#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABHD10	55347	genome.wustl.edu	37	3	111700647	111700647	+	Silent	SNP	G	G	A	rs201136439		TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr3:111700647G>A	ENST00000273359.3	+	2	186	c.159G>A	c.(157-159)acG>acA	p.T53T	ABHD10_ENST00000534857.1_Intron|ABHD10_ENST00000494817.1_Silent_p.T53T	NM_018394.2	NP_060864.1	Q9NUJ1	ABHDA_HUMAN	abhydrolase domain containing 10	53					glucuronoside catabolic process (GO:0019391)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			large_intestine(2)|lung(7)|skin(1)	10						GACAAAAGACGTCACTCTCAT	0.353													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20685	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													130.0	130.0	130.0					3																	111700647		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL713726	CCDS2963.1, CCDS63718.1	3q13.2	2012-03-26			ENSG00000144827	ENSG00000144827		"""Abhydrolase domain containing"""	25656	protein-coding gene	gene with protein product						22294686	Standard	NM_018394		Approved	FLJ11342	uc003dyk.5	Q9NUJ1	OTTHUMG00000159280	ENST00000273359.3:c.159G>A	3.37:g.111700647G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6A8|C9IZX5|D3DN63|Q8TCF9	Silent	SNP	pfam_AB_hydrolase_1,pfam_Peptidase_S9	p.T53	ENST00000273359.3	37	c.159	CCDS2963.1	3																																																																																			ABHD10	-	NULL	ENSG00000144827		0.353	ABHD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD10	HGNC	protein_coding	OTTHUMT00000354326.1	66	0.00	0	G	NM_018394		111700647	111700647	+1	no_errors	ENST00000273359	ensembl	human	known	69_37n	silent	54	15.62	10	SNP	0.998	A
ACADSB	36	genome.wustl.edu	37	10	124800027	124800027	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr10:124800027T>C	ENST00000358776.4	+	4	363	c.349T>C	c.(349-351)Tca>Cca	p.S117P	ACADSB_ENST00000368869.4_Missense_Mutation_p.S15P|ACADSB_ENST00000496730.2_3'UTR	NM_001609.3	NP_001600.1	P45954	ACDSB_HUMAN	acyl-CoA dehydrogenase, short/branched chain	117					branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid metabolic process (GO:0006631)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	17		all_neural(114;0.0765)|Colorectal(57;0.102)|all_lung(145;0.11)|Lung NSC(174;0.163)		Colorectal(40;0.0811)|COAD - Colon adenocarcinoma(40;0.0835)	L-Isoleucine(DB00167)|Valproic Acid(DB00313)	CACAGGAGCTTCATTTTTATC	0.373																																						dbGAP											0													110.0	109.0	109.0					10																	124800027		2203	4300	6503	-	-	-	SO:0001583	missense	0			U12778	CCDS7634.1	10q25-q26	2014-09-17	2010-04-30		ENSG00000196177	ENSG00000196177	1.3.99.-		91	protein-coding gene	gene with protein product		600301	"""acyl-Coenzyme A dehydrogenase, short/branched chain"""			7698750, 7759115	Standard	NM_001609		Approved	SBCAD, ACAD7	uc001lhb.3	P45954	OTTHUMG00000019200	ENST00000358776.4:c.349T>C	10.37:g.124800027T>C	ENSP00000357873:p.Ser117Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ51|Q5SQN6|Q96CX7	Missense_Mutation	SNP	pfam_Acyl-CoA_Oxase/DH_1,pfam_Acyl-CoA_DH_N,pfam_Acyl-CoA_DH_2_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C	p.S117P	ENST00000358776.4	37	c.349	CCDS7634.1	10	.	.	.	.	.	.	.	.	.	.	T	15.76	2.928426	0.52759	.	.	ENSG00000196177	ENST00000368869;ENST00000358776	D;D	0.99060	-5.38;-5.38	5.68	5.68	0.88126	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA dehydrogenase, N-terminal (1);Acyl-CoA dehydrogenase/oxidase, N-terminal (1);	0.132560	0.53938	D	0.000059	D	0.99396	0.9787	M	0.91038	3.17	0.58432	D	0.999998	D	0.69078	0.997	D	0.70016	0.967	D	0.98671	1.0688	10	0.87932	D	0	.	15.9199	0.79556	0.0:0.0:0.0:1.0	.	117	P45954	ACDSB_HUMAN	P	15;117	ENSP00000357862:S15P;ENSP00000357873:S117P	ENSP00000357873:S117P	S	+	1	0	ACADSB	124790017	1.000000	0.71417	0.936000	0.37596	0.251000	0.25915	2.022000	0.41030	2.161000	0.67846	0.533000	0.62120	TCA	ACADSB	-	pfam_Acyl-CoA_DH_N,superfamily_AcylCoA_DH/oxidase	ENSG00000196177		0.373	ACADSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACADSB	HGNC	protein_coding	OTTHUMT00000050843.1	56	0.00	0	T	NM_001609		124800027	124800027	+1	no_errors	ENST00000358776	ensembl	human	known	69_37n	missense	70	18.60	16	SNP	1.000	C
ADAMTS6	11174	genome.wustl.edu	37	5	64521997	64521997	+	IGR	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr5:64521997G>A								ADAMTS6 (27405 upstream) : ADAMTS6 (71037 downstream)																							GTTCAGTGTAGAAATTATAAC	0.443																																						dbGAP											0													104.0	97.0	100.0					5																	64521997		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0																															5.37:g.64521997G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.F661		37	c.1983		5																																																																																			ADAMTS6	-	NULL	ENSG00000049192	0	0.443					ADAMTS6	HGNC			58	0.00	0	G			64521997	64521997	-1	no_errors	ENST00000381055	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	1.000	A
ANKAR	150709	genome.wustl.edu	37	2	190602503	190602503	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr2:190602503T>C	ENST00000520309.1	+	18	3606	c.3518T>C	c.(3517-3519)aTa>aCa	p.I1173T	ANKAR_ENST00000438402.2_3'UTR|ANKAR_ENST00000313581.4_Missense_Mutation_p.I1173T|ANKAR_ENST00000281412.6_3'UTR|ANKAR_ENST00000431575.2_Missense_Mutation_p.I1102T	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1173						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			ATAATGACCATATCTATTTTT	0.308																																						dbGAP											0													65.0	64.0	64.0					2																	190602503		2203	4297	6500	-	-	-	SO:0001583	missense	0			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.3518T>C	2.37:g.190602503T>C	ENSP00000427882:p.Ile1173Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Armadillo,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Armadillo	p.I1173T	ENST00000520309.1	37	c.3518	CCDS33351.2	2	.	.	.	.	.	.	.	.	.	.	T	10.60	1.395216	0.25205	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000431575;ENST00000374838	T;T;T	0.03982	3.74;3.74;3.74	5.92	5.92	0.95590	.	0.999665	0.08091	N	0.999320	T	0.08313	0.0207	L	0.43152	1.355	0.45261	D	0.998267	B	0.18461	0.028	B	0.14023	0.01	T	0.26326	-1.0106	10	0.62326	D	0.03	-5.4911	15.3318	0.74219	0.0:0.0:0.0:1.0	.	249	E9PHS9	.	T	1173;1173;1102;249	ENSP00000427882:I1173T;ENSP00000313513:I1173T;ENSP00000393043:I1102T	ENSP00000313513:I1173T	I	+	2	0	ANKAR	190310748	0.466000	0.25823	0.669000	0.29828	0.696000	0.40369	3.951000	0.56684	2.266000	0.75297	0.528000	0.53228	ATA	ANKAR	-	superfamily_ARM-type_fold	ENSG00000151687		0.308	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKAR	HGNC	protein_coding	OTTHUMT00000335045.3	44	0.00	0	T	NM_144708		190602503	190602503	+1	no_errors	ENST00000313581	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.370	C
ARRDC4	91947	genome.wustl.edu	37	15	98513169	98513169	+	Missense_Mutation	SNP	C	C	G	rs61741967	byFrequency	TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr15:98513169C>G	ENST00000268042.6	+	6	1103	c.939C>G	c.(937-939)atC>atG	p.I313M	ARRDC4_ENST00000538249.1_Missense_Mutation_p.I226M	NM_183376.2	NP_899232.2	Q8NCT1	ARRD4_HUMAN	arrestin domain containing 4	313					positive regulation of ubiquitin-protein transferase activity (GO:0051443)	endosome (GO:0005768)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(9)|skin(3)	16	Melanoma(26;0.00539)|Lung NSC(78;0.0125)|all_lung(78;0.0222)		OV - Ovarian serous cystadenocarcinoma(32;0.0417)			CATTAGTGATCGGTACAATTC	0.403																																						dbGAP											0													82.0	86.0	85.0					15																	98513169		2197	4298	6495	-	-	-	SO:0001583	missense	0			BC028704	CCDS10377.1	15q26.2	2005-08-16			ENSG00000140450	ENSG00000140450			28087	protein-coding gene	gene with protein product						12477932	Standard	NM_183376		Approved	FLJ36045	uc010bom.3	Q8NCT1	OTTHUMG00000149849	ENST00000268042.6:c.939C>G	15.37:g.98513169C>G	ENSP00000268042:p.Ile313Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSI9	Missense_Mutation	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.I313M	ENST00000268042.6	37	c.939	CCDS10377.1	15	.	.	.	.	.	.	.	.	.	.	c	15.90	2.970792	0.53614	.	.	ENSG00000140450	ENST00000538249;ENST00000268042	T;T	0.25749	1.78;1.78	4.87	-2.89	0.05665	Immunoglobulin E-set (1);Arrestin-like, C-terminal (1);	0.075330	0.56097	D	0.000033	T	0.42921	0.1224	M	0.72353	2.195	0.48762	D	0.999703	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.28299	-1.0048	10	0.56958	D	0.05	-18.4473	11.0026	0.47616	0.0:0.4072:0.0:0.5928	.	313;226	Q8NCT1;F5H824	ARRD4_HUMAN;.	M	226;313	ENSP00000443774:I226M;ENSP00000268042:I313M	ENSP00000268042:I313M	I	+	3	3	ARRDC4	96314173	0.978000	0.34361	0.968000	0.41197	0.979000	0.70002	0.113000	0.15499	-0.678000	0.05224	-1.068000	0.02270	ATC	ARRDC4	-	pfam_Arrestin_C-like,superfamily_Ig_E-set	ENSG00000140450		0.403	ARRDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARRDC4	HGNC	protein_coding	OTTHUMT00000313535.1	81	0.00	0	C	NM_183376		98513169	98513169	+1	no_errors	ENST00000268042	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	0.990	G
ASNSD1	54529	genome.wustl.edu	37	2	190531309	190531309	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr2:190531309G>T	ENST00000260952.4	+	4	864	c.451G>T	c.(451-453)Ggc>Tgc	p.G151C	ASNSD1_ENST00000607062.1_Intron	NM_019048.2	NP_061921	Q9NWL6	ASND1_HUMAN	asparagine synthetase domain containing 1	151	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				asparagine biosynthetic process (GO:0006529)|glutamine metabolic process (GO:0006541)		asparagine synthase (glutamine-hydrolyzing) activity (GO:0004066)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(3)	25			OV - Ovarian serous cystadenocarcinoma(117;0.00318)|Epithelial(96;0.0449)|all cancers(119;0.118)			TAGTAATTTGGGCAAGAGTTT	0.398																																						dbGAP											0													103.0	106.0	105.0					2																	190531309		2190	4253	6443	-	-	-	SO:0001583	missense	0			AY116969	CCDS2300.1	2q32.2	2012-09-20			ENSG00000138381	ENSG00000138381			24910	protein-coding gene	gene with protein product							Standard	NM_019048		Approved	NS3TP1, FLJ20752, NBLA00058	uc002uqt.3	Q9NWL6	OTTHUMG00000132665	ENST00000260952.4:c.451G>T	2.37:g.190531309G>T	ENSP00000260952:p.Gly151Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPH6|Q3LIC3|Q4ZG45	Missense_Mutation	SNP	pfam_Asn_synthase	p.G151C	ENST00000260952.4	37	c.451	CCDS2300.1	2	.	.	.	.	.	.	.	.	.	.	G	13.14	2.148330	0.37923	.	.	ENSG00000138381	ENST00000260952;ENST00000420250	T;T	0.34859	1.34;1.35	5.77	3.04	0.35103	Glutamine amidotransferase, type II (1);	0.770472	0.13393	N	0.391236	T	0.38719	0.1051	L	0.59436	1.845	0.09310	N	1	P	0.44195	0.828	P	0.46543	0.52	T	0.21484	-1.0244	10	0.56958	D	0.05	13.6472	6.1408	0.20259	0.3332:0.1208:0.546:0.0	.	151	Q9NWL6	ASND1_HUMAN	C	151	ENSP00000260952:G151C;ENSP00000406790:G151C	ENSP00000260952:G151C	G	+	1	0	ASNSD1	190239554	0.510000	0.26171	0.034000	0.17996	0.903000	0.53119	2.374000	0.44274	0.471000	0.27319	-0.137000	0.14449	GGC	ASNSD1	-	NULL	ENSG00000138381		0.398	ASNSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASNSD1	HGNC	protein_coding	OTTHUMT00000255919.3	46	0.00	0	G	NM_019048		190531309	190531309	+1	no_errors	ENST00000260952	ensembl	human	known	69_37n	missense	49	19.67	12	SNP	0.000	T
ASPM	259266	genome.wustl.edu	37	1	197112485	197112485	+	Silent	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:197112485G>T	ENST00000367409.4	-	3	1153	c.897C>A	c.(895-897)acC>acA	p.T299T	ASPM_ENST00000294732.7_Silent_p.T299T	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	299					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AACAGTTGGGGGTAAGACTAA	0.318																																						dbGAP											0													77.0	78.0	78.0					1																	197112485		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.897C>A	1.37:g.197112485G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Silent	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.T299	ENST00000367409.4	37	c.897	CCDS1389.1	1																																																																																			ASPM	-	NULL	ENSG00000066279		0.318	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	47	0.00	0	G	NM_018136		197112485	197112485	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	silent	28	34.88	15	SNP	0.085	T
BBS9	27241	genome.wustl.edu	37	7	33407469	33407469	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr7:33407469C>A	ENST00000242067.6	+	17	2305	c.1784C>A	c.(1783-1785)aCt>aAt	p.T595N	BBS9_ENST00000350941.3_Missense_Mutation_p.T555N|BBS9_ENST00000355070.2_Missense_Mutation_p.T590N|BBS9_ENST00000354265.4_Missense_Mutation_p.T560N|BBS9_ENST00000396127.2_Missense_Mutation_p.T560N	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	595					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			GCTTCCAAAACTTCTCGTAAG	0.368									Bardet-Biedl syndrome																													dbGAP											0													165.0	151.0	156.0					7																	33407469		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1784C>A	7.37:g.33407469C>A	ENSP00000242067:p.Thr595Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.T595N	ENST00000242067.6	37	c.1784	CCDS43566.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.98|16.98	3.272491|3.272491	0.59649|0.59649	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000434373|ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132	.|T;T;T;T;T	.|0.12465	.|2.68;2.68;2.68;2.68;2.68	5.48|5.48	5.48|5.48	0.80851|0.80851	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.29190|0.29190	0.0726|0.0726	L|L	0.42581|0.42581	1.335|1.335	0.80722|0.80722	D|D	1|1	.|P;P;P;P;D	.|0.76494	.|0.702;0.702;0.702;0.702;0.999	.|B;B;B;B;D	.|0.74023	.|0.327;0.327;0.327;0.327;0.982	T|T	0.01679|0.01679	-1.1297|-1.1297	5|10	.|0.15952	.|T	.|0.53	-13.8047|-13.8047	18.9484|18.9484	0.92630|0.92630	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|595;555;590;560;595	.|Q3SYG4-3;Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4	.|.;.;.;.;PTHB1_HUMAN	K|N	161|595;555;560;590;560;595	.|ENSP00000242067:T595N;ENSP00000313122:T555N;ENSP00000379433:T560N;ENSP00000347182:T590N;ENSP00000346214:T560N	.|ENSP00000242067:T595N	N|T	+|+	3|2	2|0	BBS9|BBS9	33373994|33373994	0.999000|0.999000	0.42202|0.42202	0.996000|0.996000	0.52242|0.52242	0.998000|0.998000	0.95712|0.95712	3.823000|3.823000	0.55715|0.55715	2.572000|2.572000	0.86782|0.86782	0.655000|0.655000	0.94253|0.94253	AAC|ACT	BBS9	-	NULL	ENSG00000122507		0.368	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	HGNC	protein_coding	OTTHUMT00000329064.1	113	0.00	0	C			33407469	33407469	+1	no_errors	ENST00000242067	ensembl	human	known	69_37n	missense	118	12.59	17	SNP	1.000	A
BDP1	55814	genome.wustl.edu	37	5	70858139	70858139	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr5:70858139G>C	ENST00000358731.4	+	38	7798	c.7535G>C	c.(7534-7536)tGc>tCc	p.C2512S	BDP1_ENST00000380675.2_3'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	2512					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TCTTTAATATGCTCAAAGAAT	0.338																																						dbGAP											0													71.0	67.0	69.0					5																	70858139		1807	4063	5870	-	-	-	SO:0001583	missense	0			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.7535G>C	5.37:g.70858139G>C	ENSP00000351575:p.Cys2512Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.C2512S	ENST00000358731.4	37	c.7535	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	G	19.52	3.842885	0.71488	.	.	ENSG00000145734	ENST00000358731;ENST00000451951	T	0.21031	2.03	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000014	T	0.46151	0.1378	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.34428	-0.9829	10	0.87932	D	0	.	15.6992	0.77528	0.0:0.0:1.0:0.0	.	2512	A6H8Y1	BDP1_HUMAN	S	2512;2060	ENSP00000351575:C2512S	ENSP00000351575:C2512S	C	+	2	0	BDP1	70893895	1.000000	0.71417	1.000000	0.80357	0.742000	0.42306	5.172000	0.65003	2.775000	0.95449	0.650000	0.86243	TGC	BDP1	-	NULL	ENSG00000145734		0.338	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	58	0.00	0	G	NM_018429		70858139	70858139	+1	no_errors	ENST00000358731	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	1.000	C
C1orf50	79078	genome.wustl.edu	37	1	43240518	43240518	+	Nonsense_Mutation	SNP	T	T	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:43240518T>G	ENST00000372525.5	+	4	436	c.393T>G	c.(391-393)taT>taG	p.Y131*	C1orf50_ENST00000536543.1_De_novo_Start_InFrame|C1orf50_ENST00000468913.2_3'UTR|RP5-994D16.9_ENST00000447572.1_RNA	NM_024097.3	NP_077002.2	Q9BV19	CA050_HUMAN	chromosome 1 open reading frame 50	131										large_intestine(2)|ovary(1)|pancreas(1)	4	Ovarian(52;0.00744)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				GTCAGCAGTATTTTTCCATCA	0.383																																						dbGAP											0													107.0	108.0	108.0					1																	43240518		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC001711	CCDS473.1	1p34.2	2012-06-25			ENSG00000164008	ENSG00000164008			28795	protein-coding gene	gene with protein product						12477932	Standard	NM_024097		Approved	MGC955	uc001cia.4	Q9BV19	OTTHUMG00000007568	ENST00000372525.5:c.393T>G	1.37:g.43240518T>G	ENSP00000361603:p.Tyr131*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_DUF2452,superfamily_Cytidine_deaminase-like	p.Y131*	ENST00000372525.5	37	c.393	CCDS473.1	1	.	.	.	.	.	.	.	.	.	.	T	20.3	3.969362	0.74246	.	.	ENSG00000164008	ENST00000372525	.	.	.	6.17	-0.704	0.11256	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.46356	D	0.999003	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.0578	0.19820	0.0:0.3847:0.1387:0.4766	.	.	.	.	X	131	.	ENSP00000361603:Y131X	Y	+	3	2	C1orf50	43013105	1.000000	0.71417	0.993000	0.49108	0.988000	0.76386	0.796000	0.26986	-0.066000	0.12998	0.533000	0.62120	TAT	C1orf50	-	pfam_DUF2452	ENSG00000164008		0.383	C1orf50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf50	HGNC	protein_coding	OTTHUMT00000020001.2	52	0.00	0	T	NM_024097		43240518	43240518	+1	no_errors	ENST00000372525	ensembl	human	known	69_37n	nonsense	43	12.24	6	SNP	0.999	G
DRICH1	51233	genome.wustl.edu	37	22	23959793	23959793	+	Missense_Mutation	SNP	T	T	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr22:23959793T>A	ENST00000317749.5	-	7	785	c.488A>T	c.(487-489)gAt>gTt	p.D163V		NM_016449.3	NP_057533.2	Q6PGQ1	DRIC1_HUMAN		163	Asp-rich.									endometrium(1)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)	11						atcacagtcatcatcttcaCT	0.438																																						dbGAP											0													118.0	114.0	115.0					22																	23959793		1995	4199	6194	-	-	-	SO:0001583	missense	0																														ENST00000317749.5:c.488A>T	22.37:g.23959793T>A	ENSP00000316137:p.Asp163Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICJ8|Q6P4I3|Q9NU31	Missense_Mutation	SNP	NULL	p.D163V	ENST00000317749.5	37	c.488	CCDS42985.1	22	.	.	.	.	.	.	.	.	.	.	t	3.613	-0.079242	0.07141	.	.	ENSG00000189269	ENST00000317749	T	0.40225	1.04	0.649	-0.937	0.10415	.	.	.	.	.	T	0.23611	0.0571	N	0.22421	0.69	0.09310	N	1	B	0.23854	0.092	B	0.17098	0.017	T	0.16217	-1.0410	8	0.38643	T	0.18	.	.	.	.	.	163	Q6PGQ1	CV043_HUMAN	V	163	ENSP00000316137:D163V	ENSP00000316137:D163V	D	-	2	0	C22orf43	22289793	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.930000	0.03972	-0.294000	0.08973	0.147000	0.16070	GAT	C22orf43	-	NULL	ENSG00000189269		0.438	C22orf43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf43	HGNC	protein_coding	OTTHUMT00000319708.2	84	0.00	0	T			23959793	23959793	-1	no_errors	ENST00000317749	ensembl	human	known	69_37n	missense	55	17.91	12	SNP	0.000	A
CA9	768	genome.wustl.edu	37	9	35674262	35674264	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr9:35674262_35674264delAGA	ENST00000378357.4	+	1	410_412	c.306_308delAGA	c.(304-309)tcagaa>tca	p.E105del	RN7SL22P_ENST00000471800.2_RNA	NM_001216.2	NP_001207.2	Q16790	CAH9_HUMAN	carbonic anhydrase IX	105	Proteoglycan-like (PG).				bicarbonate transport (GO:0015701)|cellular response to hypoxia (GO:0071456)|morphogenesis of an epithelium (GO:0002009)|one-carbon metabolic process (GO:0006730)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|response to drug (GO:0042493)|response to testosterone (GO:0033574)|secretion (GO:0046903)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(3)|lung(5)|ovary(4)|prostate(1)|skin(2)|urinary_tract(1)	17	all_epithelial(49;0.217)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)		Benzthiazide(DB00562)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Zonisamide(DB00909)	AGCCTAAATCAGAAGAAGAGGGC	0.512																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			X66839	CCDS6585.1	9p13.3	2012-08-21			ENSG00000107159	ENSG00000107159		"""Carbonic anhydrases"""	1383	protein-coding gene	gene with protein product	"""carbonic dehydratase"", ""RCC-associated protein G250"""	603179				8661007, 9787087	Standard	NM_001216		Approved	MN, CAIX	uc003zxo.4	Q16790	OTTHUMG00000021029	ENST00000378357.4:c.306_308delAGA	9.37:g.35674268_35674270delAGA	ENSP00000367608:p.Glu105del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4R1	In_Frame_Del	DEL	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.E105in_frame_del	ENST00000378357.4	37	c.306_308	CCDS6585.1	9																																																																																			CA9	-	NULL	ENSG00000107159		0.512	CA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA9	HGNC	protein_coding	OTTHUMT00000055479.1	47	0.00	0	AGA	NM_001216		35674262	35674264	+1	no_errors	ENST00000378357	ensembl	human	known	69_37n	in_frame_del	35	17.78	8	DEL	0.103:0.045:0.000	-
CCDC168	643677	genome.wustl.edu	37	13	103386366	103386366	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr13:103386366G>C	ENST00000322527.2	-	1	2793	c.2794C>G	c.(2794-2796)Cct>Gct	p.P932A		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	932																	AGATAAAGAGGAGGTGCTGAC	0.403																																						dbGAP											0													84.0	68.0	72.0					13																	103386366		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.2794C>G	13.37:g.103386366G>C	ENSP00000320232:p.Pro932Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N800	Missense_Mutation	SNP	NULL	p.P932A	ENST00000322527.2	37	c.2794		13	.	.	.	.	.	.	.	.	.	.	G	0.621	-0.820928	0.02755	.	.	ENSG00000175820	ENST00000322527	T	0.03772	3.81	2.92	-3.25	0.05079	.	.	.	.	.	T	0.02012	0.0063	N	0.14661	0.345	0.09310	N	1	B	0.28713	0.22	B	0.26416	0.069	T	0.46652	-0.9176	9	0.13470	T	0.59	.	0.8636	0.01198	0.3131:0.1634:0.3586:0.1649	.	932	Q8NDH2	CC168_HUMAN	A	932	ENSP00000320232:P932A	ENSP00000320232:P932A	P	-	1	0	CCDC168	102184367	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	-1.609000	0.02066	-0.872000	0.04037	0.563000	0.77884	CCT	CCDC168	-	NULL	ENSG00000175820		0.403	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		41	0.00	0	G	NM_001146197		103386366	103386366	-1	no_errors	ENST00000322527	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.000	C
CNTNAP1	8506	genome.wustl.edu	37	17	40837256	40837256	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr17:40837256A>G	ENST00000264638.4	+	5	750	c.533A>G	c.(532-534)gAc>gGc	p.D178G	CTD-3193K9.3_ENST00000592440.1_RNA|CCR10_ENST00000591765.1_5'Flank	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	178					axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CTCTATTTCGACGGCGACGAT	0.627																																						dbGAP											0													84.0	79.0	81.0					17																	40837256		2203	4300	6503	-	-	-	SO:0001583	missense	0			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.533A>G	17.37:g.40837256A>G	ENSP00000264638:p.Asp178Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.D178G	ENST00000264638.4	37	c.533	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	A	22.6	4.305666	0.81247	.	.	ENSG00000108797	ENST00000264638	T	0.79141	-1.24	5.26	5.26	0.73747	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (1);	0.000000	0.64402	D	0.000001	T	0.79730	0.4496	M	0.73598	2.24	0.45366	D	0.99835	P	0.46220	0.874	P	0.44422	0.449	T	0.82291	-0.0530	10	0.56958	D	0.05	.	13.7351	0.62813	1.0:0.0:0.0:0.0	.	178	P78357	CNTP1_HUMAN	G	178	ENSP00000264638:D178G	ENSP00000264638:D178G	D	+	2	0	CNTNAP1	38090782	1.000000	0.71417	0.997000	0.53966	0.915000	0.54546	4.732000	0.62029	1.972000	0.57404	0.459000	0.35465	GAC	CNTNAP1	-	superfamily_ConA-like_lec_gl,pfscan_Laminin_G	ENSG00000108797		0.627	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	58	0.00	0	A	NM_003632		40837256	40837256	+1	no_errors	ENST00000264638	ensembl	human	known	69_37n	missense	41	12.50	6	SNP	1.000	G
CNTRL	11064	genome.wustl.edu	37	9	123922561	123922561	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr9:123922561G>T	ENST00000373855.1	+	32	5330	c.5070G>T	c.(5068-5070)caG>caT	p.Q1690H	CNTRL_ENST00000238341.5_Missense_Mutation_p.Q1690H|CNTRL_ENST00000373845.2_3'UTR|CNTRL_ENST00000373844.1_Missense_Mutation_p.Q135H|CNTRL_ENST00000373850.1_Missense_Mutation_p.Q1138H			Q7Z7A1	CNTRL_HUMAN	centriolin	1690					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TTTTAAGGCAGATGTCTAAAC	0.308																																						dbGAP											0													71.0	84.0	79.0					9																	123922561		2203	4289	6492	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.5070G>T	9.37:g.123922561G>T	ENSP00000362962:p.Gln1690His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.Q1690H	ENST00000373855.1	37	c.5070	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	G	17.95	3.513488	0.64522	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000439778;ENST00000373850;ENST00000373845;ENST00000373844	T;T;T	0.30182	1.54;1.54;1.54	5.62	-3.39	0.04868	.	.	.	.	.	T	0.45816	0.1361	M	0.66939	2.045	0.37746	D	0.925795	D	0.67145	0.996	P	0.61328	0.887	T	0.54357	-0.8306	9	0.72032	D	0.01	.	13.5018	0.61459	0.3605:0.0:0.6395:0.0	.	1690	Q7Z7A1	CNTRL_HUMAN	H	1690;1690;1690;446;1138;372;135	ENSP00000362962:Q1690H;ENSP00000238341:Q1690H;ENSP00000362956:Q1138H	ENSP00000238341:Q1690H	Q	+	3	2	CNTRL	122962382	0.731000	0.28111	0.886000	0.34754	0.996000	0.88848	-0.213000	0.09305	-0.951000	0.03654	0.591000	0.81541	CAG	CNTRL	-	NULL	ENSG00000119397		0.308	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	32	0.00	0	G	NM_007018		123922561	123922561	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	16	30.43	7	SNP	0.964	T
COL22A1	169044	genome.wustl.edu	37	8	139890331	139890331	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr8:139890331C>T	ENST00000303045.6	-	3	766	c.320G>A	c.(319-321)cGt>cAt	p.R107H	COL22A1_ENST00000435777.1_Missense_Mutation_p.R107H	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	107	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)		p.R107H(1)		breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			GTAGGCGAGACGCCGGGCAGC	0.721										HNSCC(7;0.00092)																												dbGAP											1	Substitution - Missense(1)	large_intestine(1)											16.0	18.0	17.0					8																	139890331		2183	4259	6442	-	-	-	SO:0001583	missense	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.320G>A	8.37:g.139890331C>T	ENSP00000303153:p.Arg107His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.R107H	ENST00000303045.6	37	c.320	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050290	0.36181	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	T;T	0.78816	-1.21;-1.21	5.28	-4.2	0.03823	von Willebrand factor, type A (3);	2.223100	0.02193	N	0.061529	T	0.63414	0.2509	L	0.38733	1.17	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.37384	-0.9708	9	.	.	.	.	2.6432	0.04977	0.1187:0.1849:0.118:0.5784	.	107	Q8NFW1	COMA1_HUMAN	H	107	ENSP00000303153:R107H;ENSP00000387655:R107H	.	R	-	2	0	COL22A1	139959513	0.999000	0.42202	0.000000	0.03702	0.184000	0.23303	1.571000	0.36450	-0.555000	0.06142	0.585000	0.79938	CGT	COL22A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000169436		0.721	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	17	0.00	0	C	XM_291257		139890331	139890331	-1	no_errors	ENST00000303045	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.031	T
CROCCP2	84809	genome.wustl.edu	37	1	16950261	16950261	+	lincRNA	SNP	G	G	C	rs11260845	byFrequency	TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:16950261G>C	ENST00000412962.1	-	0	1000							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											aggccagccagactcctactc	0.572																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16950261G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.572	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	13	0.00	0	G	NR_026752.1		16950261	16950261	-1	no_errors	ENST00000421700	ensembl	human	known	69_37n	rna	17	26.09	6	SNP	0.687	C
CRTAM	56253	genome.wustl.edu	37	11	122738263	122738263	+	Splice_Site	SNP	G	G	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr11:122738263G>C	ENST00000227348.4	+	8	1011	c.964G>C	c.(964-966)Gaa>Caa	p.E322Q	CRTAM_ENST00000533709.1_Splice_Site_p.E123Q	NM_019604.2	NP_062550.2			cytotoxic and regulatory T cell molecule											breast(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|pancreas(1)|prostate(1)	19		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.28e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0308)		ATGGAAGAAAGGTCAGTGGGC	0.458																																						dbGAP											0													81.0	72.0	75.0					11																	122738263		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			AF001622	CCDS8437.1	11q24.1	2013-01-11			ENSG00000109943	ENSG00000109943		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	24313	protein-coding gene	gene with protein product	"""class I MHC restricted T cell associated molecule"""	612597				10811014, 16300832	Standard	NM_019604		Approved	CD355	uc001pyj.3	O95727	OTTHUMG00000166026	ENST00000227348.4:c.964+1G>C	11.37:g.122738263G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.E322Q	ENST00000227348.4	37	c.964	CCDS8437.1	11	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203735	0.58234	.	.	ENSG00000109943	ENST00000227348;ENST00000533709	T;T	0.71222	-0.55;0.58	5.62	5.62	0.85841	.	0.056579	0.64402	D	0.000002	D	0.83524	0.5273	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.80764	0.994;0.994	D	0.84959	0.0876	10	0.87932	D	0	.	17.1549	0.86788	0.0:0.0:1.0:0.0	.	123;322	O95727-2;O95727	.;CRTAM_HUMAN	Q	322;123	ENSP00000227348:E322Q;ENSP00000433728:E123Q	ENSP00000227348:E322Q	E	+	1	0	CRTAM	122243473	1.000000	0.71417	0.984000	0.44739	0.145000	0.21501	6.053000	0.71089	2.643000	0.89663	0.655000	0.94253	GAA	CRTAM	-	NULL	ENSG00000109943		0.458	CRTAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRTAM	HGNC	protein_coding	OTTHUMT00000387507.1	58	0.00	0	G	NM_019604	Missense_Mutation	122738263	122738263	+1	no_errors	ENST00000227348	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	C
CUL4A	8451	genome.wustl.edu	37	13	113914970	113914970	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr13:113914970A>G	ENST00000375440.4	+	19	2165	c.2081A>G	c.(2080-2082)tAt>tGt	p.Y694C	CUL4A_ENST00000375441.3_Missense_Mutation_p.Y594C|CUL4A_ENST00000326335.4_Missense_Mutation_p.Y594C|CUL4A_ENST00000451881.1_Missense_Mutation_p.Y594C	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	694					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)				NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			GATAGACAATATCAGATTGAT	0.318																																						dbGAP											0													74.0	72.0	73.0					13																	113914970		2203	4300	6503	-	-	-	SO:0001583	missense	0			U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.2081A>G	13.37:g.113914970A>G	ENSP00000364589:p.Tyr694Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.Y694C	ENST00000375440.4	37	c.2081	CCDS41908.1	13	.	.	.	.	.	.	.	.	.	.	A	22.1	4.245922	0.80024	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.74632	-0.86;-0.86;-0.86;-0.73	5.38	5.38	0.77491	Cullin protein, neddylation domain (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.86289	0.5897	M	0.91561	3.22	0.80722	D	1	P;P	0.44877	0.845;0.845	P;P	0.53360	0.724;0.724	D	0.89235	0.3580	10	0.72032	D	0.01	-29.508	15.3802	0.74648	1.0:0.0:0.0:0.0	.	694;694	Q13619;A8MSH7	CUL4A_HUMAN;.	C	594;594;594;694	ENSP00000364590:Y594C;ENSP00000389118:Y594C;ENSP00000322132:Y594C;ENSP00000364589:Y694C	ENSP00000322132:Y594C	Y	+	2	0	CUL4A	112962971	1.000000	0.71417	0.994000	0.49952	0.993000	0.82548	8.687000	0.91255	2.028000	0.59812	0.459000	0.35465	TAT	CUL4A	-	pfam_Cullin_neddylation_domain,smart_Cullin_neddylation_domain	ENSG00000139842		0.318	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL4A	HGNC	protein_coding	OTTHUMT00000045888.3	55	0.00	0	A	NM_003589		113914970	113914970	+1	no_errors	ENST00000375440	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	G
CYP4A11	1579	genome.wustl.edu	37	1	47395875	47395875	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:47395875A>G	ENST00000310638.4	-	12	1503	c.1472T>C	c.(1471-1473)aTt>aCt	p.I491T	CYP4A11_ENST00000371904.4_Missense_Mutation_p.I492T|CYP4A11_ENST00000462347.1_Missense_Mutation_p.I393T	NM_000778.3	NP_000769.2	Q02928	CP4AB_HUMAN	cytochrome P450, family 4, subfamily A, polypeptide 11	491					arachidonic acid metabolic process (GO:0019369)|cellular lipid metabolic process (GO:0044255)|epoxygenase P450 pathway (GO:0019373)|fatty acid metabolic process (GO:0006631)|leukotriene B4 catabolic process (GO:0036101)|leukotriene metabolic process (GO:0006691)|long-chain fatty acid metabolic process (GO:0001676)|omega-hydroxylase P450 pathway (GO:0097267)|oxidation-reduction process (GO:0055114)|positive regulation of icosanoid secretion (GO:0032305)|pressure natriuresis (GO:0003095)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|xenobiotic metabolic process (GO:0006805)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	alkane 1-monooxygenase activity (GO:0018685)|arachidonic acid epoxygenase activity (GO:0008392)|arachidonic acid omega-hydroxylase activity (GO:0052869)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|leukotriene-B4 20-monooxygenase activity (GO:0050051)			endometrium(2)|kidney(5)|large_intestine(6)|lung(6)|ovary(5)|prostate(3)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	36					Cisplatin(DB00515)|Clofibrate(DB00636)|Dexamethasone(DB01234)|Estrone(DB00655)|Ethanol(DB00898)|Lansoprazole(DB00448)|Pegvisomant(DB00082)|Pentamidine(DB00738)|Phenobarbital(DB01174)|Rifampicin(DB01045)|Tretinoin(DB00755)	AAGTCGTGCAATGGGGATGGG	0.557																																						dbGAP											0													124.0	109.0	114.0					1																	47395875		2203	4300	6503	-	-	-	SO:0001583	missense	0			L04751	CCDS543.1	1p33	2008-02-05	2003-01-14		ENSG00000187048	ENSG00000187048		"""Cytochrome P450s"""	2642	protein-coding gene	gene with protein product		601310	"""cytochrome P450, subfamily IVA, polypeptide 11"""	CYP4A2		7679927	Standard	NM_000778		Approved	CYP4AII	uc001cqp.4	Q02928	OTTHUMG00000008020	ENST00000310638.4:c.1472T>C	1.37:g.47395875A>G	ENSP00000311095:p.Ile491Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q06766|Q16865|Q16866|Q5VSP8|Q86SU6|Q8IWY5	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-II,prints_Cyt_P450_E_grp-IV	p.I492T	ENST00000310638.4	37	c.1475	CCDS543.1	1	.	.	.	.	.	.	.	.	.	.	A	8.141	0.785288	0.16189	.	.	ENSG00000187048	ENST00000310638;ENST00000371904	T;T	0.69435	-0.4;-0.4	4.41	-8.82	0.00810	.	1.064920	0.07281	N	0.870735	T	0.38904	0.1058	N	0.26042	0.785	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.26430	-1.0103	10	0.13470	T	0.59	.	1.2832	0.02045	0.2146:0.1828:0.3335:0.2691	.	491	Q02928	CP4AB_HUMAN	T	491;492	ENSP00000311095:I491T;ENSP00000360971:I492T	ENSP00000311095:I491T	I	-	2	0	CYP4A11	47168462	0.000000	0.05858	0.000000	0.03702	0.090000	0.18270	0.022000	0.13511	-2.065000	0.00887	-0.429000	0.05907	ATT	CYP4A11	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000187048		0.557	CYP4A11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4A11	HGNC	protein_coding	OTTHUMT00000022022.1	85	0.00	0	A	NM_000778		47395875	47395875	-1	no_errors	ENST00000371904	ensembl	human	known	69_37n	missense	54	15.62	10	SNP	0.000	G
DBP	1628	genome.wustl.edu	37	19	49140184	49140184	+	Frame_Shift_Del	DEL	G	G	-	rs551268466		TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr19:49140184delG	ENST00000222122.5	-	1	511	c.68delC	c.(67-69)cctfs	p.P23fs	SEC1P_ENST00000430145.2_RNA|DBP_ENST00000593500.1_5'Flank|DBP_ENST00000601104.1_Frame_Shift_Del_p.P23fs|DBP_ENST00000599385.1_5'Flank	NM_001352.3	NP_001343.2	Q10586	DBP_HUMAN	D site of albumin promoter (albumin D-box) binding protein	23					liver development (GO:0001889)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	5		all_lung(116;0.000125)|Lung NSC(112;0.000202)|all_epithelial(76;0.000283)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;9.98e-05)|all cancers(93;0.000112)|GBM - Glioblastoma multiforme(486;0.00615)|Epithelial(262;0.0155)		TCCCCCGCCAGGGGGTGTCCC	0.706																																						dbGAP											0													12.0	15.0	14.0					19																	49140184		2191	4280	6471	-	-	-	SO:0001589	frameshift_variant	0			U06936	CCDS12728.1	19q13.33	2013-09-20			ENSG00000105516	ENSG00000105516			2697	protein-coding gene	gene with protein product		124097				1535333, 7835883	Standard	XR_243907		Approved	DABP	uc002pjx.4	Q10586	OTTHUMG00000183319	ENST00000222122.5:c.68delC	19.37:g.49140184delG	ENSP00000222122:p.Pro23fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2I2P4	Frame_Shift_Del	DEL	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.P23fs	ENST00000222122.5	37	c.68	CCDS12728.1	19																																																																																			DBP	-	NULL	ENSG00000105516		0.706	DBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBP	HGNC	protein_coding	OTTHUMT00000466167.1	26	0.00	0	G	NM_001352		49140184	49140184	-1	no_errors	ENST00000222122	ensembl	human	known	69_37n	frame_shift_del	9	41.18	7	DEL	1.000	-
DCAF13	25879	genome.wustl.edu	37	8	104438284	104438284	+	Splice_Site	SNP	G	G	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr8:104438284G>C	ENST00000297579.5	+	4	1112	c.835G>C	c.(835-837)Gtt>Ctt	p.V279L	DCAF13_ENST00000521999.1_3'UTR|DCAF13_ENST00000521971.1_Splice_Site_p.V87L|DCAF13_ENST00000519682.1_Splice_Site_p.V123L	NM_015420.6	NP_056235.4	Q9NV06	DCA13_HUMAN	DDB1 and CUL4 associated factor 13	127					protein ubiquitination (GO:0016567)|rRNA processing (GO:0006364)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	25						ATATTTCTAGGTTGGTGATGA	0.338																																						dbGAP											0													66.0	69.0	68.0					8																	104438284		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK074725	CCDS34934.1	8q22.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000164934	ENSG00000164934		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	24535	protein-coding gene	gene with protein product			"""WD repeats and SOF1 domain containing"""	WDSOF1		11042152	Standard	NM_015420		Approved	DKFZP564O0463, Gm83, HSPC064	uc003yln.3	Q9NV06	OTTHUMG00000164888	ENST00000297579.5:c.835-1G>C	8.37:g.104438284G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MII9|Q8NCH8|Q8TC51|Q96JY7|Q9NZX3	Missense_Mutation	SNP	pfam_Sof1,pfam_WD40_repeat,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V279L	ENST00000297579.5	37	c.835	CCDS34934.1	8	.	.	.	.	.	.	.	.	.	.	G	17.75	3.465934	0.63625	.	.	ENSG00000164934	ENST00000297579;ENST00000521971;ENST00000519682	T;T;T	0.60548	0.18;4.84;0.18	5.64	3.49	0.39957	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.173798	0.50627	D	0.000115	T	0.65386	0.2686	M	0.86502	2.82	0.80722	D	1	B;B	0.26081	0.141;0.118	B;B	0.37346	0.241;0.247	T	0.64744	-0.6335	9	.	.	.	-10.2007	10.6281	0.45519	0.1751:0.0:0.8249:0.0	.	127;127	B3KME9;Q9NV06	.;DCA13_HUMAN	L	279;87;123	ENSP00000297579:V279L;ENSP00000430883:V87L;ENSP00000430411:V123L	.	V	+	1	0	DCAF13	104507460	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.535000	0.36061	1.253000	0.44018	0.655000	0.94253	GTT	DCAF13	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000164934		0.338	DCAF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF13	HGNC	protein_coding	OTTHUMT00000380797.2	61	0.00	0	G	NM_015420	Missense_Mutation	104438284	104438284	+1	no_errors	ENST00000297579	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	C
DMD	1756	genome.wustl.edu	37	X	32364150	32364150	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chrX:32364150G>T	ENST00000357033.4	-	39	5702	c.5496C>A	c.(5494-5496)gaC>gaA	p.D1832E	DMD_ENST00000378677.2_Missense_Mutation_p.D1828E	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1832	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GTTGTAAGTTGTCTCCTCTTT	0.348																																						dbGAP											0													138.0	123.0	128.0					X																	32364150		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5496C>A	X.37:g.32364150G>T	ENSP00000354923:p.Asp1832Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.D1832E	ENST00000357033.4	37	c.5496	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	3.865	-0.029049	0.07589	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280;ENST00000493412	T;T;T	0.54071	0.59;0.59;0.59	5.75	5.75	0.90469	.	0.000000	0.39020	U	0.001500	T	0.18173	0.0436	N	0.01048	-1.04	0.80722	D	1	B;B;B;B;B	0.28419	0.211;0.01;0.134;0.057;0.057	B;B;B;B;B	0.24006	0.05;0.003;0.022;0.015;0.015	T	0.37407	-0.9707	10	0.02654	T	1	.	9.5188	0.39122	0.1592:0.0:0.8408:0.0	.	1824;1832;1828;491;488	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	E	1824;491;488;1828;1832;1832;1709;51	ENSP00000367948:D1828E;ENSP00000354923:D1832E;ENSP00000417725:D51E	ENSP00000354923:D1832E	D	-	3	2	DMD	32274071	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.829000	0.39121	2.410000	0.81850	0.513000	0.50165	GAC	DMD	-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.348	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	99	0.00	0	G	NM_004006		32364150	32364150	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	109	22.70	32	SNP	1.000	T
DNAH2	146754	genome.wustl.edu	37	17	7733717	7733718	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr17:7733717_7733718delCT	ENST00000572933.1	+	78	13413_13414	c.11953_11954delCT	c.(11953-11955)ctcfs	p.L3985fs	DNAH2_ENST00000389173.2_Frame_Shift_Del_p.L3985fs			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2	3985	AAA 6. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				GCTGTTTTCACTCTGTTTCTTC	0.455																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.11953_11954delCT	17.37:g.7733719_7733720delCT	ENSP00000458355:p.Leu3985fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Frame_Shift_Del	DEL	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.C3986fs	ENST00000572933.1	37	c.11953_11954	CCDS32551.1	17																																																																																			DNAH2	-	pfam_Dynein_heavy	ENSG00000183914		0.455	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	55	0.00	0	CT	NM_020877		7733717	7733718	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	frame_shift_del	24	44.19	19	DEL	1.000:1.000	-
DNAI1	27019	genome.wustl.edu	37	9	34506808	34506808	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr9:34506808C>T	ENST00000242317.4	+	13	1418	c.1247C>T	c.(1246-1248)cCc>cTc	p.P416L		NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	416					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		CTCAAGAAGCCCCACTCCCAG	0.612									Kartagener syndrome																													dbGAP											0													71.0	59.0	63.0					9																	34506808		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.1247C>T	9.37:g.34506808C>T	ENSP00000242317:p.Pro416Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P416L	ENST00000242317.4	37	c.1247	CCDS6557.1	9	.	.	.	.	.	.	.	.	.	.	C	10.09	1.253937	0.22965	.	.	ENSG00000122735	ENST00000242317	D	0.87650	-2.28	5.16	5.16	0.70880	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.369087	0.28572	N	0.014866	D	0.82600	0.5072	L	0.41710	1.295	0.80722	D	1	B	0.18610	0.029	B	0.13407	0.009	T	0.78242	-0.2280	10	0.37606	T	0.19	.	15.8168	0.78608	0.0:1.0:0.0:0.0	.	416	Q9UI46	DNAI1_HUMAN	L	416	ENSP00000242317:P416L	ENSP00000242317:P416L	P	+	2	0	DNAI1	34496808	0.995000	0.38212	1.000000	0.80357	0.262000	0.26303	0.878000	0.28126	2.390000	0.81377	0.563000	0.77884	CCC	DNAI1	-	superfamily_WD40_repeat_dom	ENSG00000122735		0.612	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAI1	HGNC	protein_coding	OTTHUMT00000052192.1	40	0.00	0	C			34506808	34506808	+1	no_errors	ENST00000242317	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.946	T
ESF1	51575	genome.wustl.edu	37	20	13756551	13756551	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr20:13756551C>A	ENST00000202816.1	-	3	1110	c.1003G>T	c.(1003-1005)Gaa>Taa	p.E335*		NM_001276380.1|NM_016649.3	NP_001263309.1|NP_057733.2	Q9H501	ESF1_HUMAN	ESF1, nucleolar pre-rRNA processing protein, homolog (S. cerevisiae)	335					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|skin(1)|stomach(1)	31						TTATCTAATTCTCTCCAAGCA	0.373																																						dbGAP											0													136.0	134.0	134.0					20																	13756551		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS13117.1	20p12.1	2007-02-12	2006-11-13	2006-11-13	ENSG00000089048	ENSG00000089048			15898	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 6"""	C20orf6			Standard	NM_016649		Approved	bA526K24.1	uc002wok.2	Q9H501	OTTHUMG00000031906	ENST00000202816.1:c.1003G>T	20.37:g.13756551C>A	ENSP00000202816:p.Glu335*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86X92|Q9H9Q5|Q9HA35|Q9NX93|Q9P1S6	Nonsense_Mutation	SNP	pfam_NUC153	p.E335*	ENST00000202816.1	37	c.1003	CCDS13117.1	20	.	.	.	.	.	.	.	.	.	.	C	39	7.725195	0.98456	.	.	ENSG00000089048	ENST00000202816	.	.	.	5.15	5.15	0.70609	.	0.047447	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	18.5983	0.91236	0.0:1.0:0.0:0.0	.	.	.	.	X	335	.	ENSP00000202816:E335X	E	-	1	0	ESF1	13704551	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.371000	0.79600	2.567000	0.86603	0.585000	0.79938	GAA	ESF1	-	NULL	ENSG00000089048		0.373	ESF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESF1	HGNC	protein_coding	OTTHUMT00000078049.1	105	0.00	0	C	NM_016649		13756551	13756551	-1	no_errors	ENST00000202816	ensembl	human	known	69_37n	nonsense	61	17.57	13	SNP	1.000	A
ESYT2	57488	genome.wustl.edu	37	7	158555812	158555812	+	Silent	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr7:158555812G>T	ENST00000251527.5	-	10	1355	c.1290C>A	c.(1288-1290)ctC>ctA	p.L430L		NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	458	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						CTTCATCAAAGAGCTCAATCT	0.363																																						dbGAP											0													101.0	93.0	96.0					7																	158555812		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.1290C>A	7.37:g.158555812G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L430	ENST00000251527.5	37	c.1290	CCDS34791.1	7																																																																																			ESYT2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000117868		0.363	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT2	HGNC	protein_coding	OTTHUMT00000322647.1	73	0.00	0	G	NM_020728		158555812	158555812	-1	no_errors	ENST00000251527	ensembl	human	known	69_37n	silent	96	13.51	15	SNP	0.996	T
EXO1	9156	genome.wustl.edu	37	1	242015696	242015699	+	Frame_Shift_Del	DEL	AGAG	AGAG	-	rs147963292	byFrequency	TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	AGAG	AGAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:242015696_242015699delAGAG	ENST00000366548.3	+	5	857_860	c.264_267delAGAG	c.(262-267)gtagagfs	p.VE88fs	EXO1_ENST00000518483.1_Frame_Shift_Del_p.VE88fs|EXO1_ENST00000493702.1_Intron|EXO1_ENST00000348581.5_Frame_Shift_Del_p.VE88fs	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	88	N-domain.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)			NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			AAAAGGAAGTAGAGAGATCTAGAA	0.304								Editing and processing nucleases																														dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.264_267delAGAG	1.37:g.242015696_242015699delAGAG	ENSP00000355506:p.Val88fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Frame_Shift_Del	DEL	pfam_XPG/RAD2_endonuclease,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_Rad_DNA_repair	p.E89fs	ENST00000366548.3	37	c.264_267	CCDS1620.1	1																																																																																			EXO1	-	pfam_XPG_DNA_repair_N,smart_XPG_DNA_repair_N,prints_XPGC_Rad_DNA_repair	ENSG00000174371		0.304	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	HGNC	protein_coding	OTTHUMT00000096405.1	92	0.00	0	AGAG	NM_006027		242015696	242015699	+1	no_errors	ENST00000348581	ensembl	human	known	69_37n	frame_shift_del	48	11.11	6	DEL	0.979:1.000:1.000:0.989	-
FAM179B	23116	genome.wustl.edu	37	14	45473547	45473547	+	Silent	SNP	T	T	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr14:45473547T>A	ENST00000361577.3	+	4	2836	c.2622T>A	c.(2620-2622)tcT>tcA	p.S874S	KLHL28_ENST00000553817.1_Intron|FAM179B_ENST00000361462.2_Silent_p.S874S|FAM179B_ENST00000382233.2_Silent_p.S874S	NM_015091.2	NP_055906.2	Q9Y4F4	F179B_HUMAN	family with sequence similarity 179, member B	874										endometrium(4)|kidney(5)|large_intestine(12)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	45						AAAAATCGTCTGATCCTACGG	0.353																																						dbGAP											0													56.0	60.0	59.0					14																	45473547		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AB007883	CCDS9681.1	14q21.3	2008-07-21	2008-07-21	2008-07-21	ENSG00000198718	ENSG00000198718			19959	protein-coding gene	gene with protein product			"""KIAA0423"""	KIAA0423			Standard	XM_005267451		Approved		uc001wvv.3	Q9Y4F4	OTTHUMG00000140264	ENST00000361577.3:c.2622T>A	14.37:g.45473547T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68D66|Q6PG27	Silent	SNP	superfamily_ARM-type_fold	p.S874	ENST00000361577.3	37	c.2622	CCDS9681.1	14																																																																																			FAM179B	-	superfamily_ARM-type_fold	ENSG00000198718		0.353	FAM179B-001	KNOWN	basic|CCDS	protein_coding	FAM179B	HGNC	protein_coding	OTTHUMT00000276791.1	48	0.00	0	T	XM_113781		45473547	45473547	+1	no_errors	ENST00000361577	ensembl	human	known	69_37n	silent	44	18.52	10	SNP	0.120	A
FSHR	2492	genome.wustl.edu	37	2	49210108	49210108	+	Missense_Mutation	SNP	T	T	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr2:49210108T>A	ENST00000406846.2	-	8	730	c.611A>T	c.(610-612)aAt>aTt	p.N204I	FSHR_ENST00000346173.3_Missense_Mutation_p.N204I|FSHR_ENST00000304421.4_Missense_Mutation_p.N178I|FSHR_ENST00000541117.1_5'UTR|FSHR_ENST00000469138.1_5'UTR	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	204					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	TTCTAAATTATTATTATCGCT	0.403									Gonadal Dysgenesis, 46 XX																													dbGAP											0													85.0	85.0	85.0					2																	49210108		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.611A>T	2.37:g.49210108T>A	ENSP00000384708:p.Asn204Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_supfam,prints_FSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.N204I	ENST00000406846.2	37	c.611	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	T	12.39	1.924967	0.34002	.	.	ENSG00000170820	ENST00000406846;ENST00000346173;ENST00000304421;ENST00000454032	T;T;T;T	0.79554	-0.85;-1.28;-0.85;-1.28	5.53	-1.63	0.08345	.	0.571535	0.20032	N	0.100684	T	0.50326	0.1609	N	0.04297	-0.235	0.80722	D	1	B;B;B	0.09022	0.001;0.0;0.002	B;B;B	0.08055	0.003;0.001;0.003	T	0.11767	-1.0574	9	.	.	.	.	3.8503	0.08953	0.2451:0.231:0.0:0.5239	.	178;204;204	Q05AH0;G5E967;P23945	.;.;FSHR_HUMAN	I	204;204;178;204	ENSP00000384708:N204I;ENSP00000333908:N204I;ENSP00000306780:N178I;ENSP00000415504:N204I	.	N	-	2	0	FSHR	49063612	0.692000	0.27719	0.998000	0.56505	0.988000	0.76386	-0.227000	0.09126	0.103000	0.17682	0.533000	0.62120	AAT	FSHR	-	pfam_Leu-rich_rpt,prints_FSH_rcpt,prints_TSH_rcpt	ENSG00000170820		0.403	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	57	0.00	0	T			49210108	49210108	-1	no_errors	ENST00000406846	ensembl	human	known	69_37n	missense	44	30.16	19	SNP	0.965	A
FN1	2335	genome.wustl.edu	37	2	216236841	216236841	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr2:216236841G>T	ENST00000359671.1	-	39	6497	c.6232C>A	c.(6232-6234)Ccg>Acg	p.P2078T	FN1_ENST00000357009.2_Intron|FN1_ENST00000443816.1_Missense_Mutation_p.P1988T|FN1_ENST00000346544.3_Intron|FN1_ENST00000345488.5_Intron|FN1_ENST00000357867.4_Intron|FN1_ENST00000446046.1_Missense_Mutation_p.P2053T|FN1_ENST00000354785.4_Missense_Mutation_p.P2169T|FN1_ENST00000323926.6_Missense_Mutation_p.P2169T|FN1_ENST00000336916.4_Missense_Mutation_p.P2078T|FN1_ENST00000432072.2_Intron|FN1_ENST00000421182.1_Missense_Mutation_p.P1963T|FN1_ENST00000356005.4_Missense_Mutation_p.P1988T			P02751	FINC_HUMAN	fibronectin 1	2078	Connecting strand 3 (CS-3) (V region).				acute-phase response (GO:0006953)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|calcium-independent cell-matrix adhesion (GO:0007161)|cell adhesion (GO:0007155)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|integrin activation (GO:0033622)|leukocyte migration (GO:0050900)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of axon extension (GO:0045773)|regulation of cell shape (GO:0008360)|response to wounding (GO:0009611)|substrate adhesion-dependent cell spreading (GO:0034446)	apical plasma membrane (GO:0016324)|basal lamina (GO:0005605)|blood microparticle (GO:0072562)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule lumen (GO:0031093)	collagen binding (GO:0005518)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)		FN1/ALK(2)	NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(7)|endometrium(9)|kidney(8)|large_intestine(33)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	109		Renal(323;0.127)		Epithelial(149;9.59e-07)|all cancers(144;0.000174)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00948)	Ocriplasmin(DB08888)	CCTACATTCGGCGGGTATGGT	0.527																																						dbGAP											0													155.0	140.0	145.0					2																	216236841		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2399.1, CCDS2400.1, CCDS42813.1, CCDS42814.1, CCDS46510.1, CCDS46512.1	2q34	2014-01-30			ENSG00000115414	ENSG00000115414		"""Fibronectin type III domain containing"", ""Endogenous ligands"""	3778	protein-coding gene	gene with protein product	"""migration-stimulating factor"", ""cold-insoluble globulin"""	135600				2992939, 3003095	Standard	NM_054034		Approved	MSF, CIG, LETS, GFND2, FINC	uc002vfa.3	P02751	OTTHUMG00000133054	ENST00000359671.1:c.6232C>A	2.37:g.216236841G>T	ENSP00000352696:p.Pro2078Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLF0|E9PE77|E9PG29|O95609|O95610|Q14312|Q14325|Q14326|Q17RV7|Q564H7|Q585T2|Q59EH1|Q60FE4|Q68DP8|Q68DP9|Q68DT4|Q6LDP6|Q6MZS0|Q6MZU5|Q6N025|Q6N0A6|Q7Z391|Q86T27|Q8IVI8|Q96KP7|Q96KP8|Q96KP9|Q9H1B8|Q9HAP3|Q9UMK2	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibronectin_type1,pfam_FN_type2_col-bd,superfamily_Kringle-like,superfamily_Fibronectin_type3,smart_Fibronectin_type1,smart_FN_type2_col-bd,smart_Fibronectin_type3,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Fibronectin_type3	p.P2169T	ENST00000359671.1	37	c.6505		2	.	.	.	.	.	.	.	.	.	.	G	11.15	1.553804	0.27739	.	.	ENSG00000115414	ENST00000421182;ENST00000323926;ENST00000336916;ENST00000354785;ENST00000265313;ENST00000359671;ENST00000446046;ENST00000443816;ENST00000356005;ENST00000456923;ENST00000438981	T;T;T;T;T;T;T;T;T;T	0.53640	3.61;3.61;3.61;2.34;2.0;3.61;3.61;1.34;0.61;1.84	6.16	6.16	0.99307	.	0.081830	0.52532	D	0.000063	T	0.66509	0.2796	M	0.61703	1.905	0.80722	D	1	D;P;D;P;D;D;D;D;P;P	0.89917	1.0;0.657;0.995;0.947;0.992;0.999;1.0;0.999;0.713;0.893	D;B;D;P;D;D;D;D;P;P	0.87578	0.992;0.3;0.966;0.9;0.939;0.997;0.998;0.998;0.614;0.694	T	0.62445	-0.6853	10	0.42905	T	0.14	.	16.3585	0.83245	0.0:0.0:0.8676:0.1324	.	1869;2169;1988;2053;2078;2079;1963;1988;2169;2078	Q68CX6;P02751-7;P02751-8;E9PE77;P02751-3;E7ERA1;P02751-9;P02751-14;P02751-15;P02751	.;.;.;.;.;.;.;.;.;FINC_HUMAN	T	1963;2169;2078;2169;2079;2078;2053;1988;1988;795;172	ENSP00000394423:P1963T;ENSP00000323534:P2169T;ENSP00000338200:P2078T;ENSP00000346839:P2169T;ENSP00000352696:P2078T;ENSP00000410422:P2053T;ENSP00000415018:P1988T;ENSP00000348285:P1988T;ENSP00000416139:P795T;ENSP00000392565:P172T	ENSP00000265313:P2079T	P	-	1	0	FN1	215945086	1.000000	0.71417	0.994000	0.49952	0.963000	0.63663	5.007000	0.63984	2.937000	0.99478	0.650000	0.86243	CCG	FN1	-	NULL	ENSG00000115414		0.527	FN1-204	KNOWN	basic	protein_coding	FN1	HGNC	protein_coding		102	0.00	0	G	NM_212476		216236841	216236841	-1	no_errors	ENST00000354785	ensembl	human	known	69_37n	missense	73	19.78	18	SNP	0.992	T
GPS2	2874	genome.wustl.edu	37	17	7217257	7217258	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr17:7217257_7217258delCT	ENST00000380728.2	-	6	747_748	c.447_448delAG	c.(445-450)agagccfs	p.RA149fs	RP11-542C16.2_ENST00000575474.1_3'UTR|GPS2_ENST00000391950.3_Frame_Shift_Del_p.RA149fs|GPS2_ENST00000389167.5_Frame_Shift_Del_p.RA149fs			Q13227	GPS2_HUMAN	G protein pathway suppressor 2	149					cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				ATTTGTTTGGCTCTGTCAGCTG	0.54																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.447_448delAG	17.37:g.7217259_7217260delCT	ENSP00000370104:p.Arg149fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXA1|Q6FHM8	Frame_Shift_Del	DEL	NULL	p.R149fs	ENST00000380728.2	37	c.448_447	CCDS11100.1	17																																																																																			GPS2	-	NULL	ENSG00000132522		0.540	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	85	0.00	0	CT	NM_004489		7217257	7217258	-1	no_errors	ENST00000380728	ensembl	human	known	69_37n	frame_shift_del	40	30.51	18	DEL	1.000:1.000	-
HAUS5	23354	genome.wustl.edu	37	19	36110654	36110654	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr19:36110654C>T	ENST00000203166.5	+	15	1425	c.1400C>T	c.(1399-1401)cCg>cTg	p.P467L	HAUS5_ENST00000379045.2_3'UTR	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	467					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						CGGCACAGGCCGGGAGAGTGA	0.642																																						dbGAP											0													16.0	19.0	18.0					19																	36110654		2095	4196	6291	-	-	-	SO:0001583	missense	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.1400C>T	19.37:g.36110654C>T	ENSP00000439056:p.Pro467Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	NULL	p.P467L	ENST00000203166.5	37	c.1400	CCDS42550.1	19	.	.	.	.	.	.	.	.	.	.	C	5.271	0.235424	0.10023	.	.	ENSG00000249115	ENST00000203166	T	0.26660	1.72	4.49	3.45	0.39498	.	0.513086	0.20852	N	0.084501	T	0.21801	0.0525	L	0.56769	1.78	0.20074	N	0.999936	P	0.50066	0.931	B	0.40477	0.33	T	0.11203	-1.0597	10	0.27082	T	0.32	-12.4476	7.4767	0.27380	0.0:0.8791:0.0:0.1209	.	467	O94927	HAUS5_HUMAN	L	467	ENSP00000439056:P467L	ENSP00000439056:P467L	P	+	2	0	HAUS5	40802494	0.013000	0.17824	0.009000	0.14445	0.127000	0.20565	2.092000	0.41700	1.086000	0.41228	0.556000	0.70494	CCG	HAUS5	-	NULL	ENSG00000249115		0.642	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2	24	0.00	0	C			36110654	36110654	+1	no_errors	ENST00000203166	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.011	T
HMBS	3145	genome.wustl.edu	37	11	118963868	118963869	+	Frame_Shift_Ins	INS	-	-	GT	rs150428209	byFrequency	TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr11:118963868_118963869insGT	ENST00000278715.3	+	14	1112_1113	c.961_962insGT	c.(961-963)cgtfs	p.R321fs	HMBS_ENST00000537841.1_Frame_Shift_Ins_p.R304fs|HMBS_ENST00000543090.1_Frame_Shift_Ins_p.R290fs|HMBS_ENST00000442944.2_Frame_Shift_Ins_p.R304fs|HMBS_ENST00000544387.1_Frame_Shift_Ins_p.R281fs|HMBS_ENST00000392841.1_Frame_Shift_Ins_p.R304fs|HMBS_ENST00000542729.1_Frame_Shift_Ins_p.R264fs	NM_000190.3	NP_000181.2	P08397	HEM3_HUMAN	hydroxymethylbilane synthase	321					heme biosynthetic process (GO:0006783)|peptidyl-pyrromethane cofactor linkage (GO:0018160)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	hydroxymethylbilane synthase activity (GO:0004418)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	15	all_hematologic(175;0.0977)	Medulloblastoma(222;0.0425)|Breast(348;0.052)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		CATCACTGCTCGTAACATTCCA	0.52																																						dbGAP											0			GRCh37	CM044642	HMBS	M	rs150428209																																			-	-	-	SO:0001589	frameshift_variant	0			X04808	CCDS8409.1, CCDS41726.1, CCDS58186.1, CCDS58187.1	11q23.3	2013-07-10			ENSG00000256269	ENSG00000256269	2.5.1.61		4982	protein-coding gene	gene with protein product		609806	"""uroporphyrinogen I synthase"", ""porphobilinogen deaminase"", ""porphyria, acute; Chester type"""	PBGD, UPS, PORC		8432552, 17298217	Standard	NM_001258208		Approved		uc001puz.1	P08397	OTTHUMG00000168295	ENST00000278715.3:c.962_963dupGT	11.37:g.118963869_118963870dupGT	ENSP00000278715:p.Arg321fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2L0|G3V1P4|G5EA58|P08396|Q16012	Frame_Shift_Ins	INS	pfam_Porphobilin_deaminase_N,pfam_Porphobilinogen_deaminase_C,superfamily_Porphobilinogen_deaminase_C,pirsf_4pyrrol_synth_OHMeBilane_synth,prints_4pyrrol_synth_OHMeBilane_synth,tigrfam_4pyrrol_synth_OHMeBilane_synth	p.N322fs	ENST00000278715.3	37	c.961_962	CCDS8409.1	11																																																																																			HMBS	-	superfamily_Porphobilinogen_deaminase_C,pirsf_4pyrrol_synth_OHMeBilane_synth	ENSG00000256269		0.520	HMBS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMBS	HGNC	protein_coding	OTTHUMT00000399188.1	66	0.00	0	-	NM_000190		118963868	118963869	+1	no_errors	ENST00000278715	ensembl	human	known	69_37n	frame_shift_ins	65	13.33	10	INS	0.029:0.000	GT
HMGCR	3156	genome.wustl.edu	37	5	74646180	74646181	+	Missense_Mutation	DNP	AG	AG	TC			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A|G	A|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr5:74646180_74646181AG>TC	ENST00000287936.4	+	8	917_918	c.761_762AG>TC	c.(760-762)cAG>cTC	p.Q254L	HMGCR_ENST00000511206.1_Missense_Mutation_p.Q254L|HMGCR_ENST00000343975.5_Missense_Mutation_p.Q254L	NM_000859.2	NP_000850.1	P04035	HMDH_HUMAN	3-hydroxy-3-methylglutaryl-CoA reductase	254					aging (GO:0007568)|cellular lipid metabolic process (GO:0044255)|cholesterol biosynthetic process (GO:0006695)|coenzyme A metabolic process (GO:0015936)|isoprenoid biosynthetic process (GO:0008299)|myoblast differentiation (GO:0045445)|negative regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061179)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of striated muscle cell apoptotic process (GO:0010664)|negative regulation of vasodilation (GO:0045908)|negative regulation of wound healing (GO:0061045)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of stress-activated MAPK cascade (GO:0032874)|protein tetramerization (GO:0051262)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|small molecule metabolic process (GO:0044281)|ubiquinone metabolic process (GO:0006743)|visual learning (GO:0008542)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisomal membrane (GO:0005778)	coenzyme binding (GO:0050662)|hydroxymethylglutaryl-CoA reductase (NADPH) activity (GO:0004420)|hydroxymethylglutaryl-CoA reductase activity (GO:0042282)|NADPH binding (GO:0070402)			breast(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	20		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Prostate(461;0.174)		OV - Ovarian serous cystadenocarcinoma(47;2.24e-54)	Atorvastatin(DB01076)|Fluvastatin(DB01095)|Lovastatin(DB00227)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rosuvastatin(DB01098)|Simvastatin(DB00641)	CCTGTAACTCAGAGGGTCAAGA	0.381																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS4027.1, CCDS47234.1	5q13.3-q14	2012-10-02	2010-04-30		ENSG00000113161	ENSG00000113161	1.1.1.88, 1.1.1.34		5006	protein-coding gene	gene with protein product	"""hydroxymethylglutaryl-CoA reductase"", ""3-hydroxy-3-methylglutaryl CoA reductase (NADPH)"""	142910	"""3-hydroxy-3-methylglutaryl-Coenzyme A reductase"""				Standard	NM_000859		Approved		uc003kdp.3	P04035	OTTHUMG00000102069	Exception_encountered	5.37:g.74646180_74646181delinsTC	ENSP00000287936:p.Gln254Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3Y9|Q8N190	Missense_Mutation	SNP	pfam_HMG_CoA_Rdtase,pfam_Patched,superfamily_HMG_CoA_Rdtase_sub-bd,superfamily_HMG_CoA_Rdtase_NAD(P)-bd,pfscan_SSD,pfscan_HMG_CoA_Rdtase,prints_HMG_CoA_Rdtase,tigrfam_HMG_CoA_Rdtase_metazoan,tigrfam_HMG_CoA_Rdtase_eu_arc	p.Q254L|p.Q254H	ENST00000287936.4	37	c.761|c.762	CCDS4027.1	5																																																																																			HMGCR	-	pfam_Patched,tigrfam_HMG_CoA_Rdtase_metazoan	ENSG00000113161		0.381	HMGCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGCR	HGNC	protein_coding	OTTHUMT00000219877.2	36|35	0.00	0	A|G			74646180|74646181	74646180|74646181	+1	no_errors	ENST00000287936	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	1.000	T|C
HSD3B2	3284	genome.wustl.edu	37	1	119962135	119962135	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:119962135C>G	ENST00000543831.1	+	3	486	c.237C>G	c.(235-237)atC>atG	p.I79M	HSD3B2_ENST00000471656.1_3'UTR|HSD3B2_ENST00000369416.3_Missense_Mutation_p.I79M	NM_001166120.1	NP_001159592.1	P26439	3BHS2_HUMAN	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2	79					androgen biosynthetic process (GO:0006702)|glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial membrane (GO:0031966)|smooth endoplasmic reticulum membrane (GO:0030868)	3-beta-hydroxy-delta5-steroid dehydrogenase activity (GO:0003854)|steroid delta-isomerase activity (GO:0004769)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(19)|ovary(2)|skin(1)	27	all_neural(166;0.187)	all_lung(203;1.06e-06)|Lung NSC(69;7.5e-06)|all_epithelial(167;0.000284)		Lung(183;0.015)|LUSC - Lung squamous cell carcinoma(189;0.0836)	Corticotropin(DB01285)|Medroxyprogesterone Acetate(DB00603)|Trilostane(DB01108)	CGGTCGTCATCCACACCGCCT	0.488																																						dbGAP											0													117.0	93.0	101.0					1																	119962135		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038419	CCDS902.1	1p12	2014-06-03			ENSG00000203859	ENSG00000203859	1.1.1.145, 5.3.3.1	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	5218	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 11E, member 2"""	613890				1363812, 19027726	Standard	NM_000198		Approved	SDR11E2	uc001eht.3	P26439	OTTHUMG00000012526	ENST00000543831.1:c.237C>G	1.37:g.119962135C>G	ENSP00000445122:p.Ile79Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRA5|Q16010|Q53GD4|Q6AI10|Q6LDB9|Q99890|Q9UD08	Missense_Mutation	SNP	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	p.I79M	ENST00000543831.1	37	c.237	CCDS902.1	1	.	.	.	.	.	.	.	.	.	.	-	16.24	3.068223	0.55539	.	.	ENSG00000203859	ENST00000543831;ENST00000433745;ENST00000369416	D;D;D	0.90955	-2.76;-2.76;-2.76	3.93	-6.44	0.01920	3-beta hydroxysteroid dehydrogenase/isomerase (1);NAD(P)-binding domain (1);	0.054705	0.64402	D	0.000001	D	0.93890	0.8045	H	0.96398	3.815	0.33078	D	0.536211	P;D	0.89917	0.762;1.0	B;D	0.85130	0.445;0.997	D	0.91451	0.5181	9	.	.	.	-10.8888	9.6131	0.39674	0.0:0.7331:0.1096:0.1573	.	79;79	P26439-2;P26439	.;3BHS2_HUMAN	M	79	ENSP00000445122:I79M;ENSP00000388292:I79M;ENSP00000358424:I79M	.	I	+	3	3	HSD3B2	119763658	0.465000	0.25815	0.889000	0.34880	0.056000	0.15407	-0.323000	0.07997	-1.216000	0.02607	0.298000	0.19748	ATC	HSD3B2	-	pfam_3Beta_OHSteriod_DH/Estase,pfam_Epimerase_deHydtase,pfam_Male_sterile_NAD-bd,pfam_Polysac_CapD-like,pfam_DH_sc/Rdtase_SDR,pfam_dTDP_dehydrorham_reduct,pfam_NmrA,pfam_PKS_KR	ENSG00000203859		0.488	HSD3B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD3B2	HGNC	protein_coding	OTTHUMT00000034994.1	76	0.00	0	C	NM_000198		119962135	119962135	+1	no_errors	ENST00000369416	ensembl	human	known	69_37n	missense	51	29.17	21	SNP	0.946	G
HTRA1	5654	genome.wustl.edu	37	10	124273729	124273729	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr10:124273729G>A	ENST00000368984.3	+	9	1425	c.1297G>A	c.(1297-1299)Gtc>Atc	p.V433I		NM_002775.4	NP_002766.1	Q92743	HTRA1_HUMAN	HtrA serine peptidase 1	433	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteolysis (GO:0006508)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			endometrium(1)|kidney(1)|large_intestine(8)|lung(7)	17		all_neural(114;0.0765)|Lung NSC(174;0.133)|all_lung(145;0.163)|Breast(234;0.238)				GGAAAACGACGTCATAATCAG	0.493																																						dbGAP											0													334.0	302.0	313.0					10																	124273729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097709	CCDS7630.1	10q26.3	2014-01-28	2005-08-18	2005-08-18	ENSG00000166033	ENSG00000166033		"""Serine peptidases / Serine peptidases"""	9476	protein-coding gene	gene with protein product		602194	"""protease, serine, 11 (IGF binding)"""	PRSS11		8977104	Standard	NM_002775		Approved	HtrA, IGFBP5-protease, ARMD7	uc001lgj.2	Q92743	OTTHUMG00000019186	ENST00000368984.3:c.1297G>A	10.37:g.124273729G>A	ENSP00000357980:p.Val433Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRE4|Q9UNS5	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_PDZ,pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,pfam_IGFBP-like,superfamily_Pept_cys/ser_Trypsin-like,superfamily_PDZ,smart_IGFBP-like,smart_Prot_inh_Kazal,smart_PDZ,pfscan_PDZ,prints_Peptidase_S1C	p.V433I	ENST00000368984.3	37	c.1297	CCDS7630.1	10	.	.	.	.	.	.	.	.	.	.	G	9.716	1.158414	0.21454	.	.	ENSG00000166033	ENST00000368984;ENST00000435263;ENST00000420892	T;T	0.27104	1.69;1.69	5.38	4.48	0.54585	PDZ/DHR/GLGF (4);	0.063434	0.64402	D	0.000006	T	0.19565	0.0470	L	0.38531	1.155	0.52099	D	0.999941	B	0.21905	0.062	B	0.28638	0.092	T	0.06006	-1.0851	10	0.18710	T	0.47	-13.2088	8.8295	0.35076	0.225:0.0:0.775:0.0	.	433	Q92743	HTRA1_HUMAN	I	433;400;174	ENSP00000357980:V433I;ENSP00000412676:V174I	ENSP00000357980:V433I	V	+	1	0	HTRA1	124263719	1.000000	0.71417	0.912000	0.35992	0.783000	0.44284	5.345000	0.65987	1.265000	0.44215	0.655000	0.94253	GTC	HTRA1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_Peptidase_S1C	ENSG00000166033		0.493	HTRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTRA1	HGNC	protein_coding	OTTHUMT00000128327.1	84	0.00	0	G	NM_002775		124273729	124273729	+1	no_errors	ENST00000368984	ensembl	human	known	69_37n	missense	75	22.68	22	SNP	1.000	A
IMPA2	3613	genome.wustl.edu	37	18	12012174	12012174	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr18:12012174C>A	ENST00000269159.3	+	4	583	c.341C>A	c.(340-342)cCg>cAg	p.P114Q	IMPA2_ENST00000588927.1_5'UTR|IMPA2_ENST00000589238.1_5'UTR|IMPA2_ENST00000588752.1_3'UTR	NM_014214.2	NP_055029.1	O14732	IMPA2_HUMAN	inositol(myo)-1(or 4)-monophosphatase 2	114					inositol biosynthetic process (GO:0006021)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylinositol phosphorylation (GO:0046854)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	inositol monophosphate 1-phosphatase activity (GO:0008934)|inositol monophosphate 3-phosphatase activity (GO:0052832)|inositol monophosphate 4-phosphatase activity (GO:0052833)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|skin(2)|stomach(2)|urinary_tract(1)	12					Lithium(DB01356)	TGCAGATTCCCGACTGTGGCG	0.602																																						dbGAP											0													136.0	139.0	138.0					18																	12012174		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF014398	CCDS11855.1	18p11.2	2008-03-18			ENSG00000141401	ENSG00000141401	3.1.3.25		6051	protein-coding gene	gene with protein product		605922				9322233	Standard	NM_014214		Approved		uc002kqp.2	O14732	OTTHUMG00000131693	ENST00000269159.3:c.341C>A	18.37:g.12012174C>A	ENSP00000269159:p.Pro114Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ29|Q9UJT3	Missense_Mutation	SNP	pfam_Inositol_monophosphatase,prints_Inositol_monophosphatase,prints_Inositol_monoPase_Li-sen	p.P114Q	ENST00000269159.3	37	c.341	CCDS11855.1	18	.	.	.	.	.	.	.	.	.	.	C	17.89	3.499970	0.64298	.	.	ENSG00000141401	ENST00000269159	T	0.53857	0.6	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.78483	0.4290	M	0.88775	2.98	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.81493	-0.0908	10	0.72032	D	0.01	-24.6316	18.9316	0.92568	0.0:1.0:0.0:0.0	.	114	O14732	IMPA2_HUMAN	Q	114	ENSP00000269159:P114Q	ENSP00000269159:P114Q	P	+	2	0	IMPA2	12002174	1.000000	0.71417	0.920000	0.36463	0.100000	0.18952	5.769000	0.68865	2.774000	0.95407	0.643000	0.83706	CCG	IMPA2	-	pfam_Inositol_monophosphatase,prints_Inositol_monophosphatase	ENSG00000141401		0.602	IMPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPA2	HGNC	protein_coding	OTTHUMT00000254601.1	100	0.00	0	C			12012174	12012174	+1	no_errors	ENST00000269159	ensembl	human	known	69_37n	missense	82	14.58	14	SNP	0.999	A
GSE1	23199	genome.wustl.edu	37	16	85689441	85689441	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr16:85689441G>A	ENST00000253458.7	+	6	1083	c.907G>A	c.(907-909)Ggg>Agg	p.G303R	GSE1_ENST00000405402.2_Missense_Mutation_p.G199R|GSE1_ENST00000393243.1_Missense_Mutation_p.G230R	NM_014615.2	NP_055430.1	Q14687	GSE1_HUMAN	Gse1 coiled-coil protein	303																	GCACCTCTCTGGGGTCCGCTA	0.677																																						dbGAP											0													50.0	45.0	47.0					16																	85689441		2197	4295	6492	-	-	-	SO:0001583	missense	0			D80004	CCDS10952.1, CCDS45539.1, CCDS62007.1	16q24.1	2012-12-07	2012-12-07	2012-10-02	ENSG00000131149	ENSG00000131149			28979	protein-coding gene	gene with protein product	"""genetic suppressor element 1"""		"""KIAA0182"", ""Gse1 coiled-coil protein homolog (mouse)"""	KIAA0182		8724849, 8786132	Standard	NM_014615		Approved		uc002fix.4	Q14687	OTTHUMG00000137650	ENST00000253458.7:c.907G>A	16.37:g.85689441G>A	ENSP00000253458:p.Gly303Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUM4|Q8IY61|Q96GA4|Q9BW09	Missense_Mutation	SNP	pfam_DUF3736	p.G303R	ENST00000253458.7	37	c.907	CCDS10952.1	16	.	.	.	.	.	.	.	.	.	.	G	18.03	3.532720	0.64972	.	.	ENSG00000131149	ENST00000405402;ENST00000411612;ENST00000253458;ENST00000393243	T;T;T	0.38401	1.2;1.2;1.14	4.9	4.9	0.64082	.	0.000000	0.85682	D	0.000000	T	0.57198	0.2037	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.61053	-0.7140	10	0.87932	D	0	-43.156	16.2415	0.82411	0.0:0.0:1.0:0.0	.	230;303	Q14687-3;Q14687	.;GSE1_HUMAN	R	199;199;303;230	ENSP00000384839:G199R;ENSP00000253458:G303R;ENSP00000376934:G230R	ENSP00000253458:G303R	G	+	1	0	KIAA0182	84246942	1.000000	0.71417	0.649000	0.29536	0.452000	0.32318	9.053000	0.93860	2.270000	0.75569	0.555000	0.69702	GGG	KIAA0182	-	NULL	ENSG00000131149		0.677	GSE1-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA0182	HGNC	protein_coding	OTTHUMT00000325527.1	21	0.00	0	G	NM_014615		85689441	85689441	+1	no_errors	ENST00000253458	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	A
KIAA1244	57221	genome.wustl.edu	37	6	138599709	138599709	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr6:138599709C>A	ENST00000251691.4	+	13	2416	c.2250C>A	c.(2248-2250)caC>caA	p.H750Q		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AGCTCTCCCACGGTGACTACT	0.602																																						dbGAP											0													130.0	107.0	115.0					6																	138599709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.2250C>A	6.37:g.138599709C>A	ENSP00000251691:p.His750Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold,superfamily_Sec7,smart_Sec7	p.H750Q	ENST00000251691.4	37	c.2250	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	c	5.862	0.343282	0.11069	.	.	ENSG00000112379	ENST00000251691	T	0.41400	1.0	5.55	-11.1	0.00147	SEC7-like (1);	0.961742	0.08755	N	0.898611	T	0.05960	0.0155	N	0.08118	0	0.21652	N	0.999603	B	0.28082	0.2	B	0.27715	0.082	T	0.23511	-1.0186	10	0.10111	T	0.7	-27.3714	17.443	0.87570	0.0:0.5172:0.0:0.4828	.	750	Q5TH69	BIG3_HUMAN	Q	750	ENSP00000251691:H750Q	ENSP00000251691:H750Q	H	+	3	2	KIAA1244	138641402	0.001000	0.12720	0.009000	0.14445	0.469000	0.32828	-1.680000	0.01939	-2.608000	0.00447	-2.416000	0.00220	CAC	KIAA1244	-	superfamily_ARM-type_fold,superfamily_Sec7,smart_Sec7	ENSG00000112379		0.602	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4	64	0.00	0	C	NM_020340		138599709	138599709	+1	no_errors	ENST00000251691	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	0.098	A
LAMB4	22798	genome.wustl.edu	37	7	107763589	107763589	+	Silent	SNP	A	A	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr7:107763589A>T	ENST00000388781.3	-	2	104	c.21T>A	c.(19-21)ctT>ctA	p.L7L	LAMB4_ENST00000205386.4_Silent_p.L7L|LAMB4_ENST00000388780.3_Silent_p.L7L|LAMB4_ENST00000414450.2_Silent_p.L7L|LAMB4_ENST00000418464.1_Silent_p.L7L	NM_007356.2	NP_031382.2	A4D0S4	LAMB4_HUMAN	laminin, beta 4	7					cell adhesion (GO:0007155)	basement membrane (GO:0005604)				NS(1)|breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(22)|lung(40)|ovary(4)|prostate(5)|skin(4)	97						GGTGCAAAAAAAGGGTCAGTT	0.299																																						dbGAP											0													101.0	104.0	103.0					7																	107763589		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF028816	CCDS34732.1	7q31	2013-03-01			ENSG00000091128	ENSG00000091128		"""Laminins"""	6491	protein-coding gene	gene with protein product							Standard	NM_007356		Approved		uc010ljo.1	A4D0S4	OTTHUMG00000154874	ENST00000388781.3:c.21T>A	7.37:g.107763589A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKU6|B2RTT3|B5MEB9|Q86TP7|Q86XN2|Q8NBX5	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.L7	ENST00000388781.3	37	c.21	CCDS34732.1	7																																																																																			LAMB4	-	NULL	ENSG00000091128		0.299	LAMB4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB4	HGNC	protein_coding	OTTHUMT00000337442.1	89	0.00	0	A	XM_209857		107763589	107763589	-1	no_errors	ENST00000205386	ensembl	human	known	69_37n	silent	61	15.28	11	SNP	0.000	T
LRP5	4041	genome.wustl.edu	37	11	68205945	68205945	+	Silent	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr11:68205945G>A	ENST00000294304.7	+	20	4249	c.4143G>A	c.(4141-4143)ccG>ccA	p.P1381P		NM_002335.2	NP_002326.2	O75197	LRP5_HUMAN	low density lipoprotein receptor-related protein 5	1381					adipose tissue development (GO:0060612)|anatomical structure regression (GO:0060033)|anterior/posterior pattern specification (GO:0009952)|apoptotic process involved in patterning of blood vessels (GO:1902262)|bone marrow development (GO:0048539)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|cell migration involved in gastrulation (GO:0042074)|cell-cell signaling involved in mammary gland development (GO:0060764)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic limb morphogenesis (GO:0030326)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|endocytosis (GO:0006897)|extracellular matrix-cell signaling (GO:0035426)|gastrulation with mouth forming second (GO:0001702)|glucose catabolic process (GO:0006007)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|osteoblast development (GO:0002076)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of mitosis (GO:0045840)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of apoptotic process (GO:0042981)|regulation of blood pressure (GO:0008217)|regulation of bone remodeling (GO:0046850)|regulation of canonical Wnt signaling pathway (GO:0060828)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|response to peptide hormone (GO:0043434)|retina morphogenesis in camera-type eye (GO:0060042)|retinal blood vessel morphogenesis (GO:0061304)|somatic stem cell maintenance (GO:0035019)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	coreceptor activity (GO:0015026)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(24)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						ACGACAGCCCGGCCCACAGCA	0.592																																						dbGAP											0													99.0	99.0	99.0					11																	68205945		2200	4294	6494	-	-	-	SO:0001819	synonymous_variant	0			AF064548	CCDS8181.1	11q13.4	2014-01-28	2003-03-12		ENSG00000162337	ENSG00000162337		"""Low density lipoprotein receptors"""	6697	protein-coding gene	gene with protein product		603506	"""osteoporosis pseudoglioma syndrome"", ""exudative vitreoretinopathy 1"""	LRP7, OPPG, EVR1		9714764, 10049586	Standard	XM_005273994		Approved	LR3, BMND1, HBM, OPS, OPTA1, VBCH2, EVR4	uc001ont.3	O75197	OTTHUMG00000167570	ENST00000294304.7:c.4143G>A	11.37:g.68205945G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96TD6|Q9UES7|Q9UP66	Silent	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EGF-like,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.P1381	ENST00000294304.7	37	c.4143	CCDS8181.1	11																																																																																			LRP5	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,superfamily_LDrepeatLR_classA_rpt	ENSG00000162337		0.592	LRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP5	HGNC	protein_coding	OTTHUMT00000395088.1	80	0.00	0	G	NM_002335		68205945	68205945	+1	no_errors	ENST00000294304	ensembl	human	known	69_37n	silent	67	14.10	11	SNP	0.000	A
LRSAM1	90678	genome.wustl.edu	37	9	130250014	130250014	+	Missense_Mutation	SNP	A	A	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr9:130250014A>T	ENST00000323301.4	+	17	1923	c.1319A>T	c.(1318-1320)aAc>aTc	p.N440I	LRSAM1_ENST00000373324.4_Missense_Mutation_p.N440I|LRSAM1_ENST00000483302.1_3'UTR|LRSAM1_ENST00000300417.6_Missense_Mutation_p.N440I|LRSAM1_ENST00000373322.1_Missense_Mutation_p.N440I	NM_138361.5	NP_612370.3	Q6UWE0	LRSM1_HUMAN	leucine rich repeat and sterile alpha motif containing 1	440					cell death (GO:0008219)|negative regulation of endocytosis (GO:0045806)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein polyubiquitination (GO:0000209)|ubiquitin-dependent endocytosis (GO:0070086)|viral budding (GO:0046755)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(2)	16						ATGGATCAGAACAAAGCCATC	0.547																																						dbGAP											0													80.0	68.0	72.0					9																	130250014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056203	CCDS6873.1, CCDS55347.1	9q34.13	2014-09-17			ENSG00000148356	ENSG00000148356		"""Sterile alpha motif (SAM) domain containing"""	25135	protein-coding gene	gene with protein product		610933				12975309	Standard	NM_001005373		Approved	FLJ31641	uc004brd.2	Q6UWE0	OTTHUMG00000020701	ENST00000323301.4:c.1319A>T	9.37:g.130250014A>T	ENSP00000322937:p.Asn440Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVV0|Q8NB40|Q96GT5|Q96MX5|Q96MZ7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,superfamily_PTS_PEP_utilis_N,smart_Leu-rich_rpt_typical-subtyp,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.N440I	ENST00000323301.4	37	c.1319	CCDS6873.1	9	.	.	.	.	.	.	.	.	.	.	A	16.60	3.169161	0.57584	.	.	ENSG00000148356	ENST00000300417;ENST00000373324;ENST00000323301;ENST00000373322	T;T;T;T	0.75589	1.36;-0.95;1.36;1.36	5.19	4.02	0.46733	.	0.196756	0.52532	D	0.000077	T	0.74245	0.3691	L	0.51422	1.61	0.44694	D	0.997686	P;P	0.52061	0.95;0.808	P;B	0.51806	0.68;0.347	T	0.74359	-0.3691	10	0.87932	D	0	-12.8461	8.4212	0.32700	0.8982:0.0:0.1018:0.0	.	440;440	Q6UWE0-2;Q6UWE0	.;LRSM1_HUMAN	I	440	ENSP00000300417:N440I;ENSP00000362421:N440I;ENSP00000322937:N440I;ENSP00000362419:N440I	ENSP00000300417:N440I	N	+	2	0	LRSAM1	129289835	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.854000	0.27791	0.777000	0.33496	-0.408000	0.06270	AAC	LRSAM1	-	NULL	ENSG00000148356		0.547	LRSAM1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRSAM1	HGNC	protein_coding	OTTHUMT00000054164.1	60	0.00	0	A	NM_138361		130250014	130250014	+1	no_errors	ENST00000300417	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	1.000	T
LYST	1130	genome.wustl.edu	37	1	235940493	235940493	+	Nonsense_Mutation	SNP	G	G	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:235940493G>C	ENST00000389794.3	-	17	5504	c.5330C>G	c.(5329-5331)tCa>tGa	p.S1777*	LYST_ENST00000536965.1_3'UTR|LYST_ENST00000389793.2_Nonsense_Mutation_p.S1777*			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1777					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AACTTCTTTTGAGCTGAAGGG	0.373																																						dbGAP											0													174.0	176.0	175.0					1																	235940493		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.5330C>G	1.37:g.235940493G>C	ENSP00000374444:p.Ser1777*	Somatic		WXS	Illumina GAIIx	Phase_IV	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1777*	ENST00000389794.3	37	c.5330	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	46	12.379311	0.99662	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	.	.	.	5.52	4.6	0.57074	.	0.505877	0.23123	N	0.051674	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.42905	T	0.14	.	13.7096	0.62661	0.1254:0.0:0.8746:0.0	.	.	.	.	X	1777	.	ENSP00000374443:S1777X	S	-	2	0	LYST	234007116	1.000000	0.71417	0.978000	0.43139	0.995000	0.86356	4.212000	0.58514	2.765000	0.95021	0.650000	0.86243	TCA	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.373	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	151	0.00	0	G			235940493	235940493	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	nonsense	95	15.18	17	SNP	0.987	C
MAN1B1	11253	genome.wustl.edu	37	9	140002075	140002075	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr9:140002075G>T	ENST00000371589.4	+	12	1930	c.1857G>T	c.(1855-1857)tgG>tgT	p.W619C	MAN1B1_ENST00000474902.1_Missense_Mutation_p.W322C|MAN1B1_ENST00000540391.1_3'UTR	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1	619					cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		ACCAGGACTGGGGCTGGGAGA	0.662																																						dbGAP											0													117.0	102.0	107.0					9																	140002075		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1857G>T	9.37:g.140002075G>T	ENSP00000360645:p.Trp619Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSG3|Q9BRS9|Q9Y5K7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.W619C	ENST00000371589.4	37	c.1857	CCDS7029.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	23.7|23.7	4.444406|4.444406	0.83993|0.83993	.|.	.|.	ENSG00000177239|ENSG00000177239	ENST00000535144;ENST00000475449;ENST00000550113|ENST00000371589;ENST00000474902	.|T;T	.|0.72835	.|-0.69;-0.69	4.66|4.66	4.66|4.66	0.58398|0.58398	.|.	.|.	.|.	.|.	.|.	D|D	0.88051|0.88051	0.6333|0.6333	M|M	0.93808|0.93808	3.46|3.46	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.97110	.|1.0;0.997;0.998	D|D	0.91325|0.91325	0.5085|0.5085	5|8	.|.	.|.	.|.	.|.	16.7075|16.7075	0.85376|0.85376	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|506;292;619	.|B4DPS9;B3KXZ1;Q9UKM7	.|.;.;MA1B1_HUMAN	W|C	593;93;57|619;322	.|ENSP00000360645:W619C;ENSP00000447256:W322C	.|.	G|W	+|+	1|3	0|0	MAN1B1|MAN1B1	139121896|139121896	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.896000|8.896000	0.92521|0.92521	2.443000|2.443000	0.82685|0.82685	0.561000|0.561000	0.74099|0.74099	GGG|TGG	MAN1B1	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	ENSG00000177239		0.662	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	46	0.00	0	G	NM_016219		140002075	140002075	+1	no_errors	ENST00000371589	ensembl	human	known	69_37n	missense	22	38.89	14	SNP	1.000	T
MANSC1	54682	genome.wustl.edu	37	12	12496115	12496116	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr12:12496115_12496116delAG	ENST00000535902.1	-	2	696_697	c.133_134delCT	c.(133-135)cttfs	p.L45fs	MANSC1_ENST00000396349.3_Intron			Q9H8J5	MANS1_HUMAN	MANSC domain containing 1	45	MANSC. {ECO:0000255|PROSITE- ProRule:PRU00341}.					integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|skin(1)|stomach(4)	23		Prostate(47;0.0865)		BRCA - Breast invasive adenocarcinoma(232;0.185)		TCCCTTAGAAAGAGATGACTGG	0.386																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK001160	CCDS8648.1	12p13.2	2006-04-12				ENSG00000111261			25505	protein-coding gene	gene with protein product						12975309	Standard	NM_018050		Approved	FLJ10298, LOH12CR3	uc001rai.1	Q9H8J5		ENST00000535902.1:c.133_134delCT	12.37:g.12496117_12496118delAG	ENSP00000438205:p.Leu45fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEC1|Q9NW60	Frame_Shift_Del	DEL	pfam_MANSC_N,smart_MANSC_N,pfscan_MANSC	p.L45fs	ENST00000535902.1	37	c.134_133	CCDS8648.1	12																																																																																			MANSC1	-	pfam_MANSC_N,smart_MANSC_N,pfscan_MANSC	ENSG00000111261		0.386	MANSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANSC1	HGNC	protein_coding	OTTHUMT00000400144.1	77	0.00	0	AG	NM_018050		12496115	12496116	-1	no_errors	ENST00000535902	ensembl	human	known	69_37n	frame_shift_del	61	17.57	13	DEL	0.974:0.973	-
MBTPS1	8720	genome.wustl.edu	37	16	84115459	84115459	+	Missense_Mutation	SNP	G	G	C	rs149021936	byFrequency	TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr16:84115459G>C	ENST00000343411.3	-	11	1836	c.1341C>G	c.(1339-1341)atC>atG	p.I447M	MBTPS1_ENST00000569770.1_5'UTR	NM_003791.2	NP_003782.1	Q14703	MBTP1_HUMAN	membrane-bound transcription factor peptidase, site 1	447	Peptidase S8.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|lipid metabolic process (GO:0006629)|lysosome organization (GO:0007040)|proteolysis (GO:0006508)|regulation of transcription factor import into nucleus (GO:0042990)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|lung(10)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GGGCTGACGCGATCAGGGCCT	0.532																																						dbGAP											0													65.0	66.0	66.0					16																	84115459		2200	4300	6500	-	-	-	SO:0001583	missense	0			D42053	CCDS10941.1	16q24	2008-08-04	2005-08-17		ENSG00000140943	ENSG00000140943			15456	protein-coding gene	gene with protein product		603355	"""membrane-bound transcription factor protease, site 1"""			9809072, 10944850	Standard	NM_003791		Approved	S1P, KIAA0091, SKI-1, PCSK8	uc002fhi.3	Q14703	OTTHUMG00000137639	ENST00000343411.3:c.1341C>G	16.37:g.84115459G>C	ENSP00000344223:p.Ile447Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6V8|Q24JQ2|Q9UF67	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.I447M	ENST00000343411.3	37	c.1341	CCDS10941.1	16	.	.	.	.	.	.	.	.	.	.	G	10.96	1.497470	0.26861	.	.	ENSG00000140943	ENST00000343411	T	0.47528	0.84	5.45	-10.9	0.00192	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.23965	0.0580	L	0.31065	0.9	0.45194	D	0.998206	B	0.29671	0.254	B	0.32805	0.153	T	0.49670	-0.8915	10	0.17832	T	0.49	-23.2059	9.1263	0.36816	0.2956:0.0:0.525:0.1793	.	447	Q14703	MBTP1_HUMAN	M	447	ENSP00000344223:I447M	ENSP00000344223:I447M	I	-	3	3	MBTPS1	82672960	0.001000	0.12720	0.051000	0.19133	0.719000	0.41307	-1.193000	0.03049	-2.948000	0.00294	-1.267000	0.01435	ATC	MBTPS1	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000140943		0.532	MBTPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS1	HGNC	protein_coding	OTTHUMT00000269080.2	55	0.00	0	G	NM_003791		84115459	84115459	-1	no_errors	ENST00000343411	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	0.227	C
MYT1	4661	genome.wustl.edu	37	20	62859285	62859285	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr20:62859285C>A	ENST00000328439.1	+	18	3000	c.2636C>A	c.(2635-2637)gCa>gAa	p.A879E	MYT1_ENST00000360149.4_Missense_Mutation_p.A558E|MYT1_ENST00000536311.1_Missense_Mutation_p.A906E	NM_004535.2	NP_004526.1	Q99640	PMYT1_HUMAN	myelin transcription factor 1	0					G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of phosphatase activity (GO:0010923)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(12)|liver(1)|lung(17)|ovary(5)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55	all_cancers(38;1.82e-11)|all_epithelial(29;3.3e-13)|Lung NSC(23;5.21e-10)|all_lung(23;1.92e-09)					GTCAAGGTGGCACCCACCAAG	0.512																																					GBM(59;481 1041 20555 21139 33705)	dbGAP											0													93.0	89.0	90.0					20																	62859285		2203	4300	6503	-	-	-	SO:0001583	missense	0			M96980	CCDS13558.1	20q13.33	2014-03-24			ENSG00000196132	ENSG00000196132		"""Zinc fingers, C2HC-type containing"""	7622	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 2"""	600379		PLPB1		1280325, 9268380	Standard	NM_004535		Approved	MTF1, MYTI, ZC2HC4A, NZF2	uc002yii.3	Q01538	OTTHUMG00000149988	ENST00000328439.1:c.2636C>A	20.37:g.62859285C>A	ENSP00000327465:p.Ala879Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUN8|B4DXD4|D3DUA4|F8W164|I3L1V2|O14731|Q7LE24|Q8TCM9	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.A906E	ENST00000328439.1	37	c.2717	CCDS13558.1	20	.	.	.	.	.	.	.	.	.	.	C	12.48	1.950535	0.34377	.	.	ENSG00000196132	ENST00000360149;ENST00000328439;ENST00000536311	T;T;T	0.43688	0.94;0.95;0.95	5.67	4.73	0.59995	.	0.114744	0.56097	D	0.000021	T	0.43500	0.1250	L	0.31578	0.945	0.30963	N	0.723462	B;B;B	0.29508	0.246;0.07;0.026	B;B;B	0.43536	0.423;0.091;0.014	T	0.54879	-0.8227	10	0.52906	T	0.07	-2.4162	14.5401	0.67987	0.0:0.9295:0.0:0.0705	.	906;879;558	F5H7M8;Q01538;Q6P6D5	.;MYT1_HUMAN;.	E	558;879;906	ENSP00000353269:A558E;ENSP00000327465:A879E;ENSP00000442412:A906E	ENSP00000327465:A879E	A	+	2	0	MYT1	62329729	0.958000	0.32768	0.239000	0.24122	0.600000	0.36913	3.958000	0.56737	1.398000	0.46701	0.655000	0.94253	GCA	MYT1	-	NULL	ENSG00000196132		0.512	MYT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYT1	HGNC	protein_coding	OTTHUMT00000080297.1	75	0.00	0	C	NM_004535		62859285	62859285	+1	no_errors	ENST00000536311	ensembl	human	known	69_37n	missense	82	18.81	19	SNP	0.949	A
NES	10763	genome.wustl.edu	37	1	156641877	156641877	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:156641877C>A	ENST00000368223.3	-	4	2235	c.2103G>T	c.(2101-2103)agG>agT	p.R701S		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	701	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTTCAAGAGACCTCAGGGGTT	0.478																																						dbGAP											0													70.0	67.0	68.0					1																	156641877		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.2103G>T	1.37:g.156641877C>A	ENSP00000357206:p.Arg701Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_F	p.R701S	ENST00000368223.3	37	c.2103	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	C	13.33	2.204151	0.38905	.	.	ENSG00000132688	ENST00000368223	D	0.85773	-2.03	5.4	2.09	0.27110	.	0.438594	0.16780	N	0.199807	T	0.60547	0.2277	L	0.38838	1.175	0.09310	N	1	B	0.18863	0.031	B	0.14023	0.01	T	0.55604	-0.8115	10	0.51188	T	0.08	.	6.5397	0.22372	0.1398:0.6887:0.0:0.1715	.	701	P48681	NEST_HUMAN	S	701	ENSP00000357206:R701S	ENSP00000357206:R701S	R	-	3	2	NES	154908501	0.000000	0.05858	0.005000	0.12908	0.255000	0.26057	-0.418000	0.07080	0.541000	0.28827	0.563000	0.77884	AGG	NES	-	NULL	ENSG00000132688		0.478	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	63	0.00	0	C	NM_006617		156641877	156641877	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	missense	71	10.13	8	SNP	0.016	A
NKAIN3	286183	genome.wustl.edu	37	8	63659492	63659492	+	Splice_Site	SNP	A	A	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr8:63659492A>T	ENST00000523211.1	+	4	407	c.275A>T	c.(274-276)gAc>gTc	p.D92V	NKAIN3_ENST00000328472.5_Splice_Site_p.D92V|NKAIN3_ENST00000519049.1_3'UTR	NM_173688.2	NP_775959.1	Q8N8D7	NKAI3_HUMAN	Na+/K+ transporting ATPase interacting 3	92						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(3)|large_intestine(2)|lung(8)	13	Breast(64;0.127)	Lung NSC(129;0.187)				CCCACCTAGGACACCGATCTA	0.453																																						dbGAP											0													110.0	103.0	106.0					8																	63659492		1986	4160	6146	-	-	-	SO:0001630	splice_region_variant	0			AK096949	CCDS55239.1	8q12.3	2014-08-12	2007-10-04	2007-10-04	ENSG00000185942	ENSG00000185942		"""Na+/K+ transporting ATPase interacting"""	26829	protein-coding gene	gene with protein product		612872	"""family with sequence similarity 77, member D"""	FAM77D		17606467	Standard	NM_173688		Approved	FLJ39630	uc010lyq.1	Q8N8D7	OTTHUMG00000164361	ENST00000523211.1:c.274-1A>T	8.37:g.63659492A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Na/K-Atpase_Interacting	p.D92V	ENST00000523211.1	37	c.275	CCDS55239.1	8	.	.	.	.	.	.	.	.	.	.	A	23.3	4.403629	0.83230	.	.	ENSG00000185942	ENST00000545532;ENST00000523211;ENST00000524201;ENST00000328472	T;T;T	0.19669	2.13;2.13;2.13	5.86	5.86	0.93980	.	0.064020	0.64402	D	0.000006	T	0.43942	0.1270	M	0.76002	2.32	0.80722	D	1	D	0.60160	0.987	P	0.60012	0.867	T	0.36286	-0.9754	10	0.52906	T	0.07	-13.2046	15.435	0.75140	1.0:0.0:0.0:0.0	.	92	Q8N8D7	NKAI3_HUMAN	V	92;92;65;92	ENSP00000429073:D92V;ENSP00000429393:D65V;ENSP00000333627:D92V	ENSP00000333627:D92V	D	+	2	0	NKAIN3	63822046	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	8.855000	0.92236	2.244000	0.73946	0.528000	0.53228	GAC	NKAIN3	-	pfam_Na/K-Atpase_Interacting	ENSG00000185942		0.453	NKAIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAIN3	HGNC	protein_coding	OTTHUMT00000378447.2	97	0.00	0	A	NM_173688	Missense_Mutation	63659492	63659492	+1	no_errors	ENST00000328472	ensembl	human	known	69_37n	missense	72	14.29	12	SNP	1.000	T
OR52J3	119679	genome.wustl.edu	37	11	5068215	5068215	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr11:5068215C>T	ENST00000380370.1	+	1	460	c.460C>T	c.(460-462)Ccc>Tcc	p.P154S		NM_001001916.2	NP_001001916.2	Q8NH60	O52J3_HUMAN	olfactory receptor, family 52, subfamily J, member 3	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(6)|large_intestine(6)|lung(19)|ovary(1)|skin(2)	36		Medulloblastoma(188;0.00131)|all_neural(188;0.0189)|Breast(177;0.0204)		Epithelial(150;9.29e-10)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.19)		TGTAATTCGTCCCGTTTTACT	0.478																																						dbGAP											0													199.0	133.0	156.0					11																	5068215		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065530	CCDS31370.1	11p15.4	2012-08-09			ENSG00000205495	ENSG00000205495		"""GPCR / Class A : Olfactory receptors"""	14799	protein-coding gene	gene with protein product							Standard	NM_001001916		Approved		uc010qyv.2	Q8NH60	OTTHUMG00000066600	ENST00000380370.1:c.460C>T	11.37:g.5068215C>T	ENSP00000369728:p.Pro154Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFE4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P154S	ENST00000380370.1	37	c.460	CCDS31370.1	11	.	.	.	.	.	.	.	.	.	.	C	0.011	-1.720496	0.00700	.	.	ENSG00000205495	ENST00000380370	T	0.29142	1.58	4.19	3.27	0.37495	GPCR, rhodopsin-like superfamily (1);	0.328746	0.22030	N	0.065610	T	0.10380	0.0254	N	0.00317	-1.655	0.09310	N	1	P	0.45902	0.868	P	0.56216	0.794	T	0.41360	-0.9513	10	0.02654	T	1	.	2.9754	0.05936	0.1873:0.5334:0.1811:0.0983	.	154	Q8NH60	O52J3_HUMAN	S	154	ENSP00000369728:P154S	ENSP00000369728:P154S	P	+	1	0	OR52J3	5024791	0.001000	0.12720	0.108000	0.21378	0.008000	0.06430	-0.229000	0.09098	0.949000	0.37715	0.655000	0.94253	CCC	OR52J3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000205495		0.478	OR52J3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52J3	HGNC	protein_coding	OTTHUMT00000142807.1	98	0.00	0	C	NM_001001916		5068215	5068215	+1	no_errors	ENST00000380370	ensembl	human	known	69_37n	missense	58	19.44	14	SNP	0.004	T
PCDHGA11	56105	genome.wustl.edu	37	5	140801206	140801206	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr5:140801206G>A	ENST00000398587.2	+	1	445	c.412G>A	c.(412-414)Gaa>Aaa	p.E138K	PCDHGA11_ENST00000518882.1_Missense_Mutation_p.E138K|PCDHGA10_ENST00000398610.2_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA5_ENST00000518069.1_Intron	NM_018914.2|NM_032092.1	NP_061737.1|NP_114481.1	Q9Y5H2	PCDGB_HUMAN	protocadherin gamma subfamily A, 11	138	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|endometrium(8)|kidney(3)|large_intestine(9)|lung(22)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	49			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGGAGGACGAAGTGGAGAT	0.473																																						dbGAP											0													29.0	30.0	30.0					5																	140801206		1945	4148	6093	-	-	-	SO:0001583	missense	0			AF152505	CCDS47294.1, CCDS54930.1, CCDS75345.1	5q31	2010-01-26			ENSG00000253873	ENSG00000253873		"""Cadherins / Protocadherins : Clustered"""	8698	other	protocadherin		606298				10380929	Standard	NM_018914		Approved	PCDH-GAMMA-A11		Q9Y5H2	OTTHUMG00000164055	ENST00000398587.2:c.412G>A	5.37:g.140801206G>A	ENSP00000381589:p.Glu138Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZVY8|Q9Y5D8|Q9Y5D9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E138K	ENST00000398587.2	37	c.412	CCDS47294.1	5	.	.	.	.	.	.	.	.	.	.	g	11.19	1.566344	0.27915	.	.	ENSG00000253873	ENST00000398587;ENST00000518882	T;T	0.20881	2.04;2.04	5.93	5.93	0.95920	Cadherin (2);Cadherin-like (1);	0.000000	0.28933	U	0.013678	T	0.21881	0.0527	M	0.67397	2.05	0.19775	N	0.999952	B;P;P	0.40398	0.338;0.716;0.669	B;B;B	0.38985	0.07;0.287;0.169	T	0.40924	-0.9537	10	0.48119	T	0.1	.	5.8203	0.18524	0.1736:0.165:0.6614:0.0	.	138;138;138	Q9Y5H2;Q9Y5H2-3;Q9Y5H2-2	PCDGB_HUMAN;.;.	K	138	ENSP00000381589:E138K;ENSP00000428333:E138K	ENSP00000381589:E138K	E	+	1	0	PCDHGA11	140781390	0.046000	0.20272	0.993000	0.49108	0.612000	0.37316	1.047000	0.30367	2.814000	0.96858	0.591000	0.81541	GAA	PCDHGA11	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000253873		0.473	PCDHGA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA11	HGNC	protein_coding	OTTHUMT00000376974.1	35	0.00	0	G	NM_018914		140801206	140801206	+1	no_errors	ENST00000398587	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.460	A
PIGA	5277	genome.wustl.edu	37	X	15343249	15343249	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chrX:15343249G>A	ENST00000333590.4	-	4	958	c.874C>T	c.(874-876)Cac>Tac	p.H292Y	PIGA_ENST00000542278.1_Missense_Mutation_p.H58Y|PIGA_ENST00000428964.1_5'UTR|PIGA_ENST00000482148.1_5'UTR	NM_002641.3	NP_002632.1	P37287	PIGA_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class A	292					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|positive regulation of metabolic process (GO:0009893)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|glycosylphosphatidylinositol-N-acetylglucosaminyltransferase (GPI-GnT) complex (GO:0000506)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	phosphatidylinositol N-acetylglucosaminyltransferase activity (GO:0017176)|UDP-glycosyltransferase activity (GO:0008194)			endometrium(2)|kidney(2)|large_intestine(2)|ovary(1)|prostate(2)|urinary_tract(1)	10	Hepatocellular(33;0.183)					ACATCCTTGTGTTCTAAAGCT	0.388																																						dbGAP											0													91.0	85.0	87.0					X																	15343249		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038236	CCDS14165.1, CCDS48086.1, CCDS48086.2	Xp22.1	2014-09-17	2008-07-31		ENSG00000165195	ENSG00000165195	2.4.1.198	"""Glycosyltransferase group 1 domain containing"", ""Phosphatidylinositol glycan anchor biosynthesis"""	8957	protein-coding gene	gene with protein product	"""paroxysmal nocturnal hemoglobinuria"", ""phosphatidylinositol N-acetylglucosaminyltransferase"""	311770	"""phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria)"""			8500164	Standard	NM_002641		Approved	GPI3	uc004cwr.3	P37287	OTTHUMG00000021174	ENST00000333590.4:c.874C>T	X.37:g.15343249G>A	ENSP00000369820:p.His292Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0V2|Q16025|Q16250	Missense_Mutation	SNP	pfam_PIGA_GPI_anchor_biosynthesis,pfam_Glyco_trans_1	p.H292Y	ENST00000333590.4	37	c.874	CCDS14165.1	X	.	.	.	.	.	.	.	.	.	.	G	29.8	5.036253	0.93630	.	.	ENSG00000165195	ENST00000542278;ENST00000333590	T;T	0.79352	-1.26;-0.96	5.92	5.92	0.95590	Glycosyl transferase, family 1 (1);	0.000000	0.85682	D	0.000000	D	0.89203	0.6648	M	0.83012	2.62	0.80722	D	1	D;D;D	0.89917	0.986;1.0;1.0	P;D;D	0.79784	0.887;0.992;0.993	D	0.89973	0.4095	10	0.62326	D	0.03	-12.8258	18.1297	0.89597	0.0:0.0:1.0:0.0	.	58;123;292	B4E0V2;P37287-2;P37287	.;.;PIGA_HUMAN	Y	58;292	ENSP00000442653:H58Y;ENSP00000369820:H292Y	ENSP00000369820:H292Y	H	-	1	0	PIGA	15253170	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.095000	0.94175	2.505000	0.84491	0.600000	0.82982	CAC	PIGA	-	pfam_Glyco_trans_1	ENSG00000165195		0.388	PIGA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGA	HGNC	protein_coding	OTTHUMT00000055854.1	70	0.00	0	G	NM_002641		15343249	15343249	-1	no_errors	ENST00000333590	ensembl	human	known	69_37n	missense	80	16.67	16	SNP	1.000	A
PIWIL1	9271	genome.wustl.edu	37	12	130839528	130839528	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr12:130839528C>T	ENST00000245255.3	+	11	1539	c.1267C>T	c.(1267-1269)Cga>Tga	p.R423*		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	423					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)	p.R423*(2)		breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		TGAAGTGGGACGACTCATTGA	0.383																																						dbGAP											2	Substitution - Nonsense(2)	large_intestine(1)|prostate(1)											203.0	191.0	195.0					12																	130839528		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1267C>T	12.37:g.130839528C>T	ENSP00000245255:p.Arg423*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Nonsense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R423*	ENST00000245255.3	37	c.1267	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.971572	0.97162	.	.	ENSG00000125207	ENST00000245255	.	.	.	5.38	1.83	0.25207	.	0.140427	0.64402	D	0.000016	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.8838	13.114	0.59289	0.4705:0.5295:0.0:0.0	.	.	.	.	X	423	.	ENSP00000245255:R423X	R	+	1	2	PIWIL1	129405481	0.402000	0.25311	0.037000	0.18230	0.353000	0.29299	1.645000	0.37238	0.076000	0.16826	-0.375000	0.07067	CGA	PIWIL1	-	superfamily_RNaseH-like_dom,superfamily_PAZ	ENSG00000125207		0.383	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	79	0.00	0	C			130839528	130839528	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	nonsense	78	11.36	10	SNP	0.046	T
PKHD1L1	93035	genome.wustl.edu	37	8	110510689	110510690	+	Splice_Site	DEL	AG	AG	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr8:110510689_110510690delAG	ENST00000378402.5	+	66	10703		c.e66-1			NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1						immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATTTCCAAACAGAGCTCATTAA	0.426										HNSCC(38;0.096)																												dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10600-1AG>-	8.37:g.110510691_110510692delAG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Splice_Site	DEL	-	e66-1	ENST00000378402.5	37	c.10600-2_10600-1	CCDS47911.1	8																																																																																			PKHD1L1	-	-	ENSG00000205038		0.426	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	96	0.00	0	AG	NM_177531	Intron	110510689	110510690	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	splice_site_del	87	10.31	10	DEL	0.996:1.000	-
PKHD1L1	93035	genome.wustl.edu	37	8	110510689	110510690	+	Splice_Site	DEL	AG	AG	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr8:110510689_110510690delAG	ENST00000378402.5	+	66	10703		c.e66-1			NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1						immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATTTCCAAACAGAGCTCATTAA	0.426										HNSCC(38;0.096)																												dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.10600-1AG>-	8.37:g.110510691_110510692delAG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Splice_Site	DEL	-	e66-1	ENST00000378402.5	37	c.10600-2_10600-1	CCDS47911.1	8																																																																																			PKHD1L1	-	-	ENSG00000205038		0.426	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	96	0	0	AG	NM_177531	Intron	110510689	110510690	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	splice_site_del	87	10.31	10	DEL	0.996:1.000	0
PKHD1L1	93035	genome.wustl.edu	37	8	110527423	110527423	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr8:110527423T>C	ENST00000378402.5	+	72	11682	c.11578T>C	c.(11578-11580)Tcc>Ccc	p.S3860P		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3860					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			AATTTTCTTTTCCACACTTCA	0.323										HNSCC(38;0.096)																												dbGAP											0													88.0	76.0	80.0					8																	110527423		1818	4077	5895	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.11578T>C	8.37:g.110527423T>C	ENSP00000367655:p.Ser3860Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.S3860P	ENST00000378402.5	37	c.11578	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	T	13.10	2.135414	0.37728	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.86230	-2.09;-1.87	5.29	1.39	0.22231	.	0.123361	0.56097	N	0.000026	T	0.77791	0.4183	L	0.35288	1.05	0.28385	N	0.919356	B	0.06786	0.001	B	0.08055	0.003	T	0.64076	-0.6492	10	0.33141	T	0.24	.	9.239	0.37484	0.0:0.1238:0.0:0.8762	.	3860	Q86WI1	PKHL1_HUMAN	P	3860;788	ENSP00000367655:S3860P;ENSP00000437376:S788P	ENSP00000367655:S3860P	S	+	1	0	PKHD1L1	110596599	1.000000	0.71417	0.994000	0.49952	0.954000	0.61252	2.170000	0.42443	0.001000	0.14605	0.477000	0.44152	TCC	PKHD1L1	-	NULL	ENSG00000205038		0.323	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	107	0.00	0	T	NM_177531		110527423	110527423	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	71	22.83	21	SNP	1.000	C
PLCG2	5336	genome.wustl.edu	37	16	81953183	81953183	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr16:81953183G>A	ENST00000359376.3	+	20	2363	c.2149G>A	c.(2149-2151)Gtc>Atc	p.V717I		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	717	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						GGTGGAGCTCGTCAGTTACTA	0.572																																						dbGAP											0													71.0	76.0	74.0					16																	81953183		1940	4128	6068	-	-	-	SO:0001583	missense	0				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.2149G>A	16.37:g.81953183G>A	ENSP00000352336:p.Val717Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_Ca-dep,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pirsf_PLC-gamma,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.V717I	ENST00000359376.3	37	c.2149	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392548	0.62066	.	.	ENSG00000197943	ENST00000359376	D	0.93247	-3.19	5.16	5.16	0.70880	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (1);SH2 motif (5);	0.000000	0.85682	D	0.000000	D	0.93874	0.8040	L	0.29908	0.895	0.80722	D	1	P;D	0.76494	0.892;0.999	P;D	0.81914	0.67;0.995	D	0.91324	0.5084	10	0.14252	T	0.57	.	18.6547	0.91448	0.0:0.0:1.0:0.0	.	584;717	B4E3H3;P16885	.;PLCG2_HUMAN	I	717	ENSP00000352336:V717I	ENSP00000352336:V717I	V	+	1	0	PLCG2	80510684	1.000000	0.71417	0.983000	0.44433	0.897000	0.52465	6.590000	0.74085	2.392000	0.81423	0.655000	0.94253	GTC	PLCG2	-	pfam_SH2,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_SH2,pirsf_PLC-gamma,prints_SH2,pfscan_SH2	ENSG00000197943		0.572	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	HGNC	protein_coding	OTTHUMT00000432429.1	50	0.00	0	G			81953183	81953183	+1	no_errors	ENST00000359376	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	1.000	A
POLR2B	5431	genome.wustl.edu	37	4	57881680	57881681	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr4:57881680_57881681delAG	ENST00000381227.1	+	15	2226_2227	c.1813_1814delAG	c.(1813-1815)agafs	p.R605fs	POLR2B_ENST00000441246.2_Frame_Shift_Del_p.R598fs|POLR2B_ENST00000314595.5_Frame_Shift_Del_p.R605fs|POLR2B_ENST00000431623.2_Frame_Shift_Del_p.R530fs|POLR2B_ENST00000510355.1_3'UTR			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	605					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					TTCTATGATCAGAGATATTCGA	0.327																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.1813_1814delAG	4.37:g.57881682_57881683delAG	ENSP00000370625:p.Arg605fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A8|Q8IZ61	Frame_Shift_Del	DEL	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpb2_4,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_5	p.D606fs	ENST00000381227.1	37	c.1813_1814	CCDS3511.1	4																																																																																			POLR2B	-	pfam_RNA_pol_Rpb2_4	ENSG00000047315		0.327	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2B	HGNC	protein_coding	OTTHUMT00000250692.1	60	0.00	0	AG	NM_000938		57881680	57881681	+1	no_errors	ENST00000314595	ensembl	human	known	69_37n	frame_shift_del	57	10.94	7	DEL	1.000:1.000	-
PRKD1	5587	genome.wustl.edu	37	14	30108065	30108065	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr14:30108065T>C	ENST00000331968.5	-	5	971	c.742A>G	c.(742-744)Aat>Gat	p.N248D	PRKD1_ENST00000551644.1_5'UTR|PRKD1_ENST00000415220.2_Missense_Mutation_p.N256D	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	248					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		GATTGAGAATTTGACCTCTTC	0.388																																						dbGAP											0													96.0	95.0	95.0					14																	30108065		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.742A>G	14.37:g.30108065T>C	ENSP00000333568:p.Asn248Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL64|B2RAF6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.N248D	ENST00000331968.5	37	c.742	CCDS9637.1	14	.	.	.	.	.	.	.	.	.	.	T	13.93	2.384141	0.42308	.	.	ENSG00000184304	ENST00000331968;ENST00000415220	T;T	0.65549	-0.12;-0.16	5.45	5.45	0.79879	.	0.112528	0.64402	D	0.000012	T	0.52289	0.1725	L	0.44542	1.39	0.40000	D	0.975155	B	0.06786	0.001	B	0.14023	0.01	T	0.50423	-0.8830	10	0.33940	T	0.23	-32.1282	10.2166	0.43173	0.0:0.0745:0.0:0.9255	.	248	Q15139	KPCD1_HUMAN	D	248;256	ENSP00000333568:N248D;ENSP00000390535:N256D	ENSP00000333568:N248D	N	-	1	0	PRKD1	29177816	1.000000	0.71417	0.968000	0.41197	0.995000	0.86356	4.822000	0.62686	2.192000	0.70111	0.528000	0.53228	AAT	PRKD1	-	NULL	ENSG00000184304		0.388	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	78	0.00	0	T	NM_002742		30108065	30108065	-1	no_errors	ENST00000331968	ensembl	human	known	69_37n	missense	73	12.05	10	SNP	0.983	C
ZNF512B	57473	genome.wustl.edu	37	20	62630991	62630991	+	Intron	SNP	T	T	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr20:62630991T>A	ENST00000450537.1	-	2	56				ZNF512B_ENST00000217130.3_Intron|PRPF6_ENST00000535781.1_Missense_Mutation_p.V301D			Q96KM6	Z512B_HUMAN	zinc finger protein 512B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CTCAAGTCTGTTCGGGAGACG	0.567																																						dbGAP											0													115.0	101.0	105.0					20																	62630991		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.5-31683A>T	20.37:g.62630991T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AK9|Q9ULM4	Missense_Mutation	SNP	pfam_PRP1_N,smart_HAT,smart_TPR_repeat,pfscan_TPR-contain_dom	p.V301D	ENST00000450537.1	37	c.902	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	T	22.3	4.273894	0.80580	.	.	ENSG00000101161	ENST00000266079;ENST00000535781	T;T	0.34072	1.38;1.38	5.54	5.54	0.83059	Tetratricopeptide-like helical (1);	0.109569	0.64402	D	0.000008	T	0.69269	0.3092	M	0.93638	3.44	0.80722	D	1	D;D	0.71674	0.998;0.977	D;D	0.71870	0.975;0.926	T	0.78633	-0.2128	10	0.72032	D	0.01	-8.5548	15.7324	0.77817	0.0:0.0:0.0:1.0	.	301;301	O94906-2;O94906	.;PRP6_HUMAN	D	301	ENSP00000266079:V301D;ENSP00000446216:V301D	ENSP00000266079:V301D	V	+	2	0	PRPF6	62101435	1.000000	0.71417	1.000000	0.80357	0.821000	0.46438	7.463000	0.80869	2.118000	0.64928	0.529000	0.55759	GTT	PRPF6	-	smart_HAT	ENSG00000101161		0.567	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF6	HGNC	protein_coding	OTTHUMT00000080246.1	42	0.00	0	T	NM_020713		62630991	62630991	+1	no_errors	ENST00000266079	ensembl	human	known	69_37n	missense	35	26.53	13	SNP	1.000	A
PTEN	5728	genome.wustl.edu	37	10	89624279	89624280	+	Frame_Shift_Ins	INS	-	-	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr10:89624279_89624280insG	ENST00000371953.3	+	1	1410_1411	c.53_54insG	c.(52-57)gaggatfs	p.D19fs	KLLN_ENST00000445946.3_5'Flank	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	19	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.		D -> N (in malignant melanoma; somatic mutation). {ECO:0000269|PubMed:10978354}.		activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(13)|p.R15fs*23(1)|p.D19fs*24(1)|p.E18fs*5(1)|p.Y16fs*21(1)|p.N12fs*6(1)|p.R14_D22del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		AGATATCAAGAGGATGGATTCG	0.465		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	56	Whole gene deletion(37)|Unknown(13)|Deletion - Frameshift(5)|Deletion - In frame(1)	prostate(14)|central_nervous_system(11)|skin(7)|lung(6)|endometrium(4)|ovary(3)|haematopoietic_and_lymphoid_tissue(2)|bone(2)|breast(2)|biliary_tract(1)|stomach(1)|soft_tissue(1)|urinary_tract(1)|kidney(1)	GRCh37	CD033224	PTEN	D																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.55dupG	10.37:g.89624281_89624281dupG	ENSP00000361021:p.Asp19fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Frame_Shift_Ins	INS	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.D19fs	ENST00000371953.3	37	c.53_54	CCDS31238.1	10																																																																																			PTEN	-	pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Phosphatase_tensin-typ	ENSG00000171862		0.465	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	116	0.00	0	-	NM_000314		89624279	89624280	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	frame_shift_ins	78	18.75	18	INS	1.000:1.000	G
PTEN	5728	genome.wustl.edu	37	10	89692935	89692935	+	Nonsense_Mutation	SNP	T	T	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr10:89692935T>G	ENST00000371953.3	+	5	1776	c.419T>G	c.(418-420)tTa>tGa	p.L140*		NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	140	Phosphatase tensin-type. {ECO:0000255|PROSITE-ProRule:PRU00590}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.?(5)|p.R55fs*1(5)|p.L140*(2)|p.Y27fs*1(2)|p.L139fs*7(1)|p.A121_F145del(1)|p.I135fs*6(1)|p.F56fs*2(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GCATATTTATTACATCGGGGC	0.383		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	55	Whole gene deletion(37)|Deletion - Frameshift(10)|Unknown(5)|Substitution - Nonsense(2)|Deletion - In frame(1)	prostate(16)|central_nervous_system(11)|skin(6)|lung(5)|haematopoietic_and_lymphoid_tissue(4)|endometrium(4)|breast(3)|ovary(3)|cervix(1)|soft_tissue(1)|urinary_tract(1)											100.0	98.0	98.0					10																	89692935		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.419T>G	10.37:g.89692935T>G	ENSP00000361021:p.Leu140*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Nonsense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.L140*	ENST00000371953.3	37	c.419	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	T	48	14.366445	0.99792	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.22	5.22	0.72569	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.6633	15.1019	0.72284	0.0:0.0:0.0:1.0	.	.	.	.	X	140	.	.	L	+	2	0	PTEN	89682915	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.661000	0.83786	1.953000	0.56701	0.533000	0.62120	TTA	PTEN	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ	ENSG00000171862		0.383	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	49	0.00	0	T	NM_000314		89692935	89692935	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	nonsense	64	21.95	18	SNP	1.000	G
RAI1	10743	genome.wustl.edu	37	17	17699094	17699095	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr17:17699094_17699095delCT	ENST00000353383.1	+	3	3301_3302	c.2832_2833delCT	c.(2830-2835)tcctctfs	p.SS944fs	RAI1_ENST00000261641.6_Frame_Shift_Del_p.SS944fs	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	944					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		GGTTTGAGTCCTCTCTGTCACA	0.634																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.2832_2833delCT	17.37:g.17699098_17699099delCT	ENSP00000323074:p.Ser944fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Frame_Shift_Del	DEL	smart_Znf_PHD	p.L946fs	ENST00000353383.1	37	c.2832_2833	CCDS11188.1	17																																																																																			RAI1	-	NULL	ENSG00000108557		0.634	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1	23	0.00	0	CT	NM_030665		17699094	17699095	+1	no_errors	ENST00000353383	ensembl	human	known	69_37n	frame_shift_del	16	23.81	5	DEL	0.986:0.999	-
RAPGEF6	51735	genome.wustl.edu	37	5	130840456	130840456	+	Nonsense_Mutation	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr5:130840456G>A	ENST00000509018.1	-	11	1322	c.1117C>T	c.(1117-1119)Cag>Tag	p.Q373*	CTC-432M15.3_ENST00000514667.1_Nonsense_Mutation_p.Q423*|RAPGEF6_ENST00000296859.6_Nonsense_Mutation_p.Q373*|RAPGEF6_ENST00000510071.1_Nonsense_Mutation_p.Q373*|RAPGEF6_ENST00000507093.1_Nonsense_Mutation_p.Q373*|RAPGEF6_ENST00000307984.5_Nonsense_Mutation_p.Q373*|RAPGEF6_ENST00000512052.1_Nonsense_Mutation_p.Q88*|RAPGEF6_ENST00000308008.6_Nonsense_Mutation_p.Q373*	NM_001164386.1|NM_016340.5	NP_001157858.1|NP_057424.3	Q8TEU7	RPGF6_HUMAN	Rap guanine nucleotide exchange factor (GEF) 6	373					positive regulation of GTPase activity (GO:0043547)|Ras protein signal transduction (GO:0007265)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTP-dependent protein binding (GO:0030742)|guanyl-nucleotide exchange factor activity (GO:0005085)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|skin(1)|stomach(1)	31			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Lung(113;0.0721)		TAATCTTGCTGGGCTATGCAG	0.378																																					Melanoma(168;435 1955 13113 13877 23213)	dbGAP											0													88.0	83.0	85.0					5																	130840456		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF117947	CCDS34225.1, CCDS54897.1, CCDS54898.1, CCDS54899.1, CCDS54900.1	5q31.1	2008-02-05	2004-03-01	2004-03-02	ENSG00000158987	ENSG00000158987			20655	protein-coding gene	gene with protein product		610499	"""PDZ domain containing guanine nucleotide exchange factor (GEF) 2"""	PDZGEF2		11524421, 12095257	Standard	NM_016340		Approved	RA-GEF-2, PDZ-GEF2	uc010jdi.2	Q8TEU7	OTTHUMG00000162683	ENST00000509018.1:c.1117C>T	5.37:g.130840456G>A	ENSP00000421684:p.Gln373*	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KN82|A5PLL6|B7ZML2|E9PDV7|Q8NI21|Q8TEU6|Q96PC1	Nonsense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_PDZ,pfam_Ras-assoc,pfam_cNMP-bd_dom,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,superfamily_PDZ,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ras-like_Gua-exchang_fac_N,smart_PDZ,smart_Ras-assoc,smart_RasGRF_CDC25,pfscan_cNMP-bd_dom,pfscan_PDZ,pfscan_Ras-assoc,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.Q373*	ENST00000509018.1	37	c.1117	CCDS34225.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.553354	0.96501	.	.	ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000158987;ENSG00000217128	ENST00000509018;ENST00000307984;ENST00000507093;ENST00000296859;ENST00000358714;ENST00000512052;ENST00000308008;ENST00000510071;ENST00000514667	.	.	.	5.03	5.03	0.67393	.	0.073837	0.56097	D	0.000035	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.3628	0.90380	0.0:0.0:1.0:0.0	.	.	.	.	X	373;373;373;373;373;88;373;373;423	.	ENSP00000426948:Q423X	Q	-	1	0	RAPGEF6;FNIP1	130868355	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.928000	0.87587	2.357000	0.79964	0.313000	0.20887	CAG	RAPGEF6	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000158987		0.378	RAPGEF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAPGEF6	HGNC	protein_coding	OTTHUMT00000370059.1	89	0.00	0	G	NM_016340		130840456	130840456	-1	no_errors	ENST00000509018	ensembl	human	known	69_37n	nonsense	63	14.86	11	SNP	1.000	A
RNF19A	25897	genome.wustl.edu	37	8	101272137	101272137	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr8:101272137C>T	ENST00000519449.1	-	10	2087	c.1771G>A	c.(1771-1773)Gcc>Acc	p.A591T	RNF19A_ENST00000523255.1_5'UTR|RNF19A_ENST00000341084.2_Missense_Mutation_p.A591T	NM_001280539.1|NM_015435.3	NP_001267468.1|NP_056250.3	Q9NV58	RN19A_HUMAN	ring finger protein 19A, RBR E3 ubiquitin protein ligase	591					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(5)|lung(11)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	30	all_cancers(14;3.5e-05)|all_epithelial(15;8.91e-08)|Lung NSC(17;0.000615)|all_lung(17;0.00166)		Epithelial(11;3.06e-11)|all cancers(13;5.78e-09)|OV - Ovarian serous cystadenocarcinoma(57;2.24e-05)|STAD - Stomach adenocarcinoma(118;0.0525)			TTGGTGCTGGCATTATCACTA	0.393																																						dbGAP											0													129.0	103.0	111.0					8																	101272137		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029316	CCDS6286.1	8q22	2013-10-03	2013-10-03	2007-08-20		ENSG00000034677		"""RING-type (C3HC4) zinc fingers"""	13432	protein-coding gene	gene with protein product		607119	"""ring finger protein 19"", ""ring finger protein 19A"", ""ring finger protein 19A, E3 ubiquitin protein ligase"""	RNF19		11237715, 10976766	Standard	NM_183419		Approved	dorfin, DKFZp566B1346	uc003yjj.1	Q9NV58		ENST00000519449.1:c.1771G>A	8.37:g.101272137C>T	ENSP00000428968:p.Ala591Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KCU9|Q52LG1|Q9H5H9|Q9H8M8|Q9UFG0|Q9UFX6|Q9Y4Y1	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.A591T	ENST00000519449.1	37	c.1771	CCDS6286.1	8	.	.	.	.	.	.	.	.	.	.	C	29.2	4.983791	0.93044	.	.	ENSG00000034677	ENST00000519449;ENST00000341084	D;D	0.89939	-2.59;-2.59	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.89550	0.6747	M	0.72894	2.215	0.80722	D	1	P	0.48294	0.908	B	0.41860	0.368	D	0.91123	0.4931	10	0.87932	D	0	.	19.1481	0.93476	0.0:1.0:0.0:0.0	.	591	Q9NV58	RN19A_HUMAN	T	591	ENSP00000428968:A591T;ENSP00000342667:A591T	ENSP00000342667:A591T	A	-	1	0	RNF19A	101341313	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.089000	0.71384	2.601000	0.87937	0.655000	0.94253	GCC	RNF19A	-	NULL	ENSG00000034677		0.393	RNF19A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF19A	HGNC	protein_coding	OTTHUMT00000380004.1	47	0.00	0	C	NM_015435		101272137	101272137	-1	no_errors	ENST00000341084	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	T
RPGR	6103	genome.wustl.edu	37	X	38146288	38146288	+	Intron	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chrX:38146288C>T	ENST00000339363.3	-	14	2688				RPGR_ENST00000318842.7_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.G655E|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000309513.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						GGTTCCATCCCCTCTACCTTC	0.507																																						dbGAP											0													354.0	275.0	302.0					X																	38146288		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+58G>A	X.37:g.38146288C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.G655E	ENST00000339363.3	37	c.1964		X	.	.	.	.	.	.	.	.	.	.	c	11.88	1.771979	0.31320	.	.	ENSG00000156313	ENST00000378505	T	0.32753	1.44	3.0	0.498	0.16908	.	0.795939	0.09898	U	0.741342	T	0.22360	0.0539	L	0.52573	1.65	0.09310	N	1	B	0.24963	0.115	B	0.20767	0.031	T	0.33803	-0.9854	10	0.08837	T	0.75	.	7.3688	0.26790	0.0:0.6518:0.0:0.3482	.	655	E9PE28	.	E	655	ENSP00000367766:G655E	ENSP00000367766:G655E	G	-	2	0	RPGR	38031232	0.000000	0.05858	0.001000	0.08648	0.527000	0.34593	0.214000	0.17541	0.290000	0.22444	0.353000	0.21931	GGG	RPGR	-	NULL	ENSG00000156313		0.507	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		216	0.00	0	C	NM_000328		38146288	38146288	-1	no_errors	ENST00000378505	ensembl	human	known	69_37n	missense	250	12.24	35	SNP	0.000	T
RP11-645C24.5	0	genome.wustl.edu	37	16	21809167	21809167	+	lincRNA	SNP	G	G	A	rs141895991	byFrequency	TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr16:21809167G>A	ENST00000567370.1	-	0	0				RRN3P1_ENST00000546471.1_RNA																							CAGACTCTGAGGATACTGCAA	0.338													.|||	359	0.0716853	0.0318	0.0764	5008	,	,		12924	0.1647		0.0318	False		,,,				2504	0.0675					dbGAP											0																																										-	-	-			0																															16.37:g.21809167G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000567370.1	37	NULL		16																																																																																			RRN3P1	-	-	ENSG00000248124		0.338	RP11-645C24.5-001	KNOWN	basic	lincRNA	RRN3P1	HGNC	lincRNA	OTTHUMT00000430026.1	16	0.00	0	G			21809167	21809167	-1	no_errors	ENST00000546471	ensembl	human	known	69_37n	rna	13	48.00	12	SNP	1.000	A
RTEL1	51750	genome.wustl.edu	37	20	62319309	62319309	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr20:62319309G>T	ENST00000360203.5	+	18	1826	c.1501G>T	c.(1501-1503)Gag>Tag	p.E501*	RTEL1_ENST00000370018.3_Nonsense_Mutation_p.E501*|RTEL1_ENST00000370003.1_5'Flank|RTEL1_ENST00000318100.4_Nonsense_Mutation_p.E501*|RTEL1_ENST00000508582.2_Nonsense_Mutation_p.E525*|RTEL1-TNFRSF6B_ENST00000482936.1_Nonsense_Mutation_p.E501*					regulator of telomere elongation helicase 1											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(38;6.47e-12)|all_epithelial(29;3.75e-13)		Epithelial(9;1.25e-09)|all cancers(9;5.13e-09)|BRCA - Breast invasive adenocarcinoma(10;7.26e-05)|OV - Ovarian serous cystadenocarcinoma(5;0.00223)|Colorectal(105;0.107)			AGTCTGCCTGGAGAACCCACA	0.647																																						dbGAP											0													34.0	34.0	34.0					20																	62319309		2199	4292	6491	-	-	-	SO:0001587	stop_gained	0			AB029011	CCDS13530.2, CCDS13531.1, CCDS13530.3, CCDS63331.1, CCDS74751.1	20q13.3	2012-06-27	2004-10-29	2004-10-29	ENSG00000258366	ENSG00000258366			15888	protein-coding gene	gene with protein product		608833	"""chromosome 20 open reading frame 41"""	C20orf41		10655513, 15210109	Standard	NM_016434		Approved	bK3184A7.3, NHL, DKFZP434C013, KIAA1088, RTEL	uc011abd.2	Q9NZ71	OTTHUMG00000032992	ENST00000360203.5:c.1501G>T	20.37:g.62319309G>T	ENSP00000353332:p.Glu501*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.E501*	ENST00000360203.5	37	c.1501		20	.	.	.	.	.	.	.	.	.	.	G	47	13.671105	0.99756	.	.	ENSG00000258366	ENST00000370018;ENST00000318100;ENST00000508582;ENST00000360203	.	.	.	5.48	4.53	0.55603	.	0.053634	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-38.1209	13.5159	0.61541	0.0757:0.0:0.9243:0.0	.	.	.	.	X	501;501;525;501	.	ENSP00000353332:E501X	E	+	1	0	AL353715.1	61789753	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	9.205000	0.95048	1.326000	0.45319	0.561000	0.74099	GAG	RTEL1	-	tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000258366		0.647	RTEL1-011	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	RTEL1	HGNC	protein_coding	OTTHUMT00000289781.1	35	0.00	0	G	NM_032957		62319309	62319309	+1	no_errors	ENST00000318100	ensembl	human	known	69_37n	nonsense	40	16.67	8	SNP	1.000	T
RTN4	57142	genome.wustl.edu	37	2	55253974	55253974	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr2:55253974C>G	ENST00000337526.6	-	3	1504	c.1261G>C	c.(1261-1263)Gat>Cat	p.D421H	RTN4_ENST00000357376.3_Missense_Mutation_p.D215H|RTN4_ENST00000402434.2_Intron|RTN4_ENST00000357732.4_Intron|RTN4_ENST00000405240.1_Missense_Mutation_p.D215H|RTN4_ENST00000404909.1_Missense_Mutation_p.D215H|RTN4_ENST00000394611.2_Missense_Mutation_p.D215H|RTN4_ENST00000354474.6_Missense_Mutation_p.D189H|RTN4_ENST00000317610.7_Intron	NM_020532.4	NP_065393.1	Q9NQC3	RTN4_HUMAN	reticulon 4	421					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonal fasciculation (GO:0007413)|cardiac epithelial to mesenchymal transition (GO:0060317)|cerebral cortex radial glia guided migration (GO:0021801)|endoplasmic reticulum tubular network organization (GO:0071786)|negative regulation of axon extension (GO:0030517)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell growth (GO:0030308)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of apoptotic process (GO:0042981)|regulation of axonogenesis (GO:0050770)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of cell migration (GO:0030334)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|intracellular (GO:0005622)|neuronal cell body (GO:0043025)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|prostate(1)|skin(1)|stomach(1)	36						CATTTTTTATCCACTTTACTT	0.388																																						dbGAP											0													235.0	232.0	233.0					2																	55253974		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF087901	CCDS1851.1, CCDS1852.1, CCDS42683.1, CCDS42684.1, CCDS42685.1	2p14-p13	2008-05-23			ENSG00000115310	ENSG00000115310			14085	protein-coding gene	gene with protein product		604475				10667797, 10773680	Standard	NM_020532		Approved	NSP-CL, KIAA0886, NOGO, ASY	uc002rye.3	Q9NQC3	OTTHUMG00000129337	ENST00000337526.6:c.1261G>C	2.37:g.55253974C>G	ENSP00000337838:p.Asp421His	Somatic		WXS	Illumina GAIIx	Phase_IV	O94962|Q7L7Q5|Q7L7Q6|Q7L7Q8|Q8IUA4|Q96B16|Q9BXG5|Q9H212|Q9H3I3|Q9UQ42|Q9Y293|Q9Y2Y7|Q9Y5U6	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.D421H	ENST00000337526.6	37	c.1261	CCDS42684.1	2	.	.	.	.	.	.	.	.	.	.	C	14.32	2.500412	0.44455	.	.	ENSG00000115310	ENST00000405240;ENST00000357376;ENST00000337526;ENST00000394611;ENST00000404909;ENST00000354474	T;T;T;T;T;T	0.28255	1.62;1.62;2.28;1.62;1.62;1.68	6.06	6.06	0.98353	.	0.933951	0.09057	N	0.854885	T	0.59046	0.2165	M	0.66939	2.045	0.41149	D	0.986014	D	0.76494	0.999	D	0.63488	0.915	T	0.54529	-0.8280	10	0.87932	D	0	-1.8717	20.6244	0.99512	0.0:1.0:0.0:0.0	.	421	Q9NQC3	RTN4_HUMAN	H	215;215;421;215;215;189	ENSP00000384471:D215H;ENSP00000349944:D215H;ENSP00000337838:D421H;ENSP00000378109:D215H;ENSP00000385650:D215H;ENSP00000346465:D189H	ENSP00000337838:D421H	D	-	1	0	RTN4	55107478	0.014000	0.17966	0.642000	0.29436	0.286000	0.27126	1.556000	0.36288	2.879000	0.98667	0.650000	0.86243	GAT	RTN4	-	NULL	ENSG00000115310		0.388	RTN4-001	KNOWN	basic|CCDS	protein_coding	RTN4	HGNC	protein_coding	OTTHUMT00000251484.1	114	0.00	0	C			55253974	55253974	-1	no_errors	ENST00000337526	ensembl	human	known	69_37n	missense	95	23.39	29	SNP	0.985	G
SCG3	29106	genome.wustl.edu	37	15	51991585	51991585	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr15:51991585G>T	ENST00000220478.3	+	9	1458	c.1055G>T	c.(1054-1056)aGc>aTc	p.S352I	SCG3_ENST00000542355.2_Missense_Mutation_p.S120I	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III	352					blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		GACAATATAAGCAAGCTTTTC	0.284																																						dbGAP											0													107.0	115.0	113.0					15																	51991585		2195	4293	6488	-	-	-	SO:0001583	missense	0			AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.1055G>T	15.37:g.51991585G>T	ENSP00000220478:p.Ser352Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	Missense_Mutation	SNP	NULL	p.S352I	ENST00000220478.3	37	c.1055	CCDS10142.1	15	.	.	.	.	.	.	.	.	.	.	G	13.55	2.270684	0.40194	.	.	ENSG00000104112	ENST00000220478;ENST00000542355	T;T	0.23147	1.92;1.92	5.26	3.22	0.36961	.	0.308918	0.34906	N	0.003593	T	0.14270	0.0345	N	0.19112	0.55	0.34480	D	0.703738	B	0.14438	0.01	B	0.15052	0.012	T	0.08848	-1.0702	10	0.66056	D	0.02	-20.3339	4.9201	0.13865	0.088:0.15:0.6076:0.1544	.	352	Q8WXD2	SCG3_HUMAN	I	352;120	ENSP00000220478:S352I;ENSP00000445205:S120I	ENSP00000220478:S352I	S	+	2	0	SCG3	49778877	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	0.660000	0.25009	1.434000	0.47414	0.655000	0.94253	AGC	SCG3	-	NULL	ENSG00000104112		0.284	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCG3	HGNC	protein_coding	OTTHUMT00000254670.2	93	0.00	0	G	NM_013243		51991585	51991585	+1	no_errors	ENST00000220478	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	1.000	T
SEC23A	10484	genome.wustl.edu	37	14	39517903	39517903	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr14:39517903C>T	ENST00000307712.6	-	15	2207	c.1690G>A	c.(1690-1692)Gac>Aac	p.D564N	SEC23A_ENST00000545328.2_Missense_Mutation_p.D535N|SEC23A_ENST00000536508.1_Missense_Mutation_p.D438N|SEC23A_ENST00000537403.1_Missense_Mutation_p.D362N	NM_006364.2	NP_006355.2	Q15436	SC23A_HUMAN	Sec23 homolog A (S. cerevisiae)	564					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			kidney(2)|large_intestine(3)|liver(1)|lung(11)|ovary(4)|pancreas(1)|upper_aerodigestive_tract(1)	23	Hepatocellular(127;0.213)		Lung(238;0.00047)|LUAD - Lung adenocarcinoma(48;0.000565)	GBM - Glioblastoma multiforme(112;0.0151)		GAACTTGGGTCATCTTTATGA	0.289																																						dbGAP											0													67.0	76.0	73.0					14																	39517903		2203	4300	6503	-	-	-	SO:0001583	missense	0			X97064	CCDS9668.1	14q21.1	2008-05-14	2001-11-28		ENSG00000100934	ENSG00000100934			10701	protein-coding gene	gene with protein product		610511	"""Sec23 (S. cerevisiae) homolog A"""			8898360, 10329445	Standard	NM_006364		Approved		uc001wup.1	Q15436	OTTHUMG00000028812	ENST00000307712.6:c.1690G>A	14.37:g.39517903C>T	ENSP00000306881:p.Asp564Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5P4|B3KXI2|Q8NE16	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.D564N	ENST00000307712.6	37	c.1690	CCDS9668.1	14	.	.	.	.	.	.	.	.	.	.	C	22.2	4.254810	0.80135	.	.	ENSG00000100934	ENST00000537403;ENST00000307712;ENST00000536508;ENST00000545328	D;D;D;D	0.94931	-3.56;-3.56;-3.56;-3.56	5.61	5.61	0.85477	Sec23/Sec24, helical domain (2);	0.000000	0.85682	D	0.000000	D	0.94830	0.8330	M	0.76938	2.355	0.80722	D	1	B;B;B	0.21606	0.058;0.033;0.02	B;B;B	0.29663	0.105;0.044;0.06	D	0.92073	0.5666	10	0.40728	T	0.16	-21.1181	19.6276	0.95684	0.0:1.0:0.0:0.0	.	535;438;564	F5H365;F5H6C4;Q15436	.;.;SC23A_HUMAN	N	362;564;438;535	ENSP00000444193:D362N;ENSP00000306881:D564N;ENSP00000437715:D438N;ENSP00000445393:D535N	ENSP00000306881:D564N	D	-	1	0	SEC23A	38587654	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.818000	0.86416	2.652000	0.90054	0.655000	0.94253	GAC	SEC23A	-	pfam_Sec23/24_helical_dom,superfamily_Sec23/24_helical_dom	ENSG00000100934		0.289	SEC23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC23A	HGNC	protein_coding	OTTHUMT00000276728.2	78	0.00	0	C			39517903	39517903	-1	no_errors	ENST00000307712	ensembl	human	known	69_37n	missense	78	13.33	12	SNP	1.000	T
SLC25A51	92014	genome.wustl.edu	37	9	37888181	37888181	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr9:37888181C>T	ENST00000377716.2	-	3	1110	c.367G>A	c.(367-369)Gtg>Atg	p.V123M	SLC25A51_ENST00000496760.1_Intron|SLC25A51_ENST00000380590.3_Missense_Mutation_p.V123M|RP11-613M10.9_ENST00000540557.1_Intron|SLC25A51_ENST00000242275.6_Missense_Mutation_p.V123M			Q9H1U9	S2551_HUMAN	solute carrier family 25, member 51	123					transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)											ACTGCCGCCACGCCACTGGTT	0.468																																						dbGAP											0													127.0	120.0	122.0					9																	37888181		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008500	CCDS6614.1	9p13.3-p12	2013-05-22	2012-03-29	2012-03-29	ENSG00000122696	ENSG00000122696		"""Solute carriers"""	23323	protein-coding gene	gene with protein product			"""mitochondrial carrier triple repeat 1"""	MCART1		12477932	Standard	NM_033412		Approved	MGC14836, CG7943	uc004aav.2	Q9H1U9	OTTHUMG00000019935	ENST00000377716.2:c.367G>A	9.37:g.37888181C>T	ENSP00000366945:p.Val123Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	p.V123M	ENST00000377716.2	37	c.367	CCDS6614.1	9	.	.	.	.	.	.	.	.	.	.	.	2.024	-0.424049	0.04734	.	.	ENSG00000122696	ENST00000380590;ENST00000377716;ENST00000242275	T;T;T	0.80033	-1.33;-1.33;-1.33	4.94	-1.32	0.09201	Mitochondrial carrier domain (2);	0.849986	0.10309	N	0.690237	T	0.58666	0.2138	N	0.08118	0	0.23762	N	0.996912	B	0.11235	0.004	B	0.16289	0.015	T	0.45804	-0.9236	10	0.46703	T	0.11	.	5.3007	0.15776	0.1374:0.6157:0.1355:0.1114	.	123	Q9H1U9	MCAR1_HUMAN	M	123	ENSP00000369964:V123M;ENSP00000366945:V123M;ENSP00000242275:V123M	ENSP00000242275:V123M	V	-	1	0	MCART1	37878181	0.006000	0.16342	0.031000	0.17742	0.060000	0.15804	-0.487000	0.06505	-0.245000	0.09625	0.585000	0.79938	GTG	SLC25A51	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000122696		0.468	SLC25A51-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC25A51	HGNC	protein_coding	OTTHUMT00000313746.1	75	0.00	0	C	NM_033412		37888181	37888181	-1	no_errors	ENST00000242275	ensembl	human	known	69_37n	missense	52	24.64	17	SNP	0.173	T
SLC2A1	6513	genome.wustl.edu	37	1	43396749	43396749	+	Silent	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:43396749G>A	ENST00000426263.3	-	3	421	c.243C>T	c.(241-243)ttC>ttT	p.F81F	SLC2A1_ENST00000415851.2_Silent_p.F81F|SLC2A1_ENST00000475162.1_5'UTR|SLC2A1_ENST00000372500.3_Silent_p.F81F	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	81					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	GGCCCACAGAGAAGGAGCCAA	0.617											OREG0013425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													107.0	89.0	95.0					1																	43396749		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.243C>T	1.37:g.43396749G>A		Somatic	916	WXS	Illumina GAIIx	Phase_IV	A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glu_transpt_1,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.F81	ENST00000426263.3	37	c.243	CCDS477.1	1																																																																																			SLC2A1	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000117394		0.617	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A1	HGNC	protein_coding	OTTHUMT00000020358.2	73	0.00	0	G	NM_006516		43396749	43396749	-1	no_errors	ENST00000426263	ensembl	human	known	69_37n	silent	56	16.42	11	SNP	1.000	A
SLC3A2	6520	genome.wustl.edu	37	11	62652967	62652967	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr11:62652967T>G	ENST00000377890.2	+	10	1501	c.1333T>G	c.(1333-1335)Ttg>Gtg	p.L445V	SLC3A2_ENST00000535296.1_Missense_Mutation_p.L414V|SLC3A2_ENST00000536981.1_5'UTR|SLC3A2_ENST00000338663.7_Missense_Mutation_p.L344V|SLC3A2_ENST00000538682.1_3'UTR|SLC3A2_ENST00000377891.2_Missense_Mutation_p.L446V|SLC3A2_ENST00000377892.1_Missense_Mutation_p.L476V|SLC3A2_ENST00000377889.2_Missense_Mutation_p.L383V	NM_002394.5	NP_002385.3	P08195	4F2_HUMAN	solute carrier family 3 (amino acid transporter heavy chain), member 2	445					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|carbohydrate metabolic process (GO:0005975)|cell growth (GO:0016049)|ion transport (GO:0006811)|leucine import (GO:0060356)|leukocyte migration (GO:0050900)|response to exogenous dsRNA (GO:0043330)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|tryptophan transport (GO:0015827)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium:sodium antiporter activity (GO:0005432)|catalytic activity (GO:0003824)|cation binding (GO:0043169)|double-stranded RNA binding (GO:0003725)|neutral amino acid transmembrane transporter activity (GO:0015175)|poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)	22						GACTTCCTTCTTGCCGGCTCA	0.567																																						dbGAP											0													214.0	205.0	208.0					11																	62652967		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS8039.2, CCDS31588.1, CCDS31589.1, CCDS31590.1	11q12-q22	2013-07-19	2013-07-19		ENSG00000168003	ENSG00000168003		"""Solute carriers"""	11026	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibodies 4F2, TRA1.10, TROP4, and T43"", ""antigen defined by monoclonal antibody 4F2"", ""heavy chain"", ""4F2 heavy chain"", ""CD98 heavy chain"", ""monoclonal antibody 44D7"", ""4F2 cell-surface antigen heavy chain"", ""lymphocyte activation antigen 4F2 large subunit"""	158070	"""solute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2"""	MDU1		3036867	Standard	NM_001012662		Approved	4T2HC, 4F2, NACAE, CD98, CD98HC, 4F2HC	uc001nwd.3	P08195	OTTHUMG00000074091	ENST00000377890.2:c.1333T>G	11.37:g.62652967T>G	ENSP00000367122:p.Leu445Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13543	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	p.L476V	ENST00000377890.2	37	c.1426	CCDS8039.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.935|3.935	-0.015430|-0.015430	0.07681|0.07681	.|.	.|.	ENSG00000168003|ENSG00000168003	ENST00000539507|ENST00000377892;ENST00000377891;ENST00000377890;ENST00000542007;ENST00000377889;ENST00000535296;ENST00000338663;ENST00000422606	.|D;D;D;D;D;D	.|0.98264	.|-4.83;-4.83;-4.83;-4.83;-4.77;-4.83	4.75|4.75	-0.0765|-0.0765	0.13723|0.13723	.|Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.928894|0.928894	0.09263|0.09263	N|N	0.826172|0.826172	D|D	0.90266|0.90266	0.6956|0.6956	N|N	0.03016|0.03016	-0.435|-0.435	0.09310|0.09310	N|N	0.999999|0.999999	.|B;B;B;B;B	.|0.09022	.|0.0;0.0;0.002;0.0;0.001	.|B;B;B;B;B	.|0.04013	.|0.0;0.0;0.001;0.0;0.001	D|D	0.83854|0.83854	0.0264|0.0264	6|10	.|0.16420	.|T	.|0.52	-5.7407|-5.7407	1.7152|1.7152	0.02900|0.02900	0.2291:0.1438:0.474:0.1532|0.2291:0.1438:0.474:0.1532	.|.	.|383;414;445;344;476	.|P08195-3;F5GZS6;P08195;P08195-2;P08195-4	.|.;.;4F2_HUMAN;.;.	R|V	71|476;446;445;446;383;414;344;326	.|ENSP00000367124:L476V;ENSP00000367123:L446V;ENSP00000367122:L445V;ENSP00000367121:L383V;ENSP00000444236:L414V;ENSP00000340815:L344V	.|ENSP00000340815:L344V	L|L	+|+	2|1	0|2	SLC3A2|SLC3A2	62409543|62409543	0.066000|0.066000	0.20996|0.20996	0.139000|0.139000	0.22197|0.22197	0.930000|0.930000	0.56654|0.56654	0.248000|0.248000	0.18198|0.18198	-0.320000|-0.320000	0.08640|0.08640	-0.736000|-0.736000	0.03550|0.03550	CTT|TTG	SLC3A2	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000168003		0.567	SLC3A2-001	KNOWN	basic|CCDS	protein_coding	SLC3A2	HGNC	protein_coding	OTTHUMT00000157306.1	137	0.00	0	T	NM_001012661		62652967	62652967	+1	no_errors	ENST00000377892	ensembl	human	known	69_37n	missense	66	39.09	43	SNP	0.337	G
SORL1	6653	genome.wustl.edu	37	11	121477957	121477957	+	Silent	SNP	A	A	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr11:121477957A>T	ENST00000260197.7	+	37	5253	c.5124A>T	c.(5122-5124)acA>acT	p.T1708T	SORL1_ENST00000527934.1_Silent_p.T323T|SORL1_ENST00000532694.1_Silent_p.T554T|SORL1_ENST00000525532.1_Silent_p.T652T|SORL1_ENST00000534286.1_Silent_p.T618T	NM_003105.5	NP_003096	Q92673	SORL_HUMAN	sortilin-related receptor, L(DLR class) A repeats containing	1708	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell death (GO:0008219)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|negative regulation of aspartic-type endopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902960)|negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of metalloendopeptidase activity involved in amyloid precursor protein catabolic process (GO:1902963)|negative regulation of neurofibrillary tangle assembly (GO:1902997)|negative regulation of neurogenesis (GO:0050768)|negative regulation of neuron death (GO:1901215)|negative regulation of protein binding (GO:0032091)|negative regulation of protein oligomerization (GO:0032460)|negative regulation of tau-protein kinase activity (GO:1902948)|positive regulation of choline O-acetyltransferase activity (GO:1902771)|positive regulation of early endosome to recycling endosome transport (GO:1902955)|positive regulation of endocytic recycling (GO:2001137)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|positive regulation of protein localization to early endosome (GO:1902966)|post-Golgi vesicle-mediated transport (GO:0006892)|protein maturation (GO:0051604)|protein retention in Golgi apparatus (GO:0045053)|protein targeting (GO:0006605)|protein targeting to Golgi (GO:0000042)|protein targeting to lysosome (GO:0006622)|receptor-mediated endocytosis (GO:0006898)|regulation of smooth muscle cell migration (GO:0014910)|signal transduction (GO:0007165)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna (GO:0031985)|integral component of plasma membrane (GO:0005887)|low-density lipoprotein particle (GO:0034362)|membrane (GO:0016020)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|nuclear envelope lumen (GO:0005641)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)	ADP-ribosylation factor binding (GO:0030306)|beta-amyloid binding (GO:0001540)|low-density lipoprotein particle binding (GO:0030169)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|liver(2)|lung(34)|ovary(5)|pancreas(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(2)	91		Breast(109;0.00119)|Medulloblastoma(222;0.0429)|all_neural(223;0.113)		BRCA - Breast invasive adenocarcinoma(274;3.34e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.108)		GTAACTTTACAGAAATCAAGA	0.448																																						dbGAP											0													82.0	77.0	79.0					11																	121477957		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			Y08110	CCDS8436.1	11q23.2-q24.4	2014-06-05	2011-01-25		ENSG00000137642	ENSG00000137642		"""Fibronectin type III domain containing"""	11185	protein-coding gene	gene with protein product	"""LDLR relative with 11 ligand-binding repeats"""	602005	"""chromosome 11 open reading frame 32"", ""sortilin-related receptor, L(DLR class) A repeats-containing"""	C11orf32		9157966, 8940146	Standard	NM_003105		Approved	gp250, LR11, LRP9, SorLA, SorLA-1	uc001pxx.3	Q92673	OTTHUMG00000166057	ENST00000260197.7:c.5124A>T	11.37:g.121477957A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX7|Q92856	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_Fibronectin_type3,pfam_LDLR_classB_rpt,superfamily_Fibronectin_type3,superfamily_LDrepeatLR_classA_rpt,smart_VPS10,smart_LDLR_classB_rpt,smart_LDrepeatLR_classA_rpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.T1708	ENST00000260197.7	37	c.5124	CCDS8436.1	11																																																																																			SORL1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000137642		0.448	SORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORL1	HGNC	protein_coding	OTTHUMT00000387626.2	62	0.00	0	A	NM_003105		121477957	121477957	+1	no_errors	ENST00000260197	ensembl	human	known	69_37n	silent	34	39.29	22	SNP	0.000	T
SRSF11	9295	genome.wustl.edu	37	1	70716046	70716046	+	Splice_Site	SNP	A	A	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:70716046A>T	ENST00000370950.3	+	12	1200		c.e12-1		SRSF11_ENST00000405432.1_Splice_Site|SRSF11_ENST00000370951.1_Splice_Site|SRSF11_ENST00000370949.1_Splice_Site|SRSF11_ENST00000484162.1_Splice_Site			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						CTGTCATTCTAGACATAaaaa	0.343																																						dbGAP											0													90.0	96.0	94.0					1																	70716046		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.1119-1A>T	1.37:g.70716046A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T758|Q8IWE6	Splice_Site	SNP	-	e11-2	ENST00000370950.3	37	c.1119-2	CCDS647.1	1	.	.	.	.	.	.	.	.	.	.	A	14.99	2.698877	0.48307	.	.	ENSG00000116754	ENST00000370951;ENST00000370950;ENST00000405432;ENST00000395136;ENST00000370949	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6083	0.68495	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SRSF11	70488634	1.000000	0.71417	0.998000	0.56505	0.844000	0.47949	7.669000	0.83911	2.153000	0.67306	0.460000	0.39030	.	SRSF11	-	-	ENSG00000116754		0.343	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRSF11	HGNC	protein_coding	OTTHUMT00000025889.1	137	0	0	A	NM_004768	Intron	70716046	70716046	+1	no_errors	ENST00000370950	ensembl	human	known	69_37n	splice_site	110	10.57	13	SNP	1.000	T
SRSF11	9295	genome.wustl.edu	37	1	70716046	70716046	+	Splice_Site	SNP	A	A	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:70716046A>T	ENST00000370950.3	+	12	1200		c.e12-1		SRSF11_ENST00000405432.1_Splice_Site|SRSF11_ENST00000370951.1_Splice_Site|SRSF11_ENST00000370949.1_Splice_Site|SRSF11_ENST00000484162.1_Splice_Site			Q05519	SRS11_HUMAN	serine/arginine-rich splicing factor 11						gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			large_intestine(3)|ovary(2)|skin(1)	6						CTGTCATTCTAGACATAaaaa	0.343																																						dbGAP											0													90.0	96.0	94.0					1																	70716046		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			M74002	CCDS647.1, CCDS53332.1	1p31.1	2013-02-12	2010-06-22	2010-06-22	ENSG00000116754	ENSG00000116754		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10782	protein-coding gene	gene with protein product	"""SR splicing factor 11"""	602010	"""splicing factor, arginine/serine-rich 11"""	SFRS11		1896467, 20516191	Standard	NM_004768		Approved	p54, NET2	uc001des.3	Q05519	OTTHUMG00000009342	ENST00000370950.3:c.1119-1A>T	1.37:g.70716046A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T758|Q8IWE6	Splice_Site	SNP	-	e11-2	ENST00000370950.3	37	c.1119-2	CCDS647.1	1	.	.	.	.	.	.	.	.	.	.	A	14.99	2.698877	0.48307	.	.	ENSG00000116754	ENST00000370951;ENST00000370950;ENST00000405432;ENST00000395136;ENST00000370949	.	.	.	5.34	5.34	0.76211	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6083	0.68495	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SRSF11	70488634	1.000000	0.71417	0.998000	0.56505	0.844000	0.47949	7.669000	0.83911	2.153000	0.67306	0.460000	0.39030	.	SRSF11	-	-	ENSG00000116754		0.343	SRSF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRSF11	HGNC	protein_coding	OTTHUMT00000025889.1	137	0.00	0	A	NM_004768	Intron	70716046	70716046	+1	no_errors	ENST00000370950	ensembl	human	known	69_37n	splice_site	110	10.57	13	SNP	1.000	T
SOX13	9580	genome.wustl.edu	37	1	204085649	204085649	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:204085649C>A	ENST00000367204.1	+	5	542	c.433C>A	c.(433-435)Cta>Ata	p.L145I	SOX13_ENST00000367203.4_3'UTR	NM_005686.2	NP_005677.2	Q9UN79	SOX13_HUMAN	SRY (sex determining region Y)-box 13	145					anatomical structure morphogenesis (GO:0009653)|regulation of gamma-delta T cell differentiation (GO:0045586)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(2)	13	all_cancers(21;0.0754)|Breast(84;0.116)|all_epithelial(62;0.189)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.109)			CCAAGAGAGCCTAGCAGAGAA	0.527																																						dbGAP											0													72.0	76.0	75.0					1																	204085649		1976	4171	6147	-	-	-	SO:0001583	missense	0				CCDS44299.1	1q32	2008-07-18			ENSG00000143842	ENSG00000143842		"""SRY (sex determining region Y)-boxes"""	11192	protein-coding gene	gene with protein product	"""islet cell antibody 12"", ""SRY-related HMG-box gene 13"", ""type 1 diabetes autoantigen"", ""SRY-box 13"""	604748				10198172	Standard	NM_005686		Approved	Sox-13, ICA12, MGC117216	uc001ham.3	Q9UN79	OTTHUMG00000036050	ENST00000367204.1:c.433C>A	1.37:g.204085649C>A	ENSP00000356172:p.Leu145Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2B0|O95275|O95826|Q3KQV7|Q5SXX1|Q9UHW7	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.L145I	ENST00000367204.1	37	c.433	CCDS44299.1	1	.	.	.	.	.	.	.	.	.	.	C	22.9	4.346815	0.82022	.	.	ENSG00000143842	ENST00000367204;ENST00000528591	D	0.99252	-5.63	5.21	5.21	0.72293	.	0.162938	0.43747	D	0.000535	D	0.99408	0.9791	M	0.80982	2.52	0.46901	D	0.999245	D;D;D;D	0.71674	0.997;0.997;0.997;0.998	D;D;D;D	0.83275	0.991;0.991;0.991;0.996	D	0.99010	1.0814	10	0.87932	D	0	.	18.3606	0.90372	0.0:1.0:0.0:0.0	.	12;13;145;127	B4DX26;B4E3N9;Q9UN79;Q5SXX2	.;.;SOX13_HUMAN;.	I	145	ENSP00000356172:L145I	ENSP00000356172:L145I	L	+	1	2	SOX13	202352272	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.076000	0.50081	2.416000	0.81992	0.655000	0.94253	CTA	SOX13	-	NULL	ENSG00000143842		0.527	SOX13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX13	HGNC	protein_coding	OTTHUMT00000087881.2	53	0.00	0	C	NM_005686		204085649	204085649	+1	no_errors	ENST00000367204	ensembl	human	known	69_37n	missense	36	35.71	20	SNP	1.000	A
TACC3	10460	genome.wustl.edu	37	4	1725222	1725222	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr4:1725222C>T	ENST00000313288.4	+	2	180	c.74C>T	c.(73-75)tCg>tTg	p.S25L	TMEM129_ENST00000382936.3_5'Flank|TMEM129_ENST00000303277.2_5'Flank|TMEM129_ENST00000536901.1_5'Flank	NM_006342.2	NP_006333.1	Q9Y6A5	TACC3_HUMAN	transforming, acidic coiled-coil containing protein 3	25					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|cytoplasmic sequestering of transcription factor (GO:0042994)|hemopoiesis (GO:0030097)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of cell cycle (GO:0051726)|regulation of microtubule-based process (GO:0032886)|response to hypoxia (GO:0001666)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|large_intestine(1)|lung(10)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	25		Breast(71;0.212)|all_epithelial(65;0.241)	OV - Ovarian serous cystadenocarcinoma(23;0.00765)|Epithelial(3;0.0126)			TTCCTGTTTTCGCCACCAGAA	0.428																																					Ovarian(120;482 2294 11894 35824)	dbGAP											0													67.0	65.0	65.0					4																	1725222		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF093543	CCDS3352.1	4p16.3	2008-07-29			ENSG00000013810	ENSG00000013810			11524	protein-coding gene	gene with protein product		605303				17675670	Standard	NM_006342		Approved	ERIC1	uc003gdo.3	Q9Y6A5	OTTHUMG00000089535	ENST00000313288.4:c.74C>T	4.37:g.1725222C>T	ENSP00000326550:p.Ser25Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK4|Q3KQS5|Q9UMQ1	Missense_Mutation	SNP	pfam_TACC	p.S25L	ENST00000313288.4	37	c.74	CCDS3352.1	4	.	.	.	.	.	.	.	.	.	.	C	9.214	1.031650	0.19590	.	.	ENSG00000013810	ENST00000485989;ENST00000313288;ENST00000343760;ENST00000493975;ENST00000458173	T;T;T;T	0.46063	0.91;2.87;0.88;0.89	5.19	2.46	0.29980	.	1.357460	0.05223	N	0.508828	T	0.35335	0.0928	L	0.52126	1.63	0.09310	N	1	P;B;B	0.51537	0.946;0.203;0.289	B;B;B	0.37780	0.258;0.04;0.055	T	0.28364	-1.0046	10	0.41790	T	0.15	-8.0447	6.7408	0.23435	0.0:0.6606:0.1255:0.2139	.	25;25;25	B4DYJ1;C9JWI7;Q9Y6A5	.;.;TACC3_HUMAN	L	25	ENSP00000419210:S25L;ENSP00000326550:S25L;ENSP00000418095:S25L;ENSP00000415914:S25L	ENSP00000326550:S25L	S	+	2	0	TACC3	1695020	0.078000	0.21339	0.014000	0.15608	0.218000	0.24690	0.655000	0.24933	0.568000	0.29311	0.655000	0.94253	TCG	TACC3	-	NULL	ENSG00000013810		0.428	TACC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TACC3	HGNC	protein_coding	OTTHUMT00000203730.2	62	0.00	0	C			1725222	1725222	+1	no_errors	ENST00000313288	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	0.021	T
TBX5	6910	genome.wustl.edu	37	12	114804031	114804031	+	Silent	SNP	T	T	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr12:114804031T>A	ENST00000310346.4	-	8	1587	c.921A>T	c.(919-921)ccA>ccT	p.P307P	TBX5_ENST00000405440.2_Silent_p.P307P|TBX5_ENST00000349716.5_Silent_p.P257P|TBX5_ENST00000526441.1_Silent_p.P307P	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	307					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		ATGGGTTGGGTGGAGGCAGGA	0.532																																					NSCLC(152;1358 1980 4050 23898 40356)	dbGAP											0													112.0	101.0	105.0					12																	114804031		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.921A>T	12.37:g.114804031T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND77|O15301|Q96TB0|Q9Y4I2	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.P307	ENST00000310346.4	37	c.921	CCDS9173.1	12																																																																																			TBX5	-	NULL	ENSG00000089225		0.532	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	HGNC	protein_coding	OTTHUMT00000388297.1	117	0.00	0	T	NM_080717		114804031	114804031	-1	no_errors	ENST00000310346	ensembl	human	known	69_37n	silent	78	16.13	15	SNP	0.086	A
TIMM8A	1678	genome.wustl.edu	37	X	100603573	100603573	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chrX:100603573G>T	ENST00000372902.3	-	1	611	c.80C>A	c.(79-81)aCt>aAt	p.T27N	TIMM8A_ENST00000480575.1_5'UTR	NM_004085.3	NP_004076.1	O60220	TIM8A_HUMAN	translocase of inner mitochondrial membrane 8 homolog A (yeast)	27					cellular protein metabolic process (GO:0044267)|chaperone-mediated protein transport (GO:0072321)|nervous system development (GO:0007399)|protein targeting to mitochondrion (GO:0006626)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			endometrium(1)|lung(1)	2						CTGCTTTTGAGTCTCTACCTC	0.577																																						dbGAP											0													118.0	98.0	105.0					X																	100603573		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66035	CCDS14481.1	Xq22	2008-02-05	2001-11-28		ENSG00000126953	ENSG00000126953			11817	protein-coding gene	gene with protein product		300356	"""translocase of inner mitochondrial membrane 8 (yeast) homolog A"""	DFN1		10552927, 8841189	Standard	NM_004085		Approved	DDP, MTS	uc004ehd.2	O60220	OTTHUMG00000022028	ENST00000372902.3:c.80C>A	X.37:g.100603573G>T	ENSP00000361993:p.Thr27Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5A6|Q6IRW6	Missense_Mutation	SNP	pfam_Tim8/9/10/13_Znf-like,superfamily_Tim8/9/10/13_Znf-like	p.T27N	ENST00000372902.3	37	c.80	CCDS14481.1	X	.	.	.	.	.	.	.	.	.	.	G	17.03	3.284075	0.59867	.	.	ENSG00000126953	ENST00000372902	T	0.62788	-0.0	5.11	4.24	0.50183	.	0.121271	0.56097	D	0.000023	T	0.50171	0.1600	.	.	.	0.42449	D	0.992741	P	0.35684	0.515	B	0.36608	0.229	T	0.38972	-0.9636	9	0.16896	T	0.51	.	13.9065	0.63839	0.0:0.0:0.8463:0.1537	.	27	O60220	TIM8A_HUMAN	N	27	ENSP00000361993:T27N	ENSP00000361993:T27N	T	-	2	0	TIMM8A	100490229	1.000000	0.71417	0.872000	0.34217	0.819000	0.46315	7.297000	0.78799	0.929000	0.37192	0.600000	0.82982	ACT	TIMM8A	-	pfam_Tim8/9/10/13_Znf-like,superfamily_Tim8/9/10/13_Znf-like	ENSG00000126953		0.577	TIMM8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM8A	HGNC	protein_coding	OTTHUMT00000057554.1	61	0.00	0	G	NM_004085		100603573	100603573	-1	no_errors	ENST00000372902	ensembl	human	known	69_37n	missense	51	20.31	13	SNP	0.998	T
POR	5447	genome.wustl.edu	37	7	75617649	75617649	+	IGR	SNP	C	C	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr7:75617649C>T	ENST00000461988.1	+	0	2522				TMEM120A_ENST00000338761.4_RNA|TMEM120A_ENST00000493111.2_RNA	NM_000941.2	NP_000932.3	P16435	NCPR_HUMAN	P450 (cytochrome) oxidoreductase						carnitine metabolic process (GO:0009437)|cellular organofluorine metabolic process (GO:0090346)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to peptide hormone stimulus (GO:0071375)|demethylation (GO:0070988)|fatty acid oxidation (GO:0019395)|flavonoid metabolic process (GO:0009812)|internal peptidyl-lysine acetylation (GO:0018393)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of lipase activity (GO:0060192)|nitrate catabolic process (GO:0043602)|nitric oxide catabolic process (GO:0046210)|oxidation-reduction process (GO:0055114)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of monooxygenase activity (GO:0032770)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of steroid hormone biosynthetic process (GO:0090031)|regulation of growth plate cartilage chondrocyte proliferation (GO:0003420)|response to drug (GO:0042493)|response to nutrient (GO:0007584)	endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|FMN binding (GO:0010181)|hydrolase activity (GO:0016787)|iron ion binding (GO:0005506)|iron-cytochrome-c reductase activity (GO:0047726)|NADP binding (GO:0050661)|NADPH-hemoprotein reductase activity (GO:0003958)|nitric oxide dioxygenase activity (GO:0008941)			central_nervous_system(1)|endometrium(2)|kidney(2)|lung(3)|ovary(1)	9					Benzphetamine(DB00865)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Ethylmorphine(DB01466)|Flavin adenine dinucleotide(DB03147)|Lipoic Acid(DB00166)|Mitomycin(DB00305)|Nilutamide(DB00665)|Nitrofurantoin(DB00698)	TTGAAGGCAGCATCTGTCACC	0.662																																						dbGAP											0													67.0	71.0	69.0					7																	75617649		2019	4169	6188	-	-	-	SO:0001628	intergenic_variant	0			AF258341	CCDS5579.1	7q11.2	2006-12-05			ENSG00000127948	ENSG00000127948			9208	protein-coding gene	gene with protein product		124015				2516426	Standard	NM_000941		Approved	CYPOR, FLJ26468	uc003udy.3	P16435	OTTHUMG00000130413		7.37:g.75617649C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16455|Q197M5|Q8N181|Q9H3M8|Q9UDT3	RNA	SNP	-	NULL	ENST00000461988.1	37	NULL	CCDS5579.1	7																																																																																			TMEM120A	-	-	ENSG00000189077		0.662	POR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM120A	HGNC	protein_coding	OTTHUMT00000252796.7	38	0.00	0	C	NM_000941		75617649	75617649	-1	no_errors	ENST00000338761	ensembl	human	known	69_37n	rna	41	22.64	12	SNP	0.849	T
TMTC2	160335	genome.wustl.edu	37	12	83250926	83250926	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr12:83250926G>A	ENST00000321196.3	+	2	928	c.221G>A	c.(220-222)cGc>cAc	p.R74H	TMTC2_ENST00000549919.1_Missense_Mutation_p.R68H|TMTC2_ENST00000548305.1_Missense_Mutation_p.R74H	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	74					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						CTTTCTTTTCGCCTGAACCAT	0.502																																						dbGAP											0													144.0	143.0	143.0					12																	83250926		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.221G>A	12.37:g.83250926G>A	ENSP00000322300:p.Arg74His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCU7|Q8N2K8	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_TPR-4,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R74H	ENST00000321196.3	37	c.221	CCDS9025.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.156354	0.94686	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919	T;T;T	0.66638	0.41;-0.22;0.3	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.82962	0.5151	M	0.77486	2.375	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.97110	1.0;0.928	T	0.82028	-0.0660	10	0.51188	T	0.08	-17.4587	19.0403	0.92995	0.0:0.0:1.0:0.0	.	74;74	Q8N394;F8VSH2	TMTC2_HUMAN;.	H	74;74;68	ENSP00000322300:R74H;ENSP00000448292:R74H;ENSP00000447609:R68H	ENSP00000322300:R74H	R	+	2	0	TMTC2	81775057	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	CGC	TMTC2	-	NULL	ENSG00000179104		0.502	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC2	HGNC	protein_coding	OTTHUMT00000405663.1	104	0.00	0	G	NM_152588		83250926	83250926	+1	no_errors	ENST00000321196	ensembl	human	known	69_37n	missense	60	15.49	11	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7577058	7577058	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr17:7577058C>A	ENST00000269305.4	-	8	1069	c.880G>T	c.(880-882)Gag>Tag	p.E294*	TP53_ENST00000420246.2_Nonsense_Mutation_p.E294*|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Nonsense_Mutation_p.E294*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E294*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000359597.4_Nonsense_Mutation_p.E294*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	294	Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		E -> A (in a sporadic cancer; somatic mutation).|E -> D (in sporadic cancers; somatic mutation).|E -> G (in sporadic cancers; somatic mutation).|E -> K (in sporadic cancers; somatic mutation).|E -> Q (in sporadic cancers; somatic mutation).|E -> V (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.E294*(46)|p.E294fs*51(9)|p.K291fs*48(8)|p.0?(8)|p.E294K(3)|p.E294fs*12(3)|p.?(2)|p.E294Q(2)|p.L265_K305del41(1)|p.E294>*(1)|p.G293fs*1(1)|p.R290fs*50(1)|p.R290_P295>X(1)|p.E294fs*11(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGTGAGGCTCCCCTTTCTTG	0.567		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	87	Substitution - Nonsense(46)|Deletion - Frameshift(20)|Whole gene deletion(8)|Substitution - Missense(5)|Insertion - Frameshift(3)|Unknown(2)|Deletion - In frame(1)|Complex - deletion inframe(1)|Complex - compound substitution(1)	upper_aerodigestive_tract(17)|lung(14)|large_intestine(10)|breast(7)|urinary_tract(6)|oesophagus(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|ovary(4)|bone(4)|stomach(3)|central_nervous_system(2)|skin(2)|salivary_gland(1)|vulva(1)|soft_tissue(1)|endometrium(1)											109.0	95.0	100.0					17																	7577058		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.880G>T	17.37:g.7577058C>A	ENSP00000269305:p.Glu294*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E294*	ENST00000269305.4	37	c.880	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.130179	0.94473	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	.	.	.	5.26	4.29	0.51040	.	0.702099	0.13430	N	0.388474	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-17.6918	13.5106	0.61511	0.0:0.8337:0.1663:0.0	.	.	.	.	X	294;294;294;294;294;283;162	.	ENSP00000269305:E294X	E	-	1	0	TP53	7517783	0.019000	0.18553	0.006000	0.13384	0.253000	0.25986	1.700000	0.37815	1.441000	0.47550	0.561000	0.74099	GAG	TP53	-	NULL	ENSG00000141510		0.567	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	95	0.00	0	C	NM_000546		7577058	7577058	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	41	32.26	20	SNP	0.015	A
TTI2	80185	genome.wustl.edu	37	8	33369846	33369847	+	Frame_Shift_Ins	INS	-	-	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr8:33369846_33369847insG	ENST00000431156.2	-	2	903_904	c.285_286insC	c.(283-288)ccctccfs	p.S96fs	TTI2_ENST00000520636.1_Frame_Shift_Ins_p.S96fs|TTI2_ENST00000360742.5_Frame_Shift_Ins_p.S96fs|TTI2_ENST00000519356.1_5'Flank|SNORD13_ENST00000459299.1_RNA	NM_001102401.2	NP_001095871.1	Q6NXR4	TTI2_HUMAN	TELO2 interacting protein 2	96																	TCCTCCTTGGAGGGGGCTGCAT	0.55																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK026916	CCDS6090.1	8p12	2011-11-10	2011-11-10	2011-09-22		ENSG00000129696			26262	protein-coding gene	gene with protein product		614426	"""chromosome 8 open reading frame 41"", ""Tel2 interacting protein 2 homolog (S. pombe)"""	C8orf41		20801936, 20810650	Standard	NM_025115		Approved	FLJ23263	uc003xjm.5	Q6NXR4		ENST00000431156.2:c.286dupC	8.37:g.33369851_33369851dupG	ENSP00000411169:p.Ser96fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSV7|Q96IM2|Q9H5N4	Frame_Shift_Ins	INS	pfam_DUF2454,superfamily_ARM-type_fold	p.S95fs	ENST00000431156.2	37	c.286_285	CCDS6090.1	8																																																																																			TTI2	-	NULL	ENSG00000129696		0.550	TTI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTI2	HGNC	protein_coding	OTTHUMT00000376555.1	34	0.00	0	-	NM_025115		33369846	33369847	-1	no_errors	ENST00000360742	ensembl	human	known	69_37n	frame_shift_ins	26	21.21	7	INS	0.000:0.001	G
UBC	7316	genome.wustl.edu	37	12	125396335	125396337	+	In_Frame_Del	DEL	TCC	TCC	-	rs397832571		TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr12:125396335_125396337delTCC	ENST00000538617.1	-	4	1157_1159	c.841_843delGGA	c.(841-843)ggadel	p.G281del	UBC_ENST00000339647.5_In_Frame_Del_p.G661del|UBC_ENST00000536661.1_5'Flank|UBC_ENST00000546120.1_In_Frame_Del_p.G585del|UBC_ENST00000536769.1_In_Frame_Del_p.G661del			P0CG48	UBC_HUMAN	ubiquitin C	661	Ubiquitin-like 4. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		ACAGGGTGCGTCCATCTTCCAGC	0.498																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000538617.1:c.841_843delGGA	12.37:g.125396335_125396337delTCC	ENSP00000443053:p.Gly281del	Somatic		WXS	Illumina GAIIx	Phase_IV	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	In_Frame_Del	DEL	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.G661in_frame_del	ENST00000538617.1	37	c.1983_1981		12																																																																																			UBC	-	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	ENSG00000150991		0.498	UBC-003	PUTATIVE	basic|exp_conf	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400179.1	107	0.00	0	TCC	NM_021009		125396335	125396337	-1	no_errors	ENST00000339647	ensembl	human	known	69_37n	in_frame_del	65	23.86	21	DEL	0.860:1.000:1.000	-
USP9X	8239	genome.wustl.edu	37	X	41075620	41075620	+	Missense_Mutation	SNP	A	A	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chrX:41075620A>C	ENST00000324545.8	+	35	6433	c.5800A>C	c.(5800-5802)Atg>Ctg	p.M1934L	USP9X_ENST00000378308.2_Missense_Mutation_p.M1934L	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	1934	USP.				axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TGATCACATGATGAAGCGTAT	0.383																																					Ovarian(172;1807 2695 35459 49286)	dbGAP											0													161.0	152.0	155.0					X																	41075620		2199	4297	6496	-	-	-	SO:0001583	missense	0			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.5800A>C	X.37:g.41075620A>C	ENSP00000316357:p.Met1934Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.M1934L	ENST00000324545.8	37	c.5800	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	A	6.429	0.447356	0.12223	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.02472	4.28;4.28	5.8	5.8	0.92144	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.01320	0.0043	N	0.01188	-0.97	0.58432	D	0.999999	B;B	0.09022	0.002;0.001	B;B	0.06405	0.001;0.002	T	0.52801	-0.8527	10	0.07990	T	0.79	.	15.0965	0.72238	1.0:0.0:0.0:0.0	.	1934;1934	Q93008-1;Q93008	.;USP9X_HUMAN	L	1934	ENSP00000367558:M1934L;ENSP00000316357:M1934L	ENSP00000316357:M1934L	M	+	1	0	USP9X	40960564	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.952000	0.93031	1.948000	0.56530	0.441000	0.28932	ATG	USP9X	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000124486		0.383	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	103	0.00	0	A	NM_004652		41075620	41075620	+1	no_errors	ENST00000324545	ensembl	human	known	69_37n	missense	112	13.18	17	SNP	1.000	C
VAPA	9218	genome.wustl.edu	37	18	9954080	9954080	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr18:9954080C>G	ENST00000400000.2	+	6	877	c.622C>G	c.(622-624)Cat>Gat	p.H208D	VAPA_ENST00000584796.1_3'UTR|VAPA_ENST00000340541.4_Missense_Mutation_p.H253D	NM_003574.5|NM_194434.2	NP_003565.4|NP_919415.2	Q9P0L0	VAPA_HUMAN	VAMP (vesicle-associated membrane protein)-associated protein A, 33kDa	208					cell death (GO:0008219)|membrane fusion (GO:0061025)|neuron projection development (GO:0031175)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein localization to endoplasmic reticulum (GO:0070972)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	protein heterodimerization activity (GO:0046982)|signal transducer activity (GO:0004871)|structural molecule activity (GO:0005198)			breast(1)|lung(2)|prostate(1)	4						AAAGGTAGCACATTCGGATAA	0.388																																						dbGAP											0													168.0	150.0	156.0					18																	9954080		1888	4111	5999	-	-	-	SO:0001583	missense	0				CCDS11847.2, CCDS11848.2	18p11.2	2008-07-28	2002-08-29		ENSG00000101558	ENSG00000101558			12648	protein-coding gene	gene with protein product		605703	"""VAMP (vesicle-associated membrane protein)-associated protein A (33kD)"""			9920726, 9657962	Standard	NM_003574		Approved	hVAP-33, VAP-A	uc002koj.3	Q9P0L0	OTTHUMG00000131603	ENST00000400000.2:c.622C>G	18.37:g.9954080C>G	ENSP00000382880:p.His208Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDZ0|D3DUI3|O75453|Q5U0E7|Q9UBZ2	Missense_Mutation	SNP	pfam_Major_sperm,superfamily_PapD-like,pirsf_Vesicle-associated_membrane,pfscan_Major_sperm	p.H253D	ENST00000400000.2	37	c.757	CCDS11848.2	18	.	.	.	.	.	.	.	.	.	.	C	16.08	3.022426	0.54683	.	.	ENSG00000101558	ENST00000340541;ENST00000400000	T;T	0.30448	1.53;1.53	5.59	5.59	0.84812	.	0.358790	0.35903	N	0.002907	T	0.34395	0.0896	L	0.33485	1.01	0.54753	D	0.999988	B;P	0.47910	0.067;0.902	B;P	0.49085	0.018;0.6	T	0.01440	-1.1354	9	.	.	.	-16.5416	17.7698	0.88487	0.0:1.0:0.0:0.0	.	208;253	Q9P0L0;Q9P0L0-2	VAPA_HUMAN;.	D	253;208	ENSP00000345656:H253D;ENSP00000382880:H208D	.	H	+	1	0	VAPA	9944080	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.933000	0.75874	2.639000	0.89480	0.655000	0.94253	CAT	VAPA	-	pirsf_Vesicle-associated_membrane	ENSG00000101558		0.388	VAPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAPA	HGNC	protein_coding	OTTHUMT00000254490.1	144	0.00	0	C			9954080	9954080	+1	no_errors	ENST00000340541	ensembl	human	known	69_37n	missense	71	26.53	26	SNP	1.000	G
VCAN	1462	genome.wustl.edu	37	5	82834915	82834915	+	Missense_Mutation	SNP	A	A	T			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr5:82834915A>T	ENST00000265077.3	+	8	6658	c.6093A>T	c.(6091-6093)caA>caT	p.Q2031H	VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.Q1044H|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000513899.1_RNA	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2031	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	GTGCTGTGCAAAAGTTTTCTG	0.488																																						dbGAP											0													65.0	70.0	68.0					5																	82834915		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.6093A>T	5.37:g.82834915A>T	ENSP00000265077:p.Gln2031His	Somatic		WXS	Illumina GAIIx	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.Q2031H	ENST00000265077.3	37	c.6093	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	A	12.69	2.012586	0.35511	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.84873	-1.88;-1.91;3.24	5.4	2.9	0.33743	.	0.726694	0.12782	N	0.439613	T	0.69305	0.3096	N	0.08118	0	0.18873	N	0.999989	B;B	0.20887	0.049;0.029	B;B	0.13407	0.009;0.003	T	0.59616	-0.7421	10	0.62326	D	0.03	.	6.9221	0.24393	0.6927:0.1623:0.0:0.145	.	1044;2031	P13611-2;P13611	.;CSPG2_HUMAN	H	2031;1044;1044	ENSP00000265077:Q2031H;ENSP00000340062:Q1044H;ENSP00000426251:Q1044H	ENSP00000265077:Q2031H	Q	+	3	2	VCAN	82870671	0.168000	0.22989	0.001000	0.08648	0.001000	0.01503	1.250000	0.32850	0.388000	0.25054	0.482000	0.46254	CAA	VCAN	-	NULL	ENSG00000038427		0.488	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	75	0.00	0	A	NM_004385		82834915	82834915	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	0.003	T
WDR6	11180	genome.wustl.edu	37	3	49050384	49050384	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr3:49050384G>C	ENST00000608424.1	+	2	1456	c.1417G>C	c.(1417-1419)Ggc>Cgc	p.G473R	WDR6_ENST00000448293.1_Missense_Mutation_p.G422R|WDR6_ENST00000415265.2_Intron|WDR6_ENST00000395474.3_Missense_Mutation_p.G503R|WDR6_ENST00000489684.1_Intron			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	473					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		CGCACCCTCTGGCAAGGCCAT	0.602																																						dbGAP											0													66.0	58.0	60.0					3																	49050384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.1417G>C	3.37:g.49050384G>C	ENSP00000477389:p.Gly473Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G503R	ENST00000608424.1	37	c.1507		3	.	.	.	.	.	.	.	.	.	.	G	16.75	3.208967	0.58343	.	.	ENSG00000178252	ENST00000395474;ENST00000448293	T;D	0.92299	0.15;-3.01	5.49	5.49	0.81192	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);	0.164767	0.53938	D	0.000043	D	0.94368	0.8189	L	0.55481	1.735	0.39841	D	0.973118	D;D	0.76494	0.999;0.997	D;D	0.66716	0.946;0.916	D	0.92086	0.5676	10	0.16896	T	0.51	-25.9035	19.3776	0.94518	0.0:0.0:1.0:0.0	.	473;422	Q9NNW5;E9PDU5	WDR6_HUMAN;.	R	503;422	ENSP00000378857:G503R;ENSP00000413432:G422R	ENSP00000378857:G503R	G	+	1	0	WDR6	49025388	0.998000	0.40836	0.997000	0.53966	0.821000	0.46438	2.918000	0.48829	2.594000	0.87642	0.561000	0.74099	GGC	WDR6	-	superfamily_Quino_amine_DH_bsu	ENSG00000178252		0.602	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	HGNC	protein_coding	OTTHUMT00000471652.1	44	0.00	0	G			49050384	49050384	+1	no_errors	ENST00000395474	ensembl	human	known	69_37n	missense	26	39.53	17	SNP	0.904	C
ZBTB38	253461	genome.wustl.edu	37	3	141162042	141162042	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr3:141162042T>G	ENST00000514251.1	+	4	1091	c.812T>G	c.(811-813)aTa>aGa	p.I271R	ZBTB38_ENST00000321464.5_Missense_Mutation_p.I272R|ZBTB38_ENST00000441582.2_Missense_Mutation_p.I271R					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						ACATTCTCCATACCACAGGAT	0.468																																						dbGAP											0													75.0	73.0	74.0					3																	141162042		1949	4142	6091	-	-	-	SO:0001583	missense	0			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.812T>G	3.37:g.141162042T>G	ENSP00000426387:p.Ile271Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.I272R	ENST00000514251.1	37	c.815	CCDS43157.1	3	.	.	.	.	.	.	.	.	.	.	T	2.761	-0.257798	0.05791	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464	T;T;T;T	0.08008	3.61;3.14;3.14;3.14	5.28	-5.46	0.02608	.	2.235930	0.02133	N	0.056521	T	0.02929	0.0087	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38200	-0.9672	9	.	.	.	-0.0953	2.5	0.04631	0.3818:0.3565:0.0919:0.1697	.	272;271	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	R	271;271;271;272	ENSP00000424254:I271R;ENSP00000426387:I271R;ENSP00000406955:I271R;ENSP00000372635:I272R	.	I	+	2	0	ZBTB38	142644732	0.000000	0.05858	0.000000	0.03702	0.760000	0.43138	-0.297000	0.08276	-0.465000	0.06953	0.482000	0.46254	ATA	ZBTB38	-	NULL	ENSG00000177311		0.468	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB38	HGNC	protein_coding	OTTHUMT00000359329.2	41	0.00	0	T			141162042	141162042	+1	no_errors	ENST00000321464	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.000	G
ZBBX	79740	genome.wustl.edu	37	3	166958696	166958696	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr3:166958696C>G	ENST00000392766.2	-	21	2628	c.2288G>C	c.(2287-2289)aGa>aCa	p.R763T	ZBBX_ENST00000455345.2_Missense_Mutation_p.R802T|ZBBX_ENST00000307529.5_Missense_Mutation_p.R802T|ZBBX_ENST00000392767.2_Missense_Mutation_p.R763T|ZBBX_ENST00000392764.1_Missense_Mutation_p.R734T	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	763						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						TTTGGTATCTCTTCCAGAACA	0.383																																						dbGAP											0													125.0	114.0	118.0					3																	166958696		1899	4125	6024	-	-	-	SO:0001583	missense	0			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2288G>C	3.37:g.166958696C>G	ENSP00000376519:p.Arg763Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	pfam_Znf_B-box	p.R802T	ENST00000392766.2	37	c.2405	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	C	8.961	0.970595	0.18659	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4	5.21	-0.977	0.10282	.	0.346016	0.24960	N	0.034229	T	0.42653	0.1212	L	0.40543	1.245	0.28133	N	0.930099	P;P	0.38922	0.557;0.651	B;B	0.41860	0.368;0.273	T	0.44283	-0.9338	10	0.72032	D	0.01	-12.5967	9.272	0.37677	0.0:0.578:0.0:0.422	.	802;763	A8MT70-2;A8MT70	.;ZBBX_HUMAN	T	763;763;802;802;734	ENSP00000376519:R763T;ENSP00000376520:R763T;ENSP00000390232:R802T;ENSP00000305065:R802T;ENSP00000376517:R734T	ENSP00000305065:R802T	R	-	2	0	ZBBX	168441390	0.991000	0.36638	0.990000	0.47175	0.267000	0.26476	-0.106000	0.10890	-0.038000	0.13624	0.557000	0.71058	AGA	ZBBX	-	NULL	ENSG00000169064		0.383	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3	77	0.00	0	C	NM_024687		166958696	166958696	-1	no_errors	ENST00000307529	ensembl	human	known	69_37n	missense	48	37.66	29	SNP	0.986	G
ZC3H13	23091	genome.wustl.edu	37	13	46549769	46549770	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr13:46549769_46549770delTC	ENST00000242848.4	-	12	2464_2465	c.2116_2117delGA	c.(2116-2118)gaafs	p.E706fs	ZC3H13_ENST00000282007.3_Frame_Shift_Del_p.E706fs			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	706	Arg/Glu-rich.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		tctttctagttctctctctttt	0.515																																					Esophageal Squamous(187;747 2077 11056 31291 44172)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.2116_2117delGA	13.37:g.46549775_46549776delTC	ENSP00000242848:p.Glu706fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Frame_Shift_Del	DEL	pfam_Znf_CCCH,smart_Znf_CCCH	p.E706fs	ENST00000242848.4	37	c.2117_2116		13																																																																																			ZC3H13	-	NULL	ENSG00000123200		0.515	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1	163	0.00	0	TC	NM_015070		46549769	46549770	-1	no_errors	ENST00000242848	ensembl	human	known	69_37n	frame_shift_del	137	15.43	25	DEL	0.966:1.000	-
ZNF319	57567	genome.wustl.edu	37	16	58030938	58030938	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr16:58030938G>A	ENST00000299237.2	-	2	1854	c.1232C>T	c.(1231-1233)tCt>tTt	p.S411F	USB1_ENST00000561743.1_5'Flank	NM_020807.1	NP_065858.1	Q9P2F9	ZN319_HUMAN	zinc finger protein 319	411					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(4)|ovary(1)|urinary_tract(1)	8						CAGCTCGGCAGATTGGTCAAA	0.652																																						dbGAP											0													48.0	49.0	49.0					16																	58030938		2198	4300	6498	-	-	-	SO:0001583	missense	0			AB037809	CCDS32462.1	16q21	2013-01-08				ENSG00000166188		"""Zinc fingers, C2H2-type"""	13644	protein-coding gene	gene with protein product						10718198, 11161788	Standard	XM_005256069		Approved	KIAA1388, Zfp319	uc002emx.1	Q9P2F9		ENST00000299237.2:c.1232C>T	16.37:g.58030938G>A	ENSP00000299237:p.Ser411Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LH8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S411F	ENST00000299237.2	37	c.1232	CCDS32462.1	16	.	.	.	.	.	.	.	.	.	.	G	10.60	1.394462	0.25205	.	.	ENSG00000166188	ENST00000299237	T	0.61392	0.11	5.21	4.24	0.50183	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.71013	0.3290	M	0.63843	1.955	0.51767	D	0.999933	D	0.89917	1.0	D	0.75484	0.986	T	0.68815	-0.5309	10	0.29301	T	0.29	-12.2396	14.162	0.65452	0.0:0.0:0.8489:0.151	.	411	Q9P2F9	ZN319_HUMAN	F	411	ENSP00000299237:S411F	ENSP00000299237:S411F	S	-	2	0	ZNF319	56588439	1.000000	0.71417	0.999000	0.59377	0.001000	0.01503	7.853000	0.86934	1.168000	0.42723	-0.181000	0.13052	TCT	ZNF319	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000166188		0.652	ZNF319-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF319	HGNC	protein_coding	OTTHUMT00000430317.1	50	0.00	0	G			58030938	58030938	-1	no_errors	ENST00000299237	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	A
ZNF615	284370	genome.wustl.edu	37	19	52496796	52496796	+	Silent	SNP	G	G	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr19:52496796G>C	ENST00000602063.1	-	6	1882	c.1533C>G	c.(1531-1533)ccC>ccG	p.P511P	ZNF615_ENST00000376716.5_Silent_p.P511P|ZNF615_ENST00000598071.1_Silent_p.P522P|ZNF615_ENST00000391795.3_Silent_p.P516P|ZNF615_ENST00000594083.1_Silent_p.P522P			Q8N8J6	ZN615_HUMAN	zinc finger protein 615	511					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(12)|ovary(5)|prostate(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	42		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00142)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CACATACATAGGGTTTTTCTC	0.428																																						dbGAP											0													109.0	98.0	102.0					19																	52496796		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096691	CCDS12846.1, CCDS59418.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	24740	protein-coding gene	gene with protein product						12477932	Standard	NM_001199324		Approved	FLJ33710	uc002pyf.2	Q8N8J6		ENST00000602063.1:c.1533C>G	19.37:g.52496796G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKW9|Q2M2Y6|Q5CZB0|Q6ZMT7|Q6ZRB3	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P516	ENST00000602063.1	37	c.1548	CCDS12846.1	19																																																																																			ZNF615	-	pfscan_Znf_C2H2	ENSG00000197619		0.428	ZNF615-009	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZNF615	HGNC	protein_coding	OTTHUMT00000462391.1	77	0.00	0	G	NM_198480		52496796	52496796	-1	no_errors	ENST00000391795	ensembl	human	known	69_37n	silent	48	15.79	9	SNP	0.511	C
ZNF644	84146	genome.wustl.edu	37	1	91404518	91404518	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr1:91404518T>C	ENST00000370440.1	-	3	2610	c.2393A>G	c.(2392-2394)gAa>gGa	p.E798G	ZNF644_ENST00000337393.5_Missense_Mutation_p.E798G|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000467231.1_Intron			Q9H582	ZN644_HUMAN	zinc finger protein 644	798					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		TTTGAAGCTTTCAGGCCTTTT	0.383																																						dbGAP											0													67.0	70.0	69.0					1																	91404518		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.2393A>G	1.37:g.91404518T>C	ENSP00000359469:p.Glu798Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E798G	ENST00000370440.1	37	c.2393	CCDS731.1	1	.	.	.	.	.	.	.	.	.	.	T	7.103	0.574491	0.13623	.	.	ENSG00000122482	ENST00000370440;ENST00000337393;ENST00000536941	T;T	0.55234	0.53;0.53	5.94	5.94	0.96194	.	0.296192	0.36200	N	0.002730	T	0.18882	0.0453	L	0.29908	0.895	0.40334	D	0.978967	B	0.06786	0.001	B	0.06405	0.002	T	0.17258	-1.0375	10	0.16420	T	0.52	-18.0028	6.6695	0.23060	0.1369:0.0711:0.0:0.792	.	798	Q9H582	ZN644_HUMAN	G	798;798;370	ENSP00000359469:E798G;ENSP00000337008:E798G	ENSP00000337008:E798G	E	-	2	0	ZNF644	91177106	1.000000	0.71417	1.000000	0.80357	0.553000	0.35397	2.124000	0.42006	2.265000	0.75225	0.482000	0.46254	GAA	ZNF644	-	NULL	ENSG00000122482		0.383	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	36	0.00	0	T	NM_032186		91404518	91404518	-1	no_errors	ENST00000337393	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.989	C
ZNF804B	219578	genome.wustl.edu	37	7	88956723	88956724	+	Frame_Shift_Ins	INS	-	-	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr7:88956723_88956724insA	ENST00000333190.4	+	3	924_925	c.315_316insA	c.(316-318)aaafs	p.K106fs		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	106							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			GGAAAGATGAGAAAAAACAAGA	0.361										HNSCC(36;0.09)																												dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.321dupA	7.37:g.88956729_88956729dupA	ENSP00000329638:p.Lys106fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTV2|Q7Z714|Q96MN7	Frame_Shift_Ins	INS	pfam_Znf_C2H2_jaz	p.Q107fs	ENST00000333190.4	37	c.315_316	CCDS5613.1	7																																																																																			ZNF804B	-	NULL	ENSG00000182348		0.361	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	86	0.00	0	-	NM_181646		88956723	88956724	+1	no_errors	ENST00000333190	ensembl	human	known	69_37n	frame_shift_ins	45	36.62	26	INS	0.992:1.000	A
ZNF91	7644	genome.wustl.edu	37	19	23544004	23544004	+	Nonsense_Mutation	SNP	T	T	A			TCGA-GM-A2DB-01A-31D-A19Y-09	TCGA-GM-A2DB-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c13e05b6-0b3e-4c1f-800e-4a49c5d417aa	7bba57a5-c11e-43a2-ab14-5b33f5afa6d9	g.chr19:23544004T>A	ENST00000300619.7	-	4	1982	c.1777A>T	c.(1777-1779)Aag>Tag	p.K593*	ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000599743.1_Intron|ZNF91_ENST00000397082.2_Nonsense_Mutation_p.K561*	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	593					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGAATTATCTTATGTGTAGAA	0.363																																						dbGAP											0													45.0	48.0	47.0					19																	23544004		2140	4261	6401	-	-	-	SO:0001587	stop_gained	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.1777A>T	19.37:g.23544004T>A	ENSP00000300619:p.Lys593*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E1|B7Z6G6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K593*	ENST00000300619.7	37	c.1777	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	T	16.97	3.267932	0.59540	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	.	.	.	1.78	-3.56	0.04626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	4.5429	0.12067	0.1548:0.0:0.4162:0.429	.	.	.	.	X	593;561	.	ENSP00000300619:K593X	K	-	1	0	ZNF91	23335844	0.000000	0.05858	0.000000	0.03702	0.046000	0.14306	-0.829000	0.04415	-0.819000	0.04323	0.260000	0.18958	AAG	ZNF91	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167232		0.363	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	35	0.00	0	T	NM_003430		23544004	23544004	-1	no_errors	ENST00000300619	ensembl	human	known	69_37n	nonsense	30	11.76	4	SNP	0.091	A
