#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AHNAK	79026	genome.wustl.edu	37	11	62299855	62299855	+	Silent	SNP	T	T	C	rs145348997		TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr11:62299855T>C	ENST00000378024.4	-	5	2308	c.2034A>G	c.(2032-2034)ggA>ggG	p.G678G	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	678					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				CTTTAAGTTTTCCCCCCAGAC	0.473																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.2034A>G	11.37:g.62299855T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.G678	ENST00000378024.4	37	c.2034	CCDS31584.1	11																																																																																			AHNAK	-	NULL	ENSG00000124942		0.473	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	71	0.00	0	T	NM_024060		62299855	62299855	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	silent	11	50.00	11	SNP	0.155	C
AKT1	207	genome.wustl.edu	37	14	105258971	105258971	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:105258971C>G	ENST00000554581.1	-	1	1490	c.10G>C	c.(10-12)Gtg>Ctg	p.V4L	AKT1_ENST00000349310.3_Missense_Mutation_p.V4L|AKT1_ENST00000402615.2_Missense_Mutation_p.V4L|AKT1_ENST00000554848.1_Missense_Mutation_p.V4L|AKT1_ENST00000407796.2_Missense_Mutation_p.V4L|AKT1_ENST00000555528.1_Missense_Mutation_p.V4L			P31749	AKT1_HUMAN	v-akt murine thymoma viral oncogene homolog 1	4					activation-induced cell death of T cells (GO:0006924)|aging (GO:0007568)|anagen (GO:0042640)|apoptotic mitochondrial changes (GO:0008637)|apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell projection organization (GO:0030030)|cell proliferation (GO:0008283)|cellular protein modification process (GO:0006464)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to mechanical stimulus (GO:0071260)|endocrine pancreas development (GO:0031018)|epidermal growth factor receptor signaling pathway (GO:0007173)|execution phase of apoptosis (GO:0097194)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|germ cell development (GO:0007281)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glycogen biosynthetic process (GO:0005978)|glycogen cell differentiation involved in embryonic placenta development (GO:0060709)|hyaluronan metabolic process (GO:0030212)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intracellular signal transduction (GO:0035556)|intrinsic apoptotic signaling pathway (GO:0097193)|labyrinthine layer blood vessel development (GO:0060716)|mammary gland epithelial cell differentiation (GO:0060644)|maternal placenta development (GO:0001893)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron death (GO:1901215)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of proteolysis (GO:0045861)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nitric oxide biosynthetic process (GO:0006809)|nitric oxide metabolic process (GO:0046209)|osteoblast differentiation (GO:0001649)|peptidyl-serine phosphorylation (GO:0018105)|peripheral nervous system myelin maintenance (GO:0032287)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell growth (GO:0030307)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of sodium ion transport (GO:0010765)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vasoconstriction (GO:0045907)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein import into nucleus, translocation (GO:0000060)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle checkpoint (GO:1901976)|regulation of cell migration (GO:0030334)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of neuron projection development (GO:0010975)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of translation (GO:0006417)|response to fluid shear stress (GO:0034405)|response to food (GO:0032094)|response to heat (GO:0009408)|response to UV-A (GO:0070141)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|striated muscle cell differentiation (GO:0051146)|T cell costimulation (GO:0031295)|translation (GO:0006412)	cell-cell junction (GO:0005911)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)	14-3-3 protein binding (GO:0071889)|ATP binding (GO:0005524)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|kinase activity (GO:0016301)|nitric-oxide synthase regulator activity (GO:0030235)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			NS(3)|breast(97)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(7)|lung(10)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|thyroid(10)|urinary_tract(15)	176		all_cancers(154;3.77e-06)|all_lung(585;3.24e-07)|all_epithelial(191;3.45e-05)|all_neural(303;0.0459)|Melanoma(154;0.155)	all cancers(16;0.000486)|OV - Ovarian serous cystadenocarcinoma(23;0.00647)|Epithelial(46;0.0153)|GBM - Glioblastoma multiforme(11;0.116)	all cancers(159;0.0107)|OV - Ovarian serous cystadenocarcinoma(161;0.0132)|Epithelial(152;0.243)	Adenosine triphosphate(DB00171)|Arsenic trioxide(DB01169)	ACAATAGCCACGTCGCTCATG	0.672		1	Mis		"""breast, colorectal, ovarian, NSCLC"""																																	dbGAP		Dom	yes		14	14q32.32	207	v-akt murine thymoma viral oncogene homolog 1		E	0													112.0	96.0	102.0					14																	105258971		2203	4299	6502	-	-	-	SO:0001583	missense	0			M63167	CCDS9994.1	14q32.33	2014-09-17			ENSG00000142208	ENSG00000142208	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	391	protein-coding gene	gene with protein product		164730					Standard	XM_005267401		Approved	RAC, PKB, PRKBA, AKT	uc001ypn.3	P31749	OTTHUMG00000170795	ENST00000554581.1:c.10G>C	14.37:g.105258971C>G	ENSP00000451828:p.Val4Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAM5|B7Z5R1|Q9BWB6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom	p.V4L	ENST00000554581.1	37	c.10	CCDS9994.1	14	.	.	.	.	.	.	.	.	.	.	C	15.32	2.797638	0.50208	.	.	ENSG00000142208	ENST00000554581;ENST00000407796;ENST00000349310;ENST00000402615;ENST00000555528;ENST00000554848;ENST00000555926	T;T;T;T;T;T	0.66815	-0.23;-0.23;-0.23;-0.23;-0.23;-0.23	2.54	2.54	0.30619	Pleckstrin homology-type (1);	0.207009	0.30809	N	0.008838	T	0.45696	0.1355	N	0.12961	0.28	0.50313	D	0.999869	B	0.09022	0.002	B	0.06405	0.002	T	0.37596	-0.9699	10	0.27785	T	0.31	.	11.2156	0.48825	0.0:1.0:0.0:0.0	.	4	P31749	AKT1_HUMAN	L	4	ENSP00000451828:V4L;ENSP00000384293:V4L;ENSP00000270202:V4L;ENSP00000385326:V4L;ENSP00000450688:V4L;ENSP00000451166:V4L	ENSP00000270202:V4L	V	-	1	0	AKT1	104330016	0.041000	0.20044	1.000000	0.80357	0.892000	0.51952	1.111000	0.31159	1.725000	0.51514	0.511000	0.50034	GTG	AKT1	-	NULL	ENSG00000142208		0.672	AKT1-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	AKT1	HGNC	protein_coding	OTTHUMT00000410418.1	74	0.00	0	C	NM_005163		105258971	105258971	-1	no_errors	ENST00000349310	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	G
ALOX5	240	genome.wustl.edu	37	10	45936008	45936008	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr10:45936008G>A	ENST00000374391.2	+	8	1165	c.1112G>A	c.(1111-1113)cGa>cAa	p.R371Q	ALOX5_ENST00000542434.1_Missense_Mutation_p.R371Q	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	371	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)	p.R371Q(1)		breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	CACCTTCTGCGAACACATCTG	0.537																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											110.0	83.0	92.0					10																	45936008		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.1112G>A	10.37:g.45936008G>A	ENSP00000363512:p.Arg371Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C,pfscan_LipOase_LH2	p.R371Q	ENST00000374391.2	37	c.1112	CCDS7212.1	10	.	.	.	.	.	.	.	.	.	.	G	13.84	2.357962	0.41801	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	T;T	0.78126	-1.15;-1.15	5.96	5.96	0.96718	Lipoxygenase, C-terminal (4);	0.252412	0.46145	D	0.000320	T	0.69726	0.3143	M	0.70787	2.145	0.43214	D	0.995087	P;B;B	0.45176	0.852;0.157;0.276	B;B;B	0.29176	0.099;0.031;0.038	T	0.71856	-0.4466	10	0.35671	T	0.21	-26.3567	11.2072	0.48775	0.0827:0.0:0.9173:0.0	.	371;371;371	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	Q	371	ENSP00000437634:R371Q;ENSP00000363512:R371Q	ENSP00000363512:R371Q	R	+	2	0	ALOX5	45256014	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.062000	0.89475	2.833000	0.97629	0.650000	0.86243	CGA	ALOX5	-	pfam_LipOase_C,superfamily_LipOase_C,prints_LipOase_C	ENSG00000012779		0.537	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	HGNC	protein_coding	OTTHUMT00000047780.1	46	0.00	0	G			45936008	45936008	+1	no_errors	ENST00000374391	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	1.000	A
ANK1	286	genome.wustl.edu	37	8	41573206	41573206	+	Silent	SNP	A	A	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr8:41573206A>G	ENST00000347528.4	-	14	1649	c.1566T>C	c.(1564-1566)ctT>ctC	p.L522L	ANK1_ENST00000352337.4_Silent_p.L522L|ANK1_ENST00000379758.2_Silent_p.L522L|ANK1_ENST00000289734.7_Silent_p.L522L|ANK1_ENST00000396945.1_Silent_p.L522L|ANK1_ENST00000396942.1_Silent_p.L522L|ANK1_ENST00000265709.8_Silent_p.L555L	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	522	89 kDa domain.				axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCTTTTCCAGAAGGGCCAGGA	0.622																																						dbGAP											0													85.0	76.0	79.0					8																	41573206		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.1566T>C	8.37:g.41573206A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.L522	ENST00000347528.4	37	c.1566	CCDS6119.1	8																																																																																			ANK1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000029534		0.622	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	109	0.00	0	A	NM_020475		41573206	41573206	-1	no_errors	ENST00000396942	ensembl	human	known	69_37n	silent	64	22.89	19	SNP	0.022	G
AR	367	genome.wustl.edu	37	X	66765158	66765159	+	In_Frame_Ins	INS	-	-	GCA	rs78686797|rs3032358|rs4045402		TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chrX:66765158_66765159insGCA	ENST00000374690.3	+	1	694_695	c.170_171insGCA	c.(169-174)ctgcag>ctGCAgcag	p.80_81insQ	AR_ENST00000396044.3_In_Frame_Ins_p.80_81insQ|AR_ENST00000504326.1_In_Frame_Ins_p.80_81insQ|AR_ENST00000513847.1_3'UTR	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	78	Gln-rich.|Modulating.				androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.L57Q(3)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TTGCTGCTGCTgcagcagcagc	0.668									Androgen Insensitivity Syndrome																													dbGAP											3	Substitution - Missense(3)	lung(1)|endometrium(1)|central_nervous_system(1)																																								-	-	-	SO:0001652	inframe_insertion	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.237_239dupGCA	X.37:g.66765165_66765167dupGCA	ENSP00000363822:p.Gln80_Gln80dup	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUN2|B1AKD7|Q9UD95	In_Frame_Ins	INS	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.61in_frame_insQ	ENST00000374690.3	37	c.170_171	CCDS14387.1	X																																																																																			AR	-	pfam_Andrgn_rcpt	ENSG00000169083		0.668	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	47	0.00	0	-	NM_000044		66765158	66765159	+1	no_errors	ENST00000374690	ensembl	human	known	69_37n	in_frame_ins	28	15.15	5	INS	0.929:0.925	GCA
ATP2B3	492	genome.wustl.edu	37	X	152818568	152818568	+	Silent	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chrX:152818568G>A	ENST00000349466.2	+	12	2225	c.1899G>A	c.(1897-1899)aaG>aaA	p.K633K	ATP2B3_ENST00000393842.1_Silent_p.K619K|ATP2B3_ENST00000359149.3_Silent_p.K633K|ATP2B3_ENST00000263519.4_Silent_p.K633K|ATP2B3_ENST00000370186.1_Silent_p.K619K|ATP2B3_ENST00000370181.2_Silent_p.K619K			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	633					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TGGTGAGGAAGATCATCGAGC	0.617																																						dbGAP											0													73.0	59.0	64.0					X																	152818568		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.1899G>A	X.37:g.152818568G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNR8|B7WNY5|Q12995|Q16858	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.K633	ENST00000349466.2	37	c.1899	CCDS35440.1	X																																																																																			ATP2B3	-	pfam_Dehalogen-like_hydro,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMCA	ENSG00000067842		0.617	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1	46	0.00	0	G	NM_021949		152818568	152818568	+1	no_errors	ENST00000263519	ensembl	human	known	69_37n	silent	29	19.44	7	SNP	1.000	A
AZIN1	51582	genome.wustl.edu	37	8	103842054	103842054	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr8:103842054G>A	ENST00000337198.5	-	10	2178	c.1015C>T	c.(1015-1017)Cac>Tac	p.H339Y	AZIN1_ENST00000347770.4_Missense_Mutation_p.H339Y	NM_148174.2	NP_680479.1	O14977	AZIN1_HUMAN	antizyme inhibitor 1	339					cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein catabolic process (GO:0042177)|polyamine biosynthetic process (GO:0006596)|positive regulation of polyamine transmembrane transport (GO:1902269)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|enzyme inhibitor activity (GO:0004857)|ornithine decarboxylase activator activity (GO:0042978)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	9	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			CTTGCCTTGTGAACCTCTGGA	0.343																																						dbGAP											0													106.0	109.0	108.0					8																	103842054		2203	4300	6503	-	-	-	SO:0001583	missense	0			AAC25391	CCDS6295.1	8p22-q21.3	2005-03-21	2005-03-21	2005-03-21		ENSG00000155096			16432	protein-coding gene	gene with protein product	"""ornithine decarboxylase 1-like"""	607909	"""ornithine decarboxylase antizyme inhibitor"""	OAZIN		9349715, 9110174	Standard	XM_005250969		Approved	OAZI, ODC1L	uc003yky.3	O14977		ENST00000337198.5:c.1015C>T	8.37:g.103842054G>A	ENSP00000337180:p.His339Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCD5|Q6IBQ7|Q96D20	Missense_Mutation	SNP	pfam_De-COase2_N,pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C,prints_Orn_de-COase,prints_Orn/DAP/Arg_de-COase	p.H339Y	ENST00000337198.5	37	c.1015	CCDS6295.1	8	.	.	.	.	.	.	.	.	.	.	G	15.32	2.798610	0.50208	.	.	ENSG00000155096	ENST00000337198;ENST00000347770	T;T	0.41758	0.99;0.99	5.71	5.71	0.89125	Orn/DAP/Arg decarboxylase 2, C-terminal (1);Alanine racemase/group IV decarboxylase, C-terminal (2);	0.126279	0.64402	D	0.000001	T	0.38957	0.1060	L	0.45352	1.415	0.80722	D	1	B	0.24651	0.108	B	0.31614	0.133	T	0.23833	-1.0177	10	0.06236	T	0.91	-7.4811	20.243	0.98386	0.0:0.0:1.0:0.0	.	339	O14977	AZIN1_HUMAN	Y	339	ENSP00000337180:H339Y;ENSP00000321507:H339Y	ENSP00000337180:H339Y	H	-	1	0	AZIN1	103911230	1.000000	0.71417	1.000000	0.80357	0.924000	0.55760	9.765000	0.98953	2.868000	0.98415	0.557000	0.71058	CAC	AZIN1	-	pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C	ENSG00000155096		0.343	AZIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZIN1	HGNC	protein_coding	OTTHUMT00000380133.1	43	0.00	0	G			103842054	103842054	-1	no_errors	ENST00000337198	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	1.000	A
BCL6B	255877	genome.wustl.edu	37	17	6930108	6930108	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr17:6930108G>T	ENST00000293805.5	+	7	1231	c.1139G>T	c.(1138-1140)gGa>gTa	p.G380V		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	380					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						ATCCATTCGGGAGAGAAGCCG	0.572																																						dbGAP											0													52.0	59.0	57.0					17																	6930108		1978	4157	6135	-	-	-	SO:0001583	missense	0			AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.1139G>T	17.37:g.6930108G>T	ENSP00000293805:p.Gly380Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PCB4	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G380V	ENST00000293805.5	37	c.1139	CCDS42248.1	17	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759115	0.89843	.	.	ENSG00000161940	ENST00000293805	T	0.23552	1.9	5.95	5.95	0.96441	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.55893	0.1949	M	0.79693	2.465	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.57877	-0.7735	10	0.87932	D	0	.	17.8727	0.88815	0.0:0.0:1.0:0.0	.	380	Q8N143	BCL6B_HUMAN	V	380	ENSP00000293805:G380V	ENSP00000293805:G380V	G	+	2	0	BCL6B	6870832	1.000000	0.71417	0.996000	0.52242	0.886000	0.51366	6.575000	0.74018	2.826000	0.97356	0.563000	0.77884	GGA	BCL6B	-	pfscan_Znf_C2H2	ENSG00000161940		0.572	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6B	HGNC	protein_coding	OTTHUMT00000439455.2	36	0.00	0	G	NM_181844		6930108	6930108	+1	no_errors	ENST00000293805	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	T
BNIPL	149428	genome.wustl.edu	37	1	151011415	151011415	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr1:151011415G>C	ENST00000368931.3	+	4	502	c.346G>C	c.(346-348)Gat>Cat	p.D116H	BNIPL_ENST00000295294.7_Missense_Mutation_p.D34H	NM_138278.3	NP_612122.2	Q7Z465	BNIPL_HUMAN	BCL2/adenovirus E1B 19kD interacting protein like	116					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|regulation of growth rate (GO:0040009)	cytosol (GO:0005829)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|endometrium(3)|large_intestine(1)|lung(4)|skin(1)	10	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			TTCCTCTCCTGATGGCAGTTC	0.537																																						dbGAP											0													98.0	86.0	90.0					1																	151011415		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF193056	CCDS978.2, CCDS53362.1	1q21.2	2008-02-05			ENSG00000163141	ENSG00000163141			16976	protein-coding gene	gene with protein product		611275				12681488, 11741952	Standard	NM_138278		Approved	BNIPl-1, BNIPL-2, PP753	uc001ewl.2	Q7Z465	OTTHUMG00000035157	ENST00000368931.3:c.346G>C	1.37:g.151011415G>C	ENSP00000357927:p.Asp116His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DK43|Q8TCY7|Q8WYG2	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.D116H	ENST00000368931.3	37	c.346	CCDS978.2	1	.	.	.	.	.	.	.	.	.	.	G	18.20	3.571884	0.65765	.	.	ENSG00000163141	ENST00000368931;ENST00000361277;ENST00000295294;ENST00000392802	T;T;T	0.67698	0.55;0.56;-0.28	4.85	3.94	0.45596	.	0.905260	0.09600	N	0.780343	T	0.61602	0.2360	M	0.76574	2.34	0.30719	N	0.748453	P	0.47484	0.896	P	0.48304	0.573	T	0.59069	-0.7523	10	0.72032	D	0.01	.	8.3568	0.32335	0.1035:0.0:0.8965:0.0	.	116	Q7Z465	BNIPL_HUMAN	H	116;114;34;34	ENSP00000357927:D116H;ENSP00000355333:D114H;ENSP00000295294:D34H	ENSP00000295294:D34H	D	+	1	0	BNIPL	149278039	0.227000	0.23707	0.789000	0.31954	0.974000	0.67602	3.200000	0.51051	2.677000	0.91161	0.563000	0.77884	GAT	BNIPL	-	pfam_Bcl2-/adenovirus-E1B	ENSG00000163141		0.537	BNIPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BNIPL	HGNC	protein_coding	OTTHUMT00000085092.1	87	0.00	0	G	NM_138279		151011415	151011415	+1	no_errors	ENST00000368931	ensembl	human	known	69_37n	missense	71	25.00	24	SNP	0.716	C
BTNL3	10917	genome.wustl.edu	37	5	180429703	180429703	+	Silent	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:180429703G>A	ENST00000342868.6	+	4	889	c.705G>A	c.(703-705)ctG>ctA	p.L235L		NM_197975.2	NP_932079.1	Q6UXE8	BTNL3_HUMAN	butyrophilin-like 3	235						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(1)|lung(10)|prostate(2)|skin(1)	25	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.00336)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_hematologic(541;0.163)|Ovarian(839;0.238)|all_lung(500;0.248)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000272)			CTTGGCGCCTGGCTTCTATTT	0.453																																						dbGAP											0													169.0	138.0	148.0					5																	180429703		1885	3800	5685	-	-	-	SO:0001819	synonymous_variant	0			AB020625	CCDS47358.1	5q35	2014-01-14			ENSG00000168903	ENSG00000168903		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	1143	protein-coding gene	gene with protein product	"""butyrophilin-like receptor"""	606192				10429365	Standard	NM_197975		Approved	BTNLR, BTN9.1	uc003mmr.3	Q6UXE8	OTTHUMG00000162091	ENST00000342868.6:c.705G>A	5.37:g.180429703G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q496L7|Q9Y2C7	Silent	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.L235	ENST00000342868.6	37	c.705	CCDS47358.1	5																																																																																			BTNL3	-	NULL	ENSG00000168903		0.453	BTNL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTNL3	HGNC	protein_coding	OTTHUMT00000367176.2	100	0.00	0	G	NM_197975		180429703	180429703	+1	no_errors	ENST00000342868	ensembl	human	known	69_37n	silent	18	56.10	23	SNP	0.000	A
C14orf142	84520	genome.wustl.edu	37	14	93673347	93673347	+	Silent	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:93673347C>G	ENST00000306954.4	-	1	92	c.36G>C	c.(34-36)ggG>ggC	p.G12G	UBR7_ENST00000013070.6_5'Flank|RP11-371E8.4_ENST00000557048.1_Intron|UBR7_ENST00000416753.1_5'Flank|RP11-371E8.4_ENST00000557574.1_Intron	NM_032490.4	NP_115879.2	Q9BXV9	CN142_HUMAN	chromosome 14 open reading frame 142	12										endometrium(1)|skin(1)	2		all_cancers(154;0.00528)|Acute lymphoblastic leukemia(33;0.0497)|all_epithelial(191;0.125)|all_neural(303;0.13)		Epithelial(152;0.177)|all cancers(159;0.198)|COAD - Colon adenocarcinoma(157;0.203)		TCTGCGGCTTCCCTTCCTGCC	0.652											OREG0022885	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													54.0	58.0	57.0					14																	93673347		1970	4147	6117	-	-	-	SO:0001819	synonymous_variant	0			AF277185	CCDS41981.1	14q32.12	2012-09-25			ENSG00000170270	ENSG00000170270			20356	protein-coding gene	gene with protein product							Standard	NM_032490		Approved		uc001ybl.1	Q9BXV9	OTTHUMG00000171267	ENST00000306954.4:c.36G>C	14.37:g.93673347C>G		Somatic	1299	WXS	Illumina GAIIx	Phase_IV	Q0D2N1|Q0P6C4|Q3B7W5	Missense_Mutation	SNP	NULL	p.E10Q	ENST00000306954.4	37	c.28	CCDS41981.1	14	.	.	.	.	.	.	.	.	.	.	C	6.549	0.469556	0.12461	.	.	ENSG00000170270	ENST00000556566	.	.	.	5.19	4.26	0.50523	.	.	.	.	.	T	0.68705	0.3030	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.66563	-0.5892	4	.	.	.	4.0221	13.9478	0.64096	0.0:0.8489:0.1511:0.0	.	.	.	.	Q	10	.	.	E	-	1	0	C14orf142	92743100	0.964000	0.33143	0.788000	0.31933	0.361000	0.29550	0.597000	0.24059	2.681000	0.91329	0.655000	0.94253	GAA	C14orf142	-	NULL	ENSG00000170270		0.652	C14orf142-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf142	HGNC	protein_coding	OTTHUMT00000412691.1	126	0.00	0	C	NM_032490		93673347	93673347	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000556566	ensembl	human	putative	69_37n	missense	36	12.20	5	SNP	0.956	G
CFAP61	26074	genome.wustl.edu	37	20	20050397	20050397	+	Intron	SNP	G	G	A	rs60455649|rs200183	byFrequency	TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr20:20050397G>A	ENST00000245957.5	+	3	219				C20orf26_ENST00000377309.2_Intron|C20orf26_ENST00000377306.1_Intron|C20orf26_ENST00000451767.2_Intron|C20orf26_ENST00000389656.3_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN												NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		AGATTTTCTCGTTCTTGTCTG	0.393													A|||	3927	0.784145	0.6573	0.8689	5008	,	,		19136	0.9712		0.7366	False		,,,				2504	0.7515					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0																														ENST00000245957.5:c.144-1101G>A	20.37:g.20050397G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	NULL	p.R51H	ENST00000245957.5	37	c.152	CCDS33447.1	20																																																																																			C20orf26	-	NULL	ENSG00000089101		0.393	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	80	0.00	0	G			20050397	20050397	+1	no_errors	ENST00000494029	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.000	A
C5orf34	375444	genome.wustl.edu	37	5	43502579	43502579	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:43502579C>T	ENST00000306862.2	-	6	1422	c.1047G>A	c.(1045-1047)atG>atA	p.M349I	RP11-159F24.3_ENST00000505645.1_RNA	NM_198566.2	NP_940968	Q96MH7	CE034_HUMAN	chromosome 5 open reading frame 34	349										breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)|prostate(1)|stomach(2)	21	Lung NSC(6;2.07e-05)					CTATTGAGTTCATATTTTGAT	0.294																																						dbGAP											0													55.0	61.0	59.0					5																	43502579		2200	4291	6491	-	-	-	SO:0001583	missense	0			AK056925	CCDS3946.1	5p12	2012-02-23			ENSG00000172244	ENSG00000172244			24738	protein-coding gene	gene with protein product						12477932	Standard	XM_006714473		Approved	FLJ32363	uc003jnz.2	Q96MH7	OTTHUMG00000131151	ENST00000306862.2:c.1047G>A	5.37:g.43502579C>T	ENSP00000303490:p.Met349Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.M349I	ENST00000306862.2	37	c.1047	CCDS3946.1	5	.	.	.	.	.	.	.	.	.	.	C	4.175	0.031066	0.08101	.	.	ENSG00000172244	ENST00000306862	T	0.38722	1.12	5.54	-0.78	0.10969	.	1.412840	0.04228	N	0.334701	T	0.26268	0.0641	N	0.19112	0.55	0.09310	N	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.15378	-1.0439	10	0.21540	T	0.41	1.541	6.2314	0.20736	0.0:0.3487:0.1348:0.5165	.	349	Q96MH7	CE034_HUMAN	I	349	ENSP00000303490:M349I	ENSP00000303490:M349I	M	-	3	0	C5orf34	43538336	0.075000	0.21258	0.203000	0.23512	0.641000	0.38312	0.170000	0.16663	0.043000	0.15746	-0.218000	0.12543	ATG	C5orf34	-	NULL	ENSG00000172244		0.294	C5orf34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf34	HGNC	protein_coding	OTTHUMT00000253843.1	79	0.00	0	C	NM_198566		43502579	43502579	-1	no_errors	ENST00000306862	ensembl	human	known	69_37n	missense	50	12.28	7	SNP	0.018	T
CDHR2	54825	genome.wustl.edu	37	5	176008530	176008530	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:176008530G>A	ENST00000510636.1	+	17	2279	c.2005G>A	c.(2005-2007)Gac>Aac	p.D669N	CDHR2_ENST00000261944.5_Missense_Mutation_p.D669N|CDHR2_ENST00000506348.1_Missense_Mutation_p.D669N	NM_001171976.1	NP_001165447.1	Q9BYE9	CDHR2_HUMAN	cadherin-related family member 2	669	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|liver(1)|lung(23)|ovary(3)|prostate(5)|skin(4)|urinary_tract(1)	56						GCTTGTGTCTGACTGCGGCGA	0.642																																						dbGAP											0													51.0	53.0	52.0					5																	176008530		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB047004	CCDS34297.1	5q35.2	2011-07-01	2010-01-25	2010-01-25		ENSG00000074276		"""Cadherins / Cadherin-related"""	18231	protein-coding gene	gene with protein product	"""protocadherin LKC"""		"""protocadherin 24"""	PCDH24		11082270, 12117771	Standard	NM_001171976		Approved	PC-LKC, FLJ20124, FLJ20383, PCLKC	uc003mem.2	Q9BYE9		ENST00000510636.1:c.2005G>A	5.37:g.176008530G>A	ENSP00000424565:p.Asp669Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U4|A6NC80|Q9NXP8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D669N	ENST00000510636.1	37	c.2005	CCDS34297.1	5	.	.	.	.	.	.	.	.	.	.	G	19.61	3.860050	0.71834	.	.	ENSG00000074276	ENST00000510636;ENST00000261944;ENST00000506348	T;T;T	0.65364	-0.15;-0.15;-0.15	5.47	5.47	0.80525	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.85128	0.5626	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88812	0.3292	9	0.87932	D	0	-43.5559	18.9133	0.92494	0.0:0.0:1.0:0.0	.	669	Q9BYE9	CDHR2_HUMAN	N	669	ENSP00000424565:D669N;ENSP00000261944:D669N;ENSP00000421078:D669N	ENSP00000261944:D669N	D	+	1	0	CDHR2	175941136	1.000000	0.71417	0.114000	0.21550	0.152000	0.21847	8.137000	0.89612	2.575000	0.86900	0.549000	0.68633	GAC	CDHR2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000074276		0.642	CDHR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR2	HGNC	protein_coding	OTTHUMT00000372201.1	102	0.00	0	G	NM_017675		176008530	176008530	+1	no_errors	ENST00000261944	ensembl	human	known	69_37n	missense	58	12.12	8	SNP	0.989	A
CDR2	1039	genome.wustl.edu	37	16	22359004	22359004	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr16:22359004C>T	ENST00000268383.2	-	5	954	c.647G>A	c.(646-648)cGg>cAg	p.R216Q		NM_001802.1	NP_001793.1	Q01850	CDR2_HUMAN	cerebellar degeneration-related protein 2, 62kDa	216						cytoplasm (GO:0005737)				endometrium(3)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11				GBM - Glioblastoma multiforme(48;0.0188)		CATAGTCACCCGCTTCTGCCG	0.557																																						dbGAP											0													138.0	136.0	136.0					16																	22359004		2197	4300	6497	-	-	-	SO:0001583	missense	0			M63256	CCDS32404.1	16p13.1-p12	2008-02-05	2002-08-29			ENSG00000140743			1799	protein-coding gene	gene with protein product	"""Yo paraneoplastic antigen"""	117340	"""cerebellar degeneration-related protein (62kD)"""			2014264	Standard	NM_001802		Approved	CDR62, Yo	uc002dkn.3	Q01850		ENST00000268383.2:c.647G>A	16.37:g.22359004C>T	ENSP00000268383:p.Arg216Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8A8|Q13977	Missense_Mutation	SNP	NULL	p.R216Q	ENST00000268383.2	37	c.647	CCDS32404.1	16	.	.	.	.	.	.	.	.	.	.	C	29.3	4.991968	0.93167	.	.	ENSG00000140743	ENST00000268383	T	0.33438	1.41	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.54367	0.1854	M	0.73962	2.25	0.48511	D	0.999661	D	0.76494	0.999	P	0.62649	0.905	T	0.46414	-0.9193	10	0.25751	T	0.34	-34.194	19.5747	0.95438	0.0:1.0:0.0:0.0	.	216	Q01850	CDR2_HUMAN	Q	216	ENSP00000268383:R216Q	ENSP00000268383:R216Q	R	-	2	0	CDR2	22266505	0.735000	0.28153	0.978000	0.43139	0.924000	0.55760	2.055000	0.41345	2.618000	0.88619	0.655000	0.94253	CGG	CDR2	-	NULL	ENSG00000140743		0.557	CDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDR2	HGNC	protein_coding	OTTHUMT00000430081.1	106	0.00	0	C			22359004	22359004	-1	no_errors	ENST00000268383	ensembl	human	known	69_37n	missense	24	40.00	16	SNP	1.000	T
CNKSR3	154043	genome.wustl.edu	37	6	154771286	154771286	+	Silent	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr6:154771286G>A	ENST00000607772.1	-	2	703	c.159C>T	c.(157-159)gtC>gtT	p.V53V	CNKSR3_ENST00000479339.1_5'UTR	NM_173515.2	NP_775786.2	Q6P9H4	CNKR3_HUMAN	CNKSR family member 3	53	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)	cytoplasm (GO:0005737)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(1)|stomach(1)|urinary_tract(1)	15		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;5.03e-11)|BRCA - Breast invasive adenocarcinoma(81;0.00627)		CAATCCGTGTGACCCCCAGCT	0.522																																						dbGAP											0													146.0	133.0	137.0					6																	154771286		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055911	CCDS5246.1	6q25.2	2013-01-10	2005-04-11	2005-04-11	ENSG00000153721	ENSG00000153721		"""Sterile alpha motif (SAM) domain containing"""	23034	protein-coding gene	gene with protein product			"""membrane associated guanylate kinase interacting protein-like 1"""	MAGI1			Standard	NM_173515		Approved	FLJ31349		Q6P9H4	OTTHUMG00000015873	ENST00000607772.1:c.159C>T	6.37:g.154771286G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SGD5|Q96N65	Silent	SNP	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,pfscan_PDZ,pfscan_SAM	p.V53	ENST00000607772.1	37	c.159	CCDS5246.1	6																																																																																			CNKSR3	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	ENSG00000153721		0.522	CNKSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR3	HGNC	protein_coding	OTTHUMT00000042792.2	67	0.00	0	G	NM_173515		154771286	154771286	-1	no_errors	ENST00000367213	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	1.000	A
CTDSPL2	51496	genome.wustl.edu	37	15	44751303	44751303	+	Frame_Shift_Del	DEL	G	G	-			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr15:44751303delG	ENST00000260327.4	+	2	654	c.91delG	c.(91-93)gatfs	p.D32fs	CTDSPL2_ENST00000396780.1_Frame_Shift_Del_p.D32fs|CTDSPL2_ENST00000558373.1_Frame_Shift_Del_p.D32fs|CTDSPL2_ENST00000558966.1_Frame_Shift_Del_p.D32fs	NM_016396.2	NP_057480.2	Q05D32	CTSL2_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2	32							phosphoprotein phosphatase activity (GO:0004721)	p.D31H(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(2)	13		all_cancers(109;4.36e-14)|all_epithelial(112;9.8e-12)|Lung NSC(122;1.66e-07)|all_lung(180;1.47e-06)|Melanoma(134;0.0122)		all cancers(107;1.02e-20)|GBM - Glioblastoma multiforme(94;1.49e-06)|COAD - Colon adenocarcinoma(120;0.0857)|Colorectal(105;0.0905)		TTCAGAGGTTGATGATAGCCT	0.408																																						dbGAP											1	Substitution - Missense(1)	lung(1)											100.0	104.0	103.0					15																	44751303		2198	4298	6496	-	-	-	SO:0001589	frameshift_variant	0			AF161478	CCDS10110.1	15q15.3-q21.1	2010-06-21			ENSG00000137770	ENSG00000137770		"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	26936	protein-coding gene	gene with protein product							Standard	NM_016396		Approved	HSPC129, FLJ10523	uc001ztr.3	Q05D32	OTTHUMG00000131159	ENST00000260327.4:c.91delG	15.37:g.44751303delG	ENSP00000260327:p.Asp32fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZTU1|Q6AI06|Q8IYI9|Q9NVT2|Q9NZX8|Q9P030	Frame_Shift_Del	DEL	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.D31fs	ENST00000260327.4	37	c.91	CCDS10110.1	15																																																																																			CTDSPL2	-	NULL	ENSG00000137770		0.408	CTDSPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL2	HGNC	protein_coding	OTTHUMT00000253851.1	31	0.00	0	G	NM_016396		44751303	44751303	+1	no_errors	ENST00000260327	ensembl	human	known	69_37n	frame_shift_del	4	33.33	2	DEL	1.000	-
CTR9	9646	genome.wustl.edu	37	11	10794775	10794775	+	Silent	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr11:10794775G>A	ENST00000361367.2	+	21	3108	c.2682G>A	c.(2680-2682)gaG>gaA	p.E894E		NM_014633.3	NP_055448.1	Q6PD62	CTR9_HUMAN	CTR9, Paf1/RNA polymerase II complex component	894	Lys-rich.				cellular response to lipopolysaccharide (GO:0071222)|endodermal cell fate commitment (GO:0001711)|histone H2B ubiquitination (GO:0033523)|histone H3-K4 trimethylation (GO:0080182)|histone monoubiquitination (GO:0010390)|interleukin-6-mediated signaling pathway (GO:0070102)|JAK-STAT cascade (GO:0007259)|negative regulation of myeloid cell differentiation (GO:0045638)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K79 methylation (GO:2001162)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	Cdc73/Paf1 complex (GO:0016593)|transcriptionally active chromatin (GO:0035327)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(7)|lung(12)|ovary(2)|pancreas(1)|stomach(1)	40				all cancers(16;1.64e-07)|Epithelial(150;2.47e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		TTACTGGTGAGACTGAAGCAA	0.423																																						dbGAP											0													135.0	137.0	136.0					11																	10794775		2201	4294	6495	-	-	-	SO:0001819	synonymous_variant	0			D63875	CCDS7805.1	11p15.3	2013-07-03	2013-07-03	2006-05-22	ENSG00000198730	ENSG00000198730		"""Tetratricopeptide (TTC) repeat domain containing"""	16850	protein-coding gene	gene with protein product		609366	"""SH2 domain binding protein 1 (tetratricopeptide repeat containing)"", ""Ctr9, Paf1/RNA polymerase II complex component, homolog (S. cerevisiae)"""	SH2BP1		8590280, 8636124	Standard	NM_014633		Approved	KIAA0155, TSBP, p150TSP	uc001mja.3	Q6PD62	OTTHUMG00000165789	ENST00000361367.2:c.2682G>A	11.37:g.10794775G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQV8|Q15015	Silent	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E894	ENST00000361367.2	37	c.2682	CCDS7805.1	11																																																																																			CTR9	-	NULL	ENSG00000198730		0.423	CTR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTR9	HGNC	protein_coding	OTTHUMT00000386215.1	93	0.00	0	G	NM_014633		10794775	10794775	+1	no_errors	ENST00000361367	ensembl	human	known	69_37n	silent	43	20.37	11	SNP	0.797	A
DGKE	8526	genome.wustl.edu	37	17	54912561	54912561	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr17:54912561C>A	ENST00000284061.3	+	2	585	c.405C>A	c.(403-405)tgC>tgA	p.C135*	DGKE_ENST00000572810.1_Nonsense_Mutation_p.C135*|C17orf67_ENST00000487705.1_Intron|C17orf67_ENST00000397861.2_5'Flank|DGKE_ENST00000576869.1_3'UTR|C17orf67_ENST00000575658.1_5'Flank	NM_003647.2	NP_003638.1	P52429	DGKE_HUMAN	diacylglycerol kinase, epsilon 64kDa	135					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|phospholipid biosynthetic process (GO:0008654)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|endometrium(3)|large_intestine(3)|lung(10)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	25	Breast(9;3.59e-07)					TGCCCCTGTGCAGTTACTGTA	0.557																																						dbGAP											0													83.0	71.0	75.0					17																	54912561		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U49379	CCDS11590.1	17q22	2008-07-18	2002-08-29			ENSG00000153933	2.7.1.107		2852	protein-coding gene	gene with protein product		601440	"""diacylglycerol kinase, epsilon (64kD)"""			8626589, 10051413	Standard	NM_003647		Approved	DAGK6, DGK	uc002iur.3	P52429		ENST00000284061.3:c.405C>A	17.37:g.54912561C>A	ENSP00000284061:p.Cys135*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBM4|Q9UKQ3	Nonsense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.C135*	ENST00000284061.3	37	c.405	CCDS11590.1	17	.	.	.	.	.	.	.	.	.	.	C	37	6.264620	0.97426	.	.	ENSG00000153933	ENST00000284061	.	.	.	5.51	5.51	0.81932	.	0.153526	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	.	19.4119	0.94677	0.0:1.0:0.0:0.0	.	.	.	.	X	135	.	ENSP00000284061:C135X	C	+	3	2	DGKE	52267560	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.305000	0.59110	2.575000	0.86900	0.655000	0.94253	TGC	DGKE	-	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000153933		0.557	DGKE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGKE	HGNC	protein_coding	OTTHUMT00000440601.1	62	0.00	0	C	NM_003647		54912561	54912561	+1	no_errors	ENST00000284061	ensembl	human	known	69_37n	nonsense	34	10.53	4	SNP	1.000	A
DIMT1	27292	genome.wustl.edu	37	5	61699154	61699154	+	Silent	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:61699154C>G	ENST00000199320.4	-	2	259	c.99G>C	c.(97-99)ggG>ggC	p.G33G	DIMT1_ENST00000506390.1_Silent_p.G33G|KIF2A_ENST00000509663.2_Intron	NM_014473.2	NP_055288.1	Q9UNQ2	DIM1_HUMAN	DIM1 dimethyladenosine transferase 1 homolog (S. cerevisiae)	33						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	18S rRNA (adenine(1779)-N(6)/adenine(1780)-N(6))-dimethyltransferase activity (GO:0052909)|poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)										GCTGCCCAATCCCCGTGTTGA	0.388																																						dbGAP											0													146.0	140.0	142.0					5																	61699154		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF102147	CCDS3981.1	5q12.1	2011-08-11	2011-08-11	2011-08-11	ENSG00000086189	ENSG00000086189			30217	protein-coding gene	gene with protein product		612499	"""DIM1 dimethyladenosine transferase 1-like (S. cerevisiae)"""	DIMT1L		11124703	Standard	NM_014473		Approved	HSA9761	uc003jta.3	Q9UNQ2	OTTHUMG00000131223	ENST00000199320.4:c.99G>C	5.37:g.61699154C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O76025|Q9BU77|Q9UES1	Silent	SNP	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,tigrfam_rRNA_adenine_dimethylase	p.G33	ENST00000199320.4	37	c.99	CCDS3981.1	5																																																																																			DIMT1	-	pfam_rRNA_Ade_methylase_transferase,tigrfam_rRNA_adenine_dimethylase	ENSG00000086189		0.388	DIMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIMT1	HGNC	protein_coding	OTTHUMT00000253967.1	91	0.00	0	C	NM_014473		61699154	61699154	-1	no_errors	ENST00000199320	ensembl	human	known	69_37n	silent	48	11.11	6	SNP	0.042	G
DNASE1L2	1775	genome.wustl.edu	37	16	2288404	2288404	+	Silent	SNP	C	C	G	rs377410925		TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr16:2288404C>G	ENST00000564065.1	+	6	1886	c.885C>G	c.(883-885)ctC>ctG	p.L295L	RP11-304L19.12_ENST00000564055.1_lincRNA|DNASE1L2_ENST00000567494.1_Silent_p.L295L|DNASE1L2_ENST00000382437.4_Silent_p.L274L|RP11-304L19.11_ENST00000565709.1_RNA|DNASE1L2_ENST00000320700.5_Silent_p.L295L			Q92874	DNSL2_HUMAN	deoxyribonuclease I-like 2	295					corneocyte development (GO:0003335)|DNA metabolic process (GO:0006259)|hair follicle development (GO:0001942)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)			endometrium(1)|prostate(1)|skin(2)	4						AGGTGACCCTCAAGTTCCACC	0.637																																						dbGAP											0													80.0	84.0	82.0					16																	2288404		2019	4170	6189	-	-	-	SO:0001819	synonymous_variant	0			U62647	CCDS42105.1	16p13.3	2008-02-05				ENSG00000167968			2958	protein-coding gene	gene with protein product		602622				9205125, 1577479	Standard	NM_001374		Approved	DNAS1L2	uc002cpp.3	Q92874		ENST00000564065.1:c.885C>G	16.37:g.2288404C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PBY4|Q6JVM2|Q6JVM3	Silent	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I_euk,pirsf_DNase_I_euk,prints_DNase_I_euk	p.L295	ENST00000564065.1	37	c.885	CCDS42105.1	16																																																																																			DNASE1L2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_DNase_I_euk,pirsf_DNase_I_euk	ENSG00000167968		0.637	DNASE1L2-001	KNOWN	basic|CCDS	protein_coding	DNASE1L2	HGNC	protein_coding	OTTHUMT00000435236.1	63	0.00	0	C	NM_001374		2288404	2288404	+1	no_errors	ENST00000320700	ensembl	human	known	69_37n	silent	20	31.03	9	SNP	0.998	G
GNAO1	2775	genome.wustl.edu	37	16	56228093	56228093	+	Intron	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr16:56228093G>A	ENST00000262493.6	+	2	1007				GNAO1_ENST00000569295.1_Intron|CTD-2050B12.2_ENST00000567381.1_RNA|GNAO1_ENST00000262494.7_Intron	NM_020988.2	NP_066268.1	P09471	GNAO_HUMAN	guanine nucleotide binding protein (G protein), alpha activating activity polypeptide O						adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|dopamine receptor signaling pathway (GO:0007212)|forebrain development (GO:0030900)|locomotory behavior (GO:0007626)|muscle contraction (GO:0006936)|negative regulation of calcium ion transport (GO:0051926)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|regulation of heart contraction (GO:0008016)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to morphine (GO:0043278)	heterotrimeric G-protein complex (GO:0005834)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	corticotropin-releasing hormone receptor 1 binding (GO:0051430)|G-protein beta/gamma-subunit complex binding (GO:0031683)|G-protein coupled serotonin receptor binding (GO:0031821)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|mu-type opioid receptor binding (GO:0031852)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(4)|prostate(1)	17		all_neural(199;0.159)				GGCTTTCTTCGCAGAGCCCCC	0.557																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS10756.1, CCDS10757.1	16q13	2008-08-01			ENSG00000087258	ENSG00000087258			4389	protein-coding gene	gene with protein product		139311				1899283, 11395521	Standard	NM_020988		Approved	G-ALPHA-o	uc002eit.4	P09471	OTTHUMG00000133241	ENST00000262493.6:c.161+1565G>A	16.37:g.56228093G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P29777|Q8TD72|Q9UMV4	RNA	SNP	-	NULL	ENST00000262493.6	37	NULL	CCDS10756.1	16																																																																																			CTD-2050B12.2	-	-	ENSG00000261439		0.557	GNAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKFZP434H168	Clone_based_vega_gene	protein_coding	OTTHUMT00000256981.2	56	0.00	0	G	NM_020988		56228093	56228093	-1	no_errors	ENST00000567381	ensembl	human	known	69_37n	rna	15	25.00	5	SNP	0.007	A
EHBP1L1	254102	genome.wustl.edu	37	11	65351789	65351789	+	Silent	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr11:65351789C>T	ENST00000309295.4	+	10	3436	c.3171C>T	c.(3169-3171)gtC>gtT	p.V1057V		NM_001099409.1	NP_001092879.1	Q8N3D4	EH1L1_HUMAN	EH domain binding protein 1-like 1	1057	CH. {ECO:0000255|PROSITE- ProRule:PRU00044}.					membrane (GO:0016020)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23						ACCGTGGCGTCCGCATCACCA	0.622																																						dbGAP											0													76.0	86.0	83.0					11																	65351789		2168	4265	6433	-	-	-	SO:0001819	synonymous_variant	0			AL834433	CCDS44649.1	11q13.1	2008-02-05			ENSG00000173442	ENSG00000173442			30682	protein-coding gene	gene with protein product							Standard	NM_001099409		Approved	DKFZp762C186, TANGERIN	uc001oeo.4	Q8N3D4	OTTHUMG00000166520	ENST00000309295.4:c.3171C>T	11.37:g.65351789C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB89|Q9H7M7	Missense_Mutation	SNP	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.P107S	ENST00000309295.4	37	c.319	CCDS44649.1	11	.	.	.	.	.	.	.	.	.	.	C	9.832	1.188775	0.21954	.	.	ENSG00000173442	ENST00000533465	.	.	.	5.41	1.1	0.20463	.	.	.	.	.	T	0.58836	0.2150	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53258	-0.8464	4	.	.	.	.	10.5637	0.45161	0.0:0.3995:0.5232:0.0772	.	.	.	.	S	107	.	.	P	+	1	0	EHBP1L1	65108365	0.602000	0.26916	0.555000	0.28281	0.926000	0.56050	-0.108000	0.10857	0.239000	0.21243	-0.308000	0.09152	CCG	EHBP1L1	-	pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000173442		0.622	EHBP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHBP1L1	HGNC	protein_coding	OTTHUMT00000390145.1	38	0.00	0	C	XM_170658		65351789	65351789	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000533465	ensembl	human	putative	69_37n	missense	11	35.29	6	SNP	0.989	T
ENTPD5	957	genome.wustl.edu	37	14	74440662	74440662	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:74440662G>C	ENST00000334696.6	-	12	1123	c.804C>G	c.(802-804)ttC>ttG	p.F268L	ENTPD5_ENST00000557325.1_Missense_Mutation_p.F268L	NM_001249.2	NP_001240.1	O75356	ENTP5_HUMAN	ectonucleoside triphosphate diphosphohydrolase 5	268					'de novo' posttranslational protein folding (GO:0051084)|ATP metabolic process (GO:0046034)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|positive regulation of glycolytic process (GO:0045821)|protein N-linked glycosylation (GO:0006487)|regulation of phosphatidylinositol 3-kinase signaling (GO:0014066)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)	guanosine-diphosphatase activity (GO:0004382)|uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	10				BRCA - Breast invasive adenocarcinoma(234;0.00394)		AGGCACTCCGGAAAGTGTGCC	0.498																																						dbGAP											0													104.0	90.0	95.0					14																	74440662		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039918	CCDS9825.1	14q24	2003-10-03	2003-10-03			ENSG00000187097			3367	protein-coding gene	gene with protein product		603162	"""proto-oncogene CPH"""	CD39L4, PCPH		9271669, 9676430	Standard	NM_001249		Approved	NTPDase-5	uc010tuo.2	O75356		ENST00000334696.6:c.804C>G	14.37:g.74440662G>C	ENSP00000335246:p.Phe268Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4C5|Q96RX0	Missense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.F268L	ENST00000334696.6	37	c.804	CCDS9825.1	14	.	.	.	.	.	.	.	.	.	.	G	10.86	1.468370	0.26335	.	.	ENSG00000187097	ENST00000557325;ENST00000334696	T;T	0.06528	3.29;3.29	5.41	1.3	0.21679	.	0.000000	0.85682	D	0.000000	T	0.04407	0.0121	N	0.01168	-0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.996	T	0.43653	-0.9378	10	0.02654	T	1	-12.9912	8.9673	0.35885	0.3058:0.0:0.6942:0.0	.	268;268	O75356;G3V4I0	ENTP5_HUMAN;.	L	268	ENSP00000451810:F268L;ENSP00000335246:F268L	ENSP00000335246:F268L	F	-	3	2	ENTPD5	73510415	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	1.612000	0.36889	0.060000	0.16281	0.557000	0.71058	TTC	ENTPD5	-	pfam_GDA1_CD39_NTPase	ENSG00000187097		0.498	ENTPD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD5	HGNC	protein_coding	OTTHUMT00000412637.1	39	0.00	0	G	NM_001249		74440662	74440662	-1	no_errors	ENST00000334696	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	C
ERAP2	64167	genome.wustl.edu	37	5	96237327	96237327	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:96237327G>C	ENST00000437043.3	+	11	2401	c.1690G>C	c.(1690-1692)Gag>Cag	p.E564Q	ERAP2_ENST00000379904.4_Missense_Mutation_p.E519Q|CTD-2260A17.2_ENST00000501338.1_Intron|ERAP2_ENST00000515095.1_3'UTR	NM_001130140.1|NM_022350.3	NP_001123612.1|NP_071745.1	Q6P179	ERAP2_HUMAN	endoplasmic reticulum aminopeptidase 2	564					antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|regulation of blood pressure (GO:0008217)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	24		all_cancers(142;0.000311)|all_epithelial(76;1.54e-06)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0596)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0703)		ACTGCAACAGGAGCGCTTCCT	0.522																																						dbGAP											0													60.0	61.0	60.0					5																	96237327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF191545	CCDS4086.1	5q15	2007-11-21			ENSG00000164308	ENSG00000164308			29499	protein-coding gene	gene with protein product	"""leukocyte-derived arginine aminopeptidase"""	609497				12799365, 15908954	Standard	NM_022350		Approved	L-RAP, LRAP	uc003kmt.3	Q6P179	OTTHUMG00000128718	ENST00000437043.3:c.1690G>C	5.37:g.96237327G>C	ENSP00000400376:p.Glu564Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5K1|Q8TD32|Q8WVJ4|Q9HBX2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.E564Q	ENST00000437043.3	37	c.1690	CCDS4086.1	5	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672083	0.88348	.	.	ENSG00000164308	ENST00000437043;ENST00000510373;ENST00000379904	T;T;T	0.01947	4.91;4.54;4.91	4.53	4.53	0.55603	.	0.310811	0.29040	N	0.013326	T	0.05318	0.0141	L	0.48362	1.52	0.80722	D	1	P;B	0.41345	0.746;0.427	P;B	0.47915	0.561;0.342	T	0.53401	-0.8444	10	0.35671	T	0.21	.	16.3968	0.83610	0.0:0.0:1.0:0.0	.	519;564	Q6P179-3;Q6P179	.;ERAP2_HUMAN	Q	564;564;519	ENSP00000400376:E564Q;ENSP00000421175:E564Q;ENSP00000369235:E519Q	ENSP00000369235:E519Q	E	+	1	0	ERAP2	96263083	1.000000	0.71417	0.604000	0.28916	0.832000	0.47134	6.468000	0.73551	2.200000	0.70718	0.551000	0.68910	GAG	ERAP2	-	NULL	ENSG00000164308		0.522	ERAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP2	HGNC	protein_coding	OTTHUMT00000250623.2	52	0.00	0	G	NM_022350		96237327	96237327	+1	no_errors	ENST00000437043	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	C
EXOC3L4	91828	genome.wustl.edu	37	14	103566715	103566715	+	Silent	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:103566715G>A	ENST00000380069.3	+	1	235	c.159G>A	c.(157-159)ctG>ctA	p.L53L	RP11-736N17.8_ENST00000559843.1_RNA	NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	53					exocytosis (GO:0006887)	exocyst (GO:0000145)				cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						TGGGCTCCCTGAGGCAGGCCT	0.657																																						dbGAP											0													19.0	21.0	21.0					14																	103566715		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.159G>A	14.37:g.103566715G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CR2	Silent	SNP	pfam_Sec6	p.L53	ENST00000380069.3	37	c.159	CCDS32163.1	14																																																																																			EXOC3L4	-	NULL	ENSG00000205436		0.657	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L4	HGNC	protein_coding	OTTHUMT00000415663.1	80	0.00	0	G	XM_941093		103566715	103566715	+1	no_errors	ENST00000380069	ensembl	human	known	69_37n	silent	25	24.24	8	SNP	0.000	A
FABP12	646486	genome.wustl.edu	37	8	82437317	82437317	+	Silent	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr8:82437317G>A	ENST00000360464.4	-	4	449	c.387C>T	c.(385-387)taC>taT	p.Y129Y	RP11-257P3.3_ENST00000523380.1_RNA|RP11-257P3.3_ENST00000518637.1_RNA	NM_001105281.1	NP_001098751.1	A6NFH5	FBP12_HUMAN	fatty acid binding protein 12	129	Fatty acid binding. {ECO:0000250}.						lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.Y129Y(1)		large_intestine(1)|lung(3)	4						ATACTTTCTCGTATGTTCGTG	0.318																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											90.0	82.0	84.0					8																	82437317		1848	4097	5945	-	-	-	SO:0001819	synonymous_variant	0				CCDS47882.1	8q21.13	2013-03-01			ENSG00000197416	ENSG00000197416		"""Fatty acid binding protein family"""	34524	protein-coding gene	gene with protein product						18786628	Standard	NM_001105281		Approved		uc011lfp.2	A6NFH5	OTTHUMG00000164679	ENST00000360464.4:c.387C>T	8.37:g.82437317G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7SUN0	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.Y129	ENST00000360464.4	37	c.387	CCDS47882.1	8																																																																																			FABP12	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	ENSG00000197416		0.318	FABP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FABP12	HGNC	protein_coding	OTTHUMT00000379720.1	78	0.00	0	G	NM_001105281		82437317	82437317	-1	no_errors	ENST00000360464	ensembl	human	known	69_37n	silent	36	28.00	14	SNP	0.915	A
FAM120A	23196	genome.wustl.edu	37	9	96214476	96214476	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr9:96214476C>A	ENST00000277165.6	+	1	473	c.279C>A	c.(277-279)ttC>ttA	p.F93L	FAM120A_ENST00000333936.5_Missense_Mutation_p.F93L|FAM120AOS_ENST00000479094.1_5'Flank|FAM120A_ENST00000375389.3_Missense_Mutation_p.F93L|FAM120A_ENST00000340893.4_Missense_Mutation_p.F93L|FAM120AOS_ENST00000375412.5_Silent_p.T172T|FAM120AOS_ENST00000423591.1_5'Flank	NM_014612.3	NP_055427.2	Q9NZB2	F120A_HUMAN	family with sequence similarity 120A	93						cytoplasm (GO:0005737)|membrane (GO:0016020)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			endometrium(5)|kidney(3)|large_intestine(8)|lung(12)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						TCGAGCTCTTCGTCTTCTTCA	0.657																																						dbGAP											0													16.0	18.0	18.0					9																	96214476		2189	4277	6466	-	-	-	SO:0001583	missense	0			AF214737	CCDS6706.1, CCDS75859.1	9q22.31	2013-03-08	2006-07-04	2006-07-04	ENSG00000048828	ENSG00000048828			13247	protein-coding gene	gene with protein product	"""DNA polymerase-transactivated protein 1"", ""oxidative stess-associated Src activator"""	612265	"""chromosome 9 open reading frame 10"""	C9orf10		14585507	Standard	NM_001286722		Approved	KIAA0183, DNAPTP1, OSSA	uc004atw.3	Q9NZB2	OTTHUMG00000020252	ENST00000277165.6:c.279C>A	9.37:g.96214476C>A	ENSP00000277165:p.Phe93Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGU0|C4AMC6|O60649|Q14688|Q4VXF4|Q4VXF5|Q4VXG2|Q86V69|Q96I21|Q9NZB1	Missense_Mutation	SNP	NULL	p.F93L	ENST00000277165.6	37	c.279	CCDS6706.1	9	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425183	0.43020	.	.	ENSG00000048828	ENST00000375389;ENST00000277165;ENST00000333936;ENST00000340893	T;T;T;T	0.40225	1.04;1.04;1.04;1.04	3.78	0.751	0.18392	.	0.133400	0.32343	U	0.006231	T	0.25232	0.0613	.	.	.	0.39975	D	0.974844	B;B	0.09022	0.001;0.002	B;B	0.10450	0.002;0.005	T	0.06643	-1.0815	9	0.24483	T	0.36	-2.8914	6.7827	0.23654	0.0:0.6854:0.1441:0.1705	.	93;93	Q9NZB2;Q9NZB2-2	F120A_HUMAN;.	L	93	ENSP00000364538:F93L;ENSP00000277165:F93L;ENSP00000334918:F93L;ENSP00000344698:F93L	ENSP00000277165:F93L	F	+	3	2	FAM120A	95254297	1.000000	0.71417	0.998000	0.56505	0.969000	0.65631	1.105000	0.31086	-0.072000	0.12864	-1.020000	0.02445	TTC	FAM120A	-	NULL	ENSG00000048828		0.657	FAM120A-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM120A	HGNC	protein_coding	OTTHUMT00000053160.2	19	0.00	0	C	NM_014612		96214476	96214476	+1	no_errors	ENST00000333936	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	1.000	A
FAM188A	80013	genome.wustl.edu	37	10	15879305	15879305	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr10:15879305G>C	ENST00000277632.3	-	6	694	c.474C>G	c.(472-474)ttC>ttG	p.F158L	FAM188A_ENST00000477891.1_5'UTR	NM_024948.2	NP_079224.1	Q9H8M7	F188A_HUMAN	family with sequence similarity 188, member A	158					apoptotic process (GO:0006915)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	22						GTAAACTTCTGAACGATCTTT	0.294																																					Pancreas(159;946 1953 2111 4475 22008)	dbGAP											0													119.0	123.0	122.0					10																	15879305		2203	4297	6500	-	-	-	SO:0001583	missense	0			AK023459	CCDS7110.1	10p13	2009-07-14	2009-07-14	2009-07-14	ENSG00000148481	ENSG00000148481			23578	protein-coding gene	gene with protein product	"""caspase recruitment domain containing pro-apoptotic protein"", ""CARD-containing protein"""	611649	"""chromosome 10 open reading frame 97"""	C10orf97		12054670, 17652099	Standard	XM_005252600		Approved	FLJ13397, CARP, my042, DERP5	uc001iod.1	Q9H8M7	OTTHUMG00000017734	ENST00000277632.3:c.474C>G	10.37:g.15879305G>C	ENSP00000277632:p.Phe158Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZ68|Q5SZ69|Q5SZ70|Q6IA40|Q6P7P0|Q7Z2S1|Q8WUF1|Q9H3I4	Missense_Mutation	SNP	NULL	p.F158L	ENST00000277632.3	37	c.474	CCDS7110.1	10	.	.	.	.	.	.	.	.	.	.	G	14.71	2.617317	0.46736	.	.	ENSG00000148481	ENST00000277632;ENST00000436829	T;T	0.29142	1.58;1.58	5.82	3.92	0.45320	.	0.137967	0.64402	D	0.000002	T	0.20414	0.0491	N	0.21617	0.685	0.80722	D	1	B	0.09022	0.002	B	0.14578	0.011	T	0.03630	-1.1018	10	0.26408	T	0.33	-15.6108	11.7029	0.51581	0.1475:0.0:0.8525:0.0	.	158	Q9H8M7	F188A_HUMAN	L	158;11	ENSP00000277632:F158L;ENSP00000389883:F11L	ENSP00000277632:F158L	F	-	3	2	FAM188A	15919311	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	2.909000	0.48758	0.751000	0.32900	0.591000	0.81541	TTC	FAM188A	-	NULL	ENSG00000148481		0.294	FAM188A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM188A	HGNC	protein_coding	OTTHUMT00000046990.2	25	0.00	0	G	NM_024948		15879305	15879305	-1	no_errors	ENST00000277632	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	1.000	C
SUPT20H	55578	genome.wustl.edu	37	13	37621496	37621496	+	Intron	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr13:37621496C>T	ENST00000350612.6	-	5	386				SUPT20H_ENST00000542180.1_Intron|SUPT20H_ENST00000464744.1_Intron|SUPT20H_ENST00000470359.2_5'UTR|SUPT20H_ENST00000356185.3_Intron|SUPT20H_ENST00000360252.4_Intron|SUPT20H_ENST00000475892.1_Intron	NM_001014286.2	NP_001014308.2	Q8NEM7	SP20H_HUMAN	suppressor of Ty 20 homolog (S. cerevisiae)						autophagy (GO:0006914)|chromatin organization (GO:0006325)|gastrulation (GO:0007369)	SAGA complex (GO:0000124)|SAGA-type complex (GO:0070461)	transcription cofactor activity (GO:0003712)										AGCAGGTGATCTCTGCCTGGT	0.408																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF093250	CCDS9362.1, CCDS31959.1, CCDS61311.1	13q13	2012-11-29	2012-11-29	2012-11-29	ENSG00000102710	ENSG00000102710			20596	protein-coding gene	gene with protein product	"""p38 interacting protein"", ""transcription factor (p38 interacting protein)"""	613417	"""chromosome 13 open reading frame 19"", ""family with sequence similarity 48, member A"""	C13orf19, FAM48A		12070015 , 16685401	Standard	NM_001278480		Approved	SPT20, bA421P11.4, P38IP	uc001uwg.3	Q8NEM7	OTTHUMG00000016747	ENST00000350612.6:c.165+175G>A	13.37:g.37621496C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7ER46|Q71RF3|Q9Y6A6	RNA	SNP	-	NULL	ENST00000350612.6	37	NULL	CCDS31959.1	13																																																																																			FAM48A	-	-	ENSG00000102710		0.408	SUPT20H-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM48A	HGNC	protein_coding	OTTHUMT00000354766.1	15	0.00	0	C	NM_017569		37621496	37621496	-1	no_errors	ENST00000470359	ensembl	human	known	69_37n	rna	21	16.00	4	SNP	0.000	T
FANCG	2189	genome.wustl.edu	37	9	35077299	35077299	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr9:35077299A>G	ENST00000378643.3	-	5	1099	c.608T>C	c.(607-609)tTg>tCg	p.L203S	FANCG_ENST00000476212.1_5'Flank	NM_004629.1	NP_004620.1	O15287	FANCG_HUMAN	Fanconi anemia, complementation group G	203					cell cycle checkpoint (GO:0000075)|DNA repair (GO:0006281)|mitochondrion organization (GO:0007005)|ovarian follicle development (GO:0001541)|response to radiation (GO:0009314)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	damaged DNA binding (GO:0003684)			NS(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(3)|stomach(1)	28			LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)			GACATCCTTCAATCCCTGGGC	0.517			"""Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks																														dbGAP	yes	Rec		Fanconi anaemia G	9	9p13	2189	"""Fanconi anemia, complementation group G"""		L	0													149.0	147.0	148.0					9																	35077299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007669	CCDS6574.1	9p13	2014-09-17			ENSG00000221829	ENSG00000221829		"""Fanconi anemia, complementation groups"""	3588	protein-coding gene	gene with protein product	"""DNA repair protein XRCC9"", ""X-ray repair, complementing defective, in Chinese hamster, 9"", ""X-ray repair complementing defective repair in Chinese hamster cells 9"""	602956		XRCC9		9256465, 9382107	Standard	NM_004629		Approved	FAG	uc003zwb.1	O15287	OTTHUMG00000019850	ENST00000378643.3:c.608T>C	9.37:g.35077299A>G	ENSP00000367910:p.Leu203Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_Sig_transdc_His_kin_Hpt_dom,smart_TPR_repeat	p.L203S	ENST00000378643.3	37	c.608	CCDS6574.1	9	.	.	.	.	.	.	.	.	.	.	A	18.62	3.663243	0.67700	.	.	ENSG00000221829	ENST00000378643;ENST00000543657;ENST00000448890	T;D	0.87179	-0.49;-2.22	5.88	5.88	0.94601	.	.	.	.	.	D	0.92420	0.7594	M	0.71581	2.175	0.42167	D	0.99162	D	0.89917	1.0	D	0.83275	0.996	D	0.93202	0.6592	9	0.87932	D	0	-7.2959	12.6927	0.56985	1.0:0.0:0.0:0.0	.	203	O15287	FANCG_HUMAN	S	203	ENSP00000367910:L203S;ENSP00000409607:L203S	ENSP00000367910:L203S	L	-	2	0	FANCG	35067299	0.666000	0.27475	0.782000	0.31804	0.987000	0.75469	4.582000	0.60957	2.246000	0.74042	0.533000	0.62120	TTG	FANCG	-	NULL	ENSG00000221829		0.517	FANCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCG	HGNC	protein_coding	OTTHUMT00000052269.1	64	0.00	0	A	NM_004629		35077299	35077299	-1	no_errors	ENST00000378643	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	0.854	G
SPATA31D5P	347127	genome.wustl.edu	37	9	84533024	84533024	+	RNA	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr9:84533024G>A	ENST00000527857.1	+	0	3046					NR_026851.1				SPATA31 subfamily D, member 5, pseudogene																		AGGGGACCCTGAGAAGACAAT	0.468																																						dbGAP											0																																										-	-	-			0					9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000240632	ENSG00000240632			38602	pseudogene	pseudogene			"""family with sequence similarity 75, member D5"", ""family with sequence similarity 75, member D5, pseudogene"""	FAM75D5			Standard	NR_026851		Approved	FLJ43950, FAM75D5P	uc011lst.2		OTTHUMG00000020087		9.37:g.84533024G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000527857.1	37	NULL		9																																																																																			FAM75D5	-	-	ENSG00000240632		0.468	SPATA31D5P-002	KNOWN	basic	processed_transcript	FAM75D5	HGNC	pseudogene	OTTHUMT00000052810.2	128	0.00	0	G	NR_026851		84533024	84533024	+1	no_errors	ENST00000527857	ensembl	human	known	69_37n	rna	59	19.18	14	SNP	0.000	A
FXR2	9513	genome.wustl.edu	37	17	7496081	7496081	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr17:7496081C>T	ENST00000250113.7	-	14	1994	c.1660G>A	c.(1660-1662)Gat>Aat	p.D554N	FXR2_ENST00000573057.1_5'Flank|MPDU1_ENST00000423172.2_3'UTR|SOX15_ENST00000570788.1_5'Flank|SOX15_ENST00000538513.2_5'Flank|SOX15_ENST00000250055.2_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	554						cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CTGTCTTCATCAGTGCGGCGG	0.627																																						dbGAP											0													25.0	26.0	25.0					17																	7496081		1933	4124	6057	-	-	-	SO:0001583	missense	0			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1660G>A	17.37:g.7496081C>T	ENSP00000250113:p.Asp554Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,smart_KH_dom,pfscan_KH_dom_type_1	p.D554N	ENST00000250113.7	37	c.1660	CCDS45604.1	17	.	.	.	.	.	.	.	.	.	.	C	32	5.163162	0.94727	.	.	ENSG00000129245	ENST00000250113	T	0.53857	0.6	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	T	0.68146	0.2969	L	0.49126	1.545	0.80722	D	1	D	0.63880	0.993	D	0.74674	0.984	T	0.68838	-0.5303	10	0.72032	D	0.01	-0.3514	17.3985	0.87453	0.0:1.0:0.0:0.0	.	554	P51116	FXR2_HUMAN	N	554	ENSP00000250113:D554N	ENSP00000250113:D554N	D	-	1	0	FXR2	7436806	1.000000	0.71417	0.972000	0.41901	0.996000	0.88848	7.360000	0.79487	2.785000	0.95823	0.655000	0.94253	GAT	FXR2	-	NULL	ENSG00000129245		0.627	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	HGNC	protein_coding	OTTHUMT00000441084.1	51	0.00	0	C			7496081	7496081	-1	no_errors	ENST00000250113	ensembl	human	known	69_37n	missense	15	37.50	9	SNP	1.000	T
GOLGA8B	440270	genome.wustl.edu	37	15	34820136	34820136	+	Silent	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr15:34820136G>A	ENST00000342314.5	-	15	1693	c.1596C>T	c.(1594-1596)gcC>gcT	p.A532A	GOLGA8B_ENST00000438958.2_Silent_p.A562A|GOLGA8B_ENST00000267731.7_Silent_p.A532A|MIR1233-2_ENST00000408138.1_RNA|GOLGA8A_ENST00000543376.1_Intron	NM_001023567.4	NP_001018861.3	A8MQT2	GOG8B_HUMAN	golgin A8 family, member B	532	Golgi-targeting domain.					Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(1)	1		all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		CATGCTTGTCGGCAGCCCCGA	0.687																																						dbGAP											0													2.0	2.0	2.0					15																	34820136		914	2717	3631	-	-	-	SO:0001819	synonymous_variant	0			AF164622	CCDS45211.1	15q14	2011-10-25	2010-02-12		ENSG00000215252	ENSG00000215252			31973	protein-coding gene	gene with protein product		609619	"""golgi autoantigen, golgin subfamily a, 8B"""				Standard	NM_001023567		Approved		uc001ziq.3	A8MQT2	OTTHUMG00000129549	ENST00000342314.5:c.1596C>T	15.37:g.34820136G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLZ2|O94937|Q2M3S9|Q9NZG8|Q9NZW0|Q9NZW3	Silent	SNP	NULL	p.A562	ENST00000342314.5	37	c.1686	CCDS45211.1	15																																																																																			GOLGA8B	-	NULL	ENSG00000215252		0.687	GOLGA8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA8B	HGNC	protein_coding	OTTHUMT00000251739.2	110	0.00	0	G	NM_001023567		34820136	34820136	-1	no_errors	ENST00000438958	ensembl	human	known	69_37n	silent	36	14.29	6	SNP	0.006	A
GRID2	2895	genome.wustl.edu	37	4	94137898	94137898	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr4:94137898G>A	ENST00000282020.4	+	6	1057	c.799G>A	c.(799-801)Gat>Aat	p.D267N	GRID2_ENST00000510992.1_Missense_Mutation_p.D172N|GRID2_ENST00000505687.1_3'UTR	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	267					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		GGAAATAAACGATGTGGACGT	0.378																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.799G>A	4.37:g.94137898G>A	ENSP00000282020:p.Asp267Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.D267N	ENST00000282020.4	37	c.799	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	G	20.4	3.990711	0.74589	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.83163	-1.69;-1.69	4.86	4.86	0.63082	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88081	0.6341	L	0.46157	1.445	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.989	D	0.87255	0.2275	10	0.39692	T	0.17	.	17.3313	0.87265	0.0:0.0:1.0:0.0	.	172;267	E9PH24;O43424	.;GRID2_HUMAN	N	267;172	ENSP00000282020:D267N;ENSP00000421257:D172N	ENSP00000282020:D267N	D	+	1	0	GRID2	94356921	1.000000	0.71417	0.998000	0.56505	0.965000	0.64279	9.254000	0.95512	2.413000	0.81919	0.591000	0.81541	GAT	GRID2	-	pfam_ANF_lig-bd_rcpt	ENSG00000152208		0.378	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	90	0.00	0	G			94137898	94137898	+1	no_errors	ENST00000282020	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	1.000	A
GRIK4	2900	genome.wustl.edu	37	11	120776145	120776145	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr11:120776145delC	ENST00000527524.2	+	13	1706	c.1419delC	c.(1417-1419)tacfs	p.Y473fs	GRIK4_ENST00000438375.2_Frame_Shift_Del_p.Y473fs	NM_001282470.1	NP_001269399.1	Q16099	GRIK4_HUMAN	glutamate receptor, ionotropic, kainate 4	473					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|response to corticosteroid (GO:0031960)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|nucleus (GO:0005634)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(20)|liver(1)|lung(29)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	69		Breast(109;0.000868)|Medulloblastoma(222;0.0453)|all_neural(223;0.116)|all_hematologic(192;0.21)		BRCA - Breast invasive adenocarcinoma(274;1.24e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.116)		ATGGCGTGTACGGCGTTCCCG	0.607																																						dbGAP											0													137.0	134.0	135.0					11																	120776145		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			S67803	CCDS8433.1	11q23.3	2012-08-29			ENSG00000149403	ENSG00000149403		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4582	protein-coding gene	gene with protein product		600282		GRIK			Standard	NM_001282470		Approved	GluK4, KA1	uc009zax.1	Q16099	OTTHUMG00000048255	ENST00000527524.2:c.1419delC	11.37:g.120776145delC	ENSP00000435648:p.Tyr473fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9L1	Frame_Shift_Del	DEL	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Y473fs	ENST00000527524.2	37	c.1419	CCDS8433.1	11																																																																																			GRIK4	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	ENSG00000149403		0.607	GRIK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK4	HGNC	protein_coding	OTTHUMT00000109760.4	48	0.00	0	C	NM_014619		120776145	120776145	+1	no_errors	ENST00000527524	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	0.153	-
MROH2A	339766	genome.wustl.edu	37	2	234703154	234703154	+	Splice_Site	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr2:234703154C>T	ENST00000389758.3	+	8	1132		c.e8+2					A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A																		GTCACGCAGGCGAGTGGCCAG	0.622																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.966+2C>T	2.37:g.234703154C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e7+2	ENST00000389758.3	37	c.966+2		2	.	.	.	.	.	.	.	.	.	.	C	3.348	-0.133209	0.06711	.	.	ENSG00000185038	ENST00000389758	.	.	.	4.85	2.38	0.29361	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0797	0.25223	0.0:0.2662:0.0:0.7338	.	.	.	.	.	-1	.	.	.	+	.	.	HEATR7B1	234367893	0.986000	0.35501	0.775000	0.31657	0.002000	0.02628	1.401000	0.34589	-0.001000	0.14495	-1.134000	0.01955	.	HEATR7B1	-	-	ENSG00000185038		0.622	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	58	0	0	C	XM_291007	Intron	234703154	234703154	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	splice_site	12	45.45	10	SNP	0.957	T
MROH2A	339766	genome.wustl.edu	37	2	234703154	234703154	+	Splice_Site	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr2:234703154C>T	ENST00000389758.3	+	8	1132		c.e8+2					A6NES4	MRO2A_HUMAN	maestro heat-like repeat family member 2A																		GTCACGCAGGCGAGTGGCCAG	0.622																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS74674.1	2q37.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000185038	ENSG00000185038		"""maestro heat-like repeat containing"""	27936	protein-coding gene	gene with protein product			"""HEAT repeat containing 7B1"""	HEATR7B1		12477932	Standard	NM_001287395		Approved			A6NES4	OTTHUMG00000059037	ENST00000389758.3:c.966+2C>T	2.37:g.234703154C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e7+2	ENST00000389758.3	37	c.966+2		2	.	.	.	.	.	.	.	.	.	.	C	3.348	-0.133209	0.06711	.	.	ENSG00000185038	ENST00000389758	.	.	.	4.85	2.38	0.29361	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.0797	0.25223	0.0:0.2662:0.0:0.7338	.	.	.	.	.	-1	.	.	.	+	.	.	HEATR7B1	234367893	0.986000	0.35501	0.775000	0.31657	0.002000	0.02628	1.401000	0.34589	-0.001000	0.14495	-1.134000	0.01955	.	HEATR7B1	-	-	ENSG00000185038		0.622	MROH2A-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	HEATR7B1	HGNC	protein_coding	OTTHUMT00000130646.6	58	0.00	0	C	XM_291007	Intron	234703154	234703154	+1	no_errors	ENST00000389758	ensembl	human	novel	69_37n	splice_site	12	45.45	10	SNP	0.957	T
HIST1H2BN	8341	genome.wustl.edu	37	6	27806549	27806549	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr6:27806549G>A	ENST00000396980.3	+	1	110	c.110G>A	c.(109-111)aGc>aAc	p.S37N	HIST1H2AK_ENST00000330180.2_5'Flank|HIST1H2BN_ENST00000606613.1_Missense_Mutation_p.S37N	NM_003520.3	NP_003511.1	Q99877	H2B1N_HUMAN	histone cluster 1, H2bn	37					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(3)|lung(3)|prostate(1)	8						CGCAAGGAGAGCTACTCCGTG	0.577																																						dbGAP											0													205.0	187.0	193.0					6																	27806549		2203	4297	6500	-	-	-	SO:0001583	missense	0			Z83336	CCDS4633.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000233822	ENSG00000233822		"""Histones / Replication-dependent"""	4749	protein-coding gene	gene with protein product		602801	"""H2B histone family, member D"", ""histone 1, H2bn"""	H2BFD		9439656, 12408966	Standard	NM_003520		Approved	H2B/d	uc003njv.3	Q99877	OTTHUMG00000016397	ENST00000396980.3:c.110G>A	6.37:g.27806549G>A	ENSP00000380177:p.Ser37Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5L4|Q494S8|Q96FB7	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.S37N	ENST00000396980.3	37	c.110	CCDS4633.1	6	.	.	.	.	.	.	.	.	.	.	.	16.24	3.066032	0.55539	.	.	ENSG00000233822	ENST00000449538;ENST00000396980	T;T	0.68903	-0.36;-0.36	4.53	4.53	0.55603	Histone-fold (2);Histone core (1);	0.000000	0.36101	U	0.002798	T	0.61825	0.2378	M	0.84156	2.68	0.36744	D	0.882377	B;B	0.21147	0.001;0.052	B;B	0.23275	0.007;0.045	T	0.68458	-0.5403	10	0.59425	D	0.04	.	17.142	0.86756	0.0:0.0:1.0:0.0	.	37;37	Q99877;B2R4S9	H2B1N_HUMAN;.	N	37	ENSP00000446031:S37N;ENSP00000380177:S37N	ENSP00000380177:S37N	S	+	2	0	HIST1H2BN	27914528	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.294000	0.96088	2.432000	0.82394	0.655000	0.94253	AGC	HIST1H2BN	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2B	ENSG00000233822		0.577	HIST1H2BN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BN	HGNC	protein_coding	OTTHUMT00000043840.2	148	0.00	0	G	NM_003520		27806549	27806549	+1	no_errors	ENST00000396980	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	1.000	A
HMHA1	23526	genome.wustl.edu	37	19	1084313	1084313	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr19:1084313C>T	ENST00000313093.2	+	22	3263	c.3032C>T	c.(3031-3033)cCg>cTg	p.P1011L	HMHA1_ENST00000543365.1_Missense_Mutation_p.P894L|HMHA1_ENST00000591169.1_3'UTR|HMHA1_ENST00000590214.1_Missense_Mutation_p.P1038L|HMHA1_ENST00000586866.1_Missense_Mutation_p.P1015L|HMHA1_ENST00000590577.1_Missense_Mutation_p.P646L|HMHA1_ENST00000536472.1_Missense_Mutation_p.P879L|HMHA1_ENST00000539243.2_Missense_Mutation_p.P1027L	NM_012292.3	NP_036424.2	Q92619	HMHA1_HUMAN	histocompatibility (minor) HA-1	1011					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(7)|ovary(1)|prostate(2)	16		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.04e-05)|all_lung(49;1.53e-05)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTGGTCTACCCGCTGCAGGAG	0.677																																						dbGAP											0													48.0	51.0	50.0					19																	1084313		2203	4295	6498	-	-	-	SO:0001583	missense	0			D86976	CCDS32863.1, CCDS58637.1, CCDS74242.1, CCDS74243.1	19p13.3	2011-09-07				ENSG00000180448		"""Rho GTPase activating proteins"""	17102	protein-coding gene	gene with protein product		601155				9820596, 9039502	Standard	NM_012292		Approved	KIAA0223, HA-1, ARHGAP45	uc010xgd.2	Q92619		ENST00000313093.2:c.3032C>T	19.37:g.1084313C>T	ENSP00000316772:p.Pro1011Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTS4|F6QP70|Q6P189|Q7LE26|Q86WS1|Q8HX84|Q9GJN9|Q9GJP0|Q9GJP1|Q9MY24	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_FCH,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.P1011L	ENST00000313093.2	37	c.3032	CCDS32863.1	19	.	.	.	.	.	.	.	.	.	.	C	11.82	1.753142	0.31046	.	.	ENSG00000180448	ENST00000539243;ENST00000313093;ENST00000536472;ENST00000412039;ENST00000543365	T;T;T;T	0.21734	2.03;2.04;2.03;1.99	3.85	2.78	0.32641	.	0.256528	0.31257	U	0.007965	T	0.13970	0.0338	L	0.50333	1.59	0.09310	N	0.999999	B;B;B;P;B;B	0.34955	0.03;0.012;0.007;0.477;0.012;0.007	B;B;B;B;B;B	0.23018	0.004;0.003;0.001;0.043;0.003;0.001	T	0.14227	-1.0480	10	0.27082	T	0.32	-17.8498	7.8597	0.29504	0.0:0.8716:0.0:0.1284	.	879;1027;893;646;894;1011	F5H4A3;F6QP70;B3KXW7;B3KVA9;F5H1R4;Q92619	.;.;.;.;.;HMHA1_HUMAN	L	1027;1011;879;1005;894	ENSP00000439601:P1027L;ENSP00000316772:P1011L;ENSP00000445109:P879L;ENSP00000438979:P894L	ENSP00000316772:P1011L	P	+	2	0	HMHA1	1035313	0.000000	0.05858	0.005000	0.12908	0.039000	0.13416	0.503000	0.22610	1.871000	0.54225	0.561000	0.74099	CCG	HMHA1	-	NULL	ENSG00000180448		0.677	HMHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HMHA1	HGNC	protein_coding	OTTHUMT00000458026.1	132	0.00	0	C			1084313	1084313	+1	no_errors	ENST00000313093	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	0.005	T
IGHV1-3	28473	genome.wustl.edu	37	14	106471404	106471404	+	RNA	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:106471404C>G	ENST00000390595.2	-	0	234									immunoglobulin heavy variable 1-3																		CCCATCCACTCAAGCCTTTGT	0.552																																						dbGAP											0													136.0	128.0	131.0					14																	106471404		1939	4122	6061	-	-	-			0			X62109		14q32.33	2012-02-08			ENSG00000211935	ENSG00000211935		"""Immunoglobulins / IGH locus"""	5552	other	immunoglobulin gene							Standard	NG_001019		Approved	VI-3B			OTTHUMG00000152323		14.37:g.106471404C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.E65Q	ENST00000390595.2	37	c.193		14																																																																																			IGHV1-3	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211935		0.552	IGHV1-3-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV1-3	HGNC	IG_V_gene	OTTHUMT00000325885.1	148	0.00	0	C	NG_001019		106471404	106471404	-1	no_stop_codon	ENST00000390595	ensembl	human	known	69_37n	missense	59	13.24	9	SNP	1.000	G
IQGAP2	10788	genome.wustl.edu	37	5	75896731	75896731	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:75896731C>T	ENST00000274364.6	+	11	1463	c.1166C>T	c.(1165-1167)tCt>tTt	p.S389F	IQGAP2_ENST00000379730.3_5'UTR	NM_006633.2	NP_006624	Q13576	IQGA2_HUMAN	IQ motif containing GTPase activating protein 2	389					negative regulation of catalytic activity (GO:0043086)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microvillus (GO:0005902)	actin binding (GO:0003779)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Ras GTPase activator activity (GO:0005099)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(15)|lung(23)|ovary(6)|prostate(1)|skin(3)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	68		all_lung(232;0.000514)|Lung NSC(167;0.00135)|Prostate(461;0.00838)|Ovarian(174;0.0149)		all cancers(79;1.38e-36)		GATCTTGTGTCTGTGCAGAAT	0.448																																						dbGAP											0													134.0	120.0	124.0					5																	75896731		2203	4300	6503	-	-	-	SO:0001583	missense	0			U51903	CCDS34188.1, CCDS68897.1, CCDS68898.1, CCDS75262.1	5q	2008-07-18			ENSG00000145703	ENSG00000145703			6111	protein-coding gene	gene with protein product		605401				8756646	Standard	XM_005248409		Approved		uc003kek.3	Q13576	OTTHUMG00000162432	ENST00000274364.6:c.1166C>T	5.37:g.75896731C>T	ENSP00000274364:p.Ser389Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V1|B7Z8A4|J3KR91	Missense_Mutation	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.S389F	ENST00000274364.6	37	c.1166	CCDS34188.1	5	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301415	0.40694	.	.	ENSG00000145703	ENST00000274364;ENST00000514350;ENST00000505766	T;T;T	0.07021	3.23;3.23;3.23	5.31	4.42	0.53409	.	0.319926	0.32868	N	0.005554	T	0.08891	0.0220	L	0.50333	1.59	0.27268	N	0.958447	B	0.15930	0.015	B	0.17098	0.017	T	0.08066	-1.0740	10	0.56958	D	0.05	-5.5453	7.9108	0.29789	0.1512:0.7231:0.0:0.1256	.	389	Q13576	IQGA2_HUMAN	F	389;362;339	ENSP00000274364:S389F;ENSP00000423672:S362F;ENSP00000421097:S339F	ENSP00000274364:S389F	S	+	2	0	IQGAP2	75932487	0.996000	0.38824	0.994000	0.49952	0.986000	0.74619	2.114000	0.41911	2.654000	0.90174	0.563000	0.77884	TCT	IQGAP2	-	NULL	ENSG00000145703		0.448	IQGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP2	HGNC	protein_coding	OTTHUMT00000368877.1	84	0.00	0	C	NM_006633		75896731	75896731	+1	no_errors	ENST00000274364	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	0.212	T
IQSEC2	23096	genome.wustl.edu	37	X	53280197	53280197	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chrX:53280197delC	ENST00000375368.5	-	4	1731	c.1531delG	c.(1531-1533)gatfs	p.D512fs	IQSEC2_ENST00000396435.3_Frame_Shift_Del_p.D522fs|IQSEC2_ENST00000375365.2_Frame_Shift_Del_p.D317fs			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	512					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						ACTGTGTCATCCAGGTAGAGG	0.632																																						dbGAP											0													91.0	95.0	94.0					X																	53280197		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.1531delG	X.37:g.53280197delC	ENSP00000364517:p.Asp512fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	Frame_Shift_Del	DEL	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.D521fs	ENST00000375368.5	37	c.1561		X																																																																																			IQSEC2	-	NULL	ENSG00000124313		0.632	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		25	0.00	0	C	XM_291345		53280197	53280197	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	frame_shift_del	6	25.00	2	DEL	1.000	-
ITPKB	3707	genome.wustl.edu	37	1	226924884	226924885	+	In_Frame_Ins	INS	-	-	CCA	rs147889095	byFrequency	TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr1:226924884_226924885insCCA	ENST00000272117.3	-	1	274_275	c.275_276insTGG	c.(274-276)agc>agTGGc	p.92_93insG	ITPKB_ENST00000429204.1_In_Frame_Ins_p.92_93insG|ITPKB_ENST00000366784.1_In_Frame_Ins_p.92_93insG			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	92					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				tactgccgctgctgccgctgcc	0.752																																					Colon(84;110 1851 5306 33547)	dbGAP											0										569,2567		147,275,1146						0.9	1.0		dbSNP_120	5	1387,5285		295,797,2244	no	coding	ITPKB	NM_002221.3		442,1072,3390	A1A1,A1R,RR		20.7884,18.1441,19.9429				1956,7852				-	-	-	SO:0001652	inframe_insertion	0			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.275_276insTGG	1.37:g.226924884_226924885insCCA	ENSP00000272117:p.Ser92_Ser93insGly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	In_Frame_Ins	INS	pfam_IPK	p.93in_frame_insG	ENST00000272117.3	37	c.276_275	CCDS1555.1	1																																																																																			ITPKB	-	NULL	ENSG00000143772		0.752	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	11	0.00	0	-	NM_002221		226924884	226924885	-1	no_errors	ENST00000272117	ensembl	human	known	69_37n	in_frame_ins	5	37.50	3	INS	0.091:0.097	CCA
JMJD1C	221037	genome.wustl.edu	37	10	64975356	64975356	+	Nonsense_Mutation	SNP	G	G	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr10:64975356G>T	ENST00000399262.2	-	6	997	c.779C>A	c.(778-780)tCa>tAa	p.S260*	JMJD1C_ENST00000542921.1_Nonsense_Mutation_p.S78*|JMJD1C_ENST00000399251.1_Nonsense_Mutation_p.S41*|JMJD1C_ENST00000489372.2_5'UTR|JMJD1C_ENST00000402544.1_Nonsense_Mutation_p.S41*	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	260					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					CCTGCGTCGTGATGTAATGCC	0.373																																						dbGAP											0													94.0	85.0	88.0					10																	64975356		1891	4122	6013	-	-	-	SO:0001587	stop_gained	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.779C>A	10.37:g.64975356G>T	ENSP00000382204:p.Ser260*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Nonsense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.S260*	ENST00000399262.2	37	c.779	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	G	44	10.946561	0.99493	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	.	.	.	5.28	5.28	0.74379	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.0925	18.9044	0.92454	0.0:0.0:1.0:0.0	.	.	.	.	X	260;41;41;78	.	ENSP00000382195:S41X	S	-	2	0	JMJD1C	64645362	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.869000	0.99810	2.473000	0.83533	0.655000	0.94253	TCA	JMJD1C	-	NULL	ENSG00000171988		0.373	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	51	0.00	0	G	NM_004241		64975356	64975356	-1	no_errors	ENST00000399262	ensembl	human	known	69_37n	nonsense	33	10.53	4	SNP	1.000	T
KCND1	3750	genome.wustl.edu	37	X	48826174	48826174	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chrX:48826174G>A	ENST00000218176.3	-	1	1802	c.505C>T	c.(505-507)Cgg>Tgg	p.R169W	KCND1_ENST00000376477.1_5'Flank	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	169					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	AGCCGCTGCCGCAGGGAGCTG	0.652																																						dbGAP											0													9.0	10.0	10.0					X																	48826174		2141	4147	6288	-	-	-	SO:0001583	missense	0			AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.505C>T	X.37:g.48826174G>A	ENSP00000218176:p.Arg169Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEF1|B2RCG0|O75671	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.R169W	ENST00000218176.3	37	c.505	CCDS14314.1	X	.	.	.	.	.	.	.	.	.	.	G	13.25	2.181757	0.38511	.	.	ENSG00000102057	ENST00000218176	D	0.97138	-4.26	4.93	2.03	0.26663	.	0.063747	0.64402	D	0.000019	D	0.97340	0.9130	M	0.90650	3.135	0.58432	D	0.999999	D	0.55605	0.972	P	0.48141	0.568	D	0.96055	0.9034	10	0.87932	D	0	.	12.1073	0.53820	0.0:0.0:0.5527:0.4473	.	169	Q9NSA2	KCND1_HUMAN	W	169	ENSP00000218176:R169W	ENSP00000218176:R169W	R	-	1	2	KCND1	48711118	0.823000	0.29233	0.384000	0.26145	0.424000	0.31475	0.318000	0.19504	0.094000	0.17404	0.600000	0.82982	CGG	KCND1	-	prints_K_chnl_volt-dep_Kv4	ENSG00000102057		0.652	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND1	HGNC	protein_coding	OTTHUMT00000060774.1	36	0.00	0	G	NM_004979		48826174	48826174	-1	no_errors	ENST00000218176	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	0.939	A
KLHL14	57565	genome.wustl.edu	37	18	30314187	30314187	+	Intron	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr18:30314187G>A	ENST00000359358.4	-	3	1508				KLHL14_ENST00000358095.4_Missense_Mutation_p.S364L	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14							endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						ctgcttccctgaaatggggtg	0.423																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.1069+7703C>T	18.37:g.30314187G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S364L	ENST00000359358.4	37	c.1091	CCDS32813.1	18	.	.	.	.	.	.	.	.	.	.	G	9.452	1.090732	0.20471	.	.	ENSG00000197705	ENST00000358095	T	0.76448	-1.02	2.22	-3.22	0.05125	.	.	.	.	.	T	0.68146	0.2969	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.59757	-0.7394	6	0.48119	T	0.1	.	4.4025	0.11393	0.5575:0.1912:0.2513:0.0	.	.	.	.	L	364	ENSP00000350808:S364L	ENSP00000350808:S364L	S	-	2	0	KLHL14	28568185	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.446000	0.06837	-1.058000	0.03197	-0.136000	0.14681	TCA	KLHL14	-	NULL	ENSG00000197705		0.423	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	105	0.00	0	G			30314187	30314187	-1	no_errors	ENST00000358095	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.000	A
KRT23	25984	genome.wustl.edu	37	17	39092673	39092673	+	Silent	SNP	A	A	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr17:39092673A>T	ENST00000209718.3	-	2	607	c.183T>A	c.(181-183)tcT>tcA	p.S61S	AC004231.2_ENST00000418393.1_RNA|KRT23_ENST00000582283.1_5'Flank|KRT23_ENST00000436344.3_Intron	NM_015515.3	NP_056330.3	Q9C075	K1C23_HUMAN	keratin 23 (histone deacetylase inducible)	61	Head.					intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21		Breast(137;0.000301)|Ovarian(249;0.15)				TGCTTCTTCCAGAACCCCAAG	0.667																																						dbGAP											0													64.0	68.0	67.0					17																	39092673		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF102848	CCDS11380.1, CCDS62182.1	17q21.2	2013-01-16			ENSG00000108244	ENSG00000108244		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6438	protein-coding gene	gene with protein product		606194				11135429, 16831889	Standard	NM_015515		Approved	K23, DKFZP434G032, HAIK1, CK23, MGC26158	uc002hvm.1	Q9C075	OTTHUMG00000133376	ENST00000209718.3:c.183T>A	17.37:g.39092673A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K084|B7Z7J2|I3L3Q6|Q9NUR6	Silent	SNP	pfam_F,prints_Keratin_I	p.S61	ENST00000209718.3	37	c.183	CCDS11380.1	17																																																																																			KRT23	-	NULL	ENSG00000108244		0.667	KRT23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT23	HGNC	protein_coding	OTTHUMT00000257223.1	81	0.00	0	A			39092673	39092673	-1	no_errors	ENST00000209718	ensembl	human	known	69_37n	silent	27	37.21	16	SNP	0.000	T
KRT19	3880	genome.wustl.edu	37	17	39680234	39680234	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr17:39680234C>G	ENST00000361566.3	-	6	1024	c.964G>C	c.(964-966)Gac>Cac	p.D322H	KRT15_ENST00000254043.3_5'Flank|KRT15_ENST00000393974.3_5'Flank|KRT15_ENST00000393976.2_5'Flank	NM_002276.4	NP_002267.2	P08727	K1C19_HUMAN	keratin 19	322	Coil 2.|Necessary for interaction with PNN.|Rod.				cell differentiation involved in embryonic placenta development (GO:0060706)|response to estrogen (GO:0043627)|sarcomere organization (GO:0045214)|viral process (GO:0016032)	cell periphery (GO:0071944)|costamere (GO:0043034)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|sarcolemma (GO:0042383)|Z disc (GO:0030018)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)	12		Breast(137;0.00038)				GCCAGTGTGTCTTCCAAGGCA	0.627																																						dbGAP											0													37.0	39.0	38.0					17																	39680234		2201	4291	6492	-	-	-	SO:0001583	missense	0				CCDS11399.1	17q21.2	2013-06-20			ENSG00000171345	ENSG00000171345		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6436	protein-coding gene	gene with protein product	"""keratin, type I cytoskeletal 19"", ""keratin, type I, 40-kd"", ""cytokeratin 19"", ""40-kDa keratin intermediate filament"""	148020				16831889	Standard	NM_002276		Approved	K19, CK19, K1CS, MGC15366		P08727	OTTHUMG00000133422	ENST00000361566.3:c.964G>C	17.37:g.39680234C>G	ENSP00000355124:p.Asp322His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R874|Q5XG83|Q6NW33|Q7L5M9|Q96A53|Q96FV1|Q9BYF9|Q9P1Y4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.D322H	ENST00000361566.3	37	c.964	CCDS11399.1	17	.	.	.	.	.	.	.	.	.	.	C	12.08	1.831489	0.32329	.	.	ENSG00000171345	ENST00000361566	D	0.89123	-2.47	5.17	2.1	0.27182	Filament (1);	0.425407	0.20100	N	0.099248	T	0.81664	0.4870	N	0.17838	0.53	0.24140	N	0.995731	B;P	0.42556	0.108;0.783	B;P	0.46419	0.139;0.516	T	0.72981	-0.4126	10	0.62326	D	0.03	.	5.4148	0.16368	0.1527:0.5763:0.0:0.271	.	485;322	B4DE59;P08727	.;K1C19_HUMAN	H	322	ENSP00000355124:D322H	ENSP00000355124:D322H	D	-	1	0	KRT19	36933760	0.000000	0.05858	1.000000	0.80357	0.088000	0.18126	-0.816000	0.04477	1.192000	0.43071	-0.264000	0.10439	GAC	KRT19	-	pfam_F	ENSG00000171345		0.627	KRT19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT19	HGNC	protein_coding	OTTHUMT00000257285.1	39	0.00	0	C	NM_002276		39680234	39680234	-1	no_errors	ENST00000361566	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.995	G
L3MBTL4	91133	genome.wustl.edu	37	18	6241437	6241437	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr18:6241437C>G	ENST00000284898.6	-	8	672	c.472G>C	c.(472-474)Gat>Cat	p.D158H	L3MBTL4_ENST00000400104.3_Missense_Mutation_p.D158H|L3MBTL4_ENST00000400105.2_Missense_Mutation_p.D158H|L3MBTL4_ENST00000535782.1_5'Flank|L3MBTL4_ENST00000317931.7_Missense_Mutation_p.D158H	NM_173464.3	NP_775735.2	Q8NA19	LMBL4_HUMAN	l(3)mbt-like 4 (Drosophila)	158					chromatin modification (GO:0016568)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(17)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		Colorectal(10;0.0249)				ACAAATTTATCTTTTCTATAA	0.323																																					Esophageal Squamous(41;748 902 17366 28959 43175)	dbGAP											0													65.0	75.0	71.0					18																	6241437		2201	4294	6495	-	-	-	SO:0001583	missense	0			BC039316	CCDS11839.2	18p11.31-p11.23	2013-01-10			ENSG00000154655	ENSG00000154655		"""Sterile alpha motif (SAM) domain containing"""	26677	protein-coding gene	gene with protein product						14702039	Standard	NM_173464		Approved	FLJ35936, HsT1031	uc010dkt.3	Q8NA19	OTTHUMG00000131573	ENST00000284898.6:c.472G>C	18.37:g.6241437C>G	ENSP00000284898:p.Asp158His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTL8|Q8IXS3	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_Znf_C2HC,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.D158H	ENST00000284898.6	37	c.472	CCDS11839.2	18	.	.	.	.	.	.	.	.	.	.	C	18.28	3.590111	0.66105	.	.	ENSG00000154655	ENST00000400105;ENST00000317931;ENST00000284898;ENST00000400104	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.45	5.45	0.79879	.	0.320649	0.26106	N	0.026310	T	0.44329	0.1288	L	0.29908	0.895	0.80722	D	1	D	0.76494	0.999	D	0.70227	0.968	T	0.33240	-0.9876	10	0.54805	T	0.06	.	16.7746	0.85548	0.0:1.0:0.0:0.0	.	158	Q8NA19	LMBL4_HUMAN	H	158	ENSP00000382976:D158H;ENSP00000318543:D158H;ENSP00000284898:D158H;ENSP00000382975:D158H	ENSP00000284898:D158H	D	-	1	0	L3MBTL4	6231437	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	4.464000	0.60134	2.565000	0.86533	0.460000	0.39030	GAT	L3MBTL4	-	pfam_Mbt	ENSG00000154655		0.323	L3MBTL4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL4	HGNC	protein_coding	OTTHUMT00000254448.2	68	0.00	0	C	NM_173464		6241437	6241437	-1	no_errors	ENST00000284898	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	G
LAIR2	3904	genome.wustl.edu	37	19	55019380	55019380	+	Silent	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr19:55019380C>T	ENST00000301202.2	+	3	467	c.345C>T	c.(343-345)ttC>ttT	p.F115F	LAIR2_ENST00000351841.2_Silent_p.F115F	NM_002288.4	NP_002279.2	Q6ISS4	LAIR2_HUMAN	leukocyte-associated immunoglobulin-like receptor 2	115	Ig-like C2-type.		F -> Y (in dbSNP:rs34429135).			extracellular region (GO:0005576)				central_nervous_system(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)	18	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0967)		ACAGTGACTTCCTGGAGCTGC	0.577																																						dbGAP											0													88.0	92.0	91.0					19																	55019380		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF013250	CCDS12897.1, CCDS12898.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167618	ENSG00000167618		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6478	protein-coding gene	gene with protein product		602993	"""leukocyte-associated Ig-like receptor 2"""			9285412	Standard	XM_005277264		Approved	CD306	uc002qgc.3	Q6ISS4	OTTHUMG00000065697	ENST00000301202.2:c.345C>T	19.37:g.55019380C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PEZ4	Silent	SNP	smart_Ig_sub	p.F115	ENST00000301202.2	37	c.345	CCDS12897.1	19																																																																																			LAIR2	-	smart_Ig_sub	ENSG00000167618		0.577	LAIR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR2	HGNC	protein_coding	OTTHUMT00000140801.1	64	0.00	0	C			55019380	55019380	+1	no_errors	ENST00000301202	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.004	T
LYST	1130	genome.wustl.edu	37	1	235872550	235872550	+	Silent	SNP	A	A	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr1:235872550A>C	ENST00000389794.3	-	44	10158	c.9984T>G	c.(9982-9984)ccT>ccG	p.P3328P	LYST_ENST00000389793.2_Silent_p.P3328P|LYST_ENST00000473037.1_5'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	3328	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			TACGCGCCCAAGGGGGAAGGT	0.453																																						dbGAP											0													79.0	76.0	77.0					1																	235872550		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.9984T>G	1.37:g.235872550A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P3328	ENST00000389794.3	37	c.9984	CCDS31062.1	1																																																																																			LYST	-	pfam_BEACH_dom,superfamily_BEACH_dom,superfamily_ARM-type_fold,pfscan_BEACH_dom	ENSG00000143669		0.453	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	34	0.00	0	A			235872550	235872550	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	silent	12	40.00	8	SNP	0.002	C
MIER3	166968	genome.wustl.edu	37	5	56231261	56231261	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:56231261C>G	ENST00000381199.3	-	7	599	c.589G>C	c.(589-591)Gag>Cag	p.E197Q	MIER3_ENST00000381226.3_Missense_Mutation_p.E202Q|MIER3_ENST00000409421.1_Missense_Mutation_p.E134Q|MIER3_ENST00000381213.3_Missense_Mutation_p.E197Q			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	197	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		TTACCTTTCTCATTACCATCG	0.338																																						dbGAP											0													120.0	119.0	119.0					5																	56231261		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.589G>C	5.37:g.56231261C>G	ENSP00000370596:p.Glu197Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Missense_Mutation	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.E197Q	ENST00000381199.3	37	c.589		5	.	.	.	.	.	.	.	.	.	.	C	24.3	4.521779	0.85600	.	.	ENSG00000155545	ENST00000381226;ENST00000381213;ENST00000381199;ENST00000409421	T;T;T;T	0.25749	1.78;1.78;1.78;1.78	6.11	6.11	0.99139	ELM2 domain (2);	0.128206	0.52532	D	0.000078	T	0.38719	0.1051	M	0.70595	2.14	0.58432	D	0.999994	B;P;P	0.41848	0.284;0.763;0.523	B;B;B	0.42771	0.365;0.361;0.397	T	0.08680	-1.0710	10	0.48119	T	0.1	-14.9389	20.7342	0.99715	0.0:1.0:0.0:0.0	.	197;202;197	Q7Z3K6;Q7Z3K6-2;Q7Z3K6-3	MIER3_HUMAN;.;.	Q	202;197;197;134	ENSP00000370624:E202Q;ENSP00000370611:E197Q;ENSP00000370596:E197Q;ENSP00000386584:E134Q	ENSP00000370596:E197Q	E	-	1	0	MIER3	56267018	1.000000	0.71417	0.999000	0.59377	0.857000	0.48899	7.336000	0.79245	2.906000	0.99361	0.655000	0.94253	GAG	MIER3	-	pfam_ELM2_dom,pfscan_ELM2_dom	ENSG00000155545		0.338	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	MIER3	HGNC	protein_coding	OTTHUMT00000132523.2	32	0.00	0	C	NM_152622		56231261	56231261	-1	no_errors	ENST00000381199	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	G
MRPS18B	28973	genome.wustl.edu	37	6	30587369	30587369	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr6:30587369G>A	ENST00000259873.4	+	2	335	c.178G>A	c.(178-180)Gaa>Aaa	p.E60K	PPP1R10_ENST00000484449.1_5'Flank|MRPS18B_ENST00000506373.2_Missense_Mutation_p.E60K|PPP1R10_ENST00000376511.2_5'Flank|MRPS18B_ENST00000472229.1_3'UTR	NM_014046.3	NP_054765.1	Q9Y676	RT18B_HUMAN	mitochondrial ribosomal protein S18B	60					translation (GO:0006412)	cell junction (GO:0030054)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	structural constituent of ribosome (GO:0003735)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(2)|prostate(1)|skin(2)	13						GAAATATCTGGAATCAGAAGG	0.483																																						dbGAP											0													62.0	74.0	70.0					6																	30587369		1508	2709	4217	-	-	-	SO:0001583	missense	0			AF100761	CCDS4682.1	6p21	2012-09-13			ENSG00000204568	ENSG00000204568		"""Mitochondrial ribosomal proteins / small subunits"""	14516	protein-coding gene	gene with protein product		611982				11279123	Standard	NM_014046		Approved	MRPS18-2, PTD017, C6orf14, HSPC183	uc003nqo.2	Q9Y676	OTTHUMG00000031268	ENST00000259873.4:c.178G>A	6.37:g.30587369G>A	ENSP00000259873:p.Glu60Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ0|Q659G4|Q9BS27	Missense_Mutation	SNP	pfam_Ribosomal_S18,superfamily_Ribosomal_S18	p.E60K	ENST00000259873.4	37	c.178	CCDS4682.1	6	.	.	.	.	.	.	.	.	.	.	G	13.17	2.157752	0.38119	.	.	ENSG00000204568	ENST00000259873;ENST00000506373;ENST00000376508	T	0.45668	0.89	6.04	6.04	0.98038	.	0.520682	0.21461	N	0.074174	T	0.14743	0.0356	N	0.16790	0.44	0.37174	D	0.903171	P;P;P	0.39480	0.675;0.675;0.546	B;B;B	0.36666	0.23;0.23;0.115	T	0.05257	-1.0896	10	0.10636	T	0.68	.	17.5116	0.87761	0.0:0.0:1.0:0.0	.	60;60;60	B4DFG6;Q5STN0;Q9Y676	.;.;RT18B_HUMAN	K	60	ENSP00000259873:E60K	ENSP00000259873:E60K	E	+	1	0	MRPS18B	30695348	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	6.905000	0.75714	2.873000	0.98535	0.563000	0.77884	GAA	MRPS18B	-	NULL	ENSG00000204568		0.483	MRPS18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS18B	HGNC	protein_coding	OTTHUMT00000076584.2	28	0.00	0	G			30587369	30587369	+1	no_errors	ENST00000259873	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	1.000	A
MTBP	27085	genome.wustl.edu	37	8	121468841	121468843	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr8:121468841_121468843delAGA	ENST00000305949.1	+	7	723_725	c.678_680delAGA	c.(676-681)ttagaa>tta	p.E227del		NM_022045.4	NP_071328.2	Q96DY7	MTBP_HUMAN	MDM2 binding protein	227					cell cycle arrest (GO:0007050)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cell proliferation (GO:0008285)|protein localization to kinetochore (GO:0034501)|traversing start control point of mitotic cell cycle (GO:0007089)	chromatin (GO:0000785)|kinetochore (GO:0000776)				NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	30	Lung NSC(37;5.68e-08)|Ovarian(258;0.00769)|all_neural(195;0.0804)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00503)			TTGTATCTTTAGAAGATCTCAGA	0.32																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS6333.1	8q24.1-q24.2	2014-03-03	2014-03-03		ENSG00000172167	ENSG00000172167			7417	protein-coding gene	gene with protein product		605927	"""MDM2 (mouse double minute 2)-binding protein, 104kD"", ""Mdm2, transformed 3T3 cell double minute 2, p53 binding protein (mouse) binding protein, 104kDa"""			10906133, 11060448	Standard	NM_022045		Approved		uc003ypc.2	Q96DY7	OTTHUMG00000165040	ENST00000305949.1:c.678_680delAGA	8.37:g.121468844_121468846delAGA	ENSP00000303398:p.Glu227del	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUR5|Q9HA89	In_Frame_Del	DEL	NULL	p.E227in_frame_del	ENST00000305949.1	37	c.678_680	CCDS6333.1	8																																																																																			MTBP	-	NULL	ENSG00000172167		0.320	MTBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTBP	HGNC	protein_coding	OTTHUMT00000381530.1	101	0.00	0	AGA	NM_022045		121468841	121468843	+1	no_errors	ENST00000305949	ensembl	human	known	69_37n	in_frame_del	31	40.74	22	DEL	0.999:1.000:0.992	-
MUC12	10071	genome.wustl.edu	37	7	100646824	100646824	+	Missense_Mutation	SNP	C	C	T	rs112781914	byFrequency	TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr7:100646824C>T	ENST00000379442.3	+	5	13409	c.13409C>T	c.(13408-13410)aCc>aTc	p.T4470I	MUC12_ENST00000536621.1_Missense_Mutation_p.T4327I			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	4470	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						GGAGAATCTACCACCTTCCAG	0.577																																						dbGAP											0													262.0	226.0	237.0					7																	100646824		685	1588	2273	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.13409C>T	7.37:g.100646824C>T	ENSP00000368755:p.Thr4470Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.T4470I	ENST00000379442.3	37	c.13409		7	.	.	.	.	.	.	.	.	.	.	N	1.793	-0.479104	0.04383	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.11821	2.74;2.74	0.481	0.481	0.16809	.	.	.	.	.	T	0.07234	0.0183	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.37798	-0.9690	7	0.46703	T	0.11	.	6.766	0.23566	0.0:0.9998:0.0:2.0E-4	.	.	.	.	I	4470;4327	ENSP00000368755:T4470I;ENSP00000441929:T4327I	ENSP00000368755:T4470I	T	+	2	0	MUC12	100433544	0.036000	0.19791	0.004000	0.12327	0.007000	0.05969	1.680000	0.37607	0.504000	0.28082	0.184000	0.17185	ACC	MUC12	-	NULL	ENSG00000205277		0.577	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	103	0.00	0	C	XM_379904		100646824	100646824	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.022	T
MUC16	94025	genome.wustl.edu	37	19	9091148	9091148	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr19:9091148G>C	ENST00000397910.4	-	1	870	c.667C>G	c.(667-669)Cca>Gca	p.P223A		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	223	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GTCCTTCCTGGAGTATGTGAG	0.453																																						dbGAP											0													123.0	117.0	119.0					19																	9091148		2017	4183	6200	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.667C>G	19.37:g.9091148G>C	ENSP00000381008:p.Pro223Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.P223A	ENST00000397910.4	37	c.667	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	1.758	-0.487521	0.04352	.	.	ENSG00000181143	ENST00000397910	T	0.03094	4.05	1.31	0.131	0.14755	.	.	.	.	.	T	0.01730	0.0055	N	0.08118	0	.	.	.	P	0.39717	0.684	B	0.32022	0.139	T	0.44097	-0.9350	8	0.87932	D	0	.	4.6166	0.12430	0.0:0.0:0.63:0.3699	.	223	B5ME49	.	A	223	ENSP00000381008:P223A	ENSP00000381008:P223A	P	-	1	0	MUC16	8952148	0.000000	0.05858	0.016000	0.15963	0.167000	0.22549	-0.181000	0.09740	0.088000	0.17205	0.313000	0.20887	CCA	MUC16	-	NULL	ENSG00000181143		0.453	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	80	0.00	0	G	NM_024690		9091148	9091148	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	35	27.08	13	SNP	0.024	C
MYLIP	29116	genome.wustl.edu	37	6	16143354	16143354	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr6:16143354C>T	ENST00000356840.3	+	4	766	c.568C>T	c.(568-570)Cat>Tat	p.H190Y	MYLIP_ENST00000349606.4_Missense_Mutation_p.H9Y|MIR4639_ENST00000584938.1_RNA	NM_013262.3	NP_037394.2	Q8WY64	MYLIP_HUMAN	myosin regulatory light chain interacting protein	190	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|cholesterol homeostasis (GO:0042632)|negative regulation of low-density lipoprotein particle clearance (GO:0010989)|nervous system development (GO:0007399)|positive regulation of protein catabolic process (GO:0045732)|protein destabilization (GO:0031648)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of low-density lipoprotein particle receptor catabolic process (GO:0032803)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	cytoskeletal protein binding (GO:0008092)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(50;0.0799)|Ovarian(93;0.103)	all_hematologic(90;0.0895)	Epithelial(50;0.241)			CATAGAATGGCATTCTGTGCG	0.453																																						dbGAP											0													152.0	145.0	148.0					6																	16143354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF187016	CCDS4536.1	6p23-p22.3	2011-11-17			ENSG00000007944	ENSG00000007944			21155	protein-coding gene	gene with protein product	"""E3 ubiquitin ligase-inducible degrader of the low density lipoprotein receptor"""	610082				10593918, 11162443, 19688294	Standard	NM_013262		Approved	MIR, IDOL	uc003nbq.3	Q8WY64	OTTHUMG00000016405	ENST00000356840.3:c.568C>T	6.37:g.16143354C>T	ENSP00000349298:p.His190Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TIA4|Q9BU73|Q9NRL9|Q9UHE7	Missense_Mutation	SNP	pfam_FERM_N,pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,pfscan_Znf_RING,prints_Band_41_fam,prints_Ez/rad/moesin	p.H190Y	ENST00000356840.3	37	c.568	CCDS4536.1	6	.	.	.	.	.	.	.	.	.	.	C	18.13	3.554866	0.65425	.	.	ENSG00000007944	ENST00000356840;ENST00000349606	T;T	0.76709	-1.04;0.94	5.57	5.57	0.84162	Band 4.1 domain (1);FERM central domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.000000	0.85682	D	0.000000	D	0.86781	0.6015	M	0.73430	2.235	0.80722	D	1	D	0.62365	0.991	D	0.76575	0.988	D	0.86107	0.1560	10	0.54805	T	0.06	-10.0855	19.9047	0.97002	0.0:1.0:0.0:0.0	.	190	Q8WY64	MYLIP_HUMAN	Y	190;9	ENSP00000349298:H190Y;ENSP00000008686:H9Y	ENSP00000008686:H9Y	H	+	1	0	MYLIP	16251333	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	7.398000	0.79919	2.763000	0.94921	0.655000	0.94253	CAT	MYLIP	-	pfam_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000007944		0.453	MYLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYLIP	HGNC	protein_coding	OTTHUMT00000043864.1	36	0.00	0	C	NM_013262		16143354	16143354	+1	no_errors	ENST00000356840	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	1	144615237	144615237	+	IGR	SNP	T	T	G	rs77154268		TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr1:144615237T>G								RP11-640M9.2 (9346 upstream) : NBPF9 (196506 downstream)																							CAGCAGTTCGTAAACCTCAAA	0.478																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.144615237T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		1																																																																																			NBPF8	-	-	ENSG00000225241	0	0.478					NBPF8	HGNC			116	0.85	1	T			144615237	144615237	+1	no_errors	ENST00000421407	ensembl	human	known	69_37n	rna	33	19.51	8	SNP	0.002	G
NDRG1	10397	genome.wustl.edu	37	8	134250811	134250811	+	3'UTR	SNP	A	A	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr8:134250811A>T	ENST00000414097.2	-	0	2362				NDRG1_ENST00000521414.1_5'UTR|NDRG1_ENST00000537882.1_3'UTR|NDRG1_ENST00000518176.1_3'UTR|NDRG1_ENST00000323851.7_3'UTR|NDRG1_ENST00000354944.5_3'UTR	NM_001135242.1	NP_001128714.1	Q92597	NDRG1_HUMAN	N-myc downstream regulated 1						cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|mast cell activation (GO:0045576)|peripheral nervous system myelin maintenance (GO:0032287)|positive regulation of spindle checkpoint (GO:0090232)|response to metal ion (GO:0010038)	cell-cell adherens junction (GO:0005913)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	cadherin binding (GO:0045296)|gamma-tubulin binding (GO:0043015)|microtubule binding (GO:0008017)|Rab GTPase binding (GO:0017137)		NDRG1/ERG(5)	endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(4)|prostate(1)|skin(1)	17	all_epithelial(106;4.26e-24)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			GTGTGCTGCTACGCGTCTTGT	0.582			T	ERG	prostate																																	dbGAP		Dom	yes		8	8q24.3	10397	N-myc downstream regulated 1		E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X92845	CCDS34945.1, CCDS59112.1, CCDS59113.1	8q24	2014-09-17	2008-09-12		ENSG00000104419	ENSG00000104419			7679	protein-coding gene	gene with protein product		605262		CAP43		9251681, 8939898, 18455888	Standard	NM_006096		Approved	DRG1, RTP, TDD5, NDR1	uc003yue.2	Q92597	OTTHUMG00000164441	ENST00000414097.2:c.*310T>A	8.37:g.134250811A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR80|B7Z446|O15207|Q6IBG2|Q9NYR6|Q9UK29	RNA	SNP	-	NULL	ENST00000414097.2	37	NULL	CCDS34945.1	8																																																																																			NDRG1	-	-	ENSG00000104419		0.582	NDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDRG1	HGNC	protein_coding	OTTHUMT00000378805.1	143	0.69	1	A			134250811	134250811	-1	no_errors	ENST00000521414	ensembl	human	known	69_37n	rna	35	32.69	17	SNP	0.000	T
NKX6-1	4825	genome.wustl.edu	37	4	85416968	85416968	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr4:85416968C>T	ENST00000295886.4	-	2	921	c.700G>A	c.(700-702)Ggg>Agg	p.G234R	NKX6-1_ENST00000515820.2_5'UTR	NM_006168.2	NP_006159.2	P78426	NKX61_HUMAN	NK6 homeobox 1	234	Repressor domain. {ECO:0000250}.				cell proliferation (GO:0008283)|cellular response to cytokine stimulus (GO:0071345)|cellular response to peptide hormone stimulus (GO:0071375)|detection of glucose (GO:0051594)|endocrine pancreas development (GO:0031018)|negative regulation of glial cell differentiation (GO:0045686)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte differentiation (GO:0048709)|organ morphogenesis (GO:0009887)|pancreas development (GO:0031016)|positive regulation of glial cell differentiation (GO:0045687)|positive regulation of insulin secretion (GO:0032024)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type B pancreatic cell development (GO:2000078)|regulation of axon extension (GO:0030516)|regulation of neuron migration (GO:2001222)|regulation of transcription from RNA polymerase II promoter involved in spinal cord motor neuron fate specification (GO:0021912)|regulation of transcription from RNA polymerase II promoter involved in ventral spinal cord interneuron specification (GO:0021913)|response to drug (GO:0042493)|response to nicotine (GO:0035094)|smoothened signaling pathway (GO:0007224)|transcription from RNA polymerase II promoter (GO:0006366)|type B pancreatic cell maturation (GO:0072560)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G234W(1)		central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(1)|skin(1)	15		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.0013)		TTTCTCTTCCCGTCTTTGTCC	0.493																																						dbGAP											1	Substitution - Missense(1)	lung(1)											86.0	90.0	88.0					4																	85416968		2203	4300	6503	-	-	-	SO:0001583	missense	0			AH007313	CCDS3607.1	4q21.33	2012-03-09	2007-07-09	2002-10-04	ENSG00000163623	ENSG00000163623		"""Homeoboxes / ANTP class : NKL subclass"""	7839	protein-coding gene	gene with protein product		602563	"""NK homeobox (Drosophila), family 6, A"", ""NK6 transcription factor related, locus 1 (Drosophila)"""	NKX6A		9119408	Standard	NM_006168		Approved	Nkx6.1	uc003hpa.1	P78426	OTTHUMG00000130426	ENST00000295886.4:c.700G>A	4.37:g.85416968C>T	ENSP00000295886:p.Gly234Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.G234R	ENST00000295886.4	37	c.700	CCDS3607.1	4	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551316	0.86127	.	.	ENSG00000163623	ENST00000295886	D	0.95554	-3.74	5.55	5.55	0.83447	Homeodomain-related (1);Homeobox (2);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.97074	0.9044	M	0.65975	2.015	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95573	0.8640	10	0.19590	T	0.45	-16.9624	18.0999	0.89503	0.0:1.0:0.0:0.0	.	234	P78426	NKX61_HUMAN	R	234	ENSP00000295886:G234R	ENSP00000295886:G234R	G	-	1	0	NKX6-1	85635992	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.200000	0.77838	2.606000	0.88127	0.655000	0.94253	GGG	NKX6-1	-	superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000163623		0.493	NKX6-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX6-1	HGNC	protein_coding	OTTHUMT00000252814.2	69	0.00	0	C	NM_006168		85416968	85416968	-1	no_errors	ENST00000295886	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	1.000	T
NRXN3	9369	genome.wustl.edu	37	14	78709989	78709989	+	IGR	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:78709989G>A								RNA5SP388 (65725 upstream) : RP11-332E19.2 (35925 downstream)																							TGGAAACTCGGAGCCTCGGCT	0.577																																						dbGAP											0													72.0	73.0	73.0					14																	78709989		876	1991	2867	-	-	-	SO:0001628	intergenic_variant	0																															14.37:g.78709989G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.E185K		37	c.553		14	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122746	0.56613	.	.	ENSG00000021645	ENST00000330071;ENST00000332068	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	T	0.77018	0.4069	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73946	-0.3822	4	.	.	.	.	20.4192	0.99033	0.0:0.0:1.0:0.0	.	.	.	.	K	185	.	.	E	+	1	0	NRXN3	77779742	1.000000	0.71417	0.993000	0.49108	0.934000	0.57294	6.295000	0.72744	2.831000	0.97527	0.650000	0.86243	GAG	NRXN3	-	superfamily_ConA-like_lec_gl,pfscan_Laminin_G	ENSG00000021645	0	0.577					NRXN3	HGNC			32	0.00	0	G			78709989	78709989	+1	no_errors	ENST00000554738	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	1.000	A
NUP210L	91181	genome.wustl.edu	37	1	153965335	153965335	+	Missense_Mutation	SNP	A	A	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr1:153965335A>T	ENST00000368559.3	-	40	5714	c.5643T>A	c.(5641-5643)caT>caA	p.H1881Q	NUP210L_ENST00000271854.3_Missense_Mutation_p.H1729Q|NUP210L_ENST00000368553.1_Missense_Mutation_p.H662Q	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1881					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			TCCATAACCAATGTTGCAGCC	0.448																																						dbGAP											0													199.0	195.0	197.0					1																	153965335		1852	4113	5965	-	-	-	SO:0001583	missense	0			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.5643T>A	1.37:g.153965335A>T	ENSP00000357547:p.His1881Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.H1881Q	ENST00000368559.3	37	c.5643	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	A	9.822	1.185978	0.21870	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.22743	3.57;1.94;3.26	4.74	-4.63	0.03359	.	0.229900	0.30244	N	0.010064	T	0.07052	0.0179	L	0.43152	1.355	0.09310	N	0.999996	B;B	0.27498	0.18;0.128	B;B	0.27076	0.076;0.019	T	0.05451	-1.0884	10	0.87932	D	0	-16.211	15.7574	0.78046	0.1224:0.0:0.8776:0.0	.	1729;1881	E7EP56;Q5VU65	.;P210L_HUMAN	Q	1881;662;1729	ENSP00000357547:H1881Q;ENSP00000357541:H662Q;ENSP00000271854:H1729Q	ENSP00000271854:H1729Q	H	-	3	2	NUP210L	152231959	0.706000	0.27856	0.068000	0.19968	0.209000	0.24338	-0.688000	0.05150	-1.511000	0.01794	-0.911000	0.02809	CAT	NUP210L	-	NULL	ENSG00000143552		0.448	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	61	0.00	0	A	NM_207308		153965335	153965335	-1	no_errors	ENST00000368559	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	0.379	T
OR10A5	144124	genome.wustl.edu	37	11	6867630	6867630	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr11:6867630C>G	ENST00000299454.4	+	1	748	c.717C>G	c.(715-717)ttC>ttG	p.F239L	OR10A5_ENST00000379831.2_Missense_Mutation_p.F243L			Q9H207	O10A5_HUMAN	olfactory receptor, family 10, subfamily A, member 5	239					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(1)|lung(12)|ovary(1)|skin(2)|urinary_tract(2)	21		Medulloblastoma(188;0.0523)|all_neural(188;0.236)		Epithelial(150;4.68e-08)|BRCA - Breast invasive adenocarcinoma(625;0.129)		ATAAAGCCTTCTCTACGTGCT	0.453																																					Pancreas(44;21 1072 25662 28041 45559)	dbGAP											0													271.0	233.0	246.0					11																	6867630		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF324499	CCDS7773.1	11p15.4	2012-08-09			ENSG00000166363	ENSG00000166363		"""GPCR / Class A : Olfactory receptors"""	15131	protein-coding gene	gene with protein product		608493		OR10A1			Standard	NM_178168		Approved	OR11-403, JCG6	uc001met.1	Q9H207	OTTHUMG00000165738	ENST00000299454.4:c.717C>G	11.37:g.6867630C>G	ENSP00000299454:p.Phe239Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O95223|Q52M66|Q96R21|Q96R22	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F243L	ENST00000299454.4	37	c.729	CCDS7773.1	11	.	.	.	.	.	.	.	.	.	.	.	13.11	2.138258	0.37728	.	.	ENSG00000166363	ENST00000299454;ENST00000379831	T;T	0.00269	8.37;8.37	3.59	2.68	0.31781	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000008	T	0.00384	0.0012	L	0.53249	1.67	0.37122	D	0.900868	D	0.89917	1.0	D	0.91635	0.999	T	0.82559	-0.0397	10	0.56958	D	0.05	.	9.278	0.37711	0.0:0.8892:0.0:0.1108	.	239	Q9H207	O10A5_HUMAN	L	239;243	ENSP00000299454:F239L;ENSP00000369159:F243L	ENSP00000299454:F239L	F	+	3	2	OR10A5	6824206	0.988000	0.35896	1.000000	0.80357	0.590000	0.36582	0.996000	0.29719	1.067000	0.40740	-0.229000	0.12294	TTC	OR10A5	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000166363		0.453	OR10A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10A5	HGNC	protein_coding	OTTHUMT00000385983.1	107	0.00	0	C	NM_178168		6867630	6867630	+1	no_errors	ENST00000379831	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	G
OR2T8	343172	genome.wustl.edu	37	1	248084909	248084909	+	Missense_Mutation	SNP	T	T	G	rs34508376	byFrequency	TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr1:248084909T>G	ENST00000319968.4	+	1	590	c.590T>G	c.(589-591)aTg>aGg	p.M197R		NM_001005522.1	NP_001005522.1	A6NH00	OR2T8_HUMAN	olfactory receptor, family 2, subfamily T, member 8	197			M -> R (in dbSNP:rs4474294).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(20)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0211)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			GAAAACGCCATGTACATCTGC	0.527													T|||	1511	0.301717	0.1029	0.4337	5008	,	,		14434	0.2778		0.4652	False		,,,				2504	0.3333					dbGAP											0													4.0	3.0	4.0					1																	248084909		1815	3480	5295	-	-	-	SO:0001583	missense	0				CCDS31100.1	1q44	2012-08-09		2004-03-10	ENSG00000177462	ENSG00000177462		"""GPCR / Class A : Olfactory receptors"""	15020	protein-coding gene	gene with protein product				OR2T8P			Standard	XM_005273117		Approved		uc010pzc.2	A6NH00	OTTHUMG00000040205	ENST00000319968.4:c.590T>G	1.37:g.248084909T>G	ENSP00000326225:p.Met197Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M197R	ENST00000319968.4	37	c.590	CCDS31100.1	1	1010	0.4624542124542125	65	0.13211382113821138	233	0.643646408839779	209	0.36538461538461536	503	0.6635883905013192	T	14.19	2.460615	0.43736	.	.	ENSG00000177462	ENST00000319968	T	0.00130	8.69	3.56	1.06	0.20224	GPCR, rhodopsin-like superfamily (1);	0.000000	0.42682	U	0.000672	T	0.00012	0.0000	L	0.54323	1.7	0.80722	P	0.0	D	0.57899	0.981	D	0.65987	0.94	T	0.13255	-1.0516	9	0.72032	D	0.01	.	4.6079	0.12387	0.1689:0.1007:0.0:0.7304	rs34508376	197	A6NH00	OR2T8_HUMAN	R	197	ENSP00000326225:M197R	ENSP00000326225:M197R	M	+	2	0	OR2T8	246151532	0.000000	0.05858	0.009000	0.14445	0.396000	0.30629	-0.130000	0.10498	0.012000	0.14892	0.332000	0.21555	ATG	OR2T8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000177462		0.527	OR2T8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T8	HGNC	protein_coding	OTTHUMT00000096862.1	38	0.00	0	T	NM_001005522		248084909	248084909	+1	no_errors	ENST00000319968	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.000	G
OR4C16	219428	genome.wustl.edu	37	11	55340443	55340443	+	Silent	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr11:55340443C>G	ENST00000314634.3	+	1	840	c.840C>G	c.(838-840)ctC>ctG	p.L280L		NM_001004701.2	NP_001004701.2	Q8NGL9	OR4CG_HUMAN	olfactory receptor, family 4, subfamily C, member 16 (gene/pseudogene)	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(28)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	41		all_epithelial(135;0.0748)				CATCTTTTCTCAACCCTGTGA	0.383																																						dbGAP											0													83.0	76.0	78.0					11																	55340443		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065773	CCDS31502.1	11q11	2013-10-10	2013-10-10		ENSG00000181935	ENSG00000181935		"""GPCR / Class A : Olfactory receptors"""	15172	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily C, member 16"""				Standard	NM_001004701		Approved		uc010rih.2	Q8NGL9	OTTHUMG00000165198	ENST00000314634.3:c.840C>G	11.37:g.55340443C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEV8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L280	ENST00000314634.3	37	c.840	CCDS31502.1	11																																																																																			OR4C16	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000181935		0.383	OR4C16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C16	HGNC	protein_coding	OTTHUMT00000382627.1	34	0.00	0	C	NM_001004701		55340443	55340443	+1	no_errors	ENST00000314634	ensembl	human	known	69_37n	silent	14	30.00	6	SNP	0.211	G
OR4N2	390429	genome.wustl.edu	37	14	20296298	20296298	+	Nonsense_Mutation	SNP	G	G	T	rs139512020	byFrequency	TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:20296298G>T	ENST00000315947.1	+	1	691	c.691G>T	c.(691-693)Gag>Tag	p.E231*	OR4N2_ENST00000568211.1_3'UTR	NM_001004723.1	NP_001004723.1	Q8NGD1	OR4N2_HUMAN	olfactory receptor, family 4, subfamily N, member 2	231						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|liver(1)|lung(32)|ovary(2)|prostate(1)|skin(2)|stomach(2)	52	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		GTCTTCTTCTGAGGCAAAAAA	0.498																																						dbGAP											0													105.0	106.0	106.0					14																	20296298		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS32022.1	14q11.2	2013-09-23				ENSG00000176294		"""GPCR / Class A : Olfactory receptors"""	14742	protein-coding gene	gene with protein product							Standard	NM_001004723		Approved		uc010tkv.2	Q8NGD1		ENST00000315947.1:c.691G>T	14.37:g.20296298G>T	ENSP00000319601:p.Glu231*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEY9|Q6IFA2	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.E231*	ENST00000315947.1	37	c.691	CCDS32022.1	14	.	.	.	.	.	.	.	.	.	.	.	13.43	2.233762	0.39498	.	.	ENSG00000176294	ENST00000315947	.	.	.	4.66	4.66	0.58398	.	0.000000	0.49916	D	0.000129	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-8.773	13.2205	0.59885	0.0:0.0:1.0:0.0	.	.	.	.	X	231	.	ENSP00000319601:E231X	E	+	1	0	OR4N2	19366138	0.000000	0.05858	0.971000	0.41717	0.140000	0.21249	0.074000	0.14662	2.575000	0.86900	0.585000	0.79938	GAG	OR4N2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176294		0.498	OR4N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N2	HGNC	protein_coding	OTTHUMT00000409821.2	206	0.96	2	G			20296298	20296298	+1	no_errors	ENST00000315947	ensembl	human	known	69_37n	nonsense	91	14.15	15	SNP	0.532	T
PACSIN2	11252	genome.wustl.edu	37	22	43287091	43287091	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr22:43287091C>G	ENST00000263246.3	-	4	516	c.315G>C	c.(313-315)atG>atC	p.M105I	PACSIN2_ENST00000402229.1_Missense_Mutation_p.M105I|PACSIN2_ENST00000403744.3_Missense_Mutation_p.M105I|PACSIN2_ENST00000407585.1_Missense_Mutation_p.M105I|PACSIN2_ENST00000337959.4_Missense_Mutation_p.M105I	NM_001184970.1	NP_001171899.1	Q9UNF0	PACN2_HUMAN	protein kinase C and casein kinase substrate in neurons 2	105	F-BAR domain.				actin cytoskeleton organization (GO:0030036)|caveola assembly (GO:0070836)|caveolin-mediated endocytosis (GO:0072584)|cell projection morphogenesis (GO:0048858)|membrane tubulation (GO:0097320)|negative regulation of endocytosis (GO:0045806)|protein localization to endosome (GO:0036010)	caveola (GO:0005901)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|focal adhesion (GO:0005925)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|recycling endosome membrane (GO:0055038)	identical protein binding (GO:0042802)|phosphatidic acid binding (GO:0070300)|transporter activity (GO:0005215)			NS(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)	19		Glioma(61;0.222)				AGTCATCGTTCATCAGTGAGG	0.577																																						dbGAP											0													82.0	81.0	82.0					22																	43287091		2171	4288	6459	-	-	-	SO:0001583	missense	0			AF128536	CCDS43023.1, CCDS54536.1	22q13.2-q13.33	2009-05-08			ENSG00000100266	ENSG00000100266			8571	protein-coding gene	gene with protein product	"""syndapin II"""	604960				10431838, 11082044	Standard	NM_007229		Approved	SDPII	uc003bdg.4	Q9UNF0	OTTHUMG00000150701	ENST00000263246.3:c.315G>C	22.37:g.43287091C>G	ENSP00000263246:p.Met105Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O95921|Q96HV9|Q9H0D3|Q9NPN1|Q9Y4V2	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,prints_SH3_domain	p.M105I	ENST00000263246.3	37	c.315	CCDS43023.1	22	.	.	.	.	.	.	.	.	.	.	C	11.93	1.784982	0.31593	.	.	ENSG00000100266	ENST00000263246;ENST00000337959;ENST00000407585;ENST00000403744;ENST00000402229;ENST00000453643;ENST00000418133;ENST00000422336	T;T;T;T;T;T;T;T	0.40476	2.61;2.61;2.61;2.61;2.61;1.03;1.03;1.03	4.81	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.28599	0.0708	N	0.17474	0.49	0.80722	D	1	B;B	0.24963	0.024;0.115	B;B	0.19666	0.01;0.026	T	0.06463	-1.0825	10	0.16896	T	0.51	-2.3714	18.4442	0.90678	0.0:1.0:0.0:0.0	.	105;105	Q6FIA3;Q9UNF0	.;PACN2_HUMAN	I	105	ENSP00000263246:M105I;ENSP00000338379:M105I;ENSP00000385952:M105I;ENSP00000385372:M105I;ENSP00000385040:M105I;ENSP00000398573:M105I;ENSP00000396816:M105I;ENSP00000403435:M105I	ENSP00000263246:M105I	M	-	3	0	PACSIN2	41617035	1.000000	0.71417	1.000000	0.80357	0.372000	0.29890	7.568000	0.82369	2.675000	0.91044	0.542000	0.68232	ATG	PACSIN2	-	NULL	ENSG00000100266		0.577	PACSIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN2	HGNC	protein_coding	OTTHUMT00000319665.1	108	0.00	0	C	NM_007229		43287091	43287091	-1	no_errors	ENST00000263246	ensembl	human	known	69_37n	missense	41	18.00	9	SNP	1.000	G
PAPLN	89932	genome.wustl.edu	37	14	73720540	73720540	+	Silent	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:73720540G>A	ENST00000554301.1	+	11	1336	c.1173G>A	c.(1171-1173)tcG>tcA	p.S391S	PAPLN_ENST00000381166.3_Silent_p.S391S|PAPLN_ENST00000555445.1_Silent_p.S391S|PAPLN_ENST00000427855.1_Silent_p.S391S|PAPLN_ENST00000340738.5_Silent_p.S364S			O95428	PPN_HUMAN	papilin, proteoglycan-like sulfated glycoprotein	391	TSP type-1 3. {ECO:0000255|PROSITE- ProRule:PRU00210}.					basement membrane (GO:0005604)	metalloendopeptidase activity (GO:0004222)|serine-type endopeptidase inhibitor activity (GO:0004867)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(3)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(3)	42				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.0468)		ACTGCATCTCGTCTGACGGGG	0.677																																						dbGAP											0													48.0	50.0	49.0					14																	73720540		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC042057	CCDS32114.1	14q24.2	2013-01-11				ENSG00000100767		"""Immunoglobulin superfamily / I-set domain containing"""	19262	protein-coding gene	gene with protein product						11076767, 19734141	Standard	NM_173462		Approved	MGC50452	uc001xnw.4	O95428		ENST00000554301.1:c.1173G>A	14.37:g.73720540G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DES8|B4DGE6|Q659F2|Q6UXJ4|Q6ZNM1|Q6ZUJ0|Q7Z681|Q8IVU0	Silent	SNP	pfam_Ig_I-set,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_inh_Kunz-m,pfam_PLAC,superfamily_Prot_inh_Kunz-m,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Prot_inh_Kunz-m,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,prints_Peptidase_M12B_ADAM-TS,prints_Prot_inh_Kunz-m,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Prot_inh_Kunz-m,pfscan_Ig-like	p.S391	ENST00000554301.1	37	c.1173		14																																																																																			PAPLN	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000100767		0.677	PAPLN-002	KNOWN	basic|appris_principal	protein_coding	PAPLN	HGNC	protein_coding	OTTHUMT00000413182.1	116	0.00	0	G	NM_173462		73720540	73720540	+1	no_errors	ENST00000427855	ensembl	human	known	69_37n	silent	30	26.83	11	SNP	0.000	A
PCDHGA1	56114	genome.wustl.edu	37	5	140712490	140712490	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:140712490C>T	ENST00000517417.1	+	1	2239	c.2239C>T	c.(2239-2241)Cgg>Tgg	p.R747W	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.R747W	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	747					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACGGGGTTCGGGCTTTCCT	0.627																																						dbGAP											0													69.0	74.0	72.0					5																	140712490		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.2239C>T	5.37:g.140712490C>T	ENSP00000431083:p.Arg747Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M273|Q9Y5D6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R747W	ENST00000517417.1	37	c.2239	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975807	0.34848	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.51071	0.79;0.72	3.89	1.89	0.25635	.	0.635593	0.13110	N	0.413019	T	0.51991	0.1707	M	0.80982	2.52	0.09310	N	1	P;B	0.37038	0.579;0.272	B;B	0.43701	0.428;0.144	T	0.52003	-0.8633	10	0.87932	D	0	.	4.4209	0.11479	0.1593:0.5964:0.1548:0.0896	.	747;747	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	W	747	ENSP00000431083:R747W;ENSP00000367345:R747W	ENSP00000367345:R747W	R	+	1	2	PCDHGA1	140692674	0.000000	0.05858	0.087000	0.20705	0.770000	0.43624	0.170000	0.16663	0.961000	0.38030	0.585000	0.79938	CGG	PCDHGA1	-	NULL	ENSG00000204956		0.627	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	129	0.00	0	C	NM_018912		140712490	140712490	+1	no_errors	ENST00000517417	ensembl	human	known	69_37n	missense	56	23.29	17	SNP	0.065	T
PGF	5228	genome.wustl.edu	37	14	75413575	75413575	+	Missense_Mutation	SNP	G	G	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr14:75413575G>T	ENST00000405431.2	-	5	468	c.469C>A	c.(469-471)Cgc>Agc	p.R157S	PGF_ENST00000553716.1_Intron|PGF_ENST00000238607.6_Intron|PGF_ENST00000555567.1_Intron			P49763	PLGF_HUMAN	placental growth factor	157					branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell-cell signaling (GO:0007267)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|organ regeneration (GO:0031100)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|regulation of morphogenesis of a branching structure (GO:0060688)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|sprouting angiogenesis (GO:0002040)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	growth factor activity (GO:0008083)|heparin binding (GO:0008201)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)	8				BRCA - Breast invasive adenocarcinoma(234;0.00668)	Aflibercept(DB08885)	GGGAGTGAGCGACGGGGTGGG	0.617																																					GBM(127;389 2301 5452 48547)	dbGAP											0													27.0	25.0	25.0					14																	75413575		876	1991	2867	-	-	-	SO:0001583	missense	0			S72960	CCDS9835.1, CCDS55932.1, CCDS73664.1	14q24.3	2013-02-18	2008-03-20		ENSG00000119630	ENSG00000119630			8893	protein-coding gene	gene with protein product	"""placenta growth factor"""	601121	"""placental growth factor-like"", ""placental growth factor, vascular endothelial growth factor-related protein"""	PGFL		7681160	Standard	NM_002632		Approved	PLGF, PlGF-2, PlGF, SHGC-10760, D12S1900	uc001xqz.3	P49763	OTTHUMG00000171496	ENST00000405431.2:c.469C>A	14.37:g.75413575G>T	ENSP00000385365:p.Arg157Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q07101|Q9BV78|Q9Y6S8	Missense_Mutation	SNP	pfam_PD_growth_factor,smart_PD_growth_factor,pfscan_PD_growth_factor	p.R157S	ENST00000405431.2	37	c.469	CCDS9835.1	14	.	.	.	.	.	.	.	.	.	.	G	3.454	-0.111419	0.06881	.	.	ENSG00000119630	ENST00000405431	.	.	.	1.26	-0.831	0.10789	.	.	.	.	.	T	0.34106	0.0886	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.35076	-0.9803	5	0.56958	D	0.05	.	3.4238	0.07402	0.0:0.2853:0.4253:0.2894	.	.	.	.	S	157	.	ENSP00000385365:R157S	R	-	1	0	PGF	74483328	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.261000	0.18442	-0.266000	0.09339	-0.802000	0.03209	CGC	PGF	-	NULL	ENSG00000119630		0.617	PGF-008	KNOWN	basic|CCDS	protein_coding	PGF	HGNC	protein_coding	OTTHUMT00000414064.1	59	0.00	0	G	NM_002632		75413575	75413575	-1	no_errors	ENST00000405431	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	0.000	T
PIGN	23556	genome.wustl.edu	37	18	59770085	59770085	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr18:59770085G>A	ENST00000357637.5	-	21	2325	c.1910C>T	c.(1909-1911)tCt>tTt	p.S637F	PIGN_ENST00000400334.3_Missense_Mutation_p.S637F	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	637					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				TTTCATGAGAGATGTTACAAC	0.318																																						dbGAP											0													58.0	57.0	57.0					18																	59770085		1844	4096	5940	-	-	-	SO:0001583	missense	0			AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.1910C>T	18.37:g.59770085G>A	ENSP00000350263:p.Ser637Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L8F8|Q8TC01|Q9NT05	Missense_Mutation	SNP	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.S637F	ENST00000357637.5	37	c.1910	CCDS45879.1	18	.	.	.	.	.	.	.	.	.	.	G	6.778	0.512414	0.12944	.	.	ENSG00000197563	ENST00000357637;ENST00000400334	T;T	0.28255	1.62;1.62	5.81	3.82	0.43975	GPI ethanolamine phosphate transferase 1, C-terminal (1);	0.219203	0.39985	N	0.001203	T	0.21509	0.0518	L	0.35288	1.05	0.09310	N	0.999996	B;B	0.17852	0.011;0.024	B;B	0.21917	0.006;0.037	T	0.18903	-1.0322	10	0.09843	T	0.71	-6.7423	12.2401	0.54538	0.0:0.0:0.6794:0.3206	.	637;637	B2RCI8;O95427	.;PIGN_HUMAN	F	637	ENSP00000350263:S637F;ENSP00000383188:S637F	ENSP00000350263:S637F	S	-	2	0	PIGN	57921065	0.159000	0.22864	0.008000	0.14137	0.742000	0.42306	0.291000	0.18994	1.426000	0.47256	-0.188000	0.12872	TCT	PIGN	-	pfam_GPI_EtnP_transferase_1_C	ENSG00000197563		0.318	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	HGNC	protein_coding	OTTHUMT00000449757.2	43	0.00	0	G	NM_176787		59770085	59770085	-1	no_errors	ENST00000357637	ensembl	human	known	69_37n	missense	18	25.00	6	SNP	0.005	A
PIK3CA	5290	genome.wustl.edu	37	3	178921551	178921551	+	Missense_Mutation	SNP	A	A	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr3:178921551A>C	ENST00000263967.3	+	5	1190	c.1033A>C	c.(1033-1035)Aat>Cat	p.N345H		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	345	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AACCTACGTGAATGTAAATAT	0.303		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													67.0	66.0	66.0					3																	178921551		1806	4074	5880	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1033A>C	3.37:g.178921551A>C	ENSP00000263967:p.Asn345His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.N345H	ENST00000263967.3	37	c.1033	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	22.9	4.353390	0.82243	.	.	ENSG00000121879	ENST00000263967	T	0.70869	-0.52	5.41	5.41	0.78517	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	D	0.83046	0.5169	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.84166	0.0431	10	0.52906	T	0.07	-21.0442	15.721	0.77710	1.0:0.0:0.0:0.0	.	345	P42336	PK3CA_HUMAN	H	345	ENSP00000263967:N345H	ENSP00000263967:N345H	N	+	1	0	PIK3CA	180404245	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.851000	0.92205	2.166000	0.68216	0.402000	0.26972	AAT	PIK3CA	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000121879		0.303	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	49	0.00	0	A			178921551	178921551	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	1.000	C
MCOLN1	57192	genome.wustl.edu	37	19	7601418	7601418	+	IGR	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr19:7601418C>T	ENST00000264079.6	+	0	2082				PNPLA6_ENST00000600737.1_Silent_p.L133L|PNPLA6_ENST00000450331.3_Silent_p.L94L|PNPLA6_ENST00000221249.6_Silent_p.L94L|PNPLA6_ENST00000414982.3_Silent_p.L142L|PNPLA6_ENST00000545201.2_Silent_p.L94L|CTD-2207O23.10_ENST00000601870.1_3'UTR	NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1						calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						TGAAGATGCTCAACATTGCCA	0.527																																						dbGAP											0													86.0	78.0	81.0					19																	7601418		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1			19.37:g.7601418C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Silent	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.L142	ENST00000264079.6	37	c.426	CCDS12180.1	19																																																																																			PNPLA6	-	NULL	ENSG00000032444		0.527	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000458974.2	64	0.00	0	C	NM_020533		7601418	7601418	+1	no_errors	ENST00000414982	ensembl	human	known	69_37n	silent	14	36.36	8	SNP	0.912	T
PPAP2A	8611	genome.wustl.edu	37	5	54763841	54763841	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:54763841G>C	ENST00000307259.8	-	3	767	c.347C>G	c.(346-348)aCt>aGt	p.T116S	PPAP2A_ENST00000515132.1_5'UTR|PPAP2A_ENST00000264775.5_Missense_Mutation_p.T117S	NM_003711.2	NP_003702.2	O14494	LPP1_HUMAN	phosphatidic acid phosphatase type 2A	116					androgen receptor signaling pathway (GO:0030521)|germ cell migration (GO:0008354)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|lipid metabolic process (GO:0006629)|negative regulation of cell proliferation (GO:0008285)|phospholipid dephosphorylation (GO:0046839)|protein dephosphorylation (GO:0006470)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of lipid metabolic process (GO:0019216)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			breast(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)	9		Lung NSC(810;4.08e-05)|Prostate(74;0.0181)|Breast(144;0.0544)				GGCAATGTCAGTCAGGGACTG	0.413																																						dbGAP											0													112.0	110.0	111.0					5																	54763841		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB000888	CCDS34159.1, CCDS34160.1	5q11	2009-05-27			ENSG00000067113	ENSG00000067113	3.1.3.4		9228	protein-coding gene	gene with protein product		607124				9305923	Standard	NM_003711		Approved	PAP-2a, LPP1	uc003jpz.4	O14494	OTTHUMG00000162240	ENST00000307259.8:c.347C>G	5.37:g.54763841G>C	ENSP00000302229:p.Thr116Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKN8|G3XA95|O60457|O60463|Q17RZ4	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.T117S	ENST00000307259.8	37	c.350	CCDS34159.1	5	.	.	.	.	.	.	.	.	.	.	G	27.6	4.847855	0.91277	.	.	ENSG00000067113	ENST00000264775;ENST00000307259	T;T	0.76316	-1.01;-1.01	5.73	5.73	0.89815	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.087419	0.85682	D	0.000000	D	0.89083	0.6614	M	0.81682	2.555	0.58432	D	0.999998	D;D	0.67145	0.996;0.976	D;P	0.71414	0.973;0.834	D	0.89380	0.3681	10	0.87932	D	0	-13.2368	20.315	0.98648	0.0:0.0:1.0:0.0	.	116;117	O14494;G3XA95	LPP1_HUMAN;.	S	117;116	ENSP00000264775:T117S;ENSP00000302229:T116S	ENSP00000264775:T117S	T	-	2	0	PPAP2A	54799598	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.420000	0.97426	2.881000	0.98747	0.573000	0.79308	ACT	PPAP2A	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	ENSG00000067113		0.413	PPAP2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2A	HGNC	protein_coding	OTTHUMT00000368073.1	50	0.00	0	G			54763841	54763841	-1	no_errors	ENST00000264775	ensembl	human	known	69_37n	missense	19	51.28	20	SNP	1.000	C
RAB4B	53916	genome.wustl.edu	37	19	41285991	41285991	+	Silent	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr19:41285991C>T	ENST00000594800.1	+	2	244	c.84C>T	c.(82-84)ttC>ttT	p.F28F	MIA-RAB4B_ENST00000600729.1_3'UTR|RAB4B-EGLN2_ENST00000594136.1_Silent_p.F28F|RAB4B-EGLN2_ENST00000601949.1_Intron|RAB4B_ENST00000602069.1_3'UTR|RAB4B_ENST00000357052.2_Silent_p.F28F			P61018	RAB4B_HUMAN	RAB4B, member RAS oncogene family	28					glucose import (GO:0046323)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	insulin-responsive compartment (GO:0032593)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	GTP binding (GO:0005525)			endometrium(2)|kidney(3)|large_intestine(3)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	11			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			TTCATCAGTTCATTGAGAATA	0.537																																						dbGAP											0													105.0	91.0	96.0					19																	41285991		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF165522	CCDS33030.1	19q13.2	2012-10-15			ENSG00000167578	ENSG00000167578		"""RAB, member RAS oncogene"""	9782	protein-coding gene	gene with protein product	"""ras-related GTP-binding protein 4b"", ""small GTP binding protein RAB4B"""	612945					Standard	NM_016154		Approved	FLJ78649, MGC52123	uc002opd.2	P61018		ENST00000594800.1:c.84C>T	19.37:g.41285991C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P22750|Q7Z514|Q9HBR6	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F28	ENST00000594800.1	37	c.84	CCDS33030.1	19																																																																																			RAB4B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000167578		0.537	RAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB4B	HGNC	protein_coding	OTTHUMT00000463168.1	141	0.00	0	C	NM_016154		41285991	41285991	+1	no_errors	ENST00000357052	ensembl	human	known	69_37n	silent	76	13.48	12	SNP	1.000	T
RASGRF2	5924	genome.wustl.edu	37	5	80363981	80363981	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr5:80363981G>A	ENST00000265080.4	+	3	593	c.526G>A	c.(526-528)Gaa>Aaa	p.E176K		NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2	176					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.E176K(1)		biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		CACAGAAATCGAAAGGCTTAA	0.383																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											123.0	117.0	119.0					5																	80363981		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.526G>A	5.37:g.80363981G>A	ENSP00000265080:p.Glu176Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG89|Q9UK56	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.E176K	ENST00000265080.4	37	c.526	CCDS4052.1	5	.	.	.	.	.	.	.	.	.	.	G	16.98	3.271995	0.59649	.	.	ENSG00000113319	ENST00000265080	T	0.41065	1.01	5.91	5.91	0.95273	.	0.088972	0.85682	D	0.000000	T	0.31857	0.0810	N	0.20986	0.625	0.52099	D	0.999947	B	0.22800	0.075	B	0.11329	0.006	T	0.11470	-1.0586	10	0.13470	T	0.59	.	20.2896	0.98541	0.0:0.0:1.0:0.0	.	176	O14827	RGRF2_HUMAN	K	176	ENSP00000265080:E176K	ENSP00000265080:E176K	E	+	1	0	RASGRF2	80399737	1.000000	0.71417	0.998000	0.56505	0.987000	0.75469	8.058000	0.89460	2.794000	0.96219	0.655000	0.94253	GAA	RASGRF2	-	NULL	ENSG00000113319		0.383	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRF2	HGNC	protein_coding	OTTHUMT00000239215.2	37	0.00	0	G	NM_006909		80363981	80363981	+1	no_errors	ENST00000265080	ensembl	human	known	69_37n	missense	6	53.85	7	SNP	1.000	A
RELL1	768211	genome.wustl.edu	37	4	37651123	37651123	+	Splice_Site	SNP	C	C	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr4:37651123C>A	ENST00000454158.2	-	2	177		c.e2-1		RELL1_ENST00000314117.4_Splice_Site	NM_001085400.1	NP_001078869.1	Q8IUW5	RELL1_HUMAN	RELT-like 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6						CTCCCATTGTCTACAGAAAGA	0.498																																						dbGAP											0													87.0	95.0	92.0					4																	37651123		1951	4163	6114	-	-	-	SO:0001630	splice_region_variant	0			AK025431	CCDS43221.1	4p14	2011-10-11				ENSG00000181826			27379	protein-coding gene	gene with protein product		611212				16389068	Standard	NM_001085399		Approved		uc003gsz.2	Q8IUW5		ENST00000454158.2:c.89-1G>T	4.37:g.37651123C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBK1	Splice_Site	SNP	-	e2-1	ENST00000454158.2	37	c.89-1	CCDS43221.1	4	.	.	.	.	.	.	.	.	.	.	C	14.39	2.522318	0.44866	.	.	ENSG00000181826	ENST00000314117;ENST00000454158;ENST00000512114	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0457	0.80720	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	RELL1	37327518	0.172000	0.23043	0.158000	0.22627	0.162000	0.22319	2.349000	0.44054	2.751000	0.94390	0.650000	0.86243	.	RELL1	-	-	ENSG00000181826		0.498	RELL1-002	KNOWN	alternative_3_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	RELL1	HGNC	protein_coding	OTTHUMT00000360485.1	49	0.00	0	C	NM_001085400	Intron	37651123	37651123	-1	no_errors	ENST00000314117	ensembl	human	known	69_37n	splice_site	18	35.71	10	SNP	0.470	A
RFPL4A	342931	genome.wustl.edu	37	19	56274193	56274193	+	Silent	SNP	G	G	C	rs149361735	byFrequency	TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr19:56274193G>C	ENST00000434937.2	+	3	687	c.516G>C	c.(514-516)gtG>gtC	p.V172V		NM_001145014.1	NP_001138486.1	A6NLU0	RFPLA_HUMAN	ret finger protein-like 4A	172	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(1)|stomach(1)	2						AGGAATCTGTGAACCGACAGG	0.577																																						dbGAP											0													57.0	56.0	56.0					19																	56274193		647	1423	2070	-	-	-	SO:0001819	synonymous_variant	0				CCDS46201.1	19q13.42	2013-02-22	2007-01-19	2007-01-19	ENSG00000223638	ENSG00000223638		"""RING-type (C3HC4) zinc fingers"""	16449	protein-coding gene	gene with protein product		612601	"""ret finger protein-like 4"""	RFPL4		11850190	Standard	NM_001145014		Approved	RNF210	uc010yge.2	A6NLU0	OTTHUMG00000165449	ENST00000434937.2:c.516G>C	19.37:g.56274193G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_RDM_domain_RFPL,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.V172	ENST00000434937.2	37	c.516	CCDS46201.1	19																																																																																			RFPL4A	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000223638		0.577	RFPL4A-001	NOVEL	upstream_ATG|basic|appris_principal|CCDS	protein_coding	RFPL4A	HGNC	protein_coding	OTTHUMT00000384184.1	33	0.00	0	G	XM_292796		56274193	56274193	+1	no_errors	ENST00000434937	ensembl	human	novel	69_37n	silent	18	14.29	3	SNP	0.000	C
RMND1	55005	genome.wustl.edu	37	6	151757629	151757629	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr6:151757629G>C	ENST00000367303.4	-	3	687	c.565C>G	c.(565-567)Caa>Gaa	p.Q189E	RMND1_ENST00000336451.3_5'UTR|RMND1_ENST00000491268.1_5'UTR	NM_017909.2	NP_060379.2	Q9NWS8	RMND1_HUMAN	required for meiotic nuclear division 1 homolog (S. cerevisiae)	189					translation (GO:0006412)	mitochondrion (GO:0005739)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.146)	OV - Ovarian serous cystadenocarcinoma(155;6.8e-11)		GCCAGATCTTGAGACAGATTT	0.443																																						dbGAP											0													166.0	151.0	156.0					6																	151757629		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000634	CCDS5232.1, CCDS75539.1	6q25.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000155906	ENSG00000155906			21176	protein-coding gene	gene with protein product		614917	"""chromosome 6 open reading frame 96"""	C6orf96			Standard	NM_001271937		Approved	bA351K16.3, FLJ20627, RMD1	uc003qoi.3	Q9NWS8	OTTHUMG00000015837	ENST00000367303.4:c.565C>G	6.37:g.151757629G>C	ENSP00000356272:p.Gln189Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8H4|Q0VDG6|Q5SZ48|Q5SZ83|Q6NSC5|Q96EN7	Missense_Mutation	SNP	pfam_DUF155	p.Q189E	ENST00000367303.4	37	c.565	CCDS5232.1	6	.	.	.	.	.	.	.	.	.	.	G	9.282	1.048389	0.19827	.	.	ENSG00000155906	ENST00000367303;ENST00000444024	T	0.40225	1.04	5.77	5.77	0.91146	.	0.046954	0.85682	D	0.000000	T	0.32436	0.0829	L	0.27053	0.805	0.80722	D	1	D;B	0.56287	0.975;0.012	P;B	0.55545	0.778;0.013	T	0.02736	-1.1117	10	0.10636	T	0.68	-19.5738	19.5865	0.95492	0.0:0.0:1.0:0.0	.	189;189	Q9NWS8-3;Q9NWS8	.;RMND1_HUMAN	E	189;19	ENSP00000356272:Q189E	ENSP00000356272:Q189E	Q	-	1	0	RMND1	151799322	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.901000	0.69861	2.723000	0.93209	0.655000	0.94253	CAA	RMND1	-	NULL	ENSG00000155906		0.443	RMND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RMND1	HGNC	protein_coding	OTTHUMT00000042718.2	38	0.00	0	G	NM_017909		151757629	151757629	-1	no_errors	ENST00000367303	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	1.000	C
SAFB2	9667	genome.wustl.edu	37	19	5604869	5604869	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr19:5604869C>T	ENST00000252542.4	-	10	1639	c.1375G>A	c.(1375-1377)Gac>Aac	p.D459N	SAFB2_ENST00000591310.1_5'UTR	NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	459	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		GTCGCCTCGTCAGATGTCGAC	0.547																																					Ovarian(127;888 1728 23957 44128 52668)	dbGAP											0													87.0	71.0	76.0					19																	5604869		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.1375G>A	19.37:g.5604869C>T	ENSP00000252542:p.Asp459Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKG3|Q8TB13	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.D459N	ENST00000252542.4	37	c.1375	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	C	26.3	4.728141	0.89390	.	.	ENSG00000130254	ENST00000434962;ENST00000415313;ENST00000394625;ENST00000252542	T	0.75260	-0.92	5.34	5.34	0.76211	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.324591	0.26304	N	0.025157	T	0.74122	0.3675	L	0.48935	1.535	0.58432	D	0.999999	B	0.25169	0.119	B	0.33690	0.168	T	0.72141	-0.4380	10	0.56958	D	0.05	-20.5333	19.0382	0.92987	0.0:1.0:0.0:0.0	.	459	Q14151	SAFB2_HUMAN	N	355;210;459;459	ENSP00000252542:D459N	ENSP00000252542:D459N	D	-	1	0	SAFB2	5555869	1.000000	0.71417	0.054000	0.19295	0.603000	0.37013	7.723000	0.84788	2.505000	0.84491	0.555000	0.69702	GAC	SAFB2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000130254		0.547	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	37	0.00	0	C	NM_014649		5604869	5604869	-1	no_errors	ENST00000252542	ensembl	human	known	69_37n	missense	16	33.33	8	SNP	0.998	T
SHANK2	22941	genome.wustl.edu	37	11	70821019	70821019	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr11:70821019delA	ENST00000338508.4	-	4	559	c.560delT	c.(559-561)ctgfs	p.L187fs				Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	0	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			ATTGGGATCCAGGCCTCGGTC	0.517																																						dbGAP											0													103.0	96.0	98.0					11																	70821019		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000338508.4:c.560delT	11.37:g.70821019delA	ENSP00000345193:p.Leu187fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Frame_Shift_Del	DEL	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.L187fs	ENST00000338508.4	37	c.560		11																																																																																			SHANK2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000162105		0.517	SHANK2-201	KNOWN	basic|appris_principal	protein_coding	SHANK2	HGNC	protein_coding		62	0.00	0	A	NM_012309		70821019	70821019	-1	no_errors	ENST00000338508	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	1.000	-
SLC35G3	146861	genome.wustl.edu	37	17	33521089	33521089	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr17:33521089G>A	ENST00000297307.5	-	1	323	c.238C>T	c.(238-240)Cac>Tac	p.H80Y	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	80	EamA 1.					integral component of membrane (GO:0016021)											ATAGGGAGGTGGAAGAGGCAT	0.612																																						dbGAP											0													147.0	151.0	149.0					17																	33521089		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.238C>T	17.37:g.33521089G>A	ENSP00000297307:p.His80Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGE9	Missense_Mutation	SNP	pfam_DMT	p.H80Y	ENST00000297307.5	37	c.238	CCDS11293.1	17	.	.	.	.	.	.	.	.	.	.	G	12.63	1.995314	0.35226	.	.	ENSG00000164729	ENST00000297307	T	0.50548	0.74	.	.	.	.	0.000000	0.47093	D	0.000249	T	0.46814	0.1412	L	0.27053	0.805	0.34487	D	0.704537	D	0.69078	0.997	D	0.79108	0.992	T	0.53301	-0.8458	9	0.38643	T	0.18	-6.9467	5.844	0.18652	9.0E-4:0.0:0.9991:0.0	.	80	Q8N808	S35G3_HUMAN	Y	80	ENSP00000297307:H80Y	ENSP00000297307:H80Y	H	-	1	0	SLC35G3	30545202	1.000000	0.71417	0.368000	0.25939	0.369000	0.29798	4.233000	0.58651	0.064000	0.16427	0.064000	0.15345	CAC	SLC35G3	-	pfam_DMT	ENSG00000164729		0.612	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G3	HGNC	protein_coding	OTTHUMT00000256445.2	137	0.00	0	G	NM_152462		33521089	33521089	-1	no_errors	ENST00000297307	ensembl	human	known	69_37n	missense	48	31.43	22	SNP	1.000	A
TCF4	6925	genome.wustl.edu	37	18	53128339	53128339	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr18:53128339C>G	ENST00000356073.4	-	5	826	c.215G>C	c.(214-216)gGa>gCa	p.G72A	TCF4_ENST00000540999.1_Missense_Mutation_p.G48A|TCF4_ENST00000567880.1_Missense_Mutation_p.G72A|TCF4_ENST00000564999.1_Missense_Mutation_p.G72A|TCF4_ENST00000564403.2_Missense_Mutation_p.G72A|TCF4_ENST00000568673.1_Missense_Mutation_p.G48A|TCF4_ENST00000354452.3_Missense_Mutation_p.G72A|TCF4_ENST00000543082.1_Missense_Mutation_p.G30A|TCF4_ENST00000537578.1_Missense_Mutation_p.G48A|TCF4_ENST00000565018.2_Missense_Mutation_p.G72A|TCF4_ENST00000566286.1_Missense_Mutation_p.G70A|TCF4_ENST00000398339.1_Missense_Mutation_p.G174A|TCF4_ENST00000568740.1_Missense_Mutation_p.G48A|TCF4_ENST00000566279.1_Missense_Mutation_p.G72A|RP11-619L19.1_ENST00000587660.1_RNA	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	72	Essential for MYOD1 inhibition. {ECO:0000250}.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		AGTCCCATCTCCATAGTTCTG	0.388																																						dbGAP											0													81.0	80.0	80.0					18																	53128339		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.215G>C	18.37:g.53128339C>G	ENSP00000348374:p.Gly72Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.G174A	ENST00000356073.4	37	c.521	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870041	0.51588	.	.	ENSG00000196628	ENST00000354452;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000398339	T;T;T;T;T;T	0.54279	0.58;0.58;0.58;0.58;0.58;0.58	5.95	5.95	0.96441	.	0.082548	0.49305	D	0.000155	T	0.48409	0.1498	N	0.16368	0.405	0.42629	D	0.993374	B;B;P;B;B	0.49185	0.004;0.007;0.92;0.001;0.004	B;B;P;B;B	0.49999	0.008;0.013;0.628;0.003;0.012	T	0.38824	-0.9643	10	0.29301	T	0.29	-27.118	18.1662	0.89727	0.0:1.0:0.0:0.0	.	48;72;174;72;30	B7Z5M6;G0LNT9;E9PH57;P15884;B3KUC0	.;.;.;ITF2_HUMAN;.	A	72;72;30;48;48;174	ENSP00000346440:G72A;ENSP00000348374:G72A;ENSP00000439656:G30A;ENSP00000445202:G48A;ENSP00000440731:G48A;ENSP00000381382:G174A	ENSP00000346440:G72A	G	-	2	0	TCF4	51279337	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.190000	0.50973	2.824000	0.97209	0.655000	0.94253	GGA	TCF4	-	NULL	ENSG00000196628		0.388	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	47	0.00	0	C	NM_003199		53128339	53128339	-1	no_errors	ENST00000398339	ensembl	human	known	69_37n	missense	14	39.13	9	SNP	1.000	G
TDRD12	91646	genome.wustl.edu	37	19	33293948	33293948	+	Missense_Mutation	SNP	G	G	A	rs35110475	byFrequency	TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr19:33293948G>A	ENST00000444215.2	+	21	2772	c.2452G>A	c.(2452-2454)Gca>Aca	p.A818T				Q587J7	TDR12_HUMAN	tudor domain containing 12	818					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)		ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			NS(1)|breast(1)|endometrium(3)|lung(2)|prostate(1)|skin(1)	9	Esophageal squamous(110;0.137)					CAAGGTCCCCGCAGAGCTGTA	0.532													G|||	857	0.171126	0.1392	0.1686	5008	,	,		18115	0.246		0.1491	False		,,,				2504	0.1616					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK023134	CCDS46038.1	19q13.11	2013-01-23				ENSG00000173809		"""Tudor domain containing"""	25044	protein-coding gene	gene with protein product						11441184	Standard	NM_001110822		Approved	ECAT8, FLJ13072	uc002ntq.2	Q587J7		ENST00000444215.2:c.2452G>A	19.37:g.33293948G>A	ENSP00000416248:p.Ala818Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tudor,pfam_DNA/RNA_helicase_DEAD/DEAH_N	p.A818T	ENST00000444215.2	37	c.2452		19	402	0.18406593406593408	78	0.15853658536585366	56	0.15469613259668508	164	0.2867132867132867	104	0.13720316622691292	G	14.10	2.434161	0.43224	.	.	ENSG00000173809	ENST00000444215	T	0.21932	1.98	5.32	-2.86	0.05717	.	1.128210	0.06762	N	0.782019	T	0.00012	0.0000	.	.	.	0.58432	P	1.999999999946489E-6	B	0.31837	0.342	B	0.20184	0.028	T	0.39375	-0.9617	8	0.52906	T	0.07	-0.2215	9.8858	0.41260	0.0:0.3423:0.5267:0.1311	rs35110475;rs57163108;rs62126515	818	Q587J7	TDR12_HUMAN	T	818	ENSP00000416248:A818T	ENSP00000416248:A818T	A	+	1	0	TDRD12	37985788	0.013000	0.17824	0.000000	0.03702	0.971000	0.66376	0.463000	0.21972	-0.401000	0.07644	0.650000	0.86243	GCA	TDRD12	-	NULL	ENSG00000173809		0.532	TDRD12-001	KNOWN	basic|appris_principal	protein_coding	TDRD12	HGNC	protein_coding	OTTHUMT00000435933.1	40	0.00	0	G	NM_001015890		33293948	33293948	+1	no_errors	ENST00000444215	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	0.000	A
ACTRT3	84517	genome.wustl.edu	37	3	169482724	169482724	+	IGR	SNP	C	C	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr3:169482724C>T	ENST00000330368.2	-	0	2005				TERC_ENST00000602385.1_lincRNA	NM_032487.4	NP_115876.3	Q9BYD9	ACTT3_HUMAN	actin-related protein T3							cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)											CGAGGCTTTTCCGCCCGCTGA	0.612																																						dbGAP											0													23.0	25.0	25.0					3																	169482724		876	1991	2867	-	-	-	SO:0001628	intergenic_variant	0			AK055346	CCDS3206.1	3q26.2	2012-04-10			ENSG00000184378	ENSG00000184378			24022	protein-coding gene	gene with protein product	"""actin related protein M1"""	608534				11750065, 18692047	Standard	NM_032487		Approved	ARPM1	uc003ffs.2	Q9BYD9			3.37:g.169482724C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96IS0|Q96NJ0	RNA	SNP	-	NULL	ENST00000330368.2	37	NULL	CCDS3206.1	3																																																																																			TERC	-	-	ENSG00000200182		0.612	ACTRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TERC	HGNC	protein_coding	OTTHUMT00000467797.1	88	0.00	0	C	NM_032487		169482724	169482724	-1	no_errors	ENST00000363312	ensembl	human	known	69_37n	rna	33	25.00	11	SNP	0.142	T
TG	7038	genome.wustl.edu	37	8	133883774	133883774	+	Frame_Shift_Del	DEL	C	C	-			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr8:133883774delC	ENST00000220616.4	+	4	496	c.456delC	c.(454-456)cgcfs	p.R152fs	TG_ENST00000377869.1_Frame_Shift_Del_p.R152fs	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	152	Thyroglobulin type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00500}.				hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ATGGGACCCGCCAGCTGGGGA	0.592																																						dbGAP											0													95.0	71.0	79.0					8																	133883774		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.456delC	8.37:g.133883774delC	ENSP00000220616:p.Arg152fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Frame_Shift_Del	DEL	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.Q153fs	ENST00000220616.4	37	c.456	CCDS34944.1	8																																																																																			TG	-	pfam_Thyroglobulin_1,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	ENSG00000042832		0.592	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	67	0.00	0	C	NM_003235		133883774	133883774	+1	no_errors	ENST00000220616	ensembl	human	known	69_37n	frame_shift_del	15	11.76	2	DEL	0.999	-
TMTC1	83857	genome.wustl.edu	37	12	29920982	29920982	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr12:29920982T>G	ENST00000539277.1	-	2	387	c.329A>C	c.(328-330)aAc>aCc	p.N110T	TMTC1_ENST00000551659.1_Missense_Mutation_p.N110T|TMTC1_ENST00000256062.5_Missense_Mutation_p.N2T|TMTC1_ENST00000381224.2_Missense_Mutation_p.N2T|TMTC1_ENST00000552618.1_Missense_Mutation_p.N110T	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	110						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GTAGAATGGGTTCATACCAGT	0.343																																						dbGAP											0													56.0	52.0	53.0					12																	29920982		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.329A>C	12.37:g.29920982T>G	ENSP00000442046:p.Asn110Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.N2T	ENST00000539277.1	37	c.5	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	T	10.66	1.414006	0.25465	.	.	ENSG00000133687	ENST00000256062;ENST00000551659;ENST00000552618;ENST00000539277;ENST00000381224	T;D;D;D;T	0.94000	-0.45;-3.33;-3.33;-3.33;1.4	5.34	5.34	0.76211	.	0.490346	0.23356	N	0.049066	D	0.90542	0.7036	L	0.55743	1.74	0.34170	D	0.669689	B;B	0.16166	0.016;0.002	B;B	0.17098	0.017;0.002	D	0.89881	0.4030	9	.	.	.	-8.3155	12.6881	0.56960	0.0:0.0:0.0:1.0	.	2;110	Q8IUR5-3;Q8IUR5	.;TMTC1_HUMAN	T	2;110;110;110;2	ENSP00000256062:N2T;ENSP00000448112:N110T;ENSP00000449043:N110T;ENSP00000442046:N110T;ENSP00000370622:N2T	.	N	-	2	0	TMTC1	29812249	1.000000	0.71417	0.996000	0.52242	0.926000	0.56050	3.903000	0.56318	2.023000	0.59567	0.533000	0.62120	AAC	TMTC1	-	NULL	ENSG00000133687		0.343	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	44	0.00	0	T	NM_031920		29920982	29920982	-1	no_errors	ENST00000256062	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	G
TRIM33	51592	genome.wustl.edu	37	1	115006967	115006967	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr1:115006967C>A	ENST00000358465.2	-	2	653	c.570G>T	c.(568-570)caG>caT	p.Q190H	TRIM33_ENST00000369543.2_Missense_Mutation_p.Q190H|TRIM33_ENST00000450349.2_5'Flank	NM_015906.3	NP_056990.3	Q9UPN9	TRI33_HUMAN	tripartite motif containing 33	190					gene expression (GO:0010467)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein ubiquitination (GO:0016567)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	48	all_epithelial(7;0.000132)|all_lung(7;0.00106)|Lung SC(450;0.184)	all_cancers(81;3.03e-08)|all_epithelial(167;3.24e-08)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CAAGGTCTATCTGTCTGCATT	0.343			T	RET	papillary thyroid																																	dbGAP		Dom	yes		1	1p13	51592	""" tripartite motif-containing 33 (PTC7,TIF1G)"""		E	0													99.0	96.0	97.0					1																	115006967		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF220136	CCDS872.1, CCDS873.1	1p13.1	2014-02-17	2011-01-25		ENSG00000197323	ENSG00000197323		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"", ""RING-type (C3HC4) zinc fingers"""	16290	protein-coding gene	gene with protein product	"""transcriptional intermediary factor 1 gamma"", ""ret-fused gene 7"""	605769	"""tripartite motif-containing 33"""			11331580, 10022127	Standard	XM_005270936		Approved	TIF1GAMMA, FLJ11429, KIAA1113, TIFGAMMA, RFG7, TF1G, TIF1G, PTC7	uc001eew.3	Q9UPN9	OTTHUMG00000011891	ENST00000358465.2:c.570G>T	1.37:g.115006967C>A	ENSP00000351250:p.Gln190His	Somatic		WXS	Illumina GAIIx	Phase_IV	O95855|Q5TG72|Q5TG73|Q5TG74|Q9C017|Q9UJ79	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Bromodomain,prints_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain	p.Q190H	ENST00000358465.2	37	c.570	CCDS872.1	1	.	.	.	.	.	.	.	.	.	.	C	16.74	3.207373	0.58343	.	.	ENSG00000197323	ENST00000358465;ENST00000369543	T;T	0.68025	-0.3;-0.3	5.8	3.77	0.43336	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.61098	0.2320	L	0.33485	1.01	0.80722	D	1	D;B	0.64830	0.994;0.073	D;B	0.78314	0.991;0.164	T	0.63475	-0.6629	10	0.45353	T	0.12	-6.4083	10.3602	0.43989	0.0:0.772:0.0:0.228	.	190;190	Q9UPN9-2;Q9UPN9	.;TRI33_HUMAN	H	190	ENSP00000351250:Q190H;ENSP00000358556:Q190H	ENSP00000351250:Q190H	Q	-	3	2	TRIM33	114808490	0.980000	0.34600	1.000000	0.80357	0.998000	0.95712	0.488000	0.22371	0.683000	0.31428	0.655000	0.94253	CAG	TRIM33	-	NULL	ENSG00000197323		0.343	TRIM33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM33	HGNC	protein_coding	OTTHUMT00000032854.1	47	0.00	0	C	NM_015906		115006967	115006967	-1	no_errors	ENST00000358465	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	A
CCDC144A	9720	genome.wustl.edu	37	17	16701809	16701809	+	3'UTR	SNP	C	C	A			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr17:16701809C>A	ENST00000443444.2	+	0	6168				USP32P1_ENST00000393005.2_RNA|RP11-219A15.4_ENST00000602730.1_RNA|RP11-219A15.1_ENST00000448331.3_3'UTR			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		AAAAGCCCATCCTCACTCAGC	0.527																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.*1744C>A	17.37:g.16701809C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60311|Q6ZU57	RNA	SNP	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			USP32P1	-	-	ENSG00000188933		0.527	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	HGNC	protein_coding		251	0.00	0	C			16701809	16701809	+1	no_errors	ENST00000341745	ensembl	human	known	69_37n	rna	118	13.24	18	SNP	0.990	A
UTRN	7402	genome.wustl.edu	37	6	144743013	144743013	+	Splice_Site	SNP	G	G	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr6:144743013G>T	ENST00000367545.3	+	3	141		c.e3-1			NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin						aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTCTTTTACAGAGTGGGAAAC	0.398																																						dbGAP											0													90.0	78.0	82.0					6																	144743013		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.142-1G>T	6.37:g.144743013G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Splice_Site	SNP	-	e3-1	ENST00000367545.3	37	c.142-1	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313604	0.81358	.	.	ENSG00000152818	ENST00000367529;ENST00000367545;ENST00000421035	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UTRN	144784706	1.000000	0.71417	0.999000	0.59377	0.788000	0.44548	8.950000	0.93019	2.861000	0.98227	0.655000	0.94253	.	UTRN	-	-	ENSG00000152818		0.398	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	64	0	0	G		Intron	144743013	144743013	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	splice_site	29	12.12	4	SNP	1.000	T
UTRN	7402	genome.wustl.edu	37	6	144743013	144743013	+	Splice_Site	SNP	G	G	T			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr6:144743013G>T	ENST00000367545.3	+	3	141		c.e3-1			NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin						aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		TTCTTTTACAGAGTGGGAAAC	0.398																																						dbGAP											0													90.0	78.0	82.0					6																	144743013		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.142-1G>T	6.37:g.144743013G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Splice_Site	SNP	-	e3-1	ENST00000367545.3	37	c.142-1	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	G	22.6	4.313604	0.81358	.	.	ENSG00000152818	ENST00000367529;ENST00000367545;ENST00000421035	.	.	.	6.03	6.03	0.97812	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	UTRN	144784706	1.000000	0.71417	0.999000	0.59377	0.788000	0.44548	8.950000	0.93019	2.861000	0.98227	0.655000	0.94253	.	UTRN	-	-	ENSG00000152818		0.398	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	64	0.00	0	G		Intron	144743013	144743013	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	splice_site	29	12.12	4	SNP	1.000	T
WDR72	256764	genome.wustl.edu	37	15	54003115	54003115	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr15:54003115C>G	ENST00000396328.1	-	9	1132	c.893G>C	c.(892-894)aGa>aCa	p.R298T	WDR72_ENST00000360509.5_Missense_Mutation_p.R298T|WDR72_ENST00000557913.1_Missense_Mutation_p.R297T|WDR72_ENST00000559418.1_Missense_Mutation_p.R310T	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	298										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TTTAAGCACTCTTCCATCAGC	0.388																																						dbGAP											0													141.0	125.0	131.0					15																	54003115		2194	4293	6487	-	-	-	SO:0001583	missense	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.893G>C	15.37:g.54003115C>G	ENSP00000379619:p.Arg298Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R298T	ENST00000396328.1	37	c.893	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	C	7.125	0.578649	0.13686	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.16597	2.33;2.33	5.58	2.64	0.31445	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.550372	0.20175	N	0.097647	T	0.11495	0.0280	L	0.36672	1.1	0.09310	N	0.999995	B	0.06786	0.001	B	0.04013	0.001	T	0.23013	-1.0200	10	0.28530	T	0.3	.	5.9447	0.19211	0.0:0.6257:0.1537:0.2205	.	298	Q3MJ13	WDR72_HUMAN	T	298	ENSP00000379619:R298T;ENSP00000353699:R298T	ENSP00000353699:R298T	R	-	2	0	WDR72	51790407	0.995000	0.38212	0.471000	0.27229	0.924000	0.55760	1.163000	0.31798	0.816000	0.34421	0.655000	0.94253	AGA	WDR72	-	superfamily_WD40_repeat_dom	ENSG00000166415		0.388	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	59	0.00	0	C	NM_182758		54003115	54003115	-1	no_errors	ENST00000360509	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.310	G
ZBTB40	9923	genome.wustl.edu	37	1	22848143	22848143	+	Frame_Shift_Del	DEL	A	A	-			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr1:22848143delA	ENST00000375647.4	+	15	3410	c.3203delA	c.(3202-3204)gaafs	p.E1068fs	ZBTB40-IT1_ENST00000438551.1_RNA|ZBTB40_ENST00000404138.1_Frame_Shift_Del_p.E1068fs|ZBTB40_ENST00000374651.4_Frame_Shift_Del_p.E956fs	NM_014870.3	NP_055685.3	Q9NUA8	ZBT40_HUMAN	zinc finger and BTB domain containing 40	1068					bone mineralization (GO:0030282)|cellular response to DNA damage stimulus (GO:0006974)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(4)|kidney(4)|large_intestine(6)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Colorectal(325;3.46e-05)|Lung NSC(340;6.55e-05)|all_lung(284;9.87e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;2.86e-26)|Colorectal(126;8.55e-08)|COAD - Colon adenocarcinoma(152;4.1e-06)|GBM - Glioblastoma multiforme(114;1.39e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000712)|KIRC - Kidney renal clear cell carcinoma(1967;0.00374)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0693)|Lung(427;0.216)		ATCAAAGCAGAACATGCAGGT	0.542																																						dbGAP											0													161.0	136.0	144.0					1																	22848143		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB007947	CCDS224.1	1p36	2013-01-08			ENSG00000184677	ENSG00000184677		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	29045	protein-coding gene	gene with protein product		612106					Standard	NM_014870		Approved	KIAA0478, ZNF923	uc001bfu.2	Q9NUA8	OTTHUMG00000002897	ENST00000375647.4:c.3203delA	1.37:g.22848143delA	ENSP00000364798:p.Glu1068fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75066|Q5TFU5|Q8N1R1	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E1068fs	ENST00000375647.4	37	c.3203	CCDS224.1	1																																																																																			ZBTB40	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000184677		0.542	ZBTB40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB40	HGNC	protein_coding	OTTHUMT00000008094.1	37	0.00	0	A	NM_014870		22848143	22848143	+1	no_errors	ENST00000375647	ensembl	human	known	69_37n	frame_shift_del	8	20.00	2	DEL	1.000	-
ZNF273	10793	genome.wustl.edu	37	7	64363752	64363752	+	Silent	SNP	G	G	C			TCGA-GM-A3NW-01A-21D-A228-09	TCGA-GM-A3NW-10A-01D-A22A-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b7ba9ef1-b3c6-45a1-a059-5aea15561d95	70a26034-3902-4c3c-b9bb-40720ae1bb73	g.chr7:64363752G>C	ENST00000476120.1	+	1	128	c.57G>C	c.(55-57)ggG>ggC	p.G19G	ZNF273_ENST00000527278.1_Intron|ZNF273_ENST00000545510.1_5'UTR|ZNF273_ENST00000319636.5_Intron	NM_021148.2	NP_066971.2	Q14593	ZN273_HUMAN	zinc finger protein 273	19					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Lung NSC(55;0.0295)|all_lung(88;0.0691)				CAGGTATTGGGAGATCCACAG	0.597																																					Ovarian(154;605 895 6696 7659 15316 19321 21716 23848 32322 36932)	dbGAP											0													75.0	76.0	76.0					7																	64363752		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X78932	CCDS5528.2	7q11.21	2013-01-08				ENSG00000198039		"""Zinc fingers, C2H2-type"", ""-"""	13067	protein-coding gene	gene with protein product		604756				7865130	Standard	NR_003099		Approved	HZF9	uc003tto.3	Q14593		ENST00000476120.1:c.57G>C	7.37:g.64363752G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQZ5|Q6P3V4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G19	ENST00000476120.1	37	c.57	CCDS5528.2	7																																																																																			ZNF273	-	NULL	ENSG00000198039		0.597	ZNF273-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF273	HGNC	protein_coding	OTTHUMT00000313502.1	95	0.00	0	G			64363752	64363752	+1	no_errors	ENST00000476120	ensembl	human	known	69_37n	silent	26	23.53	8	SNP	0.339	C
