#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
BMPR2	659	genome.wustl.edu	37	2	203420014	203420014	+	Silent	SNP	T	T	C			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr2:203420014T>C	ENST00000374580.4	+	12	2165	c.1626T>C	c.(1624-1626)ccT>ccC	p.P542P	BMPR2_ENST00000374574.2_Intron	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	542					activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						AAATTGGTCCTTATCCAGATT	0.383																																						dbGAP											0													109.0	109.0	109.0					2																	203420014		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1626T>C	2.37:g.203420014T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P542	ENST00000374580.4	37	c.1626	CCDS33361.1	2																																																																																			BMPR2	-	NULL	ENSG00000204217		0.383	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	HGNC	protein_coding	OTTHUMT00000257743.1	58	0.00	0	T	NM_001204		203420014	203420014	+1	no_errors	ENST00000374580	ensembl	human	known	69_37n	silent	28	20.00	7	SNP	0.998	C
BRD7	29117	genome.wustl.edu	37	16	50388767	50388767	+	Missense_Mutation	SNP	C	C	A	rs148401358		TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr16:50388767C>A	ENST00000394688.3	-	3	484	c.325G>T	c.(325-327)Gcc>Tcc	p.A109S	BRD7_ENST00000401491.3_5'UTR|snoU13_ENST00000459559.1_RNA|BRD7_ENST00000394689.2_Missense_Mutation_p.A109S			Q9NPI1	BRD7_HUMAN	bromodomain containing 7	109					cell cycle (GO:0007049)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	histone binding (GO:0042393)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|urinary_tract(2)	22		all_cancers(37;0.0127)				CTCACAGGGGCGTGACACTGG	0.428																																						dbGAP											0													97.0	101.0	100.0					16																	50388767		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF213969	CCDS10742.1, CCDS54007.1	16q12.1	2008-11-18	2002-01-14		ENSG00000166164	ENSG00000166164			14310	protein-coding gene	gene with protein product			"""bromodomain-containing 7"""			10526152, 18809673	Standard	NM_013263		Approved	CELTIX1, BP75	uc002ege.2	Q9NPI1	OTTHUMG00000133170	ENST00000394688.3:c.325G>T	16.37:g.50388767C>A	ENSP00000378180:p.Ala109Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VC09|Q8N2L9|Q96KA4|Q9BV48|Q9UH59	Missense_Mutation	SNP	pfam_DUF3512,pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.A109S	ENST00000394688.3	37	c.325	CCDS10742.1	16	.	.	.	.	.	.	.	.	.	.	C	5.684	0.310732	0.10733	.	.	ENSG00000166164	ENST00000394688;ENST00000394689;ENST00000401491	T;T	0.28895	1.59;1.59	5.74	-1.92	0.07618	.	0.636660	0.17384	N	0.176192	T	0.08492	0.0211	N	0.03608	-0.345	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.33111	-0.9881	10	0.06625	T	0.88	-12.3575	4.3998	0.11381	0.281:0.1943:0.0:0.5247	.	109;109	Q9NPI1;Q9NPI1-2	BRD7_HUMAN;.	S	109	ENSP00000378180:A109S;ENSP00000378181:A109S	ENSP00000378180:A109S	A	-	1	0	BRD7	48946268	0.005000	0.15991	0.006000	0.13384	0.901000	0.52897	0.064000	0.14437	-0.151000	0.11176	-0.140000	0.14226	GCC	BRD7	-	NULL	ENSG00000166164		0.428	BRD7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BRD7	HGNC	protein_coding	OTTHUMT00000256874.3	91	0.00	0	C	NM_013263		50388767	50388767	-1	no_errors	ENST00000394689	ensembl	human	known	69_37n	missense	98	21.60	27	SNP	0.012	A
CDC6	990	genome.wustl.edu	37	17	38450651	38450651	+	Silent	SNP	C	C	T			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr17:38450651C>T	ENST00000209728.4	+	7	1450	c.979C>T	c.(979-981)Cta>Tta	p.L327L		NM_001254.3	NP_001245.1	Q99741	CDC6_HUMAN	cell division cycle 6	327					DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|positive regulation of chromosome segregation (GO:0051984)|positive regulation of cytokinesis (GO:0032467)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|traversing start control point of mitotic cell cycle (GO:0007089)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|kinase binding (GO:0019900)|nucleotide binding (GO:0000166)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|stomach(2)|urinary_tract(1)	21						AGATAGAATTCTACCTAGGCT	0.373																																						dbGAP											0													95.0	90.0	92.0					17																	38450651		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U77949	CCDS11365.1	17q21.3	2013-01-17	2013-01-17		ENSG00000094804	ENSG00000094804			1744	protein-coding gene	gene with protein product		602627	"""CDC6 (cell division cycle 6, S. cerevisiae) homolog"", ""CDC6 cell division cycle 6 homolog (S. cerevisiae)"", ""cell division cycle 6 homolog (S. cerevisiae)"""	CDC18L		8990175, 9566895	Standard	NM_001254		Approved		uc002huj.1	Q99741	OTTHUMG00000133324	ENST00000209728.4:c.979C>T	17.37:g.38450651C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB30	Silent	SNP	pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6	p.L327	ENST00000209728.4	37	c.979	CCDS11365.1	17																																																																																			CDC6	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase,pirsf_Cell_div_Cdc6	ENSG00000094804		0.373	CDC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC6	HGNC	protein_coding	OTTHUMT00000257129.1	71	0.00	0	C			38450651	38450651	+1	no_errors	ENST00000209728	ensembl	human	known	69_37n	silent	91	12.50	13	SNP	1.000	T
CYLC2	1539	genome.wustl.edu	37	9	105767473	105767473	+	Missense_Mutation	SNP	A	A	C			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr9:105767473A>C	ENST00000374798.3	+	5	630	c.560A>C	c.(559-561)aAa>aCa	p.K187T	CYLC2_ENST00000487798.1_Missense_Mutation_p.K187T	NM_001340.3	NP_001331.1	Q14093	CYLC2_HUMAN	cylicin, basic protein of sperm head cytoskeleton 2	187	3 X approximate tandem repeats.|31 X 3 AA repeats of K-K-X.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(14)|ovary(1)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)	41		all_hematologic(171;0.125)				ggtgcaaagaaagataacaaa	0.368																																						dbGAP											0													79.0	76.0	77.0					9																	105767473		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z46788	CCDS35085.1	9q31.2	2008-07-21			ENSG00000155833	ENSG00000155833			2583	protein-coding gene	gene with protein product		604035				7737358	Standard	NM_001340		Approved		uc004bbs.2	Q14093	OTTHUMG00000020396	ENST00000374798.3:c.560A>C	9.37:g.105767473A>C	ENSP00000420256:p.Lys187Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8F4|Q5VVJ9	Missense_Mutation	SNP	NULL	p.K187T	ENST00000374798.3	37	c.560	CCDS35085.1	9	.	.	.	.	.	.	.	.	.	.	A	12.75	2.032046	0.35893	.	.	ENSG00000155833	ENST00000374798;ENST00000487798	T;T	0.18502	2.21;2.21	4.54	4.54	0.55810	.	0.136157	0.33938	N	0.004416	T	0.37100	0.0991	M	0.82323	2.585	0.23156	N	0.998202	D	0.71674	0.998	D	0.71656	0.974	T	0.26258	-1.0108	10	0.24483	T	0.36	-13.684	6.9102	0.24331	0.8983:0.0:0.1017:0.0	.	187	Q14093	CYLC2_HUMAN	T	187	ENSP00000420256:K187T;ENSP00000417674:K187T	ENSP00000420256:K187T	K	+	2	0	CYLC2	104807294	1.000000	0.71417	0.841000	0.33234	0.013000	0.08279	2.226000	0.42963	2.034000	0.60081	0.443000	0.29094	AAA	CYLC2	-	NULL	ENSG00000155833		0.368	CYLC2-001	KNOWN	alternative_3_UTR|NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	CYLC2	HGNC	protein_coding	OTTHUMT00000053463.3	120	0.00	0	A	NM_001340		105767473	105767473	+1	no_errors	ENST00000374798	ensembl	human	putative	69_37n	missense	58	25.64	20	SNP	0.431	C
DNAH17	8632	genome.wustl.edu	37	17	76522783	76522783	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr17:76522783C>T	ENST00000585328.1	-	24	3776	c.3652G>A	c.(3652-3654)Gag>Aag	p.E1218K	DNAH17_ENST00000389840.5_Missense_Mutation_p.E1221K	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	1221	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			AACGGGGCCTCGCGCCTGAAC	0.587																																						dbGAP											0													47.0	50.0	49.0					17																	76522783		1967	4145	6112	-	-	-	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.3652G>A	17.37:g.76522783C>T	ENSP00000465516:p.Glu1218Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.E1221K	ENST00000585328.1	37	c.3661		17	.	.	.	.	.	.	.	.	.	.	C	0.008	-1.896695	0.00522	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.21932	1.98	4.37	1.2	0.21068	.	.	.	.	.	T	0.13543	0.0328	L	0.33339	1.005	0.09310	N	1	.	.	.	.	.	.	T	0.35525	-0.9785	7	0.09338	T	0.73	.	7.0326	0.24975	0.0:0.6363:0.135:0.2287	.	.	.	.	K	1218;1221	ENSP00000374490:E1221K	ENSP00000300671:E1218K	E	-	1	0	DNAH17	74034378	0.056000	0.20664	0.027000	0.17364	0.008000	0.06430	0.616000	0.24344	0.340000	0.23745	-2.325000	0.00251	GAG	DNAH17	-	NULL	ENSG00000187775		0.587	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	32	0.00	0	C	NM_173628		76522783	76522783	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	38	26.92	14	SNP	0.169	T
DOCK11	139818	genome.wustl.edu	37	X	117777490	117777490	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chrX:117777490T>C	ENST00000276202.7	+	40	4394	c.4331T>C	c.(4330-4332)cTt>cCt	p.L1444P	DOCK11_ENST00000276204.6_Missense_Mutation_p.L1444P	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11	1444					blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						CTTGCTTTTCTTAAAAATGGA	0.368																																						dbGAP											0													178.0	178.0	178.0					X																	117777490		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.4331T>C	X.37:g.117777490T>C	ENSP00000276202:p.Leu1444Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L1444P	ENST00000276202.7	37	c.4331	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	T	21.0	4.081723	0.76528	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	T;T	0.74209	-0.82;-0.82	5.22	5.22	0.72569	.	0.141590	0.47093	D	0.000253	D	0.88658	0.6496	M	0.91249	3.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.91195	0.4987	10	0.87932	D	0	-12.4375	14.3841	0.66931	0.0:0.0:0.0:1.0	.	1444;1444	A6NIW2;Q5JSL3	.;DOC11_HUMAN	P	1444	ENSP00000276204:L1444P;ENSP00000276202:L1444P	ENSP00000276202:L1444P	L	+	2	0	DOCK11	117661518	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	1.844000	0.53588	0.486000	0.48141	CTT	DOCK11	-	NULL	ENSG00000147251		0.368	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	81	0.00	0	T	NM_144658		117777490	117777490	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	missense	72	29.41	30	SNP	1.000	C
FAM218A	152756	genome.wustl.edu	37	4	165878324	165878324	+	Silent	SNP	C	C	T			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr4:165878324C>T	ENST00000513876.2	+	1	225	c.150C>T	c.(148-150)acC>acT	p.T50T	TRIM61_ENST00000329314.5_Intron	NM_153027.1	NP_694572.1	Q96MZ4	F218A_HUMAN	family with sequence similarity 218, member A	50																	ATACGCTGACCGGCGGCCGCC	0.622																																						dbGAP											0													21.0	21.0	21.0					4																	165878324		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK056221	CCDS3807.1	4q32.3	2012-03-01	2012-03-01	2012-03-01	ENSG00000250486	ENSG00000250486			26466	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 39"""	C4orf39		12477932	Standard	NM_153027		Approved	FLJ31659	uc003iqx.1	Q96MZ4	OTTHUMG00000161252	ENST00000513876.2:c.150C>T	4.37:g.165878324C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.T50	ENST00000513876.2	37	c.150	CCDS3807.1	4																																																																																			FAM218A	-	NULL	ENSG00000250486		0.622	FAM218A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM218A	HGNC	protein_coding	OTTHUMT00000364308.1	26	0.00	0	C	NM_153027		165878324	165878324	+1	no_errors	ENST00000513876	ensembl	human	known	69_37n	silent	36	14.29	6	SNP	0.000	T
FAM86B1	85002	genome.wustl.edu	37	8	12044217	12044217	+	Missense_Mutation	SNP	G	G	C	rs201723492	byFrequency	TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr8:12044217G>C	ENST00000448228.2	-	4	415	c.366C>G	c.(364-366)ttC>ttG	p.F122L	FAM86B1_ENST00000533852.2_Missense_Mutation_p.F156L|FAM86B1_ENST00000533513.1_Missense_Mutation_p.F156L|FAM86B1_ENST00000534520.1_Missense_Mutation_p.F122L|FAM86B1_ENST00000321602.8_Nonsense_Mutation_p.S17*	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1	122										kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		ACCTGTTAATGAAGGCTGCCG	0.612																																						dbGAP											0													1.0	1.0	1.0					8																	12044217		903	2043	2946	-	-	-	SO:0001583	missense	0			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.366C>G	8.37:g.12044217G>C	ENSP00000407067:p.Phe122Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.S17*	ENST00000448228.2	37	c.50	CCDS59512.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	-|-	22.4|22.4	4.291472|4.291472	0.80914|0.80914	.|.	.|.	ENSG00000186523|ENSG00000186523	ENST00000431227;ENST00000340537;ENST00000448228;ENST00000534520;ENST00000526708;ENST00000524571;ENST00000533513|ENST00000321602;ENST00000526802	T;T;T;T;T|.	0.30448|.	1.97;2.38;1.97;1.68;1.53|.	1.17|1.17	0.24|0.24	0.15489|0.15489	.|.	.|.	.|.	.|.	.|.	T|.	0.53706|.	0.1813|.	L|L	0.48877|0.48877	1.53|1.53	0.58432|0.58432	D|D	0.999996|0.999996	D;D|.	0.89917|.	0.991;1.0|.	D;D|.	0.91635|.	0.978;0.999|.	T|.	0.51364|.	-0.8715|.	9|.	0.51188|0.62326	T|D	0.08|0.03	.|.	5.4654|5.4654	0.16639|0.16639	0.2152:0.0:0.7848:0.0|0.2152:0.0:0.7848:0.0	.|.	122;156|.	Q8N7N1;E9PN63|.	F86B1_HUMAN;.|.	L|X	156;122;122;122;156;94;156|17;118	ENSP00000342610:F122L;ENSP00000407067:F122L;ENSP00000431362:F122L;ENSP00000432790:F94L;ENSP00000435201:F156L|.	ENSP00000342610:F122L|ENSP00000439686:S17X	F|S	-|-	3|2	2|0	FAM86B1|FAM86B1	12081626|12081626	0.975000|0.975000	0.34042|0.34042	0.013000|0.013000	0.15412|0.15412	0.067000|0.067000	0.16453|0.16453	1.663000|1.663000	0.37429|0.37429	0.068000|0.068000	0.16574|0.16574	0.173000|0.173000	0.16961|0.16961	TTC|TCA	FAM86B1	-	NULL	ENSG00000186523		0.612	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	HGNC	protein_coding	OTTHUMT00000383317.1	15	0.00	0	G	NM_032916		12044217	12044217	-1	no_errors	ENST00000321602	ensembl	human	known	69_37n	nonsense	27	28.95	11	SNP	0.804	C
FIGLA	344018	genome.wustl.edu	37	2	71014794	71014794	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr2:71014794G>T	ENST00000332372.6	-	2	375	c.371C>A	c.(370-372)gCc>gAc	p.A124D		NM_001004311.3	NP_001004311.2	Q6QHK4	FIGLA_HUMAN	folliculogenesis specific basic helix-loop-helix	124					multicellular organismal development (GO:0007275)|oocyte development (GO:0048599)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|transcription factor binding (GO:0008134)			endometrium(2)|lung(3)	5						TGAGTCTTTGGCTCCTTCCAA	0.398																																						dbGAP											0													60.0	53.0	55.0					2																	71014794		1837	4081	5918	-	-	-	SO:0001583	missense	0			BC039536	CCDS46320.1	2p13.3	2013-05-21			ENSG00000183733	ENSG00000183733		"""Basic helix-loop-helix proteins"""	24669	protein-coding gene	gene with protein product	"""factor in the germline alpha"""	608697				12468641	Standard	NM_001004311		Approved	bHLHc8	uc002she.1	Q6QHK4	OTTHUMG00000153440	ENST00000332372.6:c.371C>A	2.37:g.71014794G>T	ENSP00000333097:p.Ala124Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.A124D	ENST00000332372.6	37	c.371	CCDS46320.1	2	.	.	.	.	.	.	.	.	.	.	G	11.84	1.759673	0.31137	.	.	ENSG00000183733	ENST00000332372	D	0.88354	-2.37	5.65	3.82	0.43975	Helix-loop-helix DNA-binding (1);	0.753435	0.11902	N	0.518490	D	0.91036	0.7180	L	0.59436	1.845	0.24087	N	0.99593	D	0.61080	0.989	P	0.59357	0.856	T	0.80883	-0.1183	10	0.34782	T	0.22	.	9.5476	0.39291	0.0779:0.1431:0.7791:0.0	.	124	Q6QHK4	FIGLA_HUMAN	D	124	ENSP00000333097:A124D	ENSP00000333097:A124D	A	-	2	0	FIGLA	70868302	0.703000	0.27826	0.528000	0.27938	0.014000	0.08584	2.656000	0.46716	0.904000	0.36572	-0.150000	0.13652	GCC	FIGLA	-	superfamily_HLH_DNA-bd	ENSG00000183733		0.398	FIGLA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGLA	HGNC	protein_coding	OTTHUMT00000331214.1	58	0.00	0	G	NM_001004311		71014794	71014794	-1	no_errors	ENST00000332372	ensembl	human	known	69_37n	missense	58	22.37	17	SNP	0.573	T
FMN1	342184	genome.wustl.edu	37	15	33359980	33359980	+	Intron	SNP	T	T	G			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr15:33359980T>G	ENST00000559047.1	-	3	2043				FMN1_ENST00000558197.1_Missense_Mutation_p.K36Q|FMN1_ENST00000334528.9_Missense_Mutation_p.K36Q|FMN1_ENST00000561249.1_Intron|FMN1_ENST00000559150.1_Intron			Q68DA7	FMN1_HUMAN	formin 1						actin nucleation (GO:0045010)	actin filament (GO:0005884)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|upper_aerodigestive_tract(3)	29		all_lung(180;1.14e-07)		all cancers(64;3.05e-15)|Epithelial(43;1.67e-10)|GBM - Glioblastoma multiforme(186;4.95e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0262)		AATAGGGATTTCATAGAGAAC	0.433																																						dbGAP											0													73.0	69.0	70.0					15																	33359980		1902	4128	6030	-	-	-	SO:0001627	intron_variant	0			AH002864	CCDS45209.1, CCDS61581.1, CCDS61582.1	15q13.3	2013-06-13	2005-01-20	2005-01-22	ENSG00000248905	ENSG00000248905			3768	protein-coding gene	gene with protein product	"""limb deformity protein"""	136535	"""formin (limb deformity)"""	LD, FMN		1673046	Standard	NM_001277313		Approved	DKFZP686C2281, FLJ45135, MGC125288, MGC125289	uc031qrh.1	Q68DA7	OTTHUMG00000172201	ENST00000559047.1:c.2044-2705A>C	15.37:g.33359980T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7I6|Q3ZAR4|Q6ZSY1	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,prints_Formin	p.K36Q	ENST00000559047.1	37	c.106		15	.	.	.	.	.	.	.	.	.	.	T	15.95	2.984064	0.53827	.	.	ENSG00000248905	ENST00000334528	T	0.51574	0.7	5.44	5.44	0.79542	.	.	.	.	.	T	0.69486	0.3116	.	.	.	.	.	.	D;D	0.89917	1.0;0.999	D;D	0.77557	0.99;0.964	T	0.75542	-0.3281	7	0.66056	D	0.02	.	15.4867	0.75573	0.0:0.0:0.0:1.0	.	36;36	Q68DA7-3;Q68DA7-5	.;.	Q	36	ENSP00000333950:K36Q	ENSP00000333950:K36Q	K	-	1	0	FMN1	31147272	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	5.376000	0.66178	2.066000	0.61787	0.533000	0.62120	AAA	FMN1	-	NULL	ENSG00000248905		0.433	FMN1-005	NOVEL	basic|exp_conf	protein_coding	FMN1	HGNC	protein_coding	OTTHUMT00000417414.1	61	0.00	0	T	NM_001103184		33359980	33359980	-1	no_errors	ENST00000334528	ensembl	human	known	69_37n	missense	45	18.18	10	SNP	1.000	G
HTR1A	3350	genome.wustl.edu	37	5	63256637	63256637	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr5:63256637G>A	ENST00000323865.3	-	1	1143	c.910C>T	c.(910-912)Cac>Tac	p.H304Y	RP11-158J3.2_ENST00000502882.1_RNA	NM_000524.3	NP_000515.2	P08908	5HT1A_HUMAN	5-hydroxytryptamine (serotonin) receptor 1A, G protein-coupled	304					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|behavioral fear response (GO:0001662)|cell proliferation (GO:0008283)|exploration behavior (GO:0035640)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cell proliferation (GO:0008284)|regulation of behavior (GO:0050795)|regulation of dopamine metabolic process (GO:0042053)|regulation of hormone secretion (GO:0046883)|regulation of serotonin secretion (GO:0014062)|serotonin metabolic process (GO:0042428)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	serotonin receptor activity (GO:0004993)			cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(29)|ovary(2)|pancreas(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	56		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0575)|Colorectal(97;0.234)		Lung(70;0.105)	Acepromazine(DB01614)|Alprenolol(DB00866)|Alverine(DB01616)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Buspirone(DB00490)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinitapride(DB08810)|Clozapine(DB00363)|Desipramine(DB01151)|Dopamine(DB00988)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Methysergide(DB00247)|Mianserin(DB06148)|Molindone(DB01618)|Naratriptan(DB00952)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Ondansetron(DB00904)|Paliperidone(DB01267)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sumatriptan(DB00669)|Thioproperazine(DB01622)|Trazodone(DB00656)|Trimipramine(DB00726)|Vilazodone(DB06684)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	AGAGGCAAGTGCTCTTTGGAG	0.652																																						dbGAP											0													38.0	37.0	38.0					5																	63256637		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF498978	CCDS34168.1	5q11.2-q13	2012-08-08	2012-02-03			ENSG00000178394		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5286	protein-coding gene	gene with protein product		109760	"""5-hydroxytryptamine (serotonin) receptor 1A"""	ADRB2RL1, ADRBRL1		2591972, 12969265	Standard	NM_000524		Approved	5-HT1A	uc011cqt.3	P08908		ENST00000323865.3:c.910C>T	5.37:g.63256637G>A	ENSP00000316244:p.His304Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LAE7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT1A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt,prints_NPY_rcpt	p.H304Y	ENST00000323865.3	37	c.910	CCDS34168.1	5	.	.	.	.	.	.	.	.	.	.	G	16.77	3.214026	0.58452	.	.	ENSG00000178394	ENST00000323865	T	0.62941	-0.01	5.17	5.17	0.71159	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.73969	0.3655	M	0.75264	2.295	0.58432	D	0.999998	D	0.62365	0.991	P	0.60473	0.875	T	0.75434	-0.3319	10	0.54805	T	0.06	.	11.0375	0.47811	0.0927:0.0:0.9073:0.0	.	304	P08908	5HT1A_HUMAN	Y	304	ENSP00000316244:H304Y	ENSP00000316244:H304Y	H	-	1	0	HTR1A	63292393	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.131000	0.57970	2.692000	0.91855	0.655000	0.94253	CAC	HTR1A	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000178394		0.652	HTR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1A	HGNC	protein_coding	OTTHUMT00000368397.1	20	0.00	0	G	NM_000524		63256637	63256637	-1	no_errors	ENST00000323865	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	1.000	A
KRTAP5-4	387267	genome.wustl.edu	37	11	1643266	1643266	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr11:1643266C>T	ENST00000399682.1	-	1	102	c.58G>A	c.(58-60)Ggc>Agc	p.G20S		NM_001012709.1	NP_001012727	Q6L8H1	KRA54_HUMAN	keratin associated protein 5-4	0						keratin filament (GO:0045095)				NS(1)|endometrium(9)|kidney(2)|lung(2)|pancreas(1)|prostate(3)|skin(2)	20		all_epithelial(84;0.00819)|Breast(177;0.00832)|Ovarian(85;0.0256)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		cccccacagccggagccacag	0.682																																						dbGAP											0													5.0	8.0	7.0					11																	1643266		661	1545	2206	-	-	-	SO:0001583	missense	0			AB126073		11p15.5	2012-04-19			ENSG00000241598	ENSG00000241598		"""Keratin associated proteins"""	23599	protein-coding gene	gene with protein product						15144888	Standard	NM_001012709		Approved	KRTAP5.4	uc009ycy.1	Q6L8H1	OTTHUMG00000057553	ENST00000399682.1:c.58G>A	11.37:g.1643266C>T	ENSP00000382590:p.Gly20Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G20S	ENST00000399682.1	37	c.58		11	.	.	.	.	.	.	.	.	.	.	C	0.651	-0.809377	0.02798	.	.	ENSG00000241598	ENST00000399682;ENST00000328953	T	0.00633	6.08	2.31	-3.79	0.04320	.	.	.	.	.	T	0.00241	0.0007	N	0.00890	-1.11	0.22552	N	0.998996	B	0.29212	0.237	B	0.16722	0.016	T	0.41484	-0.9506	9	0.07644	T	0.81	.	9.9268	0.41496	0.0:0.689:0.0:0.311	.	20	Q6L8H1	KRA54_HUMAN	S	20	ENSP00000382590:G20S	ENSP00000331603:G20S	G	-	1	0	KRTAP5-4	1599842	0.042000	0.20092	0.726000	0.30738	0.038000	0.13279	-0.694000	0.05115	-0.813000	0.04357	-1.406000	0.01132	GGC	KRTAP5-4	-	NULL	ENSG00000241598		0.682	KRTAP5-4-001	KNOWN	basic|appris_principal	protein_coding	KRTAP5-4	HGNC	protein_coding	OTTHUMT00000127918.1	51	0.00	0	C	NM_001012709		1643266	1643266	-1	no_errors	ENST00000399682	ensembl	human	known	69_37n	missense	51	26.09	18	SNP	0.974	T
MAP3K5	4217	genome.wustl.edu	37	6	136904772	136904773	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr6:136904772_136904773delGA	ENST00000359015.4	-	24	3691_3692	c.3331_3332delTC	c.(3331-3333)tcafs	p.S1111fs	MAP3K5_ENST00000463140.1_5'UTR|MAP3K5_ENST00000355845.4_Frame_Shift_Del_p.S358fs	NM_005923.3	NP_005914.1	Q99683	M3K5_HUMAN	mitogen-activated protein kinase kinase kinase 5	1111					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|apoptotic signaling pathway (GO:0097190)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|JNK cascade (GO:0007254)|MAPK cascade (GO:0000165)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of neuron death (GO:1901216)|programmed necrotic cell death (GO:0097300)|protein phosphorylation (GO:0006468)|response to ischemia (GO:0002931)|viral process (GO:0016032)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|protein kinase complex (GO:1902911)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein phosphatase binding (GO:0019903)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(6)|large_intestine(6)|lung(24)|ovary(2)|prostate(1)|skin(4)|urinary_tract(4)	58	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00137)|OV - Ovarian serous cystadenocarcinoma(155;0.00569)		TTTCAGCTTTGACAGTGTGGTG	0.446																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U67156	CCDS5179.1	6q22.33	2011-06-09			ENSG00000197442	ENSG00000197442		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6857	protein-coding gene	gene with protein product	"""apoptosis signal regulating kinase 1"""	602448		MEKK5		9465908	Standard	NM_005923		Approved	MAPKKK5, ASK1	uc003qhc.3	Q99683	OTTHUMG00000015647	ENST00000359015.4:c.3331_3332delTC	6.37:g.136904772_136904773delGA	ENSP00000351908:p.Ser1111fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIA0|B4DGB2|Q5THN3|Q99461	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S1111fs	ENST00000359015.4	37	c.3332_3331	CCDS5179.1	6																																																																																			MAP3K5	-	NULL	ENSG00000197442		0.446	MAP3K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP3K5	HGNC	protein_coding	OTTHUMT00000042383.1	135	0.00	0	GA			136904772	136904773	-1	no_errors	ENST00000359015	ensembl	human	known	69_37n	frame_shift_del	126	21.43	36	DEL	1.000:1.000	-
PHACTR1	221692	genome.wustl.edu	37	6	13273143	13273143	+	Silent	SNP	G	G	A			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr6:13273143G>A	ENST00000379350.1	+	10	1572	c.1443G>A	c.(1441-1443)ttG>ttA	p.L481L	RP1-257A7.4_ENST00000606627.1_RNA|RP1-257A7.4_ENST00000399446.2_RNA|PHACTR1_ENST00000332995.7_Silent_p.L481L|PHACTR1_ENST00000379335.3_Silent_p.L45L|PHACTR1_ENST00000457702.2_Silent_p.L336L|PHACTR1_ENST00000379329.1_Silent_p.L45L			Q9C0D0	PHAR1_HUMAN	phosphatase and actin regulator 1	481					actin cytoskeleton reorganization (GO:0031532)|actomyosin structure organization (GO:0031032)|cell motility (GO:0048870)|stress fiber assembly (GO:0043149)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)|synapse (GO:0045202)	actin binding (GO:0003779)|protein phosphatase inhibitor activity (GO:0004864)			breast(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	26	Breast(50;0.0427)|Ovarian(93;0.12)	all_hematologic(90;0.122)|Lung SC(78;0.195)	Epithelial(50;0.146)|BRCA - Breast invasive adenocarcinoma(129;0.239)			GGAACATTTTGAAACGTAAGT	0.468																																						dbGAP											0													216.0	222.0	220.0					6																	13273143		1915	4132	6047	-	-	-	SO:0001819	synonymous_variant	0			AB051520	CCDS75401.1	6p23	2013-01-24	2004-05-20	2004-05-21	ENSG00000112137	ENSG00000112137		"""Phosphatase and actin regulators"""	20990	protein-coding gene	gene with protein product		608723	"""RPEL repeat containing 1"""	RPEL1		11214970, 15107502	Standard	NM_030948		Approved	KIAA1733, dJ257A7.2	uc010jpc.3	Q9C0D0	OTTHUMG00000014270	ENST00000379350.1:c.1443G>A	6.37:g.13273143G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1V2|Q3MJ93|Q5JSJ2	Silent	SNP	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	p.L481	ENST00000379350.1	37	c.1443		6																																																																																			PHACTR1	-	pfam_RPEL_repeat,smart_RPEL_repeat,pfscan_RPEL_repeat	ENSG00000112137		0.468	PHACTR1-001	KNOWN	basic|appris_candidate_longest	protein_coding	PHACTR1	HGNC	protein_coding	OTTHUMT00000039876.1	89	0.00	0	G	XM_166420		13273143	13273143	+1	no_errors	ENST00000379350	ensembl	human	known	69_37n	silent	81	20.59	21	SNP	1.000	A
PTPRVP	148713	genome.wustl.edu	37	1	202139101	202139101	+	RNA	SNP	C	C	G	rs3936158	byFrequency	TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr1:202139101C>G	ENST00000482597.1	+	0	972					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		CAGGGCCCCCCCTATGAGCTG	0.612													C|||	1649	0.329273	0.0348	0.3271	5008	,	,		17235	0.4325		0.3608	False		,,,				2504	0.59					dbGAP											0																																										-	-	-			0			AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202139101C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			PTPRVP	-	-	ENSG00000243323		0.612	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	HGNC	pseudogene	OTTHUMT00000334021.1	8	0.00	0	C	XM_086287		202139101	202139101	+1	no_errors	ENST00000482597	ensembl	human	known	69_37n	rna	1	80.00	4	SNP	0.002	G
PUS10	150962	genome.wustl.edu	37	2	61233764	61233764	+	Silent	SNP	A	A	C			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr2:61233764A>C	ENST00000316752.6	-	4	657	c.396T>G	c.(394-396)gtT>gtG	p.V132V	PUS10_ENST00000407787.1_Silent_p.V132V	NM_144709.2	NP_653310.2	Q3MIT2	PUS10_HUMAN	pseudouridylate synthase 10	132					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)	22			LUSC - Lung squamous cell carcinoma(5;1.56e-06)|Lung(5;2.48e-05)|Epithelial(17;0.113)			CAGAGGCCTCAACCTTTTGGC	0.383																																						dbGAP											0													80.0	76.0	78.0					2																	61233764		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK056874	CCDS1865.1	2p16.1	2008-02-05	2008-01-09	2008-01-09	ENSG00000162927	ENSG00000162927			26505	protein-coding gene	gene with protein product		612787	"""coiled-coil domain containing 139"""	CCDC139		17900615	Standard	NM_144709		Approved	FLJ32312	uc002sao.3	Q3MIT2	OTTHUMG00000129423	ENST00000316752.6:c.396T>G	2.37:g.61233764A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPJ5|Q96MI8	Silent	SNP	superfamily_PsdUridine_synth_cat_dom	p.V132	ENST00000316752.6	37	c.396	CCDS1865.1	2																																																																																			PUS10	-	NULL	ENSG00000162927		0.383	PUS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PUS10	HGNC	protein_coding	OTTHUMT00000251582.2	41	0.00	0	A	NM_144709		61233764	61233764	-1	no_errors	ENST00000316752	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	1.000	C
R3HDM2	22864	genome.wustl.edu	37	12	57696988	57696988	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr12:57696988T>C	ENST00000347140.3	-	4	568	c.178A>G	c.(178-180)Aac>Gac	p.N60D	R3HDM2_ENST00000358907.2_Missense_Mutation_p.N60D|R3HDM2_ENST00000402412.1_Missense_Mutation_p.N60D|R3HDM2_ENST00000403821.2_Missense_Mutation_p.N60D			Q9Y2K5	R3HD2_HUMAN	R3H domain containing 2	60						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(3)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TGACCATGGTTAGATGTCCGC	0.358																																						dbGAP											0													113.0	99.0	103.0					12																	57696988		692	1591	2283	-	-	-	SO:0001583	missense	0			AB023219	CCDS8937.2	12q13.3	2012-11-19			ENSG00000179912	ENSG00000179912			29167	protein-coding gene	gene with protein product							Standard	NM_014925		Approved	KIAA1002	uc009zpm.1	Q9Y2K5	OTTHUMG00000171568	ENST00000347140.3:c.178A>G	12.37:g.57696988T>C	ENSP00000317903:p.Asn60Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1T9|Q3ZCT5	Missense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.N60D	ENST00000347140.3	37	c.178	CCDS8937.2	12	.	.	.	.	.	.	.	.	.	.	T	14.20	2.463795	0.43736	.	.	ENSG00000179912	ENST00000347140;ENST00000402412;ENST00000358907;ENST00000403821	T;T;T;T	0.22336	1.96;1.96;1.96;1.96	5.65	5.65	0.86999	.	0.304593	0.38663	N	0.001602	T	0.14013	0.0339	N	0.14661	0.345	0.80722	D	1	B;B	0.15141	0.012;0.005	B;B	0.15870	0.014;0.01	T	0.09818	-1.0657	10	0.27785	T	0.31	-3.4071	14.9931	0.71406	0.0:0.0:0.0:1.0	.	60;60	B5MCU0;Q9Y2K5	.;R3HD2_HUMAN	D	60	ENSP00000317903:N60D;ENSP00000385839:N60D;ENSP00000351784:N60D;ENSP00000385169:N60D	ENSP00000317903:N60D	N	-	1	0	R3HDM2	55983255	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	3.396000	0.52565	2.371000	0.80710	0.533000	0.62120	AAC	R3HDM2	-	NULL	ENSG00000179912		0.358	R3HDM2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	R3HDM2	HGNC	protein_coding	OTTHUMT00000326570.2	52	0.00	0	T	NM_014925		57696988	57696988	-1	no_errors	ENST00000347140	ensembl	human	known	69_37n	missense	49	44.32	39	SNP	1.000	C
RBBP4	5928	genome.wustl.edu	37	1	33117549	33117549	+	Silent	SNP	C	C	A			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr1:33117549C>A	ENST00000373493.5	+	2	210	c.51C>A	c.(49-51)atC>atA	p.I17I	RBBP4_ENST00000458695.2_5'UTR|RBBP4_ENST00000414241.3_Silent_p.I16I|ZBTB8OS_ENST00000492007.1_5'Flank|RBBP4_ENST00000373485.1_Silent_p.I17I|ZBTB8OS_ENST00000468695.1_5'Flank|ZBTB8OS_ENST00000373501.2_5'Flank|RBBP4_ENST00000524393.1_3'UTR|ZBTB8OS_ENST00000341885.5_5'Flank|RBBP4_ENST00000544435.1_5'UTR	NM_001135255.1|NM_005610.2	NP_001128727.1|NP_005601.1	Q09028	RBBP4_HUMAN	retinoblastoma binding protein 4	17					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|CENP-A containing nucleosome assembly (GO:0034080)|chromatin assembly (GO:0031497)|chromatin remodeling (GO:0006338)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of cell proliferation (GO:0008285)|nucleosome assembly (GO:0006334)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|ESC/E(Z) complex (GO:0035098)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|NURF complex (GO:0016589)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				AACGAGTGATCAACGAGGAAT	0.433																																						dbGAP											0													67.0	69.0	68.0					1																	33117549		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC053904	CCDS366.1, CCDS44105.1, CCDS44106.1	1p35.1	2014-07-17	2001-11-28		ENSG00000162521	ENSG00000162521		"""WD repeat domain containing"""	9887	protein-coding gene	gene with protein product		602923	"""retinoblastoma-binding protein 4"""			8350924, 14609955, 17531812	Standard	NM_005610		Approved	RbAp48, NURF55, lin-53	uc001bvr.3	Q09028	OTTHUMG00000007998	ENST00000373493.5:c.51C>A	1.37:g.33117549C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6G9|B4DRH0|D3DPQ3|P31149|Q53H02|Q96BV9	Silent	SNP	pfam_WD40_repeat,pfam_Histone-bd_RBBP4,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.I17	ENST00000373493.5	37	c.51	CCDS366.1	1																																																																																			RBBP4	-	NULL	ENSG00000162521		0.433	RBBP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBBP4	HGNC	protein_coding	OTTHUMT00000021957.3	33	0.00	0	C	NM_005610		33117549	33117549	+1	no_errors	ENST00000373493	ensembl	human	known	69_37n	silent	47	18.97	11	SNP	1.000	A
RP2	6102	genome.wustl.edu	37	X	46736940	46736940	+	Splice_Site	SNP	G	G	A			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chrX:46736940G>A	ENST00000218340.3	+	4	1045	c.884G>A	c.(883-885)gGt>gAt	p.G295D		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	295					cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						TTGCTTATAGGTCCTGTTATT	0.328																																						dbGAP											0													225.0	189.0	201.0					X																	46736940		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.884-1G>A	X.37:g.46736940G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XJ7|Q9NU67	Missense_Mutation	SNP	pfam_Tubulin-bd_cofactor_C,superfamily_Nucleoside_diP_kinase,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif,pirsf_Protein_XRP2	p.G295D	ENST00000218340.3	37	c.884	CCDS14270.1	X	.	.	.	.	.	.	.	.	.	.	G	18.42	3.619364	0.66787	.	.	ENSG00000102218	ENST00000218340	D	0.82526	-1.62	5.19	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.89894	0.6847	M	0.72894	2.215	0.58432	D	0.999998	D	0.76494	0.999	D	0.68621	0.959	D	0.89924	0.4061	9	.	.	.	.	16.6922	0.85325	0.0:0.0:1.0:0.0	.	295	O75695	XRP2_HUMAN	D	295	ENSP00000218340:G295D	.	G	+	2	0	RP2	46621884	1.000000	0.71417	1.000000	0.80357	0.732000	0.41865	7.296000	0.78790	2.288000	0.76882	0.415000	0.27848	GGT	RP2	-	superfamily_Nucleoside_diP_kinase,pirsf_Protein_XRP2	ENSG00000102218		0.328	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP2	HGNC	protein_coding	OTTHUMT00000056375.1	326	0.00	0	G	NM_006915	Missense_Mutation	46736940	46736940	+1	no_errors	ENST00000218340	ensembl	human	known	69_37n	missense	303	13.43	47	SNP	1.000	A
SLC4A1	6521	genome.wustl.edu	37	17	42333063	42333063	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr17:42333063T>C	ENST00000262418.6	-	14	1933	c.1778A>G	c.(1777-1779)aAc>aGc	p.N593S	AC003043.1_ENST00000597382.1_5'Flank	NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	593	Involved in anion transport.|Membrane (anion exchange).				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		ATAGGAGCTGTTCTTGAACTT	0.592																																						dbGAP											0													126.0	110.0	116.0					17																	42333063		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.1778A>G	17.37:g.42333063T>C	ENSP00000262418:p.Asn593Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_1,tigrfam_HCO3_transpt_euk	p.N593S	ENST00000262418.6	37	c.1778	CCDS11481.1	17	.	.	.	.	.	.	.	.	.	.	t	21.6	4.168883	0.78339	.	.	ENSG00000004939	ENST00000262418	T	0.80214	-1.35	5.62	4.53	0.55603	Bicarbonate transporter, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.83078	0.5176	L	0.55481	1.735	0.53005	D	0.999967	P	0.51057	0.941	P	0.53722	0.733	D	0.83731	0.0198	10	0.72032	D	0.01	.	12.5326	0.56124	0.0:0.0:0.1396:0.8604	.	593	P02730	B3AT_HUMAN	S	593	ENSP00000262418:N593S	ENSP00000262418:N593S	N	-	2	0	SLC4A1	39688589	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	5.115000	0.64655	0.947000	0.37659	-0.313000	0.08912	AAC	SLC4A1	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000004939		0.592	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1	HGNC	protein_coding	OTTHUMT00000346194.1	67	0.00	0	T	NM_000342		42333063	42333063	-1	no_errors	ENST00000262418	ensembl	human	known	69_37n	missense	63	30.00	27	SNP	1.000	C
SYNE1	23345	genome.wustl.edu	37	6	152560688	152560688	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr6:152560688C>G	ENST00000367255.5	-	108	20648	c.20047G>C	c.(20047-20049)Gag>Cag	p.E6683Q	SYNE1_ENST00000341594.5_Missense_Mutation_p.E6295Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.E6683Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.E6612Q|SYNE1_ENST00000448038.1_Missense_Mutation_p.E6612Q|SYNE1_ENST00000356820.4_Missense_Mutation_p.E1207Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6683					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TACTCCAGCTCCACACCCCTC	0.453										HNSCC(10;0.0054)																												dbGAP											0													148.0	117.0	127.0					6																	152560688		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20047G>C	6.37:g.152560688C>G	ENSP00000356224:p.Glu6683Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E6683Q	ENST00000367255.5	37	c.20047	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	25.6	4.659861	0.88154	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45;1.45	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000007	T	0.44350	0.1289	L	0.46947	1.48	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.998;0.999	T	0.23833	-1.0177	10	0.52906	T	0.07	.	19.8351	0.96655	0.0:1.0:0.0:0.0	.	6683;6683;6612	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	Q	6683;6612;6683;6612;6295;1207	ENSP00000356224:E6683Q;ENSP00000396024:E6612Q;ENSP00000265368:E6683Q;ENSP00000390975:E6612Q;ENSP00000341887:E6295Q;ENSP00000349276:E1207Q	ENSP00000265368:E6683Q	E	-	1	0	SYNE1	152602381	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.687000	0.91594	0.655000	0.94253	GAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.453	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	63	0.00	0	C	NM_182961		152560688	152560688	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	82	17.17	17	SNP	1.000	G
TARM1	441864	genome.wustl.edu	37	19	54578326	54578326	+	Silent	SNP	C	C	T			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr19:54578326C>T	ENST00000432826.1	-	3	135	c.111G>A	c.(109-111)tcG>tcA	p.S37S	TARM1_ENST00000446034.2_Silent_p.S45S	NM_001135686.1	NP_001129158.2	B6A8C7	TARM1_HUMAN	T cell-interacting, activating receptor on myeloid cells 1	37	Ig-like C2-type 1.		S -> P (in dbSNP:rs17305269).			integral component of membrane (GO:0016021)				endometrium(1)|stomach(2)	3						CAGGGACCACCGAGCTGGGCC	0.607																																						dbGAP											0													21.0	20.0	20.0					19																	54578326		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46173.1	19q13.42	2013-01-29			ENSG00000248385	ENSG00000248385		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	37250	protein-coding gene	gene with protein product							Standard	XM_005258952		Approved		uc010yei.1	B6A8C7		ENST00000432826.1:c.111G>A	19.37:g.54578326C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWY4	Silent	SNP	smart_Ig_sub	p.S45	ENST00000432826.1	37	c.135	CCDS46173.1	19																																																																																			TARM1	-	smart_Ig_sub	ENSG00000248385		0.607	TARM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TARM1	HGNC	protein_coding	OTTHUMT00000465679.1	16	0.00	0	C	NM_001135686		54578326	54578326	-1	no_errors	ENST00000446034	ensembl	human	known	69_37n	silent	17	39.29	11	SNP	0.000	T
VAC14	55697	genome.wustl.edu	37	16	70817042	70817042	+	Splice_Site	SNP	C	C	T			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr16:70817042C>T	ENST00000261776.5	-	7	965	c.705G>A	c.(703-705)atG>atA	p.M235I		NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	235					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				CAACCTCACACCTATGAACAA	0.517																																						dbGAP											0													68.0	76.0	73.0					16																	70817042		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.705-1G>A	16.37:g.70817042C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_DUF3434,pfam_HEAT,superfamily_ARM-type_fold	p.M235I	ENST00000261776.5	37	c.705	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	C	14.55	2.567945	0.45798	.	.	ENSG00000103043	ENST00000261776	T	0.66099	-0.19	5.24	5.24	0.73138	Armadillo-like helical (1);Armadillo-type fold (1);	0.115502	0.85682	D	0.000000	T	0.59715	0.2214	L	0.49126	1.545	0.80722	D	1	B	0.15930	0.015	B	0.15052	0.012	T	0.55438	-0.8141	10	0.39692	T	0.17	.	18.8615	0.92273	0.0:1.0:0.0:0.0	.	235	Q08AM6	VAC14_HUMAN	I	235	ENSP00000261776:M235I	ENSP00000261776:M235I	M	-	3	0	VAC14	69374543	1.000000	0.71417	1.000000	0.80357	0.823000	0.46562	3.246000	0.51414	2.456000	0.83038	0.655000	0.94253	ATG	VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.517	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	41	0.00	0	C	NM_018052	Missense_Mutation	70817042	70817042	-1	no_errors	ENST00000261776	ensembl	human	known	69_37n	missense	54	29.87	23	SNP	1.000	T
WDFY3	23001	genome.wustl.edu	37	4	85742538	85742538	+	Silent	SNP	A	A	G			TCGA-GM-A2DK-01A-21D-A17W-09	TCGA-GM-A2DK-10C-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0913724a-e8a8-43ed-8ba4-bfef389d6d25	8819ac99-cca4-4a90-a754-f910e8cdbbd2	g.chr4:85742538A>G	ENST00000295888.4	-	11	1697	c.1290T>C	c.(1288-1290)ttT>ttC	p.F430F	WDFY3_ENST00000322366.6_Silent_p.F430F	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	430					aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)			breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		TCTTCTCTGCAAACTGTGACA	0.358																																						dbGAP											0													106.0	109.0	108.0					4																	85742538		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.1290T>C	4.37:g.85742538A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Silent	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F430	ENST00000295888.4	37	c.1290	CCDS3609.1	4																																																																																			WDFY3	-	NULL	ENSG00000163625		0.358	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	45	0.00	0	A	NM_014991		85742538	85742538	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	silent	32	33.33	16	SNP	0.997	G
