#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABI3BP	25890	genome.wustl.edu	37	3	100489698	100489698	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr3:100489698C>T	ENST00000284322.5	-	29	2606	c.2497G>A	c.(2497-2499)Gcc>Acc	p.A833T	ABI3BP_ENST00000383691.4_Missense_Mutation_p.A787T|ABI3BP_ENST00000471714.1_Missense_Mutation_p.A1535T	NM_015429.3	NP_056244.2	Q7Z7G0	TARSH_HUMAN	ABI family, member 3 (NESH) binding protein	833					extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	extracellular space (GO:0005615)|interstitial matrix (GO:0005614)	heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	50						GGGCTGGTGGCATTCCCCTCT	0.542																																						dbGAP											0													220.0	234.0	230.0					3																	100489698		2025	4186	6211	-	-	-	SO:0001583	missense	0			AB056106	CCDS46880.1	3q12.2	2013-02-11	2008-09-12		ENSG00000154175	ENSG00000154175		"""Fibronectin type III domain containing"""	17265	protein-coding gene	gene with protein product	"""target of Nesh-SH3"""	606279				11501947	Standard	NM_015429		Approved	NESHBP, DKFZP586L2024, TARSH	uc003dun.3	Q7Z7G0	OTTHUMG00000159094	ENST00000284322.5:c.2497G>A	3.37:g.100489698C>T	ENSP00000284322:p.Ala833Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSL4|Q6ZW20|Q6ZW22|Q9C082|Q9UFI6	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.A833T	ENST00000284322.5	37	c.2497	CCDS46880.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	24.0|24.0	4.482079|4.482079	0.84747|0.84747	.|.	.|.	ENSG00000154175|ENSG00000154175	ENST00000471714;ENST00000284322;ENST00000383692;ENST00000429331;ENST00000383691|ENST00000495591	T;T;T|.	0.24350|.	2.16;1.88;1.86|.	5.98|5.98	3.88|3.88	0.44766|0.44766	Immunoglobulin-like fold (1);|.	0.314553|.	0.34652|.	N|.	0.003800|.	T|T	0.34890|0.34890	0.0913|0.0913	L|L	0.36672|0.36672	1.1|1.1	0.28332|0.28332	N|N	0.921756|0.921756	D;B;D;D|.	0.69078|.	0.997;0.375;0.99;0.992|.	D;B;P;P|.	0.65323|.	0.934;0.114;0.791;0.905|.	T|T	0.22312|0.22312	-1.0220|-1.0220	10|5	0.52906|.	T|.	0.07|.	-5.2559|-5.2559	6.7683|6.7683	0.23579|0.23579	0.0:0.5594:0.2656:0.175|0.0:0.5594:0.2656:0.175	.|.	787;833;1535;542|.	B4DSV9;Q7Z7G0;D3YTG3;D3YTD6|.	.;TARSH_HUMAN;.;.|.	T|I	1535;833;542;244;787|888	ENSP00000420524:A1535T;ENSP00000284322:A833T;ENSP00000373189:A787T|.	ENSP00000284322:A833T|.	A|M	-|-	1|3	0|0	ABI3BP|ABI3BP	101972388|101972388	0.984000|0.984000	0.35163|0.35163	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	1.350000|1.350000	0.34010|0.34010	1.280000|1.280000	0.44463|0.44463	0.591000|0.591000	0.81541|0.81541	GCC|ATG	ABI3BP	-	NULL	ENSG00000154175		0.542	ABI3BP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABI3BP	HGNC	protein_coding	OTTHUMT00000353260.1	289	0.00	0	C			100489698	100489698	-1	no_errors	ENST00000284322	ensembl	human	known	69_37n	missense	121	20.92	32	SNP	1.000	T
ACACB	32	genome.wustl.edu	37	12	109694027	109694027	+	Silent	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr12:109694027G>T	ENST00000338432.7	+	45	6368	c.6249G>T	c.(6247-6249)gtG>gtT	p.V2083V	ACACB_ENST00000543201.1_Silent_p.V749V|ACACB_ENST00000377854.5_Silent_p.V2013V|ACACB_ENST00000377848.3_Silent_p.V2083V			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	2083	Carboxyltransferase.				acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	AGACCGTGGTGACAGGACGAG	0.607																																						dbGAP											0													63.0	59.0	60.0					12																	109694027		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.6249G>T	12.37:g.109694027G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Missense_Mutation	SNP	pfam_Carboxyl_trans,pfam_AcCoA_COase_cen,pfscan_COA_CT_N,pfscan_COA_CT_C	p.D750Y	ENST00000338432.7	37	c.2248	CCDS31898.1	12																																																																																			ACACB	-	pfam_Carboxyl_trans,pfscan_COA_CT_C	ENSG00000076555		0.607	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	31	0.00	0	G	NM_001093		109694027	109694027	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000538526	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.999	T
AKAP6	9472	genome.wustl.edu	37	14	33015979	33015979	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr14:33015979C>T	ENST00000280979.4	+	4	2290	c.2120C>T	c.(2119-2121)tCa>tTa	p.S707L	AKAP6_ENST00000557354.1_Missense_Mutation_p.S707L|AKAP6_ENST00000557272.1_Missense_Mutation_p.S707L	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	707					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ATAGCCTCTTCACTAGGGGAG	0.453																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											0													91.0	84.0	86.0					14																	33015979		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.2120C>T	14.37:g.33015979C>T	ENSP00000280979:p.Ser707Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.S707L	ENST00000280979.4	37	c.2120	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	21.1	4.098974	0.76870	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272	T;T;T	0.34275	1.37;1.37;1.37	6.17	6.17	0.99709	.	0.079192	0.53938	D	0.000041	T	0.57301	0.2044	M	0.64997	1.995	0.53005	D	0.999965	D;D	0.76494	0.999;0.999	P;D	0.68765	0.895;0.96	T	0.56456	-0.7976	10	0.87932	D	0	-8.3474	15.581	0.76439	0.1377:0.8623:0.0:0.0	.	707;707	A7E242;Q13023	.;AKAP6_HUMAN	L	707	ENSP00000280979:S707L;ENSP00000450531:S707L;ENSP00000451247:S707L	ENSP00000280979:S707L	S	+	2	0	AKAP6	32085730	1.000000	0.71417	0.970000	0.41538	0.982000	0.71751	4.966000	0.63715	2.941000	0.99782	0.655000	0.94253	TCA	AKAP6	-	NULL	ENSG00000151320		0.453	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	52	0.00	0	C	NM_004274		33015979	33015979	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense	27	37.21	16	SNP	0.997	T
ARHGAP12	94134	genome.wustl.edu	37	10	32128240	32128240	+	Missense_Mutation	SNP	C	C	A	rs563582369	byFrequency	TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr10:32128240C>A	ENST00000344936.2	-	9	1613	c.1379G>T	c.(1378-1380)aGt>aTt	p.S460I	ARHGAP12_ENST00000396144.4_Intron|ARHGAP12_ENST00000375250.5_Intron|ARHGAP12_ENST00000375245.4_Intron|ARHGAP12_ENST00000311380.4_Intron	NM_001270697.1|NM_018287.6	NP_001257626.1|NP_060757.4	Q8IWW6	RHG12_HUMAN	Rho GTPase activating protein 12	460					morphogenesis of an epithelial sheet (GO:0002011)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|endometrium(2)|kidney(1)|large_intestine(11)|lung(10)|skin(1)|urinary_tract(2)	31		Prostate(175;0.0199)				TACCTTTGGACTGCTGGCCTG	0.313																																						dbGAP											0													110.0	110.0	110.0					10																	32128240		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY033594	CCDS7170.1, CCDS59214.1, CCDS59215.1, CCDS59216.1, CCDS73082.1	10p11.22	2013-01-10			ENSG00000165322	ENSG00000165322		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	16348	protein-coding gene	gene with protein product		610577				11854031	Standard	NM_001270695		Approved	FLJ20737, FLJ10971, FLJ21785	uc001ivz.2	Q8IWW6	OTTHUMG00000017911	ENST00000344936.2:c.1379G>T	10.37:g.32128240C>A	ENSP00000345808:p.Ser460Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANY0|B1ANY1|B1ANY2|Q504X1|Q86UB3|Q8IWW7|Q8N3L1|Q9NT76	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_SH3_domain,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_WW_Rsp5_WWP,smart_SH3_domain,smart_WW_Rsp5_WWP,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_WW_Rsp5_WWP,pfscan_RhoGAP_dom	p.S460I	ENST00000344936.2	37	c.1379	CCDS7170.1	10	.	.	.	.	.	.	.	.	.	.	C	9.250	1.040397	0.19669	.	.	ENSG00000165322	ENST00000344936	T	0.36878	1.23	5.39	2.31	0.28768	.	1.513660	0.04355	N	0.356385	T	0.20780	0.0500	N	0.08118	0	0.09310	N	1	B	0.19583	0.037	B	0.09377	0.004	T	0.18398	-1.0338	10	0.38643	T	0.18	.	6.5715	0.22541	0.0:0.6769:0.0:0.3231	.	460	Q8IWW6	RHG12_HUMAN	I	460	ENSP00000345808:S460I	ENSP00000345808:S460I	S	-	2	0	ARHGAP12	32168246	0.032000	0.19561	0.183000	0.23137	0.744000	0.42396	0.280000	0.18790	0.656000	0.30886	0.655000	0.94253	AGT	ARHGAP12	-	NULL	ENSG00000165322		0.313	ARHGAP12-009	KNOWN	basic|CCDS	protein_coding	ARHGAP12	HGNC	protein_coding	OTTHUMT00000047465.1	88	0.00	0	C			32128240	32128240	-1	no_errors	ENST00000344936	ensembl	human	known	69_37n	missense	47	34.72	25	SNP	0.004	A
C20orf196	149840	genome.wustl.edu	37	20	5753620	5753620	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr20:5753620G>A	ENST00000303142.6	+	2	196	c.109G>A	c.(109-111)Gaa>Aaa	p.E37K	C20orf196_ENST00000378979.4_Missense_Mutation_p.E37K	NM_152504.2	NP_689717.2	Q8IYI0	CT196_HUMAN	chromosome 20 open reading frame 196	37										endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|stomach(1)	9						ACCCAGCCAAGAAGCCAACAG	0.478																																						dbGAP											0													158.0	152.0	154.0					20																	5753620		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057796	CCDS13091.1	20p12.3	2006-07-07			ENSG00000171984	ENSG00000171984			26318	protein-coding gene	gene with protein product						12477932	Standard	NM_152504		Approved	FLJ25067	uc002wmf.3	Q8IYI0	OTTHUMG00000031813	ENST00000303142.6:c.109G>A	20.37:g.5753620G>A	ENSP00000305875:p.Glu37Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9J3|Q5TGA9|Q96LU1	Missense_Mutation	SNP	NULL	p.E37K	ENST00000303142.6	37	c.109	CCDS13091.1	20	.	.	.	.	.	.	.	.	.	.	G	10.40	1.338479	0.24253	.	.	ENSG00000171984	ENST00000378979;ENST00000303142;ENST00000378971;ENST00000445603;ENST00000442185;ENST00000541651	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	5.81	2.63	0.31362	.	0.469190	0.19615	N	0.110049	T	0.37652	0.1011	L	0.53249	1.67	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.25433	-1.0132	10	0.31617	T	0.26	-9.9605	5.9064	0.19004	0.1816:0.1534:0.665:0.0	.	37	Q8IYI0	CT196_HUMAN	K	37;37;37;37;84;84	ENSP00000368263:E37K;ENSP00000305875:E37K;ENSP00000399331:E37K;ENSP00000410534:E84K	ENSP00000305875:E37K	E	+	1	0	C20orf196	5701620	0.001000	0.12720	0.000000	0.03702	0.349000	0.29174	0.936000	0.28938	0.297000	0.22615	-0.355000	0.07637	GAA	C20orf196	-	NULL	ENSG00000171984		0.478	C20orf196-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf196	HGNC	protein_coding	OTTHUMT00000077882.2	59	0.00	0	G	NM_152504		5753620	5753620	+1	no_errors	ENST00000303142	ensembl	human	known	69_37n	missense	44	31.25	20	SNP	0.000	A
CALN1	83698	genome.wustl.edu	37	7	71275372	71275372	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr7:71275372C>A	ENST00000329008.5	-	5	779	c.481G>T	c.(481-483)Gaa>Taa	p.E161*	CALN1_ENST00000431984.1_Nonsense_Mutation_p.E161*|CALN1_ENST00000412588.1_Nonsense_Mutation_p.E203*|CALN1_ENST00000405452.2_Nonsense_Mutation_p.E161*|CALN1_ENST00000395275.2_Nonsense_Mutation_p.E203*|CALN1_ENST00000395276.2_Nonsense_Mutation_p.E161*	NM_001017440.2	NP_001017440.1	Q9BXU9	CABP8_HUMAN	calneuron 1	161						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(1)|endometrium(3)|large_intestine(6)|lung(19)|skin(2)	32		all_cancers(73;0.069)|Lung NSC(55;0.0658)|all_lung(88;0.0912)|all_epithelial(88;0.161)				AGGCTCTCTTCCTCATTGATA	0.517																																						dbGAP											0													214.0	172.0	186.0					7																	71275372		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF282250	CCDS5541.1, CCDS47603.1	7q11	2013-01-10			ENSG00000183166	ENSG00000183166		"""EF-hand domain containing"""	13248	protein-coding gene	gene with protein product	"""calcium-binding protein CABP8"""	607176				11286509	Standard	NM_031468		Approved		uc003twb.4	Q9BXU9	OTTHUMG00000023787	ENST00000329008.5:c.481G>T	7.37:g.71275372C>A	ENSP00000332498:p.Glu161*	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KQA7	Nonsense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E203*	ENST00000329008.5	37	c.607	CCDS5541.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.758724	0.96898	.	.	ENSG00000183166	ENST00000329008;ENST00000395275;ENST00000395276;ENST00000431984;ENST00000412588;ENST00000405452	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.8592	17.6921	0.88271	0.0:1.0:0.0:0.0	.	.	.	.	X	161;203;161;161;203;161	.	ENSP00000332498:E161X	E	-	1	0	CALN1	70913308	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	7.577000	0.82486	2.670000	0.90874	0.655000	0.94253	GAA	CALN1	-	NULL	ENSG00000183166		0.517	CALN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CALN1	HGNC	protein_coding	OTTHUMT00000320044.2	128	0.00	0	C	NM_031468		71275372	71275372	-1	no_errors	ENST00000395275	ensembl	human	known	69_37n	nonsense	81	22.86	24	SNP	1.000	A
CCDC18	343099	genome.wustl.edu	37	1	93730309	93730309	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr1:93730309C>G	ENST00000343253.7	+	27	4235	c.3733C>G	c.(3733-3735)Caa>Gaa	p.Q1245E	RP4-717I23.3_ENST00000447577.1_RNA|RP4-717I23.3_ENST00000429859.1_RNA|RP4-717I23.3_ENST00000602488.1_RNA|RP4-717I23.3_ENST00000446528.2_RNA|RP4-717I23.3_ENST00000442860.1_RNA|CCDC18_ENST00000401026.3_Missense_Mutation_p.Q1246E|RP4-717I23.3_ENST00000415150.1_RNA|CCDC18_ENST00000338949.4_3'UTR|RP4-717I23.3_ENST00000455474.1_RNA|RP4-717I23.3_ENST00000413606.1_RNA|RP4-717I23.3_ENST00000424517.3_RNA|RP4-717I23.3_ENST00000414430.1_RNA|CCDC18_ENST00000557479.1_Missense_Mutation_p.Q1364E|RP4-717I23.3_ENST00000457025.1_RNA|RP4-717I23.3_ENST00000427669.1_RNA|RP4-717I23.3_ENST00000451302.2_RNA|CCDC18_ENST00000334652.5_3'UTR			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	1245										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TGCTGACTCTCAAAAGTCTTC	0.358																																						dbGAP											0													90.0	84.0	86.0					1																	93730309		1849	4095	5944	-	-	-	SO:0001583	missense	0					1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.3733C>G	1.37:g.93730309C>G	ENSP00000343377:p.Gln1245Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU17	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.Q1364E	ENST00000343253.7	37	c.4090		1	.	.	.	.	.	.	.	.	.	.	C	20.9	4.058979	0.76074	.	.	ENSG00000122483	ENST00000343253;ENST00000401026;ENST00000557479	.	.	.	5.77	5.77	0.91146	.	0.145758	0.47852	D	0.000220	T	0.59183	0.2175	L	0.47716	1.5	0.80722	D	1	P;D	0.56035	0.954;0.974	D;D	0.70487	0.954;0.969	T	0.51803	-0.8659	9	0.17832	T	0.49	.	15.4724	0.75449	0.0:1.0:0.0:0.0	.	164;1364	Q5T9S4;G3V388	.;.	E	1245;1246;1364	.	ENSP00000343377:Q1245E	Q	+	1	0	CCDC18	93502897	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.423000	0.59861	2.736000	0.93811	0.591000	0.81541	CAA	CCDC18	-	superfamily_tRNA-bd_arm	ENSG00000122483		0.358	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	CCDC18	HGNC	protein_coding	OTTHUMT00000382327.1	43	0.00	0	C	NM_206886		93730309	93730309	+1	no_errors	ENST00000557479	ensembl	human	known	69_37n	missense	31	27.91	12	SNP	1.000	G
CDC16	8881	genome.wustl.edu	37	13	115016085	115016085	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr13:115016085G>T	ENST00000356221.3	+	12	1141	c.1033G>T	c.(1033-1035)Gcg>Tcg	p.A345S	CDC16_ENST00000375310.1_Missense_Mutation_p.A251S|CDC16_ENST00000375308.1_Missense_Mutation_p.A251S|CDC16_ENST00000252458.6_Missense_Mutation_p.A251S|CDC16_ENST00000360383.3_Missense_Mutation_p.A345S|CDC16_ENST00000375312.3_Missense_Mutation_p.A251S|CDC16_ENST00000252457.5_Missense_Mutation_p.A344S			Q13042	CDC16_HUMAN	cell division cycle 16	345					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			ACATTCATTTGCGGTGGAGAG	0.438																																						dbGAP											0													128.0	113.0	118.0					13																	115016085		2203	4300	6503	-	-	-	SO:0001583	missense	0			U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.1033G>T	13.37:g.115016085G>T	ENSP00000348554:p.Ala345Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A365|Q5T8C8|Q96AE6|Q9Y564	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.A345S	ENST00000356221.3	37	c.1033	CCDS9542.2	13	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030865	0.75504	.	.	ENSG00000130177	ENST00000360383;ENST00000375312;ENST00000356221;ENST00000375310;ENST00000252457;ENST00000375308;ENST00000252458	T;T;T;T;T;T;T	0.74106	0.53;-0.81;0.53;0.53;0.53;0.53;-0.81	5.94	5.07	0.68467	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	D	0.86451	0.5936	M	0.80508	2.5	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.86494	0.1799	9	.	.	.	-9.7336	16.6017	0.84817	0.0:0.0:0.8694:0.1306	.	344;344;345	Q13042-3;Q13042-2;Q13042	.;.;CDC16_HUMAN	S	345;251;345;251;344;251;251	ENSP00000353549:A345S;ENSP00000364461:A251S;ENSP00000348554:A345S;ENSP00000364459:A251S;ENSP00000252457:A344S;ENSP00000364457:A251S;ENSP00000252458:A251S	.	A	+	1	0	CDC16	114034187	1.000000	0.71417	0.888000	0.34837	0.355000	0.29361	7.130000	0.77235	2.820000	0.97059	0.650000	0.86243	GCG	CDC16	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000130177		0.438	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDC16	HGNC	protein_coding	OTTHUMT00000276737.1	82	0.00	0	G	NM_003903		115016085	115016085	+1	no_errors	ENST00000356221	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
ELF4	2000	genome.wustl.edu	37	X	129201241	129201241	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chrX:129201241G>A	ENST00000308167.5	-	9	1826	c.1447C>T	c.(1447-1449)Ctc>Ttc	p.L483F	ELF4_ENST00000335997.7_Missense_Mutation_p.L483F	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)											breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						AGGCCACTGAGAATCAGTGGA	0.647			T	ERG	AML																																	dbGAP		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	0													27.0	30.0	29.0					X																	129201241		2202	4299	6501	-	-	-	SO:0001583	missense	0			U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.1447C>T	X.37:g.129201241G>A	ENSP00000311280:p.Leu483Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.L483F	ENST00000308167.5	37	c.1447	CCDS14617.1	X	.	.	.	.	.	.	.	.	.	.	g	16.69	3.193369	0.58017	.	.	ENSG00000102034	ENST00000335997;ENST00000308167	T;T	0.24151	1.87;1.87	4.56	4.56	0.56223	.	0.438263	0.18458	N	0.140632	T	0.33381	0.0861	L	0.29908	0.895	0.30183	N	0.800267	D	0.69078	0.997	P	0.60886	0.88	T	0.12268	-1.0554	10	0.51188	T	0.08	.	11.5374	0.50645	0.0:0.0:1.0:0.0	.	483	Q99607	ELF4_HUMAN	F	483	ENSP00000338608:L483F;ENSP00000311280:L483F	ENSP00000311280:L483F	L	-	1	0	ELF4	129028922	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	4.645000	0.61404	2.102000	0.63906	0.509000	0.49947	CTC	ELF4	-	NULL	ENSG00000102034		0.647	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF4	HGNC	protein_coding	OTTHUMT00000058243.1	35	0.00	0	G	NM_001421		129201241	129201241	-1	no_errors	ENST00000308167	ensembl	human	known	69_37n	missense	16	38.46	10	SNP	1.000	A
EP300	2033	genome.wustl.edu	37	22	41521913	41521913	+	Nonsense_Mutation	SNP	C	C	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr22:41521913C>T	ENST00000263253.7	+	3	1994	c.775C>T	c.(775-777)Cag>Tag	p.Q259*		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	259					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						ACCATATACTCAGAATCCTGG	0.353			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																													dbGAP		Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													110.0	107.0	108.0					22																	41521913		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.775C>T	22.37:g.41521913C>T	ENSP00000263253:p.Gln259*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKC2	Nonsense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.Q259*	ENST00000263253.7	37	c.775	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	C	48	14.239206	0.99786	.	.	ENSG00000100393	ENST00000263253	.	.	.	5.73	5.73	0.89815	.	0.000000	0.44483	D	0.000458	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.22706	T	0.39	-5.884	19.9019	0.96988	0.0:1.0:0.0:0.0	.	.	.	.	X	259	.	ENSP00000263253:Q259X	Q	+	1	0	EP300	39851859	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	3.403000	0.52615	2.698000	0.92095	0.591000	0.81541	CAG	EP300	-	NULL	ENSG00000100393		0.353	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	70	0.00	0	C	NM_001429		41521913	41521913	+1	no_errors	ENST00000263253	ensembl	human	known	69_37n	nonsense	24	42.86	18	SNP	1.000	T
FOLH1	2346	genome.wustl.edu	37	11	49168403	49168403	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr11:49168403C>T	ENST00000256999.2	-	19	2418	c.2158G>A	c.(2158-2160)Gac>Aac	p.D720N	FOLH1_ENST00000343844.4_Missense_Mutation_p.D412N|FOLH1_ENST00000356696.3_Missense_Mutation_p.D689N|FOLH1_ENST00000340334.7_Missense_Mutation_p.D705N|FOLH1_ENST00000533034.1_Missense_Mutation_p.D674N	NM_004476.1	NP_004467.1	Q04609	FOLH1_HUMAN	folate hydrolase (prostate-specific membrane antigen) 1	720					folic acid-containing compound metabolic process (GO:0006760)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carboxypeptidase activity (GO:0004180)|dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(34)|ovary(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	60					Capromab(DB00089)	TTGGAAGGGTCCACTTTGCTT	0.478																																						dbGAP											0													133.0	128.0	130.0					11																	49168403		2201	4298	6499	-	-	-	SO:0001583	missense	0			M99487	CCDS7946.1, CCDS31493.1, CCDS53626.1, CCDS53627.1, CCDS53628.1	11p11.2	2011-07-22			ENSG00000086205	ENSG00000086205	3.4.17.21		3788	protein-coding gene	gene with protein product	"""glutamate carboxylase II"", ""glutamate carboxypeptidase II"""	600934		FOLH		9838072	Standard	NM_001193472		Approved	PSM, PSMA, NAALAD1, NAALAdase, GCP2, GCPII	uc001ngy.3	Q04609	OTTHUMG00000166625	ENST00000256999.2:c.2158G>A	11.37:g.49168403C>T	ENSP00000256999:p.Asp720Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4UU12|A9CB79|B7Z312|B7Z343|D3DQS5|E9PDX8|O43748|Q16305|Q541A4|Q8TAY3|Q9NP15|Q9NYE2|Q9P1P8	Missense_Mutation	SNP	pfam_TFR-like_dimer_dom,pfam_Protease-assoc_domain,pfam_Peptidase_M28,superfamily_TFR-like_dimer_dom	p.D720N	ENST00000256999.2	37	c.2158	CCDS7946.1	11	.	.	.	.	.	.	.	.	.	.	C	11.04	1.520729	0.27211	.	.	ENSG00000086205	ENST00000256999;ENST00000356696;ENST00000340334;ENST00000343844;ENST00000533034	T;T;T;T;T	0.32988	1.43;1.43;1.43;1.43;1.43	3.4	1.41	0.22369	Transferrin receptor-like, dimerisation domain (3);	0.397312	0.22269	N	0.062287	T	0.26085	0.0636	L	0.54323	1.7	0.20489	N	0.999899	B;B;B;B	0.24576	0.106;0.032;0.106;0.002	B;B;B;B	0.30251	0.113;0.032;0.046;0.012	T	0.20773	-1.0265	10	0.26408	T	0.33	.	7.3919	0.26915	0.0:0.7659:0.0:0.2341	.	674;705;689;720	Q04609-9;Q04609-7;Q04609-8;Q04609	.;.;.;FOLH1_HUMAN	N	720;689;705;412;674	ENSP00000256999:D720N;ENSP00000349129:D689N;ENSP00000344131:D705N;ENSP00000344086:D412N;ENSP00000431463:D674N	ENSP00000256999:D720N	D	-	1	0	FOLH1	49124979	0.923000	0.31300	0.001000	0.08648	0.814000	0.46013	1.900000	0.39828	0.224000	0.20940	0.609000	0.83330	GAC	FOLH1	-	pfam_TFR-like_dimer_dom,superfamily_TFR-like_dimer_dom	ENSG00000086205		0.478	FOLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOLH1	HGNC	protein_coding	OTTHUMT00000390896.1	154	0.00	0	C	NM_004476		49168403	49168403	-1	no_errors	ENST00000256999	ensembl	human	known	69_37n	missense	69	20.69	18	SNP	0.156	T
GPR112	139378	genome.wustl.edu	37	X	135427511	135427511	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chrX:135427511C>T	ENST00000394143.1	+	6	1937	c.1646C>T	c.(1645-1647)tCg>tTg	p.S549L	GPR112_ENST00000370652.1_Missense_Mutation_p.S549L|GPR112_ENST00000287534.4_Missense_Mutation_p.S486L|GPR112_ENST00000412101.1_Missense_Mutation_p.S344L|GPR112_ENST00000394141.1_Missense_Mutation_p.S344L	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	549					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.S549L(1)		NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					ACTTCCATGTCGAAAGAGACC	0.428																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											77.0	71.0	73.0					X																	135427511		2202	4299	6501	-	-	-	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1646C>T	X.37:g.135427511C>T	ENSP00000377699:p.Ser549Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S549L	ENST00000394143.1	37	c.1646	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	c	10.99	1.506855	0.26949	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.31769	1.52;1.52;1.48;1.62;1.48	3.42	2.54	0.30619	.	.	.	.	.	T	0.13841	0.0335	N	0.14661	0.345	0.09310	N	1	B;B;P	0.37663	0.128;0.049;0.604	B;B;B	0.21546	0.011;0.006;0.035	T	0.12066	-1.0562	9	0.87932	D	0	.	6.5405	0.22377	0.0:0.8491:0.0:0.1509	.	486;344;549	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	L	549;549;344;486;344	ENSP00000377699:S549L;ENSP00000359686:S549L;ENSP00000416526:S344L;ENSP00000287534:S486L;ENSP00000377697:S344L	ENSP00000287534:S486L	S	+	2	0	GPR112	135255177	0.004000	0.15560	0.001000	0.08648	0.020000	0.10135	1.864000	0.39469	0.569000	0.29329	0.411000	0.27672	TCG	GPR112	-	NULL	ENSG00000156920		0.428	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	33	0.00	0	C			135427511	135427511	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	0.001	T
HCN4	10021	genome.wustl.edu	37	15	73616015	73616015	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr15:73616015G>A	ENST00000261917.3	-	8	3412	c.2419C>T	c.(2419-2421)Cgc>Tgc	p.R807C		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	807					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GGGGGAGGGCGGAAGATGGCA	0.687																																						dbGAP											0													23.0	27.0	26.0					15																	73616015		2194	4296	6490	-	-	-	SO:0001583	missense	0			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.2419C>T	15.37:g.73616015G>A	ENSP00000261917:p.Arg807Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UMQ7	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,pfscan_cNMP-bd_dom	p.R807C	ENST00000261917.3	37	c.2419	CCDS10248.1	15	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149104	0.37923	.	.	ENSG00000138622	ENST00000261917	T	0.79247	-1.25	3.46	3.46	0.39613	.	.	.	.	.	T	0.78898	0.4356	L	0.60455	1.87	0.80722	D	1	D	0.76494	0.999	P	0.51806	0.68	T	0.79836	-0.1635	9	0.51188	T	0.08	.	11.2307	0.48910	0.0:0.1859:0.8141:0.0	.	807	Q9Y3Q4	HCN4_HUMAN	C	807	ENSP00000261917:R807C	ENSP00000261917:R807C	R	-	1	0	HCN4	71403068	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	6.027000	0.70881	1.761000	0.52028	0.313000	0.20887	CGC	HCN4	-	NULL	ENSG00000138622		0.687	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	HGNC	protein_coding	OTTHUMT00000268900.2	40	0.00	0	G	NM_005477		73616015	73616015	-1	no_errors	ENST00000261917	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	1.000	A
IGSF1	3547	genome.wustl.edu	37	X	130409212	130409212	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chrX:130409212G>T	ENST00000361420.3	-	17	3312	c.3233C>A	c.(3232-3234)gCc>gAc	p.A1078D	IGSF1_ENST00000370904.1_Missense_Mutation_p.A1069D|IGSF1_ENST00000467244.1_5'Flank|IGSF1_ENST00000370903.3_Missense_Mutation_p.A1083D|IGSF1_ENST00000370910.1_Missense_Mutation_p.A1069D			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	1078	Ig-like C2-type 11.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						TTCGCCAGGGGCCACCATGGG	0.527																																						dbGAP											0													90.0	94.0	92.0					X																	130409212		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.3233C>A	X.37:g.130409212G>T	ENSP00000355010:p.Ala1078Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEG2|H9KV64|O15070|Q9NTC8	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.A1083D	ENST00000361420.3	37	c.3248	CCDS14629.1	X	.	.	.	.	.	.	.	.	.	.	G	12.97	2.098355	0.37048	.	.	ENSG00000147255	ENST00000370910;ENST00000361420;ENST00000370904;ENST00000370903	T;T;T;T	0.03094	4.05;4.05;4.05;4.05	4.83	-0.33	0.12683	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.257560	0.05319	N	0.526211	T	0.08758	0.0217	M	0.78801	2.425	0.21652	N	0.999604	P;B;P	0.52842	0.955;0.322;0.956	P;B;P	0.49752	0.447;0.091;0.621	T	0.32428	-0.9907	10	0.27082	T	0.32	.	3.5709	0.07917	0.4098:0.0:0.4162:0.174	.	1069;522;1078	Q8N6C5-2;C9JP68;Q8N6C5	.;.;IGSF1_HUMAN	D	1069;1078;1069;1083	ENSP00000359947:A1069D;ENSP00000355010:A1078D;ENSP00000359941:A1069D;ENSP00000359940:A1083D	ENSP00000355010:A1078D	A	-	2	0	IGSF1	130236893	0.996000	0.38824	0.963000	0.40424	0.587000	0.36485	0.455000	0.21843	-0.039000	0.13602	-0.215000	0.12644	GCC	IGSF1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000147255		0.527	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	44	0.00	0	G			130409212	130409212	-1	no_errors	ENST00000370903	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.900	T
IL31RA	133396	genome.wustl.edu	37	5	55202014	55202014	+	Missense_Mutation	SNP	G	G	T	rs138747191		TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr5:55202014G>T	ENST00000447346.2	+	9	1215	c.1150G>T	c.(1150-1152)Gtg>Ttg	p.V384L	IL31RA_ENST00000396836.2_Missense_Mutation_p.V384L|IL31RA_ENST00000396834.1_Missense_Mutation_p.V365L|IL31RA_ENST00000297015.3_Missense_Mutation_p.V242L|IL31RA_ENST00000359040.5_Missense_Mutation_p.V384L|IL31RA_ENST00000490985.1_Missense_Mutation_p.V242L|IL31RA_ENST00000354961.4_Missense_Mutation_p.V365L	NM_001242636.1|NM_139017.5	NP_001229565.1|NP_620586.3	Q8NI17	IL31R_HUMAN	interleukin 31 receptor A	352	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cytokine-mediated signaling pathway (GO:0019221)|defense response (GO:0006952)|homeostatic process (GO:0042592)|JAK-STAT cascade (GO:0007259)|macrophage differentiation (GO:0030225)|MAPK cascade (GO:0000165)|monocyte differentiation (GO:0030224)|negative regulation of apoptotic process (GO:0043066)|negative regulation of macrophage activation (GO:0043031)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|cytokine receptor activity (GO:0004896)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)			endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)	21		Lung NSC(810;6.93e-05)|Prostate(74;0.00741)|Breast(144;0.0544)|Ovarian(174;0.223)				TGCTCTAGACGTGAACACTTG	0.527																																						dbGAP											0													219.0	191.0	201.0					5																	55202014		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY499339	CCDS3970.2, CCDS56365.1, CCDS56366.1, CCDS56367.1, CCDS75244.1, CCDS75245.1	5q11.2	2013-02-11			ENSG00000164509	ENSG00000164509		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	18969	protein-coding gene	gene with protein product		609510				15184896, 11877449	Standard	NM_139017		Approved	CRL3, GLM-R, CRL, Glmr, IL-31RA	uc003jql.3	Q8NI17	OTTHUMG00000097045	ENST00000447346.2:c.1150G>T	5.37:g.55202014G>T	ENSP00000415900:p.Val384Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIF8|Q2TBA1|Q6EBC3|Q6EBC4|Q6EBC5|Q6EBC6|Q6UWL8|Q8WYJ0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.V384L	ENST00000447346.2	37	c.1150	CCDS3970.2	5	.	.	.	.	.	.	.	.	.	.	G	13.37	2.215612	0.39102	.	.	ENSG00000164509	ENST00000396836;ENST00000396834;ENST00000447346;ENST00000359040;ENST00000297015;ENST00000490985;ENST00000354961	T;T;T;T;T;T;T	0.53857	0.6;0.6;0.6;0.6;0.6;0.6;0.6	4.95	4.06	0.47325	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.141869	0.48286	D	0.000198	T	0.66567	0.2802	M	0.76002	2.32	0.25342	N	0.98894	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;0.999	D;D;D;D;D	0.69824	0.925;0.966;0.966;0.966;0.966	T	0.57335	-0.7829	10	0.49607	T	0.09	-10.6442	8.017	0.30387	0.1703:0.0:0.8297:0.0	.	352;384;365;384;384	Q8NI17;Q8NI17-5;Q8NI17-3;Q8NI17-2;Q8NI17-8	IL31R_HUMAN;.;.;.;.	L	384;365;384;384;242;242;365	ENSP00000380048:V384L;ENSP00000380046:V365L;ENSP00000415900:V384L;ENSP00000351935:V384L;ENSP00000297015:V242L;ENSP00000427533:V242L;ENSP00000347047:V365L	ENSP00000297015:V242L	V	+	1	0	IL31RA	55237771	0.976000	0.34144	0.920000	0.36463	0.015000	0.08874	1.883000	0.39658	2.586000	0.87340	0.655000	0.94253	GTG	IL31RA	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000164509		0.527	IL31RA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL31RA	HGNC	protein_coding	OTTHUMT00000214148.1	114	0.00	0	G	NM_139017		55202014	55202014	+1	no_errors	ENST00000447346	ensembl	human	known	69_37n	missense	75	23.47	23	SNP	0.612	T
LCE1A	353131	genome.wustl.edu	37	1	152800020	152800020	+	Silent	SNP	C	C	T	rs4990424		TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr1:152800020C>T	ENST00000335123.2	+	1	72	c.72C>T	c.(70-72)tgC>tgT	p.C24C		NM_178348.2	NP_848125.1	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	24	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	8	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			ctcccaagtgccccactccta	0.652																																						dbGAP											0													56.0	62.0	60.0					1																	152800020		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1028.1	1q21.3	2011-01-28			ENSG00000186844	ENSG00000186844		"""Late cornified envelopes"""	29459	protein-coding gene	gene with protein product		612603				11698679	Standard	NM_178348		Approved	LEP1	uc010pdw.2	Q5T7P2	OTTHUMG00000012447	ENST00000335123.2:c.72C>T	1.37:g.152800020C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.C24	ENST00000335123.2	37	c.72	CCDS1028.1	1																																																																																			LCE1A	-	NULL	ENSG00000186844		0.652	LCE1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1A	HGNC	protein_coding	OTTHUMT00000034660.2	139	0.00	0	C	NM_178348		152800020	152800020	+1	no_errors	ENST00000335123	ensembl	human	known	69_37n	silent	41	26.79	15	SNP	0.789	T
KCNT2	343450	genome.wustl.edu	37	1	196367792	196367792	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr1:196367792T>G	ENST00000294725.9	-	13	2110	c.1195A>C	c.(1195-1197)Aca>Cca	p.T399P	KCNT2_ENST00000367431.4_Missense_Mutation_p.T399P|KCNT2_ENST00000498426.1_5'UTR|KCNT2_ENST00000367433.5_Missense_Mutation_p.T399P|KCNT2_ENST00000609185.1_Missense_Mutation_p.T399P|KCNT2_ENST00000451324.2_Missense_Mutation_p.T10P			Q6UVM3	KCNT2_HUMAN	potassium channel, subfamily T, member 2	399					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(16)|lung(43)|ovary(5)|pancreas(1)|prostate(1)|skin(11)|stomach(2)|upper_aerodigestive_tract(1)	97						CTCAAAATTGTTTGGTGATCC	0.318																																						dbGAP											0													57.0	59.0	58.0					1																	196367792		2202	4297	6499	-	-	-	SO:0001583	missense	0			BX647852, AY359444, AK127807	CCDS1384.1, CCDS72994.1, CCDS72995.1	1q31.3	2012-07-05			ENSG00000162687	ENSG00000162687		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18866	protein-coding gene	gene with protein product	"""sodium and chloride activated ATP sensitive potassium channel"""	610044				16382103	Standard	NM_198503		Approved	KCa4.2, SLICK, SLO2.1	uc001gtd.1	Q6UVM3	OTTHUMG00000035611	ENST00000294725.9:c.1195A>C	1.37:g.196367792T>G	ENSP00000294725:p.Thr399Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY59|Q5VTN1|Q6ZMT3	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.T399P	ENST00000294725.9	37	c.1195	CCDS1384.1	1	.	.	.	.	.	.	.	.	.	.	T	21.3	4.129138	0.77549	.	.	ENSG00000162687	ENST00000367433;ENST00000367431;ENST00000535608;ENST00000451324;ENST00000294725	T;T;T;T	0.71103	-0.54;-0.54;1.15;-0.54	5.61	4.44	0.53790	NAD(P)-binding domain (1);	0.000000	0.64402	D	0.000011	D	0.84588	0.5505	M	0.87827	2.91	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.91635	0.999;0.994;0.975;0.999	D	0.87010	0.2122	10	0.87932	D	0	-18.5639	11.7292	0.51726	0.132:0.0:0.0:0.868	.	399;399;399;399	A9LNM6;Q6UVM3-2;Q6UVM3-3;Q6UVM3	.;.;.;KCNT2_HUMAN	P	399;399;220;10;399	ENSP00000356403:T399P;ENSP00000356401:T399P;ENSP00000405474:T10P;ENSP00000294725:T399P	ENSP00000294725:T399P	T	-	1	0	KCNT2	194634415	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.817000	0.86213	2.124000	0.65301	0.477000	0.44152	ACA	KCNT2	-	NULL	ENSG00000162687		0.318	KCNT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNT2	HGNC	protein_coding	OTTHUMT00000086418.2	51	0.00	0	T	NM_198503		196367792	196367792	-1	no_errors	ENST00000294725	ensembl	human	known	69_37n	missense	19	38.71	12	SNP	1.000	G
LCP2	3937	genome.wustl.edu	37	5	169714981	169714981	+	Missense_Mutation	SNP	G	G	A	rs200125818		TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr5:169714981G>A	ENST00000046794.5	-	3	796	c.181C>T	c.(181-183)Cgg>Tgg	p.R61W		NM_005565.3	NP_005556.1	Q13094	LCP2_HUMAN	lymphocyte cytosolic protein 2 (SH2 domain containing leukocyte protein of 76kDa)	61	SAM.				blood coagulation (GO:0007596)|cytokine secretion (GO:0050663)|Fc-epsilon receptor signaling pathway (GO:0038095)|immune response (GO:0006955)|innate immune response (GO:0045087)|mast cell activation (GO:0045576)|platelet activation (GO:0030168)|T cell receptor signaling pathway (GO:0050852)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)				cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	23	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.247)		TACGGCACCCGGAGCTTGGGG	0.522													G|||	1	0.000199681	0.0	0.0	5008	,	,		15923	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													87.0	88.0	88.0					5																	169714981		1899	4132	6031	-	-	-	SO:0001583	missense	0				CCDS47339.1	5q35.1	2013-02-14	2002-08-29		ENSG00000043462	ENSG00000043462		"""SH2 domain containing"""	6529	protein-coding gene	gene with protein product	"""76 kDa tyrosine phosphoprotein"", ""SH2 domain-containing leukocyte protein of 76kD"""	601603	"""lymphocyte cytosolic protein 2 (SH2 domain-containing leukocyte protein of 76kD)"""	SLP76		7706237	Standard	NM_005565		Approved	SLP-76	uc003man.1	Q13094	OTTHUMG00000163121	ENST00000046794.5:c.181C>T	5.37:g.169714981G>A	ENSP00000046794:p.Arg61Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA25|Q53XV4	Missense_Mutation	SNP	pfam_SH2,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,smart_SH2,pfscan_SH2	p.R61W	ENST00000046794.5	37	c.181	CCDS47339.1	5	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	G	18.92	3.726661	0.69074	.	.	ENSG00000043462	ENST00000046794	D	0.85013	-1.93	4.6	2.6	0.31112	Sterile alpha motif domain (1);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 2 (1);	0.314966	0.30510	N	0.009479	D	0.88551	0.6467	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.85066	0.0937	9	.	.	.	-9.6266	5.098	0.14745	0.1049:0.0:0.615:0.28	.	61	Q13094	LCP2_HUMAN	W	61	ENSP00000046794:R61W	.	R	-	1	2	LCP2	169647559	0.998000	0.40836	1.000000	0.80357	0.995000	0.86356	1.273000	0.33121	0.398000	0.25338	0.650000	0.86243	CGG	LCP2	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	ENSG00000043462		0.522	LCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCP2	HGNC	protein_coding	OTTHUMT00000371727.1	98	0.00	0	G	NM_005565		169714981	169714981	-1	no_errors	ENST00000046794	ensembl	human	known	69_37n	missense	45	22.41	13	SNP	1.000	A
MORF4L2	9643	genome.wustl.edu	37	X	102931276	102931276	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chrX:102931276T>G	ENST00000441076.2	-	4	984	c.680A>C	c.(679-681)cAc>cCc	p.H227P	MORF4L2_ENST00000433176.2_Missense_Mutation_p.H227P|MORF4L2_ENST00000451301.1_Missense_Mutation_p.H227P|MORF4L2_ENST00000423833.2_Missense_Mutation_p.H227P|MORF4L2_ENST00000492116.1_5'Flank|MORF4L2_ENST00000360458.1_Missense_Mutation_p.H227P|MORF4L2_ENST00000422154.2_Missense_Mutation_p.H227P	NM_001142419.1|NM_012286.2	NP_001135891.1|NP_036418.1	Q15014	MO4L2_HUMAN	mortality factor 4 like 2	227	MRG. {ECO:0000255|PROSITE- ProRule:PRU00972}.				chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA repair (GO:0006281)|positive regulation of striated muscle cell differentiation (GO:0051155)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(7)	13						TCTCAGTAGGTGTGGTGCTCC	0.458																																						dbGAP											0													79.0	65.0	70.0					X																	102931276		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100620	CCDS14512.1	Xq22	2010-11-24			ENSG00000123562	ENSG00000123562			16849	protein-coding gene	gene with protein product	"""MORF-related gene X"""	300409				9891081, 7584026	Standard	NM_012286		Approved	KIAA0026, MRGX	uc011msa.2	Q15014	OTTHUMG00000022104	ENST00000441076.2:c.680A>C	X.37:g.102931276T>G	ENSP00000391969:p.His227Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP92|D3DXA5|Q567V0|Q8J026	Missense_Mutation	SNP	pfam_MRG,superfamily_Chromodomain-like	p.H227P	ENST00000441076.2	37	c.680	CCDS14512.1	X	.	.	.	.	.	.	.	.	.	.	T	17.37	3.372624	0.61624	.	.	ENSG00000123562	ENST00000360458;ENST00000372620;ENST00000433176;ENST00000422154;ENST00000451301;ENST00000372619;ENST00000441076;ENST00000423833	T;T;T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71;0.71;0.71	4.79	4.79	0.61399	.	0.000000	0.85682	D	0.000000	T	0.75997	0.3926	H	0.95437	3.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82621	-0.0367	10	0.87932	D	0	-6.283	11.5301	0.50604	0.0:0.0:0.0:1.0	.	227	Q15014	MO4L2_HUMAN	P	227;109;227;227;227;209;227;227	ENSP00000353643:H227P;ENSP00000361703:H109P;ENSP00000415476:H227P;ENSP00000394417:H227P;ENSP00000410532:H227P;ENSP00000391969:H227P;ENSP00000416120:H227P	ENSP00000353643:H227P	H	-	2	0	MORF4L2	102817932	1.000000	0.71417	0.997000	0.53966	0.987000	0.75469	7.777000	0.85628	2.088000	0.63022	0.486000	0.48141	CAC	MORF4L2	-	pfam_MRG	ENSG00000123562		0.458	MORF4L2-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MORF4L2	HGNC	protein_coding	OTTHUMT00000057732.1	62	0.00	0	T	NM_012286		102931276	102931276	-1	no_errors	ENST00000360458	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	1.000	G
NCOR2	9612	genome.wustl.edu	37	12	124886970	124886970	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr12:124886970delG	ENST00000405201.1	-	14	1620	c.1620delC	c.(1618-1620)aacfs	p.N540fs	NCOR2_ENST00000404621.1_Frame_Shift_Del_p.N539fs|NCOR2_ENST00000356219.3_Frame_Shift_Del_p.N540fs|NCOR2_ENST00000404121.2_Frame_Shift_Del_p.N110fs|NCOR2_ENST00000397355.1_Frame_Shift_Del_p.N540fs|NCOR2_ENST00000429285.2_Frame_Shift_Del_p.N539fs			Q9Y618	NCOR2_HUMAN	nuclear receptor corepressor 2	540					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|regulation of cellular ketone metabolic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072365)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	membrane (GO:0016020)|nuclear body (GO:0016604)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|Notch binding (GO:0005112)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(2)|endometrium(7)|kidney(5)|large_intestine(7)|lung(28)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	69	all_neural(191;0.0804)|Medulloblastoma(191;0.163)			Epithelial(86;3.99e-05)|OV - Ovarian serous cystadenocarcinoma(86;9.14e-05)|all cancers(50;0.000402)|BRCA - Breast invasive adenocarcinoma(302;0.0764)		CTTCCTTGTCGTTCTCCACCT	0.627																																						dbGAP											0													102.0	125.0	118.0					12																	124886970		2146	4241	6387	-	-	-	SO:0001589	frameshift_variant	0			U37146	CCDS41857.1, CCDS41858.1, CCDS41857.2, CCDS41858.2, CCDS55892.1	12q24	2010-06-10	2010-06-10		ENSG00000196498	ENSG00000196498			7673	protein-coding gene	gene with protein product		600848	"""nuclear receptor co-repressor 2"""			7566127, 8813722	Standard	NM_001077261		Approved	SMRT, SMRTE, TRAC-1, CTG26, TNRC14	uc010tbb.2	Q9Y618	OTTHUMG00000150455	ENST00000405201.1:c.1620delC	12.37:g.124886970delG	ENSP00000384018:p.Asn540fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O00613|O15416|O15421|Q13354|Q56D06|Q59GM0|Q9Y5U0	Frame_Shift_Del	DEL	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.N540fs	ENST00000405201.1	37	c.1620	CCDS41858.2	12																																																																																			NCOR2	-	NULL	ENSG00000196498		0.627	NCOR2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCOR2	HGNC	protein_coding	OTTHUMT00000318173.2	118	0.00	0	G	NM_006312		124886970	124886970	-1	no_errors	ENST00000356219	ensembl	human	known	69_37n	frame_shift_del	86	18.35	20	DEL	0.053	-
NR5A1	2516	genome.wustl.edu	37	9	127262398	127262398	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr9:127262398G>A	ENST00000373588.4	-	4	1037	c.841C>T	c.(841-843)Cgc>Tgc	p.R281C		NM_004959.4	NP_004950.2	Q13285	STF1_HUMAN	nuclear receptor subfamily 5, group A, member 1	281	Important for dimerization.|Ligand-binding.				adrenal gland development (GO:0030325)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|hormone metabolic process (GO:0042445)|intracellular receptor signaling pathway (GO:0030522)|luteinization (GO:0001553)|maintenance of protein location in nucleus (GO:0051457)|male gonad development (GO:0008584)|multicellular organismal aging (GO:0010259)|negative regulation of female gonad development (GO:2000195)|positive regulation of male gonad development (GO:2000020)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|primary sex determination (GO:0007538)|regulation of steroid biosynthetic process (GO:0050810)|tissue development (GO:0009888)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|phospholipid binding (GO:0005543)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|steroid hormone receptor activity (GO:0003707)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(1)|upper_aerodigestive_tract(1)	2						ATGCACCTGCGTGCCCAGTCC	0.667																																						dbGAP											0													45.0	41.0	42.0					9																	127262398		2203	4299	6502	-	-	-	SO:0001583	missense	0			D88155	CCDS6856.1	9q33	2013-01-16			ENSG00000136931	ENSG00000136931		"""Nuclear hormone receptors"""	7983	protein-coding gene	gene with protein product		184757		FTZF1		7789992	Standard	NM_004959		Approved	FTZ1, SF-1, ELP, AD4BP	uc004boo.1	Q13285	OTTHUMG00000020655	ENST00000373588.4:c.841C>T	9.37:g.127262398G>A	ENSP00000362690:p.Arg281Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15196|Q5T6F5	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pirsf_Steroidogenic_factor_1,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.R281C	ENST00000373588.4	37	c.841	CCDS6856.1	9	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283271	0.80803	.	.	ENSG00000136931	ENST00000373588;ENST00000373587	D;D	0.98987	-5.3;-2.0	4.64	3.73	0.42828	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.000000	0.85682	D	0.000000	D	0.99360	0.9775	M	0.91972	3.26	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98936	1.0789	10	0.87932	D	0	.	14.0218	0.64560	0.0:0.1525:0.8475:0.0	.	281	Q13285	STF1_HUMAN	C	281;65	ENSP00000362690:R281C;ENSP00000362689:R65C	ENSP00000362689:R65C	R	-	1	0	NR5A1	126302219	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	4.618000	0.61211	1.046000	0.40249	0.655000	0.94253	CGC	NR5A1	-	superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core,pirsf_Steroidogenic_factor_1,prints_Str_hrmn_rcpt	ENSG00000136931		0.667	NR5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR5A1	HGNC	protein_coding	OTTHUMT00000054029.1	26	0.00	0	G	NM_004959		127262398	127262398	-1	no_errors	ENST00000373588	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.997	A
NRG3	10718	genome.wustl.edu	37	10	83635435	83635435	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr10:83635435C>A	ENST00000404547.1	+	1	339	c.339C>A	c.(337-339)ttC>ttA	p.F113L	NRG3_ENST00000556918.1_5'Flank|NRG3_ENST00000372141.2_Missense_Mutation_p.F113L|NRG3_ENST00000404576.2_5'Flank|NRG3_ENST00000372142.2_5'Flank			P56975	NRG3_HUMAN	neuregulin 3	113	Ser/Thr-rich.				activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|intracellular signal transduction (GO:0035556)|mammary placode formation (GO:0060596)|pattern specification process (GO:0007389)|regulation of cell growth (GO:0001558)	extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	growth factor activity (GO:0008083)|receptor tyrosine kinase binding (GO:0030971)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(41)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	69				GBM - Glioblastoma multiforme(1;2.5e-18)|all cancers(1;2.85e-09)		AGGACCCCTTCTTCCTCTCCA	0.647																																						dbGAP											0													71.0	77.0	75.0					10																	83635435		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098823	CCDS31233.1, CCDS53547.1	10q22-q23	2003-09-09			ENSG00000185737	ENSG00000185737			7999	protein-coding gene	gene with protein product		605533				9275162	Standard	NM_001010848		Approved		uc001kco.2	P56975	OTTHUMG00000018626	ENST00000404547.1:c.339C>A	10.37:g.83635435C>A	ENSP00000384796:p.Phe113Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D7U1|Q0PEH2|Q5VYH3	Missense_Mutation	SNP	pfscan_EG-like_dom	p.F113L	ENST00000404547.1	37	c.339	CCDS31233.1	10	.	.	.	.	.	.	.	.	.	.	c	13.14	2.147749	0.37923	.	.	ENSG00000185737	ENST00000372141;ENST00000404547;ENST00000537287	T;T	0.27720	1.65;1.66	2.97	2.05	0.26809	.	.	.	.	.	T	0.12433	0.0302	N	0.08118	0	0.80722	D	1	B;B	0.29432	0.244;0.244	B;B	0.22152	0.038;0.038	T	0.11227	-1.0596	9	0.44086	T	0.13	.	4.3235	0.11029	0.0:0.7101:0.0:0.2899	.	113;113	B9EGV5;P56975-4	.;.	L	113	ENSP00000361214:F113L;ENSP00000384796:F113L	ENSP00000361214:F113L	F	+	3	2	NRG3	83625415	0.987000	0.35691	1.000000	0.80357	0.985000	0.73830	0.114000	0.15520	1.680000	0.50976	0.459000	0.35465	TTC	NRG3	-	NULL	ENSG00000185737		0.647	NRG3-005	KNOWN	basic|CCDS	protein_coding	NRG3	HGNC	protein_coding	OTTHUMT00000412262.1	47	0.00	0	C	XM_166086		83635435	83635435	+1	no_errors	ENST00000404547	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	1.000	A
NXF4	55999	genome.wustl.edu	37	X	101818873	101818873	+	RNA	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chrX:101818873G>A	ENST00000360035.2	+	0	1157					NR_002216.1				nuclear RNA export factor 4 pseudogene									p.S138S(1)		endometrium(2)|lung(8)	10						AGCTGAAGTCGGCTTGGGAGT	0.552													G|||	2	0.000529801	0.0	0.0	3775	,	,		13661	0.002		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	lung(1)																																								-	-	-			0			AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101818873G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			NXF4	-	-	ENSG00000196970		0.552	NXF4-001	KNOWN	basic	processed_transcript	NXF4	HGNC	pseudogene	OTTHUMT00000095720.1	110	0.00	0	G			101818873	101818873	+1	no_errors	ENST00000360035	ensembl	human	known	69_37n	rna	61	17.57	13	SNP	0.000	A
TENM2	57451	genome.wustl.edu	37	5	167674807	167674807	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr5:167674807G>T	ENST00000518659.1	+	27	6902	c.6863G>T	c.(6862-6864)aGa>aTa	p.R2288I	TENM2_ENST00000519204.1_Missense_Mutation_p.R2167I|TENM2_ENST00000520394.1_Missense_Mutation_p.R2049I|TENM2_ENST00000545108.1_Missense_Mutation_p.R2287I|TENM2_ENST00000403607.2_Missense_Mutation_p.R2112I	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	2288					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										CTCCTAACAAGAGCCTACAAC	0.552																																						dbGAP											0													80.0	82.0	82.0					5																	167674807		2015	4176	6191	-	-	-	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.6863G>T	5.37:g.167674807G>T	ENSP00000429430:p.Arg2288Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl,superfamily_Cytokine_IL1-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.R2288I	ENST00000518659.1	37	c.6863		5	.	.	.	.	.	.	.	.	.	.	G	15.94	2.981333	0.53827	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90620	-2.22;-2.21;-2.33;-2.68;-2.7	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.96116	0.8734	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;0.999;0.988	D	0.96516	0.9382	10	0.87932	D	0	.	19.2622	0.93973	0.0:0.0:1.0:0.0	.	2287;2288;2049	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	I	2288;2287;2167;2049;2112	ENSP00000429430:R2288I;ENSP00000438635:R2287I;ENSP00000428964:R2167I;ENSP00000427874:R2049I;ENSP00000384905:R2112I	ENSP00000384905:R2112I	R	+	2	0	ODZ2	167607385	1.000000	0.71417	0.638000	0.29380	0.437000	0.31866	5.844000	0.69430	2.556000	0.86216	0.561000	0.74099	AGA	ODZ2	-	NULL	ENSG00000145934		0.552	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	HGNC	protein_coding	OTTHUMT00000376096.1	28	0.00	0	G	NM_001122679		167674807	167674807	+1	no_errors	ENST00000518659	ensembl	human	known	69_37n	missense	23	23.33	7	SNP	0.999	T
PIEZO1	9780	genome.wustl.edu	37	16	88793188	88793188	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr16:88793188G>T	ENST00000301015.9	-	25	3880	c.3634C>A	c.(3634-3636)Ctc>Atc	p.L1212I		NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1212					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CACAGCACGAGGCGGGCCCGT	0.662																																						dbGAP											0													39.0	45.0	43.0					16																	88793188		692	1588	2280	-	-	-	SO:0001583	missense	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.3634C>A	16.37:g.88793188G>T	ENSP00000301015:p.Leu1212Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_DUF3595	p.L1212I	ENST00000301015.9	37	c.3634	CCDS54058.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.24|16.24	3.067008|3.067008	0.55539|0.55539	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000301015|ENST00000451779	T|.	0.15834|.	2.39|.	4.51|4.51	3.55|3.55	0.40652|0.40652	.|.	0.424401|.	0.23775|.	N|.	0.044681|.	T|T	0.71187|0.71187	0.3310|0.3310	M|M	0.75264|0.75264	2.295|2.295	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.80764|.	0.994|.	T|T	0.71307|0.71307	-0.4632|-0.4632	10|5	0.34782|.	T|.	0.22|.	-44.1507|-44.1507	11.5235|11.5235	0.50565|0.50565	0.09:0.0:0.91:0.0|0.09:0.0:0.91:0.0	.|.	1212|.	Q92508|.	PIEZ1_HUMAN|.	I|H	1212|1157	ENSP00000301015:L1212I|.	ENSP00000301015:L1212I|.	L|P	-|-	1|2	0|0	FAM38A|FAM38A	87320689|87320689	1.000000|1.000000	0.71417|0.71417	0.820000|0.820000	0.32676|0.32676	0.392000|0.392000	0.30506|0.30506	6.971000|6.971000	0.76105|0.76105	1.127000|1.127000	0.42034|0.42034	0.491000|0.491000	0.48974|0.48974	CTC|CCT	PIEZO1	-	NULL	ENSG00000103335		0.662	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	28	0.00	0	G	NM_014745		88793188	88793188	-1	no_errors	ENST00000301015	ensembl	human	novel	69_37n	missense	21	16.00	4	SNP	1.000	T
PTPRM	5797	genome.wustl.edu	37	18	8296407	8296407	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr18:8296407G>C	ENST00000332175.8	+	18	3794	c.2757G>C	c.(2755-2757)aaG>aaC	p.K919N	PTPRM_ENST00000580170.1_Missense_Mutation_p.K932N|PTPRM_ENST00000400053.4_Missense_Mutation_p.K857N|PTPRM_ENST00000444013.1_Missense_Mutation_p.K706N|PTPRM_ENST00000400060.4_Missense_Mutation_p.K933N	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	919	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				ACTCGGCTAAGAAAGATGAGA	0.418																																						dbGAP											0													200.0	172.0	181.0					18																	8296407		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2757G>C	18.37:g.8296407G>C	ENSP00000331418:p.Lys919Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.K933N	ENST00000332175.8	37	c.2799	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	G	17.25	3.342411	0.61073	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.72	5.72	0.89469	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	D	0.000000	T	0.27900	0.0687	N	0.04387	-0.21	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.77004	0.989;0.989;0.989	T	0.08617	-1.0713	10	0.02654	T	1	.	14.4204	0.67180	0.0704:0.0:0.9296:0.0	.	706;932;919	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	N	919;933;857;706	ENSP00000331418:K919N;ENSP00000382933:K933N;ENSP00000382927:K857N;ENSP00000387608:K706N	ENSP00000331418:K919N	K	+	3	2	PTPRM	8286407	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.886000	0.48578	2.865000	0.98341	0.655000	0.94253	AAG	PTPRM	-	smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000173482		0.418	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	88	0.00	0	G			8296407	8296407	+1	no_errors	ENST00000400060	ensembl	human	known	69_37n	missense	29	43.14	22	SNP	1.000	C
RGAG1	57529	genome.wustl.edu	37	X	109694771	109694771	+	Missense_Mutation	SNP	C	C	T	rs199759157		TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chrX:109694771C>T	ENST00000465301.2	+	3	1172	c.926C>T	c.(925-927)tCg>tTg	p.S309L	RGAG1_ENST00000540313.1_Missense_Mutation_p.S309L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	309										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATAATGTCATCGCTTTTAATG	0.493																																						dbGAP											0													235.0	205.0	216.0					X																	109694771		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.926C>T	X.37:g.109694771C>T	ENSP00000419786:p.Ser309Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.S309L	ENST00000465301.2	37	c.926	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	11.37	1.618724	0.28801	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.54071	0.59;0.59	3.91	3.05	0.35203	.	0.000000	0.30126	N	0.010342	T	0.30665	0.0772	N	0.17082	0.46	0.25605	N	0.986558	B	0.27416	0.178	B	0.19391	0.025	T	0.12578	-1.0542	9	.	.	.	-10.3954	8.8646	0.35278	0.0:0.8838:0.0:0.1162	.	309	Q8NET4	RGAG1_HUMAN	L	309	ENSP00000419786:S309L;ENSP00000441452:S309L	.	S	+	2	0	RGAG1	109581427	0.956000	0.32656	0.083000	0.20561	0.027000	0.11550	0.871000	0.28023	1.003000	0.39130	0.600000	0.82982	TCG	RGAG1	-	NULL	ENSG00000243978		0.493	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	89	0.00	0	C	NM_020769		109694771	109694771	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	44	32.31	21	SNP	0.692	T
RBMXL3	139804	genome.wustl.edu	37	X	114426304	114426304	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chrX:114426304C>A	ENST00000424776.3	+	1	2342	c.2300C>A	c.(2299-2301)tCc>tAc	p.S767Y	LRCH2_ENST00000317135.8_Intron|LRCH2_ENST00000538422.1_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	767	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CATGACAGTTCCAGCCGGAGC	0.652																																						dbGAP											0													32.0	37.0	35.0					X																	114426304		692	1590	2282	-	-	-	SO:0001583	missense	0			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.2300C>A	X.37:g.114426304C>A	ENSP00000417451:p.Ser767Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXC0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S767Y	ENST00000424776.3	37	c.2300	CCDS55478.1	X	.	.	.	.	.	.	.	.	.	.	C	1.504	-0.551352	0.03996	.	.	ENSG00000175718	ENST00000424776	T	0.05580	3.42	0.118	-0.237	0.13061	.	.	.	.	.	T	0.02888	0.0086	N	0.08118	0	0.09310	N	1	B	0.13145	0.007	B	0.10450	0.005	T	0.44498	-0.9324	8	0.87932	D	0	.	.	.	.	.	767	Q8N7X1	RMXL3_HUMAN	Y	767	ENSP00000417451:S767Y	ENSP00000417451:S767Y	S	+	2	0	RBMXL3	114332560	0.003000	0.15002	0.004000	0.12327	0.004000	0.04260	0.145000	0.16157	-1.270000	0.02433	-1.274000	0.01402	TCC	RBMXL3	-	NULL	ENSG00000175718		0.652	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	65	0.00	0	C	NM_001145346		114426304	114426304	+1	no_errors	ENST00000424776	ensembl	human	known	69_37n	missense	32	15.38	6	SNP	0.070	A
RPUSD4	84881	genome.wustl.edu	37	11	126075441	126075441	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr11:126075441C>G	ENST00000298317.4	-	5	771	c.718G>C	c.(718-720)Gcg>Ccg	p.A240P	RPUSD4_ENST00000533628.1_Intron|RPUSD4_ENST00000534393.1_5'Flank	NM_032795.2	NP_116184.2	Q96CM3	RUSD4_HUMAN	RNA pseudouridylate synthase domain containing 4	240					pseudouridine synthesis (GO:0001522)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(8)|skin(1)	17	all_hematologic(175;0.145)	Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.0919)|all_lung(97;0.0994)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.13e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0761)		GCAACTTGCGCATTCCGGCTG	0.542																																						dbGAP											0													139.0	125.0	129.0					11																	126075441		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC014131	CCDS8469.1, CCDS53721.1	11q24.2	2013-02-11			ENSG00000165526	ENSG00000165526		"""RNA pseudouridylate synthase domain containing"""	25898	protein-coding gene	gene with protein product							Standard	NM_032795		Approved	FLJ14494	uc001qde.3	Q96CM3	OTTHUMG00000165815	ENST00000298317.4:c.718G>C	11.37:g.126075441C>G	ENSP00000298317:p.Ala240Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PML2|Q96K56	Missense_Mutation	SNP	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom	p.A240P	ENST00000298317.4	37	c.718	CCDS8469.1	11	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463221	0.63513	.	.	ENSG00000165526	ENST00000298317	T	0.22743	1.94	5.72	5.72	0.89469	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.43299	0.1241	L	0.54323	1.7	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.19386	-1.0307	10	0.87932	D	0	-15.7206	17.0528	0.86524	0.0:1.0:0.0:0.0	.	240	Q96CM3	RUSD4_HUMAN	P	240	ENSP00000298317:A240P	ENSP00000298317:A240P	A	-	1	0	RPUSD4	125580651	1.000000	0.71417	0.140000	0.22221	0.032000	0.12392	6.191000	0.72063	2.691000	0.91804	0.655000	0.94253	GCG	RPUSD4	-	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom	ENSG00000165526		0.542	RPUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPUSD4	HGNC	protein_coding	OTTHUMT00000386336.1	74	0.00	0	C	NM_032795		126075441	126075441	-1	no_errors	ENST00000298317	ensembl	human	known	69_37n	missense	29	45.28	24	SNP	0.982	G
SAFB2	9667	genome.wustl.edu	37	19	5595489	5595489	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr19:5595489C>A	ENST00000252542.4	-	14	2066	c.1802G>T	c.(1801-1803)cGc>cTc	p.R601L		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	601	Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		TTCTGACTTGCGATCCTGACT	0.438																																					Ovarian(127;888 1728 23957 44128 52668)	dbGAP											0													121.0	100.0	107.0					19																	5595489		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.1802G>T	19.37:g.5595489C>A	ENSP00000252542:p.Arg601Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKG3|Q8TB13	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.R601L	ENST00000252542.4	37	c.1802	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051583	0.75960	.	.	ENSG00000130254	ENST00000252542	T	0.22539	1.95	4.71	4.71	0.59529	.	0.000000	0.52532	D	0.000069	T	0.42675	0.1213	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.25710	-1.0124	10	0.48119	T	0.1	-18.9277	18.0371	0.89307	0.0:1.0:0.0:0.0	.	601	Q14151	SAFB2_HUMAN	L	601	ENSP00000252542:R601L	ENSP00000252542:R601L	R	-	2	0	SAFB2	5546489	1.000000	0.71417	0.145000	0.22337	0.986000	0.74619	5.449000	0.66619	2.307000	0.77673	0.561000	0.74099	CGC	SAFB2	-	NULL	ENSG00000130254		0.438	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	100	0.00	0	C	NM_014649		5595489	5595489	-1	no_errors	ENST00000252542	ensembl	human	known	69_37n	missense	73	20.65	19	SNP	1.000	A
SETX	23064	genome.wustl.edu	37	9	135205171	135205171	+	Missense_Mutation	SNP	A	A	C			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr9:135205171A>C	ENST00000224140.5	-	10	1996	c.1814T>G	c.(1813-1815)tTt>tGt	p.F605C	SETX_ENST00000393220.1_Missense_Mutation_p.F605C|SETX_ENST00000372169.2_Missense_Mutation_p.F605C	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	605					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		CAGATCCACAAAAGTGTTACA	0.363																																						dbGAP											0													65.0	60.0	61.0					9																	135205171		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.1814T>G	9.37:g.135205171A>C	ENSP00000224140:p.Phe605Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	NULL	p.F605C	ENST00000224140.5	37	c.1814	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	A	13.64	2.296145	0.40594	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.87334	-2.15;-2.24;-1.86	5.68	-2.48	0.06423	.	1.115640	0.06693	N	0.770016	T	0.77054	0.4074	N	0.24115	0.695	0.09310	N	1	B;B;B	0.11235	0.004;0.001;0.004	B;B;B	0.10450	0.005;0.002;0.005	T	0.62469	-0.6848	10	0.54805	T	0.06	.	7.1114	0.25392	0.4018:0.1429:0.4553:0.0	.	605;605;605	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	C	605	ENSP00000224140:F605C;ENSP00000361242:F605C;ENSP00000376913:F605C	ENSP00000224140:F605C	F	-	2	0	SETX	134194992	0.000000	0.05858	0.000000	0.03702	0.737000	0.42083	-0.698000	0.05092	-0.430000	0.07318	0.528000	0.53228	TTT	SETX	-	NULL	ENSG00000107290		0.363	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	46	0.00	0	A	NM_015046		135205171	135205171	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.001	C
SIPA1L3	23094	genome.wustl.edu	37	19	38694842	38694842	+	Silent	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr19:38694842G>T	ENST00000222345.6	+	21	5705	c.5196G>T	c.(5194-5196)ctG>ctT	p.L1732L		NM_015073.1	NP_055888.1	O60292	SI1L3_HUMAN	signal-induced proliferation-associated 1 like 3	1732					hematopoietic progenitor cell differentiation (GO:0002244)|regulation of small GTPase mediated signal transduction (GO:0051056)	extracellular space (GO:0005615)	GTPase activator activity (GO:0005096)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(22)|ovary(2)|prostate(4)|skin(3)	59			Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			ACACTGACCTGCAGAAGGTAA	0.627																																						dbGAP											0													49.0	36.0	40.0					19																	38694842		2187	4260	6447	-	-	-	SO:0001819	synonymous_variant	0			AB011117	CCDS33007.1	19q13.13	2008-02-05			ENSG00000105738	ENSG00000105738			23801	protein-coding gene	gene with protein product							Standard	XM_005258671		Approved	KIAA0545	uc002ohk.3	O60292	OTTHUMG00000073727	ENST00000222345.6:c.5196G>T	19.37:g.38694842G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TV87	Silent	SNP	pfam_DUF3401,pfam_Rap_GAP,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.L1732	ENST00000222345.6	37	c.5196	CCDS33007.1	19																																																																																			SIPA1L3	-	NULL	ENSG00000105738		0.627	SIPA1L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L3	HGNC	protein_coding	OTTHUMT00000156294.2	30	0.00	0	G	XM_032278		38694842	38694842	+1	no_errors	ENST00000222345	ensembl	human	known	69_37n	silent	18	18.18	4	SNP	0.958	T
ST8SIA4	7903	genome.wustl.edu	37	5	100238563	100238563	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr5:100238563C>A	ENST00000231461.5	-	1	407	c.97G>T	c.(97-99)Gag>Tag	p.E33*	ST8SIA4_ENST00000451528.2_Nonsense_Mutation_p.E33*	NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	33					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		AGTTGCGTCTCCTGGTGCTCC	0.413																																						dbGAP											0													120.0	109.0	113.0					5																	100238563		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.97G>T	5.37:g.100238563C>A	ENSP00000231461:p.Glu33*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA07|G3V104|Q8N1F4|Q92693	Nonsense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.E33*	ENST00000231461.5	37	c.97	CCDS4091.1	5	.	.	.	.	.	.	.	.	.	.	C	39	7.420274	0.98272	.	.	ENSG00000113532	ENST00000231461;ENST00000451528	.	.	.	5.24	5.24	0.73138	.	0.069200	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	18.01	0.89220	0.0:1.0:0.0:0.0	.	.	.	.	X	33	.	ENSP00000231461:E33X	E	-	1	0	ST8SIA4	100266462	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.648000	0.67930	2.724000	0.93272	0.561000	0.74099	GAG	ST8SIA4	-	pirsf_Sialyl_trans	ENSG00000113532		0.413	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA4	HGNC	protein_coding	OTTHUMT00000250632.3	93	0.00	0	C	NM_005668		100238563	100238563	-1	no_errors	ENST00000231461	ensembl	human	known	69_37n	nonsense	54	29.87	23	SNP	1.000	A
SYNE1	23345	genome.wustl.edu	37	6	152804248	152804248	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr6:152804248G>A	ENST00000367255.5	-	14	1923	c.1322C>T	c.(1321-1323)aCg>aTg	p.T441M	SYNE1_ENST00000413186.2_Missense_Mutation_p.T441M|SYNE1_ENST00000341594.5_Missense_Mutation_p.T441M|SYNE1_ENST00000367253.4_Missense_Mutation_p.T441M|SYNE1_ENST00000367248.3_Missense_Mutation_p.T431M|SYNE1_ENST00000265368.4_Missense_Mutation_p.T441M|SYNE1_ENST00000423061.1_Missense_Mutation_p.T448M|SYNE1_ENST00000466159.2_Missense_Mutation_p.T441M|SYNE1_ENST00000448038.1_Missense_Mutation_p.T448M	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	441					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCGTTGTATCGTGTTTGCTGT	0.502										HNSCC(10;0.0054)																												dbGAP											0													349.0	334.0	339.0					6																	152804248		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1322C>T	6.37:g.152804248G>A	ENSP00000356224:p.Thr441Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.T441M	ENST00000367255.5	37	c.1322	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	17.32	3.359474	0.61403	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	T;T;T;T;T;D;D;D;D;D	0.91237	0.72;0.72;0.63;0.71;0.81;-2.14;-2.3;-2.28;-2.59;-2.81	5.87	5.01	0.66863	.	0.103185	0.42682	D	0.000675	D	0.88422	0.6432	L	0.57536	1.79	0.80722	D	1	D;D;D;D;D	0.67145	0.996;0.962;0.99;0.962;0.978	P;P;P;P;P	0.54889	0.499;0.584;0.763;0.584;0.763	D	0.87609	0.2502	10	0.36615	T	0.2	.	9.6083	0.39648	0.2536:0.0:0.7464:0.0	.	424;441;441;441;448	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	M	441;448;441;448;441;441;431;441;441;424	ENSP00000356224:T441M;ENSP00000396024:T448M;ENSP00000265368:T441M;ENSP00000390975:T448M;ENSP00000341887:T441M;ENSP00000356222:T441M;ENSP00000356217:T431M;ENSP00000414510:T441M;ENSP00000446021:T441M;ENSP00000441264:T424M	ENSP00000265368:T441M	T	-	2	0	SYNE1	152845941	0.996000	0.38824	1.000000	0.80357	0.961000	0.63080	2.690000	0.47001	1.633000	0.50488	-0.137000	0.14449	ACG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.502	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	151	0.00	0	G	NM_182961		152804248	152804248	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	79	31.30	36	SNP	0.995	A
THOC2	57187	genome.wustl.edu	37	X	122830637	122830637	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chrX:122830637G>T	ENST00000245838.8	-	6	432	c.401C>A	c.(400-402)tCa>tAa	p.S134*	THOC2_ENST00000355725.4_Nonsense_Mutation_p.S134*|THOC2_ENST00000491737.1_Nonsense_Mutation_p.S19*	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	134					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						AAGCCCTAATGATTCCAGTGT	0.328																																						dbGAP											0													199.0	174.0	182.0					X																	122830637		1832	4071	5903	-	-	-	SO:0001587	stop_gained	0			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.401C>A	X.37:g.122830637G>T	ENSP00000245838:p.Ser134*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Nonsense_Mutation	SNP	pfam_THO_THOC2_C,pfam_THO_THOC2_N	p.S134*	ENST00000245838.8	37	c.401	CCDS43988.1	X	.	.	.	.	.	.	.	.	.	.	G	37	6.327985	0.97476	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.77	5.77	0.91146	.	0.000000	0.51477	D	0.000084	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.472	18.9785	0.92747	0.0:0.0:1.0:0.0	.	.	.	.	X	134;134;19;55	.	ENSP00000245838:S134X	S	-	2	0	THOC2	122658318	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	6.758000	0.74929	2.430000	0.82344	0.544000	0.68410	TCA	THOC2	-	NULL	ENSG00000125676		0.328	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	HGNC	protein_coding	OTTHUMT00000058153.3	146	0.00	0	G			122830637	122830637	-1	no_errors	ENST00000245838	ensembl	human	known	69_37n	nonsense	94	24.80	31	SNP	1.000	T
TM2D1	83941	genome.wustl.edu	37	1	62166636	62166636	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr1:62166636C>G	ENST00000606498.1	-	4	429	c.409G>C	c.(409-411)Gat>Cat	p.D137H	TM2D1_ENST00000371177.2_Missense_Mutation_p.D137H|TM2D1_ENST00000472989.1_5'UTR|TM2D1_ENST00000294613.5_Missense_Mutation_p.D137H|TM2D1_ENST00000371180.2_Missense_Mutation_p.D199H			Q9BX74	TM2D1_HUMAN	TM2 domain containing 1	137					apoptotic signaling pathway (GO:0097190)	integral component of plasma membrane (GO:0005887)	beta-amyloid binding (GO:0001540)|G-protein coupled receptor activity (GO:0004930)			large_intestine(2)|lung(3)|ovary(1)	6						TAAAATCGATCTGCTCCCAAC	0.353																																						dbGAP											0													107.0	102.0	103.0					1																	62166636		1836	4086	5922	-	-	-	SO:0001583	missense	0			AF353990	CCDS65554.1	1p32.1	2008-02-05			ENSG00000162604	ENSG00000162604			24142	protein-coding gene	gene with protein product		610080				11278849, 12553667	Standard	NM_032027		Approved	BBP	uc001czz.1	Q9BX74	OTTHUMG00000008466	ENST00000606498.1:c.409G>C	1.37:g.62166636C>G	ENSP00000475700:p.Asp137His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDA8	Missense_Mutation	SNP	pfam_TM2	p.D199H	ENST00000606498.1	37	c.595		1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.644367	0.87859	.	.	ENSG00000162604	ENST00000371180;ENST00000294613;ENST00000371178;ENST00000371177	.	.	.	5.79	5.79	0.91817	TM2 (1);	0.000000	0.85682	D	0.000000	T	0.68091	0.2963	L	0.33189	0.99	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.70135	-0.4955	9	0.87932	D	0	-21.689	16.9567	0.86261	0.0:1.0:0.0:0.0	.	137	Q9BX74	TM2D1_HUMAN	H	199;137;137;137	.	ENSP00000294613:D137H	D	-	1	0	TM2D1	61939224	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.927000	0.75840	2.733000	0.93635	0.655000	0.94253	GAT	TM2D1	-	pfam_TM2	ENSG00000162604		0.353	TM2D1-012	KNOWN	non_canonical_U12|basic|appris_principal	protein_coding	TM2D1	HGNC	protein_coding	OTTHUMT00000470779.2	60	0.00	0	C	NM_032027		62166636	62166636	-1	no_errors	ENST00000371180	ensembl	human	known	69_37n	missense	27	34.15	14	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7577095	7577095	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr17:7577095G>T	ENST00000269305.4	-	8	1032	c.843C>A	c.(841-843)gaC>gaA	p.D281E	TP53_ENST00000359597.4_Missense_Mutation_p.D281E|TP53_ENST00000445888.2_Missense_Mutation_p.D281E|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.D281E|TP53_ENST00000455263.2_Missense_Mutation_p.D281E	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	281	Interaction with AXIN1. {ECO:0000250}.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		D -> A (in sporadic cancers; somatic mutation).|D -> E (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1459726}.|D -> G (in a brain tumor with no family history; germline mutation and in sporadic cancers; somatic mutation).|D -> H (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|D -> N (in LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> R (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).|D -> V (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation).|D -> Y (in sporadic cancers; somatic mutation).|DR -> EW (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.D281E(28)|p.R282W(10)|p.0?(8)|p.D281D(5)|p.?(2)|p.D281fs*63(2)|p.R280_D281delRD(2)|p.D281_R282>EW(2)|p.A276_R283delACPGRDRR(1)|p.D281_R282insXX(1)|p.C275fs*20(1)|p.R282fs*24(1)|p.D281R(1)|p.L265_K305del41(1)|p.D281_R282delDR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CTGTGCGCCGGTCTCTCCCAG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	72	Substitution - Missense(39)|Deletion - In frame(8)|Whole gene deletion(8)|Substitution - coding silent(5)|Deletion - Frameshift(4)|Unknown(2)|Complex - frameshift(2)|Complex - compound substitution(2)|Insertion - Frameshift(1)|Insertion - In frame(1)	skin(12)|upper_aerodigestive_tract(8)|ovary(8)|haematopoietic_and_lymphoid_tissue(7)|breast(6)|lung(5)|central_nervous_system(4)|bone(4)|urinary_tract(3)|oesophagus(3)|liver(3)|stomach(2)|endometrium(2)|large_intestine(1)|vulva(1)|genital_tract(1)|pancreas(1)|prostate(1)											82.0	70.0	74.0					17																	7577095		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.843C>A	17.37:g.7577095G>T	ENSP00000269305:p.Asp281Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.D281E	ENST00000269305.4	37	c.843	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	21.6	4.166226	0.78339	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99861	-7.26;-7.26;-7.26;-7.26;-7.26;-7.26	4.99	0.696	0.18075	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99832	0.9924	M	0.92649	3.33	0.52501	D	0.999959	D;D;D;P	0.71674	0.993;0.998;0.995;0.916	D;D;D;D	0.91635	0.965;0.999;0.951;0.943	D	0.98567	1.0644	10	0.87932	D	0	-25.6697	7.6418	0.28298	0.4422:0.0:0.5578:0.0	.	281;281;281;281	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	E	281;281;281;281;281;270;149	ENSP00000352610:D281E;ENSP00000269305:D281E;ENSP00000398846:D281E;ENSP00000391127:D281E;ENSP00000391478:D281E;ENSP00000425104:D149E	ENSP00000269305:D281E	D	-	3	2	TP53	7517820	1.000000	0.71417	0.915000	0.36163	0.964000	0.63967	1.949000	0.40313	0.286000	0.22352	0.462000	0.41574	GAC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	88	0.00	0	G	NM_000546		7577095	7577095	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	0.993	T
TPMT	7172	genome.wustl.edu	37	6	18139900	18139900	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr6:18139900G>A	ENST00000309983.4	-	5	500	c.415C>T	c.(415-417)Ccc>Tcc	p.P139S		NM_000367.2	NP_000358.1	P51580	TPMT_HUMAN	thiopurine S-methyltransferase	139					methylation (GO:0032259)|nucleobase-containing compound metabolic process (GO:0006139)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	thiopurine S-methyltransferase activity (GO:0008119)			large_intestine(2)|lung(1)	3	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.146)	all cancers(50;0.06)|Epithelial(50;0.0654)		Azathioprine(DB00993)|Bendroflumethiazide(DB00436)|Cefazolin(DB01327)|Mercaptopurine(DB01033)|Olsalazine(DB01250)|Trichlormethiazide(DB01021)	ACCTACCTGGGAAGATCAAAA	0.368																																					Colon(190;1381 2791 16728 32493)	dbGAP											0													67.0	70.0	69.0					6																	18139900		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4543.1	6p22.3	2014-09-17			ENSG00000137364	ENSG00000137364	2.1.1.67		12014	protein-coding gene	gene with protein product		187680				8316220	Standard	NM_000367		Approved		uc003ncm.3	P51580	OTTHUMG00000014317	ENST00000309983.4:c.415C>T	6.37:g.18139900G>A	ENSP00000312304:p.Pro139Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O14806|O15423|O15424|O15425|O15426|O15515|O15548|O43213|Q5VUK6|Q9UBE6|Q9UBT8|Q9UE62	Missense_Mutation	SNP	pfam_TPMT,pirsf_Thiopurine_S-MeTrfase	p.P139S	ENST00000309983.4	37	c.415	CCDS4543.1	6	.	.	.	.	.	.	.	.	.	.	G	1.555	-0.538251	0.04082	.	.	ENSG00000137364	ENST00000309983	T	0.66280	-0.2	5.21	4.35	0.52113	.	0.280318	0.40818	N	0.001008	T	0.19967	0.0480	N	0.17922	0.545	0.36872	D	0.888977	B;B	0.15473	0.004;0.013	B;B	0.13407	0.005;0.009	T	0.10894	-1.0610	10	0.11794	T	0.64	.	5.0465	0.14487	0.172:0.0:0.6601:0.1679	.	139;139	Q9BS45;P51580	.;TPMT_HUMAN	S	139	ENSP00000312304:P139S	ENSP00000312304:P139S	P	-	1	0	TPMT	18247879	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	1.788000	0.38714	1.230000	0.43646	0.556000	0.70494	CCC	TPMT	-	pfam_TPMT,pirsf_Thiopurine_S-MeTrfase	ENSG00000137364		0.368	TPMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPMT	HGNC	protein_coding	OTTHUMT00000039960.1	60	0.00	0	G			18139900	18139900	-1	no_errors	ENST00000309983	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	A
TSHZ1	10194	genome.wustl.edu	37	18	72999678	72999678	+	Silent	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr18:72999678G>A	ENST00000580243.1	+	2	2664	c.2316G>A	c.(2314-2316)gcG>gcA	p.A772A	TSHZ1_ENST00000322038.5_Silent_p.A727A			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	772					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		ACCCGCTGGCGATGCTGTACA	0.582																																						dbGAP											0													52.0	50.0	51.0					18																	72999678		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2316G>A	18.37:g.72999678G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60534|Q4LE29|Q53EU4	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.A772	ENST00000580243.1	37	c.2316		18																																																																																			TSHZ1	-	NULL	ENSG00000179981		0.582	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	HGNC	protein_coding	OTTHUMT00000444913.1	25	0.00	0	G	NM_005786		72999678	72999678	+1	no_errors	ENST00000580243	ensembl	human	known	69_37n	silent	8	46.67	7	SNP	1.000	A
TTC37	9652	genome.wustl.edu	37	5	94877078	94877078	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr5:94877078G>T	ENST00000358746.2	-	7	631	c.333C>A	c.(331-333)gaC>gaA	p.D111E		NM_014639.3	NP_055454.1	Q6PGP7	TTC37_HUMAN	tetratricopeptide repeat domain 37	111						cytoplasm (GO:0005737)|nucleus (GO:0005634)|Ski complex (GO:0055087)|transcriptionally active chromatin (GO:0035327)				breast(2)|endometrium(6)|kidney(3)|large_intestine(13)|liver(1)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(1)	47						ACTTCTGCTTGTCAACACTTA	0.318																																						dbGAP											0													77.0	77.0	77.0					5																	94877078		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002370	CCDS4072.1	5q15	2014-09-17	2008-06-11	2008-06-11	ENSG00000198677	ENSG00000198677		"""Tetratricopeptide (TTC) repeat domain containing"""	23639	protein-coding gene	gene with protein product		614589	"""KIAA0372"""	KIAA0372		9205841	Standard	NM_014639		Approved		uc003klb.3	Q6PGP7	OTTHUMG00000121165	ENST00000358746.2:c.333C>A	5.37:g.94877078G>T	ENSP00000351596:p.Asp111Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15077|Q6PJI3	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D111E	ENST00000358746.2	37	c.333	CCDS4072.1	5	.	.	.	.	.	.	.	.	.	.	G	14.37	2.514919	0.44763	.	.	ENSG00000198677	ENST00000358746;ENST00000514952	D;T	0.83075	-1.68;-1.38	5.7	2.96	0.34315	Tetratricopeptide-like helical (1);	0.101943	0.64402	N	0.000004	T	0.75273	0.3827	L	0.54323	1.7	0.34000	D	0.650149	P;B	0.35894	0.526;0.196	B;B	0.31751	0.135;0.058	T	0.74740	-0.3563	10	0.30854	T	0.27	.	9.7458	0.40446	0.2764:0.0:0.7236:0.0	.	63;111	D6RCE2;Q6PGP7	.;TTC37_HUMAN	E	111;63	ENSP00000351596:D111E;ENSP00000423742:D63E	ENSP00000351596:D111E	D	-	3	2	TTC37	94902834	1.000000	0.71417	0.998000	0.56505	0.962000	0.63368	2.862000	0.48388	0.346000	0.23899	0.650000	0.86243	GAC	TTC37	-	NULL	ENSG00000198677		0.318	TTC37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC37	HGNC	protein_coding	OTTHUMT00000241651.1	46	0.00	0	G	NM_014639		94877078	94877078	-1	no_errors	ENST00000358746	ensembl	human	known	69_37n	missense	19	36.67	11	SNP	1.000	T
TTLL3	26140	genome.wustl.edu	37	3	9874880	9874880	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr3:9874880G>A	ENST00000547186.1	+	11	1863	c.1647G>A	c.(1645-1647)atG>atA	p.M549I	TTLL3_ENST00000397241.1_Intron|TTLL3_ENST00000455274.1_Intron|TTLL3_ENST00000430793.1_Missense_Mutation_p.M337I|TTLL3_ENST00000426895.4_Missense_Mutation_p.M692I|TTLL3_ENST00000427853.3_Intron|TTLL3_ENST00000383827.1_Intron|ARPC4-TTLL3_ENST00000397256.1_Intron	NM_001025930.3	NP_001021100.3	Q9Y4R7	TTLL3_HUMAN	tubulin tyrosine ligase-like family, member 3	549					axoneme assembly (GO:0035082)|cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(2)|skin(1)	26	Medulloblastoma(99;0.227)					ATCGGCGGATGGGGGTCCGCC	0.632																																						dbGAP											0													41.0	42.0	42.0					3																	9874880		1921	4119	6040	-	-	-	SO:0001583	missense	0				CCDS43048.1, CCDS43048.2	3p25.3	2013-02-14			ENSG00000214021	ENSG00000214021		"""Tubulin tyrosine ligase-like family"""	24483	protein-coding gene	gene with protein product						11054573	Standard	NR_037162		Approved	DKFZP434B103, HOTTL	uc003btg.4	Q9Y4R7	OTTHUMG00000128439	ENST00000547186.1:c.1647G>A	3.37:g.9874880G>A	ENSP00000446659:p.Met549Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMS8|Q6AWA3|Q6ZU95|Q8NDN8|Q96GG8|Q9H876|Q9UI99	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.M692I	ENST00000547186.1	37	c.2076		3	.	.	.	.	.	.	.	.	.	.	G	7.862	0.726250	0.15439	.	.	ENSG00000214021	ENST00000426895;ENST00000547186;ENST00000443148;ENST00000430793	T;T;T;T	0.05258	3.67;3.78;3.85;3.47	5.09	-1.2	0.09554	.	.	.	.	.	T	0.04543	0.0124	.	.	.	0.09310	N	1	B;B;B	0.12013	0.001;0.004;0.005	B;B;B	0.11329	0.002;0.006;0.004	T	0.40869	-0.9540	8	0.36615	T	0.2	.	7.3316	0.26586	0.2887:0.1211:0.5902:0.0	.	488;337;549	B4DM47;Q9Y4R7-5;Q9Y4R7	.;.;TTLL3_HUMAN	I	692;549;487;337	ENSP00000392549:M692I;ENSP00000446659:M549I;ENSP00000398097:M487I;ENSP00000403874:M337I	ENSP00000392549:M692I	M	+	3	0	TTLL3	9849880	0.000000	0.05858	0.000000	0.03702	0.689000	0.40095	-0.419000	0.07071	-0.509000	0.06532	0.655000	0.94253	ATG	TTLL3	-	NULL	ENSG00000214021		0.632	TTLL3-203	KNOWN	basic	protein_coding	TTLL3	HGNC	protein_coding		28	0.00	0	G	NM_001025930.2		9874880	9874880	+1	no_errors	ENST00000426895	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.000	A
TXNDC16	57544	genome.wustl.edu	37	14	52899269	52899269	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr14:52899269delG	ENST00000281741.4	-	21	2602	c.2231delC	c.(2230-2232)ccafs	p.P744fs		NM_001160047.1|NM_020784.2	NP_001153519.1|NP_065835.2	Q9P2K2	TXD16_HUMAN	thioredoxin domain containing 16	744					cell redox homeostasis (GO:0045454)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(3)|skin(1)	21	Breast(41;0.0716)					ATCATAAGCTGGAAGAGGAGG	0.378																																						dbGAP											0													52.0	51.0	52.0					14																	52899269		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB037765	CCDS32083.1	14q22.1	2007-08-16	2007-08-16	2007-08-16		ENSG00000087301			19965	protein-coding gene	gene with protein product			"""KIAA1344"""	KIAA1344			Standard	NM_020784		Approved		uc001wzs.3	Q9P2K2		ENST00000281741.4:c.2231delC	14.37:g.52899269delG	ENSP00000281741:p.Pro744fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKW9|A7E260|A7MD07|B9EH67|Q9H9W7	Frame_Shift_Del	DEL	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.P744fs	ENST00000281741.4	37	c.2231	CCDS32083.1	14																																																																																			TXNDC16	-	NULL	ENSG00000087301		0.378	TXNDC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNDC16	HGNC	protein_coding	OTTHUMT00000411681.1	33	0.00	0	G	XM_051699		52899269	52899269	-1	no_errors	ENST00000281741	ensembl	human	known	69_37n	frame_shift_del	17	26.09	6	DEL	1.000	-
ULK4	54986	genome.wustl.edu	37	3	41942241	41942241	+	Silent	SNP	G	G	A			TCGA-GM-A2DL-01A-11D-A18P-09	TCGA-GM-A2DL-10C-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	05618052-7f63-45dc-9a47-df92fce1bad9	9f1ebbdb-32b6-4e83-80e9-d87433f83958	g.chr3:41942241G>A	ENST00000301831.4	-	13	1725	c.1263C>T	c.(1261-1263)gtC>gtT	p.V421V	U8_ENST00000390843.2_RNA|ULK4_ENST00000420927.1_Silent_p.V421V	NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	421					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		TAATGGGGGTGACAACAAGAT	0.413																																						dbGAP											0													202.0	191.0	195.0					3																	41942241		1890	4119	6009	-	-	-	SO:0001819	synonymous_variant	0			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.1263C>T	3.37:g.41942241G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V421	ENST00000301831.4	37	c.1263	CCDS43071.1	3																																																																																			ULK4	-	NULL	ENSG00000168038		0.413	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	67	0.00	0	G	XM_929989		41942241	41942241	-1	no_errors	ENST00000301831	ensembl	human	known	69_37n	silent	37	37.29	22	SNP	1.000	A
