#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACE	1636	genome.wustl.edu	37	17	61557696	61557696	+	Splice_Site	SNP	A	A	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr17:61557696A>T	ENST00000290866.4	+	5	679		c.e5-1		ACE_ENST00000538928.1_Splice_Site|ACE_ENST00000584529.1_Splice_Site|ACE_ENST00000428043.1_Splice_Site	NM_000789.3	NP_000780.1	P12821	ACE_HUMAN	angiotensin I converting enzyme						angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|arachidonic acid secretion (GO:0050482)|blood vessel remodeling (GO:0001974)|cellular protein metabolic process (GO:0044267)|hematopoietic stem cell differentiation (GO:0060218)|hormone catabolic process (GO:0042447)|kidney development (GO:0001822)|mononuclear cell proliferation (GO:0032943)|peptide catabolic process (GO:0043171)|regulation of blood pressure (GO:0008217)|regulation of renal output by angiotensin (GO:0002019)|regulation of smooth muscle cell migration (GO:0014910)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)|regulation of vasoconstriction (GO:0019229)|regulation of vasodilation (GO:0042312)	endosome (GO:0005768)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|bradykinin receptor binding (GO:0031711)|carboxypeptidase activity (GO:0004180)|chloride ion binding (GO:0031404)|drug binding (GO:0008144)|endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(3)|lung(22)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	51					Benazepril(DB00542)|Candoxatril(DB00616)|Captopril(DB01197)|Cilazapril(DB01340)|Enalapril(DB00584)|Fosinopril(DB00492)|Lisinopril(DB00722)|Moexipril(DB00691)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Rescinnamine(DB01180)|Spirapril(DB01348)|Trandolapril(DB00519)	CCACGCCCCCAGGCTTCACAG	0.622																																						dbGAP											0													68.0	64.0	65.0					17																	61557696		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			J04144	CCDS11637.1, CCDS45755.1, CCDS54155.1	17q23.3	2013-06-12	2013-06-12		ENSG00000159640	ENSG00000159640	3.4.15.1	"""CD molecules"""	2707	protein-coding gene	gene with protein product	"""peptidyl-dipeptidase A"""	106180	"""angiotensin I converting enzyme (peptidyl-dipeptidase A) 1"""	DCP1		2554286, 10319862	Standard	NM_001178057		Approved	ACE1, CD143	uc002jau.2	P12821	OTTHUMG00000154927	ENST00000290866.4:c.656-1A>T	17.37:g.61557696A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPF0|B4DXI3|E7EU16|P22966|Q53YX9|Q59GY8|Q7M4L4	Splice_Site	SNP	-	e5-2	ENST00000290866.4	37	c.656-2	CCDS11637.1	17	.	.	.	.	.	.	.	.	.	.	A	11.49	1.653534	0.29425	.	.	ENSG00000159640	ENST00000538928;ENST00000290866;ENST00000428043	.	.	.	3.96	2.85	0.33270	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.3314	0.43825	0.8342:0.1658:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ACE	58911428	1.000000	0.71417	0.536000	0.28039	0.284000	0.27059	7.334000	0.79224	0.557000	0.29117	0.418000	0.28097	.	ACE	-	-	ENSG00000159640		0.622	ACE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACE	HGNC	protein_coding	OTTHUMT00000337675.2	50	0	0	A		Intron	61557696	61557696	+1	no_errors	ENST00000290866	ensembl	human	known	69_37n	splice_site	96	21.31	26	SNP	0.990	T
AANAT	15	genome.wustl.edu	37	17	74466051	74466051	+	Nonstop_Mutation	SNP	G	G	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr17:74466051G>T	ENST00000392492.3	+	4	857	c.623G>T	c.(622-624)tGa>tTa	p.*208L	AANAT_ENST00000250615.3_Nonstop_Mutation_p.*253L	NM_001088.2	NP_001079.1	Q16613	SNAT_HUMAN	aralkylamine N-acetyltransferase	0					cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|N-terminal protein amino acid acetylation (GO:0006474)|response to calcium ion (GO:0051592)|response to copper ion (GO:0046688)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to insulin (GO:0032868)|response to light stimulus (GO:0009416)|response to prostaglandin E (GO:0034695)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	aralkylamine N-acetyltransferase activity (GO:0004059)|arylamine N-acetyltransferase activity (GO:0004060)			lung(1)	1						AGCGGCTGCTGAACTGGGCTG	0.657																																						dbGAP											0													9.0	8.0	8.0					17																	74466051		2153	4221	6374	-	-	-	SO:0001578	stop_lost	0			U40347	CCDS11745.1, CCDS54169.1	17q25.1	2013-10-15	2010-05-07		ENSG00000129673	ENSG00000129673	2.3.1.87		19	protein-coding gene	gene with protein product	"""serotonin N-acetyltransferase"""	600950	"""arylalkylamine N-acetyltransferase"""			8661026	Standard	NM_001088		Approved	SNAT	uc002jro.3	Q16613	OTTHUMG00000180179	ENST00000392492.3:c.623G>T	17.37:g.74466051G>T	ENSP00000376282:p.*208Leuext*10	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVF2|J3KMZ5|Q562F4	Nonstop_Mutation	SNP	pfam_GNAT_dom,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.*253L	ENST00000392492.3	37	c.758	CCDS11745.1	17	.	.	.	.	.	.	.	.	.	.	G	5.950	0.359226	0.11239	.	.	ENSG00000129673	ENST00000250615;ENST00000392492	.	.	.	4.61	1.45	0.22620	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5729	0.33581	0.3091:0.0:0.6909:0.0	.	.	.	.	L	253;208	.	.	X	+	2	2	AANAT	71977646	1.000000	0.71417	0.280000	0.24747	0.360000	0.29518	1.710000	0.37920	0.124000	0.18369	-0.463000	0.05309	TGA	AANAT	-	NULL	ENSG00000129673		0.657	AANAT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AANAT	HGNC	protein_coding	OTTHUMT00000450130.1	63	0.00	0	G	NM_001088		74466051	74466051	+1	no_errors	ENST00000250615	ensembl	human	known	69_37n	nonstop	67	36.79	39	SNP	0.105	T
ACSM2A	123876	genome.wustl.edu	37	16	20492197	20492197	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr16:20492197T>C	ENST00000573854.1	+	12	1577	c.1463T>C	c.(1462-1464)gTg>gCg	p.V488A	ACSM2A_ENST00000396104.2_Missense_Mutation_p.V488A|ACSM2A_ENST00000575690.1_Missense_Mutation_p.V488A|ACSM2A_ENST00000417235.2_Missense_Mutation_p.V409A|ACSM2A_ENST00000219054.6_Missense_Mutation_p.V488A|ACSM2A_ENST00000536134.1_Missense_Mutation_p.V260A|ACSM2A_ENST00000575558.1_3'UTR	NM_001010845.2	NP_001010845	Q08AH3	ACS2A_HUMAN	acyl-CoA synthetase medium-chain family member 2A	488					fatty acid metabolic process (GO:0006631)|glucose homeostasis (GO:0042593)|medium-chain fatty-acyl-CoA metabolic process (GO:0036112)|triglyceride homeostasis (GO:0070328)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(34)|ovary(1)|skin(6)|stomach(1)	51						CACCCTGCTGTGGTTGAGACG	0.567																																						dbGAP											0													124.0	110.0	115.0					16																	20492197		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK091878, AK096039	CCDS32401.1	16p12.3	2014-08-08	2007-06-20	2007-06-20	ENSG00000183747	ENSG00000183747		"""Acyl-CoA synthetase family"""	32017	protein-coding gene	gene with protein product		614358	"""acyl-CoA synthetase medium-chain family member 2"""	ACSM2			Standard	NM_001010845		Approved	A-923A4.1, MGC150530	uc010bwe.3	Q08AH3	OTTHUMG00000177401	ENST00000573854.1:c.1463T>C	16.37:g.20492197T>C	ENSP00000459451:p.Val488Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTT9|O75202	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.V488A	ENST00000573854.1	37	c.1463	CCDS32401.1	16	.	.	.	.	.	.	.	.	.	.	T	13.71	2.317019	0.40996	.	.	ENSG00000183747	ENST00000417235;ENST00000219054;ENST00000536134;ENST00000396104	T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64	3.26	2.11	0.27256	AMP-dependent synthetase/ligase (1);	0.167652	0.27816	N	0.017736	D	0.83399	0.5246	M	0.87038	2.855	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.987	T	0.82711	-0.0322	10	0.87932	D	0	-10.7268	9.3681	0.38237	0.0:0.0:0.181:0.819	.	409;488	B7Z8R0;Q08AH3	.;ACS2A_HUMAN	A	409;488;260;488	ENSP00000392169:V409A;ENSP00000219054:V488A;ENSP00000445082:V260A;ENSP00000379411:V488A	ENSP00000219054:V488A	V	+	2	0	ACSM2A	20399698	1.000000	0.71417	0.004000	0.12327	0.425000	0.31504	6.278000	0.72614	0.274000	0.22072	0.240000	0.17902	GTG	ACSM2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000183747		0.567	ACSM2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSM2A	HGNC	protein_coding	OTTHUMT00000436764.1	57	0.00	0	T	NM_001010845		20492197	20492197	+1	no_errors	ENST00000219054	ensembl	human	known	69_37n	missense	66	12.99	10	SNP	0.796	C
ALDH1A2	8854	genome.wustl.edu	37	15	58284996	58284996	+	Silent	SNP	G	G	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr15:58284996G>T	ENST00000249750.4	-	7	1472	c.705C>A	c.(703-705)gtC>gtA	p.V235V	ALDH1A2_ENST00000347587.3_Intron|ALDH1A2_ENST00000537372.1_Silent_p.V214V|ALDH1A2_ENST00000558231.1_Silent_p.V206V|ALDH1A2_ENST00000559517.1_Silent_p.V139V	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	235					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	AAATATTGATGACCCCGGGAG	0.478																																						dbGAP											0													95.0	96.0	95.0					15																	58284996		2192	4292	6484	-	-	-	SO:0001819	synonymous_variant	0			AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.705C>A	15.37:g.58284996G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Silent	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.V235	ENST00000249750.4	37	c.705	CCDS10163.1	15																																																																																			ALDH1A2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000128918		0.478	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A2	HGNC	protein_coding	OTTHUMT00000255869.1	30	0.00	0	G			58284996	58284996	-1	no_errors	ENST00000249750	ensembl	human	known	69_37n	silent	59	23.38	18	SNP	0.986	T
ANKRD30A	91074	genome.wustl.edu	37	10	37422843	37422843	+	Splice_Site	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr10:37422843G>A	ENST00000602533.1	+	5	548		c.e5-1		ANKRD30A_ENST00000374660.1_Splice_Site|RNU6-811P_ENST00000384069.1_RNA|ANKRD30A_ENST00000361713.1_Splice_Site			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						TGTTATTTTAGCACAGCCCTC	0.363																																						dbGAP											0													141.0	130.0	134.0					10																	37422843		1900	4122	6022	-	-	-	SO:0001630	splice_region_variant	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.450-1G>A	10.37:g.37422843G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W025	Splice_Site	SNP	-	e5-1	ENST00000602533.1	37	c.450-1		10	.	.	.	.	.	.	.	.	.	.	g	12.30	1.895420	0.33442	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	.	.	.	1.43	1.43	0.22495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.3406	0.21321	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ANKRD30A	37462849	1.000000	0.71417	0.817000	0.32601	0.488000	0.33401	2.204000	0.42761	0.811000	0.34303	0.289000	0.19496	.	ANKRD30A	-	-	ENSG00000148513		0.363	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	94	0.00	0	G	NM_052997	Intron	37422843	37422843	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	splice_site	87	35.07	47	SNP	0.990	A
ANXA3	306	genome.wustl.edu	37	4	79500181	79500181	+	Splice_Site	SNP	G	G	C	rs200633440	byFrequency	TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr4:79500181G>C	ENST00000264908.6	+	4	483	c.104G>C	c.(103-105)gGa>gCa	p.G35A	ANXA3_ENST00000512884.1_5'UTR|ANXA3_ENST00000503570.2_5'UTR	NM_005139.2	NP_005130.1	P12429	ANXA3_HUMAN	annexin A3	35				G -> R (in Ref. 4; CAG28576). {ECO:0000305}.	defense response to bacterium (GO:0042742)|neutrophil degranulation (GO:0043312)|phagocytosis (GO:0006909)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)			NS(1)|breast(1)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TTTCATTTAGGAACTGATGAG	0.373																																					GBM(2;126 157 27790 28920 42492)	dbGAP											0													66.0	63.0	64.0					4																	79500181		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M63310	CCDS3584.1	4q21.21	2009-07-10			ENSG00000138772	ENSG00000138772	3.1.4.43	"""Annexins"""	541	protein-coding gene	gene with protein product		106490		ANX3		1830024	Standard	XM_005262973		Approved		uc003hld.3	P12429	OTTHUMG00000130198	ENST00000264908.6:c.104-1G>C	4.37:g.79500181G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9W6|Q6LET2	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinIII	p.G35A	ENST00000264908.6	37	c.104	CCDS3584.1	4	.	.	.	.	.	.	.	.	.	.	G	15.39	2.819504	0.50633	.	.	ENSG00000138772	ENST00000264908;ENST00000512373;ENST00000514171;ENST00000508214	T;T;T;T	0.08008	3.14;3.14;3.14;3.14	4.99	4.99	0.66335	Annexin repeat, conserved site (1);	0.056121	0.64402	D	0.000001	T	0.42607	0.1210	H	0.95816	3.725	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.59669	-0.7411	9	.	.	.	.	17.2056	0.86917	0.0:0.0:1.0:0.0	.	35	P12429	ANXA3_HUMAN	A	35	ENSP00000264908:G35A;ENSP00000424584:G35A;ENSP00000421512:G35A;ENSP00000422281:G35A	.	G	+	2	0	ANXA3	79719205	1.000000	0.71417	0.946000	0.38457	0.116000	0.19942	6.370000	0.73114	2.583000	0.87209	0.591000	0.81541	GGA	ANXA3	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin	ENSG00000138772		0.373	ANXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA3	HGNC	protein_coding	OTTHUMT00000252516.3	22	0.00	0	G	NM_005139	Missense_Mutation	79500181	79500181	+1	no_errors	ENST00000264908	ensembl	human	known	69_37n	missense	29	34.78	16	SNP	1.000	C
ARHGAP19	84986	genome.wustl.edu	37	10	99030411	99030411	+	Intron	SNP	G	G	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr10:99030411G>T	ENST00000358531.4	-	2	85				ARHGAP19_ENST00000355366.5_5'UTR|ARHGAP19-SLIT1_ENST00000358308.3_Intron|ARHGAP19-SLIT1_ENST00000453547.2_Intron|ARHGAP19-SLIT1_ENST00000316676.8_Intron|ARHGAP19_ENST00000371027.1_5'UTR	NM_001204300.1|NM_032900.5	NP_001191229.1|NP_116289.4	Q14CB8	RHG19_HUMAN	Rho GTPase activating protein 19						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)|stomach(2)|urinary_tract(1)	13		Colorectal(252;0.0854)		Epithelial(162;7.65e-09)|all cancers(201;4.49e-07)		GAAGAGACAGGAAGAAAGCTT	0.388																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK074122	CCDS7454.2, CCDS58092.1, CCDS73175.1	10q24.2	2011-06-29			ENSG00000213390	ENSG00000213390		"""Rho GTPase activating proteins"""	23724	protein-coding gene	gene with protein product		611587					Standard	NM_032900		Approved	FLJ00194, MGC14258	uc001knb.3	Q14CB8	OTTHUMG00000018845	ENST00000358531.4:c.57-4529C>A	10.37:g.99030411G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1XCP1|B4DZR1|Q14CF2|Q5J8M2|Q5T460|Q5T462|Q68DG6|Q8N9X1|Q8NF34|Q8TEK1	RNA	SNP	-	NULL	ENST00000358531.4	37	NULL	CCDS7454.2	10																																																																																			ARHGAP19	-	-	ENSG00000213390		0.388	ARHGAP19-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP19	HGNC	protein_coding	OTTHUMT00000049647.2	42	0.00	0	G	NM_032900		99030411	99030411	-1	no_errors	ENST00000479633	ensembl	human	known	69_37n	rna	17	37.04	10	SNP	1.000	T
ASXL3	80816	genome.wustl.edu	37	18	31314329	31314329	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr18:31314329G>C	ENST00000269197.5	+	10	1032	c.1032G>C	c.(1030-1032)aaG>aaC	p.K344N		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	344					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						AGAAGGAAAAGAAAACAGAAC	0.323																																						dbGAP											0													55.0	55.0	55.0					18																	31314329		1797	4062	5859	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.1032G>C	18.37:g.31314329G>C	ENSP00000269197:p.Lys344Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.K344N	ENST00000269197.5	37	c.1032	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672932	0.88445	.	.	ENSG00000141431	ENST00000269197	T	0.21932	1.98	5.71	5.71	0.89125	.	0.277928	0.35378	N	0.003258	T	0.49525	0.1562	M	0.72118	2.19	0.53005	D	0.999968	D	0.89917	1.0	D	0.91635	0.999	T	0.47407	-0.9120	10	0.87932	D	0	.	19.8549	0.96755	0.0:0.0:1.0:0.0	.	344	Q9C0F0	ASXL3_HUMAN	N	344	ENSP00000269197:K344N	ENSP00000269197:K344N	K	+	3	2	ASXL3	29568327	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.477000	0.81069	2.699000	0.92147	0.460000	0.39030	AAG	ASXL3	-	NULL	ENSG00000141431		0.323	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	35	0.00	0	G			31314329	31314329	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	47	25.00	16	SNP	1.000	C
BPIFB4	149954	genome.wustl.edu	37	20	31672753	31672753	+	Missense_Mutation	SNP	G	G	C	rs145491929		TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr20:31672753G>C	ENST00000375483.3	+	4	733	c.733G>C	c.(733-735)Gtg>Ctg	p.V245L		NM_182519.2	NP_872325.2	P59827	BPIB4_HUMAN	BPI fold containing family B, member 4	245						cytoplasm (GO:0005737)|extracellular region (GO:0005576)	lipid binding (GO:0008289)										CCTGCCCGGCGTGGGTGTCTA	0.667																																						dbGAP											0													54.0	42.0	46.0					20																	31672753		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF549190	CCDS13213.2	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000186191	ENSG00000186191		"""BPI fold containing"""	16179	protein-coding gene	gene with protein product		615718	"""chromosome 20 open reading frame 186"""	C20orf186		11971875, 21787333	Standard	NM_182519		Approved	dJ726C3.5, LPLUNC4	uc010zue.2	P59827	OTTHUMG00000032235	ENST00000375483.3:c.733G>C	20.37:g.31672753G>C	ENSP00000364632:p.Val245Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDX6	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.V245L	ENST00000375483.3	37	c.733	CCDS13213.2	20	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480689	0.63849	.	.	ENSG00000186191	ENST00000375483	T	0.06528	3.29	3.39	3.39	0.38822	.	0.264809	0.26279	N	0.025284	T	0.07503	0.0189	L	0.38175	1.15	0.30042	N	0.812562	P	0.44734	0.842	P	0.45099	0.469	T	0.04347	-1.0958	10	0.48119	T	0.1	-9.4267	10.14	0.42730	0.0:0.0:1.0:0.0	.	245	P59827	BPIB4_HUMAN	L	245	ENSP00000364632:V245L	ENSP00000364632:V245L	V	+	1	0	BPIFB4	31136414	0.960000	0.32886	0.998000	0.56505	0.896000	0.52359	1.654000	0.37334	1.749000	0.51849	0.484000	0.47621	GTG	BPIFB4	-	pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N	ENSG00000186191		0.667	BPIFB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB4	HGNC	protein_coding	OTTHUMT00000078655.5	60	0.00	0	G	NM_182519		31672753	31672753	+1	no_errors	ENST00000375483	ensembl	human	known	69_37n	missense	67	31.63	31	SNP	0.998	C
BTRC	8945	genome.wustl.edu	37	10	103295142	103295142	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr10:103295142G>C	ENST00000370187.3	+	11	1497	c.1379G>C	c.(1378-1380)aGg>aCg	p.R460T	BTRC_ENST00000393441.4_Missense_Mutation_p.R419T|BTRC_ENST00000493877.1_3'UTR|BTRC_ENST00000408038.2_Missense_Mutation_p.R424T	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	460					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		GAATTTGTAAGGACCTTAAAT	0.423																																						dbGAP											0													132.0	127.0	129.0					10																	103295142		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.1379G>C	10.37:g.103295142G>C	ENSP00000359206:p.Arg460Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Beta-TrCP_D,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R460T	ENST00000370187.3	37	c.1379	CCDS7512.1	10	.	.	.	.	.	.	.	.	.	.	G	22.3	4.270808	0.80469	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000408038	T;T;T	0.40476	1.03;1.03;1.03	5.61	5.61	0.85477	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.62392	0.2424	L	0.56124	1.755	0.80722	D	1	D;D;D	0.76494	0.999;0.995;0.985	D;P;D	0.74674	0.984;0.907;0.939	T	0.63019	-0.6730	10	0.72032	D	0.01	-13.7624	19.6321	0.95713	0.0:0.0:1.0:0.0	.	434;424;460	B7Z3H4;Q9Y297-2;Q9Y297	.;.;FBW1A_HUMAN	T	460;419;424	ENSP00000359206:R460T;ENSP00000377088:R419T;ENSP00000385339:R424T	ENSP00000359206:R460T	R	+	2	0	BTRC	103285132	1.000000	0.71417	1.000000	0.80357	0.405000	0.30901	9.869000	0.99810	2.658000	0.90341	0.650000	0.86243	AGG	BTRC	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000166167		0.423	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTRC	HGNC	protein_coding	OTTHUMT00000049936.1	46	0.00	0	G	NM_033637		103295142	103295142	+1	no_errors	ENST00000370187	ensembl	human	known	69_37n	missense	26	56.67	34	SNP	1.000	C
C16orf78	123970	genome.wustl.edu	37	16	49430463	49430463	+	Missense_Mutation	SNP	G	G	A	rs61605376	byFrequency	TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr16:49430463G>A	ENST00000299191.3	+	4	641	c.524G>A	c.(523-525)aGa>aAa	p.R175K		NM_144602.2	NP_653203.1	Q8WTQ4	CP078_HUMAN	chromosome 16 open reading frame 78	175						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(1)	22						ACCTTCATAAGAGACTGGTCC	0.493																																						dbGAP											0													94.0	85.0	88.0					16																	49430463		2199	4300	6499	-	-	-	SO:0001583	missense	0			BC021181	CCDS10738.1	16q12.1	2008-02-05			ENSG00000166152	ENSG00000166152			28479	protein-coding gene	gene with protein product						12477932	Standard	NM_144602		Approved	MGC33367	uc002efr.3	Q8WTQ4	OTTHUMG00000133149	ENST00000299191.3:c.524G>A	16.37:g.49430463G>A	ENSP00000299191:p.Arg175Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R175K	ENST00000299191.3	37	c.524	CCDS10738.1	16	.	.	.	.	.	.	.	.	.	.	G	12.06	1.825832	0.32237	.	.	ENSG00000166152	ENST00000299191	T	0.59083	0.29	5.29	4.34	0.51931	.	0.114669	0.39985	N	0.001214	T	0.53142	0.1778	M	0.69823	2.125	0.09310	N	1	P	0.40107	0.703	B	0.36464	0.225	T	0.51872	-0.8650	9	.	.	.	-38.9535	10.0068	0.41961	0.0941:0.0:0.9059:0.0	.	175	Q8WTQ4	CP078_HUMAN	K	175	ENSP00000299191:R175K	.	R	+	2	0	C16orf78	47987964	0.972000	0.33761	0.232000	0.24009	0.006000	0.05464	1.952000	0.40343	1.354000	0.45846	0.655000	0.94253	AGA	C16orf78	-	NULL	ENSG00000166152		0.493	C16orf78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf78	HGNC	protein_coding	OTTHUMT00000256846.1	32	0.00	0	G	NM_144602		49430463	49430463	+1	no_errors	ENST00000299191	ensembl	human	known	69_37n	missense	37	31.48	17	SNP	0.175	A
C1orf116	79098	genome.wustl.edu	37	1	207195857	207195857	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:207195857G>C	ENST00000359470.5	-	4	1501	c.1252C>G	c.(1252-1254)Cca>Gca	p.P418A	C1orf116_ENST00000461135.2_Missense_Mutation_p.P172A	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	418	Ala-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					gctggacctggagctggagcc	0.597																																						dbGAP											0													34.0	36.0	35.0					1																	207195857		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.1252C>G	1.37:g.207195857G>C	ENSP00000352447:p.Pro418Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JV41|Q658X3	Missense_Mutation	SNP	NULL	p.P418A	ENST00000359470.5	37	c.1252	CCDS1475.1	1	.	.	.	.	.	.	.	.	.	.	G	12.56	1.973690	0.34848	.	.	ENSG00000182795	ENST00000359470;ENST00000461135	T;T	0.19938	3.07;2.11	5.16	3.21	0.36854	.	0.775161	0.12377	N	0.474271	T	0.15869	0.0382	L	0.29908	0.895	0.09310	N	1	P	0.46064	0.872	B	0.42692	0.395	T	0.08806	-1.0704	10	0.32370	T	0.25	-5.4424	7.4461	0.27211	0.0931:0.167:0.7399:0.0	.	418	Q9BW04	SARG_HUMAN	A	418;172	ENSP00000352447:P418A;ENSP00000436862:P172A	ENSP00000352447:P418A	P	-	1	0	C1orf116	205262480	0.000000	0.05858	0.005000	0.12908	0.120000	0.20174	-0.148000	0.10219	1.133000	0.42147	0.655000	0.94253	CCA	C1orf116	-	NULL	ENSG00000182795		0.597	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf116	HGNC	protein_coding	OTTHUMT00000088973.1	21	0.00	0	G	NM_024115		207195857	207195857	-1	no_errors	ENST00000359470	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	0.083	C
CFAP61	26074	genome.wustl.edu	37	20	20269404	20269404	+	Missense_Mutation	SNP	T	T	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr20:20269404T>A	ENST00000245957.5	+	23	3024	c.2948T>A	c.(2947-2949)tTc>tAc	p.F983Y	C20orf26_ENST00000377309.2_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		983										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		CTCACCAAATTCTCCAATAGA	0.448																																						dbGAP											0													110.0	102.0	105.0					20																	20269404		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000245957.5:c.2948T>A	20.37:g.20269404T>A	ENSP00000245957:p.Phe983Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.F983Y	ENST00000245957.5	37	c.2948	CCDS33447.1	20	.	.	.	.	.	.	.	.	.	.	T	10.81	1.454882	0.26161	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.42513	0.97	5.75	4.63	0.57726	.	0.172374	0.52532	N	0.000069	T	0.19565	0.0470	N	0.05554	-0.025	0.80722	D	1	B	0.29115	0.233	B	0.19148	0.024	T	0.06534	-1.0821	10	0.15066	T	0.55	.	10.3451	0.43901	0.3715:0.0:0.0:0.6284	.	983	Q8NHU2	CT026_HUMAN	Y	923;949;983	ENSP00000245957:F983Y	ENSP00000245957:F983Y	F	+	2	0	C20orf26	20217404	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.803000	0.38863	0.983000	0.38602	0.528000	0.53228	TTC	C20orf26	-	NULL	ENSG00000089101		0.448	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	45	0.00	0	T			20269404	20269404	+1	no_errors	ENST00000245957	ensembl	human	known	69_37n	missense	43	41.89	31	SNP	1.000	A
C7orf62	219557	genome.wustl.edu	37	7	88424169	88424169	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr7:88424169A>G	ENST00000297203.2	-	2	273	c.88T>C	c.(88-90)Tac>Cac	p.Y30H	ZNF804B_ENST00000333190.4_Intron	NM_152706.3	NP_689919.1	Q8TBZ9	CG062_HUMAN	chromosome 7 open reading frame 62	30										NS(1)|breast(1)|endometrium(3)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	30						AAGTGCAGGTAATTGCTACGT	0.418																																						dbGAP											0													124.0	133.0	130.0					7																	88424169		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028365	CCDS34678.1	7q21.13	2013-10-11			ENSG00000164645	ENSG00000164645			22402	protein-coding gene	gene with protein product						12690205	Standard	NM_152706		Approved	MGC26647	uc003ujv.3	Q8TBZ9	OTTHUMG00000153859	ENST00000297203.2:c.88T>C	7.37:g.88424169A>G	ENSP00000297203:p.Tyr30His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Y30H	ENST00000297203.2	37	c.88	CCDS34678.1	7	.	.	.	.	.	.	.	.	.	.	A	21.1	4.098246	0.76870	.	.	ENSG00000164645	ENST00000297203	T	0.20881	2.04	6.16	6.16	0.99307	.	0.164394	0.42420	D	0.000705	T	0.45935	0.1367	M	0.72118	2.19	0.33709	D	0.615594	D	0.89917	1.0	D	0.91635	0.999	T	0.62248	-0.6894	10	0.87932	D	0	-0.0134	13.1979	0.59749	1.0:0.0:0.0:0.0	.	30	Q8TBZ9	CG062_HUMAN	H	30	ENSP00000297203:Y30H	ENSP00000297203:Y30H	Y	-	1	0	C7orf62	88262105	1.000000	0.71417	0.998000	0.56505	0.935000	0.57460	4.247000	0.58750	2.367000	0.80283	0.528000	0.53228	TAC	C7orf62	-	NULL	ENSG00000164645		0.418	C7orf62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf62	HGNC	protein_coding	OTTHUMT00000332714.1	72	0.00	0	A	NM_152706		88424169	88424169	-1	no_errors	ENST00000297203	ensembl	human	known	69_37n	missense	69	24.18	22	SNP	1.000	G
CADM1	23705	genome.wustl.edu	37	11	115102163	115102163	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr11:115102163C>G	ENST00000452722.3	-	4	492	c.472G>C	c.(472-474)Gaa>Caa	p.E158Q	CADM1_ENST00000331581.6_Missense_Mutation_p.E158Q|CADM1_ENST00000536727.1_Missense_Mutation_p.E158Q|CADM1_ENST00000542447.2_Missense_Mutation_p.E158Q|CADM1_ENST00000537058.1_Missense_Mutation_p.E158Q|CADM1_ENST00000537140.1_5'UTR	NM_014333.3	NP_055148.3			cell adhesion molecule 1											cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(9)|ovary(2)|skin(1)	32	all_hematologic(175;0.0628)	all_cancers(61;2.98e-14)|all_epithelial(67;2.64e-08)|all_hematologic(158;0.000154)|Melanoma(852;0.000952)|Acute lymphoblastic leukemia(157;0.00101)|Breast(348;0.0102)|Medulloblastoma(222;0.0429)|Prostate(24;0.145)|all_neural(223;0.237)		BRCA - Breast invasive adenocarcinoma(274;5.01e-06)|Epithelial(105;0.000305)|all cancers(92;0.00303)		TCCTCACCTTCCACCGCAGTG	0.438																																						dbGAP											0													261.0	214.0	230.0					11																	115102163		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB017563	CCDS8373.1, CCDS53711.1, CCDS73397.1, CCDS73398.1, CCDS73399.1	11q23.2	2013-01-29	2007-02-07	2007-02-07	ENSG00000182985	ENSG00000182985		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5951	protein-coding gene	gene with protein product	"""nectin-like 2"""	605686	"""tumor suppressor in lung cancer 1"", ""immunoglobulin superfamily, member 4"""	TSLC1, IGSF4		10610705	Standard	NM_014333		Approved	NECL2, ST17, BL2, SYNCAM, IGSF4A, Necl-2, SYNCAM1, RA175	uc001ppi.4	Q9BY67	OTTHUMG00000168202	ENST00000452722.3:c.472G>C	11.37:g.115102163C>G	ENSP00000395359:p.Glu158Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like	p.E158Q	ENST00000452722.3	37	c.472	CCDS8373.1	11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	34|34|34	5.370105|5.370105|5.370105	0.95900|0.95900|0.95900	.|.|.	.|.|.	ENSG00000182985|ENSG00000182985|ENSG00000182985	ENST00000542447;ENST00000452722;ENST00000537058;ENST00000536727;ENST00000404468;ENST00000331581;ENST00000542450;ENST00000543540;ENST00000545094|ENST00000545380|ENST00000543249	T;T;T;T;T;T;T;T|.|.	0.78481|.|.	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18;-1.18;-1.18|.|.	6.17|6.17|6.17	6.17|6.17|6.17	0.99709|0.99709|0.99709	CD80-like, immunoglobulin C2-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	D|D|D	0.84266|0.84266|0.84266	0.5434|0.5434|0.5434	M|M|M	0.86268|0.86268|0.86268	2.805|2.805|2.805	0.80722|0.80722|0.80722	D|D|D	1|1|1	D;D;D;D;D|.|.	0.89917|.|.	0.999;1.0;0.999;1.0;0.997|.|.	D;D;D;D;D|.|.	0.97110|.|.	0.995;0.998;0.997;1.0;0.992|.|.	D|D|D	0.83810|0.83810|0.83810	0.0241|0.0241|0.0241	10|5|5	0.41790|.|.	T|.|.	0.15|.|.	.|.|.	20.8794|20.8794|20.8794	0.99867|0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.|.	158;158;159;158;158|.|.	Q9BY67-2;F5H0J4;A4FVB5;Q9BY67;A0A4Z1|.|.	.;.;.;CADM1_HUMAN;.|.|.	Q|A|C	158;158;158;158;117;158;11;11;125|156|141	ENSP00000439176:E158Q;ENSP00000395359:E158Q;ENSP00000439817:E158Q;ENSP00000440322:E158Q;ENSP00000329797:E158Q;ENSP00000442001:E11Q;ENSP00000439847:E11Q;ENSP00000439696:E125Q|.|.	ENSP00000329797:E158Q|.|.	E|G|W	-|-|-	1|2|3	0|0|0	CADM1|CADM1|CADM1	114607373|114607373|114607373	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.885000|0.885000|0.885000	0.51271|0.51271|0.51271	7.456000|7.456000|7.456000	0.80751|0.80751|0.80751	2.941000|2.941000|2.941000	0.99782|0.99782|0.99782	0.655000|0.655000|0.655000	0.94253|0.94253|0.94253	GAA|GGA|TGG	CADM1	-	pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000182985		0.438	CADM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CADM1	HGNC	protein_coding	OTTHUMT00000398753.2	137	0.00	0	C	NM_014333		115102163	115102163	-1	no_errors	ENST00000452722	ensembl	human	known	69_37n	missense	96	17.24	20	SNP	1.000	G
CCDC120	90060	genome.wustl.edu	37	X	48922006	48922006	+	Missense_Mutation	SNP	C	C	G	rs367553934		TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chrX:48922006C>G	ENST00000376396.3	+	6	649	c.430C>G	c.(430-432)Cgg>Ggg	p.R144G	CCDC120_ENST00000422185.2_Missense_Mutation_p.R144G|CCDC120_ENST00000597275.1_Missense_Mutation_p.R144G|CCDC120_ENST00000496529.2_Missense_Mutation_p.R144G|CCDC120_ENST00000603986.1_Missense_Mutation_p.R179G|CCDC120_ENST00000536628.2_Missense_Mutation_p.R132G	NM_001271835.1|NM_001271836.1|NM_033626.2	NP_001258764.1|NP_001258765.1|NP_296375.1	Q96HB5	CC120_HUMAN	coiled-coil domain containing 120	144										breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14						CGAGCAGCGCCGGCGCCGGCG	0.706																																						dbGAP											0													5.0	6.0	6.0					X																	48922006		2109	4072	6181	-	-	-	SO:0001583	missense	0			BC008769	CCDS14316.1, CCDS55413.1, CCDS55414.1, CCDS55414.2	Xp11.23	2008-02-05			ENSG00000147144	ENSG00000147144			28910	protein-coding gene	gene with protein product						12477932	Standard	NM_033626		Approved	JM11	uc011mmr.3	Q96HB5	OTTHUMG00000021509	ENST00000376396.3:c.430C>G	X.37:g.48922006C>G	ENSP00000365577:p.Arg144Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFC1|B4DTU2|F5GZU4	Missense_Mutation	SNP	pfam_DUF3338	p.R144G	ENST00000376396.3	37	c.430	CCDS14316.1	X	.	.	.	.	.	.	.	.	.	.	C	13.91	2.377679	0.42105	.	.	ENSG00000147144	ENST00000376396;ENST00000422185;ENST00000536628	.	.	.	4.81	2.98	0.34508	.	0.000000	0.48286	D	0.000188	T	0.48804	0.1520	N	0.19112	0.55	0.34283	D	0.682349	D;D;D;D	0.63880	0.987;0.993;0.993;0.987	D;D;D;D	0.74023	0.953;0.982;0.982;0.953	T	0.59820	-0.7382	9	0.87932	D	0	-8.988	8.0016	0.30299	0.1801:0.6494:0.1705:0.0	.	132;179;132;144	B4DTU2;B4DFC1;B4DF24;Q96HB5	.;.;.;CC120_HUMAN	G	144;144;132	.	ENSP00000365577:R144G	R	+	1	2	CCDC120	48808950	0.952000	0.32445	0.758000	0.31321	0.135000	0.20990	1.481000	0.35476	0.278000	0.22164	0.468000	0.43344	CGG	CCDC120	-	NULL	ENSG00000147144		0.706	CCDC120-001	KNOWN	basic|CCDS	protein_coding	CCDC120	HGNC	protein_coding	OTTHUMT00000056528.1	22	0.00	0	C	NM_033626		48922006	48922006	+1	no_errors	ENST00000422185	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	0.981	G
CEP83	51134	genome.wustl.edu	37	12	94729586	94729586	+	Intron	SNP	G	G	A	rs78047124	byFrequency	TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr12:94729586G>A	ENST00000397809.5	-	12	1893				CCDC41_ENST00000397807.2_Intron|CCDC41_ENST00000339839.5_Intron	NM_016122.2	NP_057206.2	Q9Y592	CEP83_HUMAN							cilium assembly (GO:0042384)|protein localization to centrosome (GO:0071539)|vesicle docking (GO:0048278)	centriole (GO:0005814)|ciliary transition fiber (GO:0097539)|Golgi apparatus (GO:0005794)				breast(1)|central_nervous_system(3)|kidney(3)|large_intestine(8)|lung(8)|prostate(2)|skin(2)	27						ACTAGGTTGTGTTCACGTATA	0.348													G|||	211	0.0421326	0.1437	0.0274	5008	,	,		18738	0.0		0.002	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0																														ENST00000397809.5:c.1344-146C>T	12.37:g.94729586G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVB1|Q08AP1	RNA	SNP	-	NULL	ENST00000397809.5	37	NULL	CCDS41820.1	12																																																																																			CCDC41	-	-	ENSG00000173588		0.348	CCDC41-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CCDC41	HGNC	protein_coding	OTTHUMT00000408147.3	8	0.00	0	G			94729586	94729586	-1	no_errors	ENST00000546587	ensembl	human	known	69_37n	rna	2	71.43	5	SNP	0.000	A
CELA3B	23436	genome.wustl.edu	37	1	22304463	22304463	+	Intron	SNP	A	A	G	rs12058649	byFrequency	TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:22304463A>G	ENST00000337107.6	+	2	62				RN7SL421P_ENST00000582599.1_RNA	NM_007352.2	NP_031378.1	P08861	CEL3B_HUMAN	chymotrypsin-like elastase family, member 3B						cholesterol metabolic process (GO:0008203)|proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			breast(2)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	8						cggcctctcaaagcactagga	0.493													G|||	3804	0.759585	0.5862	0.8588	5008	,	,		13145	0.6558		0.8936	False		,,,				2504	0.8926					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			M18692	CCDS219.1	1p36.12	2009-05-05	2009-05-05	2009-05-05	ENSG00000219073	ENSG00000219073	3.4.21.70		15945	protein-coding gene	gene with protein product	"""proteinase E"", ""elastase 1"", ""cholesterol-binding pancreatic protease"", ""pancreatic endopeptidase E"""		"""elastase 3B, pancreatic"""	ELA3B		2826474, 2460440	Standard	NM_007352		Approved	CBPP	uc001bfk.3	P08861	OTTHUMG00000002758	ENST00000337107.6:c.44-399A>G	1.37:g.22304463A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE44|P11423|Q5VU28|Q5VU29|Q5VU30	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.Q25	ENST00000337107.6	37	c.75	CCDS219.1	1																																																																																			CELA3B	-	NULL	ENSG00000219073		0.493	CELA3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA3B	HGNC	protein_coding	OTTHUMT00000007797.1	24	0.00	0	A	NM_007352		22304463	22304463	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000374666	ensembl	human	known	69_37n	silent	11	21.43	3	SNP	0.000	G
CELSR3	1951	genome.wustl.edu	37	3	48699704	48699704	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr3:48699704C>G	ENST00000164024.4	-	1	644	c.364G>C	c.(364-366)Gaa>Caa	p.E122Q	RP11-148G20.1_ENST00000421275.1_RNA|CELSR3_ENST00000544264.1_Missense_Mutation_p.E122Q	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	122					axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		GTCTCTCGTTCGCGGCTGCCC	0.622																																						dbGAP											0													85.0	96.0	92.0					3																	48699704		2184	4267	6451	-	-	-	SO:0001583	missense	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.364G>C	3.37:g.48699704C>G	ENSP00000164024:p.Glu122Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O75092	Missense_Mutation	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E122Q	ENST00000164024.4	37	c.364	CCDS2775.1	3	.	.	.	.	.	.	.	.	.	.	C	0.110	-1.140248	0.01728	.	.	ENSG00000008300	ENST00000164024;ENST00000544264	T;T	0.70631	-0.5;-0.5	4.59	-0.768	0.11013	.	.	.	.	.	T	0.45296	0.1335	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.25363	-1.0134	9	0.32370	T	0.25	.	6.8335	0.23923	0.0:0.3228:0.43:0.2472	.	122;192	Q9NYQ7;Q5Y190	CELR3_HUMAN;.	Q	122	ENSP00000164024:E122Q;ENSP00000445694:E122Q	ENSP00000164024:E122Q	E	-	1	0	CELSR3	48674708	0.000000	0.05858	0.001000	0.08648	0.061000	0.15899	-0.091000	0.11146	-0.044000	0.13491	-0.948000	0.02665	GAA	CELSR3	-	NULL	ENSG00000008300		0.622	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	81	0.00	0	C	NM_001407		48699704	48699704	-1	no_errors	ENST00000544264	ensembl	human	known	69_37n	missense	52	36.59	30	SNP	0.000	G
CEP250	11190	genome.wustl.edu	37	20	34084421	34084421	+	Silent	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr20:34084421G>C	ENST00000397527.1	+	25	3903	c.3183G>C	c.(3181-3183)ctG>ctC	p.L1061L	CEP250_ENST00000342580.4_Silent_p.L1005L	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	1061	Gln/Glu-rich.				centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CTCTGTCACTGATGGAAAAGG	0.473																																						dbGAP											0													75.0	70.0	71.0					20																	34084421		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.3183G>C	20.37:g.34084421G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Q3|O14812|O60588|Q9H450	Silent	SNP	superfamily_Prefoldin	p.L1061	ENST00000397527.1	37	c.3183	CCDS13255.1	20																																																																																			CEP250	-	NULL	ENSG00000126001		0.473	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	18	0.00	0	G	NM_007186		34084421	34084421	+1	no_errors	ENST00000397527	ensembl	human	known	69_37n	silent	40	38.46	25	SNP	0.986	C
CRYZ	1429	genome.wustl.edu	37	1	75180309	75180309	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:75180309C>G	ENST00000340866.5	-	5	521	c.434G>C	c.(433-435)tGt>tCt	p.C145S	CRYZ_ENST00000370872.3_Missense_Mutation_p.C8S|CRYZ_ENST00000370871.3_Missense_Mutation_p.C145S|CRYZ_ENST00000417775.1_Missense_Mutation_p.C145S	NM_001889.3	NP_001880.2	Q08257	QOR_HUMAN	crystallin, zeta (quinone reductase)	145					protein homotetramerization (GO:0051289)|visual perception (GO:0007601)|xenobiotic catabolic process (GO:0042178)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	mRNA 3'-UTR binding (GO:0003730)|NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)	10					Dicoumarol(DB00266)	AGCTTTCACACAGGCACTGCA	0.383																																						dbGAP											0													100.0	94.0	96.0					1																	75180309		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS665.1, CCDS44162.1, CCDS44163.1	1p31.1	2013-02-14			ENSG00000116791	ENSG00000116791			2419	protein-coding gene	gene with protein product		123691					Standard	NM_001889		Approved		uc001dgj.3	Q08257	OTTHUMG00000009620	ENST00000340866.5:c.434G>C	1.37:g.75180309C>G	ENSP00000339399:p.Cys145Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN60|D3DQ76|Q53FT0|Q59EU7|Q5HYE7|Q6NSK9	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.C145S	ENST00000340866.5	37	c.434	CCDS665.1	1	.	.	.	.	.	.	.	.	.	.	C	0.014	-1.578668	0.00879	.	.	ENSG00000116791	ENST00000340866;ENST00000370872;ENST00000417775;ENST00000370871;ENST00000370870;ENST00000441120	T;T;T;T;T;T	0.39056	1.1;1.67;1.1;1.1;1.1;1.1	5.71	-0.436	0.12275	GroES-like (1);	0.360246	0.32901	N	0.005519	T	0.04092	0.0114	N	0.02158	-0.66	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.44390	-0.9331	10	0.17369	T	0.5	.	6.6787	0.23108	0.0:0.3398:0.128:0.5322	.	8;145;145	Q5HYE7;A6NN60;Q08257	.;.;QOR_HUMAN	S	145;8;145;145;145;145	ENSP00000339399:C145S;ENSP00000359909:C8S;ENSP00000399805:C145S;ENSP00000359908:C145S;ENSP00000359907:C145S;ENSP00000404289:C145S	ENSP00000339399:C145S	C	-	2	0	CRYZ	74952897	0.000000	0.05858	0.088000	0.20740	0.327000	0.28475	-0.258000	0.08733	0.098000	0.17522	-0.222000	0.12452	TGT	CRYZ	-	superfamily_GroES-like,smart_PKS_ER	ENSG00000116791		0.383	CRYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYZ	HGNC	protein_coding	OTTHUMT00000026514.1	53	0.00	0	C			75180309	75180309	-1	no_errors	ENST00000340866	ensembl	human	known	69_37n	missense	56	22.22	16	SNP	0.008	G
CSMD3	114788	genome.wustl.edu	37	8	114031335	114031335	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr8:114031335T>C	ENST00000297405.5	-	6	1235	c.991A>G	c.(991-993)Agc>Ggc	p.S331G	CSMD3_ENST00000343508.3_Missense_Mutation_p.S291G|CSMD3_ENST00000455883.2_Missense_Mutation_p.S331G|CSMD3_ENST00000352409.3_Missense_Mutation_p.S331G	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	331	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						CGATGATTGCTGTCTGTAACA	0.353										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													219.0	198.0	206.0					8																	114031335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.991A>G	8.37:g.114031335T>C	ENSP00000297405:p.Ser331Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.S331G	ENST00000297405.5	37	c.991	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	T	9.386	1.074213	0.20227	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000455883;ENST00000352409	D;D;D;D	0.93488	-3.23;-3.23;-3.23;-3.23	5.46	4.3	0.51218	CUB (5);	0.125351	0.50627	D	0.000110	D	0.85708	0.5759	N	0.13043	0.29	0.27699	N	0.945865	B;B;B;B	0.20671	0.047;0.0;0.004;0.018	B;B;B;B	0.22152	0.021;0.003;0.007;0.038	T	0.74087	-0.3778	10	0.26408	T	0.33	.	11.2047	0.48762	0.0:0.0722:0.0:0.9278	.	331;331;331;291	Q7Z407-3;Q7Z407-4;Q7Z407;Q7Z407-2	.;.;CSMD3_HUMAN;.	G	291;331;331;331	ENSP00000345799:S291G;ENSP00000297405:S331G;ENSP00000412263:S331G;ENSP00000343124:S331G	ENSP00000297405:S331G	S	-	1	0	CSMD3	114100511	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	5.945000	0.70226	0.904000	0.36572	0.377000	0.23210	AGC	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000164796		0.353	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	56	0.00	0	T	NM_052900		114031335	114031335	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	74	20.43	19	SNP	1.000	C
CYP4X1	260293	genome.wustl.edu	37	1	47489663	47489663	+	Silent	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:47489663G>A	ENST00000371901.3	+	1	424	c.174G>A	c.(172-174)caG>caA	p.Q58Q	CYP4X1_ENST00000538609.1_Intron	NM_178033.1	NP_828847.1	Q8N118	CP4X1_HUMAN	cytochrome P450, family 4, subfamily X, polypeptide 1	58						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	17						TTGGGCACCagaaggtagatg	0.677																																						dbGAP											0													12.0	14.0	13.0					1																	47489663		2193	4290	6483	-	-	-	SO:0001819	synonymous_variant	0			AK091806	CCDS544.1	1p33	2008-02-05			ENSG00000186377	ENSG00000186377		"""Cytochrome P450s"""	20244	protein-coding gene	gene with protein product		614999				12176035	Standard	NM_178033		Approved	MGC40051	uc001cqt.3	Q8N118	OTTHUMG00000008017	ENST00000371901.3:c.174G>A	1.37:g.47489663G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1U1|Q5VVE5|Q6ZN67|Q8NAZ3	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.Q58	ENST00000371901.3	37	c.174	CCDS544.1	1																																																																																			CYP4X1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000186377		0.677	CYP4X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP4X1	HGNC	protein_coding	OTTHUMT00000022017.1	75	0.00	0	G	NM_178033		47489663	47489663	+1	no_errors	ENST00000371901	ensembl	human	known	69_37n	silent	58	33.33	29	SNP	0.982	A
DCAF11	80344	genome.wustl.edu	37	14	24590084	24590084	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr14:24590084A>G	ENST00000446197.3	+	12	1857	c.1130A>G	c.(1129-1131)cAg>cGg	p.Q377R	RP11-468E2.6_ENST00000558325.1_5'Flank|DCAF11_ENST00000559115.1_Missense_Mutation_p.Q377R|DCAF11_ENST00000396936.1_Missense_Mutation_p.Q277R|DCAF11_ENST00000396941.4_Missense_Mutation_p.Q351R	NM_025230.4	NP_079506.3	Q8TEB1	DCA11_HUMAN	DDB1 and CUL4 associated factor 11	377					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)											TCTAAAGACCAGACCATCAAA	0.527																																						dbGAP											0													124.0	124.0	124.0					14																	24590084		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF130070	CCDS9610.1, CCDS41929.1	14q11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000100897	ENSG00000100897		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20258	protein-coding gene	gene with protein product		613317	"""WD repeat domain 23"""	WDR23			Standard	NM_025230		Approved	PRO2389, GL014	uc001wlv.3	Q8TEB1	OTTHUMG00000028793	ENST00000446197.3:c.1130A>G	14.37:g.24590084A>G	ENSP00000415556:p.Gln377Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ83|D3DS56|Q5D039|Q86U00|Q86U39|Q8NDN2|Q9H2J0|Q9H3A3|Q9H5C9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p23,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Q377R	ENST00000446197.3	37	c.1130	CCDS9610.1	14	.	.	.	.	.	.	.	.	.	.	a	31	5.085313	0.94100	.	.	ENSG00000100897	ENST00000326009;ENST00000446197;ENST00000396936;ENST00000396941	T;T	0.58060	0.36;0.36	6.17	6.17	0.99709	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.48589	0.1508	N	0.02539	-0.55	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.998;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.997;0.982;0.995;0.998	T	0.61884	-0.6971	10	0.38643	T	0.18	-6.9076	14.7743	0.69713	1.0:0.0:0.0:0.0	.	300;351;277;377;377	Q59GN6;Q8TEB1-2;Q8TEB1-3;A8K9T2;Q8TEB1	.;.;.;.;DCA11_HUMAN	R	377;351;277;351	ENSP00000380142:Q277R;ENSP00000380146:Q351R	ENSP00000323680:Q377R	Q	+	2	0	DCAF11	23659924	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.176000	0.89686	2.371000	0.80710	0.533000	0.62120	CAG	DCAF11	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p23,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	ENSG00000100897		0.527	DCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF11	HGNC	protein_coding	OTTHUMT00000071907.4	36	0.00	0	A			24590084	24590084	+1	no_errors	ENST00000446197	ensembl	human	known	69_37n	missense	57	10.94	7	SNP	1.000	G
DEF8	54849	genome.wustl.edu	37	16	90030911	90030911	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr16:90030911G>A	ENST00000268676.7	+	12	1453	c.1364G>A	c.(1363-1365)aGa>aAa	p.R455K	DEF8_ENST00000563795.1_Missense_Mutation_p.R377K|DEF8_ENST00000569453.1_Missense_Mutation_p.R394K|DEF8_ENST00000567874.1_Missense_Mutation_p.R334K|DEF8_ENST00000570182.1_Missense_Mutation_p.R384K|DEF8_ENST00000563594.1_Missense_Mutation_p.R394K	NM_207514.2	NP_997397.1	Q6ZN54	DEFI8_HUMAN	differentially expressed in FDCP 8 homolog (mouse)	455					intracellular signal transduction (GO:0035556)		zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)	12		all_cancers(9;7.59e-13)|Lung NSC(15;1.56e-06)|all_lung(18;2.18e-06)|all_neural(9;0.0019)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0274)		GAGCTCTGCAGAGAGGGCGAC	0.682																																						dbGAP											0													63.0	47.0	53.0					16																	90030911		2196	4297	6493	-	-	-	SO:0001583	missense	0			AK131370	CCDS10989.1, CCDS45555.1, CCDS58493.1, CCDS58494.1, CCDS58495.1, CCDS58496.1	16q24.3	2011-01-31			ENSG00000140995	ENSG00000140995			25969	protein-coding gene	gene with protein product						12477932	Standard	NM_207514		Approved	FLJ20186	uc002fpn.2	Q6ZN54	OTTHUMG00000138989	ENST00000268676.7:c.1364G>A	16.37:g.90030911G>A	ENSP00000268676:p.Arg455Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT65|B4DK62|B4E0S9|B7Z3H6|H3BUG7|Q8N8N3|Q9NXL0	Missense_Mutation	SNP	pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.R455K	ENST00000268676.7	37	c.1364	CCDS10989.1	16	.	.	.	.	.	.	.	.	.	.	g	9.881	1.201567	0.22121	.	.	ENSG00000140995	ENST00000268676	T	0.39997	1.05	5.37	3.17	0.36434	Zinc finger, RING-type (1);Protein kinase C-like, phorbol ester/diacylglycerol binding (1);	0.125148	0.51477	N	0.000094	T	0.15522	0.0374	N	0.05124	-0.11	0.26962	N	0.965799	B;B;B;B	0.06786	0.0;0.0;0.0;0.001	B;B;B;B	0.10450	0.0;0.0;0.0;0.005	T	0.24333	-1.0163	10	0.06891	T	0.86	-3.0394	4.2102	0.10507	0.5131:0.0:0.4869:0.0	.	394;334;384;455	Q6ZN54-5;Q6ZN54-4;Q6ZN54-3;Q6ZN54	.;.;.;DEFI8_HUMAN	K	455	ENSP00000268676:R455K	ENSP00000268676:R455K	R	+	2	0	DEF8	88558412	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.959000	0.56744	1.251000	0.43983	0.651000	0.88453	AGA	DEF8	-	smart_Prot_Kinase_C-like_PE/DAG-bd	ENSG00000140995		0.682	DEF8-001	KNOWN	basic|CCDS	protein_coding	DEF8	HGNC	protein_coding	OTTHUMT00000272878.1	54	0.00	0	G	NM_207514		90030911	90030911	+1	no_errors	ENST00000268676	ensembl	human	known	69_37n	missense	78	22.77	23	SNP	1.000	A
DENND4A	10260	genome.wustl.edu	37	15	65960402	65960402	+	Nonsense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr15:65960402G>C	ENST00000431932.2	-	27	4923	c.4715C>G	c.(4714-4716)tCa>tGa	p.S1572*	DENND4A_ENST00000443035.3_Nonsense_Mutation_p.S1615*	NM_005848.3	NP_005839.3	Q7Z401	MYCPP_HUMAN	DENN/MADD domain containing 4A	1572					positive regulation of Rab GTPase activity (GO:0032851)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(11)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	51						AGCTGTTTTTGATCTATTAGC	0.383																																						dbGAP											0													79.0	75.0	77.0					15																	65960402		1822	4074	5896	-	-	-	SO:0001587	stop_gained	0			AF534403	CCDS45285.1, CCDS53949.1	15q22.31	2012-10-03	2006-01-27	2006-01-27				"""DENN/MADD domain containing"""	24321	protein-coding gene	gene with protein product		600382	"""c-myc promoter binding protein"""	MYCPBP		8056341, 12906859	Standard	NM_005848		Approved	IRLB	uc002api.3	Q7Z401		ENST00000431932.2:c.4715C>G	15.37:g.65960402G>C	ENSP00000396830:p.Ser1572*	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPL3|Q14655|Q86T77|Q8IVX2|Q8NB93	Nonsense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,tigrfam_Pentatricopeptide_repeat	p.S1615*	ENST00000431932.2	37	c.4844	CCDS45285.1	15	.	.	.	.	.	.	.	.	.	.	G	44	10.896385	0.99485	.	.	ENSG00000174485	ENST00000443035;ENST00000431932	.	.	.	5.41	4.44	0.53790	.	0.579168	0.17222	N	0.182320	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	9.8682	0.41157	0.0:0.1127:0.6754:0.2118	.	.	.	.	X	1615;1572	.	ENSP00000396830:S1572X	S	-	2	0	DENND4A	63747456	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.064000	0.41432	2.680000	0.91292	0.650000	0.86243	TCA	DENND4A	-	NULL	ENSG00000174485		0.383	DENND4A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND4A	HGNC	protein_coding	OTTHUMT00000419611.1	60	0.00	0	G	NM_005848		65960402	65960402	-1	no_errors	ENST00000443035	ensembl	human	known	69_37n	nonsense	65	23.53	20	SNP	0.999	C
DNAH9	1770	genome.wustl.edu	37	17	11593039	11593039	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr17:11593039C>G	ENST00000262442.4	+	20	3968	c.3900C>G	c.(3898-3900)tgC>tgG	p.C1300W	DNAH9_ENST00000454412.2_Missense_Mutation_p.C1300W	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	1300	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		AGGAGGTCTGCCAGCTGAAGG	0.527																																						dbGAP											0													90.0	83.0	86.0					17																	11593039		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.3900C>G	17.37:g.11593039C>G	ENSP00000262442:p.Cys1300Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.C1300W	ENST00000262442.4	37	c.3900	CCDS11160.1	17	.	.	.	.	.	.	.	.	.	.	C	10.35	1.326959	0.24080	.	.	ENSG00000007174	ENST00000262442;ENST00000454412	T;T	0.60797	0.16;0.16	5.6	-2.37	0.06643	Dynein heavy chain, domain-2 (1);	0.214732	0.41097	D	0.000955	T	0.58666	0.2138	L	0.44542	1.39	0.40972	D	0.984708	D	0.54772	0.968	P	0.61275	0.886	T	0.58634	-0.7602	10	0.72032	D	0.01	.	8.5276	0.33315	0.1099:0.2739:0.0:0.6162	.	1300	Q9NYC9	DYH9_HUMAN	W	1300	ENSP00000262442:C1300W;ENSP00000414874:C1300W	ENSP00000262442:C1300W	C	+	3	2	DNAH9	11533764	0.948000	0.32251	0.129000	0.21949	0.424000	0.31475	-0.089000	0.11180	-0.499000	0.06623	-0.251000	0.11542	TGC	DNAH9	-	pfam_Dynein_heavy_dom-2	ENSG00000007174		0.527	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	22	0.00	0	C	NM_001372		11593039	11593039	+1	no_errors	ENST00000262442	ensembl	human	known	69_37n	missense	16	60.47	26	SNP	0.060	G
DNAJC18	202052	genome.wustl.edu	37	5	138778163	138778163	+	5'Flank	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr5:138778163G>A	ENST00000302060.5	-	0	0				DNAJC18_ENST00000505268.1_5'UTR	NM_152686.3	NP_689899.1	Q9H819	DJC18_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 18							integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GAAAAGGTCTGGAGGTACTAC	0.527																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK024054	CCDS4214.1	5q31.2	2011-09-02		2005-08-09	ENSG00000170464	ENSG00000170464		"""Heat shock proteins / DNAJ (HSP40)"""	28429	protein-coding gene	gene with protein product							Standard	NM_152686		Approved	MGC29463	uc003len.3	Q9H819	OTTHUMG00000129225		5.37:g.138778163G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000302060.5	37	NULL	CCDS4214.1	5																																																																																			DNAJC18	-	-	ENSG00000170464		0.527	DNAJC18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC18	HGNC	protein_coding	OTTHUMT00000374191.1	45	0.00	0	G	NM_152686		138778163	138778163	-1	no_errors	ENST00000505268	ensembl	human	known	69_37n	rna	60	10.45	7	SNP	0.003	A
FBXW7	55294	genome.wustl.edu	37	4	153249385	153249385	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr4:153249385G>A	ENST00000281708.4	-	9	2622	c.1393C>T	c.(1393-1395)Cgt>Tgt	p.R465C	FBXW7_ENST00000393956.3_Missense_Mutation_p.R289C|FBXW7_ENST00000603548.1_Missense_Mutation_p.R465C|FBXW7_ENST00000296555.5_Missense_Mutation_p.R347C|FBXW7_ENST00000603841.1_Missense_Mutation_p.R465C|FBXW7_ENST00000263981.5_Missense_Mutation_p.R385C	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	465			R -> C (in a acute lymphoblastic leukemia cell line). {ECO:0000269|PubMed:11565033}.|R -> H (in a colorectal cancer sample; somatic mutation). {ECO:0000269|PubMed:16959974}.		cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R465C(71)|p.R226C(11)|p.R385C(11)|p.R347C(3)|p.R465Y(2)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				TGCATACAACGCACAGTGGAA	0.413			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	99	Substitution - Missense(98)|Unknown(1)	haematopoietic_and_lymphoid_tissue(41)|large_intestine(27)|endometrium(20)|stomach(6)|biliary_tract(4)|pancreas(1)											260.0	223.0	235.0					4																	153249385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1393C>T	4.37:g.153249385G>A	ENSP00000281708:p.Arg465Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R465C	ENST00000281708.4	37	c.1393	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909959	0.92107	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	6.05	6.05	0.98169	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.67287	0.2877	M	0.71206	2.165	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.67130	-0.5748	10	0.87932	D	0	-17.2313	20.6013	0.99457	0.0:0.0:1.0:0.0	.	289;465;347;385	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	C	465;347;385;289	ENSP00000281708:R465C;ENSP00000296555:R347C;ENSP00000263981:R385C;ENSP00000377528:R289C	ENSP00000263981:R385C	R	-	1	0	FBXW7	153468835	1.000000	0.71417	0.959000	0.39883	0.996000	0.88848	9.869000	0.99810	2.878000	0.98634	0.650000	0.86243	CGT	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.413	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	71	0.00	0	G			153249385	153249385	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	missense	47	45.35	39	SNP	1.000	A
FGB	2244	genome.wustl.edu	37	4	155487118	155487118	+	Silent	SNP	T	T	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr4:155487118T>C	ENST00000302068.4	+	2	336	c.273T>C	c.(271-273)gaT>gaC	p.D91D	FGB_ENST00000509493.1_Intron|FGB_ENST00000502545.1_3'UTR	NM_005141.4	NP_005132.2	P02675	FIBB_HUMAN	fibrinogen beta chain	91			Missing (in New York-1). {ECO:0000269|PubMed:3156856}.		blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|cellular response to interleukin-1 (GO:0071347)|cellular response to leptin stimulus (GO:0044320)|extracellular matrix organization (GO:0030198)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	chaperone binding (GO:0051087)|structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(2)|lung(22)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34	all_hematologic(180;0.215)	Renal(120;0.0458)			Sucralfate(DB00364)	AAGCCCCTGATGCTGGAGGCT	0.572																																					NSCLC(106;1133 1613 21870 46110 52656)	dbGAP											0													40.0	38.0	39.0					4																	155487118		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3786.1	4q28	2014-09-17			ENSG00000171564	ENSG00000171564		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3662	protein-coding gene	gene with protein product		134830	"""fibrinogen, B beta polypeptide"""				Standard	NM_005141		Approved		uc003ioa.4	P02675	OTTHUMG00000150331	ENST00000302068.4:c.273T>C	4.37:g.155487118T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLR9|B2R7G3|Q32Q65|Q3KPF2	Silent	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.D91	ENST00000302068.4	37	c.273	CCDS3786.1	4																																																																																			FGB	-	pfam_Fibrinogen_a/b/g_coil_dom	ENSG00000171564		0.572	FGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGB	HGNC	protein_coding	OTTHUMT00000317595.1	16	0.00	0	T	NM_005141		155487118	155487118	+1	no_errors	ENST00000302068	ensembl	human	known	69_37n	silent	11	63.33	19	SNP	1.000	C
FLNC	2318	genome.wustl.edu	37	7	128491319	128491319	+	Missense_Mutation	SNP	A	A	G	rs76165988		TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr7:128491319A>G	ENST00000325888.8	+	34	5834	c.5573A>G	c.(5572-5574)aAc>aGc	p.N1858S	FLNC_ENST00000346177.6_Missense_Mutation_p.N1825S|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1858					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GATGCCATCAACAGCCGCCAT	0.562																																						dbGAP											0													46.0	49.0	48.0					7																	128491319		2015	4185	6200	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.5573A>G	7.37:g.128491319A>G	ENSP00000327145:p.Asn1858Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.N1858S	ENST00000325888.8	37	c.5573	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	A	19.43	3.825489	0.71143	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.91894	-2.93;-2.93	5.64	5.64	0.86602	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93779	0.8011	L	0.37697	1.125	0.54753	D	0.999985	D;B	0.57257	0.979;0.011	D;B	0.72075	0.976;0.077	D	0.94567	0.7767	10	0.72032	D	0.01	.	15.8524	0.78943	1.0:0.0:0.0:0.0	.	1825;1858	Q14315-2;Q14315	.;FLNC_HUMAN	S	1858;1825	ENSP00000327145:N1858S;ENSP00000344002:N1825S	ENSP00000327145:N1858S	N	+	2	0	FLNC	128278555	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.293000	0.96082	2.143000	0.66587	0.533000	0.62120	AAC	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.562	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	63	0.00	0	A			128491319	128491319	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	60	19.74	15	SNP	1.000	G
FRY	10129	genome.wustl.edu	37	13	32811953	32811953	+	Missense_Mutation	SNP	A	A	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr13:32811953A>G	ENST00000380250.3	+	44	6744	c.6248A>G	c.(6247-6249)gAa>gGa	p.E2083G		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	2083						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		GAGAACCGAGAAAAGCTTGAG	0.512																																						dbGAP											0													61.0	63.0	62.0					13																	32811953		1961	4162	6123	-	-	-	SO:0001583	missense	0			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.6248A>G	13.37:g.32811953A>G	ENSP00000369600:p.Glu2083Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E2083G	ENST00000380250.3	37	c.6248	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	A	27.2	4.808512	0.90707	.	.	ENSG00000073910	ENST00000380250;ENST00000380257	T	0.26518	1.73	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.50222	0.1603	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.41324	-0.9515	10	0.38643	T	0.18	.	16.5582	0.84512	1.0:0.0:0.0:0.0	.	2083	Q5TBA9	FRY_HUMAN	G	2083;920	ENSP00000369600:E2083G	ENSP00000369600:E2083G	E	+	2	0	FRY	31709953	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	9.339000	0.96797	2.308000	0.77769	0.533000	0.62120	GAA	FRY	-	superfamily_ARM-type_fold	ENSG00000073910		0.512	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	13	0.00	0	A	NM_023037		32811953	32811953	+1	no_errors	ENST00000380250	ensembl	human	known	69_37n	missense	24	47.83	22	SNP	1.000	G
GOLGA8T	653075	genome.wustl.edu	37	15	30437636	30437636	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr15:30437636G>A	ENST00000569052.1	+	19	1762	c.1762G>A	c.(1762-1764)Gcc>Acc	p.A588T	RN7SL469P_ENST00000491512.2_RNA|AC120045.2_ENST00000408858.1_RNA					golgin A8 family, member T																		CCAAGGAGAGGCCAGGGAGGA	0.612																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					15q13.2	2013-01-17			ENSG00000261247	ENSG00000261247			44410	other	unknown							Standard	NR_033933		Approved		uc021sha.1		OTTHUMG00000175638	ENST00000569052.1:c.1762G>A	15.37:g.30437636G>A	ENSP00000455826:p.Ala588Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A588T	ENST00000569052.1	37	c.1762		15																																																																																			RP5-1086D14.3	-	NULL	ENSG00000261247		0.612	GOLGA8T-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8J	Clone_based_vega_gene	protein_coding	OTTHUMT00000430690.1	15	0.00	0	G	NR_033933		30437636	30437636	+1	no_errors	ENST00000569052	ensembl	human	novel	69_37n	missense	0	100.00	3	SNP	0.079	A
GUCY2C	2984	genome.wustl.edu	37	12	14829904	14829904	+	Splice_Site	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr12:14829904C>T	ENST00000261170.3	-	7	968	c.832G>A	c.(832-834)Gac>Aac	p.D278N	RP11-174G6.1_ENST00000501178.2_RNA	NM_004963.3	NP_004954.2	P25092	GUC2C_HUMAN	guanylate cyclase 2C (heat stable enterotoxin receptor)	278					intracellular signal transduction (GO:0035556)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of cell proliferation (GO:0042127)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|toxic substance binding (GO:0015643)			breast(3)|endometrium(7)|kidney(3)|large_intestine(9)|lung(17)|ovary(4)|skin(7)|urinary_tract(1)	51					Linaclotide(DB08890)	AAGTACTGGTCACTGTAATAA	0.373																																						dbGAP											0													69.0	70.0	70.0					12																	14829904		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS8664.1	12p12	2008-08-18			ENSG00000070019	ENSG00000070019			4688	protein-coding gene	gene with protein product		601330		GUC2C		8661067	Standard	NM_004963		Approved	STAR	uc001rcd.3	P25092	OTTHUMG00000168732	ENST00000261170.3:c.831-1G>A	12.37:g.14829904C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMY6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.D278N	ENST00000261170.3	37	c.832	CCDS8664.1	12	.	.	.	.	.	.	.	.	.	.	C	0.873	-0.731389	0.03135	.	.	ENSG00000070019	ENST00000261170	D	0.83914	-1.78	5.77	-2.24	0.06909	Extracellular ligand-binding receptor (1);	0.624455	0.18401	N	0.142359	T	0.55545	0.1927	N	0.03608	-0.345	0.24470	N	0.994398	B	0.10296	0.003	B	0.13407	0.009	T	0.50372	-0.8836	10	0.02654	T	1	.	10.9531	0.47341	0.0:0.5414:0.0:0.4586	.	278	P25092	GUC2C_HUMAN	N	278	ENSP00000261170:D278N	ENSP00000261170:D278N	D	-	1	0	GUCY2C	14721171	1.000000	0.71417	0.173000	0.22940	0.006000	0.05464	0.783000	0.26802	-0.656000	0.05380	-0.781000	0.03364	GAC	GUCY2C	-	pfam_ANF_lig-bd_rcpt	ENSG00000070019		0.373	GUCY2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2C	HGNC	protein_coding	OTTHUMT00000400835.1	48	0.00	0	C		Missense_Mutation	14829904	14829904	-1	no_errors	ENST00000261170	ensembl	human	known	69_37n	missense	48	26.15	17	SNP	0.527	T
HK3	3101	genome.wustl.edu	37	5	176308172	176308172	+	Missense_Mutation	SNP	A	A	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr5:176308172A>C	ENST00000292432.5	-	19	2765	c.2674T>G	c.(2674-2676)Tgt>Ggt	p.C892G		NM_002115.2	NP_002106.2	P52790	HXK3_HUMAN	hexokinase 3 (white cell)	892	Catalytic.|Hexokinase type-2 2.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|cellular glucose homeostasis (GO:0001678)|glucose 6-phosphate metabolic process (GO:0051156)|glucose transport (GO:0015758)|glycolytic process (GO:0006096)|hexose metabolic process (GO:0019318)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	ATP binding (GO:0005524)|fructokinase activity (GO:0008865)|glucokinase activity (GO:0004340)|hexokinase activity (GO:0004396)|hormone binding (GO:0042562)|mannokinase activity (GO:0019158)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	47	all_cancers(89;0.000104)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTGACCACACAGCGAGGGGCC	0.677																																						dbGAP											0													52.0	50.0	50.0					5																	176308172		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4407.1	5q35.2	2008-02-05			ENSG00000160883	ENSG00000160883	2.7.1.1		4925	protein-coding gene	gene with protein product		142570				8812439	Standard	NM_002115		Approved		uc003mfa.3	P52790	OTTHUMG00000130855	ENST00000292432.5:c.2674T>G	5.37:g.176308172A>C	ENSP00000292432:p.Cys892Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1E7	Missense_Mutation	SNP	pfam_Hexokinase_C,pfam_Hexokinase_N,prints_Hexokinase	p.C892G	ENST00000292432.5	37	c.2674	CCDS4407.1	5	.	.	.	.	.	.	.	.	.	.	A	17.58	3.425442	0.62733	.	.	ENSG00000160883	ENST00000292432	D	0.96365	-3.99	5.22	5.22	0.72569	Hexokinase, C-terminal (1);	0.000000	0.53938	D	0.000051	D	0.97645	0.9228	M	0.71036	2.16	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.98274	1.0505	10	0.72032	D	0.01	-11.4303	14.0859	0.64957	1.0:0.0:0.0:0.0	.	892	P52790	HXK3_HUMAN	G	892	ENSP00000292432:C892G	ENSP00000292432:C892G	C	-	1	0	HK3	176240778	1.000000	0.71417	0.176000	0.23000	0.773000	0.43773	8.751000	0.91628	2.192000	0.70111	0.459000	0.35465	TGT	HK3	-	pfam_Hexokinase_C	ENSG00000160883		0.677	HK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HK3	HGNC	protein_coding	OTTHUMT00000253428.1	27	0.00	0	A			176308172	176308172	-1	no_errors	ENST00000292432	ensembl	human	known	69_37n	missense	31	32.61	15	SNP	0.995	C
HSD17B7	51478	genome.wustl.edu	37	1	162770091	162770091	+	Intron	SNP	A	A	T	rs557674923		TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:162770091A>T	ENST00000254521.3	+	5	697				HSD17B7_ENST00000367917.3_Intron|HSD17B7_ENST00000485405.1_Intron	NM_016371.2	NP_057455.1	P56937	DHB7_HUMAN	hydroxysteroid (17-beta) dehydrogenase 7						cholesterol biosynthetic process (GO:0006695)|estrogen biosynthetic process (GO:0006703)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	3-keto sterol reductase activity (GO:0000253)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			endometrium(3)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	9	all_hematologic(112;0.115)					tgaggacactaaatctcggag	0.423																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF098786	CCDS1242.1	1q23	2011-09-14			ENSG00000132196	ENSG00000132196	1.1.1.270	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5215	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 37C, member 1"""	606756				10544267, 10419022, 19027726	Standard	NM_016371		Approved	PRAP, SDR37C1	uc001gci.3	P56937	OTTHUMG00000034420	ENST00000254521.3:c.642+364A>T	1.37:g.162770091A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T246|Q7Z4V9|Q8WWS2|Q9UF00	RNA	SNP	-	NULL	ENST00000254521.3	37	NULL	CCDS1242.1	1																																																																																			HSD17B7	-	-	ENSG00000132196		0.423	HSD17B7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B7	HGNC	protein_coding	OTTHUMT00000083207.1	49	0.00	0	A	NM_016371		162770091	162770091	+1	no_errors	ENST00000470195	ensembl	human	known	69_37n	rna	41	59.41	60	SNP	0.000	T
HSF2BP	11077	genome.wustl.edu	37	21	45050302	45050302	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr21:45050302G>C	ENST00000291560.2	-	6	806	c.475C>G	c.(475-477)Caa>Gaa	p.Q159E	HSF2BP_ENST00000542962.1_Missense_Mutation_p.Q84E	NM_007031.1	NP_008962.1	O75031	HSF2B_HUMAN	heat shock transcription factor 2 binding protein	159					spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)				kidney(2)|large_intestine(3)|prostate(1)|skin(1)	7				STAD - Stomach adenocarcinoma(101;0.18)		TCCATTGTTTGACCAGTGATG	0.393																																						dbGAP											0													94.0	79.0	84.0					21																	45050302		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007131	CCDS13697.1	21q22.3	2008-07-31			ENSG00000160207	ENSG00000160207			5226	protein-coding gene	gene with protein product	"""heat shock factor 2 binding protein"""	604554				9651507	Standard	XM_005261090		Approved		uc002zdi.3	O75031	OTTHUMG00000086863	ENST00000291560.2:c.475C>G	21.37:g.45050302G>C	ENSP00000291560:p.Gln159Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX36	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.Q159E	ENST00000291560.2	37	c.475	CCDS13697.1	21	.	.	.	.	.	.	.	.	.	.	G	16.10	3.026291	0.54683	.	.	ENSG00000160207	ENST00000291560;ENST00000542962;ENST00000443485	T;T;T	0.62105	0.05;0.05;0.05	5.24	5.24	0.73138	Armadillo-type fold (1);	0.056776	0.64402	D	0.000001	T	0.75273	0.3827	M	0.65975	2.015	0.43745	D	0.99624	D	0.67145	0.996	D	0.76071	0.987	T	0.73984	-0.3810	10	0.39692	T	0.17	.	12.8109	0.57639	0.0788:0.0:0.9212:0.0	.	159	O75031	HSF2B_HUMAN	E	159;84;162	ENSP00000291560:Q159E;ENSP00000443367:Q84E;ENSP00000409585:Q162E	ENSP00000291560:Q159E	Q	-	1	0	HSF2BP	43874730	1.000000	0.71417	0.856000	0.33681	0.992000	0.81027	6.946000	0.75953	2.610000	0.88304	0.650000	0.86243	CAA	HSF2BP	-	superfamily_ARM-type_fold	ENSG00000160207		0.393	HSF2BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF2BP	HGNC	protein_coding	OTTHUMT00000195620.1	35	0.00	0	G	NM_007031		45050302	45050302	-1	no_errors	ENST00000291560	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	0.716	C
IFNL1	282618	genome.wustl.edu	37	19	39789125	39789125	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr19:39789125T>G	ENST00000333625.2	+	5	669	c.572T>G	c.(571-573)cTg>cGg	p.L191R		NM_172140.1	NP_742152.1	Q8IU54	IFNL1_HUMAN	interferon, lambda 1	191					defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|negative regulation of cell proliferation (GO:0008285)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of memory T cell differentiation (GO:0043381)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of immune response (GO:0050778)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-28 receptor complex (GO:0032002)	interleukin-28 receptor binding (GO:0032003)|receptor binding (GO:0005102)										AACCTGTGTCTGAGAACGTCA	0.527																																						dbGAP											0													173.0	169.0	171.0					19																	39789125		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY129150	CCDS12531.1	19q13.13	2014-05-22	2012-11-26	2012-11-26	ENSG00000182393	ENSG00000182393		"""Interferons"""	18363	protein-coding gene	gene with protein product		607403	"""interleukin 29"", ""interleukin 29 (interferon, lambda 1)"""	IL29			Standard	NM_172140		Approved	IL-29	uc002okv.3	Q8IU54		ENST00000333625.2:c.572T>G	19.37:g.39789125T>G	ENSP00000329991:p.Leu191Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV25|Q17R34	Missense_Mutation	SNP	NULL	p.L191R	ENST00000333625.2	37	c.572	CCDS12531.1	19	.	.	.	.	.	.	.	.	.	.	T	13.88	2.369371	0.42003	.	.	ENSG00000182393	ENST00000333625	T	0.18016	2.24	3.15	2.08	0.27032	.	1.281060	0.05577	N	0.572183	T	0.22360	0.0539	L	0.29908	0.895	0.09310	N	1	D	0.59767	0.986	P	0.54312	0.748	T	0.21008	-1.0258	10	0.87932	D	0	-2.1543	6.2839	0.21023	0.0:0.0:0.2572:0.7428	.	191	Q8IU54	IL29_HUMAN	R	191	ENSP00000329991:L191R	ENSP00000329991:L191R	L	+	2	0	IL29	44480965	0.508000	0.26154	0.004000	0.12327	0.064000	0.16182	2.037000	0.41174	0.557000	0.29117	0.260000	0.18958	CTG	IL29	-	NULL	ENSG00000182393		0.527	IFNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL29	HGNC	protein_coding	OTTHUMT00000463834.1	90	0.00	0	T	NM_172140		39789125	39789125	+1	no_errors	ENST00000333625	ensembl	human	known	69_37n	missense	131	10.88	16	SNP	0.008	G
IGSF23	147710	genome.wustl.edu	37	19	45117195	45117195	+	Intron	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr19:45117195G>C	ENST00000402988.1	+	1	141					NM_001205280.1	NP_001192209.1	A1L1A6	IGS23_HUMAN	immunoglobulin superfamily, member 23							integral component of membrane (GO:0016021)											CCCCATGTGTGATGAGGAGAC	0.602																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS54277.1	19q13.31	2013-01-11			ENSG00000216588	ENSG00000216588		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	40040	protein-coding gene	gene with protein product							Standard	NM_001205280		Approved		uc021uvj.1	A1L1A6	OTTHUMG00000151531	ENST00000402988.1:c.125+115G>C	19.37:g.45117195G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.V6	ENST00000402988.1	37	c.18	CCDS54277.1	19																																																																																			IGSF23	-	NULL	ENSG00000216588		0.602	IGSF23-003	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IGSF23	HGNC	protein_coding	OTTHUMT00000323031.1	28	0.00	0	G	NM_001205280		45117195	45117195	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000592507	ensembl	human	putative	69_37n	silent	36	18.18	8	SNP	0.000	C
IMMP2L	83943	genome.wustl.edu	37	7	111161425	111161425	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr7:111161425C>G	ENST00000405709.2	-	2	521	c.79G>C	c.(79-81)Gtg>Ctg	p.V27L	IMMP2L_ENST00000415362.1_Missense_Mutation_p.V27L|IMMP2L_ENST00000447215.1_Missense_Mutation_p.V27L|IMMP2L_ENST00000437687.1_Missense_Mutation_p.V27L|IMMP2L_ENST00000331762.3_Missense_Mutation_p.V27L|IMMP2L_ENST00000452895.1_Missense_Mutation_p.V27L	NM_032549.3	NP_115938.1	Q96T52	IMP2L_HUMAN	IMP2 inner mitochondrial membrane peptidase-like (S. cerevisiae)	27					ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|protein processing involved in protein targeting to mitochondrion (GO:0006627)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|mitochondrial inner membrane peptidase complex (GO:0042720)	peptidase activity (GO:0008233)|serine-type peptidase activity (GO:0008236)			endometrium(3)|large_intestine(6)|lung(5)	14				UCEC - Uterine corpus endometrioid carcinoma (4;0.053)|Epithelial(3;2.27e-07)|all cancers(3;1.36e-05)|STAD - Stomach adenocarcinoma(3;0.00148)|KIRC - Kidney renal clear cell carcinoma(11;0.0339)|Lung(3;0.0375)|Kidney(11;0.0415)|LUSC - Lung squamous cell carcinoma(290;0.173)		AAGAAAGTCACTGCCACAGGC	0.438																																						dbGAP											0													94.0	96.0	95.0					7																	111161425		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF359563	CCDS5753.1	7q31	2014-01-06	2005-08-17		ENSG00000184903	ENSG00000184903			14598	protein-coding gene	gene with protein product		605977	"""IMP2 inner mitochondrial membrane protease-like (S. cerevisiae)"", ""IMMP2L intronic transcript 1 (non-protein coding)"""	IMMP2L-IT1		11254443	Standard	NM_032549		Approved	IMP2	uc010ljr.2	Q96T52	OTTHUMG00000155023	ENST00000405709.2:c.79G>C	7.37:g.111161425C>G	ENSP00000384966:p.Val27Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75MF1|Q75MN9|Q75MP0|Q75MS5|Q75MS8|Q96HJ2	Missense_Mutation	SNP	pfam_Peptidase_S24_S26,superfamily_Peptidase_S24_S26A/B/C,prints_Pept_S26A_signal_pept_1,tigrfam_Pept_S26A_signal_pept_1	p.V27L	ENST00000405709.2	37	c.79	CCDS5753.1	7	.	.	.	.	.	.	.	.	.	.	C	15.51	2.854675	0.51376	.	.	ENSG00000184903	ENST00000405709;ENST00000331762;ENST00000452895;ENST00000415362;ENST00000447215;ENST00000437687;ENST00000452753	.	.	.	5.9	5.9	0.94986	.	0.065812	0.64402	D	0.000012	T	0.74489	0.3723	L	0.54323	1.7	0.80722	D	1	D;D	0.67145	0.996;0.984	D;D	0.76071	0.987;0.956	T	0.65647	-0.6117	9	0.11485	T	0.65	-41.435	19.8787	0.96886	0.0:1.0:0.0:0.0	.	27;27	Q96T52-2;Q96T52	.;IMP2L_HUMAN	L	27	.	ENSP00000329553:V27L	V	-	1	0	IMMP2L	110948661	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.429000	0.73387	2.800000	0.96347	0.591000	0.81541	GTG	IMMP2L	-	tigrfam_Pept_S26A_signal_pept_1	ENSG00000184903		0.438	IMMP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMMP2L	HGNC	protein_coding	OTTHUMT00000338109.4	44	0.00	0	C	NM_032549		111161425	111161425	-1	no_errors	ENST00000331762	ensembl	human	known	69_37n	missense	50	15.00	9	SNP	1.000	G
KLC3	147700	genome.wustl.edu	37	19	45851372	45851372	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr19:45851372C>G	ENST00000391946.2	+	5	835	c.733C>G	c.(733-735)Cac>Gac	p.H245D	KLC3_ENST00000470402.1_Missense_Mutation_p.H259D|KLC3_ENST00000585434.1_Missense_Mutation_p.H244D	NM_177417.2	NP_803136.2	Q6P597	KLC3_HUMAN	kinesin light chain 3	245					axon cargo transport (GO:0008088)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|motile cilium (GO:0031514)|neuron projection (GO:0043005)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(1)|ovary(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0226)		GGGCCACTGCCACCCTGACGT	0.682																																						dbGAP											0													16.0	15.0	15.0					19																	45851372		2199	4298	6497	-	-	-	SO:0001583	missense	0			AK092481	CCDS12660.2	19q13	2013-01-10			ENSG00000104892	ENSG00000104892		"""Tetratricopeptide (TTC) repeat domain containing"""	20717	protein-coding gene	gene with protein product		601334					Standard	XM_005258536		Approved	KLC2L, KNS2B, KLCt	uc002pbf.1	Q6P597	OTTHUMG00000143722	ENST00000391946.2:c.733C>G	19.37:g.45851372C>G	ENSP00000375810:p.His245Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVM3|A2RUT6|Q6GMU2|Q8NAL1|Q8WWJ9	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR-1,smart_TPR_repeat,prints_Kinesin_light,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.H259D	ENST00000391946.2	37	c.775	CCDS12660.2	19	.	.	.	.	.	.	.	.	.	.	C	21.6	4.175697	0.78564	.	.	ENSG00000104892	ENST00000391946;ENST00000470402	T;T	0.49139	0.79;0.79	3.24	3.24	0.37175	Tetratricopeptide-like helical (1);Rabaptin, GTPase-Rab5 binding (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.63546	0.2520	M	0.62266	1.93	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.85130	0.995;0.995;0.997	T	0.68040	-0.5514	10	0.87932	D	0	-0.0793	12.7599	0.57359	0.0:1.0:0.0:0.0	.	244;259;245	Q6P597-2;Q6P597-3;Q6P597	.;.;KLC3_HUMAN	D	245;259	ENSP00000375810:H245D;ENSP00000436019:H259D	ENSP00000375810:H245D	H	+	1	0	KLC3	50543212	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.437000	0.80417	2.131000	0.65755	0.407000	0.27541	CAC	KLC3	-	pfam_Rabaptin_Rab5-bd_dom,pfscan_TPR-contain_dom	ENSG00000104892		0.682	KLC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KLC3	HGNC	protein_coding	OTTHUMT00000289776.1	78	0.00	0	C	NM_145275		45851372	45851372	+1	no_errors	ENST00000470402	ensembl	human	known	69_37n	missense	68	26.88	25	SNP	1.000	G
KRTAP10-3	386682	genome.wustl.edu	37	21	45978529	45978529	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr21:45978529C>T	ENST00000391620.1	-	1	114	c.70G>A	c.(70-72)Gag>Aag	p.E24K	TSPEAR_ENST00000323084.4_Intron|TSPEAR_ENST00000397916.1_Intron	NM_198696.2	NP_941969.2	P60369	KR103_HUMAN	keratin associated protein 10-3	24						keratin filament (GO:0045095)				kidney(1)|lung(4)|prostate(1)|skin(1)	7						CAGCAGCTCTCTGGGCAGGCG	0.692																																						dbGAP											0													38.0	39.0	39.0					21																	45978529		2185	4281	6466	-	-	-	SO:0001583	missense	0			AJ566383	CCDS42956.1	21q22.3	2007-10-05			ENSG00000212935	ENSG00000212935		"""Keratin associated proteins"""	22968	protein-coding gene	gene with protein product				KRTAP18-3			Standard	NM_198696		Approved	KAP10.3, KAP18.3	uc002zfj.1	P60369	OTTHUMG00000057628	ENST00000391620.1:c.70G>A	21.37:g.45978529C>T	ENSP00000375478:p.Glu24Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KN67|Q70LJ4	Missense_Mutation	SNP	NULL	p.E24K	ENST00000391620.1	37	c.70	CCDS42956.1	21	.	.	.	.	.	.	.	.	.	.	c	15.84	2.951704	0.53186	.	.	ENSG00000212935	ENST00000391620	T	0.13778	2.56	3.43	3.43	0.39272	.	.	.	.	.	T	0.38719	0.1051	M	0.89095	3.005	0.29517	N	0.853752	D	0.67145	0.996	P	0.60068	0.868	T	0.39522	-0.9610	9	0.66056	D	0.02	.	12.7318	0.57203	0.0:1.0:0.0:0.0	.	24	P60369	KR103_HUMAN	K	24	ENSP00000375478:E24K	ENSP00000375478:E24K	E	-	1	0	KRTAP10-3	44802957	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	1.447000	0.35101	1.904000	0.55121	0.561000	0.74099	GAG	KRTAP10-3	-	NULL	ENSG00000212935		0.692	KRTAP10-3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP10-3	HGNC	protein_coding	OTTHUMT00000128031.1	63	0.00	0	C			45978529	45978529	-1	no_errors	ENST00000391620	ensembl	human	known	69_37n	missense	76	12.64	11	SNP	1.000	T
LGR5	8549	genome.wustl.edu	37	12	71898466	71898466	+	Splice_Site	SNP	G	G	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr12:71898466G>T	ENST00000266674.5	+	2	595		c.e2+1		LGR5_ENST00000540815.2_Splice_Site|LGR5_ENST00000536515.1_Splice_Site			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5						G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						TGGAGGAGTTGTAAGTATCAC	0.493																																						dbGAP											0													170.0	149.0	156.0					12																	71898466		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.284+1G>T	12.37:g.71898466G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Splice_Site	SNP	-	e2+1	ENST00000266674.5	37	c.284+1	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	G	18.52	3.640774	0.67244	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1421	0.98061	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LGR5	70184733	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	7.017000	0.76399	2.836000	0.97738	0.655000	0.94253	.	LGR5	-	-	ENSG00000139292		0.493	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	58	0.00	0	G	NM_003667	Intron	71898466	71898466	+1	no_errors	ENST00000266674	ensembl	human	known	69_37n	splice_site	83	12.63	12	SNP	1.000	T
MEPCE	56257	genome.wustl.edu	37	7	100028728	100028728	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr7:100028728C>T	ENST00000310512.2	+	1	1475	c.1087C>T	c.(1087-1089)Cgc>Tgc	p.R363C	ZCWPW1_ENST00000360951.4_5'Flank|ZCWPW1_ENST00000324725.6_5'Flank|ZCWPW1_ENST00000398027.2_5'Flank|MEPCE_ENST00000414441.1_5'UTR	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	363					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CTCCCGACATCGCAAACGTCG	0.637																																						dbGAP											0													89.0	97.0	94.0					7																	100028728		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1087C>T	7.37:g.100028728C>T	ENSP00000308546:p.Arg363Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	pfam_Bin3	p.R363C	ENST00000310512.2	37	c.1087	CCDS5693.1	7	.	.	.	.	.	.	.	.	.	.	C	18.79	3.698922	0.68501	.	.	ENSG00000146834	ENST00000310512	.	.	.	4.73	4.73	0.59995	.	0.137823	0.48767	D	0.000164	T	0.63271	0.2497	N	0.22421	0.69	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.67304	-0.5704	9	0.62326	D	0.03	-9.0646	15.2352	0.73422	0.0:1.0:0.0:0.0	.	363	Q7L2J0	MEPCE_HUMAN	C	363	.	ENSP00000308546:R363C	R	+	1	0	MEPCE	99866664	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.969000	0.49232	2.461000	0.83175	0.462000	0.41574	CGC	MEPCE	-	NULL	ENSG00000146834		0.637	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPCE	HGNC	protein_coding	OTTHUMT00000339135.1	35	0.00	0	C			100028728	100028728	+1	no_errors	ENST00000310512	ensembl	human	known	69_37n	missense	20	57.69	30	SNP	1.000	T
METAP1	23173	genome.wustl.edu	37	4	99944097	99944097	+	Intron	SNP	G	G	A	rs6841819	byFrequency	TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr4:99944097G>A	ENST00000296411.6	+	2	248				METAP1_ENST00000506548.1_3'UTR	NM_015143.2	NP_055958.2	P53582	MAP11_HUMAN	methionyl aminopeptidase 1						N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|phototransduction, visible light (GO:0007603)|platelet aggregation (GO:0070527)|protein initiator methionine removal (GO:0070084)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of translation (GO:0006417)|rhodopsin mediated signaling pathway (GO:0016056)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic ribosome (GO:0022626)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			endometrium(3)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17				OV - Ovarian serous cystadenocarcinoma(123;3.12e-07)		AGAAGGTTGCGGACATGTAGG	0.557													G|||	864	0.172524	0.0159	0.2248	5008	,	,		21942	0.0496		0.3698	False		,,,				2504	0.271					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D42084	CCDS47110.1	4q23	2010-08-20			ENSG00000164024	ENSG00000164024	3.4.11.18		15789	protein-coding gene	gene with protein product	"""Peptidase M"""	610151				7788527, 12144506	Standard	NM_015143		Approved	KIAA0094, MetAP1A, MAP1A	uc003huf.4	P53582	OTTHUMG00000161231	ENST00000296411.6:c.115-5921G>A	4.37:g.99944097G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2E6	RNA	SNP	-	NULL	ENST00000296411.6	37	NULL	CCDS47110.1	4																																																																																			METAP1	-	-	ENSG00000164024		0.557	METAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METAP1	HGNC	protein_coding	OTTHUMT00000364237.1	9	0.00	0	G	NM_015143		99944097	99944097	+1	no_errors	ENST00000506548	ensembl	human	known	69_37n	rna	11	38.89	7	SNP	0.986	A
MND1	84057	genome.wustl.edu	37	4	154271274	154271274	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr4:154271274C>G	ENST00000504860.1	+	1	60	c.17C>G	c.(16-18)tCt>tGt	p.S6C	MND1_ENST00000240488.3_Missense_Mutation_p.S21C|MND1_ENST00000503967.1_3'UTR					meiotic nuclear divisions 1 homolog (S. cerevisiae)											large_intestine(2)|lung(1)	3	all_hematologic(180;0.093)					GAAATATTTTCTGAAACAGTA	0.294																																						dbGAP											0													60.0	66.0	64.0					4																	154271274		2203	4298	6501	-	-	-	SO:0001583	missense	0			AY028916	CCDS3782.1, CCDS75202.1	4q31.3	2008-02-05			ENSG00000121211	ENSG00000121211			24839	protein-coding gene	gene with protein product		611422				11940665	Standard	NM_032117		Approved	GAJ	uc003ink.2	Q9BWT6	OTTHUMG00000161523	ENST00000504860.1:c.17C>G	4.37:g.154271274C>G	ENSP00000422933:p.Ser6Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Mnd1,pfam_Pencillinase_R,pirsf_Mnd1	p.S21C	ENST00000504860.1	37	c.62		4	.	.	.	.	.	.	.	.	.	.	c	9.795	1.178881	0.21787	.	.	ENSG00000121211	ENST00000240488;ENST00000508731;ENST00000504860	.	.	.	5.6	3.13	0.36017	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.090126	0.85682	D	0.000000	T	0.17831	0.0428	N	0.08118	0	0.23959	N	0.996344	B	0.17268	0.021	B	0.18561	0.022	T	0.16129	-1.0413	9	0.42905	T	0.14	-7.5718	7.5957	0.28046	0.1254:0.0692:0.0:0.8054	.	21	Q9BWT6	MND1_HUMAN	C	21;6;6	.	ENSP00000240488:S21C	S	+	2	0	MND1	154490724	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	4.493000	0.60341	0.385000	0.24970	-0.285000	0.09966	TCT	MND1	-	pfam_Mnd1,pfam_Pencillinase_R,pirsf_Mnd1	ENSG00000121211		0.294	MND1-002	PUTATIVE	alternative_5_UTR|basic|exp_conf	protein_coding	MND1	HGNC	protein_coding	OTTHUMT00000365195.1	35	0.00	0	C	NM_032117		154271274	154271274	+1	no_errors	ENST00000240488	ensembl	human	known	69_37n	missense	36	46.27	31	SNP	1.000	G
MS4A10	341116	genome.wustl.edu	37	11	60565929	60565929	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr11:60565929C>T	ENST00000308287.1	+	7	760	c.664C>T	c.(664-666)Ccc>Tcc	p.P222S		NM_206893.3	NP_996776.2	Q96PG2	M4A10_HUMAN	membrane-spanning 4-domains, subfamily A, member 10	222						integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|skin(2)	21						GCCGGTGGAGCCCCCGCCATC	0.557																																						dbGAP											0													100.0	93.0	96.0					11																	60565929		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK122633	CCDS7992.1	11q12.2	2008-02-05				ENSG00000172689			13368	protein-coding gene	gene with protein product		608403				11486273, 11401424	Standard	NM_206893		Approved	CD20L7, MS4A9	uc001npz.1	Q96PG2		ENST00000308287.1:c.664C>T	11.37:g.60565929C>T	ENSP00000311862:p.Pro222Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP45|Q96PG3	Missense_Mutation	SNP	pfam_CD20-like	p.P222S	ENST00000308287.1	37	c.664	CCDS7992.1	11	.	.	.	.	.	.	.	.	.	.	C	11.48	1.651161	0.29336	.	.	ENSG00000172689	ENST00000308287	T	0.26810	1.71	2.59	2.59	0.31030	.	0.523771	0.14449	N	0.318918	T	0.33585	0.0868	L	0.29908	0.895	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.05632	-1.0873	10	0.36615	T	0.2	-3.8268	8.8249	0.35050	0.0:1.0:0.0:0.0	.	222	Q96PG2	M4A10_HUMAN	S	222	ENSP00000311862:P222S	ENSP00000311862:P222S	P	+	1	0	MS4A10	60322505	0.005000	0.15991	0.003000	0.11579	0.014000	0.08584	2.401000	0.44513	1.739000	0.51704	0.467000	0.42956	CCC	MS4A10	-	NULL	ENSG00000172689		0.557	MS4A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A10	HGNC	protein_coding	OTTHUMT00000395619.1	60	0.00	0	C	NM_206893		60565929	60565929	+1	no_errors	ENST00000308287	ensembl	human	known	69_37n	missense	61	40.78	42	SNP	0.003	T
MUC12	10071	genome.wustl.edu	37	7	100643155	100643155	+	Missense_Mutation	SNP	A	A	T	rs199601905	byFrequency	TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr7:100643155A>T	ENST00000379442.3	+	5	9740	c.9740A>T	c.(9739-9741)aAa>aTa	p.K3247I	MUC12_ENST00000536621.1_Missense_Mutation_p.K3104I			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3247	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CTGAGTGAGAAATCTACCACC	0.532																																						dbGAP											0													3.0	4.0	4.0					7																	100643155		642	1461	2103	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.9740A>T	7.37:g.100643155A>T	ENSP00000368755:p.Lys3247Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.K3247I	ENST00000379442.3	37	c.9740		7	.	.	.	.	.	.	.	.	.	.	A	6.096	0.385972	0.11524	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.13196	2.61;2.61	0.86	-1.72	0.08107	.	.	.	.	.	T	0.05502	0.0145	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.34775	-0.9815	7	0.38643	T	0.18	.	2.3687	0.04325	0.2892:0.3217:0.3891:0.0	.	.	.	.	I	3247;3104	ENSP00000368755:K3247I;ENSP00000441929:K3104I	ENSP00000368755:K3247I	K	+	2	0	MUC12	100429875	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-1.253000	0.02877	-0.939000	0.03709	0.155000	0.16302	AAA	MUC12	-	NULL	ENSG00000205277		0.532	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	22	0.00	0	A	XM_379904		100643155	100643155	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.000	T
MUC21	394263	genome.wustl.edu	37	6	30955119	30955119	+	Silent	SNP	A	A	T	rs55918804	byFrequency	TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr6:30955119A>T	ENST00000376296.3	+	2	1408	c.1167A>T	c.(1165-1167)acA>acT	p.T389T	MUC21_ENST00000486149.2_5'UTR	NM_001010909.2	NP_001010909.2	Q5SSG8	MUC21_HUMAN	mucin 21, cell surface associated	389	28 X 15 AA approximate tandem repeats.|Ser-rich.				cellular protein metabolic process (GO:0044267)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cell-substrate adhesion (GO:0010812)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(4)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GGGCCAGCACAGCCACCACCT	0.637																																						dbGAP											0													143.0	140.0	141.0					6																	30955119		2203	4294	6497	-	-	-	SO:0001819	synonymous_variant	0			AK056612	CCDS34388.1	6p21.33	2008-05-14	2008-05-14	2008-05-14	ENSG00000204544	ENSG00000204544		"""Mucins"""	21661	protein-coding gene	gene with protein product	"""epiglycanin"""		"""chromosome 6 open reading frame 205"""	C6orf205		17977904	Standard	NM_001010909		Approved	bCX31G15.2	uc003nsh.2	Q5SSG8	OTTHUMG00000031216	ENST00000376296.3:c.1167A>T	6.37:g.30955119A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0UZT7|B4DQ55|C9JMK2|D9N007|Q0VGF1|Q3B7T2|Q5SS94|Q6UXC5	Silent	SNP	NULL	p.T389	ENST00000376296.3	37	c.1167	CCDS34388.1	6																																																																																			MUC21	-	NULL	ENSG00000204544		0.637	MUC21-001	KNOWN	basic|CCDS	protein_coding	MUC21	HGNC	protein_coding	OTTHUMT00000128579.3	52	0.00	0	A	NM_001010909		30955119	30955119	+1	no_errors	ENST00000376296	ensembl	human	known	69_37n	silent	52	13.33	8	SNP	0.074	T
MUC4	4585	genome.wustl.edu	37	3	195509449	195509449	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr3:195509449G>A	ENST00000463781.3	-	2	9461	c.9002C>T	c.(9001-9003)gCa>gTa	p.A3001V	MUC4_ENST00000475231.1_Missense_Mutation_p.A3001V|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		ACCTATGGATGCTGAGGAAGT	0.577																																						dbGAP											0													15.0	10.0	12.0					3																	195509449		625	1552	2177	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9002C>T	3.37:g.195509449G>A	ENSP00000417498:p.Ala3001Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.A3001V	ENST00000463781.3	37	c.9002	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	N	2.389	-0.340385	0.05243	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.30448	1.53;1.54	.	.	.	.	.	.	.	.	T	0.20251	0.0487	N	0.19112	0.55	0.09310	N	1	D	0.53885	0.963	P	0.50192	0.634	T	0.07908	-1.0748	7	.	.	.	.	2.1441	0.03782	0.3271:0.3438:0.3291:0.0	.	2873	E7ESK3	.	V	3001	ENSP00000417498:A3001V;ENSP00000420243:A3001V	.	A	-	2	0	MUC4	196994228	.	.	0.008000	0.14137	0.000000	0.00434	.	.	-0.893000	0.03930	0.000000	0.15137	GCA	MUC4	-	NULL	ENSG00000145113		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	35	0.00	0	G	NM_018406		195509449	195509449	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	29	19.44	7	SNP	0.002	A
NLRP3	114548	genome.wustl.edu	37	1	247587695	247587695	+	Missense_Mutation	SNP	C	C	A	rs180177462		TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:247587695C>A	ENST00000336119.3	+	3	1696	c.950C>A	c.(949-951)cCg>cAg	p.P317Q	NLRP3_ENST00000391827.2_Missense_Mutation_p.P317Q|NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000366497.2_Missense_Mutation_p.P317Q|NLRP3_ENST00000391828.3_Missense_Mutation_p.P317Q|NLRP3_ENST00000348069.2_Missense_Mutation_p.P317Q|NLRP3_ENST00000366496.2_Missense_Mutation_p.P317Q	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	317	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			CACATAGGACCGCTCTGCACT	0.567																																						dbGAP											0			GRCh37	CM060236	NLRP3	M	rs180177462						69.0	69.0	69.0					1																	247587695		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.950C>A	1.37:g.247587695C>A	ENSP00000337383:p.Pro317Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.P317Q	ENST00000336119.3	37	c.950	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	C	4.231	0.041676	0.08196	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	T;T;T;T;T;T	0.74632	-0.79;-0.8;-0.79;-0.86;-0.8;-0.83	4.04	0.887	0.19200	NACHT nucleoside triphosphatase (1);	0.844988	0.10340	N	0.686446	T	0.64461	0.2600	L	0.38175	1.15	0.09310	N	1	B;B;P;B;B	0.37914	0.355;0.049;0.611;0.073;0.044	B;B;B;B;B	0.43123	0.347;0.141;0.409;0.11;0.022	T	0.52208	-0.8606	10	0.27785	T	0.31	.	4.7316	0.12968	0.4776:0.4099:0.0:0.1124	.	317;317;317;317;317	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	Q	317	ENSP00000375704:P317Q;ENSP00000355453:P317Q;ENSP00000337383:P317Q;ENSP00000294752:P317Q;ENSP00000355452:P317Q;ENSP00000375703:P317Q	ENSP00000337383:P317Q	P	+	2	0	NLRP3	245654318	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-0.252000	0.08806	0.187000	0.20147	0.563000	0.77884	CCG	NLRP3	-	pfscan_NACHT_NTPase	ENSG00000162711		0.567	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1	13	0.00	0	C	NM_004895		247587695	247587695	+1	no_errors	ENST00000336119	ensembl	human	known	69_37n	missense	17	54.05	20	SNP	0.003	A
OR51A2	401667	genome.wustl.edu	37	11	4976926	4976926	+	Silent	SNP	T	T	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr11:4976926T>A	ENST00000380371.1	-	1	17	c.18A>T	c.(16-18)acA>acT	p.T6T	MMP26_ENST00000380390.1_Intron|MMP26_ENST00000477339.1_Intron	NM_001004748.1	NP_001004748.1	Q8NGJ7	O51A2_HUMAN	olfactory receptor, family 51, subfamily A, member 2	6						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;3.22e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0284)|LUSC - Lung squamous cell carcinoma(625;0.19)		CAACATATGATGTGTTGATAA	0.428																																						dbGAP											0													47.0	46.0	46.0					11																	4976926		2155	4271	6426	-	-	-	SO:0001819	synonymous_variant	0			AB065797	CCDS31368.1	11p15.4	2012-08-09			ENSG00000205496	ENSG00000205496		"""GPCR / Class A : Olfactory receptors"""	14764	protein-coding gene	gene with protein product							Standard	NM_001004748		Approved		uc010qyt.2	Q8NGJ7	OTTHUMG00000066602	ENST00000380371.1:c.18A>T	11.37:g.4976926T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.T6	ENST00000380371.1	37	c.18	CCDS31368.1	11																																																																																			OR51A2	-	NULL	ENSG00000205496		0.428	OR51A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51A2	HGNC	protein_coding	OTTHUMT00000142809.1	58	0.00	0	T	NM_001004748		4976926	4976926	-1	no_errors	ENST00000380371	ensembl	human	known	69_37n	silent	48	43.53	37	SNP	0.001	A
OR5B3	441608	genome.wustl.edu	37	11	58170355	58170355	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr11:58170355G>C	ENST00000309403.2	-	1	527	c.528C>G	c.(526-528)ttC>ttG	p.F176L		NM_001005469.1	NP_001005469.1	Q8NH48	OR5B3_HUMAN	olfactory receptor, family 5, subfamily B, member 3	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(17)|ovary(1)|prostate(1)|skin(2)|stomach(6)|upper_aerodigestive_tract(1)	34	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				GAATATCACAGAAAAAGTGAT	0.423																																						dbGAP											0													100.0	94.0	96.0					11																	58170355		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065545	CCDS31549.1	11q12.1	2012-08-09			ENSG00000172769	ENSG00000172769		"""GPCR / Class A : Olfactory receptors"""	8324	protein-coding gene	gene with protein product				OR5B13			Standard	NM_001005469		Approved	OST129	uc010rkf.2	Q8NH48	OTTHUMG00000167516	ENST00000309403.2:c.528C>G	11.37:g.58170355G>C	ENSP00000308270:p.Phe176Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEV6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F176L	ENST00000309403.2	37	c.528	CCDS31549.1	11	.	.	.	.	.	.	.	.	.	.	g	14.92	2.678564	0.47886	.	.	ENSG00000172769	ENST00000309403	T	0.00220	8.52	4.05	4.05	0.47172	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000113	T	0.00608	0.0020	M	0.83603	2.65	0.32812	D	0.501512	D	0.89917	1.0	D	0.85130	0.997	T	0.55379	-0.8150	10	0.72032	D	0.01	-81.1037	15.2879	0.73843	0.0:0.0:1.0:0.0	.	176	Q8NH48	OR5B3_HUMAN	L	176	ENSP00000308270:F176L	ENSP00000308270:F176L	F	-	3	2	OR5B3	57926931	1.000000	0.71417	1.000000	0.80357	0.278000	0.26855	0.926000	0.28804	2.264000	0.75181	0.650000	0.86243	TTC	OR5B3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000172769		0.423	OR5B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B3	HGNC	protein_coding	OTTHUMT00000394886.1	26	0.00	0	G	NM_001005469		58170355	58170355	-1	no_errors	ENST00000309403	ensembl	human	known	69_37n	missense	34	32.00	16	SNP	1.000	C
OTOGL	283310	genome.wustl.edu	37	12	80730698	80730698	+	Missense_Mutation	SNP	T	T	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr12:80730698T>G	ENST00000547103.1	+	41	4717	c.4711T>G	c.(4711-4713)Tct>Gct	p.S1571A	OTOGL_ENST00000458043.2_Missense_Mutation_p.S1583A			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1571	VWFD 4. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TAAGGCTCCCTCTGGAAGAAT	0.318																																						dbGAP											0													25.0	22.0	23.0					12																	80730698		1783	4039	5822	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.4711T>G	12.37:g.80730698T>G	ENSP00000447211:p.Ser1571Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.S1583A	ENST00000547103.1	37	c.4747		12	.	.	.	.	.	.	.	.	.	.	T	5.288	0.238523	0.10023	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.15487	2.42;2.42	5.06	1.23	0.21249	.	.	.	.	.	T	0.10937	0.0267	L	0.36672	1.1	0.09310	N	1	.	.	.	.	.	.	T	0.32214	-0.9915	7	0.21014	T	0.42	.	0.8103	0.01092	0.1593:0.2505:0.1635:0.4267	.	.	.	.	A	1571;1583	ENSP00000447211:S1571A;ENSP00000400895:S1583A	ENSP00000400895:S1583A	S	+	1	0	OTOGL	79254829	0.157000	0.22836	0.738000	0.30950	0.951000	0.60555	0.496000	0.22499	0.314000	0.23086	0.482000	0.46254	TCT	OTOGL	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000165899		0.318	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	35	0.00	0	T	NM_173591		80730698	80730698	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.061	G
PDLIM5	10611	genome.wustl.edu	37	4	95498545	95498545	+	Intron	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr4:95498545C>G	ENST00000317968.4	+	5	846				PDLIM5_ENST00000508216.1_Intron|PDLIM5_ENST00000318007.5_Intron|PDLIM5_ENST00000514743.1_Intron|PDLIM5_ENST00000538141.1_Missense_Mutation_p.S104R|PDLIM5_ENST00000437932.1_Intron|PDLIM5_ENST00000450793.1_Intron|PDLIM5_ENST00000542407.1_Intron|PDLIM5_ENST00000380180.3_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5						regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		AGAGGGAGAGCAGGAGCTCTA	0.468																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.710+1360C>G	4.37:g.95498545C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S104R	ENST00000317968.4	37	c.312	CCDS3641.1	4	.	.	.	.	.	.	.	.	.	.	C	10.79	1.449876	0.26074	.	.	ENSG00000163110	ENST00000538141	T	0.37752	1.18	3.22	1.25	0.21368	.	.	.	.	.	T	0.17195	0.0413	.	.	.	0.21499	N	0.999664	.	.	.	.	.	.	T	0.22312	-1.0220	6	0.18276	T	0.48	.	1.7059	0.02881	0.2018:0.4375:0.2327:0.1279	.	.	.	.	R	104	ENSP00000439795:S104R	ENSP00000439795:S104R	S	+	3	2	PDLIM5	95717568	0.131000	0.22433	0.815000	0.32552	0.561000	0.35649	0.116000	0.15561	0.518000	0.28383	0.313000	0.20887	AGC	PDLIM5	-	NULL	ENSG00000163110		0.468	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM5	HGNC	protein_coding	OTTHUMT00000253586.1	23	0.00	0	C			95498545	95498545	+1	no_errors	ENST00000538141	ensembl	human	known	69_37n	missense	36	44.62	29	SNP	0.268	G
PINK1	65018	genome.wustl.edu	37	1	20972049	20972049	+	Intron	SNP	C	C	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:20972049C>A	ENST00000321556.4	+	5	1053				PINK1-AS_ENST00000451424.1_RNA|PINK1_ENST00000492302.1_Intron	NM_032409.2	NP_115785.1	Q9BXM7	PINK1_HUMAN	PTEN induced putative kinase 1						activation of protein kinase B activity (GO:0032148)|cell death (GO:0008219)|cellular response to hypoxia (GO:0071456)|cellular response to toxic substance (GO:0097237)|intracellular signal transduction (GO:0035556)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of gene expression (GO:0010629)|negative regulation of hydrogen peroxide-induced neuron intrinsic apoptotic signaling pathway (GO:1903384)|negative regulation of JNK cascade (GO:0046329)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced cell death (GO:1903202)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of oxidative stress-induced neuron death (GO:1903204)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|peptidyl-serine autophosphorylation (GO:0036289)|peptidyl-serine phosphorylation (GO:0018105)|phosphorylation (GO:0016310)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of mitochondrial electron transport, NADH to ubiquinone (GO:1902958)|positive regulation of peptidase activity (GO:0010952)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of synaptic transmission, dopaminergic (GO:0032226)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein complex assembly (GO:0043254)|regulation of protein ubiquitination (GO:0031396)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|response to stress (GO:0006950)|TORC2 signaling (GO:0038203)|ubiquitin-dependent protein catabolic process (GO:0006511)	astrocyte projection (GO:0097449)|axon (GO:0030424)|cell body (GO:0044297)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|Lewy body (GO:0097413)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|C3HC4-type RING finger domain binding (GO:0055131)|calcium-dependent protein kinase activity (GO:0010857)|kinase activity (GO:0016301)|magnesium ion binding (GO:0000287)|peptidase activator activity (GO:0016504)|protease binding (GO:0002020)|protein kinase B binding (GO:0043422)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)	14		all_lung(284;2.72e-05)|Lung NSC(340;2.94e-05)|Colorectal(325;3.46e-05)|Renal(390;0.000147)|Breast(348;0.00179)|Ovarian(437;0.00327)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|COAD - Colon adenocarcinoma(152;1.21e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000146)|Kidney(64;0.000182)|GBM - Glioblastoma multiforme(114;0.000497)|KIRC - Kidney renal clear cell carcinoma(64;0.00269)|STAD - Stomach adenocarcinoma(196;0.00308)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		CCCCTCTCCGCCAGCTATCCC	0.567																																					Esophageal Squamous(145;853 1803 8146 34412 35011)	dbGAP											0													42.0	41.0	41.0					1																	20972049		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AB053323	CCDS211.1	1p36.12	2011-07-21			ENSG00000158828	ENSG00000158828		"""Parkinson disease"""	14581	protein-coding gene	gene with protein product		608309	"""Parkinson disease (autosomal recessive) 6"""	PARK6		11494141, 15349860	Standard	NM_032409		Approved		uc001bdm.3	Q9BXM7	OTTHUMG00000002841	ENST00000321556.4:c.960-4C>A	1.37:g.20972049C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6T9|Q8NBU3|Q96DE4	RNA	SNP	-	NULL	ENST00000321556.4	37	NULL	CCDS211.1	1																																																																																			PINK1	-	-	ENSG00000158828		0.567	PINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PINK1	HGNC	protein_coding	OTTHUMT00000007954.1	51	0.00	0	C	NM_032409		20972049	20972049	+1	no_errors	ENST00000400490	ensembl	human	known	69_37n	rna	40	34.43	21	SNP	0.393	A
PIWIL1	9271	genome.wustl.edu	37	12	130839167	130839167	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr12:130839167C>A	ENST00000245255.3	+	10	1402	c.1130C>A	c.(1129-1131)cCa>cAa	p.P377Q		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	377	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		GGGACACTGCCAGGGCCTGCC	0.532																																						dbGAP											0													61.0	68.0	66.0					12																	130839167		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.1130C>A	12.37:g.130839167C>A	ENSP00000245255:p.Pro377Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.P377Q	ENST00000245255.3	37	c.1130	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	C	8.882	0.951802	0.18431	.	.	ENSG00000125207	ENST00000245255	T	0.09630	2.96	5.37	5.37	0.77165	Argonaute/Dicer protein, PAZ (4);	0.415352	0.28001	N	0.016995	T	0.08758	0.0217	L	0.31664	0.95	0.33852	D	0.632704	B;B	0.17268	0.008;0.021	B;B	0.21546	0.035;0.021	T	0.17471	-1.0368	10	0.21540	T	0.41	-11.6204	11.0238	0.47732	0.1432:0.7185:0.1383:0.0	.	377;377	Q96J94;Q96J94-2	PIWL1_HUMAN;.	Q	377	ENSP00000245255:P377Q	ENSP00000245255:P377Q	P	+	2	0	PIWIL1	129405120	0.059000	0.20769	0.531000	0.27976	0.857000	0.48899	2.057000	0.41365	2.512000	0.84698	0.558000	0.71614	CCA	PIWIL1	-	pfam_PAZ,superfamily_PAZ,smart_PAZ,pfscan_PAZ	ENSG00000125207		0.532	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	45	0.00	0	C			130839167	130839167	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	missense	26	52.73	29	SNP	0.917	A
PTPRA	5786	genome.wustl.edu	37	20	2985753	2985753	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr20:2985753G>A	ENST00000216877.6	+	9	1163	c.763G>A	c.(763-765)Gaa>Aaa	p.E255K	PTPRA_ENST00000380393.3_Missense_Mutation_p.E264K|PTPRA_ENST00000425918.2_Missense_Mutation_p.E275K|PTPRA_ENST00000358719.4_Missense_Mutation_p.E120K|PTPRA_ENST00000356147.3_Missense_Mutation_p.E255K|PTPRA_ENST00000399903.2_Missense_Mutation_p.E264K|PTPRA_ENST00000318266.5_Missense_Mutation_p.E255K	NM_080840.2	NP_543030.1	P18433	PTPRA_HUMAN	protein tyrosine phosphatase, receptor type, A	264	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|insulin receptor signaling pathway (GO:0008286)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein phosphorylation (GO:0006468)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17						TTCCAAGGAGGAAAACAAGGA	0.413																																						dbGAP											0													243.0	240.0	241.0					20																	2985753		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13038.1, CCDS13039.1	20p13	2011-06-09			ENSG00000132670	ENSG00000132670		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9664	protein-coding gene	gene with protein product		176884		PTPRL2, PTPA		2172030, 2169617	Standard	NM_080840		Approved	LRP, HLPR, HPTPA, RPTPA	uc002whn.3	P18433	OTTHUMG00000031718	ENST00000216877.6:c.763G>A	20.37:g.2985753G>A	ENSP00000216877:p.Glu255Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2G8|D3DVX5|Q14513|Q7Z2I2|Q96TD9	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_a/e-type,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E275K	ENST00000216877.6	37	c.823	CCDS13039.1	20	.	.	.	.	.	.	.	.	.	.	G	31	5.099503	0.94197	.	.	ENSG00000132670	ENST00000380393;ENST00000216877;ENST00000399903;ENST00000358719;ENST00000425918;ENST00000318266;ENST00000356147	T;T;T;T;T;T;T	0.12672	2.66;2.66;2.66;2.66;2.66;2.66;2.66	5.66	5.66	0.87406	Protein-tyrosine phosphatase, receptor/non-receptor type (2);	0.000000	0.85682	U	0.000000	T	0.33818	0.0876	L	0.58428	1.81	0.80722	D	1	P;P;D;D	0.63880	0.923;0.954;0.993;0.973	P;P;D;P	0.69479	0.545;0.548;0.964;0.815	T	0.00460	-1.1726	10	0.30078	T	0.28	.	18.5318	0.90995	0.0:0.0:1.0:0.0	.	275;264;264;255	B7Z2A4;P18433-3;P18433;P18433-4	.;.;PTPRA_HUMAN;.	K	264;255;264;120;275;255;255	ENSP00000369756:E264K;ENSP00000216877:E255K;ENSP00000382787:E264K;ENSP00000351559:E120K;ENSP00000393553:E275K;ENSP00000314568:E255K;ENSP00000348468:E255K	ENSP00000216877:E255K	E	+	1	0	PTPRA	2933753	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.921000	0.92784	2.675000	0.91044	0.655000	0.94253	GAA	PTPRA	-	pirsf_Tyr_Pase_rcpt_a/e-type,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000132670		0.413	PTPRA-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTPRA	HGNC	protein_coding	OTTHUMT00000077682.3	95	0.00	0	G			2985753	2985753	+1	no_errors	ENST00000425918	ensembl	human	known	69_37n	missense	116	20.55	30	SNP	1.000	A
RASGRP2	10235	genome.wustl.edu	37	11	64508450	64508450	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr11:64508450C>T	ENST00000354024.3	-	5	593	c.341G>A	c.(340-342)cGg>cAg	p.R114Q	RASGRP2_ENST00000377489.1_Missense_Mutation_p.R114Q|RASGRP2_ENST00000377486.3_Missense_Mutation_p.R114Q|RASGRP2_ENST00000394430.1_Missense_Mutation_p.R114Q|RASGRP2_ENST00000377497.3_Missense_Mutation_p.R114Q|RASGRP2_ENST00000394428.1_3'UTR|RASGRP2_ENST00000377487.1_Missense_Mutation_p.R114Q|RASGRP2_ENST00000394432.3_Missense_Mutation_p.R114Q|RASGRP2_ENST00000377494.1_Missense_Mutation_p.R114Q|RASGRP2_ENST00000394429.1_3'UTR	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	114	N-terminal Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00135}.				blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GCTGCTGTGCCGTCGGTTCCC	0.557											OREG0004006	type=REGULATORY REGION|Gene=RASGRP2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													76.0	61.0	66.0					11																	64508450		2201	4297	6498	-	-	-	SO:0001583	missense	0			U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.341G>A	11.37:g.64508450C>T	ENSP00000338864:p.Arg114Gln	Somatic	1077	WXS	Illumina GAIIx	Phase_IV	A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R114Q	ENST00000354024.3	37	c.341	CCDS31598.1	11	.	.	.	.	.	.	.	.	.	.	C	14.20	2.463948	0.43736	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024;ENST00000431822;ENST00000377486;ENST00000377487;ENST00000377489;ENST00000394430;ENST00000439594	T;T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	4.17	4.17	0.49024	Ras guanine nucleotide exchange factor, domain (1);Ras-like guanine nucleotide exchange factor, N-terminal (2);	0.124126	0.53938	D	0.000052	T	0.22044	0.0531	L	0.38531	1.155	0.42855	D	0.994099	D	0.53619	0.961	B	0.39068	0.289	T	0.05241	-1.0897	10	0.18710	T	0.47	0.4858	14.3537	0.66722	0.0:1.0:0.0:0.0	.	114	Q7LDG7	GRP2_HUMAN	Q	114	ENSP00000366714:R114Q;ENSP00000377953:R114Q;ENSP00000366717:R114Q;ENSP00000338864:R114Q;ENSP00000399114:R114Q;ENSP00000366706:R114Q;ENSP00000366707:R114Q;ENSP00000366709:R114Q;ENSP00000377951:R114Q	ENSP00000338864:R114Q	R	-	2	0	RASGRP2	64265026	0.135000	0.22499	0.863000	0.33907	0.794000	0.44872	2.743000	0.47442	2.034000	0.60081	0.313000	0.20887	CGG	RASGRP2	-	superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,pfscan_Ras-like_Gua-exchang_fac_N	ENSG00000068831		0.557	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	HGNC	protein_coding	OTTHUMT00000142062.1	36	0.00	0	C	NM_153819		64508450	64508450	-1	no_errors	ENST00000377494	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	0.997	T
RASSF5	83593	genome.wustl.edu	37	1	206757788	206757788	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:206757788G>C	ENST00000355294.4	+	4	817	c.760G>C	c.(760-762)Gct>Cct	p.A254P	RASSF5_ENST00000491368.1_3'UTR|RASSF5_ENST00000367117.3_Missense_Mutation_p.A254P|RASSF5_ENST00000304534.8_Missense_Mutation_p.A101P|EIF2D_ENST00000472709.2_Intron	NM_182663.2	NP_872604.1	Q8WWW0	RASF5_HUMAN	Ras association (RalGDS/AF-6) domain family member 5	254					apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein localization to nucleus (GO:1900180)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)	8	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.166)			GACGGTGCCTGCTGGGATCCG	0.602											OREG0014174	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(162;656 1984 11916 22872 31529)	dbGAP											0													87.0	89.0	88.0					1																	206757788		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004270	CCDS1463.1, CCDS1464.1, CCDS30998.1	1q31	2014-04-10	2008-02-22		ENSG00000136653	ENSG00000266094			17609	protein-coding gene	gene with protein product		607020				11978988, 11965544	Standard	NM_182663		Approved	Maxp1, NORE1, RAPL	uc001hed.3	Q8WWW0	OTTHUMG00000184616	ENST00000355294.4:c.760G>C	1.37:g.206757788G>C	ENSP00000347443:p.Ala254Pro	Somatic	2162	WXS	Illumina GAIIx	Phase_IV	A8K1E6|Q5SY32|Q8WWV9|Q8WXF4|Q9BT99	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.A254P	ENST00000355294.4	37	c.760	CCDS30998.1	1	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839709	0.71488	.	.	ENSG00000136653	ENST00000355294;ENST00000367117;ENST00000338603;ENST00000367118;ENST00000304534	T;T;T;T	0.16743	2.93;2.33;2.32;2.61	5.12	5.12	0.69794	.	0.221963	0.47093	D	0.000254	T	0.32041	0.0816	L	0.41710	1.295	0.80722	D	1	B;D;D;B;D	0.76494	0.188;0.999;0.999;0.047;0.999	B;P;D;B;D	0.73708	0.042;0.899;0.929;0.042;0.981	T	0.01188	-1.1424	10	0.33141	T	0.24	-27.8223	15.7182	0.77685	0.0:0.0:1.0:0.0	.	252;101;254;254;256	E9PDW5;Q8WWW0-2;Q8WWW0-3;Q8WWW0;Q59GG4	.;.;.;RASF5_HUMAN;.	P	254;254;254;254;101	ENSP00000347443:A254P;ENSP00000356084:A254P;ENSP00000342620:A254P;ENSP00000306091:A101P	ENSP00000306091:A101P	A	+	1	0	RASSF5	204824411	0.933000	0.31639	0.908000	0.35775	0.995000	0.86356	2.889000	0.48601	2.381000	0.81170	0.549000	0.68633	GCT	RASSF5	-	NULL	ENSG00000136653		0.602	RASSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF5	HGNC	protein_coding	OTTHUMT00000088469.1	35	0.00	0	G	NM_031437		206757788	206757788	+1	no_errors	ENST00000355294	ensembl	human	known	69_37n	missense	43	34.78	24	SNP	0.850	C
RESP18	389075	genome.wustl.edu	37	2	220197269	220197269	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr2:220197269C>G	ENST00000333527.5	-	2	208	c.209G>C	c.(208-210)gGc>gCc	p.G70A	RESP18_ENST00000392083.1_5'UTR	NM_001007089.3	NP_001007090.3	Q5W5W9	RES18_HUMAN	regulated endocrine-specific protein 18	28					in utero embryonic development (GO:0001701)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|perikaryon (GO:0043204)|rough endoplasmic reticulum lumen (GO:0048237)|secretory granule (GO:0030141)				endometrium(1)|prostate(1)	2						GTCGCTGCAGCCCCCCGGGCA	0.677																																						dbGAP											0													11.0	16.0	14.0					2																	220197269		691	1588	2279	-	-	-	SO:0001583	missense	0			AF437883	CCDS33382.2	2q35	2012-12-07	2012-12-07		ENSG00000182698	ENSG00000182698			33762	protein-coding gene	gene with protein product		612721	"""regulated endocrine-specific protein 18 homolog (rat)"""			17951542, 7988462	Standard	NM_001007089		Approved		uc002vlc.4	Q5W5W9	OTTHUMG00000150223	ENST00000333527.5:c.209G>C	2.37:g.220197269C>G	ENSP00000330269:p.Gly70Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQ49|Q38I23|Q5W5X0	Missense_Mutation	SNP	NULL	p.G70A	ENST00000333527.5	37	c.209	CCDS33382.2	2	.	.	.	.	.	.	.	.	.	.	C	8.197	0.797190	0.16327	.	.	ENSG00000182698	ENST00000333527	.	.	.	4.43	-0.497	0.12023	.	0.868649	0.09598	N	0.780511	T	0.42877	0.1222	M	0.69823	2.125	0.09310	N	1	P	0.42908	0.793	B	0.42738	0.396	T	0.36432	-0.9748	9	0.59425	D	0.04	.	7.2759	0.26283	0.0:0.4895:0.0:0.5105	.	70	Q5W5W9-2	.	A	70	.	ENSP00000330269:G70A	G	-	2	0	RESP18	219905513	0.019000	0.18553	0.032000	0.17829	0.470000	0.32858	0.103000	0.15292	-0.214000	0.10078	-0.136000	0.14681	GGC	RESP18	-	NULL	ENSG00000182698		0.677	RESP18-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	RESP18	HGNC	protein_coding	OTTHUMT00000316885.1	51	0.00	0	C	NM_001007089		220197269	220197269	-1	no_errors	ENST00000333527	ensembl	human	putative	69_37n	missense	68	19.05	16	SNP	0.055	G
RHPN1	114822	genome.wustl.edu	37	8	144463488	144463488	+	Nonsense_Mutation	SNP	A	A	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr8:144463488A>T	ENST00000289013.6	+	12	1563	c.1462A>T	c.(1462-1464)Aag>Tag	p.K488*		NM_052924.2	NP_443156.2	Q8TCX5	RHPN1_HUMAN	rhophilin, Rho GTPase binding protein 1	513					signal transduction (GO:0007165)		small GTPase regulator activity (GO:0005083)			endometrium(1)|large_intestine(1)|lung(7)	9	all_cancers(97;7.39e-11)|all_epithelial(106;5.44e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.156)			GTCCCAGGGGAAGGGGCCTGA	0.637																																						dbGAP											0													46.0	50.0	48.0					8																	144463488		2093	4219	6312	-	-	-	SO:0001587	stop_gained	0			AB067516	CCDS47927.1	8q24.3	2003-02-06			ENSG00000158106	ENSG00000158106			19973	protein-coding gene	gene with protein product		601031				11572484	Standard	NM_052924		Approved	KIAA1929, RHPN, ODF5	uc003yyb.3	Q8TCX5	OTTHUMG00000165006	ENST00000289013.6:c.1462A>T	8.37:g.144463488A>T	ENSP00000289013:p.Lys488*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAV1|Q96PV9	Nonsense_Mutation	SNP	pfam_BRO1_dom,pfam_HR1_rho-bd,pfam_PDZ,superfamily_PDZ,superfamily_HR1_rho-bd,smart_HR1_rho-bd,smart_PDZ,pfscan_BRO1_dom,pfscan_PDZ	p.K488*	ENST00000289013.6	37	c.1462	CCDS47927.1	8	.	.	.	.	.	.	.	.	.	.	A	34	5.341857	0.95783	.	.	ENSG00000158106	ENST00000289013	.	.	.	4.83	-2.12	0.07165	.	0.206475	0.40469	N	0.001082	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-24.5396	4.9422	0.13971	0.491:0.2757:0.2333:0.0	.	.	.	.	X	488	.	ENSP00000289013:K488X	K	+	1	0	RHPN1	144534631	0.992000	0.36948	0.000000	0.03702	0.528000	0.34623	0.749000	0.26320	-0.376000	0.07943	0.374000	0.22700	AAG	RHPN1	-	pfam_BRO1_dom	ENSG00000158106		0.637	RHPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHPN1	HGNC	protein_coding	OTTHUMT00000381417.1	36	0.00	0	A			144463488	144463488	+1	no_errors	ENST00000289013	ensembl	human	known	69_37n	nonsense	69	28.87	28	SNP	0.001	T
RPS6KA1	6195	genome.wustl.edu	37	1	26887564	26887564	+	Missense_Mutation	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:26887564C>T	ENST00000374168.2	+	16	1524	c.1370C>T	c.(1369-1371)tCa>tTa	p.S457L	RPS6KA1_ENST00000531382.1_Missense_Mutation_p.S466L|RPS6KA1_ENST00000374166.4_Missense_Mutation_p.S446L|RPS6KA1_ENST00000374162.2_Missense_Mutation_p.S365L|RPS6KA1_ENST00000526792.1_Missense_Mutation_p.S365L|RPS6KA1_ENST00000530003.1_Missense_Mutation_p.S441L	NM_002953.3	NP_002944.2	Q15418	KS6A1_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 1	457	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell cycle (GO:0007049)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell growth (GO:0030307)|positive regulation of hepatic stellate cell activation (GO:2000491)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of translation in response to stress (GO:0043555)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			lung(1)	1		all_cancers(24;2.49e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00571)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;1.12e-50)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-29)|Colorectal(126;1.4e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000537)|KIRC - Kidney renal clear cell carcinoma(1967;0.000759)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.0361)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.161)|LUSC - Lung squamous cell carcinoma(448;0.234)		CGGGATCCTTCAGAAGAGATT	0.547																																						dbGAP											0													84.0	84.0	84.0					1																	26887564		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014966	CCDS284.1, CCDS30649.1	1p	2011-04-05	2002-08-29		ENSG00000117676	ENSG00000117676			10430	protein-coding gene	gene with protein product		601684	"""ribosomal protein S6 kinase, 90kD, polypeptide 1"""			8141249	Standard	NM_001006665		Approved	RSK, RSK1, HU-1	uc001bms.1	Q15418	OTTHUMG00000004003	ENST00000374168.2:c.1370C>T	1.37:g.26887564C>T	ENSP00000363283:p.Ser457Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGG4|A8K9K7|B2RDY8|B7Z5J0|Q5SVM5|Q5SVM8|Q5SVM9|Q96C05|Q9BQK2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S466L	ENST00000374168.2	37	c.1397	CCDS284.1	1	.	.	.	.	.	.	.	.	.	.	C	24.5	4.536817	0.85812	.	.	ENSG00000117676	ENST00000374168;ENST00000374166;ENST00000526792;ENST00000374162;ENST00000530003;ENST00000374164;ENST00000531382;ENST00000403732	T;T;T;T;T;T;T	0.65916	-0.18;-0.18;-0.18;-0.18;-0.18;-0.18;-0.18	5.29	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.124181	0.56097	D	0.000028	T	0.50034	0.1592	N	0.05619	-0.005	0.80722	D	1	B;B;B	0.30326	0.028;0.185;0.276	B;B;B	0.36244	0.055;0.136;0.22	T	0.57124	-0.7865	10	0.87932	D	0	.	18.9343	0.92579	0.0:1.0:0.0:0.0	.	441;466;457	B7Z2K7;Q15418-2;Q15418	.;.;KS6A1_HUMAN	L	457;446;365;365;441;135;466;73	ENSP00000363283:S457L;ENSP00000363281:S446L;ENSP00000431651:S365L;ENSP00000363277:S365L;ENSP00000432281:S441L;ENSP00000435412:S466L;ENSP00000383967:S73L	ENSP00000363277:S365L	S	+	2	0	RPS6KA1	26760151	1.000000	0.71417	0.961000	0.40146	0.964000	0.63967	7.709000	0.84645	2.480000	0.83734	0.561000	0.74099	TCA	RPS6KA1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000117676		0.547	RPS6KA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA1	HGNC	protein_coding	OTTHUMT00000011431.1	30	0.00	0	C	NM_002953		26887564	26887564	+1	no_errors	ENST00000531382	ensembl	human	known	69_37n	missense	17	48.48	16	SNP	0.999	T
RRNAD1	51093	genome.wustl.edu	37	1	156704177	156704177	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:156704177C>G	ENST00000368216.4	+	6	1643	c.1013C>G	c.(1012-1014)aCt>aGt	p.T338S	RRNAD1_ENST00000476229.1_Intron|MRPL24_ENST00000478899.1_5'Flank|RRNAD1_ENST00000368218.4_Intron	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	338						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						GGCCTTCGAACTCACTGCTAC	0.657																																						dbGAP											0													32.0	28.0	29.0					1																	156704177		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.1013C>G	1.37:g.156704177C>G	ENSP00000357199:p.Thr338Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	NULL	p.T338S	ENST00000368216.4	37	c.1013	CCDS1154.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	4.000824	0.74818	.	.	ENSG00000143303	ENST00000368216;ENST00000519086	T	0.41400	1.0	5.15	4.22	0.49857	.	0.097800	0.64402	D	0.000002	T	0.22282	0.0537	M	0.66939	2.045	0.80722	D	1	B	0.24721	0.11	B	0.17433	0.018	T	0.04991	-1.0913	10	0.21014	T	0.42	-24.8409	9.518	0.39117	0.0:0.8488:0.0:0.1512	.	338	Q96FB5	RRNAD_HUMAN	S	338;317	ENSP00000357199:T338S	ENSP00000357199:T338S	T	+	2	0	RRNAD1	154970801	0.834000	0.29399	1.000000	0.80357	0.995000	0.86356	3.508000	0.53378	2.577000	0.86979	0.561000	0.74099	ACT	RRNAD1	-	NULL	ENSG00000143303		0.657	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRNAD1	HGNC	protein_coding	OTTHUMT00000098973.1	51	0.00	0	C	NM_015997		156704177	156704177	+1	no_errors	ENST00000368216	ensembl	human	known	69_37n	missense	118	16.08	23	SNP	0.992	G
RYR2	6262	genome.wustl.edu	37	1	237804204	237804204	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:237804204G>C	ENST00000366574.2	+	47	7440	c.7123G>C	c.(7123-7125)Gag>Cag	p.E2375Q	RYR2_ENST00000542537.1_Missense_Mutation_p.E2359Q|RYR2_ENST00000360064.6_Missense_Mutation_p.E2373Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2375	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AAGTGACACAGAGGAGGAGGA	0.433																																						dbGAP											0													139.0	131.0	133.0					1																	237804204		2032	4206	6238	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7123G>C	1.37:g.237804204G>C	ENSP00000355533:p.Glu2375Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E2373Q	ENST00000366574.2	37	c.7117	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419895	0.42918	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98493	-4.96;-4.96;-4.96	5.7	5.7	0.88788	.	0.078135	0.48286	D	0.000188	D	0.96324	0.8801	L	0.38953	1.18	0.80722	D	1	B	0.24533	0.105	B	0.20577	0.03	D	0.93397	0.6757	10	0.45353	T	0.12	-20.7184	19.8338	0.96646	0.0:0.0:1.0:0.0	.	2375	Q92736	RYR2_HUMAN	Q	2375;2373;2359	ENSP00000355533:E2375Q;ENSP00000353174:E2373Q;ENSP00000443798:E2359Q	ENSP00000353174:E2373Q	E	+	1	0	RYR2	235870827	1.000000	0.71417	0.709000	0.30452	0.284000	0.27059	7.841000	0.86834	2.692000	0.91855	0.591000	0.81541	GAG	RYR2	-	NULL	ENSG00000198626		0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	93	0.00	0	G	NM_001035		237804204	237804204	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	97	29.20	40	SNP	0.850	C
SAGE1	55511	genome.wustl.edu	37	X	134993474	134993474	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chrX:134993474G>C	ENST00000370709.3	+	16	2129	c.2129G>C	c.(2128-2130)aGa>aCa	p.R710T	SAGE1_ENST00000535938.1_Missense_Mutation_p.R710T|SAGE1_ENST00000324447.3_Missense_Mutation_p.R710T|SAGE1_ENST00000537770.1_Missense_Mutation_p.R334T			Q9NXZ1	SAGE1_HUMAN	sarcoma antigen 1	710						nucleus (GO:0005634)				breast(5)|endometrium(5)|large_intestine(10)|lung(23)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	55	Acute lymphoblastic leukemia(192;0.000127)					ATTTCATGCAGAAGTACCAGG	0.448																																						dbGAP											0													184.0	135.0	151.0					X																	134993474		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278111	CCDS14652.1	Xq26	2009-03-25			ENSG00000181433	ENSG00000181433			30369	protein-coding gene	gene with protein product	"""cancer/testis antigen 14"""	300359				10919659	Standard	NM_018666		Approved	SAGE, CT14	uc004ezh.3	Q9NXZ1	OTTHUMG00000022496	ENST00000370709.3:c.2129G>C	X.37:g.134993474G>C	ENSP00000359743:p.Arg710Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JNW0	Missense_Mutation	SNP	NULL	p.R710T	ENST00000370709.3	37	c.2129	CCDS14652.1	X	.	.	.	.	.	.	.	.	.	.	G	4.873	0.162255	0.09287	.	.	ENSG00000181433	ENST00000324447;ENST00000535938;ENST00000537770;ENST00000370709	T;T;T;T	0.34275	1.37;1.37;1.52;1.37	1.03	0.0473	0.14280	.	1.122720	0.07046	U	0.831071	T	0.19327	0.0464	N	0.17082	0.46	0.09310	N	1	B;B	0.24483	0.022;0.104	B;B	0.27887	0.017;0.084	T	0.30736	-0.9968	10	0.15499	T	0.54	.	3.1958	0.06633	0.3408:0.0:0.6592:0.0	.	334;710	F5H2Z8;Q9NXZ1	.;SAGE1_HUMAN	T	710;710;334;710	ENSP00000323191:R710T;ENSP00000445959:R710T;ENSP00000438276:R334T;ENSP00000359743:R710T	ENSP00000323191:R710T	R	+	2	0	SAGE1	134821140	0.001000	0.12720	0.002000	0.10522	0.017000	0.09413	-0.620000	0.05565	-0.063000	0.13065	0.179000	0.17066	AGA	SAGE1	-	NULL	ENSG00000181433		0.448	SAGE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAGE1	HGNC	protein_coding	OTTHUMT00000058448.1	54	0.00	0	G	NM_018666		134993474	134993474	+1	no_errors	ENST00000324447	ensembl	human	known	69_37n	missense	68	32.00	32	SNP	0.002	C
SI	6476	genome.wustl.edu	37	3	164716431	164716431	+	Silent	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr3:164716431C>T	ENST00000264382.3	-	38	4499	c.4437G>A	c.(4435-4437)ggG>ggA	p.G1479G		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1479	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	AAATTACAATCCCTCTTTTTC	0.388										HNSCC(35;0.089)																												dbGAP											0													188.0	168.0	175.0					3																	164716431		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.4437G>A	3.37:g.164716431C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.G1479	ENST00000264382.3	37	c.4437	CCDS3196.1	3																																																																																			SI	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000090402		0.388	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	67	0.00	0	C	NM_001041		164716431	164716431	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	silent	74	16.85	15	SNP	0.997	T
SIGLEC1	6614	genome.wustl.edu	37	20	3673310	3673310	+	Silent	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr20:3673310G>A	ENST00000344754.4	-	15	3887	c.3888C>T	c.(3886-3888)caC>caT	p.H1296H	SIGLEC1_ENST00000202578.4_Silent_p.H1296H	NM_023068.3	NP_075556.1	Q9BZZ2	SN_HUMAN	sialic acid binding Ig-like lectin 1, sialoadhesin	1296	Ig-like C2-type 13.				cell-matrix adhesion (GO:0007160)|endocytosis (GO:0006897)|inflammatory response (GO:0006954)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of T cell apoptotic process (GO:0070234)|single organismal cell-cell adhesion (GO:0016337)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|liver(2)|lung(24)|ovary(3)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)	70						AACGACCGTTGTGGTACCAAG	0.647																																						dbGAP											0													50.0	50.0	50.0					20																	3673310		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF230073	CCDS13060.1	20p13	2013-01-29	2006-01-19	2006-01-19	ENSG00000088827	ENSG00000088827		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	11127	protein-coding gene	gene with protein product		600751	"""sialoadhesin"""	SN		8530048	Standard	XM_006723610		Approved	SIGLEC-1, CD169, FLJ00051, FLJ00055, FLJ00073, FLJ32150, dJ1009E24.1, sialoadhesin	uc002wja.3	Q9BZZ2	OTTHUMG00000031757	ENST00000344754.4:c.3888C>T	20.37:g.3673310G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96DL4|Q9GZS5|Q9H1H6|Q9H1H7|Q9H7L7	Nonsense_Mutation	SNP	smart_Ig_sub2,smart_Ig_sub,pfscan_Ig-like	p.Q110*	ENST00000344754.4	37	c.328	CCDS13060.1	20	.	.	.	.	.	.	.	.	.	.	G	3.840	-0.034005	0.07543	.	.	ENSG00000088827	ENST00000419548	.	.	.	5.71	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.18	0.31305	0.084:0.1583:0.7578:0.0	.	.	.	.	X	110	.	.	Q	-	1	0	SIGLEC1	3621310	1.000000	0.71417	1.000000	0.80357	0.449000	0.32228	2.185000	0.42584	1.413000	0.46997	0.655000	0.94253	CAA	SIGLEC1	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000088827		0.647	SIGLEC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC1	HGNC	protein_coding	OTTHUMT00000077761.2	62	0.00	0	G	NM_023068		3673310	3673310	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000419548	ensembl	human	known	69_37n	nonsense	54	38.64	34	SNP	1.000	A
SIM1	6492	genome.wustl.edu	37	6	100841736	100841736	+	Silent	SNP	T	T	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr6:100841736T>C	ENST00000369208.3	-	11	1979	c.1197A>G	c.(1195-1197)gaA>gaG	p.E399E	SIM1_ENST00000262901.4_Silent_p.E399E			P81133	SIM1_HUMAN	single-minded family bHLH transcription factor 1	399	Single-minded C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00632}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)|ureteric bud development (GO:0001657)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(4)|endometrium(5)|kidney(1)|large_intestine(15)|lung(34)|ovary(4)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(5)	79		all_cancers(76;9.88e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0248)|Colorectal(196;0.13)		BRCA - Breast invasive adenocarcinoma(108;0.0774)		CATGATCAGATTCCGATCTTT	0.507																																						dbGAP											0													34.0	35.0	34.0					6																	100841736		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			U70212	CCDS5045.1	6q16.3	2013-10-17	2013-10-17		ENSG00000112246	ENSG00000112246		"""Basic helix-loop-helix proteins"""	10882	protein-coding gene	gene with protein product		603128	"""single-minded (Drosophila) homolog 1"", ""single-minded homolog 1 (Drosophila)"""			9199934, 11448938	Standard	NM_005068		Approved	bHLHe14	uc003pqj.4	P81133	OTTHUMG00000015275	ENST00000369208.3:c.1197A>G	6.37:g.100841736T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDP7	Silent	SNP	pfam_SIM_C,pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd	p.E399	ENST00000369208.3	37	c.1197	CCDS5045.1	6																																																																																			SIM1	-	pfam_SIM_C	ENSG00000112246		0.507	SIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIM1	HGNC	protein_coding	OTTHUMT00000041628.3	13	0.00	0	T	NM_005068		100841736	100841736	-1	no_errors	ENST00000262901	ensembl	human	known	69_37n	silent	29	27.50	11	SNP	0.997	C
SLC16A2	6567	genome.wustl.edu	37	X	73744433	73744433	+	Frame_Shift_Del	DEL	T	T	-			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chrX:73744433delT	ENST00000587091.1	+	3	992	c.815delT	c.(814-816)gttfs	p.V272fs	SLC16A2_ENST00000276033.5_Frame_Shift_Del_p.V346fs	NM_006517.4	NP_006508.2	P36021	MOT8_HUMAN	solute carrier family 16, member 2 (thyroid hormone transporter)	272					monocarboxylic acid transport (GO:0015718)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|symporter activity (GO:0015293)|transporter activity (GO:0005215)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(2)	21					L-Leucine(DB00149)|L-Tryptophan(DB00150)|L-Tyrosine(DB00135)|Levothyroxine(DB00451)|Liotrix(DB01583)|Pyruvic acid(DB00119)	TTCATGTTTGTTCTTATGCTG	0.552																																						dbGAP											0													136.0	103.0	114.0					X																	73744433		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS14426.1, CCDS14426.2	Xq13.2	2013-05-22	2012-03-20		ENSG00000147100	ENSG00000147100		"""Solute carriers"""	10923	protein-coding gene	gene with protein product		300095	"""solute carrier family 16 (monocarboxylic acid transporters), member 2 (putative transporter)"", ""Allan-Herndon-Dudley syndrome"", ""solute carrier family 16 (monocarboxylic acid transporters), member 2"", ""mental retardation, X-linked 22"", ""solute carrier family 16, member 2 (monocarboxylic acid transporter 8)"""	DXS128, AHDS, MRX22		7981683, 12871948, 15889350	Standard	NM_006517		Approved	XPCT, MCT8, MCT7	uc031tjy.1	P36021	OTTHUMG00000021857	ENST00000587091.1:c.815delT	X.37:g.73744433delT	ENSP00000465734:p.Val272fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z797	Frame_Shift_Del	DEL	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.M348fs	ENST00000587091.1	37	c.1037	CCDS14426.2	X																																																																																			SLC16A2	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000147100		0.552	SLC16A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A2	HGNC	protein_coding	OTTHUMT00000057266.3	98	0.00	0	T			73744433	73744433	+1	no_errors	ENST00000276033	ensembl	human	known	69_37n	frame_shift_del	92	30.30	40	DEL	0.999	-
SLC2A13	114134	genome.wustl.edu	37	12	40158269	40158269	+	Silent	SNP	T	T	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr12:40158269T>C	ENST00000280871.4	-	9	1763	c.1713A>G	c.(1711-1713)acA>acG	p.T571T		NM_052885.3	NP_443117.3	Q96QE2	MYCT_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 13	571					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	29		Lung NSC(34;0.105)|all_lung(34;0.123)				TACCATAGTATGTAAGATACT	0.294										HNSCC(50;0.14)																												dbGAP											0													63.0	64.0	63.0					12																	40158269		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ315644	CCDS8736.2	12q12	2013-05-22			ENSG00000151229	ENSG00000151229		"""Solute carriers"""	15956	protein-coding gene	gene with protein product	"""H(+)-myo-inositol symporter"""	611036				11500374	Standard	NM_052885		Approved	HMIT	uc010skm.2	Q96QE2	OTTHUMG00000059743	ENST00000280871.4:c.1713A>G	12.37:g.40158269T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S07	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,superfamily_Plexin-like_fold,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.T571	ENST00000280871.4	37	c.1713	CCDS8736.2	12																																																																																			SLC2A13	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000151229		0.294	SLC2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A13	HGNC	protein_coding	OTTHUMT00000132849.2	37	0.00	0	T			40158269	40158269	-1	no_errors	ENST00000280871	ensembl	human	known	69_37n	silent	56	22.22	16	SNP	0.997	C
SLC5A3	6526	genome.wustl.edu	37	21	35469199	35469199	+	Missense_Mutation	SNP	C	C	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr21:35469199C>A	ENST00000381151.3	+	2	2214	c.1702C>A	c.(1702-1704)Caa>Aaa	p.Q568K	MRPS6_ENST00000399312.2_Intron|AP000320.7_ENST00000362077.4_RNA|SLC5A3_ENST00000608209.1_Missense_Mutation_p.Q568K			P53794	SC5A3_HUMAN	solute carrier family 5 (sodium/myo-inositol cotransporter), member 3	568					inositol metabolic process (GO:0006020)|peripheral nervous system development (GO:0007422)|regulation of respiratory gaseous exchange (GO:0043576)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	myo-inositol:sodium symporter activity (GO:0005367)			breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	20						ATACCAAATGCAAGAAAAGAG	0.463																																						dbGAP											0													112.0	100.0	104.0					21																	35469199		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33549.1	21q22.11	2013-05-22	2008-09-02		ENSG00000198743	ENSG00000198743		"""Solute carriers"""	11038	protein-coding gene	gene with protein product		600444	"""solute carrier family 5 (inositol transporter), member 3"""			7789985	Standard	NM_006933		Approved	SMIT, SMIT1	uc002yto.3	P53794	OTTHUMG00000065821	ENST00000381151.3:c.1702C>A	21.37:g.35469199C>A	ENSP00000370543:p.Gln568Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43489	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.Q568K	ENST00000381151.3	37	c.1702	CCDS33549.1	21	.	.	.	.	.	.	.	.	.	.	C	5.372	0.253941	0.10185	.	.	ENSG00000198743	ENST00000381151	T	0.61510	0.1	6.08	6.08	0.98989	.	0.545324	0.14669	N	0.305445	T	0.39708	0.1088	N	0.08118	0	0.28311	N	0.922669	B	0.02656	0.0	B	0.04013	0.001	T	0.06180	-1.0841	10	0.07644	T	0.81	.	20.2585	0.98435	0.0:1.0:0.0:0.0	.	568	P53794	SC5A3_HUMAN	K	568	ENSP00000370543:Q568K	ENSP00000370543:Q568K	Q	+	1	0	SLC5A3	34391069	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.201000	0.65163	2.894000	0.99253	0.655000	0.94253	CAA	SLC5A3	-	NULL	ENSG00000198743		0.463	SLC5A3-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	SLC5A3	HGNC	protein_coding	OTTHUMT00000141037.1	32	0.00	0	C			35469199	35469199	+1	no_errors	ENST00000381151	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	A
SLC6A8	6535	genome.wustl.edu	37	X	152956984	152956984	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chrX:152956984G>A	ENST00000253122.5	+	3	1096	c.620G>A	c.(619-621)cGg>cAg	p.R207Q	SLC6A8_ENST00000430077.2_Missense_Mutation_p.R92Q	NM_001142805.1|NM_005629.3	NP_001136277.1|NP_005620.1	P48029	SC6A8_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 8	207					cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|creatine transmembrane transport (GO:1902598)|creatine transport (GO:0015881)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	creatine transmembrane transporter activity (GO:0005308)|creatine:sodium symporter activity (GO:0005309)|neurotransmitter:sodium symporter activity (GO:0005328)			breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)|pancreas(1)|upper_aerodigestive_tract(1)	13	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Creatine(DB00148)	GCTGACCGCCGGTCCCCTGTC	0.637																																						dbGAP											0													108.0	107.0	108.0					X																	152956984		2202	4298	6500	-	-	-	SO:0001583	missense	0				CCDS14726.1, CCDS48190.1	Xq28	2013-07-19	2013-07-19		ENSG00000130821	ENSG00000130821		"""Solute carriers"""	11055	protein-coding gene	gene with protein product	"""creatine transporter"""	300036	"""solute carrier family 6 (neurotransmitter transporter, creatine), member 8"""			7774949	Standard	NM_001142805		Approved	CRTR, CT1	uc004fib.3	P48029	OTTHUMG00000024208	ENST00000253122.5:c.620G>A	X.37:g.152956984G>A	ENSP00000253122:p.Arg207Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2KY47|B4DIA3|E9PFC0|Q13032|Q66I36	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_creatine	p.R207Q	ENST00000253122.5	37	c.620	CCDS14726.1	X	.	.	.	.	.	.	.	.	.	.	g	15.26	2.780408	0.49891	.	.	ENSG00000130821	ENST00000253122;ENST00000430077	T;T	0.74209	-0.82;-0.82	3.83	3.83	0.44106	.	.	.	.	.	T	0.52435	0.1734	N	0.20357	0.565	0.38713	D	0.953277	B;P;B	0.40032	0.265;0.699;0.147	B;B;B	0.26094	0.041;0.066;0.066	T	0.61023	-0.7146	9	0.54805	T	0.06	.	9.4389	0.38657	0.0:0.0:0.7876:0.2123	.	207;226;207	D3DWV2;Q59EV7;P48029	.;.;SC6A8_HUMAN	Q	207;92	ENSP00000253122:R207Q;ENSP00000403041:R92Q	ENSP00000253122:R207Q	R	+	2	0	SLC6A8	152610178	1.000000	0.71417	1.000000	0.80357	0.970000	0.65996	4.648000	0.61425	1.751000	0.51876	0.436000	0.28706	CGG	SLC6A8	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport_creatine	ENSG00000130821		0.637	SLC6A8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A8	HGNC	protein_coding	OTTHUMT00000061003.1	69	0.00	0	G			152956984	152956984	+1	no_errors	ENST00000253122	ensembl	human	known	69_37n	missense	105	23.36	32	SNP	0.998	A
SP1	6667	genome.wustl.edu	37	12	53776138	53776138	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr12:53776138C>G	ENST00000327443.4	+	3	505	c.407C>G	c.(406-408)tCt>tGt	p.S136C	SP1_ENST00000426431.2_Missense_Mutation_p.S129C	NM_001251825.1|NM_138473.2	NP_001238754.1|NP_612482.2	P08047	SP1_HUMAN	Sp1 transcription factor	136	Ser/Thr-rich.				cellular lipid metabolic process (GO:0044255)|definitive hemopoiesis (GO:0060216)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic placenta development (GO:0001892)|embryonic process involved in female pregnancy (GO:0060136)|embryonic skeletal system development (GO:0048706)|enucleate erythrocyte differentiation (GO:0043353)|gene expression (GO:0010467)|liver development (GO:0001889)|lung development (GO:0030324)|megakaryocyte differentiation (GO:0030219)|ossification (GO:0001503)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)	bHLH transcription factor binding (GO:0043425)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|histone deacetylase binding (GO:0042826)|HMG box domain binding (GO:0071837)|metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II repressing transcription factor binding (GO:0001103)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5				BRCA - Breast invasive adenocarcinoma(357;0.00527)		GGCAGTGAGTCTTCCAAGAAT	0.547																																						dbGAP											0													66.0	66.0	66.0					12																	53776138		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03133	CCDS8857.1, CCDS44898.1	12q13.1	2013-01-08						"""Specificity protein transcription factors"", ""Zinc fingers, C2H2-type"""	11205	protein-coding gene	gene with protein product	"""specificity protein 1"""	189906				1662663	Standard	NM_003109		Approved		uc001scw.3	P08047	OTTHUMG00000170047	ENST00000327443.4:c.407C>G	12.37:g.53776138C>G	ENSP00000329357:p.Ser136Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E4Z9M7|G5E9M8|Q86TN8|Q9H3Q5|Q9NR51|Q9NY21|Q9NYE7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S136C	ENST00000327443.4	37	c.407	CCDS8857.1	12	.	.	.	.	.	.	.	.	.	.	C	12.18	1.860783	0.32884	.	.	ENSG00000185591	ENST00000327443;ENST00000426431	T;T	0.09350	3.02;2.99	4.13	4.13	0.48395	.	0.109070	0.38720	N	0.001591	T	0.16385	0.0394	L	0.39898	1.24	0.51233	D	0.999919	D	0.56521	0.976	P	0.50708	0.648	T	0.01363	-1.1374	10	0.56958	D	0.05	.	15.6957	0.77494	0.0:1.0:0.0:0.0	.	136	P08047	SP1_HUMAN	C	136;129	ENSP00000329357:S136C;ENSP00000404263:S129C	ENSP00000329357:S136C	S	+	2	0	SP1	52062405	0.000000	0.05858	1.000000	0.80357	0.892000	0.51952	-0.068000	0.11561	2.306000	0.77630	0.467000	0.42956	TCT	SP1	-	NULL	ENSG00000185591		0.547	SP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SP1	HGNC	protein_coding	OTTHUMT00000407044.1	27	0.00	0	C			53776138	53776138	+1	no_errors	ENST00000327443	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	1.000	G
STARD6	147323	genome.wustl.edu	37	18	51858148	51858148	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr18:51858148T>C	ENST00000581310.1	-	7	722	c.349A>G	c.(349-351)Atc>Gtc	p.I117V	STARD6_ENST00000307844.3_Missense_Mutation_p.I117V|STARD6_ENST00000580990.2_Missense_Mutation_p.H24R			P59095	STAR6_HUMAN	StAR-related lipid transfer (START) domain containing 6	117	START. {ECO:0000255|PROSITE- ProRule:PRU00197}.				lipid transport (GO:0006869)		lipid binding (GO:0008289)			endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)	8				Colorectal(16;0.021)|READ - Rectum adenocarcinoma(59;0.188)		TAGCGCTTGATGTACACTAAG	0.388																																						dbGAP											0													119.0	109.0	112.0					18																	51858148		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF480305	CCDS11955.1	18q21.2	2011-09-12	2007-08-16		ENSG00000174448	ENSG00000174448		"""StAR-related lipid transfer (START) domain containing"""	18066	protein-coding gene	gene with protein product		607051	"""START domain containing 6"""			12011452	Standard	NM_139171		Approved		uc010xdt.2	P59095	OTTHUMG00000132702	ENST00000581310.1:c.349A>G	18.37:g.51858148T>C	ENSP00000462349:p.Ile117Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	p.I117V	ENST00000581310.1	37	c.349	CCDS11955.1	18	.	.	.	.	.	.	.	.	.	.	T	5.170	0.216937	0.09810	.	.	ENSG00000174448	ENST00000307844	T	0.79940	-1.32	5.89	-5.85	0.02311	Lipid-binding START (3);START-like domain (1);	0.379656	0.24296	N	0.039770	T	0.49983	0.1589	N	0.12182	0.205	0.19775	N	0.999957	B	0.10296	0.003	B	0.12156	0.007	T	0.47724	-0.9095	10	0.15952	T	0.53	.	1.3121	0.02100	0.3495:0.1393:0.1007:0.4105	.	117	P59095	STAR6_HUMAN	V	117	ENSP00000310814:I117V	ENSP00000310814:I117V	I	-	1	0	STARD6	50112146	0.660000	0.27420	0.005000	0.12908	0.205000	0.24178	0.100000	0.15231	-1.348000	0.02205	0.496000	0.49642	ATC	STARD6	-	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	ENSG00000174448		0.388	STARD6-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	STARD6	HGNC	protein_coding	OTTHUMT00000256000.3	54	0.00	0	T	NM_139171		51858148	51858148	-1	no_errors	ENST00000307844	ensembl	human	known	69_37n	missense	65	28.57	26	SNP	0.023	C
SWT1	54823	genome.wustl.edu	37	1	185173860	185173860	+	Silent	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:185173860G>A	ENST00000367500.4	+	12	1863	c.1698G>A	c.(1696-1698)aaG>aaA	p.K566K	SWT1_ENST00000367501.3_Silent_p.K566K	NM_017673.6	NP_060143.4	Q5T5J6	SWT1_HUMAN	SWT1 RNA endoribonuclease homolog (S. cerevisiae)	566										breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(11)|liver(1)|lung(16)|ovary(1)|prostate(1)|urinary_tract(1)	41						AGAGCTATAAGGAGGAATCTA	0.303																																						dbGAP											0													73.0	75.0	74.0					1																	185173860		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF288392	CCDS1367.1	1q25	2013-08-29	2011-01-24	2011-01-24	ENSG00000116668	ENSG00000116668			16785	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 26"""	C1orf26		11318611, 19127978, 23768067	Standard	NM_017673		Approved	FLJ20121, HsSwt1	uc001grg.4	Q5T5J6	OTTHUMG00000035390	ENST00000367500.4:c.1698G>A	1.37:g.185173860G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEK9|Q9BZQ7|Q9NXQ0	Silent	SNP	smart_PINc_nuc-bd	p.K566	ENST00000367500.4	37	c.1698	CCDS1367.1	1																																																																																			SWT1	-	NULL	ENSG00000116668		0.303	SWT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SWT1	HGNC	protein_coding	OTTHUMT00000085790.1	32	0.00	0	G	NM_017673		185173860	185173860	+1	no_errors	ENST00000367500	ensembl	human	known	69_37n	silent	59	16.90	12	SNP	0.000	A
TANC1	85461	genome.wustl.edu	37	2	160006963	160006963	+	Nonsense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr2:160006963C>G	ENST00000263635.6	+	7	815	c.578C>G	c.(577-579)tCa>tGa	p.S193*	TANC1_ENST00000454300.1_Intron	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	193	Ser-rich.				dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)		p.S193*(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						AGCCCCTGCTCAACCTTGAAT	0.522																																						dbGAP											1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											77.0	79.0	78.0					2																	160006963		2096	4234	6330	-	-	-	SO:0001587	stop_gained	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.578C>G	2.37:g.160006963C>G	ENSP00000263635:p.Ser193*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD88|Q49AI8	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.S193*	ENST00000263635.6	37	c.578	CCDS42766.1	2	.	.	.	.	.	.	.	.	.	.	C	38	7.144927	0.98092	.	.	ENSG00000115183	ENST00000263635	.	.	.	5.46	5.46	0.80206	.	0.183599	0.37530	N	0.002042	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.7077	0.96081	0.0:1.0:0.0:0.0	.	.	.	.	X	193	.	ENSP00000263635:S193X	S	+	2	0	TANC1	159715209	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.768000	0.85345	2.733000	0.93635	0.655000	0.94253	TCA	TANC1	-	NULL	ENSG00000115183		0.522	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1	62	0.00	0	C			160006963	160006963	+1	no_errors	ENST00000263635	ensembl	human	known	69_37n	nonsense	22	45.00	18	SNP	1.000	G
TATDN2	9797	genome.wustl.edu	37	3	10291219	10291219	+	Nonsense_Mutation	SNP	C	C	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr3:10291219C>A	ENST00000287652.4	+	2	1386	c.335C>A	c.(334-336)tCa>tAa	p.S112*	RP11-438J1.1_ENST00000450534.1_Nonsense_Mutation_p.S55*|TATDN2_ENST00000448281.2_Nonsense_Mutation_p.S112*	NM_014760.3	NP_055575.3	Q93075	TATD2_HUMAN	TatD DNase domain containing 2	112					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|DNA catabolic process (GO:0006308)|endoplasmic reticulum unfolded protein response (GO:0030968)	intracellular organelle (GO:0043229)|nucleoplasm (GO:0005654)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(9)|pancreas(2)|prostate(1)|stomach(2)	28						TTCCTGTCTTCAGGGGGATCC	0.602																																						dbGAP											0													50.0	56.0	54.0					3																	10291219		2191	4280	6471	-	-	-	SO:0001587	stop_gained	0			D86972	CCDS33698.1	3p25.3	2010-11-24			ENSG00000157014	ENSG00000157014			28988	protein-coding gene	gene with protein product						9039502	Standard	NM_014760		Approved	KIAA0218	uc003bvf.3	Q93075	OTTHUMG00000155361	ENST00000287652.4:c.335C>A	3.37:g.10291219C>A	ENSP00000287652:p.Ser112*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIL9|Q5BKU0	Nonsense_Mutation	SNP	pfam_TatD_superfamily	p.S112*	ENST00000287652.4	37	c.335	CCDS33698.1	3	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561030	0.86335	.	.	ENSG00000157014	ENST00000287652;ENST00000448281	.	.	.	3.81	3.81	0.43845	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.6962	11.4097	0.49919	0.0:1.0:0.0:0.0	.	.	.	.	X	112	.	ENSP00000287652:S112X	S	+	2	0	TATDN2	10266219	0.004000	0.15560	0.027000	0.17364	0.703000	0.40648	1.481000	0.35476	2.138000	0.66242	0.563000	0.77884	TCA	TATDN2	-	NULL	ENSG00000157014		0.602	TATDN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TATDN2	HGNC	protein_coding	OTTHUMT00000339641.1	12	0.00	0	C	XM_376203		10291219	10291219	+1	no_errors	ENST00000287652	ensembl	human	known	69_37n	nonsense	24	27.27	9	SNP	0.031	A
TECTA	7007	genome.wustl.edu	37	11	121000467	121000467	+	Missense_Mutation	SNP	A	A	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr11:121000467A>T	ENST00000392793.1	+	10	2759	c.2488A>T	c.(2488-2490)Ata>Tta	p.I830L	TECTA_ENST00000264037.2_Missense_Mutation_p.I830L			O75443	TECTA_HUMAN	tectorin alpha	830	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)			TECTA/TBCEL(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|liver(1)|lung(46)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	135	all_hematologic(175;0.208)	Breast(109;0.000766)|Medulloblastoma(222;0.0427)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;8.04e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.166)		GTACTCAGACATAGGTCTATT	0.498																																						dbGAP											0													170.0	162.0	165.0					11																	121000467		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF055136	CCDS8434.1	11q22-q24	2008-02-05			ENSG00000109927	ENSG00000109927			11720	protein-coding gene	gene with protein product		602574		DFNA12, DFNA8, DFNB21		9503015, 9590290	Standard	NM_005422		Approved		uc010rzo.2	O75443	OTTHUMG00000149908	ENST00000392793.1:c.2488A>T	11.37:g.121000467A>T	ENSP00000376543:p.Ile830Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_Zona_pellucida_Endoglin/CD105,pfam_Nidogen_extracell_dom,pfam_TIL_dom,superfamily_TIL_dom,smart_Nidogen_extracell_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	p.I830L	ENST00000392793.1	37	c.2488	CCDS8434.1	11	.	.	.	.	.	.	.	.	.	.	A	2.101	-0.406145	0.04832	.	.	ENSG00000109927	ENST00000392793;ENST00000264037	T;T	0.59224	0.28;0.28	5.56	-11.1	0.00147	von Willebrand factor, type D domain (3);	2.303480	0.01173	N	0.006912	T	0.22551	0.0544	N	0.03608	-0.345	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.14868	-1.0457	10	0.10377	T	0.69	.	3.0416	0.06140	0.4914:0.0692:0.1533:0.286	.	830	O75443	TECTA_HUMAN	L	830	ENSP00000376543:I830L;ENSP00000264037:I830L	ENSP00000264037:I830L	I	+	1	0	TECTA	120505677	0.000000	0.05858	0.000000	0.03702	0.444000	0.32077	-1.239000	0.02916	-2.014000	0.00948	-1.032000	0.02404	ATA	TECTA	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000109927		0.498	TECTA-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TECTA	HGNC	protein_coding	OTTHUMT00000313850.1	61	0.00	0	A	NM_005422		121000467	121000467	+1	no_errors	ENST00000264037	ensembl	human	known	69_37n	missense	32	52.94	36	SNP	0.000	T
THAP1	55145	genome.wustl.edu	37	8	42693372	42693372	+	Silent	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr8:42693372G>A	ENST00000254250.3	-	3	605	c.375C>T	c.(373-375)acC>acT	p.T125T	THAP1_ENST00000532093.1_5'Flank|THAP1_ENST00000345117.2_3'UTR	NM_018105.2	NP_060575.1	Q9NVV9	THAP1_HUMAN	THAP domain containing, apoptosis associated protein 1	125					cell cycle (GO:0007049)|endothelial cell proliferation (GO:0001935)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|lung(4)|prostate(1)|skin(1)	7	all_lung(13;3.33e-12)|Lung NSC(13;9.17e-11)|Ovarian(28;0.01)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Acute lymphoblastic leukemia(644;0.000299)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.129)	Lung(22;0.0377)|LUSC - Lung squamous cell carcinoma(45;0.0869)			GATTAACAGGGGTCTGAAGAG	0.478																																						dbGAP											0													115.0	123.0	120.0					8																	42693372		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC021721	CCDS6136.1, CCDS6137.1	8p11.1	2013-01-25			ENSG00000131931	ENSG00000131931		"""THAP (C2CH-type zinc finger) domain containing"""	20856	protein-coding gene	gene with protein product		609520	"""dystonia 6, torsion (autosomal dominant)"""	DYT6		12575992, 12717420, 19182804	Standard	NM_018105		Approved	FLJ10477, 4833431A01Rik	uc003xpk.3	Q9NVV9	OTTHUMG00000165276	ENST00000254250.3:c.375C>T	8.37:g.42693372G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCB6|D3DSY5|H9KV49|Q53FQ1|Q6IA99	Silent	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.T125	ENST00000254250.3	37	c.375	CCDS6136.1	8																																																																																			THAP1	-	NULL	ENSG00000131931		0.478	THAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP1	HGNC	protein_coding	OTTHUMT00000383161.1	25	0.00	0	G	NM_018105		42693372	42693372	-1	no_errors	ENST00000254250	ensembl	human	known	69_37n	silent	20	44.44	16	SNP	1.000	A
TIAM1	7074	genome.wustl.edu	37	21	32638444	32638444	+	Missense_Mutation	SNP	G	G	C	rs375767791		TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr21:32638444G>C	ENST00000286827.3	-	5	1316	c.845C>G	c.(844-846)cCg>cGg	p.P282R	TIAM1_ENST00000469412.1_Intron|TIAM1_ENST00000541036.1_Missense_Mutation_p.P282R	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	282					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						ATTACTGTACGGAGGAGTCTC	0.478																																						dbGAP											0													119.0	110.0	113.0					21																	32638444		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.845C>G	21.37:g.32638444G>C	ENSP00000286827:p.Pro282Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.P282R	ENST00000286827.3	37	c.845	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	G	9.317	1.057017	0.19907	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.38887	1.11;1.11	5.41	4.53	0.55603	.	0.344100	0.34314	N	0.004080	T	0.35537	0.0935	L	0.43152	1.355	0.09310	N	1	B;B;B	0.22146	0.065;0.039;0.039	B;B;B	0.24269	0.052;0.024;0.024	T	0.17107	-1.0380	10	0.21540	T	0.41	.	14.0595	0.64790	0.0718:0.0:0.9282:0.0	.	282;282;282	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	R	282;123;282	ENSP00000286827:P282R;ENSP00000441570:P282R	ENSP00000286827:P282R	P	-	2	0	TIAM1	31560315	0.998000	0.40836	0.259000	0.24435	0.986000	0.74619	5.044000	0.64214	1.516000	0.48900	0.591000	0.81541	CCG	TIAM1	-	NULL	ENSG00000156299		0.478	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	78	0.00	0	G	NM_003253		32638444	32638444	-1	no_errors	ENST00000286827	ensembl	human	known	69_37n	missense	94	17.54	20	SNP	0.092	C
TNIP3	79931	genome.wustl.edu	37	4	122059806	122059806	+	Missense_Mutation	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr4:122059806G>A	ENST00000057513.3	-	10	1133	c.919C>T	c.(919-921)Ccg>Tcg	p.P307S	TNIP3_ENST00000511909.1_5'UTR|TNIP3_ENST00000454328.1_Missense_Mutation_p.P307S|TNIP3_ENST00000509841.1_Intron|TNIP3_ENST00000507879.1_Intron	NM_024873.5	NP_079149.3			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						ACATCTGGCGGAAGCTGGTCA	0.393																																						dbGAP											0													226.0	197.0	207.0					4																	122059806		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000057513.3:c.919C>T	4.37:g.122059806G>A	ENSP00000057513:p.Pro307Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P307S	ENST00000057513.3	37	c.919	CCDS3718.1	4	.	.	.	.	.	.	.	.	.	.	G	23.7	4.442582	0.83993	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000515036	T;T	0.65916	-0.18;-0.18	5.34	5.34	0.76211	.	0.600251	0.14379	N	0.323264	T	0.76176	0.3951	L	0.47716	1.5	0.35634	D	0.810469	D	0.89917	1.0	D	0.79784	0.993	T	0.80683	-0.1273	10	0.87932	D	0	.	19.0369	0.92982	0.0:0.0:1.0:0.0	.	307	Q96KP6	TNIP3_HUMAN	S	307;307;40	ENSP00000057513:P307S;ENSP00000411817:P307S	ENSP00000057513:P307S	P	-	1	0	TNIP3	122279256	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.750000	0.74888	2.509000	0.84616	0.655000	0.94253	CCG	TNIP3	-	NULL	ENSG00000050730		0.393	TNIP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000256527.2	55	0.00	0	G	NM_024873		122059806	122059806	-1	no_errors	ENST00000057513	ensembl	human	known	69_37n	missense	59	30.59	26	SNP	1.000	A
TNIP3	79931	genome.wustl.edu	37	4	122071373	122071373	+	Splice_Site	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr4:122071373G>C	ENST00000509841.1	-	9	803	c.725C>G	c.(724-726)gCt>gGt	p.A242G	TNIP3_ENST00000511909.1_5'Flank|TNIP3_ENST00000454328.1_Splice_Site_p.A165G|TNIP3_ENST00000507879.1_Splice_Site_p.A235G|TNIP3_ENST00000057513.3_Splice_Site_p.A165G	NM_001244764.1	NP_001231693.1			TNFAIP3 interacting protein 3											NS(1)|endometrium(4)|large_intestine(4)|lung(9)|ovary(1)|prostate(3)|skin(2)	24						ATCCTGAAGAGCCTACGTAAT	0.373																																						dbGAP											0													90.0	85.0	87.0					4																	122071373		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ320534	CCDS3718.1, CCDS58925.1, CCDS58926.1	4q27	2008-02-05			ENSG00000050730	ENSG00000050730			19315	protein-coding gene	gene with protein product		608019				11345586	Standard	NM_024873		Approved	LIND, FLJ21162, ABIN-3	uc021xrj.1	Q96KP6	OTTHUMG00000132969	ENST00000509841.1:c.724-1C>G	4.37:g.122071373G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A165G	ENST00000509841.1	37	c.494	CCDS58926.1	4	.	.	.	.	.	.	.	.	.	.	G	13.42	2.230811	0.39399	.	.	ENSG00000050730	ENST00000057513;ENST00000454328;ENST00000507879;ENST00000509841	T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07	5.63	2.43	0.29744	.	0.335250	0.28549	N	0.014959	T	0.70107	0.3186	M	0.78456	2.415	0.23144	N	0.998225	P;P	0.47191	0.888;0.891	P;P	0.51550	0.667;0.673	T	0.64110	-0.6484	10	0.72032	D	0.01	-0.0337	11.1386	0.48390	0.2528:0.0:0.7472:0.0	.	235;165	B4DVF5;Q96KP6	.;TNIP3_HUMAN	G	165;165;235;242	ENSP00000057513:A165G;ENSP00000411817:A165G;ENSP00000427106:A235G;ENSP00000426613:A242G	ENSP00000057513:A165G	A	-	2	0	TNIP3	122290823	1.000000	0.71417	0.990000	0.47175	0.162000	0.22319	2.669000	0.46825	-0.001000	0.14495	-0.813000	0.03139	GCT	TNIP3	-	NULL	ENSG00000050730		0.373	TNIP3-003	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	TNIP3	HGNC	protein_coding	OTTHUMT00000364000.4	33	0.00	0	G	NM_024873	Missense_Mutation	122071373	122071373	-1	no_errors	ENST00000057513	ensembl	human	known	69_37n	missense	47	17.54	10	SNP	0.997	C
TP53	7157	genome.wustl.edu	37	17	7578462	7578464	+	In_Frame_Del	DEL	GCG	GCG	-	rs563378859|rs371524413		TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	GCG	GCG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr17:7578462_7578464delGCG	ENST00000269305.4	-	5	655_657	c.466_468delCGC	c.(466-468)cgcdel	p.R156del	TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_In_Frame_Del_p.R156del|TP53_ENST00000359597.4_In_Frame_Del_p.R156del|TP53_ENST00000455263.2_In_Frame_Del_p.R156del|TP53_ENST00000420246.2_In_Frame_Del_p.R156del|TP53_ENST00000445888.2_In_Frame_Del_p.R156del	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	156	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> C (in sporadic cancers; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> H (in LFS; germline mutation and in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation).|R -> P (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:7682763}.|R -> S (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R156P(24)|p.R156fs*14(10)|p.R156H(10)|p.0?(8)|p.?(5)|p.P152fs*14(4)|p.V157fs*13(3)|p.R156S(3)|p.R156R(3)|p.R156L(3)|p.R156G(3)|p.G154fs*14(2)|p.R156_I162delRVRAMAI(2)|p.T155fs*23(2)|p.P153fs*22(2)|p.R156fs*25(2)|p.R156C(2)|p.V157fs*24(2)|p.R156_A161delRVRAMA(1)|p.P151_V173del23(1)|p.S149fs*72(1)|p.R156del(1)|p.R156_R158delRVR(1)|p.R156fs*12(1)|p.R156fs*18(1)|p.R156_A161del(1)|p.V157fs*9(1)|p.R156_V157del(1)|p.D148fs*23(1)|p.R156_V157insV(1)|p.T155_A161delTRVRAMA(1)|p.G154fs*22(1)|p.T155_R156delTR(1)|p.R156fs*20(1)|p.V157fs*23(1)|p.G154_R156delGTR(1)|p.V157fs*25(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TGGCGCGGACGCGGGTGCCGGGC	0.616		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	109	Substitution - Missense(45)|Deletion - Frameshift(30)|Deletion - In frame(11)|Whole gene deletion(8)|Insertion - Frameshift(5)|Unknown(5)|Substitution - coding silent(3)|Insertion - In frame(1)|Complex - frameshift(1)	breast(16)|ovary(11)|lung(10)|upper_aerodigestive_tract(9)|large_intestine(8)|stomach(7)|central_nervous_system(7)|haematopoietic_and_lymphoid_tissue(7)|skin(7)|urinary_tract(5)|oesophagus(5)|bone(5)|pancreas(3)|kidney(2)|liver(2)|prostate(2)|soft_tissue(1)|genital_tract(1)|biliary_tract(1)	GRCh37	CM984589	TP53	M																																				-	-	-	SO:0001651	inframe_deletion	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.466_468delCGC	17.37:g.7578462_7578464delGCG	ENSP00000269305:p.Arg156del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	In_Frame_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R156in_frame_del	ENST00000269305.4	37	c.468_466	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.616	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	29	0.00	0	GCG	NM_000546		7578462	7578464	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	in_frame_del	19	42.42	14	DEL	0.000:0.019:0.010	-
TPH2	121278	genome.wustl.edu	37	12	72355404	72355404	+	Intron	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr12:72355404C>G	ENST00000333850.3	+	6	749				TPH2_ENST00000546576.1_3'UTR	NM_173353.3	NP_775489.2	Q8IWU9	TPH2_HUMAN	tryptophan hydroxylase 2						aromatic amino acid family metabolic process (GO:0009072)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to lithium ion (GO:0071285)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|response to activity (GO:0014823)|response to calcium ion (GO:0051592)|response to estrogen (GO:0043627)|response to glucocorticoid (GO:0051384)|response to nutrient levels (GO:0031667)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	41					L-Tryptophan(DB00150)	TCTTTGAGCTCAAGCTCCTTG	0.378																																						dbGAP											0													77.0	74.0	75.0					12																	72355404		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			AY098914	CCDS31859.1	12q15	2008-02-07				ENSG00000139287	1.14.16.4		20692	protein-coding gene	gene with protein product		607478				12511643	Standard	NM_173353		Approved	NTPH, FLJ37295	uc009zrw.1	Q8IWU9		ENST00000333850.3:c.609-10895C>G	12.37:g.72355404C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGA4|Q14CB0	Nonsense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C	p.S227*	ENST00000333850.3	37	c.680	CCDS31859.1	12	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245480	0.59103	.	.	ENSG00000139287	ENST00000266669	.	.	.	4.7	0.695	0.18070	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	1.0327	0.01541	0.1874:0.4242:0.182:0.2063	.	.	.	.	X	227	.	ENSP00000266669:S227X	S	+	2	0	TPH2	70641671	0.000000	0.05858	0.000000	0.03702	0.399000	0.30720	0.179000	0.16840	0.264000	0.21851	0.655000	0.94253	TCA	TPH2	-	NULL	ENSG00000139287		0.378	TPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH2	HGNC	protein_coding	OTTHUMT00000405234.1	78	0.00	0	C	NM_173353		72355404	72355404	+1	no_errors	ENST00000546576	ensembl	human	known	69_37n	nonsense	104	16.13	20	SNP	0.000	G
TRAPPC9	83696	genome.wustl.edu	37	8	141468548	141468548	+	5'Flank	SNP	G	G	A			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr8:141468548G>A	ENST00000438773.2	-	0	0				TRAPPC9_ENST00000389328.4_Missense_Mutation_p.A39V|TRAPPC9_ENST00000389327.3_5'Flank	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9						cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						CGTGGCGCGCGCGGCCTGGGA	0.741																																						dbGAP											0													8.0	9.0	9.0					8																	141468548		2164	4222	6386	-	-	-	SO:0001631	upstream_gene_variant	0			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187		8.37:g.141468548G>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	pfam_TRAPP_II_complex_Trs120	p.A39V	ENST00000438773.2	37	c.116	CCDS55278.1	8	.	.	.	.	.	.	.	.	.	.	G	11.33	1.606470	0.28623	.	.	ENSG00000167632	ENST00000389328	.	.	.	1.59	-2.44	0.06502	.	.	.	.	.	T	0.16727	0.0402	N	0.08118	0	0.09310	N	0.999996	B	0.02656	0.0	B	0.01281	0.0	T	0.18808	-1.0325	8	0.87932	D	0	.	6.0724	0.19897	0.4084:0.0:0.5916:0.0	.	39	Q96Q05-2	.	V	39	.	ENSP00000373979:A39V	A	-	2	0	TRAPPC9	141537730	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.050000	0.03510	-0.780000	0.04553	0.491000	0.48974	GCG	TRAPPC9	-	NULL	ENSG00000167632		0.741	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	82	0.00	0	G	NM_031466		141468548	141468548	-1	no_errors	ENST00000389328	ensembl	human	known	69_37n	missense	133	15.62	25	SNP	0.000	A
TRIP11	9321	genome.wustl.edu	37	14	92474126	92474126	+	Missense_Mutation	SNP	T	T	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr14:92474126T>C	ENST00000267622.4	-	10	1758	c.1385A>G	c.(1384-1386)gAc>gGc	p.D462G		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	462					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CAAACTTATGTCTCTTGTAGC	0.313			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	dbGAP		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													118.0	110.0	113.0					14																	92474126		2202	4299	6501	-	-	-	SO:0001583	missense	0			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1385A>G	14.37:g.92474126T>C	ENSP00000267622:p.Asp462Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	superfamily_Ribosomal_L29,pfscan_GRIP	p.D462G	ENST00000267622.4	37	c.1385	CCDS9899.1	14	.	.	.	.	.	.	.	.	.	.	T	7.554	0.663284	0.14710	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.66280	-0.2	5.62	3.29	0.37713	.	0.351090	0.31507	N	0.007539	T	0.55242	0.1908	M	0.63843	1.955	0.09310	N	1	B;P	0.41232	0.003;0.743	B;B	0.43052	0.007;0.406	T	0.41378	-0.9512	10	0.15952	T	0.53	.	6.0469	0.19766	0.0:0.1568:0.1827:0.6605	.	198;462	F5H1Z0;Q15643	.;TRIPB_HUMAN	G	462;198	ENSP00000267622:D462G	ENSP00000267622:D462G	D	-	2	0	TRIP11	91543879	0.525000	0.26290	0.002000	0.10522	0.080000	0.17528	3.152000	0.50677	0.965000	0.38133	0.459000	0.35465	GAC	TRIP11	-	NULL	ENSG00000100815		0.313	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	70	0.00	0	T			92474126	92474126	-1	no_errors	ENST00000267622	ensembl	human	known	69_37n	missense	30	67.03	61	SNP	0.002	C
TSSC1	7260	genome.wustl.edu	37	2	3357043	3357043	+	Intron	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr2:3357043C>T	ENST00000382125.4	-	2	319				TSSC1_ENST00000398659.4_Intron|TSSC1_ENST00000443925.2_Intron	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1											breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		CTGAAGATAACCCTTGGCTCA	0.413																																					Colon(140;1261 1762 4183 34270 49743)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.126+1277G>A	2.37:g.3357043C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W4Y1|O43179|Q53S19|Q53SG2	Missense_Mutation	SNP	NULL	p.V60I	ENST00000382125.4	37	c.178	CCDS1651.1	2																																																																																			TSSC1	-	NULL	ENSG00000032389		0.413	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC1	HGNC	protein_coding	OTTHUMT00000206694.2	83	0.00	0	C	NM_003310		3357043	3357043	-1	no_errors	ENST00000406835	ensembl	human	known	69_37n	missense	81	27.68	31	SNP	0.004	T
TTC39B	158219	genome.wustl.edu	37	9	15190604	15190604	+	Silent	SNP	T	T	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr9:15190604T>G	ENST00000512701.2	-	11	1089	c.1053A>C	c.(1051-1053)gcA>gcC	p.A351A	TTC39B_ENST00000541445.1_3'UTR|TTC39B_ENST00000380850.4_Silent_p.A351A|TTC39B_ENST00000507993.1_Silent_p.A186A|TTC39B_ENST00000355694.2_Silent_p.A285A|TTC39B_ENST00000297615.5_Silent_p.A282A|TTC39B_ENST00000507285.1_Silent_p.A186A			Q5VTQ0	TT39B_HUMAN	tetratricopeptide repeat domain 39B	351										NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|ovary(2)|prostate(1)	21						AGCAGCACAGTGCAGACCTCA	0.413																																						dbGAP											0													105.0	96.0	99.0					9																	15190604		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091187	CCDS6477.1, CCDS6477.2, CCDS55294.1, CCDS55295.1, CCDS55296.1	9p22.2	2013-01-11	2008-06-23	2008-06-23	ENSG00000155158	ENSG00000155158		"""Tetratricopeptide (TTC) repeat domain containing"""	23704	protein-coding gene	gene with protein product		613574	"""chromosome 9 open reading frame 52"""	C9orf52			Standard	NM_001168339		Approved	FLJ33868	uc003zlr.2	Q5VTQ0	OTTHUMG00000019581	ENST00000512701.2:c.1053A>C	9.37:g.15190604T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLN1|B4DQ10|B4DQX4|B4DW93|Q8IVR7|Q8IXZ6|Q8N267	Silent	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.A351	ENST00000512701.2	37	c.1053	CCDS6477.2	9																																																																																			TTC39B	-	pfam_OMP_IML2_mit/TPR_39	ENSG00000155158		0.413	TTC39B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC39B	HGNC	protein_coding	OTTHUMT00000051758.3	34	0.00	0	T	NM_152574		15190604	15190604	-1	no_errors	ENST00000512701	ensembl	human	known	69_37n	silent	42	32.26	20	SNP	0.044	G
UBAP2	55833	genome.wustl.edu	37	9	33934266	33934266	+	Intron	SNP	A	A	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr9:33934266A>T	ENST00000379238.1	-	18	2087				UBAP2_ENST00000360802.1_Intron|UBAP2_ENST00000449054.1_Intron|UBAP2_ENST00000379239.4_Intron|UBAP2_ENST00000539807.1_Intron|UBAP2_ENST00000418786.2_Intron|SNORD121B_ENST00000458838.1_RNA					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		AGGCTTCAGAAAGGATGTGGA	0.433																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.1970-640T>A	9.37:g.33934266A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000379238.1	37	NULL	CCDS6547.1	9																																																																																			UBAP2	-	-	ENSG00000137073		0.433	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2	HGNC	protein_coding	OTTHUMT00000001071.1	15	0.00	0	A	NM_018449		33934266	33934266	-1	no_errors	ENST00000474372	ensembl	human	known	69_37n	rna	20	31.03	9	SNP	0.000	T
UNC80	285175	genome.wustl.edu	37	2	210742807	210742807	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr2:210742807G>C	ENST00000439458.1	+	24	4056	c.3976G>C	c.(3976-3978)Gat>Cat	p.D1326H	UNC80_ENST00000272845.6_Missense_Mutation_p.D1321H	NM_032504.1	NP_115893.1	Q8N2C7	UNC80_HUMAN	unc-80 homolog (C. elegans)	1326					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)	20						AGACTTTTTAGATGACAGTAA	0.453																																						dbGAP											0													138.0	120.0	125.0					2																	210742807		692	1591	2283	-	-	-	SO:0001583	missense	0			AK090815	CCDS2387.1, CCDS46504.1, CCDS2387.2	2q35	2009-08-17	2009-08-17	2009-08-17	ENSG00000144406	ENSG00000144406			26582	protein-coding gene	gene with protein product		612636	"""chromosome 2 open reading frame 21"""	C2orf21		19092807	Standard	NM_032504		Approved	FLJ33496, KIAA1843, UNC-80	uc010zjc.1	Q8N2C7	OTTHUMG00000132963	ENST00000439458.1:c.3976G>C	2.37:g.210742807G>C	ENSP00000391088:p.Asp1326His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN50|B4DQY9|B4DZB3|C4IXS8|C9J1U3|Q96JI4|Q96SS0	Missense_Mutation	SNP	NULL	p.D1326H	ENST00000439458.1	37	c.3976	CCDS46504.1	2	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310630	0.81358	.	.	ENSG00000144406	ENST00000439458;ENST00000272845	T;T	0.47869	0.83;0.83	6.05	6.05	0.98169	.	0.053460	0.64402	D	0.000001	T	0.59252	0.2180	L	0.49126	1.545	0.80722	D	1	P	0.52061	0.95	P	0.53006	0.715	T	0.58521	-0.7622	10	0.72032	D	0.01	-18.8182	20.6087	0.99469	0.0:0.0:1.0:0.0	.	1326	Q8N2C7	UNC80_HUMAN	H	1326;1321	ENSP00000391088:D1326H;ENSP00000272845:D1321H	ENSP00000272845:D1321H	D	+	1	0	UNC80	210451052	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.635000	0.83286	2.866000	0.98385	0.650000	0.86243	GAT	UNC80	-	NULL	ENSG00000144406		0.453	UNC80-201	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC80	HGNC	protein_coding		30	0.00	0	G	NM_182587		210742807	210742807	+1	no_errors	ENST00000439458	ensembl	human	known	69_37n	missense	60	12.68	9	SNP	1.000	C
USP24	23358	genome.wustl.edu	37	1	55589148	55589148	+	Silent	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:55589148C>T	ENST00000294383.6	-	36	4247	c.4248G>A	c.(4246-4248)acG>acA	p.T1416T	USP24_ENST00000407756.1_Silent_p.T1256T	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1416					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						GCTGTAGGCACGTAACAAGAA	0.488																																						dbGAP											0													56.0	56.0	56.0					1																	55589148		1924	4122	6046	-	-	-	SO:0001819	synonymous_variant	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.4248G>A	1.37:g.55589148C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	pfam_Peptidase_C19,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19	p.T1416	ENST00000294383.6	37	c.4248	CCDS44154.2	1																																																																																			USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.488	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	36	0.00	0	C			55589148	55589148	-1	no_errors	ENST00000294383	ensembl	human	known	69_37n	silent	41	36.36	24	SNP	0.029	T
XIRP2	129446	genome.wustl.edu	37	2	168107125	168107125	+	Missense_Mutation	SNP	G	G	C			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr2:168107125G>C	ENST00000409195.1	+	9	9312	c.9223G>C	c.(9223-9225)Gcc>Ccc	p.A3075P	XIRP2_ENST00000295237.9_Missense_Mutation_p.A3075P|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.A2853P|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409728.1_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	2900					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						AAATAAAATTGCCAAAGAGAA	0.358																																						dbGAP											0													77.0	74.0	75.0					2																	168107125		1876	4110	5986	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.9223G>C	2.37:g.168107125G>C	ENSP00000386840:p.Ala3075Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.A3075P	ENST00000409195.1	37	c.9223	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	2.102	-0.405733	0.04832	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.02656	4.21;4.21;4.21	5.78	1.47	0.22746	.	0.774566	0.11828	N	0.525466	T	0.02230	0.0069	N	0.22421	0.69	0.09310	N	1	B;B;B	0.06786	0.0;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.002	T	0.46555	-0.9183	10	0.30854	T	0.27	-1.3949	6.6196	0.22796	0.5901:0.0:0.4099:0.0	.	2900;2900;2853	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	P	3075;3075;2853;489	ENSP00000386840:A3075P;ENSP00000295237:A3075P;ENSP00000387255:A2853P	ENSP00000295237:A3075P	A	+	1	0	XIRP2	167815371	0.002000	0.14202	0.329000	0.25429	0.042000	0.13812	1.070000	0.30653	0.377000	0.24735	-0.259000	0.10710	GCC	XIRP2	-	superfamily_FH2_actin-bd	ENSG00000163092		0.358	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	8	0.00	0	G	NM_152381		168107125	168107125	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.004	C
ZC3H3	23144	genome.wustl.edu	37	8	144550658	144550658	+	Missense_Mutation	SNP	C	C	G			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr8:144550658C>G	ENST00000262577.5	-	7	2030	c.1999G>C	c.(1999-2001)Gag>Cag	p.E667Q		NM_015117.2	NP_055932.2	Q8IXZ2	ZC3H3_HUMAN	zinc finger CCCH-type containing 3	667					mRNA polyadenylation (GO:0006378)|poly(A)+ mRNA export from nucleus (GO:0016973)|regulation of mRNA export from nucleus (GO:0010793)	nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	23	all_cancers(97;8.64e-11)|all_epithelial(106;6.43e-09)|Lung NSC(106;0.000202)|all_lung(105;0.000548)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		Colorectal(110;0.107)|BRCA - Breast invasive adenocarcinoma(115;0.107)			TTCCTCTTCTCCCTGCGCTGC	0.672																																						dbGAP											0													28.0	33.0	32.0					8																	144550658		2189	4294	6483	-	-	-	SO:0001583	missense	0			D63484	CCDS6402.1	8q24.3	2012-07-05	2005-06-02	2005-06-02	ENSG00000014164	ENSG00000014164		"""Zinc fingers, CCCH-type domain containing"""	28972	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 3"""	ZC3HDC3		8590280	Standard	NM_015117		Approved	KIAA0150	uc003yyd.2	Q8IXZ2	OTTHUMG00000165127	ENST00000262577.5:c.1999G>C	8.37:g.144550658C>G	ENSP00000262577:p.Glu667Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14163|Q8N4E2|Q9BUS4	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.E667Q	ENST00000262577.5	37	c.1999	CCDS6402.1	8	.	.	.	.	.	.	.	.	.	.	C	7.741	0.701271	0.15172	.	.	ENSG00000014164	ENST00000262577	T	0.03094	4.05	5.07	3.24	0.37175	Zinc finger, CCCH-type (1);	0.311758	0.31461	N	0.007615	T	0.03783	0.0107	L	0.38175	1.15	0.32589	N	0.527476	B	0.29627	0.252	B	0.19148	0.024	T	0.14337	-1.0476	10	0.31617	T	0.26	-3.4951	14.9326	0.70929	0.0:0.7766:0.2233:0.0	.	667	Q8IXZ2	ZC3H3_HUMAN	Q	667	ENSP00000262577:E667Q	ENSP00000262577:E667Q	E	-	1	0	ZC3H3	144621801	1.000000	0.71417	0.003000	0.11579	0.054000	0.15201	2.150000	0.42254	1.151000	0.42436	0.561000	0.74099	GAG	ZC3H3	-	NULL	ENSG00000014164		0.672	ZC3H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H3	HGNC	protein_coding	OTTHUMT00000382011.2	67	0.00	0	C	NM_015117		144550658	144550658	-1	no_errors	ENST00000262577	ensembl	human	known	69_37n	missense	117	16.43	23	SNP	0.957	G
ZDHHC8P1	150244	genome.wustl.edu	37	22	23742579	23742579	+	RNA	SNP	C	C	T	rs6003689	byFrequency	TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr22:23742579C>T	ENST00000255890.4	-	0	630									zinc finger, DHHC-type containing 8 pseudogene 1																		CCCGCCCTGCCGGCTTGAGGC	0.682													.|||	23	0.00459265	0.0166	0.0014	5008	,	,		18592	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0					22q11.23	2010-02-25	2010-02-25	2010-02-25	ENSG00000133519	ENSG00000133519			26461	pseudogene	pseudogene			"""zinc finger, DHHC-type containing 8 pseudogene"""	ZDHHC8P			Standard	NR_003950		Approved	FLJ31568	uc002zwz.5		OTTHUMG00000150650		22.37:g.23742579C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000255890.4	37	NULL		22																																																																																			ZDHHC8P1	-	-	ENSG00000133519		0.682	ZDHHC8P1-001	KNOWN	basic	processed_transcript	ZDHHC8P1	HGNC	pseudogene	OTTHUMT00000319397.1	9	0.00	0	C	NR_003950		23742579	23742579	-1	no_errors	ENST00000255890	ensembl	human	known	69_37n	rna	13	55.17	16	SNP	0.998	T
ZRANB2	9406	genome.wustl.edu	37	1	71529633	71529633	+	3'UTR	SNP	C	C	T			TCGA-GM-A3XL-01A-11D-A22X-09	TCGA-GM-A3XL-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b27d75ba-5989-4200-bfe9-f1b7d7cf8008	90469bfb-140c-4856-be28-a9b04c183157	g.chr1:71529633C>T	ENST00000370920.3	-	0	2418				ZRANB2-AS1_ENST00000450461.1_RNA|ZRANB2_ENST00000254821.6_3'UTR|ZRANB2_ENST00000477096.1_5'UTR|ZRANB2-AS1_ENST00000426999.1_RNA	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						ACTGGAAATACTGTTAAGAGA	0.313																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.*1124G>A	1.37:g.71529633C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	RNA	SNP	-	NULL	ENST00000370920.3	37	NULL	CCDS659.1	1																																																																																			ZRANB2	-	-	ENSG00000132485		0.313	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	36	0.00	0	C	NM_203350		71529633	71529633	-1	no_errors	ENST00000477096	ensembl	human	known	69_37n	rna	62	18.42	14	SNP	1.000	T
