.44685	0.1305	N	0.00188	-1.89	0.09310	N	1	B;B;B;B;B;B;B	0.13145	0.002;0.001;0.002;0.004;0.001;0.001;0.007	B;B;B;B;B;B;B	0.09377	0.002;0.001;0.002;0.001;0.001;0.002;0.004	T	0.48843	-0.8999	10	0.19147	T	0.46	-5.6542	5.2073	0.15297	0.1836:0.0:0.1871:0.6292	.	93;189;189;189;189;189;189	O15519-3;C9JK38;O15519-11;O15519-8;O15519;O15519-12;O15519-2	.;.;.;.;CFLAR_HUMAN;.;.	S	189;93;189;189;189;93;189;189;189;189;189	ENSP00000312455:A189S;ENSP00000413270:A93S;ENSP00000339335:A189S;ENSP00000347757:A189S;ENSP00000339326:A189S;ENSP00000345807:A189S;ENSP00000342809:A189S;ENSP00000399420:A189S;ENSP00000406775:A189S;ENSP00000411535:A189S	ENSP00000312455:A189S	A	+	1	0	CFLAR	201713366	0.352000	0.24895	0.019000	0.16419	0.001000	0.01503	1.040000	0.30278	0.546000	0.28920	-0.271000	0.10264	GCA	CFLAR	-	NULL	ENSG00000003402		0.373	CFLAR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CFLAR	HGNC	protein_coding	OTTHUMT00000256276.3	36	0.00	0	G	NM_003879		202005121	202005121	+1	no_errors	ENST00000309955	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.023	T
COL19A1	1310	genome.wustl.edu	37	6	70642694	70642694	+	Missense_Mutation	SNP	A	A	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr6:70642694A>C	ENST00000322773.4	+	7	788	c.686A>C	c.(685-687)aAa>aCa	p.K229T		NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	229	Laminin G-like.				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						CACCAACTTAAAATCTACTGC	0.303																																						dbGAP											0													56.0	57.0	56.0					6																	70642694		2201	4299	6500	-	-	-	SO:0001583	missense	0				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.686A>C	6.37:g.70642694A>C	ENSP00000316030:p.Lys229Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.K229T	ENST00000322773.4	37	c.686	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	A	10.48	1.361482	0.24684	.	.	ENSG00000082293	ENST00000322773	T	0.02103	4.45	5.68	0.337	0.15966	Concanavalin A-like lectin/glucanase (1);Laminin G, thrombospondin-type, N-terminal (1);	0.475923	0.22440	N	0.060033	T	0.00412	0.0013	L	0.28274	0.84	0.26894	N	0.967255	B	0.10296	0.003	B	0.06405	0.002	T	0.46938	-0.9155	10	0.13470	T	0.59	.	0.4536	0.00505	0.3214:0.2893:0.1655:0.2239	.	229	Q14993	COJA1_HUMAN	T	229	ENSP00000316030:K229T	ENSP00000316030:K229T	K	+	2	0	COL19A1	70699415	0.992000	0.36948	0.997000	0.53966	0.997000	0.91878	0.822000	0.27352	0.108000	0.17862	0.533000	0.62120	AAA	COL19A1	-	superfamily_ConA-like_lec_gl,smart_Laminin_G	ENSG00000082293		0.303	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	27	0.00	0	A			70642694	70642694	+1	no_errors	ENST00000322773	ensembl	human	known	69_37n	missense	51	34.62	27	SNP	0.324	C
COL4A3	1285	genome.wustl.edu	37	2	228111412	228111412	+	Silent	SNP	G	G	T	rs75683214	byFrequency	TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:228111412G>T	ENST00000396578.3	+	7	561	c.399G>T	c.(397-399)ggG>ggT	p.G133G	AC097662.2_ENST00000396588.2_RNA|AC097662.2_ENST00000439598.2_RNA|AC097662.2_ENST00000606119.1_RNA|AC097662.2_ENST00000437673.1_RNA	NM_000091.4	NP_000082.2	Q01955	CO4A3_HUMAN	collagen, type IV, alpha 3 (Goodpasture antigen)	133	Triple-helical region.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|blood circulation (GO:0008015)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|collagen catabolic process (GO:0030574)|endothelial cell apoptotic process (GO:0072577)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of endopeptidase activity (GO:0010951)|sensory perception of sound (GO:0007605)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metalloendopeptidase inhibitor activity (GO:0008191)|structural molecule activity (GO:0005198)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(24)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_lung(227;0.00101)|Lung NSC(271;0.00278)|Renal(207;0.0112)|Ovarian(221;0.0129)|all_hematologic(139;0.211)|Esophageal squamous(248;0.247)		Epithelial(121;1.17e-46)|all cancers(144;6.87e-42)|Lung(261;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0187)		GTGAGCAGGGGTTTCCAGGAC	0.433																																						dbGAP											0													64.0	64.0	64.0					2																	228111412		1838	4084	5922	-	-	-	SO:0001819	synonymous_variant	0				CCDS42829.1	2q36-q37	2014-09-17			ENSG00000169031	ENSG00000169031		"""Collagens"""	2204	protein-coding gene	gene with protein product	"""tumstatin"""	120070				1737849	Standard	NM_000091		Approved		uc002vom.2	Q01955	OTTHUMG00000149891	ENST00000396578.3:c.399G>T	2.37:g.228111412G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QQ1|Q53R14|Q53RW8|Q9BQT2|Q9NYC4|Q9UDJ9|Q9UDK9|Q9UDL0|Q9UDL1	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G133	ENST00000396578.3	37	c.399	CCDS42829.1	2																																																																																			COL4A3	-	pfam_Collagen	ENSG00000169031		0.433	COL4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A3	HGNC	protein_coding	OTTHUMT00000331409.2	43	0.00	0	G	NM_000091		228111412	228111412	+1	no_errors	ENST00000396578	ensembl	human	known	69_37n	silent	35	33.96	18	SNP	0.866	T
BRINP1	1620	genome.wustl.edu	37	9	121929962	121929962	+	Silent	SNP	G	G	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr9:121929962G>C	ENST00000265922.3	-	8	2147	c.1686C>G	c.(1684-1686)gtC>gtG	p.V562V	BRINP1_ENST00000482797.1_Intron	NM_014618.2	NP_055433.2	O60477	BRNP1_HUMAN	bone morphogenetic protein/retinoic acid inducible neural-specific 1	562					cell cycle arrest (GO:0007050)|cell death (GO:0008219)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell cycle (GO:0045786)|negative regulation of mitotic cell cycle (GO:0045930)|positive regulation of neuron differentiation (GO:0045666)	cytoplasm (GO:0005737)											GGTTGACATAGACAAAGAACA	0.557																																						dbGAP											0													42.0	41.0	42.0					9																	121929962		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF027734	CCDS6822.1	9q32-q33	2013-08-06	2013-08-06	2013-07-31	ENSG00000078725	ENSG00000078725			2687	protein-coding gene	gene with protein product		602865	"""deleted in bladder cancer chromosome region candidate 1"", ""deleted in bladder cancer 1"""	DBCCR1, DBC1		9175739, 10444335, 15193422	Standard	NM_014618		Approved	FAM5A	uc004bkc.2	O60477	OTTHUMG00000021020	ENST00000265922.3:c.1686C>G	9.37:g.121929962G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPV6|Q6P1A0|Q8WU22	Silent	SNP	pfam_MACPF,smart_MACPF	p.V562	ENST00000265922.3	37	c.1686	CCDS6822.1	9																																																																																			DBC1	-	NULL	ENSG00000078725		0.557	BRINP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBC1	HGNC	protein_coding	OTTHUMT00000055440.2	31	0.00	0	G	NM_014618		121929962	121929962	-1	no_errors	ENST00000265922	ensembl	human	known	69_37n	silent	8	68.00	17	SNP	1.000	C
DDR2	4921	genome.wustl.edu	37	1	162722987	162722987	+	Splice_Site	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr1:162722987G>A	ENST00000367922.3	+	5	623	c.185G>A	c.(184-186)aGg>aAg	p.R62K	DDR2_ENST00000367921.3_Splice_Site_p.R62K	NM_001014796.1	NP_001014796.1	Q16832	DDR2_HUMAN	discoidin domain receptor tyrosine kinase 2	62	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				biomineral tissue development (GO:0031214)|cell adhesion (GO:0007155)|chondrocyte proliferation (GO:0035988)|collagen fibril organization (GO:0030199)|collagen-activated tyrosine kinase receptor signaling pathway (GO:0038063)|endochondral bone growth (GO:0003416)|extracellular matrix organization (GO:0030198)|ossification (GO:0001503)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autophosphorylation (GO:0046777)|regulation of bone mineralization (GO:0030500)|regulation of extracellular matrix disassembly (GO:0010715)|signal transduction (GO:0007165)	apical plasma membrane (GO:0016324)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|collagen binding (GO:0005518)|protein tyrosine kinase collagen receptor activity (GO:0038062)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			central_nervous_system(2)|kidney(1)|lung(2)|ovary(1)|skin(1)	7	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.113)		Regorafenib(DB08896)	AAATATGGAAGGTGAGGATGG	0.532																																					NSCLC(161;314 2006 8283 19651 23192)	dbGAP											0													80.0	72.0	74.0					1																	162722987		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK095975	CCDS1241.1	1q12-q23	2009-07-10	2008-01-23		ENSG00000162733	ENSG00000162733	2.7.10.1		2731	protein-coding gene	gene with protein product		191311	"""discoidin domain receptor family, member 2"""	TYRO10, NTRKR3		9659899	Standard	XM_005245221		Approved	TKT	uc001gcg.3	Q16832	OTTHUMG00000034423	ENST00000367922.3:c.185+1G>A	1.37:g.162722987G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z730	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R62K	ENST00000367922.3	37	c.185	CCDS1241.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.341158	0.95783	.	.	ENSG00000162733	ENST00000446985;ENST00000415555;ENST00000542391;ENST00000367922;ENST00000367921	D;D;D;D	0.98437	-4.93;-4.93;-4.93;-4.93	5.15	5.15	0.70609	Coagulation factor 5/8 C-terminal type domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	D	0.99115	0.9695	M	0.90542	3.125	.	.	.	D	0.89917	1.0	D	0.81914	0.995	D	0.99690	1.1001	9	0.87932	D	0	.	17.5431	0.87853	0.0:0.0:1.0:0.0	.	62	Q16832	DDR2_HUMAN	K	62	ENSP00000400309:R62K;ENSP00000391310:R62K;ENSP00000356899:R62K;ENSP00000356898:R62K	ENSP00000356898:R62K	R	+	2	0	DDR2	160989611	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.574000	0.98184	2.547000	0.85894	0.655000	0.94253	AGG	DDR2	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000162733		0.532	DDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDR2	HGNC	protein_coding	OTTHUMT00000083213.2	15	0.00	0	G	NM_006182	Missense_Mutation	162722987	162722987	+1	no_errors	ENST00000367921	ensembl	human	known	69_37n	missense	50	23.08	15	SNP	1.000	A
DDX1	1653	genome.wustl.edu	37	2	15743373	15743373	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:15743373C>T	ENST00000381341.2	+	9	838	c.449C>T	c.(448-450)tCt>tTt	p.S150F	DDX1_ENST00000233084.3_Missense_Mutation_p.S150F			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	150	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.|Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with HNRNPK.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		GTCGGGTGGTCTACCATGCAG	0.378																																						dbGAP											0													76.0	74.0	74.0					2																	15743373		2203	4300	6503	-	-	-	SO:0001583	missense	0			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.449C>T	2.37:g.15743373C>T	ENSP00000370745:p.Ser150Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DME8|B4DPN6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_SPRY_rcpt,pfam_Helicase_C,superfamily_ConA-like_lec_gl,smart_Helicase_ATP-bd,smart_SPla/RYanodine_receptor_subgr,smart_Helicase_C,pfscan_B30.2/SPRY,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S150F	ENST00000381341.2	37	c.449	CCDS1686.1	2	.	.	.	.	.	.	.	.	.	.	C	18.11	3.550356	0.65311	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	T;T	0.76839	-1.05;-1.05	5.25	4.36	0.52297	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);DEAD-like helicase (1);B30.2/SPRY domain (1);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.85682	D	0.000000	D	0.90280	0.6960	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.92739	0.6206	10	0.87932	D	0	-16.4175	15.7939	0.78394	0.0:0.8632:0.1368:0.0	.	150	Q92499	DDX1_HUMAN	F	150;150;134	ENSP00000370745:S150F;ENSP00000233084:S150F	ENSP00000233084:S150F	S	+	2	0	DDX1	15660824	1.000000	0.71417	0.999000	0.59377	0.520000	0.34377	7.452000	0.80683	1.201000	0.43203	-0.274000	0.10170	TCT	DDX1	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_Helicase_ATP-bd,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000079785		0.378	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX1	HGNC	protein_coding	OTTHUMT00000207141.2	48	0.00	0	C	NM_004939		15743373	15743373	+1	no_errors	ENST00000233084	ensembl	human	known	69_37n	missense	47	34.72	25	SNP	1.000	T
DYNC1I1	1780	genome.wustl.edu	37	7	95499217	95499217	+	Missense_Mutation	SNP	G	G	A	rs201114371	byFrequency	TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr7:95499217G>A	ENST00000324972.6	+	6	641	c.448G>A	c.(448-450)Gtg>Atg	p.V150M	DYNC1I1_ENST00000457059.1_Missense_Mutation_p.V133M|DYNC1I1_ENST00000359388.4_Missense_Mutation_p.V113M|DYNC1I1_ENST00000537881.1_Missense_Mutation_p.V113M|DYNC1I1_ENST00000437599.1_Missense_Mutation_p.V130M|DYNC1I1_ENST00000447467.2_Missense_Mutation_p.V133M	NM_004411.4	NP_004402.1	O14576	DC1I1_HUMAN	dynein, cytoplasmic 1, intermediate chain 1	150					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|metabolic process (GO:0008152)|vesicle transport along microtubule (GO:0047496)	cytoplasmic dynein complex (GO:0005868)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|spindle pole (GO:0000922)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)|spectrin binding (GO:0030507)			NS(2)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(27)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	54	all_cancers(62;9.39e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.165)|all_lung(186;0.191)		STAD - Stomach adenocarcinoma(171;0.0957)			TAAACTGGGCGTGTCAAAGGT	0.453													G|||	2	0.000399361	0.0	0.0029	5008	,	,		20381	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													144.0	133.0	137.0					7																	95499217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063228	CCDS5644.1, CCDS47645.1, CCDS47646.1, CCDS64718.1	7q21.3-q22.1	2013-01-18	2005-11-24	2005-11-24	ENSG00000158560	ENSG00000158560		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2963	protein-coding gene	gene with protein product		603772	"""dynein, cytoplasmic, intermediate polypeptide 1"""	DNCI1		10049579, 16260502	Standard	NM_004411		Approved	DNCIC1	uc003uoc.4	O14576	OTTHUMG00000153983	ENST00000324972.6:c.448G>A	7.37:g.95499217G>A	ENSP00000320130:p.Val150Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DME3|F5H050|G5E9K1|Q8TBF7|Q9Y2X1	Missense_Mutation	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.V150M	ENST00000324972.6	37	c.448	CCDS5644.1	7	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	G	4.959	0.178065	0.09443	.	.	ENSG00000158560	ENST00000447467;ENST00000324972;ENST00000537881;ENST00000437599;ENST00000359388;ENST00000457059	T;T;T;T;T;T	0.75260	-0.6;-0.54;-0.92;-0.62;-0.7;-0.6	5.33	5.33	0.75918	.	0.063242	0.64402	D	0.000007	T	0.45677	0.1354	N	0.00841	-1.15	0.49299	D	0.999778	B;B;B;B;B	0.29646	0.253;0.102;0.213;0.253;0.213	B;B;B;B;B	0.23150	0.044;0.026;0.026;0.044;0.026	T	0.52019	-0.8631	10	0.23302	T	0.38	-2.5743	18.1916	0.89808	0.0:0.0:1.0:0.0	.	133;130;133;150;113	Q7Z6M0;G5E9K1;O14576-2;O14576;O14576-3	.;.;.;DC1I1_HUMAN;.	M	133;150;113;130;113;133	ENSP00000392337:V133M;ENSP00000320130:V150M;ENSP00000438377:V113M;ENSP00000398118:V130M;ENSP00000352348:V113M;ENSP00000412444:V133M	ENSP00000320130:V150M	V	+	1	0	DYNC1I1	95337153	1.000000	0.71417	0.981000	0.43875	0.975000	0.68041	4.060000	0.57477	2.673000	0.90976	0.650000	0.86243	GTG	DYNC1I1	-	pfam_Dynein_IC_1/2	ENSG00000158560		0.453	DYNC1I1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYNC1I1	HGNC	protein_coding	OTTHUMT00000333432.1	35	0.00	0	G	NM_004411		95499217	95499217	+1	no_errors	ENST00000324972	ensembl	human	known	69_37n	missense	47	32.86	23	SNP	0.993	A
EBF2	64641	genome.wustl.edu	37	8	25747294	25747294	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr8:25747294C>G	ENST00000520164.1	-	8	1262	c.725G>C	c.(724-726)aGa>aCa	p.R242T	EBF2_ENST00000535548.1_5'Flank|EBF2_ENST00000408929.3_Missense_Mutation_p.R94T	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	242					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		TCTTCTTGCTCTCCGTCCATG	0.458																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	dbGAP											0													111.0	104.0	107.0					8																	25747294		2010	4192	6202	-	-	-	SO:0001583	missense	0			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.725G>C	8.37:g.25747294C>G	ENSP00000430241:p.Arg242Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	p.R242T	ENST00000520164.1	37	c.725	CCDS43726.1	8	.	.	.	.	.	.	.	.	.	.	C	19.21	3.784075	0.70222	.	.	ENSG00000221818	ENST00000520164;ENST00000408929	T;T	0.58652	0.39;0.32	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.68613	0.3020	M	0.86953	2.85	0.80722	D	1	P	0.44776	0.843	B	0.42214	0.38	T	0.76449	-0.2955	10	0.87932	D	0	-9.9516	19.6778	0.95943	0.0:1.0:0.0:0.0	.	242	Q9HAK2	COE2_HUMAN	T	242;94	ENSP00000430241:R242T;ENSP00000386178:R94T	ENSP00000386178:R94T	R	-	2	0	EBF2	25803211	1.000000	0.71417	1.000000	0.80357	0.473000	0.32948	7.818000	0.86416	2.663000	0.90544	0.655000	0.94253	AGA	EBF2	-	NULL	ENSG00000221818		0.458	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	HGNC	protein_coding	OTTHUMT00000375886.2	28	0.00	0	C	NM_022659		25747294	25747294	-1	no_errors	ENST00000520164	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	1.000	G
EFNA5	1946	genome.wustl.edu	37	5	106722968	106722968	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr5:106722968T>C	ENST00000333274.6	-	4	814	c.533A>G	c.(532-534)aAc>aGc	p.N178S	EFNA5_ENST00000510359.1_5'UTR|EFNA5_ENST00000509503.1_Intron	NM_001962.2	NP_001953.1	P52803	EFNA5_HUMAN	ephrin-A5	178					axon guidance (GO:0007411)|ephrin receptor signaling pathway (GO:0048013)|nervous system development (GO:0007399)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell-cell adhesion (GO:0022407)|regulation of focal adhesion assembly (GO:0051893)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of Rac GTPase activity (GO:0032314)|regulation of Rho GTPase activity (GO:0032319)|retinal ganglion cell axon guidance (GO:0031290)	anchored component of external side of plasma membrane (GO:0031362)|plasma membrane (GO:0005886)	chemorepellent activity (GO:0045499)|ephrin receptor binding (GO:0046875)			large_intestine(6)	6		all_cancers(142;5.15e-06)|all_epithelial(76;4.39e-07)|Prostate(80;0.00726)|Lung NSC(167;0.0736)|Ovarian(225;0.0797)|all_lung(232;0.0854)|Colorectal(57;0.241)		Epithelial(69;1.25e-12)|OV - Ovarian serous cystadenocarcinoma(64;1.32e-11)|BRCA - Breast invasive adenocarcinoma(61;0.0376)|COAD - Colon adenocarcinoma(37;0.109)		TACTTTGTCGTTAACATCGAA	0.333																																						dbGAP											0													97.0	94.0	95.0					5																	106722968		2200	4298	6498	-	-	-	SO:0001583	missense	0			U26403	CCDS4097.1	5q21	2011-03-09			ENSG00000184349	ENSG00000184349		"""Ephrins"""	3225	protein-coding gene	gene with protein product		601535		EPLG7		8661153, 9245480	Standard	NM_001962		Approved	AF1, LERK7	uc003kol.3	P52803	OTTHUMG00000128741	ENST00000333274.6:c.533A>G	5.37:g.106722968T>C	ENSP00000328777:p.Asn178Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.N178S	ENST00000333274.6	37	c.533	CCDS4097.1	5	.	.	.	.	.	.	.	.	.	.	T	14.19	2.461126	0.43736	.	.	ENSG00000184349	ENST00000333274	D	0.95918	-3.85	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	D	0.88804	0.6536	N	0.14661	0.345	0.80722	D	1	B	0.29716	0.255	B	0.22152	0.038	D	0.87095	0.2175	10	0.08837	T	0.75	-15.8733	16.1519	0.81629	0.0:0.0:0.0:1.0	.	178	P52803	EFNA5_HUMAN	S	178	ENSP00000328777:N178S	ENSP00000328777:N178S	N	-	2	0	EFNA5	106750867	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.216000	0.71823	0.533000	0.62120	AAC	EFNA5	-	NULL	ENSG00000184349		0.333	EFNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFNA5	HGNC	protein_coding	OTTHUMT00000250652.1	17	0.00	0	T	NM_001962		106722968	106722968	-1	no_errors	ENST00000333274	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	1.000	C
EP300	2033	genome.wustl.edu	37	22	41527549	41527549	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr22:41527549G>A	ENST00000263253.7	+	6	2659	c.1440G>A	c.(1438-1440)atG>atA	p.M480I		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	480					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TAAATCAGATGCCGACACAAC	0.512			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													dbGAP		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													84.0	83.0	83.0					22																	41527549		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.1440G>A	22.37:g.41527549G>A	ENSP00000263253:p.Met480Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.M480I	ENST00000263253.7	37	c.1440	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	G	12.74	2.027405	0.35797	.	.	ENSG00000100393	ENST00000263253	D	0.83250	-1.7	5.6	4.56	0.56223	.	0.100031	0.42964	N	0.000627	T	0.73353	0.3576	N	0.21448	0.665	0.31437	N	0.672487	B	0.22414	0.069	B	0.27076	0.076	T	0.67522	-0.5649	10	0.15952	T	0.53	-8.3909	15.7521	0.77994	0.0:0.0:0.8585:0.1415	.	480	Q09472	EP300_HUMAN	I	480	ENSP00000263253:M480I	ENSP00000263253:M480I	M	+	3	0	EP300	39857495	1.000000	0.71417	0.993000	0.49108	0.990000	0.78478	1.779000	0.38624	1.433000	0.47394	0.650000	0.86243	ATG	EP300	-	NULL	ENSG00000100393		0.512	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	19	0.00	0	G	NM_001429		41527549	41527549	+1	no_errors	ENST00000263253	ensembl	human	known	69_37n	missense	20	48.72	19	SNP	1.000	A
FAM47B	170062	genome.wustl.edu	37	X	34961262	34961262	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chrX:34961262C>T	ENST00000329357.5	+	1	350	c.314C>T	c.(313-315)tCc>tTc	p.S105F		NM_152631.2	NP_689844.2	Q8NA70	FA47B_HUMAN	family with sequence similarity 47, member B	105										breast(3)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(28)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	71						GCCCTATTTTCCGAGCTCTCG	0.542																																						dbGAP											0													87.0	81.0	83.0					X																	34961262		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC035026	CCDS14236.1	Xp21.1	2004-08-09			ENSG00000189132	ENSG00000189132			26659	protein-coding gene	gene with protein product						14702039	Standard	NM_152631		Approved	FLJ35782	uc004ddi.2	Q8NA70	OTTHUMG00000021345	ENST00000329357.5:c.314C>T	X.37:g.34961262C>T	ENSP00000328307:p.Ser105Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQN5|Q6PIG3	Missense_Mutation	SNP	NULL	p.S105F	ENST00000329357.5	37	c.314	CCDS14236.1	X	.	.	.	.	.	.	.	.	.	.	c	10.75	1.437722	0.25900	.	.	ENSG00000189132	ENST00000329357	T	0.20200	2.09	0.834	-0.174	0.13319	.	.	.	.	.	T	0.42359	0.1199	M	0.81942	2.565	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.17289	-1.0374	9	0.62326	D	0.03	.	6.363	0.21439	0.0:0.6934:0.3066:0.0	.	105	Q8NA70	FA47B_HUMAN	F	105	ENSP00000328307:S105F	ENSP00000328307:S105F	S	+	2	0	FAM47B	34871183	0.013000	0.17824	0.019000	0.16419	0.009000	0.06853	0.139000	0.16036	-0.139000	0.11414	-0.880000	0.02959	TCC	FAM47B	-	NULL	ENSG00000189132		0.542	FAM47B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47B	HGNC	protein_coding	OTTHUMT00000056211.1	71	0.00	0	C	NM_152631		34961262	34961262	+1	no_errors	ENST00000329357	ensembl	human	known	69_37n	missense	78	43.48	60	SNP	0.096	T
FRG2B	441581	genome.wustl.edu	37	10	135438753	135438753	+	Silent	SNP	G	G	A	rs375000694		TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr10:135438753G>A	ENST00000425520.1	-	4	739	c.687C>T	c.(685-687)acC>acT	p.T229T	FRG2B_ENST00000443774.1_Silent_p.T230T	NM_001080998.1	NP_001074467.1	Q96QU4	FRG2B_HUMAN	FSHD region gene 2 family, member B	229						nucleus (GO:0005634)				endometrium(2)|kidney(2)|lung(14)|ovary(1)|prostate(1)	20		all_cancers(35;7.01e-07)|all_epithelial(44;1.45e-05)|Lung NSC(174;0.027)|all_lung(145;0.0384)|all_neural(114;0.0726)|Glioma(114;0.172)|Melanoma(40;0.175)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)		AAGCTGCCTGGGTGGCCATGG	0.597																																						dbGAP											0													3.0	4.0	4.0					10																	135438753		1467	3364	4831	-	-	-	SO:0001819	synonymous_variant	0			AY744466	CCDS44502.1	10q26.3	2012-10-02			ENSG00000225899	ENSG00000225899			33518	protein-coding gene	gene with protein product						15520407	Standard	NM_001080998		Approved		uc010qvg.2	Q96QU4	OTTHUMG00000019328	ENST00000425520.1:c.687C>T	10.37:g.135438753G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSQ1	Silent	SNP	NULL	p.T230	ENST00000425520.1	37	c.690	CCDS44502.1	10																																																																																			FRG2B	-	NULL	ENSG00000225899		0.597	FRG2B-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	FRG2B	HGNC	protein_coding	OTTHUMT00000467780.1	9	0.00	0	G	NM_001080998		135438753	135438753	-1	no_errors	ENST00000443774	ensembl	human	known	69_37n	silent	21	36.36	12	SNP	0.707	A
HERC2P4	100289574	genome.wustl.edu	37	16	32192677	32192677	+	IGR	SNP	T	T	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr16:32192677T>C								HERC2P4 (9789 upstream) : RP11-17M15.1 (6976 downstream)																							TGGCGTTCCGTGAACATCCCT	0.537																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															16.37:g.32192677T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		16																																																																																			HERC2P4	-	-	ENSG00000230267	0	0.537					HERC2P4	HGNC			102	0.97	1	T			32192677	32192677	-1	no_errors	ENST00000568097	ensembl	human	known	69_37n	rna	167	32.39	80	SNP	1.000	C
HEXDC	284004	genome.wustl.edu	37	17	80393721	80393721	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr17:80393721C>T	ENST00000327949.9	+	5	615	c.604C>T	c.(604-606)Cga>Tga	p.R202*	HEXDC_ENST00000337014.6_Nonsense_Mutation_p.R202*|HEXDC_ENST00000577944.1_Nonsense_Mutation_p.R202*			Q8WVB3	HEXDC_HUMAN	hexosaminidase (glycosyl hydrolase family 20, catalytic domain) containing	202					carbohydrate metabolic process (GO:0005975)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	beta-N-acetylhexosaminidase activity (GO:0004563)			breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(7)|ovary(1)|prostate(1)|skin(1)	16	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			CGACATGCTCCGAGACCTGCC	0.672																																						dbGAP											0													44.0	53.0	50.0					17																	80393721		2045	4155	6200	-	-	-	SO:0001587	stop_gained	0			AK074405	CCDS42402.1	17q25.3	2011-12-19			ENSG00000169660	ENSG00000169660			26307	protein-coding gene	gene with protein product						12477932	Standard	NM_173620		Approved	FLJ23825	uc002kev.4	Q8WVB3		ENST00000327949.9:c.604C>T	17.37:g.80393721C>T	ENSP00000332634:p.Arg202*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7UUP6|Q8IYN4|Q8TE81	Nonsense_Mutation	SNP	pfam_Glyco_hydro_20_cat-core,superfamily_Glycoside_hydrolase_SF	p.R202*	ENST00000327949.9	37	c.604		17	.	.	.	.	.	.	.	.	.	.	C	16.70	3.197004	0.58126	.	.	ENSG00000169660	ENST00000337014;ENST00000327949	.	.	.	5.42	4.39	0.52855	.	0.047951	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-35.7882	14.6556	0.68831	0.1945:0.8055:0.0:0.0	.	.	.	.	X	202	.	ENSP00000332634:R202X	R	+	1	2	HEXDC	77987010	0.979000	0.34478	0.953000	0.39169	0.063000	0.16089	2.164000	0.42387	2.684000	0.91462	0.563000	0.77884	CGA	HEXDC	-	pfam_Glyco_hydro_20_cat-core,superfamily_Glycoside_hydrolase_SF	ENSG00000169660		0.672	HEXDC-003	KNOWN	basic|appris_principal	protein_coding	HEXDC	HGNC	protein_coding	OTTHUMT00000443513.1	22	0.00	0	C	NM_173620		80393721	80393721	+1	no_errors	ENST00000337014	ensembl	human	known	69_37n	nonsense	61	22.78	18	SNP	0.805	T
HLA-DRB1	3123	genome.wustl.edu	37	6	32548026	32548026	+	Missense_Mutation	SNP	G	G	C	rs9269744	byFrequency	TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr6:32548026G>C	ENST00000360004.5	-	5	890	c.785C>G	c.(784-786)aCa>aGa	p.T262R		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	262			T -> R (in dbSNP:rs9269744).		antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						GGTATTACCTGTTGGCTGAAG	0.453										Multiple Myeloma(14;0.17)																												dbGAP											0													32.0	37.0	35.0					6																	32548026		2089	4081	6170	-	-	-	SO:0001583	missense	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.785C>G	6.37:g.32548026G>C	ENSP00000353099:p.Thr262Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	P01914|Q9MYF5	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.T262R	ENST00000360004.5	37	c.785	CCDS47409.1	6	.	.	.	.	.	.	.	.	.	.	.	14.00	2.403780	0.42613	.	.	ENSG00000196126	ENST00000360004	T	0.00628	6.11	3.96	3.06	0.35304	.	0.521505	0.16081	N	0.230501	T	0.01287	0.0042	.	.	.	0.80722	D	1	B;B;D	0.89917	0.005;0.001;1.0	B;B;D	0.85130	0.012;0.012;0.997	T	0.62732	-0.6792	9	0.52906	T	0.07	.	9.6894	0.40118	0.0:0.213:0.787:0.0	rs9269744;rs17880393;rs33909504	262;262;262	P04229;Q29974;P01911	2B11_HUMAN;2B1G_HUMAN;2B1F_HUMAN	R	262	ENSP00000353099:T262R	ENSP00000353099:T262R	T	-	2	0	HLA-DRB1	32656004	1.000000	0.71417	1.000000	0.80357	0.755000	0.42902	2.243000	0.43115	0.736000	0.32559	0.551000	0.68910	ACA	HLA-DRB1	-	NULL	ENSG00000196126		0.453	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	11	0.00	0	G	NM_002124		32548026	32548026	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	missense	33	35.29	18	SNP	1.000	C
IGF2BP1	10642	genome.wustl.edu	37	17	47074903	47074903	+	5'UTR	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr17:47074903G>A	ENST00000290341.3	+	0	130				RP11-501C14.5_ENST00000505903.1_RNA|IGF2BP1_ENST00000431824.2_5'Flank	NM_006546.3	NP_006537.3	Q9NZI8	IF2B1_HUMAN	insulin-like growth factor 2 mRNA binding protein 1						CRD-mediated mRNA stabilization (GO:0070934)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of mRNA stability involved in response to stress (GO:0010610)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	31						ACTTCTCCTGGGCTCTCCCCG	0.672																																					Esophageal Squamous(198;1041 2123 8248 37119 38268)	dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF198254	CCDS11543.1, CCDS54138.1	17q21.32	2013-02-12			ENSG00000159217	ENSG00000159217		"""RNA binding motif (RRM) containing"""	28866	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 1"""	608288				9891060, 11992722	Standard	NM_001160423		Approved	IMP-1	uc002iom.3	Q9NZI8	OTTHUMG00000161173	ENST00000290341.3:c.-205G>A	17.37:g.47074903G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JT33	RNA	SNP	-	NULL	ENST00000290341.3	37	NULL	CCDS11543.1	17																																																																																			IGF2BP1	-	-	ENSG00000159217		0.672	IGF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP1	HGNC	protein_coding	OTTHUMT00000364046.1	53	0.00	0	G	NM_006546		47074903	47074903	+1	no_errors	ENST00000510023	ensembl	human	putative	69_37n	rna	76	47.59	69	SNP	0.078	A
KANK2	25959	genome.wustl.edu	37	19	11287434	11287434	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr19:11287434G>A	ENST00000586659.1	-	7	1894	c.1580C>T	c.(1579-1581)aCa>aTa	p.T527I	KANK2_ENST00000355150.5_Missense_Mutation_p.T527I|KANK2_ENST00000432929.2_Missense_Mutation_p.T535I|KANK2_ENST00000589359.1_Missense_Mutation_p.T535I|KANK2_ENST00000589894.1_Missense_Mutation_p.T527I			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	527					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						CTCGTTCTCTGTGCTGTCGTT	0.657																																						dbGAP											0													102.0	89.0	93.0					19																	11287434		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1580C>T	19.37:g.11287434G>A	ENSP00000465650:p.Thr527Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T535I	ENST00000586659.1	37	c.1604	CCDS12255.1	19	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972724	0.34848	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.40476	1.03;1.05	5.61	4.58	0.56647	.	0.232427	0.37136	N	0.002240	T	0.51193	0.1660	M	0.63843	1.955	0.39588	D	0.969548	B;P	0.50369	0.365;0.934	B;P	0.51999	0.121;0.687	T	0.57505	-0.7800	10	0.66056	D	0.02	-8.8608	11.7323	0.51744	0.0836:0.0:0.9164:0.0	.	527;535	Q63ZY3;Q63ZY3-2	KANK2_HUMAN;.	I	535;527	ENSP00000395650:T535I;ENSP00000347276:T527I	ENSP00000347276:T527I	T	-	2	0	KANK2	11148434	0.994000	0.37717	0.979000	0.43373	0.556000	0.35491	2.365000	0.44196	1.377000	0.46286	0.462000	0.41574	ACA	KANK2	-	NULL	ENSG00000197256		0.657	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	45	0.00	0	G	NM_015493		11287434	11287434	-1	no_errors	ENST00000432929	ensembl	human	known	69_37n	missense	63	39.42	41	SNP	0.988	A
KCNC1	3746	genome.wustl.edu	37	11	17794066	17794066	+	Silent	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr11:17794066C>T	ENST00000379472.3	+	2	1455	c.1425C>T	c.(1423-1425)gtC>gtT	p.V475V	KCNC1_ENST00000265969.6_Silent_p.V475V	NM_004976.4	NP_004967.1	P48547	KCNC1_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 1	475					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(9)|lung(7)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33					Dalfampridine(DB06637)	GTAAATCTGTCGTAAACTCTC	0.448																																						dbGAP											0													57.0	63.0	61.0					11																	17794066		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			M96747	CCDS7827.1, CCDS44547.1	11p15	2012-07-05			ENSG00000129159	ENSG00000129159		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6233	protein-coding gene	gene with protein product		176258				8449507, 16382104	Standard	NM_004976		Approved	Kv3.1	uc009yhc.1	P48547	OTTHUMG00000166359	ENST00000379472.3:c.1425C>T	11.37:g.17794066C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	K4DI87	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.V475	ENST00000379472.3	37	c.1425	CCDS7827.1	11																																																																																			KCNC1	-	prints_K_chnl_volt-dep_Kv3.1	ENSG00000129159		0.448	KCNC1-001	KNOWN	basic|CCDS	protein_coding	KCNC1	HGNC	protein_coding	OTTHUMT00000389389.1	19	0.00	0	C	NM_004976		17794066	17794066	+1	no_errors	ENST00000265969	ensembl	human	known	69_37n	silent	51	33.77	26	SNP	1.000	T
KIRREL3	84623	genome.wustl.edu	37	11	126870458	126870458	+	5'UTR	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr11:126870458C>T	ENST00000525144.2	-	0	197				KIRREL3-AS3_ENST00000525678.1_RNA|KIRREL3_ENST00000533026.2_5'UTR|KIRREL3_ENST00000529097.2_5'Flank|KIRREL3_ENST00000525704.2_5'UTR	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)						hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		TGGTTAGTTTCTCTTCCTTGG	0.607																																						dbGAP											0													55.0	61.0	59.0					11																	126870458		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.-53G>A	11.37:g.126870458C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	RNA	SNP	-	NULL	ENST00000525144.2	37	NULL	CCDS53723.1	11																																																																																			KIRREL3	-	-	ENSG00000149571		0.607	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL3	HGNC	protein_coding	OTTHUMT00000386479.2	16	0.00	0	C	NM_032531		126870458	126870458	-1	no_errors	ENST00000533026	ensembl	human	known	69_37n	rna	7	75.00	21	SNP	0.990	T
KLHL29	114818	genome.wustl.edu	37	2	23916391	23916391	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:23916391G>A	ENST00000486442.1	+	8	2252	c.1535G>A	c.(1534-1536)cGc>cAc	p.R512H		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	512										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						CCCGCGACACGCACACAGGTG	0.607																																						dbGAP											0													32.0	30.0	30.0					2																	23916391		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.1535G>A	2.37:g.23916391G>A	ENSP00000420659:p.Arg512His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N388|Q96BF0|Q96PW7	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_Kelch_2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.R512H	ENST00000486442.1	37	c.1535	CCDS54335.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	37|37	6.087010|6.087010	0.97271|0.97271	.|.	.|.	ENSG00000119771|ENSG00000119771	ENST00000288548|ENST00000486442	.|T	.|0.73897	.|-0.79	5.24|5.24	5.24|5.24	0.73138|0.73138	.|BTB/Kelch-associated (2);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89241|0.89241	0.6659|0.6659	M|M	0.89904|0.89904	3.07|3.07	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.85130	.|0.993;0.997	D|D	0.91156|0.91156	0.4957|0.4957	5|10	.|0.87932	.|D	.|0	.|.	19.2145|19.2145	0.93770|0.93770	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|292;292	.|Q96CT2;Q96CT2-2	.|KLH29_HUMAN;.	T|H	352|512	.|ENSP00000420659:R512H	.|ENSP00000420659:R512H	A|R	+|+	1|2	0|0	KLHL29|KLHL29	23769896|23769896	1.000000|1.000000	0.71417|0.71417	0.135000|0.135000	0.22099|0.22099	0.631000|0.631000	0.37964|0.37964	9.692000|9.692000	0.98682|0.98682	2.606000|2.606000	0.88127|0.88127	0.563000|0.563000	0.77884|0.77884	GCA|CGC	KLHL29	-	pfam_BACK,smart_BACK	ENSG00000119771		0.607	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	KLHL29	HGNC	protein_coding	OTTHUMT00000324315.3	16	0.00	0	G	NM_052920		23916391	23916391	+1	no_errors	ENST00000486442	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.946	A
LANCL3	347404	genome.wustl.edu	37	X	37431625	37431625	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chrX:37431625G>A	ENST00000378619.3	+	1	721	c.502G>A	c.(502-504)Gac>Aac	p.D168N	TM4SF2_ENST00000465127.1_Intron|LANCL3_ENST00000378621.3_Missense_Mutation_p.D168N	NM_001170331.1	NP_001163802.1	Q6ZV70	LANC3_HUMAN	LanC lantibiotic synthetase component C-like 3 (bacterial)	168							catalytic activity (GO:0003824)			lung(4)|pancreas(1)	5						GTGCGGCTCCGACGAGCTGTT	0.697																																						dbGAP											0													4.0	4.0	4.0					X																	37431625		2029	3930	5959	-	-	-	SO:0001583	missense	0			AK124915	CCDS14240.1, CCDS55398.1	Xp21.1	2008-02-05			ENSG00000147036	ENSG00000147036			24767	protein-coding gene	gene with protein product							Standard	NM_198511		Approved	FLJ42925	uc011mkd.2	Q6ZV70	OTTHUMG00000033177	ENST00000378619.3:c.502G>A	X.37:g.37431625G>A	ENSP00000367882:p.Asp168Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHE3	Missense_Mutation	SNP	pfam_LANC-like,superfamily_6-hairpin_glycosidase-like,prints_LANC-like,prints_LanC-like_prot_euk	p.D168N	ENST00000378619.3	37	c.502	CCDS55398.1	X	.	.	.	.	.	.	.	.	.	.	G	19.87	3.908051	0.72868	.	.	ENSG00000147036	ENST00000378621;ENST00000378619	T;T	0.45276	0.9;0.9	4.09	4.09	0.47781	.	0.065778	0.64402	D	0.000018	T	0.55609	0.1931	L	0.53671	1.685	0.80722	D	1	D;D	0.65815	0.995;0.995	D;P	0.65684	0.937;0.723	T	0.52208	-0.8606	10	0.27785	T	0.31	-7.815	14.6153	0.68544	0.0:0.0:1.0:0.0	.	168;168	Q6ZV70;Q6ZV70-2	LANC3_HUMAN;.	N	168	ENSP00000367885:D168N;ENSP00000367882:D168N	ENSP00000367882:D168N	D	+	1	0	LANCL3	37316544	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	7.888000	0.87302	1.880000	0.54463	0.476000	0.43555	GAC	LANCL3	-	pfam_LANC-like,prints_LANC-like	ENSG00000147036		0.697	LANCL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LANCL3	HGNC	protein_coding	OTTHUMT00000080885.1	45	0.00	0	G	NM_198511		37431625	37431625	+1	no_errors	ENST00000378619	ensembl	human	known	69_37n	missense	49	35.53	27	SNP	1.000	A
LINC00200	399706	genome.wustl.edu	37	10	1205736	1205736	+	lincRNA	SNP	A	A	G	rs60415666		TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr10:1205736A>G	ENST00000425630.1	+	0	29					NR_015376.2				long intergenic non-protein coding RNA 200																		ATGAGGGATGACGCAGGCACA	0.667																																						dbGAP											0													15.0	18.0	17.0					10																	1205736		687	1591	2278	-	-	-			0			AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1205736A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			LINC00200	-	-	ENSG00000229205		0.667	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	HGNC	lincRNA	OTTHUMT00000046417.2	23	0.00	0	A	NR_015376		1205736	1205736	+1	no_errors	ENST00000425630	ensembl	human	known	69_37n	rna	63	17.11	13	SNP	0.155	G
MCM3AP	8888	genome.wustl.edu	37	21	47695144	47695144	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr21:47695144G>A	ENST00000397708.1	-	7	2208	c.1954C>T	c.(1954-1956)Cgt>Tgt	p.R652C	MCM3AP_ENST00000291688.1_Missense_Mutation_p.R652C			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	652	SAC3 homology.				DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					AGCTGGCTACGGGTCTCCCGC	0.582																																						dbGAP											0													87.0	71.0	77.0					21																	47695144		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1954C>T	21.37:g.47695144G>A	ENSP00000380820:p.Arg652Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.R652C	ENST00000397708.1	37	c.1954	CCDS13734.1	21	.	.	.	.	.	.	.	.	.	.	G	19.00	3.742688	0.69418	.	.	ENSG00000160294	ENST00000397708;ENST00000291688	T;T	0.03860	3.78;3.78	5.73	4.78	0.61160	.	0.000000	0.85682	D	0.000000	T	0.19406	0.0466	M	0.72479	2.2	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.00290	-1.1843	10	0.87932	D	0	-31.5782	12.9759	0.58537	0.0:0.0:0.6871:0.3129	.	652	O60318	MCM3A_HUMAN	C	652	ENSP00000380820:R652C;ENSP00000291688:R652C	ENSP00000291688:R652C	R	-	1	0	MCM3AP	46519572	0.999000	0.42202	0.972000	0.41901	0.831000	0.47069	2.960000	0.49161	1.352000	0.45808	0.655000	0.94253	CGT	MCM3AP	-	NULL	ENSG00000160294		0.582	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP	HGNC	protein_coding	OTTHUMT00000207254.1	45	0.00	0	G	NM_003906		47695144	47695144	-1	no_errors	ENST00000291688	ensembl	human	known	69_37n	missense	53	44.21	42	SNP	0.973	A
MRPL23	6150	genome.wustl.edu	37	11	1983601	1983601	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr11:1983601G>A	ENST00000381514.3	+	5	452	c.430G>A	c.(430-432)Gtg>Atg	p.V144M	MRPL23_ENST00000397297.3_Intron|MRPL23_ENST00000397294.3_Intron			Q16540	RM23_HUMAN	mitochondrial ribosomal protein L23	0					translation (GO:0006412)	mitochondrial large ribosomal subunit (GO:0005762)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			large_intestine(2)|lung(1)|ovary(1)	4		all_epithelial(84;6.24e-05)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.0026)|Lung(200;0.0171)|LUSC - Lung squamous cell carcinoma(625;0.0842)		TGCCCTGTGCGTGGTGGCCAG	0.617																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB051340	CCDS31336.1	11p15.5	2012-09-13			ENSG00000214026	ENSG00000214026		"""Mitochondrial ribosomal proteins / large subunits"""	10322	protein-coding gene	gene with protein product		600789		RPL23L		8541832	Standard	NM_021134		Approved	L23MRP	uc001lux.3	Q16540	OTTHUMG00000012476	ENST00000381514.3:c.430G>A	11.37:g.1983601G>A	ENSP00000370925:p.Val144Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT29|Q96Q71	Missense_Mutation	SNP	pfam_Ribosomal_L25/23,superfamily_Ribosomal_L23/L15e_core_dom	p.V144M	ENST00000381514.3	37	c.430		11	.	.	.	.	.	.	.	.	.	.	G	3.197	-0.164540	0.06502	.	.	ENSG00000214026	ENST00000381514	T	0.24350	1.86	1.97	-2.36	0.06663	.	.	.	.	.	T	0.24928	0.0605	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35151	-0.9800	6	0.87932	D	0	.	6.392	0.21591	0.6533:0.0:0.3467:0.0	.	.	.	.	M	144	ENSP00000370925:V144M	ENSP00000370925:V144M	V	+	1	0	MRPL23	1940177	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.448000	0.01009	-0.686000	0.05170	-0.671000	0.03813	GTG	MRPL23	-	NULL	ENSG00000214026		0.617	MRPL23-002	PUTATIVE	basic	protein_coding	MRPL23	HGNC	protein_coding	OTTHUMT00000034766.1	43	0.00	0	G	NM_021134		1983601	1983601	+1	no_errors	ENST00000381514	ensembl	human	putative	69_37n	missense	75	44.85	61	SNP	0.000	A
NOTCH2	4853	genome.wustl.edu	37	1	120480488	120480488	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr1:120480488G>A	ENST00000256646.2	-	20	3548	c.3329C>T	c.(3328-3330)tCc>tTc	p.S1110F		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1110	EGF-like 29. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		ACCTCTCCTGGAGGCTGCTAT	0.478			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													107.0	94.0	98.0					1																	120480488		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.3329C>T	1.37:g.120480488G>A	ENSP00000256646:p.Ser1110Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.S1110F	ENST00000256646.2	37	c.3329	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	8.232	0.804860	0.16467	.	.	ENSG00000134250	ENST00000256646	D	0.88586	-2.4	5.77	-0.42	0.12336	Epidermal growth factor-like (1);	1.739360	0.03869	U	0.275336	T	0.71846	0.3388	L	0.47190	1.495	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.001	T	0.57831	-0.7743	10	0.52906	T	0.07	.	4.5365	0.12037	0.2288:0.0:0.5102:0.261	.	1110;1110	Q6IQ50;Q04721	.;NOTC2_HUMAN	F	1110	ENSP00000256646:S1110F	ENSP00000256646:S1110F	S	-	2	0	NOTCH2	120282011	0.006000	0.16342	0.000000	0.03702	0.230000	0.25150	0.571000	0.23669	-0.365000	0.08076	0.591000	0.81541	TCC	NOTCH2	-	pirsf_Notch,smart_EGF-like,smart_EGF-like_Ca-bd	ENSG00000134250		0.478	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	24	0.00	0	G	NM_024408		120480488	120480488	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	missense	42	12.50	6	SNP	0.001	A
NPNT	255743	genome.wustl.edu	37	4	106861703	106861703	+	Frame_Shift_Del	DEL	T	T	-			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr4:106861703delT	ENST00000379987.2	+	7	889	c.673delT	c.(673-675)tgcfs	p.C225fs	NPNT_ENST00000506666.1_Frame_Shift_Del_p.C255fs|NPNT_ENST00000514622.1_Frame_Shift_Del_p.C225fs|NPNT_ENST00000427316.2_Frame_Shift_Del_p.C255fs|NPNT_ENST00000453617.2_Frame_Shift_Del_p.C242fs|NPNT_ENST00000305572.8_Frame_Shift_Del_p.C225fs	NM_001033047.2	NP_001028219.1	Q6UXI9	NPNT_HUMAN	nephronectin	225	EGF-like 5; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-matrix adhesion (GO:0007160)|cellular response to tumor necrosis factor (GO:0071356)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|pilomotor reflex (GO:0097195)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|ureteric bud development (GO:0001657)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integrin alpha8-beta1 complex (GO:0034678)|proteinaceous extracellular matrix (GO:0005578)|smooth muscle contractile fiber (GO:0030485)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			kidney(5)|large_intestine(2)|lung(10)|prostate(2)|skin(1)|urinary_tract(1)	21		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;5.41e-07)		TCAGTATCAGTGCAGCAGCTT	0.388																																						dbGAP											0													174.0	154.0	161.0					4																	106861703		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS34046.1, CCDS54784.1, CCDS54785.1, CCDS54786.1, CCDS54787.1	4q25	2005-10-07							27405	protein-coding gene	gene with protein product		610306				15754038	Standard	NM_001033047		Approved	EGFL6L, POEM	uc011cfd.2	Q6UXI9		ENST00000379987.2:c.673delT	4.37:g.106861703delT	ENSP00000369323:p.Cys225fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFT9|A8K1W4|B4DIT4|B4DYK3|B4E2H7|B4E3H2|D6RCA1|E9PCK8|E9PCQ1|E9PE64|E9PF04	Frame_Shift_Del	DEL	pfam_MAM_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_MAM_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.C225fs	ENST00000379987.2	37	c.673	CCDS34046.1	4																																																																																			NPNT	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000168743		0.388	NPNT-001	KNOWN	basic|CCDS	protein_coding	NPNT	HGNC	protein_coding	OTTHUMT00000364083.1	40	0.00	0	T	NM_198278		106861703	106861703	+1	no_errors	ENST00000379987	ensembl	human	known	69_37n	frame_shift_del	39	40.30	27	DEL	1.000	-
OGFR	11054	genome.wustl.edu	37	20	61444633	61444633	+	Missense_Mutation	SNP	G	G	A	rs75570150		TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr20:61444633G>A	ENST00000290291.6	+	7	1691	c.1666G>A	c.(1666-1668)Gag>Aag	p.E556K	OGFR_ENST00000370461.1_Missense_Mutation_p.E504K	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	556	7 X 20 AA approximate tandem repeats of [ST]-P-S-E-T-P-G-P-[SR]-P-A-G-P-[AT]- [GR]-D-E-P-A-[EK].				opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)	p.E556K(1)		endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					CGAGCCAGCCGAGAGCCCATC	0.756																																						dbGAP											1	Substitution - Missense(1)	skin(1)											6.0	11.0	9.0					20																	61444633		1936	3778	5714	-	-	-	SO:0001583	missense	0			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.1666G>A	20.37:g.61444633G>A	ENSP00000290291:p.Glu556Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Missense_Mutation	SNP	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.E556K	ENST00000290291.6	37	c.1666	CCDS13504.1	20	.	.	.	.	.	.	.	.	.	.	A	2.693	-0.272793	0.05716	.	.	ENSG00000060491	ENST00000290291;ENST00000357163;ENST00000370469;ENST00000370461	T;T	0.52983	0.64;0.64	0.773	-1.55	0.08558	.	.	.	.	.	T	0.25195	0.0612	N	0.14661	0.345	0.09310	N	1	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.04013	0.0;0.001;0.0	T	0.12785	-1.0534	9	0.34782	T	0.22	.	5.1465	0.14987	0.4456:0.0:0.5544:0.0	.	556;539;556	B3KMQ6;Q05BV5;Q9NZT2	.;.;OGFR_HUMAN	K	556;536;391;504	ENSP00000290291:E556K;ENSP00000359491:E504K	ENSP00000290291:E556K	E	+	1	0	OGFR	60915078	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.269000	0.00532	-0.808000	0.04387	-1.125000	0.01998	GAG	OGFR	-	pfam_OGF_rcpt_rpt	ENSG00000060491		0.756	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	HGNC	protein_coding	OTTHUMT00000080067.1	16	0.00	0	G			61444633	61444633	+1	no_errors	ENST00000290291	ensembl	human	known	69_37n	missense	43	24.56	14	SNP	0.040	A
OR6F1	343169	genome.wustl.edu	37	1	247875683	247875683	+	Silent	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr1:247875683G>A	ENST00000302084.2	-	1	422	c.375C>T	c.(373-375)gcC>gcT	p.A125A	RP11-634B7.4_ENST00000449298.1_RNA	NM_001005286.1	NP_001005286.1	Q8NGZ6	OR6F1_HUMAN	olfactory receptor, family 6, subfamily F, member 1	125						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.A125A(1)		breast(1)|kidney(1)|large_intestine(5)|lung(34)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)	47	all_cancers(71;3.24e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)		OV - Ovarian serous cystadenocarcinoma(106;0.0168)			GATAGCAGATGGCAAGACAGC	0.517																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											79.0	76.0	77.0					1																	247875683		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004460	CCDS31095.1	1q44	2012-08-09			ENSG00000169214	ENSG00000169214		"""GPCR / Class A : Olfactory receptors"""	15027	protein-coding gene	gene with protein product							Standard	NM_001005286		Approved	OST731	uc001idj.1	Q8NGZ6	OTTHUMG00000040213	ENST00000302084.2:c.375C>T	1.37:g.247875683G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNV6|Q6IF02|Q96R39	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.A125	ENST00000302084.2	37	c.375	CCDS31095.1	1																																																																																			OR6F1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000169214		0.517	OR6F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6F1	HGNC	protein_coding	OTTHUMT00000096870.1	17	0.00	0	G	NM_001005286		247875683	247875683	-1	no_errors	ENST00000302084	ensembl	human	known	69_37n	silent	47	20.34	12	SNP	1.000	A
OTOG	340990	genome.wustl.edu	37	11	17580087	17580087	+	Silent	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr11:17580087C>T	ENST00000399391.2	+	9	1035	c.1035C>T	c.(1033-1035)ggC>ggT	p.G345G	OTOG_ENST00000399397.1_Silent_p.G272G	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	345	VWFD 1. {ECO:0000255|PROSITE- ProRule:PRU00580}.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						TGCTCTAGGGCGTGTACGAGC	0.622																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.1035C>T	11.37:g.17580087C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.G345	ENST00000399391.2	37	c.1035	CCDS59225.1	11																																																																																			OTOG	-	smart_Unchr_dom_Cys-rich	ENSG00000188162		0.622	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		26	0.00	0	C			17580087	17580087	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	silent	37	47.14	33	SNP	0.928	T
PDE6C	5146	genome.wustl.edu	37	10	95386562	95386562	+	Splice_Site	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr10:95386562G>A	ENST00000371447.3	+	7	1143	c.1005G>A	c.(1003-1005)ccG>ccA	p.P335P		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	335	GAF 2.				phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	CTTCCCCAAGGACGCCTCCTG	0.383																																						dbGAP											0													74.0	77.0	76.0					10																	95386562		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.1005-1G>A	10.37:g.95386562G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCR6|Q5VY29	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.P335	ENST00000371447.3	37	c.1005	CCDS7429.1	10																																																																																			PDE6C	-	pfam_GAF,smart_GAF	ENSG00000095464		0.383	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6C	HGNC	protein_coding	OTTHUMT00000049437.1	61	0.00	0	G	NM_006204	Silent	95386562	95386562	+1	no_errors	ENST00000371447	ensembl	human	known	69_37n	silent	71	24.47	23	SNP	0.953	A
PIK3R4	30849	genome.wustl.edu	37	3	130454763	130454763	+	Missense_Mutation	SNP	A	A	G			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr3:130454763A>G	ENST00000356763.3	-	3	1374	c.817T>C	c.(817-819)Ttc>Ctc	p.F273L		NM_014602.2	NP_055417.1	Q99570	PI3R4_HUMAN	phosphoinositide-3-kinase, regulatory subunit 4	273	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		F -> L (in dbSNP:rs55951445). {ECO:0000269|PubMed:17344846}.		innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(6)|large_intestine(16)|lung(28)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	77						TGTTCAGGGAAAAAATGTCCA	0.333																																						dbGAP											0													117.0	127.0	124.0					3																	130454763		2203	4299	6502	-	-	-	SO:0001583	missense	0			Y08991	CCDS3067.1	3q22.1	2013-01-10	2008-02-04		ENSG00000196455	ENSG00000196455		"""WD repeat domain containing"""	8982	protein-coding gene	gene with protein product		602610				8999962	Standard	NM_014602		Approved	VPS15, p150	uc003enj.3	Q99570	OTTHUMG00000159645	ENST00000356763.3:c.817T>C	3.37:g.130454763A>G	ENSP00000349205:p.Phe273Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TBF4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_WD40_repeat,pfam_HEAT,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_WD40_repeat,pfscan_HEAT_type_2,pfscan_Prot_kinase_cat_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F273L	ENST00000356763.3	37	c.817	CCDS3067.1	3	.	.	.	.	.	.	.	.	.	.	A	10.30	1.312503	0.23908	.	.	ENSG00000196455	ENST00000356763	T	0.61859	0.07	5.68	5.68	0.88126	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.324738	0.36200	N	0.002730	T	0.35189	0.0923	N	0.04355	-0.22	0.25869	N	0.983735	B	0.02656	0.0	B	0.01281	0.0	T	0.20773	-1.0265	10	0.35671	T	0.21	-18.5212	12.7092	0.57080	0.8628:0.1372:0.0:0.0	.	273	Q99570	PI3R4_HUMAN	L	273	ENSP00000349205:F273L	ENSP00000349205:F273L	F	-	1	0	PIK3R4	131937453	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.953000	0.63624	2.289000	0.77006	0.482000	0.46254	TTC	PIK3R4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196455		0.333	PIK3R4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R4	HGNC	protein_coding	OTTHUMT00000356668.1	36	0.00	0	A	NM_014602		130454763	130454763	-1	no_errors	ENST00000356763	ensembl	human	known	69_37n	missense	36	50.00	36	SNP	1.000	G
PKHD1L1	93035	genome.wustl.edu	37	8	110439324	110439324	+	Missense_Mutation	SNP	G	G	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr8:110439324G>C	ENST00000378402.5	+	25	3043	c.2939G>C	c.(2938-2940)tGt>tCt	p.C980S		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	980					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			GAGGGAACCTGTGCTGGCTAC	0.522										HNSCC(38;0.096)																												dbGAP											0													70.0	73.0	72.0					8																	110439324		1944	4165	6109	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.2939G>C	8.37:g.110439324G>C	ENSP00000367655:p.Cys980Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.C980S	ENST00000378402.5	37	c.2939	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	15.58	2.875337	0.51695	.	.	ENSG00000205038	ENST00000378402	D	0.87650	-2.28	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.93562	0.7945	M	0.83603	2.65	0.32938	D	0.518034	D	0.89917	1.0	D	0.85130	0.997	D	0.95675	0.8727	10	0.87932	D	0	.	14.7913	0.69844	0.0:0.0:1.0:0.0	.	980	Q86WI1	PKHL1_HUMAN	S	980	ENSP00000367655:C980S	ENSP00000367655:C980S	C	+	2	0	PKHD1L1	110508500	1.000000	0.71417	1.000000	0.80357	0.206000	0.24218	5.258000	0.65479	2.555000	0.86185	0.591000	0.81541	TGT	PKHD1L1	-	NULL	ENSG00000205038		0.522	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	65	0.00	0	G	NM_177531		110439324	110439324	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	101	22.31	29	SNP	1.000	C
PSD	5662	genome.wustl.edu	37	10	104172164	104172164	+	Silent	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr10:104172164G>A	ENST00000020673.5	-	6	2248	c.1722C>T	c.(1720-1722)gcC>gcT	p.A574A	PSD_ENST00000406432.1_Silent_p.A574A	NM_001270966.1|NM_002779.4	NP_001257895.1|NP_002770.3	A5PKW4	PSD1_HUMAN	pleckstrin and Sec7 domain containing	574	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)|signal transducer activity (GO:0004871)			breast(4)|endometrium(2)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				Epithelial(162;1.27e-08)|all cancers(201;2.85e-07)		GGGCCACATCGGCCTTCCTGA	0.597																																						dbGAP											0													60.0	52.0	55.0					10																	104172164		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X99688	CCDS31272.1, CCDS73187.1	10q24	2013-01-10	2004-04-28		ENSG00000059915	ENSG00000059915		"""Pleckstrin homology (PH) domain containing"""	9507	protein-coding gene	gene with protein product		602327	"""pleckstrin and Sec7 domain protein"""			9417912	Standard	NM_002779		Approved	KIAA2011, TYL, PSD1	uc009xxd.2	A5PKW4	OTTHUMG00000018954	ENST00000020673.5:c.1722C>T	10.37:g.104172164G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKX7|D3DR87|Q15673|Q8IVG0	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7,prints_PH_dom-spectrin-type	p.A574	ENST00000020673.5	37	c.1722	CCDS31272.1	10																																																																																			PSD	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000059915		0.597	PSD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD	HGNC	protein_coding	OTTHUMT00000050041.2	52	0.00	0	G			104172164	104172164	-1	no_errors	ENST00000020673	ensembl	human	known	69_37n	silent	65	36.89	38	SNP	0.017	A
PTPRN2	5799	genome.wustl.edu	37	7	157926524	157926524	+	Silent	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr7:157926524G>A	ENST00000389418.4	-	9	1410	c.1401C>T	c.(1399-1401)gcC>gcT	p.A467A	PTPRN2_ENST00000404321.2_Silent_p.A490A|PTPRN2_ENST00000389413.3_Silent_p.A467A|PTPRN2_ENST00000409483.1_Silent_p.A429A|PTPRN2_ENST00000389416.4_Silent_p.A450A	NM_002847.3	NP_002838.2	Q92932	PTPR2_HUMAN	protein tyrosine phosphatase, receptor type, N polypeptide 2	467					negative regulation of GTPase activity (GO:0034260)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum lumen (GO:0005788)|integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)|secretory granule (GO:0030141)|terminal bouton (GO:0043195)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.A467A(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|liver(1)|lung(42)|ovary(4)|pleura(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	86	all_neural(206;0.181)	all_cancers(7;8.99e-13)|all_epithelial(9;2.4e-06)|all_hematologic(28;0.0155)|Breast(660;0.132)	OV - Ovarian serous cystadenocarcinoma(82;0.00463)	STAD - Stomach adenocarcinoma(7;0.0875)		CAAACGCAGCGGCCCCGGGCT	0.632																																						dbGAP											1	Substitution - coding silent(1)	cervix(1)											44.0	50.0	48.0					7																	157926524		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002385	CCDS5947.1, CCDS5948.1, CCDS5949.1	7q36	2011-06-09			ENSG00000155093	ENSG00000155093		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9677	protein-coding gene	gene with protein product	"""IAR PTPRP"""	601698				8954911, 9220540	Standard	NM_130842		Approved	KIAA0387, phogrin, ICAAR, IA-2beta	uc003wno.3	Q92932	OTTHUMG00000152646	ENST00000389418.4:c.1401C>T	7.37:g.157926524G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PC57|Q8N4I5|Q92662|Q9Y4F8|Q9Y4I6	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Receptor_IA-2,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.A490	ENST00000389418.4	37	c.1470	CCDS5947.1	7																																																																																			PTPRN2	-	NULL	ENSG00000155093		0.632	PTPRN2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTPRN2	HGNC	protein_coding	OTTHUMT00000353214.1	43	0.00	0	G			157926524	157926524	-1	no_errors	ENST00000404321	ensembl	human	known	69_37n	silent	64	37.25	38	SNP	0.000	A
RANBP3	8498	genome.wustl.edu	37	19	5925680	5925680	+	Silent	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr19:5925680G>A	ENST00000340578.6	-	10	939	c.882C>T	c.(880-882)acC>acT	p.T294T	RANBP3_ENST00000541471.1_Silent_p.T166T|RANBP3_ENST00000034275.8_Silent_p.T226T|RANBP3_ENST00000439268.2_Silent_p.T289T|RANBP3_ENST00000591092.1_Silent_p.T221T	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	294					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						AGTTCGTTGCGGTTGGCGTGT	0.592																																						dbGAP											0													81.0	90.0	87.0					19																	5925680		2124	4225	6349	-	-	-	SO:0001819	synonymous_variant	0			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.882C>T	19.37:g.5925680G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Silent	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.T294	ENST00000340578.6	37	c.882	CCDS42478.1	19																																																																																			RANBP3	-	NULL	ENSG00000031823		0.592	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	58	0.00	0	G	NM_007322		5925680	5925680	-1	no_errors	ENST00000340578	ensembl	human	known	69_37n	silent	72	44.19	57	SNP	0.003	A
RASGRP4	115727	genome.wustl.edu	37	19	38916711	38916711	+	Silent	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr19:38916711C>T	ENST00000587738.1	-	1	91	c.21G>A	c.(19-21)aaG>aaA	p.K7K	RASGRP4_ENST00000433821.2_Silent_p.K7K|RASGRP4_ENST00000454404.2_Silent_p.K7K|RASGRP4_ENST00000586305.1_Silent_p.K7K|RASGRP4_ENST00000587753.1_Silent_p.K7K|RASGRP4_ENST00000293062.9_Silent_p.K7K|RASGRP4_ENST00000426920.2_Silent_p.K7K			Q8TDF6	GRP4_HUMAN	RAS guanyl releasing protein 4	7					activation of phospholipase C activity (GO:0007202)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|myeloid cell differentiation (GO:0030099)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to extracellular stimulus (GO:0009991)|small GTPase mediated signal transduction (GO:0007264)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|GTP-dependent protein binding (GO:0030742)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)			cervix(1)|kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|prostate(3)|skin(1)	23	all_cancers(60;4.21e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTCTCACCTCTTACTGTCTT	0.642																																						dbGAP											0													70.0	77.0	75.0					19																	38916711		1898	4098	5996	-	-	-	SO:0001819	synonymous_variant	0			AY048119	CCDS46068.1, CCDS54262.1, CCDS54263.1, CCDS54264.1	19q13.1	2013-01-10						"""EF-hand domain containing"""	18958	protein-coding gene	gene with protein product		607320				11956218	Standard	NM_170604		Approved		uc021uub.1	Q8TDF6		ENST00000587738.1:c.21G>A	19.37:g.38916711C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8M4|C0LTP2|C0LTP3|C0LTP4|C0LTP5|C0LTP7|C9J416|C9JHZ1|Q8N858|Q96QN5|Q96QN6|Q96QN7	Silent	SNP	pfam_RasGRF_CDC25,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N,prints_DAG/PE-bd	p.K7	ENST00000587738.1	37	c.21	CCDS46068.1	19																																																																																			RASGRP4	-	NULL	ENSG00000171777		0.642	RASGRP4-013	KNOWN	non_canonical_other|basic|appris_principal|CCDS	protein_coding	RASGRP4	HGNC	protein_coding	OTTHUMT00000460540.1	23	0.00	0	C	NM_170604		38916711	38916711	-1	no_errors	ENST00000587738	ensembl	human	known	69_37n	silent	60	34.78	32	SNP	1.000	T
RBM45	129831	genome.wustl.edu	37	2	178977293	178977293	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:178977293C>G	ENST00000286070.5	+	1	112	c.20C>G	c.(19-21)tCt>tGt	p.S7C		NM_152945.2	NP_694453.2	Q8IUH3	RBM45_HUMAN	RNA binding motif protein 45	7					cell differentiation (GO:0030154)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.00957)|all cancers(119;0.037)			GCTGGCAGCTCTGCGAGCGGC	0.637											OREG0015102	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													25.0	30.0	28.0					2																	178977293		2191	4282	6473	-	-	-	SO:0001583	missense	0			AF526533	CCDS33335.1	2q31.2	2013-02-12			ENSG00000155636	ENSG00000155636		"""RNA binding motif (RRM) containing"""	24468	protein-coding gene	gene with protein product	"""developmentally regulated RNA binding protein 1"""	608888				12220514	Standard	XM_005246287		Approved	DRB1, FLJ44612	uc002ulv.3	Q8IUH3	OTTHUMG00000154202	ENST00000286070.5:c.20C>G	2.37:g.178977293C>G	ENSP00000286070:p.Ser7Cys	Somatic	1950	WXS	Illumina GAIIx	Phase_IV	Q6NYL0|Q8NFC9	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S7C	ENST00000286070.5	37	c.20	CCDS33335.1	2	.	.	.	.	.	.	.	.	.	.	C	10.51	1.371062	0.24771	.	.	ENSG00000155636	ENST00000286070	T	0.05382	3.45	5.54	2.58	0.30949	.	0.526604	0.19231	N	0.119406	T	0.04227	0.0117	N	0.22421	0.69	0.27826	N	0.941631	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	10	0.40728	T	0.16	-2.3114	5.5648	0.17165	0.0949:0.5628:0.2349:0.1074	.	7	Q8IUH3-3	.	C	7	ENSP00000286070:S7C	ENSP00000286070:S7C	S	+	2	0	RBM45	178685539	0.551000	0.26497	0.854000	0.33618	0.415000	0.31203	0.185000	0.16958	0.691000	0.31592	0.563000	0.77884	TCT	RBM45	-	NULL	ENSG00000155636		0.637	RBM45-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM45	HGNC	protein_coding	OTTHUMT00000334375.2	29	0.00	0	C	NM_152945		178977293	178977293	+1	no_errors	ENST00000286070	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	0.692	G
SCNM1	79005	genome.wustl.edu	37	1	151139102	151139102	+	Intron	SNP	G	G	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr1:151139102G>T	ENST00000368905.4	+	2	233				LYSMD1_ENST00000368908.5_5'Flank|LYSMD1_ENST00000440902.2_5'Flank|SCNM1_ENST00000461862.1_Intron	NM_001204856.1|NM_024041.3	NP_001191785.1|NP_076946.1	Q9BWG6	SCNM1_HUMAN	sodium channel modifier 1						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	17	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			tgagacggaggtctcgcggtg	0.552																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC000264	CCDS987.1, CCDS55636.1	1q21.3	2012-03-13			ENSG00000163156	ENSG00000163156			23136	protein-coding gene	gene with protein product		608095				12920299	Standard	NM_024041		Approved	MGC3180	uc001ewz.3	Q9BWG6	OTTHUMG00000012258	ENST00000368905.4:c.122+85G>T	1.37:g.151139102G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWR1|Q5JR74	RNA	SNP	-	NULL	ENST00000368905.4	37	NULL	CCDS987.1	1																																																																																			SCNM1	-	-	ENSG00000163156		0.552	SCNM1-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	SCNM1	HGNC	protein_coding	OTTHUMT00000034064.2	13	0.00	0	G	NM_024041		151139102	151139102	+1	no_errors	ENST00000471039	ensembl	human	putative	69_37n	rna	31	38.00	19	SNP	0.064	T
SDK2	54549	genome.wustl.edu	37	17	71431705	71431705	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr17:71431705C>T	ENST00000392650.3	-	9	1079	c.1079G>A	c.(1078-1080)cGc>cAc	p.R360H	SDK2_ENST00000388726.3_Missense_Mutation_p.R360H	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	360	Ig-like C2-type 4.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						CCCGTCGTTGCGCTGCCGGAA	0.662																																						dbGAP											0													50.0	35.0	40.0					17																	71431705		2201	4293	6494	-	-	-	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1079G>A	17.37:g.71431705C>T	ENSP00000376421:p.Arg360His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R360H	ENST00000392650.3	37	c.1079	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	13.59	2.281959	0.40394	.	.	ENSG00000069188	ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.67865	-0.29;-0.29	4.84	1.18	0.20946	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.237219	0.35495	N	0.003179	T	0.39064	0.1064	N	0.12831	0.26	0.32582	N	0.528305	B;B	0.09022	0.001;0.002	B;B	0.08055	0.003;0.001	T	0.21999	-1.0229	9	.	.	.	.	4.7724	0.13162	0.24:0.482:0.0:0.278	.	360;360	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	H	360	ENSP00000376421:R360H;ENSP00000373378:R360H	.	R	-	2	0	SDK2	68943300	0.006000	0.16342	0.511000	0.27724	0.920000	0.55202	0.083000	0.14871	0.453000	0.26858	0.561000	0.74099	CGC	SDK2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000069188		0.662	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	40	0.00	0	C	NM_019064		71431705	71431705	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	missense	88	16.98	18	SNP	0.616	T
SIGLEC5	8778	genome.wustl.edu	37	19	52130755	52130755	+	Silent	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr19:52130755G>A	ENST00000534261.2	-	7	1641	c.1242C>T	c.(1240-1242)aaC>aaT	p.N414N	SIGLEC5_ENST00000222107.4_Silent_p.N414N|SIGLEC5_ENST00000599649.1_Silent_p.N414N|SIGLEC5_ENST00000429354.3_Silent_p.N414N|SIGLEC5_ENST00000570106.2_Silent_p.N414N			O15389	SIGL5_HUMAN	sialic acid binding Ig-like lectin 5	414					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|large_intestine(4)|lung(9)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	27		all_neural(266;0.0726)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0218)		ACCCATAGATGTTCCAGGCCT	0.637																																						dbGAP											0													83.0	82.0	82.0					19																	52130755		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U71383	CCDS33088.1	19q13.41	2013-01-29			ENSG00000105501	ENSG00000105501		"""Sialic acid binding Ig-like lectins"", ""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10874	protein-coding gene	gene with protein product		604200		CD33L2		10343116	Standard	NM_003830		Approved	OB-BP2, SIGLEC-5, CD170	uc002pxe.4	O15389	OTTHUMG00000165510	ENST00000534261.2:c.1242C>T	19.37:g.52130755G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.N414	ENST00000534261.2	37	c.1242	CCDS33088.1	19																																																																																			SIGLEC5	-	NULL	ENSG00000105501		0.637	SIGLEC5-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	SIGLEC5	HGNC	protein_coding	OTTHUMT00000466897.2	68	0.00	0	G	NM_003830		52130755	52130755	-1	no_errors	ENST00000222107	ensembl	human	known	69_37n	silent	106	20.30	27	SNP	0.002	A
COL18A1	80781	genome.wustl.edu	37	21	46918318	46918318	+	Intron	SNP	G	G	A	rs560781871	byFrequency	TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr21:46918318G>A	ENST00000359759.4	+	31	3949				SLC19A1_ENST00000567670.1_Missense_Mutation_p.A501V|COL18A1_ENST00000400337.2_Intron|COL18A1_ENST00000355480.5_Intron			P39060	COIA1_HUMAN	collagen, type XVIII, alpha 1						angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endothelial cell morphogenesis (GO:0001886)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|organ morphogenesis (GO:0009887)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell apoptotic process (GO:2000353)|response to drug (GO:0042493)|response to hydrostatic pressure (GO:0051599)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25				Colorectal(79;0.0157)|READ - Rectum adenocarcinoma(84;0.0929)		CCCTCTCGCCGCCAGGGTCCC	0.776													g|||	2	0.000399361	0.0008	0.0014	5008	,	,		10414	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS42971.1, CCDS42972.1	21q22.3	2013-01-16			ENSG00000182871	ENSG00000182871		"""Collagens"""	2195	protein-coding gene	gene with protein product	"""endostatin"""	120328	"""Knobloch syndrome, type 1"""	KNO		8188291, 8776601, 10942434, 17546652	Standard	NM_130445		Approved	KS, KNO1	uc002zhi.3	P39060	OTTHUMG00000090407	ENST00000359759.4:c.3928+743G>A	21.37:g.46918318G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVI4|Q58EX6|Q6RZ39|Q6RZ40|Q6RZ41|Q8N4S4|Q8WXI5|Q96T70|Q9UK38|Q9Y6Q7|Q9Y6Q8	Missense_Mutation	SNP	pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,superfamily_Glu_synth_asu_C,pirsf_Folate_carrier,tigrfam_Folate_carrier	p.A501V	ENST00000359759.4	37	c.1502		21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	1.628|1.628	-0.519792|-0.519792	0.04171|0.04171	.|.	.|.	ENSG00000173638|ENSG00000173638	ENST00000380014|ENST00000417954	.|.	.|.	.|.	0.118|0.118	-0.237|-0.237	0.13061|0.13061	.|.	.|.	.|.	.|.	.|.	T|T	0.23649|0.23649	0.0572|0.0572	.|.	.|.	.|.	0.23331|0.23331	N|N	0.997894|0.997894	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.25328|0.25328	-1.0135|-1.0135	5|4	0.21540|.	T|.	0.41|.	.|.	4.5337|4.5337	0.12017|0.12017	0.3185:0.0:0.6815:0.0|0.3185:0.0:0.6815:0.0	.|.	.|.	.|.	.|.	V|W	248|236	.|.	ENSP00000369352:A248V|.	A|R	-|-	2|1	0|2	SLC19A1|SLC19A1	45742746|45742746	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.001000|0.001000	0.01503|0.01503	-1.433000|-1.433000	0.02428|0.02428	-1.115000|-1.115000	0.02973|0.02973	-1.111000|-1.111000	0.02071|0.02071	GCG|CGG	SLC19A1	-	superfamily_Glu_synth_asu_C	ENSG00000173638		0.776	COL18A1-201	KNOWN	basic|appris_principal	protein_coding	SLC19A1	HGNC	protein_coding	OTTHUMT00000206827.1	8	0.00	0	G			46918318	46918318	-1	no_errors	ENST00000567670	ensembl	human	putative	69_37n	missense	39	51.25	41	SNP	0.291	A
SLIT2	9353	genome.wustl.edu	37	4	20598129	20598129	+	Missense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr4:20598129G>A	ENST00000504154.1	+	32	3664	c.3412G>A	c.(3412-3414)Gtc>Atc	p.V1138I	SLIT2_ENST00000503837.1_Missense_Mutation_p.V1134I|SLIT2_ENST00000273739.5_Missense_Mutation_p.V1151I|SLIT2_ENST00000503823.1_Missense_Mutation_p.V1130I	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	1138	EGF-like 6. {ECO:0000255|PROSITE- ProRule:PRU00076}.				apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TCAGTGTATCGTCAGAATAAA	0.408																																						dbGAP											0													127.0	125.0	125.0					4																	20598129		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.3412G>A	4.37:g.20598129G>A	ENSP00000422591:p.Val1138Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.V1138I	ENST00000504154.1	37	c.3412	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	5.929	0.355461	0.11239	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837	D;D;D;D	0.91631	-2.88;-2.88;-2.88;-2.88	6.17	0.795	0.18643	Follistatin-like, N-terminal (1);Concanavalin A-like lectin/glucanase, subgroup (1);EGF (1);Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.380226	0.31415	N	0.007687	D	0.88134	0.6355	L	0.53249	1.67	0.38989	D	0.959115	B;B	0.18310	0.027;0.008	B;B	0.18263	0.021;0.014	T	0.80432	-0.1385	10	0.37606	T	0.19	.	11.527	0.50586	0.5516:0.0:0.4484:0.0	.	1130;1138	O94813-3;O94813	.;SLIT2_HUMAN	I	1130;1138;1151;1134;1134	ENSP00000427548:V1130I;ENSP00000422591:V1138I;ENSP00000273739:V1151I;ENSP00000422261:V1134I	ENSP00000273739:V1151I	V	+	1	0	SLIT2	20207227	0.936000	0.31750	0.996000	0.52242	0.014000	0.08584	0.569000	0.23638	-0.023000	0.13963	-0.290000	0.09829	GTC	SLIT2	-	pfam_EGF-like_dom,smart_Fol_N,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	ENSG00000145147		0.408	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	31	0.00	0	G			20598129	20598129	+1	no_errors	ENST00000504154	ensembl	human	known	69_37n	missense	36	54.43	43	SNP	0.999	A
SLITRK3	22865	genome.wustl.edu	37	3	164906171	164906171	+	Silent	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr3:164906171C>T	ENST00000475390.1	-	2	2891	c.2448G>A	c.(2446-2448)aaG>aaA	p.K816K	SLITRK3_ENST00000241274.3_Silent_p.K816K			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	816					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						GGGCCCACTCCTTCTCTTTTT	0.542										HNSCC(40;0.11)																												dbGAP											0													95.0	98.0	97.0					3																	164906171		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.2448G>A	3.37:g.164906171C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q1RMY6	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.K816	ENST00000475390.1	37	c.2448	CCDS3197.1	3																																																																																			SLITRK3	-	NULL	ENSG00000121871		0.542	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	41	0.00	0	C	NM_014926		164906171	164906171	-1	no_errors	ENST00000241274	ensembl	human	known	69_37n	silent	44	25.42	15	SNP	1.000	T
MAGED2	10916	genome.wustl.edu	37	X	54840889	54840889	+	Intron	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chrX:54840889C>T	ENST00000375068.1	+	11	1504				MAGED2_ENST00000375060.1_Intron|SNORA11_ENST00000408789.1_RNA|MAGED2_ENST00000218439.4_Intron|MAGED2_ENST00000375058.1_Intron|MAGED2_ENST00000375062.4_Intron|MAGED2_ENST00000396224.1_Intron|MAGED2_ENST00000375053.2_Intron|MAGED2_ENST00000347546.4_Intron			Q9UNF1	MAGD2_HUMAN	melanoma antigen family D, 2							membrane (GO:0016020)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26						GTGATGAGGGCGTCAAACTTG	0.522																																						dbGAP											0													299.0	265.0	275.0					X																	54840889		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AF128527	CCDS14362.1	Xp11.2	2008-08-01			ENSG00000102316	ENSG00000102316			16353	protein-coding gene	gene with protein product	"""hepatocellular carcinoma associated protein"", ""breast cancer associated gene 1"", ""melanoma-associated antigen D2"", ""hepatocellular carcinoma-associated protein HCA10"""	300470					Standard	NM_014599		Approved	JCL-1, BCG1, 11B6, MAGE-D2, HCA10, MAGED, MGC8386	uc004dtk.1	Q9UNF1	OTTHUMG00000021638	ENST00000375068.1:c.1272-205C>T	X.37:g.54840889C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMX0|O76058|Q5BJF3|Q8NAL6|Q9H218|Q9P0U9|Q9UM52	RNA	SNP	-	NULL	ENST00000375068.1	37	NULL	CCDS14362.1	X																																																																																			SNORA11	-	-	ENSG00000221716		0.522	MAGED2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SNORA11	HGNC	protein_coding	OTTHUMT00000056821.2	107	0.00	0	C	NM_014599		54840889	54840889	+1	no_errors	ENST00000408789	ensembl	human	known	69_37n	rna	136	43.62	106	SNP	0.000	T
SRCAP	10847	genome.wustl.edu	37	16	30744741	30744741	+	Missense_Mutation	SNP	G	G	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr16:30744741G>T	ENST00000262518.4	+	28	6653	c.6268G>T	c.(6268-6270)Gat>Tat	p.D2090Y	SRCAP_ENST00000344771.4_Missense_Mutation_p.D1932Y|SRCAP_ENST00000395059.2_Missense_Mutation_p.D2028Y	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	2090	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCTGCGCCTGGATGGATCTAC	0.537																																						dbGAP											0													91.0	79.0	83.0					16																	30744741		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.6268G>T	16.37:g.30744741G>T	ENSP00000262518:p.Asp2090Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.D2090Y	ENST00000262518.4	37	c.6268	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	G	12.34	1.907419	0.33628	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.93133	-3.17;-3.17;-3.17	5.01	4.05	0.47172	Helicase, C-terminal (3);	0.270722	0.26345	N	0.024906	D	0.96803	0.8956	M	0.90650	3.135	0.39045	D	0.960206	D;D	0.76494	0.999;0.999	D;D	0.71870	0.958;0.975	D	0.97864	1.0282	10	0.87932	D	0	-11.5149	12.3026	0.54882	0.0833:0.0:0.9167:0.0	.	2028;2090	Q6ZRS2-2;Q6ZRS2	.;SRCAP_HUMAN	Y	2090;2028;1932	ENSP00000262518:D2090Y;ENSP00000378499:D2028Y;ENSP00000343042:D1932Y	ENSP00000262518:D2090Y	D	+	1	0	SRCAP	30652242	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	9.578000	0.98200	1.332000	0.45431	0.655000	0.94253	GAT	SRCAP	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000080603		0.537	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	16	0.00	0	G	NM_006662		30744741	30744741	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	missense	43	25.86	15	SNP	1.000	T
SRD5A1	6715	genome.wustl.edu	37	5	6663007	6663007	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr5:6663007G>A	ENST00000274192.5	+	4	875	c.641G>A	c.(640-642)tGg>tAg	p.W214*	SRD5A1_ENST00000538824.1_Nonsense_Mutation_p.W167*|SRD5A1_ENST00000537411.1_3'UTR	NM_001047.2	NP_001038.1	P18405	S5A1_HUMAN	steroid-5-alpha-reductase, alpha polypeptide 1 (3-oxo-5 alpha-steroid delta 4-dehydrogenase alpha 1)	214					androgen biosynthetic process (GO:0006702)|cell differentiation (GO:0030154)|sex determination (GO:0007530)|sex differentiation (GO:0007548)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	3-oxo-5-alpha-steroid 4-dehydrogenase activity (GO:0003865)|cholestenone 5-alpha-reductase activity (GO:0047751)|electron carrier activity (GO:0009055)			endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19					Dutasteride(DB01126)|Finasteride(DB01216)|Levonorgestrel(DB00367)|Spironolactone(DB00421)	CTGGCCAGCTGGTCTGTCCAA	0.418																																						dbGAP											0													133.0	125.0	128.0					5																	6663007		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M32313	CCDS3870.1	5p15.31	2008-02-05			ENSG00000145545	ENSG00000145545	1.3.99.5		11284	protein-coding gene	gene with protein product		184753				1686016	Standard	XR_427663		Approved		uc003jdw.3	P18405	OTTHUMG00000090456	ENST00000274192.5:c.641G>A	5.37:g.6663007G>A	ENSP00000274192:p.Trp214*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7Q1|Q9UHY4|Q9UP36|Q9UP37	Nonsense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfam_DUF1295,pirsf_3-oxo-5-alpha-steroid_4-DH,pfscan_3-oxo-5_a-steroid_4-DH_C	p.W214*	ENST00000274192.5	37	c.641	CCDS3870.1	5	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703887	0.48412	.	.	ENSG00000145545	ENST00000274192;ENST00000538824	.	.	.	4.66	4.66	0.58398	.	0.273203	0.37955	N	0.001865	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-19.4386	16.7063	0.85373	0.0:0.0:1.0:0.0	.	.	.	.	X	214;167	.	ENSP00000274192:W214X	W	+	2	0	SRD5A1	6716007	1.000000	0.71417	1.000000	0.80357	0.112000	0.19704	2.987000	0.49378	2.308000	0.77769	0.655000	0.94253	TGG	SRD5A1	-	pfam_3-oxo-5_a-steroid_4-DH_C,pfam_DUF1295,pirsf_3-oxo-5-alpha-steroid_4-DH,pfscan_3-oxo-5_a-steroid_4-DH_C	ENSG00000145545		0.418	SRD5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRD5A1	HGNC	protein_coding	OTTHUMT00000206903.1	54	0.00	0	G	NM_001047		6663007	6663007	+1	no_errors	ENST00000274192	ensembl	human	known	69_37n	nonsense	117	16.43	23	SNP	1.000	A
SYNPO2	171024	genome.wustl.edu	37	4	119952660	119952660	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr4:119952660T>A	ENST00000429713.2	+	4	2912	c.2730T>A	c.(2728-2730)agT>agA	p.S910R	SYNPO2_ENST00000434046.2_Missense_Mutation_p.S910R|SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000307142.4_Missense_Mutation_p.S910R	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	910						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						TCCCGGCCAGTTGGAAGTACT	0.562																																						dbGAP											0													95.0	87.0	90.0					4																	119952660		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.2730T>A	4.37:g.119952660T>A	ENSP00000395143:p.Ser910Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S910R	ENST00000429713.2	37	c.2730	CCDS47129.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	18.91|18.91	3.724271|3.724271	0.68959|0.68959	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000504178|ENST00000307142;ENST00000429713;ENST00000434046	.|T;T;T	.|0.12465	.|2.68;2.77;2.73	5.76|5.76	-8.59|-8.59	0.00893|0.00893	.|.	.|0.535942	.|0.18565	.|N	.|0.137508	T|T	0.17280|0.17280	0.0415|0.0415	M|M	0.69823|0.69823	2.125|2.125	0.80722|0.80722	D|D	1|1	.|P;P;P;P	.|0.45212	.|0.771;0.853;0.771;0.529	.|B;P;P;B	.|0.51777	.|0.328;0.679;0.48;0.397	T|T	0.37150|0.37150	-0.9718|-0.9718	5|9	.|.	.|.	.|.	-0.4689|-0.4689	7.6575|7.6575	0.28383|0.28383	0.1846:0.4272:0.0:0.3883|0.1846:0.4272:0.0:0.3883	.|.	.|910;910;910;910	.|B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6	.|.;.;.;SYNP2_HUMAN	M|R	862|910	.|ENSP00000306015:S910R;ENSP00000395143:S910R;ENSP00000390965:S910R	.|.	L|S	+|+	1|3	2|2	SYNPO2|SYNPO2	120172108|120172108	0.001000|0.001000	0.12720|0.12720	0.809000|0.809000	0.32408|0.32408	0.958000|0.958000	0.62258|0.62258	-1.416000|-1.416000	0.02467|0.02467	-1.358000|-1.358000	0.02177|0.02177	0.533000|0.533000	0.62120|0.62120	TTG|AGT	SYNPO2	-	NULL	ENSG00000172403		0.562	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	SYNPO2	HGNC	protein_coding	OTTHUMT00000364020.1	18	0.00	0	T			119952660	119952660	+1	no_errors	ENST00000307142	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	0.405	A
TBC1D10B	26000	genome.wustl.edu	37	16	30376911	30376911	+	Missense_Mutation	SNP	T	T	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr16:30376911T>A	ENST00000409939.3	-	2	1041	c.961A>T	c.(961-963)Agc>Tgc	p.S321C		NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	321					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			GGAATGGAGCTCTCTCTGCAG	0.572																																						dbGAP											0													74.0	72.0	72.0					16																	30376911		2197	4300	6497	-	-	-	SO:0001583	missense	0			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.961A>T	16.37:g.30376911T>A	ENSP00000386538:p.Ser321Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.S321C	ENST00000409939.3	37	c.961	CCDS10676.2	16	.	.	.	.	.	.	.	.	.	.	T	21.3	4.126083	0.77436	.	.	ENSG00000169221	ENST00000409939	T	0.05717	3.4	5.56	5.56	0.83823	.	0.306413	0.35349	N	0.003276	T	0.13713	0.0332	L	0.48642	1.525	0.41681	D	0.989294	D	0.57899	0.981	P	0.57776	0.827	T	0.00785	-1.1567	10	0.62326	D	0.03	.	9.2465	0.37529	0.0:0.0821:0.0:0.9179	.	321	Q4KMP7	TB10B_HUMAN	C	321	ENSP00000386538:S321C	ENSP00000386538:S321C	S	-	1	0	TBC1D10B	30284412	0.999000	0.42202	1.000000	0.80357	0.980000	0.70556	2.627000	0.46469	2.115000	0.64714	0.482000	0.46254	AGC	TBC1D10B	-	NULL	ENSG00000169221		0.572	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	HGNC	protein_coding	OTTHUMT00000255527.3	44	0.00	0	T	NM_015527		30376911	30376911	-1	no_errors	ENST00000409939	ensembl	human	known	69_37n	missense	78	19.39	19	SNP	1.000	A
TBC1D8	11138	genome.wustl.edu	37	2	101667087	101667087	+	Silent	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:101667087C>T	ENST00000376840.4	-	5	602	c.603G>A	c.(601-603)ccG>ccA	p.P201P	TBC1D8_ENST00000409318.1_Silent_p.P216P			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	201	GRAM 1.				blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TATCAACCCACGGAACCACAA	0.423																																						dbGAP											0													81.0	82.0	81.0					2																	101667087		1911	4118	6029	-	-	-	SO:0001819	synonymous_variant	0			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.603G>A	2.37:g.101667087C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.P216	ENST00000376840.4	37	c.648	CCDS46375.1	2																																																																																			TBC1D8	-	pfam_GRAM,smart_GRAM	ENSG00000204634		0.423	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	HGNC	protein_coding	OTTHUMT00000376092.1	20	0.00	0	C	NM_007063		101667087	101667087	-1	no_errors	ENST00000409318	ensembl	human	known	69_37n	silent	37	27.45	14	SNP	0.924	T
TNC	3371	genome.wustl.edu	37	9	117848957	117848957	+	Silent	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr9:117848957G>A	ENST00000350763.4	-	3	1464	c.1053C>T	c.(1051-1053)caC>caT	p.H351H	TNC_ENST00000340094.3_Silent_p.H351H|TNC_ENST00000423613.2_Silent_p.H351H|TNC_ENST00000542877.1_Silent_p.H351H|TNC_ENST00000535648.1_Silent_p.H351H|TNC_ENST00000537320.1_Silent_p.H351H|TNC_ENST00000346706.3_Silent_p.H351H|TNC_ENST00000341037.4_Silent_p.H351H|TNC_ENST00000345230.3_Silent_p.H351H	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	351	EGF-like 7. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						GGCCCTGGGTGTGGCAGGCAT	0.607																																						dbGAP											0													69.0	66.0	67.0					9																	117848957		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.1053C>T	9.37:g.117848957G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.H351	ENST00000350763.4	37	c.1053	CCDS6811.1	9																																																																																			TNC	-	pfam_EGF_extracell,smart_EGF-like	ENSG00000041982		0.607	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	26	0.00	0	G	NM_002160		117848957	117848957	-1	no_errors	ENST00000350763	ensembl	human	known	69_37n	silent	15	67.39	31	SNP	0.000	A
TNC	3371	genome.wustl.edu	37	9	117849163	117849163	+	Silent	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr9:117849163G>A	ENST00000350763.4	-	3	1258	c.847C>T	c.(847-849)Ctg>Ttg	p.L283L	TNC_ENST00000340094.3_Silent_p.L283L|TNC_ENST00000423613.2_Silent_p.L283L|TNC_ENST00000542877.1_Silent_p.L283L|TNC_ENST00000535648.1_Silent_p.L283L|TNC_ENST00000537320.1_Silent_p.L283L|TNC_ENST00000346706.3_Silent_p.L283L|TNC_ENST00000341037.4_Silent_p.L283L|TNC_ENST00000345230.3_Silent_p.L283L	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	283	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TTGAGACACAGAGGCTTGTTG	0.552																																						dbGAP											0													203.0	152.0	169.0					9																	117849163		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.847C>T	9.37:g.117849163G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.L283	ENST00000350763.4	37	c.847	CCDS6811.1	9																																																																																			TNC	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000041982		0.552	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	41	0.00	0	G	NM_002160		117849163	117849163	-1	no_errors	ENST00000350763	ensembl	human	known	69_37n	silent	15	64.29	27	SNP	0.741	A
TOP3B	8940	genome.wustl.edu	37	22	22311882	22311882	+	Silent	SNP	G	G	A	rs145256528		TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr22:22311882G>A	ENST00000398793.2	-	18	2627	c.2193C>T	c.(2191-2193)agC>agT	p.S731S	TOP3B_ENST00000357179.5_Silent_p.S731S	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	731					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		CCAGCACCCCGCTCTCACATT	0.662																																						dbGAP											0													1.0	1.0	1.0					22																	22311882		936	2047	2983	-	-	-	SO:0001819	synonymous_variant	0			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.2193C>T	22.37:g.22311882G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8Q3|Q9BUP5	Silent	SNP	pfam_Topo_IA_cen,pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.S731	ENST00000398793.2	37	c.2193	CCDS13797.1	22																																																																																			TOP3B	-	NULL	ENSG00000100038		0.662	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1	12	0.00	0	G	NM_003935		22311882	22311882	-1	no_errors	ENST00000357179	ensembl	human	known	69_37n	silent	13	43.48	10	SNP	0.068	A
TTC34	100287898	genome.wustl.edu	37	1	2704167	2704167	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr1:2704167C>T	ENST00000401095.3	-	2	273	c.194G>A	c.(193-195)cGc>cAc	p.R65H	TTC34_ENST00000401094.6_Intron	NM_001242672.1	NP_001229601.1	A8MYJ7	TTC34_HUMAN	tetratricopeptide repeat domain 34	65																	CTCCTCCAGGCGGCCCAGGCG	0.706																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55565.1	1p36.32	2013-01-11			ENSG00000215912	ENSG00000215912		"""Tetratricopeptide (TTC) repeat domain containing"""	34297	protein-coding gene	gene with protein product							Standard	NM_001242672		Approved		uc021oey.1	A8MYJ7	OTTHUMG00000000539	ENST00000401095.3:c.194G>A	1.37:g.2704167C>T	ENSP00000383873:p.Arg65His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXL8	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R65H	ENST00000401095.3	37	c.194	CCDS55565.1	1	.	.	.	.	.	.	.	.	.	.	C	9.139	1.013261	0.19277	.	.	ENSG00000215912	ENST00000401094;ENST00000401095	T	0.79845	-1.31	4.21	2.33	0.28932	.	0.171125	0.35040	N	0.003485	T	0.77572	0.4150	L	0.40543	1.245	0.43835	D	0.996412	.	.	.	.	.	.	T	0.74642	-0.3597	8	0.51188	T	0.08	.	9.7421	0.40424	0.0:0.8287:0.0:0.1713	.	.	.	.	H	65	ENSP00000383873:R65H	ENSP00000387700:R65H	R	-	2	0	TTC34	2694027	1.000000	0.71417	1.000000	0.80357	0.335000	0.28730	2.207000	0.42788	0.529000	0.28599	0.555000	0.69702	CGC	TTC34	-	NULL	ENSG00000215912		0.706	TTC34-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC34	HGNC	protein_coding		27	0.00	0	C	XM_002342015		2704167	2704167	-1	no_errors	ENST00000401095	ensembl	human	known	69_37n	missense	14	68.18	30	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179594184	179594184	+	Silent	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:179594184C>T	ENST00000591111.1	-	62	17972	c.17748G>A	c.(17746-17748)ctG>ctA	p.L5916L	TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.L6233L|RP11-171I2.1_ENST00000590024.1_RNA|TTN_ENST00000342992.6_Silent_p.L4989L|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12711	Ig-like 40.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTATTCTTCAGCCAAGTGA	0.448																																						dbGAP											0													128.0	121.0	123.0					2																	179594184		1923	4130	6053	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17748G>A	2.37:g.179594184C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L4989	ENST00000591111.1	37	c.14967		2																																																																																			TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000155657		0.448	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	23	0.00	0	C	NM_133378		179594184	179594184	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	17	37.04	10	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179595299	179595299	+	Silent	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:179595299C>T	ENST00000591111.1	-	59	17234	c.17010G>A	c.(17008-17010)ggG>ggA	p.G5670G	TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.G5987G|TTN_ENST00000342992.6_Silent_p.G4743G|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12479	Ig-like 37.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAGTGTATGTCCCACTGTCTG	0.413																																						dbGAP											0													124.0	122.0	122.0					2																	179595299		1950	4136	6086	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17010G>A	2.37:g.179595299C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.G4743	ENST00000591111.1	37	c.14229		2																																																																																			TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000155657		0.413	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	47	0.00	0	C	NM_133378		179595299	179595299	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	56	29.11	23	SNP	0.557	T
TTN	7273	genome.wustl.edu	37	2	179595307	179595307	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr2:179595307C>T	ENST00000591111.1	-	59	17226	c.17002G>A	c.(17002-17004)Gac>Aac	p.D5668N	TTN-AS1_ENST00000582847.1_RNA|TTN_ENST00000342175.6_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Missense_Mutation_p.D5985N|TTN_ENST00000342992.6_Missense_Mutation_p.D4741N|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12477	Ig-like 37.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTCCCACTGTCTGTACCTTCC	0.418																																						dbGAP											0													125.0	122.0	123.0					2																	179595307		1939	4134	6073	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.17002G>A	2.37:g.179595307C>T	ENSP00000465570:p.Asp5668Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D4741N	ENST00000591111.1	37	c.14221		2	.	.	.	.	.	.	.	.	.	.	C	15.59	2.879788	0.51801	.	.	ENSG00000155657	ENST00000342992	T	0.80994	-1.44	5.99	5.99	0.97316	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.92912	0.7745	M	0.93678	3.445	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.93710	0.7023	9	0.87932	D	0	.	20.4777	0.99188	0.0:1.0:0.0:0.0	.	5668	Q8WZ42	TITIN_HUMAN	N	4741	ENSP00000343764:D4741N	ENSP00000343764:D4741N	D	-	1	0	TTN	179303552	1.000000	0.71417	0.983000	0.44433	0.648000	0.38561	7.818000	0.86416	2.840000	0.97914	0.655000	0.94253	GAC	TTN	-	pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000155657		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	41	0.00	0	C	NM_133378		179595307	179595307	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	51	31.08	23	SNP	1.000	T
UGGT2	55757	genome.wustl.edu	37	13	96506701	96506701	+	Missense_Mutation	SNP	C	C	T			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr13:96506701C>T	ENST00000376747.3	-	35	4107	c.4037G>A	c.(4036-4038)cGa>cAa	p.R1346Q		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1346	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						ATCGAAATCTCGAAGTTCTTT	0.368																																						dbGAP											0													66.0	62.0	64.0					13																	96506701		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.4037G>A	13.37:g.96506701C>T	ENSP00000365938:p.Arg1346Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.R1346Q	ENST00000376747.3	37	c.4037	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	C	31	5.087143	0.94100	.	.	ENSG00000102595	ENST00000376747	T	0.41400	1.0	5.58	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.45135	0.1327	L	0.50333	1.59	0.80722	D	1	P	0.47910	0.902	P	0.48552	0.581	T	0.26395	-1.0104	10	0.17832	T	0.49	-9.9164	15.6532	0.77112	0.1384:0.8616:0.0:0.0	.	1346	Q9NYU1	UGGG2_HUMAN	Q	1346	ENSP00000365938:R1346Q	ENSP00000365938:R1346Q	R	-	2	0	UGGT2	95304702	1.000000	0.71417	0.865000	0.33974	0.974000	0.67602	7.487000	0.81328	1.310000	0.45006	0.591000	0.81541	CGA	UGGT2	-	pfam_Glyco_trans_8	ENSG00000102595		0.368	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	36	0.00	0	C	NM_020121		96506701	96506701	-1	no_errors	ENST00000376747	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	T
CCDC144A	9720	genome.wustl.edu	37	17	16707369	16707369	+	3'UTR	SNP	C	C	T	rs142134057		TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr17:16707369C>T	ENST00000443444.2	+	0	8514				RP11-219A15.2_ENST00000582895.1_lincRNA|RP11-219A15.4_ENST00000602730.1_RNA|RP11-219A15.1_ENST00000448331.3_3'UTR|USP32P1_ENST00000393005.2_RNA			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		ATTTTCAGTACATAAAATCTG	0.299																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.*4090C>T	17.37:g.16707369C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60311|Q6ZU57	RNA	SNP	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			USP32P1	-	-	ENSG00000188933		0.299	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	HGNC	protein_coding		30	0.00	0	C			16707369	16707369	+1	no_errors	ENST00000341745	ensembl	human	known	69_37n	rna	28	50.88	29	SNP	0.750	T
UXT	8409	genome.wustl.edu	37	X	47518369	47518369	+	Intron	SNP	C	C	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chrX:47518369C>A	ENST00000333119.3	-	2	47				UXT_ENST00000460840.1_5'Flank|RP1-212G6.7_ENST00000590504.1_RNA|RP1-212G6.7_ENST00000591832.1_RNA|UXT_ENST00000335890.2_5'UTR	NM_004182.3	NP_004173.1	Q9UBK9	UXT_HUMAN	ubiquitously-expressed, prefoldin-like chaperone						centrosome organization (GO:0051297)|microtubule cytoskeleton organization (GO:0000226)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein folding (GO:0006457)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)|prefoldin complex (GO:0016272)	beta-tubulin binding (GO:0048487)|chromatin binding (GO:0003682)|microtubule binding (GO:0008017)|RNA polymerase II transcription corepressor activity (GO:0001106)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(1)	6						CCATGTTGACCGATCCAGTTT	0.637																																						dbGAP											0													64.0	49.0	54.0					X																	47518369		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF092737	CCDS14284.1, CCDS14285.1	Xp11.23-p11.22	2011-11-21	2011-11-21		ENSG00000126756	ENSG00000126756			12641	protein-coding gene	gene with protein product	"""androgen receptor trapped clone 27"", ""SKP2-associated alpha PFD 1"""	300234	"""ubiquitously-expressed transcript"""			10087202, 16221885	Standard	NM_004182		Approved	ART-27, STAP1	uc004dim.3	Q9UBK9	OTTHUMG00000021453	ENST00000333119.3:c.9-34G>T	X.37:g.47518369C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R561|Q5JZG3|Q9Y6E5	RNA	SNP	-	NULL	ENST00000333119.3	37	NULL	CCDS14285.1	X																																																																																			UXT	-	-	ENSG00000126756		0.637	UXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UXT	HGNC	protein_coding	OTTHUMT00000056440.1	67	0.00	0	C	NM_153477		47518369	47518369	-1	no_errors	ENST00000485641	ensembl	human	known	69_37n	rna	110	21.43	30	SNP	0.011	A
VPS52	6293	genome.wustl.edu	37	6	33236395	33236395	+	Missense_Mutation	SNP	T	T	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr6:33236395T>C	ENST00000445902.2	-	7	798	c.580A>G	c.(580-582)Agg>Ggg	p.R194G	VPS52_ENST00000478934.1_5'UTR|VPS52_ENST00000436044.2_Missense_Mutation_p.R69G|VPS52_ENST00000482399.1_3'UTR	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	194					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TCCAAGAACCTGGGCTCTGTC	0.592																																						dbGAP											0													56.0	54.0	54.0					6																	33236395		1509	2708	4217	-	-	-	SO:0001583	missense	0			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.580A>G	6.37:g.33236395T>C	ENSP00000409952:p.Arg194Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	pfam_Vps52,pfam_Exocyst_Exoc1	p.R194G	ENST00000445902.2	37	c.580	CCDS4770.2	6	.	.	.	.	.	.	.	.	.	.	T	12.74	2.028750	0.35797	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	5.1	0.999	0.19862	.	0.282262	0.40064	N	0.001189	T	0.07954	0.0199	N	0.04203	-0.255	0.28446	N	0.916586	B;B;B	0.17852	0.001;0.024;0.001	B;B;B	0.21708	0.001;0.036;0.001	T	0.35871	-0.9771	9	0.27082	T	0.32	-7.1547	12.2569	0.54629	0.0:0.0:0.6092:0.3908	.	172;69;194	B4DS44;B3KMF7;Q8N1B4	.;.;VPS52_HUMAN	G	194;172;69	.	ENSP00000414785:R172G	R	-	1	2	VPS52	33344373	0.997000	0.39634	0.999000	0.59377	0.930000	0.56654	0.663000	0.25053	0.452000	0.26830	0.467000	0.42956	AGG	VPS52	-	pfam_Vps52,pfam_Exocyst_Exoc1	ENSG00000223501		0.592	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS52	HGNC	protein_coding	OTTHUMT00000076598.2	18	0.00	0	T	NM_022553		33236395	33236395	-1	no_errors	ENST00000445902	ensembl	human	known	69_37n	missense	20	62.96	34	SNP	0.953	C
ZNF44	51710	genome.wustl.edu	37	19	12383720	12383720	+	Silent	SNP	T	T	C			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr19:12383720T>C	ENST00000356109.5	-	5	1612	c.1494A>G	c.(1492-1494)aaA>aaG	p.K498K	ZNF44_ENST00000355684.5_Silent_p.K450K	NM_001164276.1	NP_001157748.1	P15621	ZNF44_HUMAN	zinc finger protein 44	498					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			ovary(1)	1		Renal(1328;0.157)		GBM - Glioblastoma multiforme(1328;0.0164)|Lung(535;0.179)		CACATTTACATTTATAGGGTT	0.403																																						dbGAP											0													47.0	52.0	50.0					19																	12383720		2165	4289	6454	-	-	-	SO:0001819	synonymous_variant	0			X52338	CCDS45988.1, CCDS54223.1	19p13.2	2013-01-08	2006-05-11		ENSG00000197857	ENSG00000197857		"""Zinc fingers, C2H2-type"", ""-"""	13110	protein-coding gene	gene with protein product		194542	"""zinc finger protein 58"", ""zinc finger protein 44 (KOX 7)"", ""zinc finger protein 55"""	ZNF58, ZNF55		1946370, 1505991	Standard	NM_016264		Approved	KOX7, ZNF504	uc010xmj.2	P15621	OTTHUMG00000156424	ENST00000356109.5:c.1494A>G	19.37:g.12383720T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DML9|B9EGJ5|B9ZVM2|P17018|Q9ULZ7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K498	ENST00000356109.5	37	c.1494	CCDS54223.1	19																																																																																			ZNF44	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197857		0.403	ZNF44-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	ZNF44	HGNC	protein_coding	OTTHUMT00000344132.1	29	0.00	0	T	NM_016264		12383720	12383720	-1	no_errors	ENST00000393337	ensembl	human	known	69_37n	silent	58	28.40	23	SNP	0.259	C
ZNF521	25925	genome.wustl.edu	37	18	22806796	22806796	+	Silent	SNP	G	G	A			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr18:22806796G>A	ENST00000361524.3	-	4	1234	c.1086C>T	c.(1084-1086)aaC>aaT	p.N362N	ZNF521_ENST00000538137.2_Silent_p.N362N|ZNF521_ENST00000579111.1_5'Flank|ZNF521_ENST00000584787.1_Silent_p.N142N	NM_015461.2	NP_056276.1	Q96K83	ZN521_HUMAN	zinc finger protein 521	362					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)			NS(1)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(21)|lung(97)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	149	all_cancers(21;0.0025)|all_epithelial(16;3.62e-05)|Ovarian(20;0.0991)					CCACTGAGAGGTTGGAATCTG	0.577			T	PAX5	ALL																																	dbGAP		Dom	yes		18	18q11.2	25925	zinc finger protein 521		L	0													77.0	74.0	75.0					18																	22806796		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027354	CCDS32806.1	18q11.2	2013-01-08				ENSG00000198795		"""Zinc fingers, C2H2-type"""	24605	protein-coding gene	gene with protein product	"""early hematopoietic zinc finger"""	610974				11984006, 14630787	Standard	NM_015461		Approved	EHZF, Evi3	uc002kvk.2	Q96K83		ENST00000361524.3:c.1086C>T	18.37:g.22806796G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A3QVP7|B0YJB7|Q8IXI0|Q8TES6|Q9C065|Q9HAL5|Q9UFK4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.N362	ENST00000361524.3	37	c.1086	CCDS32806.1	18																																																																																			ZNF521	-	NULL	ENSG00000198795		0.577	ZNF521-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	ZNF521	HGNC	protein_coding	OTTHUMT00000446781.2	34	0.00	0	G	NM_015461		22806796	22806796	-1	no_errors	ENST00000361524	ensembl	human	known	69_37n	silent	26	44.68	21	SNP	1.000	A
ZNF91	7644	genome.wustl.edu	37	19	23543146	23543146	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr19:23543146C>G	ENST00000300619.7	-	4	2840	c.2635G>C	c.(2635-2637)Gag>Cag	p.E879Q	ZNF91_ENST00000397082.2_Missense_Mutation_p.E847Q|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	879					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GAAGGTTTCTCTTTAGTATGA	0.348																																						dbGAP											0													71.0	78.0	76.0					19																	23543146		2164	4282	6446	-	-	-	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2635G>C	19.37:g.23543146C>G	ENSP00000300619:p.Glu879Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E879Q	ENST00000300619.7	37	c.2635	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	C	13.32	2.200576	0.38905	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.20200	2.09;3.23	1.41	1.41	0.22369	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.42381	0.1200	M	0.79258	2.445	0.25811	N	0.984399	P;D	0.76494	0.927;0.999	B;D	0.66602	0.417;0.945	T	0.16512	-1.0400	9	0.72032	D	0.01	.	9.7	0.40180	0.0:1.0:0.0:0.0	.	847;879	Q05481-2;Q05481	.;ZNF91_HUMAN	Q	879;847	ENSP00000300619:E879Q;ENSP00000380272:E847Q	ENSP00000300619:E879Q	E	-	1	0	ZNF91	23334986	0.238000	0.23825	0.001000	0.08648	0.001000	0.01503	2.735000	0.47377	0.726000	0.32339	0.313000	0.20887	GAG	ZNF91	-	pfscan_Znf_C2H2	ENSG00000167232		0.348	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	13	0.00	0	C	NM_003430		23543146	23543146	-1	no_errors	ENST00000300619	ensembl	human	known	69_37n	missense	38	40.62	26	SNP	1.000	G
ZNF91	7644	genome.wustl.edu	37	19	23543480	23543480	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr19:23543480C>G	ENST00000300619.7	-	4	2506	c.2301G>C	c.(2299-2301)gaG>gaC	p.E767D	ZNF91_ENST00000397082.2_Missense_Mutation_p.E735D|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	767					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGAAGGGTTTCTCTCTAGTAT	0.373																																						dbGAP											0													58.0	64.0	62.0					19																	23543480		2167	4274	6441	-	-	-	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2301G>C	19.37:g.23543480C>G	ENSP00000300619:p.Glu767Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E767D	ENST00000300619.7	37	c.2301	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	C	9.670	1.146403	0.21288	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.26810	1.71;1.71	1.71	-1.61	0.08399	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.15478	0.0373	N	0.03194	-0.395	0.25792	N	0.984605	B;P	0.42961	0.291;0.795	B;P	0.51101	0.082;0.659	T	0.19582	-1.0301	9	0.56958	D	0.05	.	5.0237	0.14374	0.0:0.6409:0.2119:0.1471	.	735;767	Q05481-2;Q05481	.;ZNF91_HUMAN	D	767;735	ENSP00000300619:E767D;ENSP00000380272:E735D	ENSP00000300619:E767D	E	-	3	2	ZNF91	23335320	0.816000	0.29132	0.002000	0.10522	0.024000	0.10985	0.307000	0.19296	-0.511000	0.06514	0.205000	0.17691	GAG	ZNF91	-	pfscan_Znf_C2H2	ENSG00000167232		0.373	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	36	0.00	0	C	NM_003430		23543480	23543480	-1	no_errors	ENST00000300619	ensembl	human	known	69_37n	missense	51	37.80	31	SNP	1.000	G
ZNF91	7644	genome.wustl.edu	37	19	23543820	23543820	+	Missense_Mutation	SNP	C	C	G			TCGA-EW-A423-01A-11D-A243-09	TCGA-EW-A423-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0077cf20-d598-4e04-863c-534e3386580e	5c24d17e-b10e-4b8e-9250-f0ed71fd4e3b	g.chr19:23543820C>G	ENST00000300619.7	-	4	2166	c.1961G>C	c.(1960-1962)gGa>gCa	p.G654A	ZNF91_ENST00000397082.2_Missense_Mutation_p.G622A|ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	654					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				GGGTTTCTCTCCAGTATGAAT	0.383																																						dbGAP											0													50.0	53.0	52.0					19																	23543820		2085	4225	6310	-	-	-	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.1961G>C	19.37:g.23543820C>G	ENSP00000300619:p.Gly654Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G654A	ENST00000300619.7	37	c.1961	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172875	0.38413	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.01505	4.82;4.82	1.71	0.572	0.17357	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04861	0.0131	L	0.52905	1.665	0.28784	N	0.899676	D;D	0.76494	0.999;0.987	P;P	0.61477	0.889;0.726	T	0.31364	-0.9946	9	0.59425	D	0.04	.	5.4936	0.16789	0.0:0.66:0.0:0.34	.	622;654	Q05481-2;Q05481	.;ZNF91_HUMAN	A	654;622	ENSP00000300619:G654A;ENSP00000380272:G622A	ENSP00000300619:G654A	G	-	2	0	ZNF91	23335660	0.010000	0.17322	0.000000	0.03702	0.005000	0.04900	2.028000	0.41088	0.039000	0.15632	0.205000	0.17691	GGA	ZNF91	-	pfscan_Znf_C2H2	ENSG00000167232		0.383	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	14	0.00	0	C	NM_003430		23543820	23543820	-1	no_errors	ENST00000300619	ensembl	human	known	69_37n	missense	39	45.07	32	SNP	0.996	G
