#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2MP1	3	genome.wustl.edu	37	12	9413853	9413853	+	IGR	SNP	T	T	C	rs252031|rs386760161	byFrequency	TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr12:9413853T>C								RP11-118B22.4 (3297 upstream) : SNORA75 (25415 downstream)																							GTTTCCTTGTTCAATGGATAA	0.313													T|||	3264	0.651757	0.5469	0.7075	5008	,	,		-128	0.624		0.66	False		,,,				2504	0.774					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.9413853T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		12																																																																																			A2MP1	-	-	ENSG00000256069	0	0.313					A2MP1	HGNC			45	0.00	0	T			9413853	9413853	-1	no_errors	ENST00000544183	ensembl	human	known	69_37n	rna	42	12.50	6	SNP	0.001	C
A2MP1	3	genome.wustl.edu	37	12	9413867	9413867	+	IGR	SNP	A	A	G	rs386760161|rs252032	byFrequency	TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr12:9413867A>G								RP11-118B22.4 (3311 upstream) : SNORA75 (25401 downstream)																							TGGATAACACATGGATTCCTG	0.308													G|||	3263	0.651558	0.5469	0.7075	5008	,	,		-128	0.624		0.659	False		,,,				2504	0.774					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															12.37:g.9413867A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL		37	NULL		12																																																																																			A2MP1	-	-	ENSG00000256069	0	0.308					A2MP1	HGNC			43	0.00	0	A			9413867	9413867	-1	no_errors	ENST00000544183	ensembl	human	known	69_37n	rna	42	12.50	6	SNP	0.000	G
ZNF721	170960	genome.wustl.edu	37	4	420298	420299	+	IGR	DEL	AC	AC	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr4:420298_420299delAC	ENST00000506646.1	-	0	935				ABCA11P_ENST00000451020.2_RNA			Q8TF20	ZN721_HUMAN	zinc finger protein 721						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(2)|large_intestine(15)|lung(6)|ovary(1)|skin(1)|stomach(5)|urinary_tract(1)	33						TAAGTTTGGGACACAGTGAGTT	0.48																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK092362	CCDS46991.1	4p16.3	2013-01-08			ENSG00000182903	ENSG00000182903		"""Zinc fingers, C2H2-type"", ""-"""	29425	protein-coding gene	gene with protein product						11853319	Standard	NM_133474		Approved	KIAA1982	uc003gag.4	Q8TF20			4.37:g.420300_420301delAC		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YG7	RNA	DEL	-	NULL	ENST00000506646.1	37	NULL		4																																																																																			ABCA11P	-	-	ENSG00000251595		0.480	ZNF721-003	PUTATIVE	basic	protein_coding	ABCA11P	HGNC	protein_coding	OTTHUMT00000357869.2	76	0.00	0	AC	NM_133474		420298	420299	-1	no_errors	ENST00000451020	ensembl	human	known	69_37n	rna	75	11.36	10	DEL	1.000:1.000	-
ACOT11	26027	genome.wustl.edu	37	1	55067005	55067005	+	Silent	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:55067005C>A	ENST00000371316.3	+	9	1030	c.948C>A	c.(946-948)atC>atA	p.I316I	ACOT11_ENST00000343744.2_Silent_p.I316I|ACOT11_ENST00000481208.1_3'UTR	NM_015547.3	NP_056362.1	Q8WXI4	ACO11_HUMAN	acyl-CoA thioesterase 11	316	Acyl coenzyme A hydrolase 2.				fatty acid metabolic process (GO:0006631)|intracellular signal transduction (GO:0035556)|response to cold (GO:0009409)|response to temperature stimulus (GO:0009266)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|endometrium(6)|large_intestine(3)|lung(5)|ovary(1)	17						GGCGCCACATCAACAGTGCCT	0.647																																					Ovarian(148;1440 1861 22015 32453 51933)	dbGAP											0													96.0	93.0	94.0					1																	55067005		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014607	CCDS592.1, CCDS593.1	1p32.3	2011-09-13	2005-09-08	2005-09-08	ENSG00000162390	ENSG00000162390	3.1.2.-	"""Acyl CoA thioesterases"", ""StAR-related lipid transfer (START) domain containing"""	18156	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 14"""	606803	"""thioesterase, adipose associated"""	THEA		11696000, 16103133, 16940157	Standard	NM_015547		Approved	STARD14, BFIT, KIAA0707, BFIT1, THEM1	uc001cxl.2	Q8WXI4	OTTHUMG00000009891	ENST00000371316.3:c.948C>A	1.37:g.55067005C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ22|D3DQ50|O75187|Q52LP1|Q53ER9|Q96DI1|Q9H883	Silent	SNP	pfam_START_lipid-bd,pfam_Thioestr_supf,smart_START_lipid-bd,pfscan_START_lipid-bd	p.I316	ENST00000371316.3	37	c.948	CCDS592.1	1																																																																																			ACOT11	-	NULL	ENSG00000162390		0.647	ACOT11-001	KNOWN	basic|CCDS	protein_coding	ACOT11	HGNC	protein_coding	OTTHUMT00000027356.1	83	0.00	0	C	NM_015547		55067005	55067005	+1	no_errors	ENST00000371316	ensembl	human	known	69_37n	silent	66	15.38	12	SNP	1.000	A
ALOX15B	247	genome.wustl.edu	37	17	7948280	7948281	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr17:7948280_7948281delAG	ENST00000380183.4	+	6	949_950	c.810_811delAG	c.(808-813)tcagtgfs	p.V271fs	ALOX15B_ENST00000380173.2_Frame_Shift_Del_p.V271fs|ALOX15B_ENST00000572022.1_Frame_Shift_Del_p.V271fs|ALOX15B_ENST00000573359.1_Frame_Shift_Del_p.V271fs	NM_001141.2	NP_001132.2	O15296	LX15B_HUMAN	arachidonate 15-lipoxygenase, type B	271	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.			V -> L (in Ref. 1; AAB61706 and 2; CAC34521). {ECO:0000305}.	apoptotic process (GO:0006915)|arachidonic acid metabolic process (GO:0019369)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipid metabolic process (GO:0006629)|lipoxygenase pathway (GO:0019372)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth (GO:0045926)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|prostate gland development (GO:0030850)|regulation of epithelial cell differentiation (GO:0030856)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	arachidonate 15-lipoxygenase activity (GO:0050473)|arachidonate 8(S)-lipoxygenase activity (GO:0036403)|calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|linoleate 13S-lipoxygenase activity (GO:0016165)|lipid binding (GO:0008289)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	24						TGGTGGCCTCAGTGTTGGGTCC	0.599																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U78294	CCDS11128.1, CCDS32558.1, CCDS32559.1	17p13.1	2013-03-20	2006-01-16		ENSG00000179593	ENSG00000179593	1.13.11.33	"""Arachidonate lipoxygenases"""	434	protein-coding gene	gene with protein product		603697	"""arachidonate 15-lipoxygenase, second type"""			9177185	Standard	NM_001039130		Approved	15-LOX-2	uc002gju.3	O15296	OTTHUMG00000108181	ENST00000380183.4:c.810_811delAG	17.37:g.7948280_7948281delAG	ENSP00000369530:p.Val271fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTR2|Q8IYQ2|Q8TEV3|Q8TEV4|Q8TEV5|Q8TEV6|Q9UKM4	Frame_Shift_Del	DEL	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C	p.L272fs	ENST00000380183.4	37	c.810_811	CCDS11128.1	17																																																																																			ALOX15B	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000179593		0.599	ALOX15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15B	HGNC	protein_coding	OTTHUMT00000226985.2	162	0.00	0	AG			7948280	7948281	+1	no_errors	ENST00000380183	ensembl	human	known	69_37n	frame_shift_del	197	14.04	33	DEL	0.000:0.002	-
ARHGAP35	2909	genome.wustl.edu	37	19	47440520	47440520	+	Splice_Site	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr19:47440520G>A	ENST00000404338.3	+	2	3681		c.e2-1			NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35						axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										TTCCTGGACAGAAACCAAAGC	0.458																																						dbGAP											0													49.0	48.0	48.0					19																	47440520		1870	4108	5978	-	-	-	SO:0001630	splice_region_variant	0			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.3682-1G>A	19.37:g.47440520G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2A4|Q14452|Q9C0E1	Splice_Site	SNP	-	e2-1	ENST00000404338.3	37	c.3682-1	CCDS46127.1	19	.	.	.	.	.	.	.	.	.	.	G	24.7	4.555752	0.86231	.	.	ENSG00000160007	ENST00000317082;ENST00000404338	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2703	0.90066	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ARHGAP35	52132360	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	6.979000	0.76154	2.603000	0.88011	0.467000	0.42956	.	ARHGAP35	-	-	ENSG00000160007		0.458	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	66	0.00	0	G	NM_004491	Intron	47440520	47440520	+1	no_errors	ENST00000404338	ensembl	human	known	69_37n	splice_site	76	19.15	18	SNP	1.000	A
ARHGEF7	8874	genome.wustl.edu	37	13	111938540	111938540	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr13:111938540G>T	ENST00000375741.2	+	18	2310	c.2060G>T	c.(2059-2061)cGc>cTc	p.R687L	ARHGEF7_ENST00000375736.4_Missense_Mutation_p.R509L|ARHGEF7_ENST00000478679.1_Missense_Mutation_p.R431L|ARHGEF7_ENST00000375737.5_Missense_Mutation_p.R584L|ARHGEF7_ENST00000218789.5_Missense_Mutation_p.R509L|ARHGEF7_ENST00000375739.2_Missense_Mutation_p.R637L|ARHGEF7_ENST00000375723.1_Missense_Mutation_p.R509L|ARHGEF7_ENST00000370623.3_Missense_Mutation_p.R594L|ARHGEF7_ENST00000317133.5_Missense_Mutation_p.R666L|ARHGEF7_ENST00000426073.2_Missense_Mutation_p.R509L	NM_001113511.1|NM_145735.2	NP_001106983.1|NP_663788.1	Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	687					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			CTGCCCAAGCGCAAACCTGAA	0.502																																						dbGAP											0													101.0	93.0	95.0					13																	111938540		2203	4300	6503	-	-	-	SO:0001583	missense	0			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000375741.2:c.2060G>T	13.37:g.111938540G>T	ENSP00000364893:p.Arg687Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_CH-domain,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,prints_SH3_domain,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.R687L	ENST00000375741.2	37	c.2060	CCDS45068.1	13	.	.	.	.	.	.	.	.	.	.	G	33	5.220751	0.95139	.	.	ENSG00000102606	ENST00000317133;ENST00000375741;ENST00000375739;ENST00000370623;ENST00000545635;ENST00000218789;ENST00000375736;ENST00000426073;ENST00000375737;ENST00000375723;ENST00000478679	T;T;T;T;T;T;T;T;T;T	0.64260	0.45;0.44;0.44;0.53;0.43;0.53;0.53;0.56;0.41;-0.09	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	T	0.74344	0.3704	L	0.52759	1.655	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.979;1.0;1.0;1.0;1.0	D;P;D;D;D;D	0.97110	0.983;0.807;0.999;0.999;0.999;1.0	T	0.73789	-0.3872	10	0.37606	T	0.19	.	17.4325	0.87543	0.0:0.0:1.0:0.0	.	431;584;509;637;687;666	E9PDQ5;B7Z6G2;Q14155-6;Q14155-2;Q14155;Q14155-3	.;.;.;.;ARHG7_HUMAN;.	L	666;687;637;594;664;509;509;509;584;509;431	ENSP00000325994:R666L;ENSP00000364893:R687L;ENSP00000364891:R637L;ENSP00000359657:R594L;ENSP00000218789:R509L;ENSP00000364888:R509L;ENSP00000397068:R509L;ENSP00000364889:R584L;ENSP00000364875:R509L;ENSP00000417596:R431L	ENSP00000218789:R509L	R	+	2	0	ARHGEF7	110736541	1.000000	0.71417	0.993000	0.49108	0.965000	0.64279	8.904000	0.92590	2.099000	0.63709	0.561000	0.74099	CGC	ARHGEF7	-	NULL	ENSG00000102606		0.502	ARHGEF7-204	KNOWN	basic|CCDS	protein_coding	ARHGEF7	HGNC	protein_coding		43	0.00	0	G	NM_001113511		111938540	111938540	+1	no_errors	ENST00000375741	ensembl	human	known	69_37n	missense	46	34.29	24	SNP	1.000	T
ASB4	51666	genome.wustl.edu	37	7	95157289	95157289	+	Missense_Mutation	SNP	T	T	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr7:95157289T>C	ENST00000325885.5	+	3	723	c.652T>C	c.(652-654)Tgg>Cgg	p.W218R	ASB4_ENST00000428113.1_Missense_Mutation_p.W218R	NM_016116.2	NP_057200.1	Q9Y574	ASB4_HUMAN	ankyrin repeat and SOCS box containing 4	218					intracellular signal transduction (GO:0035556)|positive regulation of vasculogenesis (GO:2001214)|protein autoubiquitination (GO:0051865)	Cul2-RING ubiquitin ligase complex (GO:0031462)|Cul5-RING ubiquitin ligase complex (GO:0031466)	ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|pancreas(1)|prostate(1)|skin(2)	20	all_cancers(62;2.27e-10)|all_epithelial(64;2.28e-09)|Lung NSC(181;0.218)|all_lung(186;0.246)		STAD - Stomach adenocarcinoma(171;0.0151)			CGCCGCCTACTGGGCCCTCCG	0.612											OREG0018172	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													57.0	51.0	53.0					7																	95157289		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156779	CCDS5641.1, CCDS5642.1	7q21-q22	2013-01-10	2011-01-25		ENSG00000005981	ENSG00000005981		"""Ankyrin repeat domain containing"""	16009	protein-coding gene	gene with protein product		605761	"""ankyrin repeat and SOCS box-containing 4"""				Standard	NM_145872		Approved	ASB-4	uc011kij.2	Q9Y574	OTTHUMG00000153960	ENST00000325885.5:c.652T>C	7.37:g.95157289T>C	ENSP00000321388:p.Trp218Arg	Somatic	1310	WXS	Illumina GAIIx	Phase_IV	A4D1H6|O14586|Q14D68|Q8TBT2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.W218R	ENST00000325885.5	37	c.652	CCDS5641.1	7	.	.	.	.	.	.	.	.	.	.	T	13.95	2.389163	0.42410	.	.	ENSG00000005981	ENST00000325885;ENST00000428113	T;T	0.50277	0.75;0.75	4.87	4.87	0.63330	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	T	0.55433	0.1920	L	0.29908	0.895	0.80722	D	1	B;D	0.89917	0.069;1.0	B;D	0.97110	0.115;1.0	T	0.50849	-0.8779	10	0.25751	T	0.34	-16.9201	15.1719	0.72881	0.0:0.0:0.0:1.0	.	218;218	Q9Y574;Q14D68	ASB4_HUMAN;.	R	218	ENSP00000321388:W218R;ENSP00000397070:W218R	ENSP00000321388:W218R	W	+	1	0	ASB4	94995225	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.216000	0.72212	2.132000	0.65825	0.379000	0.24179	TGG	ASB4	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000005981		0.612	ASB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB4	HGNC	protein_coding	OTTHUMT00000333225.2	44	0.00	0	T	NM_016116		95157289	95157289	+1	no_errors	ENST00000325885	ensembl	human	known	69_37n	missense	82	12.77	12	SNP	1.000	C
ATN1	1822	genome.wustl.edu	37	12	7050171	7050171	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr12:7050171C>T	ENST00000356654.4	+	8	3580	c.3343C>T	c.(3343-3345)Cgt>Tgt	p.R1115C	U47924.31_ENST00000607421.1_RNA|RNU7-1_ENST00000458811.1_RNA|ATN1_ENST00000396684.2_Missense_Mutation_p.R1115C|C12orf57_ENST00000537087.1_5'Flank|C12orf57_ENST00000544681.1_5'Flank	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	1115					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						CGAAGTTCTTCGTCACCAGCT	0.582																																						dbGAP											0													84.0	73.0	77.0					12																	7050171		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.3343C>T	12.37:g.7050171C>T	ENSP00000349076:p.Arg1115Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.R1115C	ENST00000356654.4	37	c.3343	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	C	23.2	4.387304	0.82902	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325;ENST00000229279	T;T;T	0.56776	0.44;0.44;0.44	4.06	4.06	0.47325	.	0.000000	0.34580	U	0.003857	T	0.69958	0.3169	M	0.64170	1.965	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.74844	-0.3526	10	0.87932	D	0	.	16.8445	0.85977	0.0:1.0:0.0:0.0	.	1115	P54259	ATN1_HUMAN	C	1115;1115;1115;700	ENSP00000349076:R1115C;ENSP00000379915:R1115C;ENSP00000441744:R1115C	ENSP00000229279:R700C	R	+	1	0	ATN1	6920432	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.320000	0.79064	2.284000	0.76573	0.655000	0.94253	CGT	ATN1	-	pfam_Atrophin-like,prints_Atrophin-1	ENSG00000111676		0.582	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	78	0.00	0	C	NM_001940		7050171	7050171	+1	no_errors	ENST00000356654	ensembl	human	known	69_37n	missense	108	10.74	13	SNP	1.000	T
BAZ2B	29994	genome.wustl.edu	37	2	160318673	160318673	+	Intron	DEL	A	A	-	rs74547104		TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr2:160318673delA	ENST00000392783.2	-	4	641				BAZ2B_ENST00000483316.1_5'UTR|BAZ2B_ENST00000392782.1_Intron|BAZ2B_ENST00000343439.5_Intron|BAZ2B_ENST00000355831.2_Intron	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						TGGCAGAATTAAAAAAAAAAG	0.338																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.146-8361T>-	2.37:g.160318673delA		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	RNA	DEL	-	NULL	ENST00000392783.2	37	NULL	CCDS2209.2	2																																																																																			BAZ2B	-	-	ENSG00000123636		0.338	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	18	0.00	0	A			160318673	160318673	-1	no_errors	ENST00000483316	ensembl	human	known	69_37n	rna	9	28.57	4	DEL	0.007	-
BLM	641	genome.wustl.edu	37	15	91304486	91304486	+	Splice_Site	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr15:91304486G>T	ENST00000355112.3	+	7	2000		c.e7+1		BLM_ENST00000560509.1_Splice_Site	NM_000057.2	NP_000048.1	P54132	BLM_HUMAN	Bloom syndrome, RecQ helicase-like						alpha-beta T cell differentiation (GO:0046632)|ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to hydroxyurea (GO:0072711)|cellular response to ionizing radiation (GO:0071479)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA strand renaturation (GO:0000733)|double-strand break repair via homologous recombination (GO:0000724)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of cell division (GO:0051782)|negative regulation of DNA recombination (GO:0045910)|negative regulation of mitotic recombination (GO:0045950)|negative regulation of thymocyte apoptotic process (GO:0070244)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of transcription, DNA-templated (GO:0045893)|protein oligomerization (GO:0051259)|regulation of binding (GO:0051098)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to X-ray (GO:0010165)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|nuclear chromosome (GO:0000228)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|pronucleus (GO:0045120)|replication fork (GO:0005657)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent helicase activity (GO:0008026)|ATPase activity (GO:0016887)|bubble DNA binding (GO:0000405)|four-way junction helicase activity (GO:0009378)|G-quadruplex DNA binding (GO:0051880)|helicase activity (GO:0004386)|p53 binding (GO:0002039)|single-stranded DNA binding (GO:0003697)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(11)|liver(4)|lung(9)|ovary(6)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(78;0.0875)|all_lung(78;0.109)		Lung(145;0.189)			AATTATACTGGTAAGTTTAAA	0.318			"""Mis, N, F"""			"""leukemia, lymphoma, skin squamous cell , other cancers"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Bloom syndrome																													dbGAP	yes	Rec		Bloom Syndrome	15	15q26.1	641	Bloom Syndrome		"""L, E"""	0													26.0	28.0	27.0					15																	91304486		2188	4290	6478	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database		U39817	CCDS10363.1, CCDS73782.1	15q26.1	2014-09-17	2009-03-19		ENSG00000197299	ENSG00000197299			1058	protein-coding gene	gene with protein product		604610	"""Bloom syndrome"""			9388193	Standard	NM_000057		Approved	BS, RECQL3, RECQ2	uc002bpr.3	P54132	OTTHUMG00000149834	ENST00000355112.3:c.1882+1G>T	15.37:g.91304486G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M96	Splice_Site	SNP	-	e6+1	ENST00000355112.3	37	c.1882+1	CCDS10363.1	15	.	.	.	.	.	.	.	.	.	.	G	19.62	3.861864	0.71949	.	.	ENSG00000197299	ENST00000355112;ENST00000536925	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.701	0.77541	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BLM	89105490	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	6.357000	0.73051	2.767000	0.95098	0.591000	0.81541	.	BLM	-	-	ENSG00000197299		0.318	BLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BLM	HGNC	protein_coding	OTTHUMT00000313495.1	18	0.00	0	G		Intron	91304486	91304486	+1	no_errors	ENST00000355112	ensembl	human	known	69_37n	splice_site	31	13.89	5	SNP	1.000	T
RSRP1	57035	genome.wustl.edu	37	1	25572984	25572985	+	Frame_Shift_Del	DEL	TC	TC	-	rs34484514|rs114469235	byFrequency	TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:25572984_25572985delTC	ENST00000243189.7	-	2	746_747	c.470_471delGA	c.(469-471)agafs	p.R157fs	C1orf63_ENST00000431849.2_Frame_Shift_Del_p.R157fs|C1orf63_ENST00000417642.2_Frame_Shift_Del_p.R150fs|RP3-465N24.6_ENST00000607698.1_lincRNA	NM_020317.3	NP_064713.3	Q9BUV0	RSRP1_HUMAN		157	Arg/Ser-rich.									breast(1)|large_intestine(1)|lung(4)|pancreas(1)	7		Colorectal(325;3.46e-05)|Lung NSC(340;0.000245)|all_lung(284;0.000335)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0101)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0936)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;7.9e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;6.43e-07)|STAD - Stomach adenocarcinoma(196;0.000333)|BRCA - Breast invasive adenocarcinoma(304;0.000443)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|GBM - Glioblastoma multiforme(114;0.000932)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.199)		TCGTCCTGGATCTGTCCCTCCA	0.564																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0																														ENST00000243189.7:c.470_471delGA	1.37:g.25572984_25572985delTC	ENSP00000243189:p.Arg157fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K917|Q49AA4|Q5TH71|Q9GZP6	Frame_Shift_Del	DEL	NULL	p.R150fs	ENST00000243189.7	37	c.450_449	CCDS260.1	1																																																																																			C1orf63	-	NULL	ENSG00000117616		0.564	C1orf63-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C1orf63	HGNC	protein_coding	OTTHUMT00000101966.2	65	0.00	0	TC			25572984	25572985	-1	no_errors	ENST00000417642	ensembl	human	known	69_37n	frame_shift_del	75	10.71	9	DEL	0.009:0.020	-
C21orf2	755	genome.wustl.edu	37	21	45750001	45750001	+	3'UTR	SNP	G	G	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr21:45750001G>C	ENST00000339818.4	-	0	1058				C21orf2_ENST00000325223.7_3'UTR|C21orf2_ENST00000397956.3_3'UTR|AP001062.8_ENST00000422357.1_RNA|AP001062.7_ENST00000448927.1_RNA|C21orf2_ENST00000496321.1_5'UTR	NM_001271440.1|NM_004928.2	NP_001258369.1|NP_004919.1	O43822	CU002_HUMAN	chromosome 21 open reading frame 2						cilium morphogenesis (GO:0060271)|cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|smoothened signaling pathway (GO:0007224)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				endometrium(2)	2				Colorectal(79;0.0806)		TGCGGCCATGGCAGCCACCCT	0.706																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			Y11392	CCDS13709.1, CCDS59444.1, CCDS59445.1	21q22.3	2014-03-24			ENSG00000160226	ENSG00000160226			1260	protein-coding gene	gene with protein product	"""nuclear encoded mitochondrial protein"", ""leucine rich repeat containing 76"""	603191				9465297	Standard	NM_004928		Approved	YF5, A2, LRRC76	uc002zeq.2	O43822	OTTHUMG00000086909	ENST00000339818.4:c.*80C>G	21.37:g.45750001G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPS9|O14993|Q8N5X6|Q99837|Q99838	RNA	SNP	-	NULL	ENST00000339818.4	37	NULL	CCDS13709.1	21																																																																																			C21orf2	-	-	ENSG00000160226		0.706	C21orf2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C21orf2	HGNC	protein_coding	OTTHUMT00000195799.1	25	0.00	0	G	NM_004928		45750001	45750001	-1	no_errors	ENST00000470196	ensembl	human	known	69_37n	rna	29	17.14	6	SNP	0.000	C
CAMK2B	816	genome.wustl.edu	37	7	44260459	44260459	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr7:44260459C>T	ENST00000395749.2	-	21	1715	c.1639G>A	c.(1639-1641)Gag>Aag	p.E547K	CAMK2B_ENST00000350811.3_Missense_Mutation_p.E423K|CAMK2B_ENST00000258682.6_Missense_Mutation_p.E398K|CAMK2B_ENST00000489429.1_5'UTR|CAMK2B_ENST00000358707.3_Missense_Mutation_p.E384K|CAMK2B_ENST00000346990.4_Missense_Mutation_p.E330K|CAMK2B_ENST00000353625.4_Missense_Mutation_p.E360K|CAMK2B_ENST00000347193.4_Missense_Mutation_p.E399K|CAMK2B_ENST00000457475.1_Missense_Mutation_p.E399K|CAMK2B_ENST00000502837.2_Missense_Mutation_p.E294K|CAMK2B_ENST00000395747.2_Missense_Mutation_p.E399K|CAMK2B_ENST00000440254.2_Missense_Mutation_p.E423K	NM_001220.4	NP_001211.3	Q13554	KCC2B_HUMAN	calcium/calmodulin-dependent protein kinase II beta	547					activation of meiosis involved in egg activation (GO:0060466)|calcium ion transport (GO:0006816)|cytokine-mediated signaling pathway (GO:0019221)|G1/S transition of mitotic cell cycle (GO:0000082)|inhibitory G-protein coupled receptor phosphorylation (GO:0002030)|interferon-gamma-mediated signaling pathway (GO:0060333)|neuromuscular process controlling balance (GO:0050885)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of neuron projection development (GO:0010976)|positive regulation of synapse maturation (GO:0090129)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of calcium ion transport (GO:0051924)|regulation of dendritic spine development (GO:0060998)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of skeletal muscle adaptation (GO:0014733)|regulation of synapse structural plasticity (GO:0051823)|regulation of synaptic transmission, cholinergic (GO:0032222)|response to cadmium ion (GO:0046686)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|spindle midzone (GO:0051233)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|ovary(2)|skin(1)	18						TTGACGGCCTCGATGAGCTGC	0.662																																						dbGAP											0													75.0	61.0	65.0					7																	44260459		2198	4290	6488	-	-	-	SO:0001583	missense	0			U50358	CCDS5483.1, CCDS5484.1, CCDS5485.1, CCDS5486.1, CCDS5487.1, CCDS5488.1, CCDS5489.1, CCDS43573.1	7p14.3-p14.1	2008-10-30	2008-10-30		ENSG00000058404	ENSG00000058404			1461	protein-coding gene	gene with protein product	"""CaM-kinase II beta chain"", ""calcium/calmodulin-dependent protein kinase type II beta chain"", ""CaM kinase II beta subunit"", ""proline rich calmodulin-dependent protein kinase"""	607707	"""calcium/calmodulin-dependent protein kinase (CaM kinase) II beta"""	CAMKB			Standard	NM_172079		Approved	CAM2, CAMK2	uc003tkq.2	Q13554	OTTHUMG00000023491	ENST00000395749.2:c.1639G>A	7.37:g.44260459C>T	ENSP00000379098:p.Glu547Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2K0|A4D2K1|A4D2K2|A4D2K3|A4D2K4|A4D2K5|A4D2K6|O95437|O95438|O95599|Q9UGH7|Q9UGH8|Q9UGH9|Q9UNX0|Q9UNX7|Q9UP00|Q9Y5N4|Q9Y6F4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ca/CaM-dep_prot_kinase-assoc,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E547K	ENST00000395749.2	37	c.1639	CCDS5483.1	7	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522074	0.85600	.	.	ENSG00000058404	ENST00000350811;ENST00000457475;ENST00000395749;ENST00000502837;ENST00000425809;ENST00000440254;ENST00000358707;ENST00000353625;ENST00000347193;ENST00000346990;ENST00000258682;ENST00000395747	T;T;T;T;T;T;T;T;T;T;T;T	0.48201	0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82;0.82	4.04	4.04	0.47022	Calcium/calmodulin-dependent protein kinase II, association-domain (1);	.	.	.	.	T	0.66056	0.2751	M	0.73372	2.23	0.53005	D	0.99996	P;P;P;D;P;P;P;D;D;D	0.89917	0.786;0.947;0.514;0.967;0.953;0.822;0.614;1.0;0.998;1.0	B;B;B;P;B;P;B;D;P;D	0.87578	0.349;0.252;0.061;0.572;0.32;0.481;0.119;0.998;0.801;0.998	T	0.66280	-0.5963	9	0.35671	T	0.21	.	15.0948	0.72226	0.0:1.0:0.0:0.0	.	398;330;360;384;399;398;399;547;423;547	Q13554-8;Q13554-7;Q13554-4;Q13554-3;Q13554-6;A4D2K5;Q13554-5;Q13554;Q13554-2;A4D2J9	.;.;.;.;.;.;.;KCC2B_HUMAN;.;.	K	423;399;547;294;65;423;384;360;399;330;398;399	ENSP00000326375:E423K;ENSP00000390292:E399K;ENSP00000379098:E547K;ENSP00000422416:E294K;ENSP00000410445:E65K;ENSP00000397937:E423K;ENSP00000351542:E384K;ENSP00000326427:E360K;ENSP00000326544:E399K;ENSP00000326518:E330K;ENSP00000258682:E398K;ENSP00000379096:E399K	ENSP00000258682:E398K	E	-	1	0	CAMK2B	44226984	1.000000	0.71417	0.961000	0.40146	0.621000	0.37620	7.545000	0.82128	2.085000	0.62840	0.313000	0.20887	GAG	CAMK2B	-	pfam_Ca/CaM-dep_prot_kinase-assoc	ENSG00000058404		0.662	CAMK2B-002	KNOWN	basic|CCDS	protein_coding	CAMK2B	HGNC	protein_coding	OTTHUMT00000251138.2	103	0.00	0	C	NM_172084		44260459	44260459	-1	no_errors	ENST00000395749	ensembl	human	known	69_37n	missense	109	25.85	38	SNP	0.999	T
CALD1	800	genome.wustl.edu	37	7	134644791	134644791	+	Missense_Mutation	SNP	C	C	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr7:134644791C>G	ENST00000361675.2	+	12	2357	c.2128C>G	c.(2128-2130)Cgc>Ggc	p.R710G	CALD1_ENST00000361388.2_Missense_Mutation_p.R481G|CALD1_ENST00000393118.2_Missense_Mutation_p.R475G|CALD1_ENST00000417172.1_Missense_Mutation_p.R455G|CALD1_ENST00000495522.1_Missense_Mutation_p.R474G|CALD1_ENST00000466704.1_3'UTR|CALD1_ENST00000424922.1_Missense_Mutation_p.R449G|CALD1_ENST00000361901.2_Missense_Mutation_p.R455G|CALD1_ENST00000543443.1_Missense_Mutation_p.R460G|CALD1_ENST00000422748.1_Missense_Mutation_p.R480G			Q05682	CALD1_HUMAN	caldesmon 1	710					cellular component movement (GO:0006928)|muscle contraction (GO:0006936)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|calmodulin binding (GO:0005516)|tropomyosin binding (GO:0005523)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(15)|lung(10)	43						TGAAGGTGTACGCAACATCAA	0.453																																						dbGAP											0													126.0	108.0	114.0					7																	134644791		2203	4300	6503	-	-	-	SO:0001583	missense	0			M64110	CCDS5834.1, CCDS5835.1, CCDS5836.1, CCDS47716.1, CCDS47717.1, CCDS5836.2	7q33	2007-04-23			ENSG00000122786	ENSG00000122786			1441	protein-coding gene	gene with protein product		114213				1885618	Standard	NM_004342		Approved	CDM, H-CAD, L-CAD	uc003vrz.3	Q05682	OTTHUMG00000155407	ENST00000361675.2:c.2128C>G	7.37:g.134644791C>G	ENSP00000354826:p.Arg710Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X1|Q13978|Q13979|Q14741|Q14742|Q9UD91	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Caldesmon	p.R481G	ENST00000361675.2	37	c.1441	CCDS5835.1	7	.	.	.	.	.	.	.	.	.	.	C	18.08	3.544409	0.65198	.	.	ENSG00000122786	ENST00000417172;ENST00000436461;ENST00000361388;ENST00000422748;ENST00000432646;ENST00000361675;ENST00000361901;ENST00000393118;ENST00000424922;ENST00000495522;ENST00000543443	T;T;T;T;T;T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67;0.67	5.74	5.74	0.90152	.	0.000000	0.53938	D	0.000059	T	0.72285	0.3441	M	0.81682	2.555	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.89917	0.998;0.998;0.999;0.999;0.998;0.998;0.999;0.998;1.0;0.999	D;D;D;D;D;D;D;D;D;D	0.83275	0.965;0.942;0.965;0.965;0.914;0.914;0.971;0.942;0.992;0.996	T	0.71991	-0.4425	10	0.46703	T	0.11	-7.2613	19.9145	0.97053	0.0:1.0:0.0:0.0	.	404;460;480;474;449;475;455;481;710;455	B4DPW5;F5H1Z9;A8K0X1;E7EX44;Q05682-5;Q05682-3;Q05682-4;Q05682-2;Q05682;Q9NYG1	.;.;.;.;.;.;.;.;CALD1_HUMAN;.	G	455;455;481;480;88;710;455;475;449;474;460	ENSP00000398826:R455G;ENSP00000411476:R455G;ENSP00000355000:R481G;ENSP00000395710:R480G;ENSP00000354826:R710G;ENSP00000354513:R455G;ENSP00000376826:R475G;ENSP00000393621:R449G;ENSP00000419673:R474G;ENSP00000445641:R460G	ENSP00000355000:R481G	R	+	1	0	CALD1	134295331	1.000000	0.71417	0.906000	0.35671	0.048000	0.14542	7.124000	0.77185	2.709000	0.92574	0.655000	0.94253	CGC	CALD1	-	pfam_Caldesmon_LSP,prints_Caldesmon	ENSG00000122786		0.453	CALD1-005	NOVEL	basic|appris_principal|CCDS	protein_coding	CALD1	HGNC	protein_coding	OTTHUMT00000339939.1	53	0.00	0	C	NM_033138		134644791	134644791	+1	no_errors	ENST00000361388	ensembl	human	known	69_37n	missense	81	11.96	11	SNP	1.000	G
CEP120	153241	genome.wustl.edu	37	5	122748104	122748104	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr5:122748104C>T	ENST00000306467.5	-	4	756	c.452G>A	c.(451-453)cGa>cAa	p.R151Q	CEP120_ENST00000306481.6_Missense_Mutation_p.R125Q|CEP120_ENST00000328236.5_Missense_Mutation_p.R151Q|CEP120_ENST00000395431.2_Missense_Mutation_p.R151Q			Q8N960	CE120_HUMAN	centrosomal protein 120kDa	151					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)|regulation of protein localization (GO:0032880)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	29						TTTTCCATCTCGAGGGGGAGC	0.413																																						dbGAP											0													146.0	140.0	142.0					5																	122748104		1832	4079	5911	-	-	-	SO:0001583	missense	0			AK095646	CCDS4134.2, CCDS54890.1	5q23.2	2014-02-20	2008-08-14	2008-08-14	ENSG00000168944	ENSG00000168944			26690	protein-coding gene	gene with protein product		613446	"""coiled-coil domain containing 100"""	CCDC100		17920017	Standard	NM_153223		Approved	FLJ36090	uc003ktk.3	Q8N960	OTTHUMG00000128922	ENST00000306467.5:c.452G>A	5.37:g.122748104C>T	ENSP00000303058:p.Arg151Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AI52|Q6AW89|Q8IWB5|Q8N9Y0|Q8NDE8	Missense_Mutation	SNP	pfam_DUF3668,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.R151Q	ENST00000306467.5	37	c.452	CCDS4134.2	5	.	.	.	.	.	.	.	.	.	.	C	34	5.302176	0.95601	.	.	ENSG00000168944	ENST00000306467;ENST00000328236;ENST00000306481;ENST00000508442;ENST00000395431	T;T;T;T	0.52057	2.01;2.01;2.01;0.68	5.69	5.69	0.88448	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.69762	0.3147	M	0.69823	2.125	0.53688	D	0.999979	D	0.89917	1.0	D	0.78314	0.991	T	0.70745	-0.4788	10	0.62326	D	0.03	-12.3449	19.4223	0.94726	0.0:1.0:0.0:0.0	.	151	Q8N960	CE120_HUMAN	Q	151;151;125;125;151	ENSP00000303058:R151Q;ENSP00000327504:R151Q;ENSP00000307419:R125Q;ENSP00000421620:R125Q	ENSP00000303058:R151Q	R	-	2	0	CEP120	122776003	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.229000	0.78088	2.686000	0.91538	0.655000	0.94253	CGA	CEP120	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000168944		0.413	CEP120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP120	HGNC	protein_coding	OTTHUMT00000250899.2	51	0.00	0	C	NM_153223		122748104	122748104	-1	no_errors	ENST00000306467	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	1.000	T
CHKA	1119	genome.wustl.edu	37	11	67864505	67864505	+	Missense_Mutation	SNP	T	T	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr11:67864505T>C	ENST00000265689.4	-	2	469	c.443A>G	c.(442-444)tAt>tGt	p.Y148C	CHKA_ENST00000356135.5_Missense_Mutation_p.Y148C	NM_001277.2	NP_001268.2	P35790	CHKA_HUMAN	choline kinase alpha	148					CDP-choline pathway (GO:0006657)|choline metabolic process (GO:0019695)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline binding (GO:0033265)|choline kinase activity (GO:0004103)|cholinesterase activity (GO:0004104)|drug binding (GO:0008144)|ethanolamine kinase activity (GO:0004305)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)	13					Choline(DB00122)	AATCGCTCCATACAGCCGCAG	0.517																																						dbGAP											0													81.0	73.0	76.0					11																	67864505		2200	4294	6494	-	-	-	SO:0001583	missense	0			D10704	CCDS8178.1, CCDS8179.1	11q13.1	2008-02-05	2004-04-19	2004-04-21	ENSG00000110721	ENSG00000110721	2.7.1.32		1937	protein-coding gene	gene with protein product		118491	"""choline kinase"""	CHK		1618328, 15003397	Standard	NM_001277		Approved	CKI	uc001onj.3	P35790	OTTHUMG00000167424	ENST00000265689.4:c.443A>G	11.37:g.67864505T>C	ENSP00000265689:p.Tyr148Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NE29	Missense_Mutation	SNP	pfam_Choline/ethanolamine_kinase,pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	p.Y148C	ENST00000265689.4	37	c.443	CCDS8178.1	11	.	.	.	.	.	.	.	.	.	.	T	15.62	2.888580	0.52014	.	.	ENSG00000110721	ENST00000265689;ENST00000356135;ENST00000531341	T;T;T	0.61040	0.14;0.14;0.14	5.74	5.74	0.90152	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);	0.000000	0.85682	D	0.000000	D	0.82797	0.5115	H	0.94183	3.505	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	D	0.87824	0.2640	10	0.87932	D	0	-15.4527	16.0499	0.80749	0.0:0.0:0.0:1.0	.	148;148	P35790-2;P35790	.;CHKA_HUMAN	C	148;148;26	ENSP00000265689:Y148C;ENSP00000348454:Y148C;ENSP00000435032:Y26C	ENSP00000265689:Y148C	Y	-	2	0	CHKA	67621081	1.000000	0.71417	0.863000	0.33907	0.133000	0.20885	7.159000	0.77483	2.193000	0.70182	0.533000	0.62120	TAT	CHKA	-	pfam_Choline/ethanolamine_kinase,superfamily_Kinase-like_dom	ENSG00000110721		0.517	CHKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHKA	HGNC	protein_coding	OTTHUMT00000394570.1	30	0.00	0	T	NM_001277		67864505	67864505	-1	no_errors	ENST00000265689	ensembl	human	known	69_37n	missense	17	37.04	10	SNP	0.999	C
CHTF18	63922	genome.wustl.edu	37	16	845727	845727	+	Missense_Mutation	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr16:845727C>A	ENST00000262315.9	+	17	2281	c.2218C>A	c.(2218-2220)Ctg>Atg	p.L740M	CHTF18_ENST00000317063.6_Missense_Mutation_p.L949M|CHTF18_ENST00000455171.2_Missense_Mutation_p.L768M	NM_022092.2	NP_071375.1	Q8WVB6	CTF18_HUMAN	CTF18, chromosome transmission fidelity factor 18 homolog (S. cerevisiae)	740					cell cycle (GO:0007049)|DNA replication (GO:0006260)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			endometrium(1)|kidney(3)|liver(2)|lung(4)|prostate(1)	11		Hepatocellular(780;0.00335)				GATCCAGACGCTGGTGTCCGG	0.692																																						dbGAP											0													15.0	20.0	19.0					16																	845727		2075	4180	6255	-	-	-	SO:0001583	missense	0			BC018184	CCDS45371.1	16p13.3	2010-04-21	2003-12-09		ENSG00000127586	ENSG00000127586		"""ATPases / AAA-type"""	18435	protein-coding gene	gene with protein product		613201	"""chromosome 16 open reading frame 41"""	C16orf41		12171929	Standard	NM_022092		Approved	CHL12, C321D2.4, Ctf18	uc002cke.4	Q8WVB6	OTTHUMG00000047838	ENST00000262315.9:c.2218C>A	16.37:g.845727C>A	ENSP00000262315:p.Leu740Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBA2|D3DU68|Q7Z6Y4|Q7Z6Y6|Q9BR83|Q9BRG5|Q9H7K3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.L949M	ENST00000262315.9	37	c.2845	CCDS45371.1	16	.	.	.	.	.	.	.	.	.	.	c	9.494	1.101465	0.20632	.	.	ENSG00000127586	ENST00000317063;ENST00000455171;ENST00000262315	T;T;T	0.11930	2.73;2.81;2.81	4.41	2.29	0.28610	.	0.048809	0.85682	D	0.000000	T	0.06962	0.0177	N	0.19112	0.55	0.31703	N	0.640497	P;B	0.38729	0.644;0.33	B;B	0.40534	0.332;0.135	T	0.13072	-1.0523	10	0.15952	T	0.53	-18.4987	2.3406	0.04259	0.307:0.4333:0.1585:0.1012	.	768;740	Q8WVB6-2;Q8WVB6	.;CTF18_HUMAN	M	949;768;740	ENSP00000313029:L949M;ENSP00000406252:L768M;ENSP00000262315:L740M	ENSP00000262315:L740M	L	+	1	2	CHTF18	785728	0.115000	0.22152	0.564000	0.28396	0.909000	0.53808	0.679000	0.25291	0.866000	0.35629	0.450000	0.29827	CTG	CHTF18	-	NULL	ENSG00000127586		0.692	CHTF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHTF18	HGNC	protein_coding	OTTHUMT00000109061.3	46	0.00	0	C	NM_022092		845727	845727	+1	no_errors	ENST00000317063	ensembl	human	known	69_37n	missense	52	28.77	21	SNP	0.692	A
CLUL1	27098	genome.wustl.edu	37	18	596992	596992	+	5'Flank	SNP	T	T	G	rs73942572	byFrequency	TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr18:596992T>G	ENST00000400606.2	+	0	0				CLUL1_ENST00000581619.1_5'Flank|CLUL1_ENST00000540035.1_5'Flank	NM_014410.4	NP_055225.1	Q15846	CLUL1_HUMAN	clusterin-like 1 (retinal)						cell death (GO:0008219)	extracellular region (GO:0005576)				NS(1)|breast(1)|endometrium(5)|large_intestine(5)|liver(2)|lung(7)|ovary(2)|skin(1)	24						ccgcccacccTGCGTCACCTG	0.756													G|||	1417	0.282947	0.4455	0.1513	5008	,	,		7143	0.3194		0.1143	False		,,,				2504	0.2924					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			D63813	CCDS42405.1, CCDS74187.1	18p11.32	2008-07-28				ENSG00000079101			2096	protein-coding gene	gene with protein product						10675623, 14507903	Standard	NM_199167		Approved		uc002kkq.3	Q15846			18.37:g.596992T>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FDN7	RNA	SNP	-	NULL	ENST00000400606.2	37	NULL	CCDS42405.1	18																																																																																			CLUL1	-	-	ENSG00000079101		0.756	CLUL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CLUL1	HGNC	protein_coding	OTTHUMT00000441183.1	15	0.00	0	T			596992	596992	+1	no_errors	ENST00000579912	ensembl	human	known	69_37n	rna	10	28.57	4	SNP	0.000	G
COA1	55744	genome.wustl.edu	37	7	43687050	43687050	+	Intron	SNP	A	A	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr7:43687050A>C	ENST00000395879.1	-	2	1797				COA1_ENST00000395880.3_Intron|COA1_ENST00000310564.6_Intron|COA1_ENST00000223336.6_Intron			Q9GZY4	COA1_HUMAN	cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)						mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)	cytoplasm (GO:0005737)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrion (GO:0005739)											AATCTAAACAAAGCATCTCAA	0.463																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK001665	CCDS5471.1	7p13	2012-12-05	2012-10-15	2012-06-25	ENSG00000106603	ENSG00000106603		"""Mitochondrial respiratory chain complex assembly factors"""	21868	protein-coding gene	gene with protein product		614769	"""chromosome 7 open reading frame 44"""	C7orf44		22356826	Standard	NM_018224		Approved	FLJ10803, MITRAC15	uc003tin.2	Q9GZY4	OTTHUMG00000128949	ENST00000395879.1:c.115+83T>G	7.37:g.43687050A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU8|A8KAH8|Q9HAB7|Q9NVD2	RNA	SNP	-	NULL	ENST00000395879.1	37	NULL	CCDS5471.1	7																																																																																			COA1	-	-	ENSG00000106603		0.463	COA1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COA1	HGNC	protein_coding	OTTHUMT00000313664.1	42	0.00	0	A	NM_018224		43687050	43687050	-1	no_errors	ENST00000459713	ensembl	human	putative	69_37n	rna	60	14.29	10	SNP	0.577	C
COL7A1	1294	genome.wustl.edu	37	3	48617226	48617226	+	Silent	SNP	T	T	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr3:48617226T>G	ENST00000328333.8	-	57	5253	c.5146A>C	c.(5146-5148)Aga>Cga	p.R1716R	COL7A1_ENST00000454817.1_Silent_p.R1716R|MIR711_ENST00000390201.1_RNA	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1	1716	Triple-helical region.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		ACCTTCTCTCTGGCTCCAGGT	0.572																																						dbGAP											0													71.0	76.0	74.0					3																	48617226		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.5146A>C	3.37:g.48617226T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14054|Q16507	Silent	SNP	pfam_Collagen,pfam_Fibronectin_type3,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Fibronectin_type3,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m,prints_Prot_inh_Kunz-m	p.R1716	ENST00000328333.8	37	c.5146	CCDS2773.1	3																																																																																			COL7A1	-	NULL	ENSG00000114270		0.572	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	32	0.00	0	T	NM_000094		48617226	48617226	-1	no_errors	ENST00000328333	ensembl	human	known	69_37n	silent	39	20.41	10	SNP	0.036	G
CROCC	9696	genome.wustl.edu	37	1	17250935	17250935	+	Silent	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:17250935C>T	ENST00000375541.5	+	3	381	c.312C>T	c.(310-312)cgC>cgT	p.R104R	CROCC_ENST00000467938.1_Intron	NM_014675.3	NP_055490.3			ciliary rootlet coiled-coil, rootletin											breast(3)|central_nervous_system(2)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(1)|lung(20)|ovary(3)|prostate(9)|skin(3)|urinary_tract(1)	62		Colorectal(325;3.46e-05)|Breast(348;0.000162)|Lung NSC(340;0.000174)|all_lung(284;0.000234)|Renal(390;0.000518)|Ovarian(437;0.00669)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.63e-06)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(64;0.000163)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.181)		GTGCCGAGCGCGATGAGCTCG	0.657																																						dbGAP											0													49.0	36.0	40.0					1																	17250935		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB007914	CCDS30616.1	1p36.13	2010-06-04	2009-03-04	2009-03-04	ENSG00000058453	ENSG00000058453			21299	protein-coding gene	gene with protein product	"""rootletin, ciliary rootlet protein"""	615776				12427867, 17971504	Standard	XM_006711056		Approved	rootletin, ROLT	uc001azt.2	Q5TZA2	OTTHUMG00000002200	ENST00000375541.5:c.312C>T	1.37:g.17250935C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.R104	ENST00000375541.5	37	c.312	CCDS30616.1	1																																																																																			CROCC	-	NULL	ENSG00000058453		0.657	CROCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROCC	HGNC	protein_coding	OTTHUMT00000006249.2	58	0.00	0	C	NM_014675		17250935	17250935	+1	no_errors	ENST00000375541	ensembl	human	known	69_37n	silent	68	21.84	19	SNP	0.121	T
CUL5	8065	genome.wustl.edu	37	11	107965648	107965648	+	Silent	SNP	A	A	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr11:107965648A>G	ENST00000393094.2	+	15	2293	c.1677A>G	c.(1675-1677)gaA>gaG	p.E559E		NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	559					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		CGGAAGTAGAAGAATTCTACA	0.353																																						dbGAP											0													62.0	66.0	65.0					11																	107965648		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.1677A>G	11.37:g.107965648A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K960|O14766|Q9BZC6	Silent	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.E559	ENST00000393094.2	37	c.1677	CCDS31668.1	11																																																																																			CUL5	-	pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_homology,pfscan_Cullin_homology	ENSG00000166266		0.353	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL5	HGNC	protein_coding	OTTHUMT00000389429.1	60	0.00	0	A			107965648	107965648	+1	no_errors	ENST00000393094	ensembl	human	known	69_37n	silent	55	19.12	13	SNP	1.000	G
DENND1A	57706	genome.wustl.edu	37	9	126392666	126392666	+	Silent	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr9:126392666C>T	ENST00000373624.2	-	10	909	c.708G>A	c.(706-708)ctG>ctA	p.L236L	DENND1A_ENST00000394215.2_Silent_p.L206L|DENND1A_ENST00000373620.3_Silent_p.L236L|DENND1A_ENST00000542603.1_Silent_p.L20L|DENND1A_ENST00000473039.1_5'UTR|DENND1A_ENST00000394219.3_Silent_p.L204L|DENND1A_ENST00000373618.1_Silent_p.L204L	NM_020946.1	NP_065997.1	Q8TEH3	DEN1A_HUMAN	DENN/MADD domain containing 1A	236	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|protein transport (GO:0015031)|regulation of Rab protein signal transduction (GO:0032483)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|liver(2)|lung(18)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43						AGCAGTAGTCCAGCAGATGCG	0.587																																						dbGAP											0													28.0	29.0	29.0					9																	126392666		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046828	CCDS35133.1, CCDS35134.1	9q34.11	2012-10-03	2005-08-17	2005-08-17	ENSG00000119522	ENSG00000119522		"""DENN/MADD domain containing"""	29324	protein-coding gene	gene with protein product		613633	"""KIAA1608"""	KIAA1608		10997877	Standard	XM_005252109		Approved	FLJ21129, FAM31A	uc004bnz.1	Q8TEH3	OTTHUMG00000020643	ENST00000373624.2:c.708G>A	9.37:g.126392666C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZA3|B1AM80|B7Z3C8|B7Z669|D3PFD3|Q05C88|Q5VWF0|Q6PJZ5|Q8IVD6|Q9H796	Silent	SNP	pfam_DENN_dom,pfam_dDENN_dom,pfam_uDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.L204	ENST00000373624.2	37	c.612	CCDS35133.1	9																																																																																			DENND1A	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom	ENSG00000119522		0.587	DENND1A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DENND1A	HGNC	protein_coding	OTTHUMT00000053997.1	16	0.00	0	C	NM_024820		126392666	126392666	-1	no_errors	ENST00000394219	ensembl	human	known	69_37n	silent	15	25.00	5	SNP	1.000	T
DLG5	9231	genome.wustl.edu	37	10	79552005	79552005	+	3'UTR	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr10:79552005G>T	ENST00000372391.2	-	0	5958				RP13-39P12.3_ENST00000434097.2_RNA|DLG5_ENST00000459739.1_5'Flank|RP13-39P12.3_ENST00000601701.1_RNA|DLG5_ENST00000372388.2_3'UTR	NM_004747.3	NP_004738.3	Q8TDM6	DLG5_HUMAN	discs, large homolog 5 (Drosophila)						apical protein localization (GO:0045176)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|intracellular signal transduction (GO:0035556)|metanephric collecting duct development (GO:0072205)|midbrain development (GO:0030901)|negative regulation of cell proliferation (GO:0008285)|polarized epithelial cell differentiation (GO:0030859)|protein complex assembly (GO:0006461)|protein localization to adherens junction (GO:0071896)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|zonula adherens assembly (GO:0045186)	cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cytoskeletal protein binding (GO:0008092)|receptor signaling complex scaffold activity (GO:0030159)			breast(9)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(17)|ovary(5)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	60	all_cancers(46;0.0316)|all_epithelial(25;0.00147)|Breast(12;0.0015)|Prostate(51;0.0146)		Epithelial(14;0.00105)|OV - Ovarian serous cystadenocarcinoma(4;0.00151)|all cancers(16;0.00446)			CGGGCAGAGTGTGTGGGCCTG	0.552																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U61843	CCDS7353.2	10q23	2008-07-09	2001-11-28		ENSG00000151208	ENSG00000151208			2904	protein-coding gene	gene with protein product		604090	"""discs, large (Drosophila) homolog 5"""			9738934	Standard	XM_005270276		Approved	P-dlg, KIAA0583	uc001jzk.3	Q8TDM6	OTTHUMG00000018548	ENST00000372391.2:c.*193C>A	10.37:g.79552005G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8Y3|Q149N1|Q5T1H7|Q5T1H8|Q6DKG3|Q86WC0|Q8TDM7|Q9UE73|Q9Y4E3	RNA	SNP	-	NULL	ENST00000372391.2	37	NULL	CCDS7353.2	10																																																																																			DLG5	-	-	ENSG00000151208		0.552	DLG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLG5	HGNC	protein_coding	OTTHUMT00000048900.2	29	0.00	0	G			79552005	79552005	-1	no_errors	ENST00000463362	ensembl	human	known	69_37n	rna	15	40.00	10	SNP	0.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103006345	103006346	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr11:103006345_103006346delAT	ENST00000375735.2	+	16	2471_2472	c.2327_2328delAT	c.(2326-2328)aatfs	p.N776fs	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Frame_Shift_Del_p.N776fs	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	776	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CCAGAAATAAATATAGACTTAA	0.302																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.2327_2328delAT	11.37:g.103006347_103006348delAT	ENSP00000364887:p.Asn776fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Frame_Shift_Del	DEL	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.I777fs	ENST00000375735.2	37	c.2327_2328	CCDS53701.1	11																																																																																			DYNC2H1	-	NULL	ENSG00000187240		0.302	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	41	0.00	0	AT	XM_370652		103006345	103006346	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	frame_shift_del	40	24.53	13	DEL	0.998:0.918	-
EFNA4	1945	genome.wustl.edu	37	1	155039911	155039911	+	Missense_Mutation	SNP	A	A	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:155039911A>T	ENST00000368409.3	+	3	557	c.464A>T	c.(463-465)gAg>gTg	p.E155V	EFNA3_ENST00000505139.1_Intron|EFNA4_ENST00000359751.4_Missense_Mutation_p.E155V|EFNA4_ENST00000427683.2_Missense_Mutation_p.E155V|EFNA3_ENST00000556931.1_Intron	NM_005227.2	NP_005218.1	P52798	EFNA4_HUMAN	ephrin-A4	155	Ephrin RBD. {ECO:0000255|PROSITE- ProRule:PRU00884}.				axon guidance (GO:0007411)|bone remodeling (GO:0046849)|cell-cell signaling (GO:0007267)|ephrin receptor signaling pathway (GO:0048013)|osteoclast differentiation (GO:0030316)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ephrin receptor binding (GO:0046875)|transmembrane-ephrin receptor activity (GO:0005005)			breast(1)|endometrium(1)|large_intestine(1)|ovary(1)	4	all_epithelial(22;1.43e-30)|all_lung(78;6.64e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.000434)			TGCTGCAAGGAGAGGAGTAAG	0.567																																						dbGAP											0													101.0	98.0	99.0					1																	155039911		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006352	CCDS1089.1, CCDS41407.1, CCDS44237.1	1q21-q22	2011-03-09			ENSG00000243364	ENSG00000243364		"""Ephrins"""	3224	protein-coding gene	gene with protein product		601380		EPLG4		8660976	Standard	NM_182690		Approved	LERK4		P52798	OTTHUMG00000035309	ENST00000368409.3:c.464A>T	1.37:g.155039911A>T	ENSP00000357394:p.Glu155Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JHJ8|G3XAK2|O95457|Q5SR71|Q6FI57	Missense_Mutation	SNP	pfam_Ephrin,superfamily_Cupredoxin,prints_Ephrin	p.E155V	ENST00000368409.3	37	c.464	CCDS1089.1	1	.	.	.	.	.	.	.	.	.	.	A	18.09	3.546393	0.65198	.	.	ENSG00000243364	ENST00000368409;ENST00000359751;ENST00000427683	T;T;T	0.45668	0.89;0.89;0.89	4.89	4.89	0.63831	Cupredoxin (1);	0.000000	0.52532	D	0.000078	T	0.44685	0.1305	L	0.56769	1.78	0.80722	D	1	P;D;D	0.61697	0.916;0.972;0.99	P;P;P	0.61874	0.553;0.895;0.844	T	0.41610	-0.9499	10	0.42905	T	0.14	-19.4756	10.8095	0.46538	1.0:0.0:0.0:0.0	.	155;155;155	P52798-2;P52798;G3XAK2	.;EFNA4_HUMAN;.	V	155	ENSP00000357394:E155V;ENSP00000352789:E155V;ENSP00000414378:E155V	ENSP00000352789:E155V	E	+	2	0	EFNA4	153306535	0.928000	0.31464	1.000000	0.80357	0.987000	0.75469	1.093000	0.30939	2.057000	0.61298	0.454000	0.30748	GAG	EFNA4	-	pfam_Ephrin	ENSG00000243364		0.567	EFNA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	EFNA4	HGNC	protein_coding	OTTHUMT00000085421.2	101	0.00	0	A	NM_005227		155039911	155039911	+1	no_errors	ENST00000427683	ensembl	human	known	69_37n	missense	90	13.46	14	SNP	1.000	T
DENND6A	201627	genome.wustl.edu	37	3	57627445	57627445	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr3:57627445G>A	ENST00000311128.5	-	12	1137	c.1067C>T	c.(1066-1068)cCt>cTt	p.P356L	RP11-755B10.2_ENST00000470427.1_RNA	NM_152678.2	NP_689891.1	Q8IWF6	DEN6A_HUMAN	DENN/MADD domain containing 6A	356					positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of Rab GTPase activity (GO:0032851)	cytoplasm (GO:0005737)|recycling endosome (GO:0055037)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										AGCAAAAAAAGGGTTGGTTAC	0.348																																						dbGAP											0													125.0	124.0	124.0					3																	57627445		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074156	CCDS33773.1	3p14.3	2013-10-11	2012-10-03	2012-10-03	ENSG00000174839	ENSG00000174839		"""DENN/MADD domain containing"""	26635	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member A"""	FAM116A		21330364	Standard	NM_152678		Approved	FLJ34969, AFI1A	uc003dja.3	Q8IWF6	OTTHUMG00000158639	ENST00000311128.5:c.1067C>T	3.37:g.57627445G>A	ENSP00000311401:p.Pro356Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5T4|Q8N235|Q8TEG8	Missense_Mutation	SNP	pfam_Afi1_N,pfam_Secretory_pathway_prot_Avl9,pfam_DENN_dom	p.P356L	ENST00000311128.5	37	c.1067	CCDS33773.1	3	.	.	.	.	.	.	.	.	.	.	G	27.1	4.800312	0.90538	.	.	ENSG00000174839	ENST00000311128	.	.	.	5.35	5.35	0.76521	.	0.048856	0.85682	D	0.000000	T	0.80014	0.4546	M	0.74467	2.265	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.80067	-0.1537	9	0.51188	T	0.08	-21.2955	19.4233	0.94730	0.0:0.0:1.0:0.0	.	356	Q8IWF6	F116A_HUMAN	L	356	.	ENSP00000311401:P356L	P	-	2	0	FAM116A	57602485	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.245000	0.95431	2.665000	0.90641	0.650000	0.86243	CCT	FAM116A	-	pfam_Afi1_N,pfam_DENN_dom	ENSG00000174839		0.348	DENND6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM116A	HGNC	protein_coding	OTTHUMT00000351594.1	49	0.00	0	G	NM_152678		57627445	57627445	-1	no_errors	ENST00000311128	ensembl	human	known	69_37n	missense	60	10.45	7	SNP	1.000	A
ERICH6	131831	genome.wustl.edu	37	3	150421606	150421606	+	Missense_Mutation	SNP	T	T	A	rs140978408		TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr3:150421606T>A	ENST00000295910.6	-	1	132	c.80A>T	c.(79-81)gAg>gTg	p.E27V	RP11-103G8.2_ENST00000475393.1_RNA|FAM194A_ENST00000491361.1_5'UTR|RP11-103G8.2_ENST00000471093.1_RNA	NM_152394.3	NP_689607.2														NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	38						ctcctcctcctcctctaactc	0.632																																						dbGAP											0													58.0	56.0	57.0					3																	150421606		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000295910.6:c.80A>T	3.37:g.150421606T>A	ENSP00000295910:p.Glu27Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E27V	ENST00000295910.6	37	c.80	CCDS3151.2	3	.	.	.	.	.	.	.	.	.	.	T	8.120	0.780671	0.16120	.	.	ENSG00000163645	ENST00000295910;ENST00000474463;ENST00000498386	T;T;T	0.58652	2.55;0.32;2.16	3.0	-4.76	0.03229	.	1.295330	0.05951	N	0.638762	T	0.32010	0.0815	N	0.14661	0.345	0.20873	N	0.999839	B	0.09022	0.002	B	0.08055	0.003	T	0.11470	-1.0586	10	0.48119	T	0.1	5.6736	0.9544	0.01382	0.293:0.1054:0.3302:0.2715	.	27	Q7L0X2	F194A_HUMAN	V	27	ENSP00000295910:E27V;ENSP00000419304:E27V;ENSP00000417780:E27V	ENSP00000295910:E27V	E	-	2	0	FAM194A	151904296	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.479000	0.06567	-1.024000	0.03338	-2.447000	0.00209	GAG	FAM194A	-	NULL	ENSG00000163645		0.632	FAM194A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194A	HGNC	protein_coding	OTTHUMT00000257666.1	33	0.00	0	T			150421606	150421606	-1	no_errors	ENST00000295910	ensembl	human	known	69_37n	missense	37	24.00	12	SNP	0.000	A
SPATA31D1	389763	genome.wustl.edu	37	9	84609281	84609281	+	Missense_Mutation	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr9:84609281C>A	ENST00000344803.2	+	4	3943	c.3896C>A	c.(3895-3897)cCc>cAc	p.P1299H		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1299					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCTGTGAGACCCAAAGGAGGA	0.542																																						dbGAP											0													37.0	37.0	37.0					9																	84609281		1939	4141	6080	-	-	-	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3896C>A	9.37:g.84609281C>A	ENSP00000341988:p.Pro1299His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P1299H	ENST00000344803.2	37	c.3896	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	12.19	1.864294	0.32977	.	.	ENSG00000214929	ENST00000344803	T	0.06849	3.25	3.26	-0.0877	0.13676	.	1.021380	0.07870	U	0.967738	T	0.04952	0.0133	N	0.19112	0.55	0.09310	N	1	P	0.37955	0.612	B	0.30716	0.119	T	0.38607	-0.9653	10	0.87932	D	0	0.1933	6.1084	0.20087	0.2041:0.3966:0.3993:0.0	.	1299	Q6ZQQ2	F75D1_HUMAN	H	1299	ENSP00000341988:P1299H	ENSP00000341988:P1299H	P	+	2	0	FAM75D1	83799101	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.866000	0.04245	0.000000	0.14550	0.655000	0.94253	CCC	FAM75D1	-	NULL	ENSG00000214929		0.542	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75D1	HGNC	protein_coding	OTTHUMT00000402325.1	41	0.00	0	C	NM_001001670		84609281	84609281	+1	no_errors	ENST00000344803	ensembl	human	known	69_37n	missense	55	21.43	15	SNP	0.000	A
FLYWCH1	84256	genome.wustl.edu	37	16	2990083	2990083	+	Missense_Mutation	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr16:2990083C>A	ENST00000253928.9	+	9	2506	c.2101C>A	c.(2101-2103)Cag>Aag	p.Q701K	LA16c-321D4.2_ENST00000573260.1_RNA|FLYWCH1_ENST00000399667.2_Missense_Mutation_p.Q750K|FLYWCH1_ENST00000570752.1_3'UTR|FLYWCH1_ENST00000416288.2_Missense_Mutation_p.Q700K			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	701						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						tgaaagccagcagatttatgg	0.333																																						dbGAP											0													83.0	76.0	78.0					16																	2990083		1855	4101	5956	-	-	-	SO:0001583	missense	0			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.2101C>A	16.37:g.2990083C>A	ENSP00000253928:p.Gln701Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Missense_Mutation	SNP	pfam_Znf_FLYWCH	p.Q750K	ENST00000253928.9	37	c.2248		16	.	.	.	.	.	.	.	.	.	.	C	2.477	-0.320479	0.05386	.	.	ENSG00000059122	ENST00000399667;ENST00000253928;ENST00000416288;ENST00000344592	.	.	.	0.785	0.785	0.18584	.	.	.	.	.	T	0.17152	0.0412	N	0.19112	0.55	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.30736	-0.9968	8	0.07482	T	0.82	.	4.8622	0.13590	0.0:1.0:0.0:0.0	.	750;701;700	Q4VC44-3;Q4VC44;Q4VC44-2	.;FWCH1_HUMAN;.	K	750;701;700;313	.	ENSP00000253928:Q701K	Q	+	1	0	FLYWCH1	2930084	0.003000	0.15002	0.130000	0.21974	0.016000	0.09150	-0.400000	0.07241	0.711000	0.32018	0.407000	0.27541	CAG	FLYWCH1	-	NULL	ENSG00000059122		0.333	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	FLYWCH1	HGNC	protein_coding	OTTHUMT00000436479.1	59	0.00	0	C	NM_032296		2990083	2990083	+1	no_errors	ENST00000399667	ensembl	human	known	69_37n	missense	71	11.25	9	SNP	0.146	A
FMN2	56776	genome.wustl.edu	37	1	240371079	240371079	+	Silent	SNP	T	T	G	rs557827551		TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:240371079T>G	ENST00000319653.9	+	5	3197	c.2967T>G	c.(2965-2967)ccT>ccG	p.P989P		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	989	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TACCCCCTCCTCCCCCACTTC	0.711																																						dbGAP											0													12.0	14.0	13.0					1																	240371079		2173	4256	6429	-	-	-	SO:0001819	synonymous_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.2967T>G	1.37:g.240371079T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.P989	ENST00000319653.9	37	c.2967	CCDS31069.2	1																																																																																			FMN2	-	pfam_Formin_homology_1,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.711	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	8	0.00	0	T	XM_371352		240371079	240371079	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	silent	10	44.44	8	SNP	0.357	G
FREM3	166752	genome.wustl.edu	37	4	144545279	144545279	+	Missense_Mutation	SNP	T	T	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr4:144545279T>G	ENST00000329798.5	-	4	5634	c.5635A>C	c.(5635-5637)Att>Ctt	p.I1879L		NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	1879	Calx-beta 2.				cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						GGGTCTACAATTTCAACCGTT	0.433																																						dbGAP											0													162.0	137.0	144.0					4																	144545279		692	1591	2283	-	-	-	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.5635A>C	4.37:g.144545279T>G	ENSP00000332886:p.Ile1879Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.I1879L	ENST00000329798.5	37	c.5635	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	T	22.2	4.263904	0.80358	.	.	ENSG00000183090	ENST00000329798	T	0.52295	0.67	4.27	4.27	0.50696	.	0.000000	0.64402	D	0.000001	T	0.72550	0.3474	M	0.93462	3.42	0.51482	D	0.99992	.	.	.	.	.	.	T	0.79227	-0.1890	8	0.52906	T	0.07	-6.048	12.4967	0.55931	0.0:0.0:0.0:1.0	.	.	.	.	L	1879	ENSP00000332886:I1879L	ENSP00000332886:I1879L	I	-	1	0	FREM3	144764729	1.000000	0.71417	0.997000	0.53966	0.878000	0.50629	7.195000	0.77798	1.781000	0.52344	0.528000	0.53228	ATT	FREM3	-	pfam_Calx_beta,smart_Calx_beta	ENSG00000183090		0.433	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	69	0.00	0	T	XM_094074		144545279	144545279	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	missense	87	13.00	13	SNP	1.000	G
GHITM	27069	genome.wustl.edu	37	10	85902445	85902445	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr10:85902445G>A	ENST00000372134.3	+	3	357	c.164G>A	c.(163-165)cGt>cAt	p.R55H	RP11-338I21.1_ENST00000606511.1_RNA	NM_014394.2	NP_055209.2	Q9H3K2	GHITM_HUMAN	growth hormone inducible transmembrane protein	55					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(1)|endometrium(1)|large_intestine(3)|lung(3)|prostate(2)	10						GGGATCCGGCGTGGGAGAACT	0.393																																						dbGAP											0													90.0	93.0	92.0					10																	85902445		1893	4119	6012	-	-	-	SO:0001583	missense	0			AB009685	CCDS41542.1	10q23.1	2008-02-01			ENSG00000165678	ENSG00000165678			17281	protein-coding gene	gene with protein product	"""transmembrane BAX inhibitor motif containing 5"""					8619474, 9110174	Standard	NM_014394		Approved	HSPC282, PTD010, DERP2, My021, TMBIM5	uc001kcs.1	Q9H3K2	OTTHUMG00000018637	ENST00000372134.3:c.164G>A	10.37:g.85902445G>A	ENSP00000361207:p.Arg55His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Z9|D3DWE0|O95894|Q5VT95|Q9H0P2	Missense_Mutation	SNP	pfam_Bax_inhibitor_1-related	p.R55H	ENST00000372134.3	37	c.164	CCDS41542.1	10	.	.	.	.	.	.	.	.	.	.	G	19.37	3.815186	0.70912	.	.	ENSG00000165678	ENST00000372134;ENST00000538477;ENST00000436406;ENST00000339736	.	.	.	5.86	5.86	0.93980	.	0.046469	0.85682	D	0.000000	T	0.77811	0.4186	M	0.79258	2.445	0.58432	D	0.999993	D	0.76494	0.999	P	0.59643	0.861	T	0.77048	-0.2732	9	0.44086	T	0.13	-17.4394	18.9591	0.92671	0.0:0.0:1.0:0.0	.	55	Q9H3K2	GHITM_HUMAN	H	55;42;55;55	.	ENSP00000342214:R55H	R	+	2	0	GHITM	85892425	1.000000	0.71417	0.979000	0.43373	0.990000	0.78478	6.477000	0.73591	2.765000	0.95021	0.655000	0.94253	CGT	GHITM	-	NULL	ENSG00000165678		0.393	GHITM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHITM	HGNC	protein_coding	OTTHUMT00000049125.1	60	0.00	0	G	NM_014394		85902445	85902445	+1	no_errors	ENST00000372134	ensembl	human	known	69_37n	missense	52	25.71	18	SNP	1.000	A
GOLGA8A	23015	genome.wustl.edu	37	15	34674048	34674048	+	Missense_Mutation	SNP	G	G	A	rs146057371		TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr15:34674048G>A	ENST00000359187.4	-	15	1527	c.1463C>T	c.(1462-1464)gCt>gTt	p.A488V	GOLGA8A_ENST00000543376.1_Missense_Mutation_p.A345V|GOLGA8A_ENST00000432566.2_Missense_Mutation_p.A518V|MIR1233-1_ENST00000408722.1_RNA|GOLGA8A_ENST00000360553.3_Missense_Mutation_p.A488V	NM_181077.3	NP_851422.1	A7E2F4	GOG8A_HUMAN	golgin A8 family, member A	516						Golgi apparatus (GO:0005794)|membrane (GO:0016020)							all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		TGCAGCTCCAGCAGCTTCACC	0.682																																						dbGAP											0													1.0	1.0	1.0					15																	34674048		280	580	860	-	-	-	SO:0001583	missense	0			BX648160	CCDS10038.1	15q14	2011-10-25	2010-02-12		ENSG00000175265	ENSG00000175265			31972	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 8A"""			10660574, 10677249	Standard	NM_181077		Approved	GM88, GOLGIN-67	uc001zii.3	A7E2F4	OTTHUMG00000129447	ENST00000359187.4:c.1463C>T	15.37:g.34674048G>A	ENSP00000352111:p.Ala488Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MCY9|B7ZMK5|O94937|Q52M46|Q68DK6|Q9NZG8|Q9NZW0|Q9NZW3	Missense_Mutation	SNP	NULL	p.A518V	ENST00000359187.4	37	c.1553	CCDS10038.1	15	.	.	.	.	.	.	.	.	.	.	g	12.33	1.906991	0.33628	.	.	ENSG00000175265	ENST00000359187;ENST00000360553;ENST00000432566;ENST00000543376	T;T;T;D	0.88818	3.06;3.06;2.56;-2.43	0.496	0.496	0.16896	.	.	.	.	.	T	0.82157	0.4976	L	0.46885	1.475	0.22171	N	0.999311	B;P	0.47762	0.405;0.9	B;B	0.39840	0.204;0.311	T	0.71351	-0.4619	9	0.39692	T	0.17	.	6.8237	0.23870	1.0E-4:0.0:0.9999:0.0	.	488;516	A7E2F4-3;A7E2F4	.;GOG8A_HUMAN	V	488;488;518;345	ENSP00000352111:A488V;ENSP00000353755:A488V;ENSP00000402791:A518V;ENSP00000438613:A345V	ENSP00000352111:A488V	A	-	2	0	GOLGA8A	32461340	0.946000	0.32159	0.663000	0.29738	0.311000	0.27955	0.499000	0.22546	0.528000	0.28580	0.384000	0.25694	GCT	GOLGA8A	-	NULL	ENSG00000175265		0.682	GOLGA8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA8A	HGNC	protein_coding	OTTHUMT00000251830.2	8	0.00	0	G	NM_181076		34674048	34674048	-1	no_errors	ENST00000432566	ensembl	human	known	69_37n	missense	2	71.43	5	SNP	0.999	A
GPS2	2874	genome.wustl.edu	37	17	7216885	7216885	+	Splice_Site	SNP	A	A	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr17:7216885A>G	ENST00000380728.2	-	7	935		c.e7+1		GPS2_ENST00000389167.5_Splice_Site|GPS2_ENST00000391950.3_Splice_Site|RP11-542C16.2_ENST00000575474.1_Splice_Site			Q13227	GPS2_HUMAN	G protein pathway suppressor 2						cell cycle (GO:0007049)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase inhibitor activity (GO:0005095)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(4)	24		Prostate(122;0.157)				CCTATTACTCACCTCTGAGCT	0.517											OREG0024133	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													94.0	94.0	94.0					17																	7216885		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U28963	CCDS11100.1	17p13.1	2006-04-29			ENSG00000132522	ENSG00000132522			4550	protein-coding gene	gene with protein product		601935				8943324	Standard	NM_004489		Approved		uc002gfx.1	Q13227	OTTHUMG00000102198	ENST00000380728.2:c.634+1T>C	17.37:g.7216885A>G		Somatic	640	WXS	Illumina GAIIx	Phase_IV	B4DXA1|Q6FHM8	Splice_Site	SNP	-	e6+2	ENST00000380728.2	37	c.634+2	CCDS11100.1	17	.	.	.	.	.	.	.	.	.	.	A	18.87	3.715280	0.68844	.	.	ENSG00000132522	ENST00000391950;ENST00000380728;ENST00000389167;ENST00000315601	.	.	.	4.88	4.88	0.63580	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.119	0.53882	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPS2	7157609	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	5.938000	0.70170	2.043000	0.60533	0.533000	0.62120	.	GPS2	-	-	ENSG00000132522		0.517	GPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPS2	HGNC	protein_coding	OTTHUMT00000220048.4	30	0	0	A	NM_004489	Intron	7216885	7216885	-1	no_errors	ENST00000380728	ensembl	human	known	69_37n	splice_site	35	10.26	4	SNP	1.000	G
GPR179	440435	genome.wustl.edu	37	17	36483415	36483415	+	Missense_Mutation	SNP	T	T	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr17:36483415T>C	ENST00000342292.4	-	11	6057	c.6037A>G	c.(6037-6039)Agt>Ggt	p.S2013G	GPR179_ENST00000584976.1_Intron	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	2013					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GCCTTGGCACTGCTGTCAGAT	0.547																																						dbGAP											0													82.0	80.0	80.0					17																	36483415		2013	4185	6198	-	-	-	SO:0001583	missense	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.6037A>G	17.37:g.36483415T>C	ENSP00000345060:p.Ser2013Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.S2013G	ENST00000342292.4	37	c.6037	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	T	9.493	1.101130	0.20632	.	.	ENSG00000188888	ENST00000342292	T	0.59772	0.24	4.88	-1.36	0.09085	.	0.982896	0.08306	N	0.966117	T	0.32102	0.0818	N	0.19112	0.55	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.23619	-1.0183	10	0.05721	T	0.95	0.1308	4.6511	0.12596	0.1473:0.3739:0.0:0.4787	.	2013	Q6PRD1	GP179_HUMAN	G	2013	ENSP00000345060:S2013G	ENSP00000345060:S2013G	S	-	1	0	GPR179	33736941	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.249000	0.08842	-0.475000	0.06852	0.459000	0.35465	AGT	GPR179	-	NULL	ENSG00000188888		0.547	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	55	0.00	0	T			36483415	36483415	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	missense	57	33.72	29	SNP	0.000	C
GPT2	84706	genome.wustl.edu	37	16	46962906	46962906	+	Silent	SNP	G	G	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr16:46962906G>C	ENST00000340124.4	+	12	1681	c.1569G>C	c.(1567-1569)gcG>gcC	p.A523A	GPT2_ENST00000440783.2_Silent_p.A423A	NM_133443.2	NP_597700.1	Q8TD30	ALAT2_HUMAN	glutamic pyruvate transaminase (alanine aminotransferase) 2	523					2-oxoglutarate metabolic process (GO:0006103)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-alanine catabolic process (GO:0042853)|L-alanine metabolic process (GO:0042851)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)	L-alanine:2-oxoglutarate aminotransferase activity (GO:0004021)|pyridoxal phosphate binding (GO:0030170)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(37;0.0276)|all_epithelial(9;0.0498)|all_lung(18;0.0522)			L-Alanine(DB00160)|Phenelzine(DB00780)	AGAAGTACGCGTGAGGACGCC	0.602																																						dbGAP											0													102.0	78.0	86.0					16																	46962906		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS10725.1, CCDS45478.1	16q12.1	2008-02-05			ENSG00000166123	ENSG00000166123	2.6.1.2		18062	protein-coding gene	gene with protein product		138210					Standard	NM_133443		Approved	ALT2	uc002eel.3	Q8TD30	OTTHUMG00000132541	ENST00000340124.4:c.1569G>C	16.37:g.46962906G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N9E2	Silent	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.A523	ENST00000340124.4	37	c.1569	CCDS10725.1	16																																																																																			GPT2	-	NULL	ENSG00000166123		0.602	GPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPT2	HGNC	protein_coding	OTTHUMT00000255741.2	38	0.00	0	G			46962906	46962906	+1	no_errors	ENST00000340124	ensembl	human	known	69_37n	silent	45	30.77	20	SNP	0.000	C
HERC1	8925	genome.wustl.edu	37	15	63964739	63964739	+	Silent	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr15:63964739C>T	ENST00000443617.2	-	39	8088	c.8001G>A	c.(7999-8001)gtG>gtA	p.V2667V	RP11-317G6.1_ENST00000559303.2_RNA	NM_003922.3	NP_003913.3	Q15751	HERC1_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 1	2667					cerebellar Purkinje cell differentiation (GO:0021702)|negative regulation of autophagy (GO:0010507)|neuromuscular process controlling balance (GO:0050885)|neuron projection development (GO:0031175)|positive regulation of GTPase activity (GO:0043547)|transport (GO:0006810)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(3)|breast(9)|central_nervous_system(4)|endometrium(23)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(22)|liver(1)|lung(36)|ovary(7)|prostate(4)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	132						CGGATGCAGGCACTGTTTCTG	0.517																																						dbGAP											0													72.0	77.0	75.0					15																	63964739		2081	4211	6292	-	-	-	SO:0001819	synonymous_variant	0			U50078	CCDS45277.1	15q22	2013-01-10	2012-02-23			ENSG00000103657		"""WD repeat domain containing"""	4867	protein-coding gene	gene with protein product		605109	"""hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 1"""			8861955, 9233772	Standard	NM_003922		Approved	p532, p619	uc002amp.3	Q15751		ENST00000443617.2:c.8001G>A	15.37:g.63964739C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW65	Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_WD40_repeat,pfam_SPRY_rcpt,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_UBA-like,superfamily_ARM-type_fold,smart_SPla/RYanodine_receptor_subgr,smart_WD40_repeat,smart_HECT,pfscan_B30.2/SPRY,pfscan_HECT,pfscan_Reg_chr_condens,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Reg_chr_condens	p.V2667	ENST00000443617.2	37	c.8001	CCDS45277.1	15																																																																																			HERC1	-	NULL	ENSG00000103657		0.517	HERC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC1	HGNC	protein_coding	OTTHUMT00000418523.1	73	0.00	0	C	NM_003922		63964739	63964739	-1	no_errors	ENST00000443617	ensembl	human	known	69_37n	silent	96	15.04	17	SNP	0.998	T
KCTD20	222658	genome.wustl.edu	37	6	36454815	36454815	+	Missense_Mutation	SNP	C	C	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr6:36454815C>G	ENST00000373731.2	+	8	1514	c.1123C>G	c.(1123-1125)Ctc>Gtc	p.L375V	KCTD20_ENST00000474988.1_3'UTR|KCTD20_ENST00000449081.2_Missense_Mutation_p.L209V|KCTD20_ENST00000536244.1_Missense_Mutation_p.L230V|KCTD20_ENST00000544295.1_Missense_Mutation_p.L129V	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	375					protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						AAGCAAATCCCTCACGAATCT	0.483																																						dbGAP											0													177.0	172.0	174.0					6																	36454815		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.1123C>G	6.37:g.36454815C>G	ENSP00000362836:p.Leu375Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.L375V	ENST00000373731.2	37	c.1123	CCDS4821.1	6	.	.	.	.	.	.	.	.	.	.	C	7.000	0.554699	0.13436	.	.	ENSG00000112078	ENST00000373731;ENST00000544295;ENST00000449081;ENST00000536244	D;D;D;D	0.85013	-1.93;-1.93;-1.93;-1.93	6.03	6.03	0.97812	.	0.079374	0.52532	D	0.000063	T	0.43809	0.1264	N	0.02247	-0.625	0.46521	D	0.999086	B;B	0.32071	0.319;0.355	B;B	0.30855	0.121;0.1	T	0.59107	-0.7516	10	0.05620	T	0.96	-20.8171	9.5732	0.39440	0.1425:0.7872:0.0:0.0703	.	209;375	Q7Z5Y7-2;Q7Z5Y7	.;KCD20_HUMAN	V	375;129;209;230	ENSP00000362836:L375V;ENSP00000440150:L129V;ENSP00000412205:L209V;ENSP00000439118:L230V	ENSP00000362836:L375V	L	+	1	0	KCTD20	36562793	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	2.263000	0.43293	2.861000	0.98227	0.655000	0.94253	CTC	KCTD20	-	NULL	ENSG00000112078		0.483	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD20	HGNC	protein_coding	OTTHUMT00000040345.2	38	0.00	0	C	NM_173562		36454815	36454815	+1	no_errors	ENST00000373731	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	G
KDM3A	55818	genome.wustl.edu	37	2	86693921	86693921	+	Silent	SNP	T	T	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr2:86693921T>C	ENST00000409556.1	+	11	1799	c.1434T>C	c.(1432-1434)gcT>gcC	p.A478A	KDM3A_ENST00000542128.1_Silent_p.A426A|KDM3A_ENST00000485171.1_Intron|KDM3A_ENST00000409064.1_Silent_p.A478A|KDM3A_ENST00000312912.5_Silent_p.A478A			Q9Y4C1	KDM3A_HUMAN	lysine (K)-specific demethylase 3A	478					androgen receptor signaling pathway (GO:0030521)|formaldehyde biosynthetic process (GO:0046293)|histone H3-K9 demethylation (GO:0033169)|histone H3-K9 dimethylation (GO:0036123)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of histone H3-K9 methylation (GO:0051573)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatid nucleus elongation (GO:0007290)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|dioxygenase activity (GO:0051213)|iron ion binding (GO:0005506)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(13)|ovary(1)|prostate(3)|skin(1)|stomach(3)|upper_aerodigestive_tract(2)	47						CAGCTTTAGCTTGCCGATCAC	0.383																																					NSCLC(96;1150 1523 6936 46253 49736)	dbGAP											0													49.0	51.0	51.0					2																	86693921		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018285	CCDS1990.1	2p11.2	2011-07-01	2009-04-06	2009-04-06	ENSG00000115548	ENSG00000115548		"""Chromatin-modifying enzymes / K-demethylases"""	20815	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 2A"""	611512	"""jumonji domain containing 1"", ""jumonji domain containing 1A"""	JMJD1, JMJD1A		9872452	Standard	NM_018433		Approved	TSGA, KIAA0742, JHMD2A	uc010ytj.2	Q9Y4C1	OTTHUMG00000130204	ENST00000409556.1:c.1434T>C	2.37:g.86693921T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5M3|Q53S72|Q68D47|Q68UT9|Q6N050|Q8IY08	Silent	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.A478	ENST00000409556.1	37	c.1434	CCDS1990.1	2																																																																																			KDM3A	-	NULL	ENSG00000115548		0.383	KDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3A	HGNC	protein_coding	OTTHUMT00000252522.2	38	0.00	0	T	NM_018433		86693921	86693921	+1	no_errors	ENST00000312912	ensembl	human	known	69_37n	silent	55	17.91	12	SNP	0.010	C
KIAA1210	57481	genome.wustl.edu	37	X	118242398	118242398	+	Missense_Mutation	SNP	T	T	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chrX:118242398T>C	ENST00000402510.2	-	6	813	c.814A>G	c.(814-816)Agt>Ggt	p.S272G		NM_020721.1	NP_065772.1	Q9ULL0	K1210_HUMAN	KIAA1210	272										breast(3)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(31)|ovary(4)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	64						GGAACCTTACTCCTAGGTTTA	0.468																																						dbGAP											0													92.0	85.0	87.0					X																	118242398		1946	4136	6082	-	-	-	SO:0001583	missense	0			AB033036	CCDS48156.1	Xq24	2012-10-04			ENSG00000250423	ENSG00000250423			29218	protein-coding gene	gene with protein product						10574462	Standard	NM_020721		Approved		uc004era.4	Q9ULL0	OTTHUMG00000162980	ENST00000402510.2:c.814A>G	X.37:g.118242398T>C	ENSP00000384670:p.Ser272Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZCI8|Q5JPN4	Missense_Mutation	SNP	NULL	p.S272G	ENST00000402510.2	37	c.814	CCDS48156.1	X	.	.	.	.	.	.	.	.	.	.	T	13.15	2.152327	0.38021	.	.	ENSG00000250423;ENSG00000241087	ENST00000402510;ENST00000420240	T	0.11385	2.78	2.43	2.43	0.29744	.	.	.	.	.	T	0.06280	0.0162	N	0.08118	0	0.09310	N	1	P	0.50819	0.939	P	0.45406	0.479	T	0.28364	-1.0046	9	0.37606	T	0.19	.	6.0127	0.19584	0.0:0.0:0.0:1.0	.	272	Q9ULL0	K1210_HUMAN	G	272;108	ENSP00000384670:S272G	ENSP00000396164:S108G	S	-	1	0	RP13-347D8.5;RP13-347D8.6	118126426	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.119000	0.15626	1.209000	0.43321	0.486000	0.48141	AGT	KIAA1210	-	NULL	ENSG00000250423		0.468	KIAA1210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1210	HGNC	protein_coding	OTTHUMT00000371251.2	52	0.00	0	T	NM_020721		118242398	118242398	-1	no_errors	ENST00000402510	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	0.001	C
KIAA1324	57535	genome.wustl.edu	37	1	109737206	109737206	+	Missense_Mutation	SNP	G	G	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:109737206G>C	ENST00000369939.3	+	15	2294	c.2111G>C	c.(2110-2112)tGt>tCt	p.C704S	KIAA1324_ENST00000369938.1_3'UTR|KIAA1324_ENST00000529753.1_Missense_Mutation_p.C617S	NM_020775.4	NP_065826	Q6UXG2	K1324_HUMAN	KIAA1324	704					cellular response to starvation (GO:0009267)|macroautophagy (GO:0016236)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|positive regulation of autophagic vacuole assembly (GO:2000786)|positive regulation of vacuole organization (GO:0044090)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(9)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		all_epithelial(167;0.000102)|all_lung(203;0.000323)|Lung NSC(277;0.00063)		Colorectal(144;0.0188)|Lung(183;0.0527)|COAD - Colon adenocarcinoma(174;0.14)|Epithelial(280;0.21)|all cancers(265;0.249)		CTCAGTCTCTGTGGAAACCAG	0.483																																						dbGAP											0													88.0	71.0	77.0					1																	109737206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057647	CCDS794.1, CCDS58015.1	1p13.3	2008-09-18			ENSG00000116299	ENSG00000116299			29618	protein-coding gene	gene with protein product	"""estrogen induced gene 121"""	611298				10718198, 16322283	Standard	NM_020775		Approved	maba1, EIG121	uc021orb.1	Q6UXG2	OTTHUMG00000011725	ENST00000369939.3:c.2111G>C	1.37:g.109737206G>C	ENSP00000358955:p.Cys704Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AE6|Q5T5C9|Q5T5D0|Q5T5D1|Q9P2M2	Missense_Mutation	SNP	superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Growth_fac_rcpt	p.C704S	ENST00000369939.3	37	c.2111	CCDS794.1	1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.828593	0.90955	.	.	ENSG00000116299	ENST00000369939;ENST00000457623;ENST00000529753	T;T;T	0.13901	2.55;2.55;2.55	5.43	5.43	0.79202	Mannose-6-phosphate receptor, binding (1);	0.000000	0.85682	D	0.000000	T	0.33235	0.0856	M	0.76838	2.35	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.998;0.998	T	0.11446	-1.0587	10	0.87932	D	0	-0.2441	18.0084	0.89216	0.0:0.0:1.0:0.0	.	704;617;704;704	Q6UXG2-4;Q6UXG2-3;C9J810;Q6UXG2	.;.;.;K1324_HUMAN	S	704;654;617	ENSP00000358955:C704S;ENSP00000393964:C654S;ENSP00000434595:C617S	ENSP00000358955:C704S	C	+	2	0	KIAA1324	109538729	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.864000	0.99589	2.530000	0.85305	0.591000	0.81541	TGT	KIAA1324	-	superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000116299		0.483	KIAA1324-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1324	HGNC	protein_coding	OTTHUMT00000032389.2	27	0.00	0	G	NM_020775		109737206	109737206	+1	no_errors	ENST00000369939	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	C
KIF26A	26153	genome.wustl.edu	37	14	104641938	104641938	+	Missense_Mutation	SNP	A	A	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr14:104641938A>C	ENST00000423312.2	+	12	2813	c.2813A>C	c.(2812-2814)aAg>aCg	p.K938T	KIF26A_ENST00000315264.7_Missense_Mutation_p.K799T	NM_015656.1	NP_056471.1	Q9ULI4	KI26A_HUMAN	kinesin family member 26A	938					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|enteric nervous system development (GO:0048484)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of signal transduction (GO:0009968)|regulation of cell growth by extracellular stimulus (GO:0001560)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	21		all_cancers(154;0.109)|Melanoma(154;0.0525)|all_epithelial(191;0.0767)	Epithelial(46;0.152)	Epithelial(152;0.161)		GTCCCGGAAAAGGCTGCAGTG	0.667																																						dbGAP											0													14.0	17.0	16.0					14																	104641938		1936	4066	6002	-	-	-	SO:0001583	missense	0			AB033062	CCDS45171.1	14q32.33	2009-03-19			ENSG00000066735	ENSG00000066735		"""Kinesins"""	20226	protein-coding gene	gene with protein product		613231				10574462, 11416179	Standard	NM_015656		Approved	KIAA1236, DKFZP434N178	uc001yos.4	Q9ULI4	OTTHUMG00000154986	ENST00000423312.2:c.2813A>C	14.37:g.104641938A>C	ENSP00000388241:p.Lys938Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAZ7|Q96GK3|Q9UFL3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K938T	ENST00000423312.2	37	c.2813	CCDS45171.1	14	.	.	.	.	.	.	.	.	.	.	a	17.17	3.321953	0.60634	.	.	ENSG00000066735	ENST00000423312;ENST00000315264	T;T	0.80994	-1.44;-1.43	3.98	1.45	0.22620	.	.	.	.	.	T	0.81074	0.4747	L	0.55481	1.735	0.44380	D	0.997283	D	0.69078	0.997	P	0.58013	0.831	T	0.76729	-0.2852	9	0.62326	D	0.03	.	4.8412	0.13491	0.7452:0.0:0.0917:0.1631	.	938	Q9ULI4	KI26A_HUMAN	T	938;799	ENSP00000388241:K938T;ENSP00000325452:K799T	ENSP00000325452:K799T	K	+	2	0	KIF26A	103711691	1.000000	0.71417	0.002000	0.10522	0.015000	0.08874	2.175000	0.42491	0.066000	0.16515	0.255000	0.18592	AAG	KIF26A	-	NULL	ENSG00000066735		0.667	KIF26A-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIF26A	HGNC	protein_coding	OTTHUMT00000414356.1	92	0.00	0	A			104641938	104641938	+1	no_errors	ENST00000423312	ensembl	human	known	69_37n	missense	56	21.13	15	SNP	0.976	C
KLF6	1316	genome.wustl.edu	37	10	3824189	3824190	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr10:3824189_3824190delTC	ENST00000497571.1	-	2	579_580	c.319_320delGA	c.(319-321)gatfs	p.D107fs	KLF6_ENST00000542957.1_Frame_Shift_Del_p.D107fs|KLF6_ENST00000469435.1_Frame_Shift_Del_p.D107fs|KLF6_ENST00000173785.4_5'UTR	NM_001160124.1|NM_001300.5	NP_001153596.1|NP_001291.3	Q99612	KLF6_HUMAN	Kruppel-like factor 6	107					B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16				Colorectal(1;0.238)		GCTGCTGACATCTGAGTTCAGG	0.505											OREG0019980	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U51869	CCDS7060.1, CCDS53490.1	10p15	2013-01-08	2004-11-29	2004-12-01	ENSG00000067082	ENSG00000067082		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	2235	protein-coding gene	gene with protein product	"""GC-rich binding factor"""	602053	"""core promoter element binding protein"""	BCD1, ST12, COPEB		9503030, 9685731	Standard	NM_001300		Approved	CPBP, GBF, Zf9, PAC1	uc001iha.3	Q99612	OTTHUMG00000017567	ENST00000497571.1:c.319_320delGA	10.37:g.3824189_3824190delTC	ENSP00000419923:p.Asp107fs	Somatic	614	WXS	Illumina GAIIx	Phase_IV	B2RE86|B4DDN0|D3DRR1|F5H3M5|Q5VUT7|Q5VUT8|Q9BT79	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D107fs	ENST00000497571.1	37	c.320_319	CCDS7060.1	10																																																																																			KLF6	-	NULL	ENSG00000067082		0.505	KLF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF6	HGNC	protein_coding	OTTHUMT00000046495.1	58	0.00	0	TC			3824189	3824190	-1	no_errors	ENST00000497571	ensembl	human	known	69_37n	frame_shift_del	56	22.22	16	DEL	1.000:1.000	-
KRT2	3849	genome.wustl.edu	37	12	53042059	53042059	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr12:53042059G>T	ENST00000309680.3	-	5	1041	c.1020C>A	c.(1018-1020)agC>agA	p.S340R		NM_000423.2	NP_000414.2	P35908	K22E_HUMAN	keratin 2	340	Linker 12.|Rod.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte activation (GO:0032980)|keratinocyte migration (GO:0051546)|keratinocyte proliferation (GO:0043616)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(18)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32				BRCA - Breast invasive adenocarcinoma(357;0.19)		CCAGGTTGCGGCTGTTGTCCA	0.547																																						dbGAP											0													230.0	196.0	207.0					12																	53042059		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8835.1	12q13.13	2013-01-16	2008-08-01	2006-07-17	ENSG00000172867	ENSG00000172867		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6439	protein-coding gene	gene with protein product	"""epidermal ichthyosis bullosa of Siemens"""	600194	"""keratin 2A (epidermal ichthyosis bullosa of Siemens)"""	KRT2A		7524919, 16831889	Standard	NM_000423		Approved	KRTE	uc001sat.3	P35908	OTTHUMG00000169748	ENST00000309680.3:c.1020C>A	12.37:g.53042059G>T	ENSP00000310861:p.Ser340Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAQ2	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S340R	ENST00000309680.3	37	c.1020	CCDS8835.1	12	.	.	.	.	.	.	.	.	.	.	G	17.39	3.376550	0.61735	.	.	ENSG00000172867	ENST00000309680	D	0.91011	-2.77	4.52	1.68	0.24146	Filament (1);	.	.	.	.	D	0.91570	0.7337	L	0.55834	1.745	0.26795	N	0.969311	D	0.55385	0.971	P	0.62298	0.9	T	0.82571	-0.0391	9	0.87932	D	0	.	5.4372	0.16488	0.2971:0.0:0.5721:0.1308	.	340	P35908	K22E_HUMAN	R	340	ENSP00000310861:S340R	ENSP00000310861:S340R	S	-	3	2	KRT2	51328326	1.000000	0.71417	0.990000	0.47175	0.608000	0.37181	2.758000	0.47565	0.269000	0.21961	0.563000	0.77884	AGC	KRT2	-	pfam_F,superfamily_Prefoldin	ENSG00000172867		0.547	KRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT2	HGNC	protein_coding	OTTHUMT00000405704.1	131	0.00	0	G	NM_000423		53042059	53042059	-1	no_errors	ENST00000309680	ensembl	human	known	69_37n	missense	141	12.96	21	SNP	1.000	T
LINC00283	100874057	genome.wustl.edu	37	13	103395563	103395564	+	RNA	DEL	TT	TT	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr13:103395563_103395564delTT	ENST00000430111.1	+	0	224_225									long intergenic non-protein coding RNA 283																		AGTTCTTCTCTTGTCAATGGGA	0.396																																						dbGAP											0																																										-	-	-			0					13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103395563_103395564delTT		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000430111.1	37	NULL		13																																																																																			LINC00283	-	-	ENSG00000231633		0.396	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	LINC00283	HGNC	antisense	OTTHUMT00000045714.1	111	0.00	0	TT			103395563	103395564	+1	no_errors	ENST00000430111	ensembl	human	known	69_37n	rna	119	18.79	28	DEL	0.000:0.000	-
LRP2	4036	genome.wustl.edu	37	2	170003328	170003328	+	Missense_Mutation	SNP	G	G	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr2:170003328G>C	ENST00000263816.3	-	69	13017	c.12732C>G	c.(12730-12732)atC>atG	p.I4244M		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	4244					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CACTCCAGTAGATTCGGTCAT	0.428																																						dbGAP											0													109.0	102.0	105.0					2																	170003328		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.12732C>G	2.37:g.170003328G>C	ENSP00000263816:p.Ile4244Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.I4244M	ENST00000263816.3	37	c.12732	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	17.72	3.458074	0.63401	.	.	ENSG00000081479	ENST00000263816	D	0.92199	-2.99	5.71	3.89	0.44902	Six-bladed beta-propeller, TolB-like (1);Growth factor, receptor (1);	0.094997	0.64402	D	0.000001	D	0.94165	0.8128	M	0.86864	2.845	0.80722	D	1	D	0.59357	0.985	P	0.55923	0.787	D	0.92431	0.5954	10	0.56958	D	0.05	.	5.5848	0.17269	0.2099:0.0:0.6492:0.141	.	4244	P98164	LRP2_HUMAN	M	4244	ENSP00000263816:I4244M	ENSP00000263816:I4244M	I	-	3	3	LRP2	169711574	1.000000	0.71417	0.998000	0.56505	0.925000	0.55904	2.418000	0.44662	0.744000	0.32741	-0.150000	0.13652	ATC	LRP2	-	superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000081479		0.428	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	87	0.00	0	G	NM_004525		170003328	170003328	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	106	24.29	34	SNP	1.000	C
LTF	4057	genome.wustl.edu	37	3	46496886	46496886	+	Frame_Shift_Del	DEL	T	T	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr3:46496886delT	ENST00000231751.4	-	5	841	c.546delA	c.(544-546)aaafs	p.K182fs	LTF_ENST00000417439.1_Frame_Shift_Del_p.K182fs|LTF_ENST00000426532.2_Frame_Shift_Del_p.K138fs	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	182	Transferrin-like 1. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		GGAACTGTCCTTTATCTGCAC	0.557																																						dbGAP											0													127.0	103.0	111.0					3																	46496886		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.546delA	3.37:g.46496886delT	ENSP00000231751:p.Lys182fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Frame_Shift_Del	DEL	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.G183fs	ENST00000231751.4	37	c.546	CCDS33747.1	3																																																																																			LTF	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin	ENSG00000012223		0.557	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LTF	HGNC	protein_coding	OTTHUMT00000343951.2	93	0.00	0	T	NM_002343		46496886	46496886	-1	no_errors	ENST00000231751	ensembl	human	known	69_37n	frame_shift_del	114	21.62	32	DEL	0.000	-
NRROS	375387	genome.wustl.edu	37	3	196387261	196387261	+	Silent	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr3:196387261C>A	ENST00000328557.4	+	3	950	c.747C>A	c.(745-747)gcC>gcA	p.A249A		NM_198565.1	NP_940967.1	Q86YC3	NRROS_HUMAN	negative regulator of reactive oxygen species	249					immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|superoxide metabolic process (GO:0006801)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)											GAGAGGCTGCCTTCGAGCTGG	0.642																																						dbGAP											0													65.0	65.0	65.0					3																	196387261		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358322	CCDS3319.1	3q29	2013-07-02	2013-07-02	2013-07-02	ENSG00000174004	ENSG00000174004			24613	protein-coding gene	gene with protein product		615322	"""leucine rich repeat containing 33"""	LRRC33		12975309	Standard	NM_198565		Approved	UNQ3030, ELLP3030, MGC50789, GARPL1	uc003fwv.3	Q86YC3	OTTHUMG00000155569	ENST00000328557.4:c.747C>A	3.37:g.196387261C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A249	ENST00000328557.4	37	c.747	CCDS3319.1	3																																																																																			LRRC33	-	NULL	ENSG00000174004		0.642	NRROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC33	HGNC	protein_coding	OTTHUMT00000340676.1	86	0.00	0	C	NM_198565		196387261	196387261	+1	no_errors	ENST00000328557	ensembl	human	known	69_37n	silent	113	13.08	17	SNP	0.930	A
MRE11A	4361	genome.wustl.edu	37	11	94194110	94194110	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr11:94194110C>T	ENST00000323929.3	-	12	1540	c.1318G>A	c.(1318-1320)Gca>Aca	p.A440T	MRE11A_ENST00000407439.3_Missense_Mutation_p.A443T|MRE11A_ENST00000393241.4_Missense_Mutation_p.A440T|MRE11A_ENST00000323977.3_Missense_Mutation_p.A440T	NM_005591.3	NP_005582.1	P49959	MRE11_HUMAN	MRE11 meiotic recombination 11 homolog A (S. cerevisiae)	440					base-excision repair (GO:0006284)|cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|innate immune response (GO:0045087)|intra-S DNA damage checkpoint (GO:0031573)|mitotic G2 DNA damage checkpoint (GO:0007095)|negative regulation of DNA endoreduplication (GO:0032876)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|positive regulation of kinase activity (GO:0033674)|positive regulation of protein autophosphorylation (GO:0031954)|positive regulation of type I interferon production (GO:0032481)|reciprocal meiotic recombination (GO:0007131)|regulation of mitotic recombination (GO:0000019)|sister chromatid cohesion (GO:0007062)|synapsis (GO:0007129)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromatin (GO:0000785)|cytosol (GO:0005829)|Mre11 complex (GO:0030870)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|double-stranded DNA binding (GO:0003690)|endodeoxyribonuclease activity (GO:0004520)|endonuclease activity (GO:0004519)|manganese ion binding (GO:0030145)|nuclease activity (GO:0004518)|protein C-terminus binding (GO:0008022)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(5)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	29		Acute lymphoblastic leukemia(157;2.37e-05)|all_hematologic(158;0.00824)				ACCTTCTCTGCGGTTTGAAAG	0.313								Homologous recombination	Ataxia-Telangiectasia-Like Disorder																													dbGAP											0													98.0	97.0	97.0					11																	94194110		2200	4297	6497	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ATLD	BC063458	CCDS8298.1, CCDS8299.1	11q21	2014-09-17	2001-11-28		ENSG00000020922	ENSG00000020922			7230	protein-coding gene	gene with protein product	"""AT-like disease"""	600814	"""meiotic recombination (S. cerevisiae) 11 homolog A"""	MRE11		8530104	Standard	XM_005274007		Approved	ATLD	uc001peu.2	P49959	OTTHUMG00000167780	ENST00000323929.3:c.1318G>A	11.37:g.94194110C>T	ENSP00000325863:p.Ala440Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43475	Missense_Mutation	SNP	pfam_Mre11_DNA-bd,pfam_Metallo_PEstase_dom,pirsf_DNA_repair_Mre11,tigrfam_DNA_repair_Mre11	p.A440T	ENST00000323929.3	37	c.1318	CCDS8299.1	11	.	.	.	.	.	.	.	.	.	.	C	13.81	2.348452	0.41599	.	.	ENSG00000020922	ENST00000323929;ENST00000407439;ENST00000323977;ENST00000393241	T;T;T;T	0.75821	-0.97;-0.97;-0.97;-0.97	5.54	4.63	0.57726	Mre11, DNA-binding (1);	0.045601	0.85682	D	0.000000	T	0.74176	0.3682	M	0.80982	2.52	0.80722	D	1	B;B;B	0.27625	0.015;0.183;0.027	B;B;B	0.27500	0.013;0.08;0.013	T	0.70543	-0.4843	10	0.18276	T	0.48	-23.5922	14.6395	0.68714	0.0:0.9298:0.0:0.0702	.	443;440;440	B3KTC7;P49959-2;P49959	.;.;MRE11_HUMAN	T	440;443;440;440	ENSP00000325863:A440T;ENSP00000385614:A443T;ENSP00000326094:A440T;ENSP00000376933:A440T	ENSP00000325863:A440T	A	-	1	0	MRE11A	93833758	1.000000	0.71417	0.854000	0.33618	0.853000	0.48598	4.546000	0.60705	1.358000	0.45922	-0.224000	0.12420	GCA	MRE11A	-	pfam_Mre11_DNA-bd,pirsf_DNA_repair_Mre11	ENSG00000020922		0.313	MRE11A-001	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	MRE11A	HGNC	protein_coding	OTTHUMT00000396237.3	50	0.00	0	C	NM_005591		94194110	94194110	-1	no_errors	ENST00000323929	ensembl	human	known	69_37n	missense	60	22.08	17	SNP	0.995	T
MTSS1L	92154	genome.wustl.edu	37	16	70713720	70713720	+	Silent	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr16:70713720C>T	ENST00000338779.6	-	5	625	c.351G>A	c.(349-351)gcG>gcA	p.A117A		NM_138383.2	NP_612392.1	Q765P7	MTSSL_HUMAN	metastasis suppressor 1-like	117	IMD. {ECO:0000255|PROSITE- ProRule:PRU00668}.				filopodium assembly (GO:0046847)|signal transduction (GO:0007165)					breast(1)|central_nervous_system(2)|endometrium(1)|liver(1)|lung(1)|skin(1)	7						GCTGGTTGGCCGCCTTCTTCC	0.701																																						dbGAP											0													39.0	37.0	37.0					16																	70713720		2198	4299	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS32476.1	16q22.1	2008-12-16				ENSG00000132613			25094	protein-coding gene	gene with protein product	"""actin-bundling protein with BAIAP2 homology"""					12477932	Standard	XM_006721335		Approved	ABBA-1, LOC92154	uc002ezj.3	Q765P7		ENST00000338779.6:c.351G>A	16.37:g.70713720C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJI7|Q9BUA8	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD	p.R39Q	ENST00000338779.6	37	c.116	CCDS32476.1	16																																																																																			MTSS1L	-	pfam_IRSp53/MIM_homology_IMD	ENSG00000132613		0.701	MTSS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTSS1L	HGNC	protein_coding	OTTHUMT00000434927.3	58	0.00	0	C	NM_138383		70713720	70713720	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000576338	ensembl	human	novel	69_37n	missense	81	17.35	17	SNP	0.370	T
MUC16	94025	genome.wustl.edu	37	19	9071187	9071187	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr19:9071187G>A	ENST00000397910.4	-	3	16462	c.16259C>T	c.(16258-16260)aCa>aTa	p.T5420I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	5422	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGCGGTGTTTGTGGAATGATG	0.498																																						dbGAP											0													440.0	417.0	425.0					19																	9071187		2115	4237	6352	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.16259C>T	19.37:g.9071187G>A	ENSP00000381008:p.Thr5420Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T5420I	ENST00000397910.4	37	c.16259	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	4.139	0.024042	0.08006	.	.	ENSG00000181143	ENST00000397910	T	0.24723	1.84	2.2	-3.16	0.05217	.	.	.	.	.	T	0.12135	0.0295	N	0.12182	0.205	.	.	.	B	0.23540	0.087	B	0.27076	0.076	T	0.30504	-0.9976	8	0.87932	D	0	.	3.5294	0.07771	0.1489:0.0:0.343:0.5081	.	5420	B5ME49	.	I	5420	ENSP00000381008:T5420I	ENSP00000381008:T5420I	T	-	2	0	MUC16	8932187	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.667000	0.05274	-0.609000	0.05724	0.313000	0.20887	ACA	MUC16	-	NULL	ENSG00000181143		0.498	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	179	0.00	0	G	NM_024690		9071187	9071187	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	195	16.67	39	SNP	0.001	A
MUC16	94025	genome.wustl.edu	37	19	9072753	9072753	+	Missense_Mutation	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr19:9072753C>A	ENST00000397910.4	-	3	14896	c.14693G>T	c.(14692-14694)aGg>aTg	p.R4898M		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4900	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GCTGGTCTCCCTCAGTTTAGG	0.488																																						dbGAP											0													241.0	227.0	231.0					19																	9072753		2090	4219	6309	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.14693G>T	19.37:g.9072753C>A	ENSP00000381008:p.Arg4898Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.R4898M	ENST00000397910.4	37	c.14693	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	10.68	1.417226	0.25552	.	.	ENSG00000181143	ENST00000397910	T	0.02974	4.09	2.57	-5.14	0.02875	.	.	.	.	.	T	0.06508	0.0167	L	0.43923	1.385	.	.	.	D	0.76494	0.999	D	0.64237	0.923	T	0.04840	-1.0923	8	0.87932	D	0	.	8.4378	0.32797	0.0:0.2343:0.6463:0.1194	.	4898	B5ME49	.	M	4898	ENSP00000381008:R4898M	ENSP00000381008:R4898M	R	-	2	0	MUC16	8933753	0.000000	0.05858	0.000000	0.03702	0.826000	0.46750	-1.066000	0.03454	-1.033000	0.03299	0.298000	0.19748	AGG	MUC16	-	NULL	ENSG00000181143		0.488	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	114	0.00	0	C	NM_024690		9072753	9072753	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	107	26.21	38	SNP	0.000	A
MXD3	83463	genome.wustl.edu	37	5	176734175	176734175	+	IGR	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr5:176734175C>A	ENST00000439742.2	-	0	1483				MXD3_ENST00000427908.2_Missense_Mutation_p.G176V|MXD3_ENST00000423571.2_Missense_Mutation_p.G371V	NM_031300.3	NP_112590.1	Q9BW11	MAD3_HUMAN	MAX dimerization protein 3						negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)					all_cancers(89;2.49e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GTTGGGAGTTCCCCCGTTTTC	0.463																																						dbGAP											0													222.0	186.0	197.0					5																	176734175		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0			BC000745	CCDS4416.1, CCDS47347.1	5q35.3	2013-03-20			ENSG00000213347	ENSG00000213347		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	14008	protein-coding gene	gene with protein product		609450					Standard	NM_031300		Approved	MAD3, bHLHc13	uc003mgb.2	Q9BW11	OTTHUMG00000130854		5.37:g.176734175C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0J1|Q53HK1|Q7Z4Y0|Q8NDJ7|Q96ME3	Missense_Mutation	SNP	pfam_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.G176V	ENST00000439742.2	37	c.527	CCDS4416.1	5	.	.	.	.	.	.	.	.	.	.	C	9.947	1.219148	0.22373	.	.	ENSG00000213347	ENST00000427908;ENST00000423571	T;T	0.46451	1.46;0.87	3.4	2.51	0.30379	.	.	.	.	.	T	0.52419	0.1733	.	.	.	0.25885	N	0.983542	D;D	0.76494	0.981;0.999	P;P	0.59056	0.789;0.851	T	0.38564	-0.9655	8	0.87932	D	0	.	6.9809	0.24702	0.0:0.8705:0.0:0.1295	.	176;371	Q9BW11-3;B4E0J1	.;.	V	176;371	ENSP00000416921:G176V;ENSP00000389716:G371V	ENSP00000389716:G371V	G	-	2	0	MXD3	176666781	0.001000	0.12720	0.041000	0.18516	0.160000	0.22226	-0.324000	0.07986	0.964000	0.38108	0.561000	0.74099	GGA	MXD3	-	NULL	ENSG00000213347		0.463	MXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXD3	HGNC	protein_coding	OTTHUMT00000253427.1	47	0.00	0	C			176734175	176734175	-1	no_errors	ENST00000427908	ensembl	human	known	69_37n	missense	58	21.62	16	SNP	0.136	A
MYH1	4619	genome.wustl.edu	37	17	10408575	10408575	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr17:10408575C>T	ENST00000226207.5	-	21	2434	c.2340G>A	c.(2338-2340)atG>atA	p.M780I	RP11-799N11.1_ENST00000399342.2_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_005963.3	NP_005954.3	P12882	MYH1_HUMAN	myosin, heavy chain 1, skeletal muscle, adult	780	Myosin motor.				muscle contraction (GO:0006936)	A band (GO:0031672)|cytoplasmic ribonucleoprotein granule (GO:0036464)|intercalated disc (GO:0014704)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(7)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(22)|lung(78)|ovary(11)|pancreas(1)|prostate(3)|skin(13)|upper_aerodigestive_tract(4)|urinary_tract(5)	176						TCTCATCTCGCATCTCCTCTA	0.463																																						dbGAP											0													70.0	72.0	71.0					17																	10408575		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11155.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109061	ENSG00000109061		"""Myosins / Myosin superfamily : Class II"""	7567	protein-coding gene	gene with protein product	"""myosin heavy chain IIx/d"""	160730	"""myosin, heavy polypeptide 1, skeletal muscle, adult"""			6304733	Standard	NM_005963		Approved	MYHSA1, MYHa, MyHC-2X/D, MGC133384	uc002gmo.3	P12882	OTTHUMG00000130362	ENST00000226207.5:c.2340G>A	17.37:g.10408575C>T	ENSP00000226207:p.Met780Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CA4|Q9Y622	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.M780I	ENST00000226207.5	37	c.2340	CCDS11155.1	17	.	.	.	.	.	.	.	.	.	.	C	19.21	3.782699	0.70222	.	.	ENSG00000109061	ENST00000226207	D	0.93076	-3.16	5.47	5.47	0.80525	Myosin head, motor domain (1);	0.000000	0.52532	U	0.000072	D	0.92645	0.7663	M	0.64567	1.98	0.80722	D	1	B	0.24132	0.098	B	0.24269	0.052	D	0.89649	0.3868	10	0.54805	T	0.06	.	19.6961	0.96026	0.0:1.0:0.0:0.0	.	780	P12882	MYH1_HUMAN	I	780	ENSP00000226207:M780I	ENSP00000226207:M780I	M	-	3	0	MYH1	10349300	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.611000	0.82962	2.745000	0.94114	0.650000	0.86243	ATG	MYH1	-	smart_Myosin_head_motor_dom	ENSG00000109061		0.463	MYH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH1	HGNC	protein_coding	OTTHUMT00000252725.1	65	0.00	0	C	NM_005963		10408575	10408575	-1	no_errors	ENST00000226207	ensembl	human	known	69_37n	missense	59	34.44	31	SNP	1.000	T
NACAP1	83955	genome.wustl.edu	37	8	102381722	102381722	+	RNA	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr8:102381722C>A	ENST00000419462.1	+	0	1134					NR_002182.1		Q9BZK3	NACP1_HUMAN	nascent-polypeptide-associated complex alpha polypeptide pseudogene 1																		AAAGGCAGTCCGAGCCCTGAA	0.408																																						dbGAP											0																																										-	-	-			0			AF315951		8q22.3	2007-04-20				ENSG00000228224			24688	pseudogene	pseudogene							Standard	NR_002182		Approved	FKSG17	uc003ykc.1	Q9BZK3			8.37:g.102381722C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000419462.1	37	NULL		8																																																																																			NACAP1	-	-	ENSG00000228224		0.408	NACAP1-001	KNOWN	basic	processed_transcript	NACAP1	HGNC	pseudogene	OTTHUMT00000380521.1	88	0.00	0	C	NR_002182		102381722	102381722	+1	no_errors	ENST00000419462	ensembl	human	known	69_37n	rna	73	23.96	23	SNP	1.000	A
NAP1L1	4673	genome.wustl.edu	37	12	76447083	76447084	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr12:76447083_76447084delAT	ENST00000261182.8	-	10	1303_1304	c.817_818delAT	c.(817-819)attfs	p.I273fs	NAP1L1_ENST00000547993.1_Frame_Shift_Del_p.I90fs|NAP1L1_ENST00000542344.1_Frame_Shift_Del_p.I231fs|NAP1L1_ENST00000431879.3_Frame_Shift_Del_p.I205fs|NAP1L1_ENST00000393263.3_Frame_Shift_Del_p.I273fs|NAP1L1_ENST00000549596.1_Frame_Shift_Del_p.I273fs|NAP1L1_ENST00000535020.2_Frame_Shift_Del_p.I273fs|NAP1L1_ENST00000547773.1_Frame_Shift_Del_p.I210fs|NAP1L1_ENST00000544816.1_Frame_Shift_Del_p.I90fs|NAP1L1_ENST00000548044.1_Frame_Shift_Del_p.I232fs|NAP1L1_ENST00000552342.1_Frame_Shift_Del_p.I284fs	NM_004537.4|NM_139207.2	NP_004528.1|NP_631946.1	P55209	NP1L1_HUMAN	nucleosome assembly protein 1-like 1	273					DNA replication (GO:0006260)|nucleosome assembly (GO:0006334)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(3)|ovary(2)|prostate(1)|skin(1)	9		Colorectal(145;0.09)				CTTCTTCTTAATAGTTTTCAAA	0.361																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS9013.1	12q21.1	2010-03-17			ENSG00000187109	ENSG00000187109			7637	protein-coding gene	gene with protein product		164060				8297347	Standard	NM_004537		Approved	NRP, NAP1, NAP1L, MGC8688, MGC23410	uc001sxx.2	P55209		ENST00000261182.8:c.817_818delAT	12.37:g.76447083_76447084delAT	ENSP00000261182:p.Ile273fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNT8	Frame_Shift_Del	DEL	pfam_NAP_family	p.I273fs	ENST00000261182.8	37	c.818_817	CCDS9013.1	12																																																																																			NAP1L1	-	pfam_NAP_family	ENSG00000187109		0.361	NAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L1	HGNC	protein_coding	OTTHUMT00000405850.3	15	0.00	0	AT	NM_139207		76447083	76447084	-1	no_errors	ENST00000261182	ensembl	human	known	69_37n	frame_shift_del	17	50.00	17	DEL	1.000:1.000	-
NFE2L3	9603	genome.wustl.edu	37	7	26224265	26224265	+	Missense_Mutation	SNP	A	A	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr7:26224265A>G	ENST00000056233.3	+	4	1206	c.947A>G	c.(946-948)cAt>cGt	p.H316R		NM_004289.6	NP_004280.5	Q9Y4A8	NF2L3_HUMAN	nuclear factor, erythroid 2-like 3	316					transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|skin(5)|urinary_tract(7)	29						GTGAATCTTCATGAGGCCATC	0.413																																						dbGAP											0													115.0	106.0	109.0					7																	26224265		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB010812	CCDS5396.1	7p15.2	2013-08-23	2013-08-23		ENSG00000050344	ENSG00000050344		"""basic leucine zipper proteins"""	7783	protein-coding gene	gene with protein product		604135	"""nuclear factor (erythroid-derived 2)-like 3"""			10037736	Standard	NM_004289		Approved	Nrf3	uc003sxq.3	Q9Y4A8	OTTHUMG00000023882	ENST00000056233.3:c.947A>G	7.37:g.26224265A>G	ENSP00000056233:p.His316Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUS0|Q7Z498|Q86UJ4|Q86VR5|Q9UQA4	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_Maf,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.H316R	ENST00000056233.3	37	c.947	CCDS5396.1	7	.	.	.	.	.	.	.	.	.	.	A	15.52	2.857668	0.51376	.	.	ENSG00000050344	ENST00000056233;ENST00000398175	T	0.37915	1.17	5.06	2.7	0.31948	.	0.300651	0.35936	N	0.002896	T	0.33527	0.0866	M	0.65975	2.015	0.36223	D	0.852099	B	0.15473	0.013	B	0.15870	0.014	T	0.29912	-0.9996	10	0.72032	D	0.01	-7.7779	6.765	0.23562	0.7444:0.1314:0.1242:0.0	.	316	Q9Y4A8	NF2L3_HUMAN	R	316;22	ENSP00000056233:H316R	ENSP00000056233:H316R	H	+	2	0	NFE2L3	26190790	0.624000	0.27102	0.999000	0.59377	0.926000	0.56050	1.286000	0.33273	0.373000	0.24621	0.383000	0.25322	CAT	NFE2L3	-	NULL	ENSG00000050344		0.413	NFE2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFE2L3	HGNC	protein_coding	OTTHUMT00000214088.1	51	0.00	0	A			26224265	26224265	+1	no_errors	ENST00000056233	ensembl	human	known	69_37n	missense	53	30.26	23	SNP	0.997	G
OR51I1	390063	genome.wustl.edu	37	11	5462607	5462607	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr11:5462607G>T	ENST00000380211.1	-	1	137	c.138C>A	c.(136-138)agC>agA	p.S46R	HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380252.1_Intron|HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA	NM_001005288.2	NP_001005288.1	Q9H343	O51I1_HUMAN	olfactory receptor, family 51, subfamily I, member 1	46					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;1.92e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GAGTGAGAATGCTGAGGTTAC	0.502																																						dbGAP											0													125.0	119.0	121.0					11																	5462607		2201	4297	6498	-	-	-	SO:0001583	missense	0			BK004429	CCDS31382.1	11p15.4	2012-08-09			ENSG00000167359	ENSG00000167359		"""GPCR / Class A : Olfactory receptors"""	15200	protein-coding gene	gene with protein product							Standard	NM_001005288		Approved		uc010qze.2	Q9H343	OTTHUMG00000066908	ENST00000380211.1:c.138C>A	11.37:g.5462607G>T	ENSP00000369559:p.Ser46Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EKW2|Q6IF33	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S46R	ENST00000380211.1	37	c.138	CCDS31382.1	11	.	.	.	.	.	.	.	.	.	.	G	8.628	0.893068	0.17613	.	.	ENSG00000167359	ENST00000317283;ENST00000321307;ENST00000380211	T	0.19669	2.13	5.9	1.43	0.22495	GPCR, rhodopsin-like superfamily (1);	0.431314	0.22037	N	0.065503	T	0.17789	0.0427	L	0.54965	1.715	0.21579	N	0.999637	B	0.21381	0.055	B	0.20384	0.029	T	0.18650	-1.0330	10	0.59425	D	0.04	.	5.9233	0.19094	0.1808:0.2936:0.5257:0.0	.	46	Q9H343	O51I1_HUMAN	R	31;43;46	ENSP00000369559:S46R	ENSP00000348350:S31R	S	-	3	2	OR51I1	5419183	0.000000	0.05858	0.989000	0.46669	0.121000	0.20230	-3.040000	0.00633	0.308000	0.22923	0.644000	0.83932	AGC	OR51I1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000167359		0.502	OR51I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51I1	HGNC	protein_coding	OTTHUMT00000143399.1	51	0.00	0	G	NM_001005288		5462607	5462607	-1	no_errors	ENST00000380211	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	0.391	T
PARP8	79668	genome.wustl.edu	37	5	50090941	50090941	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr5:50090941C>T	ENST00000281631.5	+	12	1276	c.1118C>T	c.(1117-1119)tCa>tTa	p.S373L	PARP8_ENST00000505697.2_Missense_Mutation_p.S373L|PARP8_ENST00000505554.1_Missense_Mutation_p.S352L|PARP8_ENST00000503750.2_Missense_Mutation_p.S373L|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000514067.2_Missense_Mutation_p.S373L|PARP8_ENST00000514342.2_Missense_Mutation_p.S126L	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	373						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				GCTGTTAAGTCAGAGGAATGC	0.488																																						dbGAP											0													113.0	109.0	110.0					5																	50090941		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.1118C>T	5.37:g.50090941C>T	ENSP00000281631:p.Ser373Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.S373L	ENST00000281631.5	37	c.1118	CCDS3954.1	5	.	.	.	.	.	.	.	.	.	.	C	13.00	2.106208	0.37145	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	.	.	.	5.3	-0.355	0.12587	.	0.496411	0.20841	N	0.084718	T	0.21347	0.0514	N	0.08118	0	0.23616	N	0.997286	B;B;B	0.14805	0.011;0.007;0.011	B;B;B	0.14023	0.01;0.005;0.01	T	0.15464	-1.0436	8	.	.	.	0.0018	14.9981	0.71449	0.4661:0.5339:0.0:0.0	.	265;373;373	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	L	373;373;126;373;373;352;126;126	.	.	S	+	2	0	PARP8	50126698	0.687000	0.27671	0.621000	0.29145	0.905000	0.53344	1.165000	0.31822	-0.231000	0.09825	-0.274000	0.10170	TCA	PARP8	-	NULL	ENSG00000151883		0.488	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	51	0.00	0	C	NM_024615		50090941	50090941	+1	no_errors	ENST00000281631	ensembl	human	known	69_37n	missense	71	21.11	19	SNP	0.753	T
PHB2	11331	genome.wustl.edu	37	12	7075640	7075640	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr12:7075640G>A	ENST00000546111.1	-	3	443	c.236C>T	c.(235-237)tCt>tTt	p.S79F	PHB2_ENST00000399433.2_Silent_p.I271I|MIR200C_ENST00000384980.1_RNA|PHB2_ENST00000440277.1_Silent_p.I233I|PHB2_ENST00000535923.1_Silent_p.I271I|PHB2_ENST00000542912.1_Intron|U47924.29_ENST00000606539.1_RNA|U47924.27_ENST00000537269.1_lincRNA|SCARNA12_ENST00000459155.1_RNA|PHB2_ENST00000544134.1_5'Flank|MIR141_ENST00000384975.1_RNA					prohibitin 2											ovary(2)|pancreas(1)	3						CTGTGAGATAGATACGATTCT	0.488																																						dbGAP											0													170.0	172.0	171.0					12																	7075640		2133	4265	6398	-	-	-	SO:0001583	missense	0			AF126021	CCDS53741.1, CCDS58207.1	12p13	2013-03-11			ENSG00000215021	ENSG00000215021			30306	protein-coding gene	gene with protein product		610704				11302691, 9259555	Standard	NM_001144831		Approved	REA, BCAP37, Bap37, p22	uc021quf.1	Q99623	OTTHUMG00000168519	ENST00000546111.1:c.236C>T	12.37:g.7075640G>A	ENSP00000438634:p.Ser79Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S79F	ENST00000546111.1	37	c.236		12	.	.	.	.	.	.	.	.	.	.	G	2.488	-0.318137	0.05386	.	.	ENSG00000215021	ENST00000546111	.	.	.	5.86	4.0	0.46444	.	.	.	.	.	T	0.61714	0.2369	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.60475	-0.7256	5	0.87932	D	0	-11.4225	5.1601	0.15056	0.134:0.1953:0.5674:0.1033	.	.	.	.	F	79	.	ENSP00000438634:S79F	S	-	2	0	PHB2	6945901	1.000000	0.71417	0.827000	0.32855	0.006000	0.05464	0.956000	0.29202	0.377000	0.24735	-0.797000	0.03246	TCT	PHB2	-	NULL	ENSG00000215021		0.488	PHB2-008	PUTATIVE	basic	protein_coding	PHB2	HGNC	protein_coding	OTTHUMT00000401794.2	113	0.00	0	G	NM_007273		7075640	7075640	-1	no_errors	ENST00000546111	ensembl	human	putative	69_37n	missense	106	34.16	55	SNP	0.946	A
PHF11	51131	genome.wustl.edu	37	13	50098311	50098311	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr13:50098311C>G	ENST00000378319.3	+	8	769	c.728C>G	c.(727-729)tCa>tGa	p.S243*	PHF11_ENST00000488958.1_Nonsense_Mutation_p.S204*|PHF11_ENST00000357596.3_Nonsense_Mutation_p.S204*	NM_001040443.1	NP_001035533.1	Q9UIL8	PHF11_HUMAN	PHD finger protein 11	243					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			large_intestine(3)|lung(1)	4		Lung NSC(96;2.1e-05)|Breast(56;0.00017)|Prostate(109;0.00314)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;2.38e-09)		AAAGTTCATTCAATTCCAGAA	0.328																																						dbGAP											0													54.0	57.0	56.0					13																	50098311		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			AB011031	CCDS31975.1, CCDS41887.1	13q14.11	2014-05-20			ENSG00000136147	ENSG00000136147		"""Zinc fingers, PHD-type"""	17024	protein-coding gene	gene with protein product	"""IgE responsiveness (atopic)"""	607796				10508479, 15057823	Standard	XM_005266417		Approved	NY-REN-34, BCAP, IGER	uc001vdb.3	Q9UIL8	OTTHUMG00000016916	ENST00000378319.3:c.728C>G	13.37:g.50098311C>G	ENSP00000367570:p.Ser243*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0A4|Q5W0A6|Q9Y5A2	Nonsense_Mutation	SNP	superfamily_Znf_FYVE_PHD,smart_Znf_PHD	p.S243*	ENST00000378319.3	37	c.728	CCDS31975.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.931|6.931	0.541460|0.541460	0.13250|0.13250	.|.	.|.	ENSG00000136147|ENSG00000136147	ENST00000426879|ENST00000378319;ENST00000357596;ENST00000488958	.|.	.|.	.|.	4.27|4.27	-2.87|-2.87	0.05700|0.05700	.|.	.|1.110750	.|0.06867	.|N	.|0.800147	T|.	0.14270|.	0.0345|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.26467|.	-1.0102|.	3|.	.|0.10902	.|T	.|0.67	2.9529|2.9529	4.8476|4.8476	0.13521|0.13521	0.0:0.266:0.2834:0.4507|0.0:0.266:0.2834:0.4507	.|.	.|.	.|.	.|.	E|X	198|243;204;204	.|.	.|ENSP00000350209:S204X	Q|S	+|+	1|2	0|0	PHF11|PHF11	48996312|48996312	0.819000|0.819000	0.29175|0.29175	0.000000|0.000000	0.03702|0.03702	0.000000|0.000000	0.00434|0.00434	0.340000|0.340000	0.19892|0.19892	-0.248000|-0.248000	0.09583|0.09583	-1.031000|-1.031000	0.02408|0.02408	CAA|TCA	PHF11	-	NULL	ENSG00000136147		0.328	PHF11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF11	HGNC	protein_coding	OTTHUMT00000044915.1	31	0.00	0	C	NM_016119		50098311	50098311	+1	no_errors	ENST00000378319	ensembl	human	known	69_37n	nonsense	43	21.82	12	SNP	0.001	G
PI4KB	5298	genome.wustl.edu	37	1	151274425	151274425	+	Silent	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:151274425G>T	ENST00000368873.1	-	8	1812	c.1644C>A	c.(1642-1644)tcC>tcA	p.S548S	PI4KB_ENST00000368875.2_Silent_p.S560S|PI4KB_ENST00000368874.4_Silent_p.S533S|PI4KB_ENST00000271657.5_Silent_p.S560S|PI4KB_ENST00000368872.1_Silent_p.S533S|PI4KB_ENST00000529142.1_Silent_p.S216S|RN7SL444P_ENST00000578948.1_RNA			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	548					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGCCGTAGGGGGAGCCCTCTC	0.537																																					Colon(154;765 1838 9854 28443 37492)	dbGAP											0													46.0	52.0	50.0					1																	151274425		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.1644C>A	1.37:g.151274425G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Silent	SNP	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.S560	ENST00000368873.1	37	c.1680		1																																																																																			PI4KB	-	superfamily_Kinase-like_dom	ENSG00000143393		0.537	PI4KB-002	KNOWN	basic	protein_coding	PI4KB	HGNC	protein_coding	OTTHUMT00000034400.3	36	0.00	0	G	NM_002651		151274425	151274425	-1	no_errors	ENST00000271657	ensembl	human	known	69_37n	silent	49	10.91	6	SNP	1.000	T
PKP4	8502	genome.wustl.edu	37	2	159499112	159499112	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr2:159499112G>T	ENST00000389759.3	+	11	1922	c.1810G>T	c.(1810-1812)Gat>Tat	p.D604Y	PKP4_ENST00000389757.3_Missense_Mutation_p.D604Y	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	604					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						CAAGTCTACAGATGAAAATAA	0.433										HNSCC(62;0.18)																												dbGAP											0													150.0	151.0	151.0					2																	159499112		2203	4300	6503	-	-	-	SO:0001583	missense	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.1810G>T	2.37:g.159499112G>T	ENSP00000374409:p.Asp604Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W91	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.D604Y	ENST00000389759.3	37	c.1810	CCDS33305.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	29.2|29.2	4.990098|4.990098	0.93106|0.93106	.|.	.|.	ENSG00000144283|ENSG00000144283	ENST00000428353;ENST00000389757;ENST00000389759|ENST00000389756	T;T|.	0.71222|.	-0.55;-0.55|.	6.06|6.06	6.06|6.06	0.98353|0.98353	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85831|0.85831	0.5788|0.5788	M|M	0.88842|0.88842	2.985|2.985	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0;1.0|.	D;D;D;D;D|.	0.97110|.	1.0;1.0;0.999;1.0;0.999|.	D|D	0.86970|0.86970	0.2097|0.2097	10|6	0.87932|0.87932	D|D	0|0	-14.2271|-14.2271	20.6208|20.6208	0.99490|0.99490	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	456;559;604;604;455|.	Q6LCG8;Q4W5T8;Q99569-2;Q99569;F8W7E2|.	.;.;.;PKP4_HUMAN;.|.	Y|I	455;604;604|91	ENSP00000374407:D604Y;ENSP00000374409:D604Y|.	ENSP00000374407:D604Y|ENSP00000374406:R91I	D|R	+|+	1|2	0|0	PKP4|PKP4	159207358|159207358	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.869000|9.869000	0.99810|0.99810	2.882000|2.882000	0.98803|0.98803	0.655000|0.655000	0.94253|0.94253	GAT|AGA	PKP4	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000144283		0.433	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	72	0.00	0	G			159499112	159499112	+1	no_errors	ENST00000389759	ensembl	human	known	69_37n	missense	97	25.38	33	SNP	1.000	T
PLAC1	10761	genome.wustl.edu	37	X	133699960	133699960	+	3'UTR	SNP	T	T	G	rs1982	byFrequency	TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chrX:133699960T>G	ENST00000359237.4	-	0	1038				PLAC1_ENST00000476971.1_5'UTR	NM_021796.3	NP_068568.1			placenta-specific 1											large_intestine(4)|lung(1)|pancreas(1)	6	Acute lymphoblastic leukemia(192;0.000127)					GCTATAGGTTTCTCTTTCTCA	0.303													G|||	1995	0.528477	0.6543	0.4424	3775	,	,		14595	0.2768		0.2425	False		,,,				2504	0.3067					dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF234654	CCDS14642.1	Xq26.3	2013-10-14			ENSG00000170965	ENSG00000170965			9044	protein-coding gene	gene with protein product	"""cancer/testis antigen 92"""	300296				10995572	Standard	NM_021796		Approved	CT92, OOSP2L	uc004exo.1	Q9HBJ0	OTTHUMG00000022457	ENST00000359237.4:c.*114A>C	X.37:g.133699960T>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000359237.4	37	NULL	CCDS14642.1	X																																																																																			PLAC1	-	-	ENSG00000170965		0.303	PLAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAC1	HGNC	protein_coding	OTTHUMT00000058375.1	30	0.00	0	T	NM_021796		133699960	133699960	-1	no_errors	ENST00000476971	ensembl	human	known	69_37n	rna	30	11.76	4	SNP	0.000	G
POLR3C	10623	genome.wustl.edu	37	1	145608455	145608455	+	Missense_Mutation	SNP	T	T	C	rs587647881	byFrequency	TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:145608455T>C	ENST00000334163.3	-	3	512	c.352A>G	c.(352-354)Atg>Gtg	p.M118V	RNF115_ENST00000369291.5_5'Flank|POLR3C_ENST00000369294.1_Missense_Mutation_p.M118V|POLR3C_ENST00000471254.1_5'UTR	NM_006468.6	NP_006459.3	Q9BUI4	RPC3_HUMAN	polymerase (RNA) III (DNA directed) polypeptide C (62kD)	118					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)|endometrium(4)|kidney(1)|large_intestine(3)|liver(1)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)		Epithelial(2;7.55e-13)			ACAGCTGACATTGTCAGTTTG	0.458													T|||	2	0.000399361	0.0	0.0	5008	,	,		22395	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													126.0	111.0	116.0					1																	145608455		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ238234	CCDS72864.1	1q21	2013-01-21			ENSG00000186141	ENSG00000186141		"""RNA polymerase subunits"""	30076	protein-coding gene	gene with protein product						9171375, 12391170	Standard	NM_006468		Approved	RPC62, RPC3	uc001eoh.3	Q9BUI4	OTTHUMG00000013753	ENST00000334163.3:c.352A>G	1.37:g.145608455T>C	ENSP00000334564:p.Met118Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15317|Q9Y3R6	Missense_Mutation	SNP	pfam_RNA_pol_III_Rpc82_C,pfam_RNA_pol_III_RPC82-rel_HTH	p.M118V	ENST00000334163.3	37	c.352	CCDS921.1	1	.	.	.	.	.	.	.	.	.	.	T	13.40	2.224908	0.39300	.	.	ENSG00000186141	ENST00000334163;ENST00000369294	T;T	0.43294	0.95;0.96	4.89	4.89	0.63831	.	0.043191	0.85682	D	0.000000	T	0.15132	0.0365	L	0.57536	1.79	0.54753	D	0.99998	B;B;P	0.40660	0.41;0.116;0.726	B;B;B	0.30105	0.03;0.013;0.111	T	0.04454	-1.0950	10	0.11485	T	0.65	-22.2397	8.7288	0.34485	0.0:0.0:0.1918:0.8082	.	118;118;118	E9PHH9;Q9BUI4;Q53F76	.;RPC3_HUMAN;.	V	118	ENSP00000334564:M118V;ENSP00000358300:M118V	ENSP00000334564:M118V	M	-	1	0	POLR3C	144319812	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.365000	0.59486	2.046000	0.60703	0.533000	0.62120	ATG	POLR3C	-	NULL	ENSG00000186141		0.458	POLR3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3C	HGNC	protein_coding	OTTHUMT00000038542.1	58	0.00	0	T	NM_006468		145608455	145608455	-1	no_errors	ENST00000334163	ensembl	human	known	69_37n	missense	46	43.21	35	SNP	1.000	C
PPM1B	5495	genome.wustl.edu	37	2	44396108	44396108	+	5'UTR	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr2:44396108C>T	ENST00000282412.4	+	0	93				PPM1B_ENST00000378540.4_3'UTR|PPM1B_ENST00000345249.4_5'UTR|PPM1B_ENST00000409432.3_5'UTR|PPM1B_ENST00000409895.4_5'UTR|RP11-559M23.1_ENST00000609837.1_RNA|PPM1B_ENST00000378551.2_5'UTR	NM_002706.4	NP_002697.1	O75688	PPM1B_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1B						cytokine-mediated signaling pathway (GO:0019221)|N-terminal protein myristoylation (GO:0006499)|negative regulation of defense response to virus (GO:0050687)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|peptidyl-threonine dephosphorylation (GO:0035970)|protein dephosphorylation (GO:0006470)	cytosol (GO:0005829)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			kidney(4)|large_intestine(3)|lung(7)|skin(2)	16		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)				AGTTTCCTGCCGGCGCGGCTG	0.652																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AJ005801	CCDS1816.1, CCDS1817.1, CCDS1818.1, CCDS46271.1	2p22.1	2012-04-17	2010-03-05		ENSG00000138032	ENSG00000138032	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	9276	protein-coding gene	gene with protein product	"""protein phosphatase 2C, beta isoform"""	603770	"""protein phosphatase 1B (formerly 2C), magnesium-dependent, beta isoform"""			9684878	Standard	NM_002706		Approved	PPC2BETAX, PP2CB, PP2CBETA	uc002rtt.3	O75688	OTTHUMG00000128757	ENST00000282412.4:c.-320C>T	2.37:g.44396108C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q461Q2|Q4J6C1|Q4J6C2|Q658R4|Q96ER6|Q9HAY8	RNA	SNP	-	NULL	ENST00000282412.4	37	NULL	CCDS1817.1	2																																																																																			PPM1B	-	-	ENSG00000138032		0.652	PPM1B-001	KNOWN	basic|CCDS	protein_coding	PPM1B	HGNC	protein_coding	OTTHUMT00000250672.1	161	0.00	0	C	NM_002706		44396108	44396108	+1	no_errors	ENST00000378540	ensembl	human	known	69_37n	rna	235	23.20	71	SNP	1.000	T
PPTC7	160760	genome.wustl.edu	37	12	110983717	110983717	+	Silent	SNP	G	G	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr12:110983717G>C	ENST00000354300.3	-	3	858	c.570C>G	c.(568-570)ccC>ccG	p.P190P		NM_139283.1	NP_644812.1	Q8NI37	PPTC7_HUMAN	PTC7 protein phosphatase homolog (S. cerevisiae)	190	PP2C-like.					mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|large_intestine(2)|lung(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	9						CGGCTTCAGGGGGAGCGATTG	0.562																																						dbGAP											0													120.0	108.0	112.0					12																	110983717		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF385435	CCDS9149.1	12q24.11	2009-11-05				ENSG00000196850			30695	protein-coding gene	gene with protein product	"""T cell activation protein phosphatase 2C"""	609668				15177553	Standard	NM_139283		Approved	TA-PP2C	uc001trh.1	Q8NI37	OTTHUMG00000169529	ENST00000354300.3:c.570C>G	12.37:g.110983717G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWC5|Q68DZ7|Q6UY82	Silent	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.P190	ENST00000354300.3	37	c.570	CCDS9149.1	12																																																																																			PPTC7	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	ENSG00000196850		0.562	PPTC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPTC7	HGNC	protein_coding	OTTHUMT00000404635.1	80	0.00	0	G	NM_139283		110983717	110983717	-1	no_errors	ENST00000354300	ensembl	human	known	69_37n	silent	70	18.60	16	SNP	0.201	C
PTPLAD1	51495	genome.wustl.edu	37	15	65849103	65849103	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr15:65849103G>T	ENST00000261875.5	+	4	397	c.231G>T	c.(229-231)caG>caT	p.Q77H	PTPLAD1_ENST00000566511.1_5'UTR|PTPLAD1_ENST00000565299.1_Missense_Mutation_p.Q115H|PTPLAD1_ENST00000442729.2_Intron|PTPLAD1_ENST00000569894.1_5'UTR|PTPLAD1_ENST00000568793.1_Missense_Mutation_p.Q52H|PTPLAD1_ENST00000566074.1_5'UTR|PTPLAD1_ENST00000562901.1_5'UTR	NM_016395.2	NP_057479.2	Q9P035	HACD3_HUMAN	protein tyrosine phosphatase-like A domain containing 1	77	CS. {ECO:0000255|PROSITE- ProRule:PRU00547}.				activation of JUN kinase activity (GO:0007257)|fatty acid biosynthetic process (GO:0006633)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|positive regulation of GTPase activity (GO:0043547)|Rac protein signal transduction (GO:0016601)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	endoplasmic reticulum (GO:0005783)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)	GTPase activator activity (GO:0005096)|lyase activity (GO:0016829)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|pancreas(1)	5						CCCAGAGGCAGGTAAACATTA	0.498																																						dbGAP											0													66.0	63.0	64.0					15																	65849103		1916	4142	6058	-	-	-	SO:0001583	missense	0				CCDS45282.1	15q22.2	2005-11-11				ENSG00000074696			24175	protein-coding gene	gene with protein product		615940				10747961, 11042152	Standard	NM_016395		Approved	B-ind1, HSPC121	uc002apc.3	Q9P035		ENST00000261875.5:c.231G>T	15.37:g.65849103G>T	ENSP00000261875:p.Gln77His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJA1|B4DRF4|Q280Z3|Q6PD63|Q8IUI5|Q8NC86|Q8NCB1|Q96T12|Q9NQA7	Missense_Mutation	SNP	pfam_Tyr_Pase-like_PTPLA,pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.Q77H	ENST00000261875.5	37	c.231	CCDS45282.1	15	.	.	.	.	.	.	.	.	.	.	G	19.69	3.874380	0.72180	.	.	ENSG00000074696	ENST00000261875	T	0.13778	2.56	5.2	3.29	0.37713	CS-like domain (1);CS domain (1);HSP20-like chaperone (1);	0.125473	0.56097	D	0.000028	T	0.31071	0.0785	L	0.56396	1.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.04090	-1.0978	10	0.66056	D	0.02	-2.5869	11.8837	0.52589	0.1439:0.0:0.8561:0.0	.	77	Q9P035	HACD3_HUMAN	H	77	ENSP00000261875:Q77H	ENSP00000261875:Q77H	Q	+	3	2	PTPLAD1	63636156	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	3.761000	0.55242	1.428000	0.47296	-0.259000	0.10710	CAG	PTPLAD1	-	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	ENSG00000074696		0.498	PTPLAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPLAD1	HGNC	protein_coding	OTTHUMT00000419739.1	104	0.00	0	G	NM_016395		65849103	65849103	+1	no_errors	ENST00000261875	ensembl	human	known	69_37n	missense	85	13.27	13	SNP	1.000	T
RFPL4B	442247	genome.wustl.edu	37	6	112671398	112671398	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr6:112671398G>A	ENST00000441065.2	+	3	800	c.488G>A	c.(487-489)tGc>tAc	p.C163Y	RP11-506B6.6_ENST00000587816.1_RNA|RP11-506B6.6_ENST00000590673.1_RNA|RP11-506B6.6_ENST00000585611.1_RNA	NM_001013734.2	NP_001013756.2	Q6ZWI9	RFPLB_HUMAN	ret finger protein-like 4B	163	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.						zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|skin(1)	14		all_cancers(87;9.44e-05)|all_hematologic(75;0.000114)|all_epithelial(87;0.00265)|Colorectal(196;0.0209)		all cancers(137;0.0202)|OV - Ovarian serous cystadenocarcinoma(136;0.0477)|Epithelial(106;0.0646)|GBM - Glioblastoma multiforme(226;0.0866)|BRCA - Breast invasive adenocarcinoma(108;0.244)		CTGGGCGTCTGCAAGGAGCCG	0.567																																						dbGAP											0													72.0	76.0	74.0					6																	112671398		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122906	CCDS34515.1	6q21	2007-04-24			ENSG00000251258	ENSG00000251258		"""RING-type (C3HC4) zinc fingers"""	33264	protein-coding gene	gene with protein product							Standard	NM_001013734		Approved	RNF211	uc003pvx.1	Q6ZWI9	OTTHUMG00000015390	ENST00000441065.2:c.488G>A	6.37:g.112671398G>A	ENSP00000423391:p.Cys163Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU91	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_RING,prints_Butyrophylin	p.C163Y	ENST00000441065.2	37	c.488	CCDS34515.1	6	.	.	.	.	.	.	.	.	.	.	G	13.55	2.270141	0.40194	.	.	ENSG00000251258	ENST00000441065	T	0.63255	-0.03	4.14	2.33	0.28932	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.000000	0.37906	N	0.001894	T	0.69967	0.3170	M	0.90082	3.085	0.09310	N	1	D	0.89917	1.0	D	0.79108	0.992	T	0.61850	-0.6978	10	0.87932	D	0	.	6.3428	0.21332	0.0996:0.3627:0.5377:0.0	.	163	Q6ZWI9	RFPLB_HUMAN	Y	163	ENSP00000423391:C163Y	ENSP00000423391:C163Y	C	+	2	0	RFPL4B	112778091	0.015000	0.18098	0.020000	0.16555	0.069000	0.16628	0.231000	0.17872	0.695000	0.31675	0.655000	0.94253	TGC	RFPL4B	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	ENSG00000251258		0.567	RFPL4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFPL4B	HGNC	protein_coding	OTTHUMT00000041885.2	28	0.00	0	G	NM_001013734		112671398	112671398	+1	no_errors	ENST00000441065	ensembl	human	known	69_37n	missense	34	32.00	16	SNP	0.003	A
RFXANK	8625	genome.wustl.edu	37	19	19307824	19307824	+	Missense_Mutation	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr19:19307824C>A	ENST00000303088.4	+	4	714	c.240C>A	c.(238-240)aaC>aaA	p.N80K	RFXANK_ENST00000456252.3_Missense_Mutation_p.N80K|RFXANK_ENST00000392324.4_Missense_Mutation_p.N79K|RFXANK_ENST00000353145.1_Missense_Mutation_p.N79K|RFXANK_ENST00000407360.3_Missense_Mutation_p.N80K	NM_003721.2	NP_003712.1	O14593	RFXK_HUMAN	regulatory factor X-associated ankyrin-containing protein	80					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			NS(1)|breast(1)|endometrium(1)|lung(8)|ovary(2)|prostate(1)	14			Epithelial(12;0.00228)			AGCGAGGGAACGAGGTGTCAG	0.612																																						dbGAP											0													78.0	72.0	74.0					19																	19307824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF094760	CCDS12395.1, CCDS12396.1, CCDS62611.1	19p12	2014-09-17			ENSG00000064490	ENSG00000064490		"""Ankyrin repeat domain containing"""	9987	protein-coding gene	gene with protein product	"""ankyrin repeat-containing regulatory factor X-associated protein"", ""regulatory factor X subunit B"", ""RFX-Bdelta4"", ""DNA-binding protein RFXANK"""	603200				9806546, 10072068	Standard	NM_003721		Approved	BLS, RFX-B, ANKRA1, F14150_1, MGC138628	uc002nls.3	O14593	OTTHUMG00000169224	ENST00000303088.4:c.240C>A	19.37:g.19307824C>A	ENSP00000305071:p.Asn80Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95839|Q24JQ1|Q6FGA8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_DNA-bd_RFXANK,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.N80K	ENST00000303088.4	37	c.240	CCDS12395.1	19	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718302	0.48622	.	.	ENSG00000064490	ENST00000353145;ENST00000456252;ENST00000303088;ENST00000407360;ENST00000543652;ENST00000540981;ENST00000541873;ENST00000392324;ENST00000535017	T;T;T;T;T;T;T;T	0.71934	-0.61;-0.61;1.16;1.09;1.77;-0.4;-0.61;-0.4	5.16	-8.05	0.01106	.	0.086984	0.85682	N	0.000000	T	0.76292	0.3967	M	0.78049	2.395	0.42707	D	0.993632	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.995	T	0.79743	-0.1675	10	0.35671	T	0.21	-21.1874	9.7826	0.40658	0.0947:0.2951:0.0:0.6102	.	80;80;79;80	Q6IB23;Q24JQ1;O14593-2;O14593	.;.;.;RFXK_HUMAN	K	79;80;80;79;80;80;79;79;45	ENSP00000262804:N79K;ENSP00000409138:N80K;ENSP00000305071:N80K;ENSP00000384572:N79K;ENSP00000439581:N80K;ENSP00000440325:N80K;ENSP00000376138:N79K;ENSP00000444280:N45K	ENSP00000305071:N80K	N	+	3	2	RFXANK	19168824	0.013000	0.17824	0.203000	0.23512	0.337000	0.28794	-1.046000	0.03525	-1.513000	0.01789	-0.314000	0.08810	AAC	RFXANK	-	pirsf_DNA-bd_RFXANK	ENSG00000064490		0.612	RFXANK-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	RFXANK	HGNC	protein_coding	OTTHUMT00000402923.2	48	0.00	0	C	NM_003721		19307824	19307824	+1	no_errors	ENST00000303088	ensembl	human	known	69_37n	missense	30	36.17	17	SNP	0.209	A
C15orf52	388115	genome.wustl.edu	37	15	40623824	40623824	+	IGR	SNP	A	A	G	rs1129264	byFrequency	TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr15:40623824A>G	ENST00000559313.1	-	0	3022				C15orf52_ENST00000397536.2_3'UTR|RNA5SP392_ENST00000516905.1_RNA	NM_207380.2	NP_997263.2	Q6ZUT6	CO052_HUMAN	chromosome 15 open reading frame 52								poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	19		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.06e-06)|Colorectal(105;0.0107)|BRCA - Breast invasive adenocarcinoma(123;0.0505)|READ - Rectum adenocarcinoma(2;0.0649)|Lung(196;0.0781)|LUAD - Lung adenocarcinoma(183;0.0841)		gagattaggcacgttcagggt	0.463													G|||	3146	0.628195	0.7269	0.5764	5008	,	,		18737	0.8611		0.333	False		,,,				2504	0.5951					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK124643	CCDS10055.2	15q15.1	2007-06-14			ENSG00000188549	ENSG00000188549			33488	protein-coding gene	gene with protein product							Standard	NM_207380		Approved	FLJ43339	uc001zlh.4	Q6ZUT6	OTTHUMG00000129981		15.37:g.40623824A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ8|Q68DG9|Q6ZTM3|Q6ZU22	RNA	SNP	-	NULL	ENST00000559313.1	37	NULL	CCDS10055.2	15																																																																																			RNA5SP392	-	-	ENSG00000252714		0.463	C15orf52-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RNA5SP392	HGNC	protein_coding	OTTHUMT00000319567.2	30	0.00	0	A	NM_207380		40623824	40623824	-1	no_errors	ENST00000516905	ensembl	human	known	69_37n	rna	20	16.67	4	SNP	0.000	G
SF3B6	51639	genome.wustl.edu	37	2	24291245	24291245	+	Silent	SNP	C	C	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr2:24291245C>G	ENST00000233468.4	-	3	447	c.234G>C	c.(232-234)tcG>tcC	p.S78S		NM_016047.3	NP_057131.1														NS(1)|kidney(1)|large_intestine(1)|lung(1)	4	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CATTGAATCCCGATAGGTGAT	0.403																																						dbGAP											0													145.0	128.0	134.0					2																	24291245		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000233468.4:c.234G>C	2.37:g.24291245C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S78	ENST00000233468.4	37	c.234	CCDS1707.1	2																																																																																			AC008073.5	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000115128		0.403	SF3B14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B14	Clone_based_vega_gene	protein_coding	OTTHUMT00000246826.1	50	0.00	0	C			24291245	24291245	-1	no_errors	ENST00000233468	ensembl	human	known	69_37n	silent	58	22.67	17	SNP	0.972	G
SLC9A3R1	9368	genome.wustl.edu	37	17	72745097	72745097	+	Missense_Mutation	SNP	T	T	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr17:72745097T>C	ENST00000262613.5	+	1	307	c.112T>C	c.(112-114)Tac>Cac	p.Y38H	MIR3615_ENST00000581999.1_RNA|MIR3615_ENST00000585285.1_RNA	NM_004252.4	NP_004243.1	O14745	NHRF1_HUMAN	solute carrier family 9, subfamily A (NHE3, cation proton antiporter 3), member 3 regulator 1	38	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin cytoskeleton organization (GO:0030036)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|bile acid secretion (GO:0032782)|cellular phosphate ion homeostasis (GO:0030643)|cellular protein localization (GO:0034613)|glutathione transport (GO:0034635)|microvillus assembly (GO:0030033)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of sodium ion transport (GO:0010766)|negative regulation of sodium:proton antiporter activity (GO:0032416)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|protein complex assembly (GO:0006461)|regulation of excretion (GO:0044062)|regulation of protein kinase activity (GO:0045859)|regulation of sodium:proton antiporter activity (GO:0032415)|renal absorption (GO:0070293)|renal phosphate ion absorption (GO:0097291)|renal sodium ion transport (GO:0003096)|Wnt signaling pathway (GO:0016055)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|membrane raft (GO:0045121)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)|vesicle (GO:0031982)	beta-2 adrenergic receptor binding (GO:0031698)|beta-catenin binding (GO:0008013)|chloride channel regulator activity (GO:0017081)|growth factor receptor binding (GO:0070851)|PDZ domain binding (GO:0030165)|phosphatase binding (GO:0019902)|protein self-association (GO:0043621)|receptor binding (GO:0005102)			large_intestine(4)	4						GTTGGGCCAGTACATCCGGCT	0.716																																						dbGAP											0													12.0	16.0	14.0					17																	72745097		2196	4289	6485	-	-	-	SO:0001583	missense	0			AF015926	CCDS11705.1	17q25.1	2014-09-04	2012-03-22		ENSG00000109062	ENSG00000109062			11075	protein-coding gene	gene with protein product		604990	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulatory factor 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), isoform 3 regulator 1"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 3 regulator 1"""			9314537, 9430655	Standard	NM_004252		Approved	NHERF, EBP50	uc002jlo.4	O14745	OTTHUMG00000178863	ENST00000262613.5:c.112T>C	17.37:g.72745097T>C	ENSP00000262613:p.Tyr38His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY21|O43552|Q86WQ5	Missense_Mutation	SNP	pfam_PDZ,pfam_EBP50_C-term,superfamily_PDZ,smart_PDZ,pirsf_NaH_exchngr_reg_CF_NHE-RF,pfscan_PDZ	p.Y38H	ENST00000262613.5	37	c.112	CCDS11705.1	17	.	.	.	.	.	.	.	.	.	.	T	16.47	3.133615	0.56828	.	.	ENSG00000109062	ENST00000262613	T	0.56103	0.48	4.33	4.33	0.51752	PDZ/DHR/GLGF (4);	0.355525	0.29853	N	0.011023	T	0.60444	0.2269	L	0.38649	1.16	0.80722	D	1	P	0.46987	0.888	P	0.61275	0.886	T	0.63994	-0.6511	10	0.72032	D	0.01	-9.4453	13.3318	0.60492	0.0:0.0:0.0:1.0	.	38	O14745	NHRF1_HUMAN	H	38	ENSP00000262613:Y38H	ENSP00000262613:Y38H	Y	+	1	0	SLC9A3R1	70256692	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.853000	0.62911	1.827000	0.53221	0.397000	0.26171	TAC	SLC9A3R1	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_NaH_exchngr_reg_CF_NHE-RF,pfscan_PDZ	ENSG00000109062		0.716	SLC9A3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A3R1	HGNC	protein_coding	OTTHUMT00000443671.1	16	0.00	0	T			72745097	72745097	+1	no_errors	ENST00000262613	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	1.000	C
SLC38A10	124565	genome.wustl.edu	37	17	79220047	79220047	+	Missense_Mutation	SNP	T	T	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr17:79220047T>G	ENST00000374759.3	-	16	3052	c.2669A>C	c.(2668-2670)cAa>cCa	p.Q890P		NM_001037984.1	NP_001033073.1	Q9HBR0	S38AA_HUMAN	solute carrier family 38, member 10	890					amino acid transport (GO:0006865)|bone development (GO:0060348)|sodium ion transport (GO:0006814)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TTTCCTGTCTTGGGAACCGCC	0.647																																						dbGAP											0													52.0	66.0	62.0					17																	79220047		1936	4103	6039	-	-	-	SO:0001583	missense	0			BC014642	CCDS11780.1, CCDS42397.1	17q25.3	2013-05-22			ENSG00000157637	ENSG00000157637		"""Solute carriers"""	28237	protein-coding gene	gene with protein product							Standard	XM_005257019		Approved	MGC15523, PP1744	uc002jzz.1	Q9HBR0	OTTHUMG00000168049	ENST00000374759.3:c.2669A>C	17.37:g.79220047T>G	ENSP00000363891:p.Gln890Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRC5|Q8NA99|Q96C66	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.Q890P	ENST00000374759.3	37	c.2669	CCDS42397.1	17	.	.	.	.	.	.	.	.	.	.	T	17.05	3.289441	0.59976	.	.	ENSG00000157637	ENST00000374759;ENST00000540966	T;T	0.50277	2.96;0.75	3.99	-1.48	0.08745	.	1932.660000	0.00166	U	0.000000	T	0.39253	0.1071	L	0.40543	1.245	0.09310	N	0.999998	P	0.49961	0.93	B	0.41571	0.36	T	0.35773	-0.9775	10	0.45353	T	0.12	-1.3329	6.0078	0.19557	0.0:0.1616:0.4017:0.4366	.	890	Q9HBR0	S38AA_HUMAN	P	890;276	ENSP00000363891:Q890P;ENSP00000437601:Q276P	ENSP00000363891:Q890P	Q	-	2	0	SLC38A10	76834642	0.000000	0.05858	0.008000	0.14137	0.486000	0.33341	0.158000	0.16422	-0.557000	0.06126	0.383000	0.25322	CAA	SLC38A10	-	NULL	ENSG00000157637		0.647	SLC38A10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC38A10	HGNC	protein_coding	OTTHUMT00000397747.1	410	0.00	0	T	NM_138570		79220047	79220047	-1	no_errors	ENST00000374759	ensembl	human	known	69_37n	missense	200	21.57	55	SNP	0.008	G
SLTM	79811	genome.wustl.edu	37	15	59191708	59191708	+	Missense_Mutation	SNP	T	T	C			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr15:59191708T>C	ENST00000380516.2	-	7	1105	c.1018A>G	c.(1018-1020)Aaa>Gaa	p.K340E	SLTM_ENST00000557950.1_5'Flank|SLTM_ENST00000536328.1_Intron	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	340					apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						GAGGGCCCTTTCTTCAAAGTA	0.438																																						dbGAP											0													86.0	91.0	89.0					15																	59191708		2192	4292	6484	-	-	-	SO:0001583	missense	0			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1018A>G	15.37:g.59191708T>C	ENSP00000369887:p.Lys340Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.K340E	ENST00000380516.2	37	c.1018	CCDS10168.2	15	.	.	.	.	.	.	.	.	.	.	T	17.88	3.497113	0.64186	.	.	ENSG00000137776	ENST00000380516;ENST00000249736	D;D	0.88201	-2.35;-2.35	5.78	5.78	0.91487	.	0.000000	0.64402	D	0.000012	D	0.93559	0.7944	M	0.66939	2.045	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.75020	0.985;0.985	D	0.94011	0.7284	10	0.66056	D	0.02	.	16.1082	0.81241	0.0:0.0:0.0:1.0	.	322;340	C9IZZ3;Q9NWH9	.;SLTM_HUMAN	E	340;322	ENSP00000369887:K340E;ENSP00000249736:K322E	ENSP00000249736:K322E	K	-	1	0	SLTM	56979000	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.205000	0.71048	0.482000	0.46254	AAA	SLTM	-	NULL	ENSG00000137776		0.438	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	HGNC	protein_coding	OTTHUMT00000157124.1	51	0.00	0	T	NM_024755		59191708	59191708	-1	no_errors	ENST00000380516	ensembl	human	known	69_37n	missense	45	22.41	13	SNP	1.000	C
SMC4	10051	genome.wustl.edu	37	3	160132222	160132222	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr3:160132222G>A	ENST00000357388.3	+	9	1640	c.1189G>A	c.(1189-1191)Gat>Aat	p.D397N	SMC4_ENST00000469762.1_Missense_Mutation_p.D372N|SMC4_ENST00000360111.2_Missense_Mutation_p.D397N|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000344722.5_Missense_Mutation_p.D397N|SMC4_ENST00000462787.1_Missense_Mutation_p.D397N	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	397					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)	p.D397H(1)		breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AGATTTGGAAGATGTTCAAGT	0.284																																						dbGAP											1	Substitution - Missense(1)	lung(1)											38.0	39.0	39.0					3																	160132222		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1189G>A	3.37:g.160132222G>A	ENSP00000349961:p.Asp397Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.D397N	ENST00000357388.3	37	c.1189	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	G	22.3	4.275426	0.80580	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000392788;ENST00000469762;ENST00000489573;ENST00000462787;ENST00000344722	T;T;T;T;T;T	0.74106	-0.81;-0.81;-0.81;0.22;-0.81;-0.81	5.49	5.49	0.81192	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.83622	0.5294	L	0.58101	1.795	0.80722	D	1	P;B;D;P	0.89917	0.79;0.087;1.0;0.893	P;B;D;P	0.91635	0.604;0.196;0.999;0.658	T	0.78687	-0.2107	10	0.18276	T	0.48	-29.5989	19.39	0.94576	0.0:0.0:1.0:0.0	.	397;372;372;397	Q9NTJ3-2;B3KXX5;E9PD53;Q9NTJ3	.;.;.;SMC4_HUMAN	N	397;397;397;372;397;397;397	ENSP00000349961:D397N;ENSP00000353225:D397N;ENSP00000417964:D372N;ENSP00000420121:D397N;ENSP00000420734:D397N;ENSP00000341382:D397N	ENSP00000341382:D397N	D	+	1	0	SMC4	161614916	1.000000	0.71417	1.000000	0.80357	0.584000	0.36387	9.036000	0.93758	2.583000	0.87209	0.650000	0.86243	GAT	SMC4	-	pfam_RecF/RecN/SMC	ENSG00000113810		0.284	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	27	0.00	0	G			160132222	160132222	+1	no_errors	ENST00000344722	ensembl	human	known	69_37n	missense	17	19.05	4	SNP	1.000	A
SRSF4	6429	genome.wustl.edu	37	1	29476663	29476663	+	Missense_Mutation	SNP	C	C	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:29476663C>G	ENST00000373795.4	-	5	854	c.620G>C	c.(619-621)cGa>cCa	p.R207P	RP11-242O24.5_ENST00000450108.1_RNA|SRSF4_ENST00000466448.1_Intron|SRSF4_ENST00000546138.1_Intron	NM_005626.4	NP_005617.2	Q08170	SRSF4_HUMAN	serine/arginine-rich splicing factor 4	207	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(1)	27						GCTGCCACTTCGGCTTCTGCT	0.473																																						dbGAP											0													212.0	209.0	210.0					1																	29476663		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002781	CCDS333.1	1p35.3	2013-02-12	2010-06-22	2010-06-22	ENSG00000116350	ENSG00000116350		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10786	protein-coding gene	gene with protein product	"""SR splicing factor 4"""	601940	"""splicing factor, arginine/serine-rich 4"""	SFRS4		8321209, 20516191	Standard	NM_005626		Approved	SRP75	uc001bro.3	Q08170	OTTHUMG00000003663	ENST00000373795.4:c.620G>C	1.37:g.29476663C>G	ENSP00000362900:p.Arg207Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXP1|Q9BUA4|Q9UEB5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R207P	ENST00000373795.4	37	c.620	CCDS333.1	1	.	.	.	.	.	.	.	.	.	.	C	19.21	3.784582	0.70222	.	.	ENSG00000116350	ENST00000373795;ENST00000434636	T	0.44083	0.93	5.36	5.36	0.76844	.	0.271361	0.38217	N	0.001768	T	0.59101	0.2169	L	0.49126	1.545	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.56056	-0.8042	10	0.45353	T	0.12	.	16.6233	0.84935	0.0:1.0:0.0:0.0	.	207	Q08170	SRSF4_HUMAN	P	207	ENSP00000362900:R207P	ENSP00000362900:R207P	R	-	2	0	SRSF4	29349250	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.192000	0.50989	2.668000	0.90789	0.650000	0.86243	CGA	SRSF4	-	NULL	ENSG00000116350		0.473	SRSF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF4	HGNC	protein_coding	OTTHUMT00000010392.1	49	0.00	0	C	NM_005626		29476663	29476663	-1	no_errors	ENST00000373795	ensembl	human	known	69_37n	missense	68	22.73	20	SNP	1.000	G
STAM	8027	genome.wustl.edu	37	10	17730056	17730056	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr10:17730056G>A	ENST00000377524.3	+	5	543	c.328G>A	c.(328-330)Gct>Act	p.A110T	STAM_ENST00000540523.1_5'UTR	NM_003473.3	NP_003464.1	Q92783	STAM1_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 1	110	VHS. {ECO:0000255|PROSITE- ProRule:PRU00218}.				endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|positive regulation of signal transduction (GO:0009967)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	26						AAAATTAAAGGCTCTTATGGT	0.323																																						dbGAP											0													100.0	106.0	104.0					10																	17730056		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43899	CCDS7122.1	10p14-p13	2009-04-29			ENSG00000136738	ENSG00000136738			11357	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	601899				8780729	Standard	NM_003473		Approved	STAM1	uc001ipj.2	Q92783	OTTHUMG00000017749	ENST00000377524.3:c.328G>A	10.37:g.17730056G>A	ENSP00000366746:p.Ala110Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ99|D3DRU5|Q8N6D9	Missense_Mutation	SNP	pfam_VHS,pfam_SH3_domain,pfam_SH3_2,pfam_Ubiquitin-int_motif,superfamily_ENTH_VHS,superfamily_SH3_domain,smart_VHS_subgr,smart_SH3_domain,pfscan_SH3_domain,pfscan_Ubiquitin-int_motif,pfscan_VHS,prints_SH3_domain,prints_p67phox	p.A110T	ENST00000377524.3	37	c.328	CCDS7122.1	10	.	.	.	.	.	.	.	.	.	.	G	18.96	3.734176	0.69189	.	.	ENSG00000136738	ENST00000377524;ENST00000445846;ENST00000377500	T	0.20881	2.04	5.83	4.9	0.64082	VHS subgroup (1);ENTH/VHS (2);VHS (2);	0.102265	0.64402	D	0.000002	T	0.16938	0.0407	N	0.20357	0.565	0.80722	D	1	P	0.50617	0.937	P	0.45232	0.474	T	0.03364	-1.1044	10	0.19147	T	0.46	-23.4298	16.3687	0.83346	0.0:0.0:0.8677:0.1323	.	110	Q92783	STAM1_HUMAN	T	110;60;13	ENSP00000366746:A110T	ENSP00000366721:A13T	A	+	1	0	STAM	17770062	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.930000	0.87610	2.762000	0.94881	0.591000	0.81541	GCT	STAM	-	pfam_VHS,superfamily_ENTH_VHS,smart_VHS_subgr,pfscan_VHS	ENSG00000136738		0.323	STAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM	HGNC	protein_coding	OTTHUMT00000047039.1	34	0.00	0	G	NM_003473		17730056	17730056	+1	no_errors	ENST00000377524	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	A
TAF7L	54457	genome.wustl.edu	37	X	100537337	100537337	+	Missense_Mutation	SNP	T	T	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chrX:100537337T>A	ENST00000372907.3	-	5	653	c.642A>T	c.(640-642)gaA>gaT	p.E214D	TAF7L_ENST00000356784.1_Missense_Mutation_p.E128D|TAF7L_ENST00000324762.6_Missense_Mutation_p.E128D|TAF7L_ENST00000372905.2_Missense_Mutation_p.E128D	NM_024885.3	NP_079161.3	Q5H9L4	TAF7L_HUMAN	TAF7-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 50kDa	214					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|transcription factor TFIID complex (GO:0005669)				NS(1)|breast(4)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	29						AGACACATTTTTCTTCTCTCC	0.443																																					Ovarian(104;431 1530 3210 15406 18594)	dbGAP											0													231.0	172.0	192.0					X																	100537337		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285595	CCDS35347.1, CCDS55466.1	Xq22.1	2009-03-25	2002-08-29	2001-12-07	ENSG00000102387	ENSG00000102387			11548	protein-coding gene	gene with protein product	"""cancer/testis antigen 40"""	300314	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, Q"""	TAF2Q		11279525	Standard	NM_024885		Approved	CT40	uc004ehb.3	Q5H9L4	OTTHUMG00000022021	ENST00000372907.3:c.642A>T	X.37:g.100537337T>A	ENSP00000361998:p.Glu214Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9L6|Q86XI4|Q9BXU5|Q9H5R0	Missense_Mutation	SNP	pfam_TAFII55_prot_cons_reg	p.E214D	ENST00000372907.3	37	c.642	CCDS35347.1	X	.	.	.	.	.	.	.	.	.	.	T	15.81	2.943982	0.53079	.	.	ENSG00000102387	ENST00000372907;ENST00000372905;ENST00000324762;ENST00000356784	T;T;T;T	0.22945	2.5;1.93;1.93;3.23	6.08	1.85	0.25348	TAFII55 protein, conserved region (1);	0.582870	0.15444	N	0.262036	T	0.14141	0.0342	N	0.11927	0.2	0.23524	N	0.997495	B;B	0.23185	0.081;0.066	B;B	0.18871	0.023;0.014	T	0.20306	-1.0279	10	0.87932	D	0	-7.4066	9.312	0.37910	0.0:0.6961:0.0:0.3039	.	214;128	Q5H9L4;Q5H9L4-3	TAF7L_HUMAN;.	D	214;128;128;128	ENSP00000361998:E214D;ENSP00000361996:E128D;ENSP00000320283:E128D;ENSP00000349235:E128D	ENSP00000320283:E128D	E	-	3	2	TAF7L	100423993	1.000000	0.71417	0.001000	0.08648	0.022000	0.10575	1.076000	0.30729	0.038000	0.15604	0.441000	0.28932	GAA	TAF7L	-	pfam_TAFII55_prot_cons_reg	ENSG00000102387		0.443	TAF7L-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TAF7L	HGNC	protein_coding	OTTHUMT00000057526.2	107	0.00	0	T			100537337	100537337	-1	no_errors	ENST00000372907	ensembl	human	known	69_37n	missense	131	12.67	19	SNP	0.987	A
TARDBP	23435	genome.wustl.edu	37	1	11076915	11076915	+	Missense_Mutation	SNP	A	A	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:11076915A>G	ENST00000240185.3	+	3	367	c.253A>G	c.(253-255)Atg>Gtg	p.M85V	TARDBP_ENST00000315091.3_Missense_Mutation_p.M85V|TARDBP_ENST00000439080.2_Intron	NM_007375.3	NP_031401.1	Q13148	TADBP_HUMAN	TAR DNA binding protein	85					3'-UTR-mediated mRNA stabilization (GO:0070935)|cell death (GO:0008219)|mRNA processing (GO:0006397)|negative regulation by host of viral transcription (GO:0043922)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)	11	Ovarian(185;0.249)	Lung NSC(185;1.04e-05)|all_lung(284;1.31e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00262)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0578)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.37e-07)|COAD - Colon adenocarcinoma(227;7.38e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|Kidney(185;0.000754)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|READ - Rectum adenocarcinoma(331;0.0487)		CAAAAGAAAAATGGATGAGAC	0.368																																						dbGAP											0													64.0	68.0	67.0					1																	11076915		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23731	CCDS122.1	1p36.22	2014-09-17			ENSG00000120948	ENSG00000120948		"""RNA binding motif (RRM) containing"""	11571	protein-coding gene	gene with protein product		605078				7745706	Standard	NM_007375		Approved	TDP-43, ALS10	uc001art.3	Q13148	OTTHUMG00000002120	ENST00000240185.3:c.253A>G	1.37:g.11076915A>G	ENSP00000240185:p.Met85Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4GUK4|A4GUK5|A4GUK6|B2R629|B4DJ45|E2PU12|Q53H27|Q6FI92|Q96DJ0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.M85V	ENST00000240185.3	37	c.253	CCDS122.1	1	.	.	.	.	.	.	.	.	.	.	A	13.57	2.277338	0.40294	.	.	ENSG00000120948	ENST00000240185;ENST00000315091	D;T	0.85484	-1.99;1.48	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	D	0.82857	0.5128	M	0.65975	2.015	0.80722	D	1	B	0.22211	0.066	B	0.22753	0.041	T	0.78448	-0.2200	10	0.12766	T	0.61	-19.8068	15.5002	0.75691	1.0:0.0:0.0:0.0	.	85	Q13148	TADBP_HUMAN	V	85	ENSP00000240185:M85V;ENSP00000313129:M85V	ENSP00000240185:M85V	M	+	1	0	TARDBP	10999502	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.035000	0.93752	2.056000	0.61249	0.383000	0.25322	ATG	TARDBP	-	NULL	ENSG00000120948		0.368	TARDBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARDBP	HGNC	protein_coding	OTTHUMT00000006063.1	45	0.00	0	A	NM_007375		11076915	11076915	+1	no_errors	ENST00000240185	ensembl	human	known	69_37n	missense	72	25.00	24	SNP	1.000	G
TCF4	6925	genome.wustl.edu	37	18	53017614	53017614	+	Missense_Mutation	SNP	T	T	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr18:53017614T>G	ENST00000356073.4	-	8	1136	c.525A>C	c.(523-525)aaA>aaC	p.K175N	TCF4_ENST00000540999.1_Missense_Mutation_p.K151N|TCF4_ENST00000566279.1_Intron|TCF4_ENST00000567880.1_Intron|TCF4_ENST00000398339.1_Missense_Mutation_p.K277N|TCF4_ENST00000543082.1_Missense_Mutation_p.K133N|TCF4_ENST00000564999.1_Missense_Mutation_p.K175N|TCF4_ENST00000566286.1_Missense_Mutation_p.K173N|TCF4_ENST00000564403.2_Missense_Mutation_p.K175N|TCF4_ENST00000544241.2_Missense_Mutation_p.K104N|TCF4_ENST00000354452.3_Missense_Mutation_p.K175N|TCF4_ENST00000570177.2_Missense_Mutation_p.K45N|TCF4_ENST00000537856.3_Missense_Mutation_p.K45N|TCF4_ENST00000537578.1_Missense_Mutation_p.K151N|TCF4_ENST00000568673.1_Missense_Mutation_p.K151N|TCF4_ENST00000568740.1_Missense_Mutation_p.K150N|TCF4_ENST00000561992.1_Missense_Mutation_p.K45N|TCF4_ENST00000565018.2_Missense_Mutation_p.K175N|TCF4_ENST00000564228.1_Missense_Mutation_p.K104N	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	175					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CTGGAGGAACTTTTCGAACTT	0.368																																						dbGAP											0													145.0	125.0	132.0					18																	53017614		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.525A>C	18.37:g.53017614T>G	ENSP00000348374:p.Lys175Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.K277N	ENST00000356073.4	37	c.831	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	T	19.23	3.788380	0.70337	.	.	ENSG00000196628	ENST00000354452;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T	0.63744	-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06;-0.06	5.48	4.32	0.51571	.	0.134036	0.50627	D	0.000111	T	0.73644	0.3613	M	0.71871	2.18	0.34615	D	0.717954	D;D;D;D;D;D;D	0.76494	0.999;0.997;0.997;0.988;0.99;0.997;0.999	D;D;D;P;P;D;D	0.72982	0.979;0.957;0.964;0.627;0.697;0.964;0.963	T	0.79974	-0.1577	10	0.87932	D	0	-26.677	6.6884	0.23158	0.0:0.2538:0.0:0.7462	.	151;175;151;277;175;133;104	B7Z5M6;G0LNT9;B7Z6Y1;E9PH57;P15884;B3KUC0;B3KT62	.;.;.;.;ITF2_HUMAN;.;.	N	175;175;133;151;151;104;45;277	ENSP00000346440:K175N;ENSP00000348374:K175N;ENSP00000439656:K133N;ENSP00000445202:K151N;ENSP00000440731:K151N;ENSP00000441562:K104N;ENSP00000439827:K45N;ENSP00000381382:K277N	ENSP00000346440:K175N	K	-	3	2	TCF4	51168612	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.570000	0.36439	0.930000	0.37217	0.402000	0.26972	AAA	TCF4	-	NULL	ENSG00000196628		0.368	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	43	0.00	0	T	NM_003199		53017614	53017614	-1	no_errors	ENST00000398339	ensembl	human	known	69_37n	missense	36	21.74	10	SNP	1.000	G
TGDS	23483	genome.wustl.edu	37	13	95248374	95248374	+	Missense_Mutation	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr13:95248374C>A	ENST00000261296.5	-	1	137	c.17G>T	c.(16-18)tGg>tTg	p.W6L	TGDS_ENST00000498294.1_5'UTR	NM_014305.2	NP_055120.1	O95455	TGDS_HUMAN	TDP-glucose 4,6-dehydratase	6					nucleotide-sugar metabolic process (GO:0009225)		coenzyme binding (GO:0050662)|dTDP-glucose 4,6-dehydratase activity (GO:0008460)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	8	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CGGTTCCTCCCAACACGCCGC	0.622																																						dbGAP											0													41.0	39.0	39.0					13																	95248374		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF048686	CCDS9471.1	13q32.1	2012-02-22			ENSG00000088451	ENSG00000088451	4.2.1.46	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	20324	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 2E, member 1"""					19027726	Standard	NM_014305		Approved	TDPGD, SDR2E1	uc001vlw.3	O95455	OTTHUMG00000046308	ENST00000261296.5:c.17G>T	13.37:g.95248374C>A	ENSP00000261296:p.Trp6Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DQ3|Q2TU31|Q5T3Z2|Q9H1T9	Missense_Mutation	SNP	pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_dTDP_dehydrorham_reduct,pfam_Polysac_CapD-like,pfam_Male_sterile_NAD-bd	p.W6L	ENST00000261296.5	37	c.17	CCDS9471.1	13	.	.	.	.	.	.	.	.	.	.	C	12.06	1.825268	0.32237	.	.	ENSG00000088451	ENST00000261296	D	0.83250	-1.7	5.98	-0.345	0.12624	.	1.318270	0.04985	N	0.466405	T	0.69260	0.3091	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.53464	-0.8435	10	0.44086	T	0.13	.	3.3871	0.07276	0.3406:0.4243:0.1102:0.1249	.	6	O95455	TGDS_HUMAN	L	6	ENSP00000261296:W6L	ENSP00000261296:W6L	W	-	2	0	TGDS	94046375	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.550000	0.06034	-0.106000	0.12110	0.591000	0.81541	TGG	TGDS	-	NULL	ENSG00000088451		0.622	TGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGDS	HGNC	protein_coding	OTTHUMT00000106904.2	51	0.00	0	C	NM_014305		95248374	95248374	-1	no_errors	ENST00000261296	ensembl	human	known	69_37n	missense	59	32.95	29	SNP	0.000	A
TMEM133	83935	genome.wustl.edu	37	11	100863339	100863340	+	Frame_Shift_Del	DEL	TG	TG	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr11:100863339_100863340delTG	ENST00000303130.2	+	1	529_530	c.300_301delTG	c.(298-303)actgtafs	p.V101fs		NM_032021.2	NP_114410.1	Q9H2Q1	TM133_HUMAN	transmembrane protein 133	101						integral component of membrane (GO:0016021)				kidney(2)|large_intestine(1)|lung(1)|prostate(1)	5		Acute lymphoblastic leukemia(157;0.000869)|all_hematologic(158;0.014)		BRCA - Breast invasive adenocarcinoma(274;0.0675)		ACACATTCACTGTATCCCTCAT	0.411																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF247167	CCDS8309.1	11q22.1	2006-03-09				ENSG00000170647			24033	protein-coding gene	gene with protein product						12477932	Standard	NM_032021		Approved	AD031	uc001pgf.3	Q9H2Q1		ENST00000303130.2:c.300_301delTG	11.37:g.100863339_100863340delTG	ENSP00000303999:p.Val101fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	NULL	p.V101fs	ENST00000303130.2	37	c.300_301	CCDS8309.1	11																																																																																			TMEM133	-	NULL	ENSG00000170647		0.411	TMEM133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM133	HGNC	protein_coding	OTTHUMT00000395137.1	88	0.00	0	TG	NM_032021		100863339	100863340	+1	no_errors	ENST00000303130	ensembl	human	known	69_37n	frame_shift_del	94	12.96	14	DEL	0.000:0.000	-
TNC	3371	genome.wustl.edu	37	9	117825203	117825203	+	Silent	SNP	G	G	A	rs557438215		TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr9:117825203G>A	ENST00000350763.4	-	13	4437	c.4026C>T	c.(4024-4026)gtC>gtT	p.V1342V	TNC_ENST00000423613.2_Silent_p.V1342V|TNC_ENST00000341037.4_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000345230.3_Intron|TNC_ENST00000542877.1_Intron|TNC_ENST00000537320.1_Intron|TNC_ENST00000340094.3_Intron|TNC_ENST00000346706.3_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1342	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)	p.V1342V(1)		NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						TACCTGTGACGACCTCTACAG	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17422	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - coding silent(1)	prostate(1)											37.0	33.0	34.0					9																	117825203		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4026C>T	9.37:g.117825203G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.V1342	ENST00000350763.4	37	c.4026	CCDS6811.1	9																																																																																			TNC	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000041982		0.557	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	71	0.00	0	G	NM_002160		117825203	117825203	-1	no_errors	ENST00000350763	ensembl	human	known	69_37n	silent	121	14.79	21	SNP	1.000	A
TP53	7157	genome.wustl.edu	37	17	7579536	7579536	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr17:7579536C>A	ENST00000269305.4	-	4	340	c.151G>T	c.(151-153)Gaa>Taa	p.E51*	TP53_ENST00000455263.2_Nonsense_Mutation_p.E51*|TP53_ENST00000420246.2_Nonsense_Mutation_p.E51*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E51*|TP53_ENST00000413465.2_Nonsense_Mutation_p.E51*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E51*|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	51	Interaction with HRMT1L2.				apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.E51*(6)|p.E51fs*6(3)|p.E51fs*59(1)|p.I50fs*4(1)|p.D48fs*55(1)|p.E51fs*72(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	AACCATTGTTCAATATCGTCC	0.592		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	23	Whole gene deletion(8)|Substitution - Nonsense(6)|Deletion - Frameshift(6)|Insertion - Frameshift(3)	ovary(5)|bone(4)|skin(3)|upper_aerodigestive_tract(2)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|stomach(1)|kidney(1)|breast(1)|prostate(1)|pancreas(1)											169.0	168.0	168.0					17																	7579536		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.151G>T	17.37:g.7579536C>A	ENSP00000269305:p.Glu51*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E51*	ENST00000269305.4	37	c.151	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	15.05	2.718125	0.48622	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	3.77	0.663	0.17885	.	1.997220	0.02241	N	0.065738	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	0.6634	5.7343	0.18057	0.0:0.6465:0.0:0.3535	.	.	.	.	X	51	.	ENSP00000269305:E51X	E	-	1	0	TP53	7520261	0.000000	0.05858	0.001000	0.08648	0.010000	0.07245	-0.943000	0.03917	0.194000	0.20326	0.561000	0.74099	GAA	TP53	-	NULL	ENSG00000141510		0.592	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	34	0.00	0	C	NM_000546		7579536	7579536	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	37	35.09	20	SNP	0.001	A
TOM1L1	10040	genome.wustl.edu	37	17	53026927	53026927	+	Missense_Mutation	SNP	A	A	G			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr17:53026927A>G	ENST00000575882.1	+	13	1584	c.1231A>G	c.(1231-1233)Acc>Gcc	p.T411A	TOM1L1_ENST00000540336.1_Missense_Mutation_p.T299A|TOM1L1_ENST00000445275.2_Missense_Mutation_p.T400A|TOM1L1_ENST00000536554.1_Missense_Mutation_p.T334A|TOM1L1_ENST00000348161.4_Missense_Mutation_p.T334A|TOM1L1_ENST00000572158.1_Missense_Mutation_p.T404A|COX11_ENST00000573912.1_5'Flank	NM_005486.2	NP_005477.2	O75674	TM1L1_HUMAN	target of myb1 (chicken)-like 1	411					activation of protein kinase activity (GO:0032147)|intracellular protein transport (GO:0006886)|negative regulation of mitosis (GO:0045839)|positive regulation of protein autophosphorylation (GO:0031954)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|membrane (GO:0016020)	clathrin binding (GO:0030276)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|ubiquitin binding (GO:0043130)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	15						TAGTCTACAAACCATTGCAGC	0.393																																						dbGAP											0													141.0	138.0	139.0					17																	53026927		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010071	CCDS11582.1	17q23.2	2008-01-03	2007-01-12			ENSG00000141198			11983	protein-coding gene	gene with protein product		604701	"""target of myb1 (chicken) homolog-like 1"""			10329004, 15611048, 17977829	Standard	NM_005486		Approved	SRCASM	uc002iud.2	O75674		ENST00000575882.1:c.1231A>G	17.37:g.53026927A>G	ENSP00000460823:p.Thr411Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53G06|Q8N749	Missense_Mutation	SNP	pfam_VHS,pfam_GAT,superfamily_ENTH_VHS,smart_VHS_subgr,pirsf_TOM1,pfscan_GAT,pfscan_VHS	p.T411A	ENST00000575882.1	37	c.1231	CCDS11582.1	17	.	.	.	.	.	.	.	.	.	.	A	0.012	-1.669917	0.00758	.	.	ENSG00000141198	ENST00000445275;ENST00000540336;ENST00000348161;ENST00000536554	T;T;T	0.21932	1.98;1.99;1.99	5.46	1.91	0.25777	.	1.848060	0.03366	N	0.198331	T	0.15003	0.0362	L	0.35414	1.06	0.09310	N	1	B;B;B;B	0.10296	0.003;0.003;0.003;0.003	B;B;B;B	0.10450	0.005;0.003;0.003;0.003	T	0.23904	-1.0175	10	0.15066	T	0.55	-0.1226	2.4512	0.04518	0.5295:0.0:0.2458:0.2248	.	299;404;334;411	B4DUW5;B4E1N0;B7Z9E2;O75674	.;.;.;TM1L1_HUMAN	A	411;299;334;334	ENSP00000441242:T299A;ENSP00000343901:T334A;ENSP00000443099:T334A	ENSP00000343901:T334A	T	+	1	0	TOM1L1	50381926	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	0.360000	0.20250	0.481000	0.27557	-0.438000	0.05819	ACC	TOM1L1	-	pirsf_TOM1	ENSG00000141198		0.393	TOM1L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TOM1L1	HGNC	protein_coding	OTTHUMT00000439029.2	32	0.00	0	A	NM_005486		53026927	53026927	+1	no_errors	ENST00000575882	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	0.001	G
TUBA4A	7277	genome.wustl.edu	37	2	220118076	220118077	+	Intron	INS	-	-	GG	rs60456844|rs371311421		TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr2:220118076_220118077insGG	ENST00000248437.4	-	1	177				TUBA4A_ENST00000392088.2_Intron|TUBA4A_ENST00000498660.1_Intron|TUBA4B_ENST00000490341.1_RNA	NM_006000.2	NP_005991.1	P68366	TBA4A_HUMAN	tubulin, alpha 4a						'de novo' posttranslational protein folding (GO:0051084)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	20		Renal(207;0.0474)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)	Cabazitaxel(DB06772)|Podofilox(DB01179)|Vincristine(DB00541)	TGCTGAGTCACGGGGGGGGGGT	0.644																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK054731	CCDS2438.1, CCDS63131.1	2q36.1	2012-10-02	2007-02-12	2007-02-12	ENSG00000127824	ENSG00000127824		"""Tubulins"""	12407	protein-coding gene	gene with protein product		191110	"""tubulin, alpha 1 (testis specific)"", ""tubulin, alpha 1"""	TUBA1		3785200	Standard	NM_006000		Approved	FLJ30169, H2-ALPHA	uc002vkt.1	P68366	OTTHUMG00000133126	ENST00000248437.4:c.3+500->CC	2.37:g.220118085_220118086dupGG		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB1|B3KNQ6|P05215	RNA	INS	-	NULL	ENST00000248437.4	37	NULL	CCDS2438.1	2																																																																																			TUBA4B	-	-	ENSG00000243910		0.644	TUBA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA4B	HGNC	protein_coding	OTTHUMT00000256816.3	10	0.00	0	-	NM_006000		220118076	220118077	+1	no_errors	ENST00000473885	ensembl	human	known	69_37n	rna	9	30.77	4	INS	0.812:0.000	GG
TUBB8	347688	genome.wustl.edu	37	10	93894	93894	+	Silent	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr10:93894C>A	ENST00000309812.4	-	4	500	c.438G>T	c.(436-438)ggG>ggT	p.G146G	TUBB8_ENST00000447903.2_Silent_p.G74G|TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000413237.3_5'UTR	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	146					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GGGTACCCATCCCAGACCCAG	0.587																																					Pancreas(192;2041 3010 9013 18103)	dbGAP											0													77.0	70.0	72.0					10																	93894		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.438G>T	10.37:g.93894C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SQX9|Q8WZ78	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.G146	ENST00000309812.4	37	c.438	CCDS7051.1	10																																																																																			TUBB8	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Alpha_tubulin	ENSG00000173876		0.587	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	253	0.00	0	C	NM_177987		93894	93894	-1	no_errors	ENST00000328974	ensembl	human	known	69_37n	silent	300	18.26	67	SNP	1.000	A
TXNDC2	84203	genome.wustl.edu	37	18	9887913	9887913	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr18:9887913G>T	ENST00000306084.6	+	2	1636	c.1437G>T	c.(1435-1437)tgG>tgT	p.W479C	TXNDC2_ENST00000357775.5_Missense_Mutation_p.W412C|TXNDC2_ENST00000536353.2_3'UTR	NM_001098529.1	NP_001091999.1	Q86VQ3	TXND2_HUMAN	thioredoxin domain containing 2 (spermatozoa)	479	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|glycerol ether metabolic process (GO:0006662)|multicellular organismal development (GO:0007275)|oxidation-reduction process (GO:0055114)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|outer dense fiber (GO:0001520)	nutrient reservoir activity (GO:0045735)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(9)|ovary(2)|pancreas(1)|skin(7)|urinary_tract(1)	31						CGGCCACGTGGTGTGGGCCCT	0.587																																						dbGAP											0													93.0	70.0	78.0					18																	9887913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF080095	CCDS11846.1, CCDS42414.1	18p11.31-p11.2	2009-03-11	2009-03-11	2007-08-16	ENSG00000168454	ENSG00000168454			16470	protein-coding gene	gene with protein product	"""sperm-specific thioredoxin 1"""					11230166, 11399755	Standard	NM_001098529		Approved	SPTRX1	uc002koi.4	Q86VQ3	OTTHUMG00000131602	ENST00000306084.6:c.1437G>T	18.37:g.9887913G>T	ENSP00000304908:p.Trp479Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM73|Q8N7U4|Q96RX3|Q9H0L8	Missense_Mutation	SNP	pfam_Thioredoxin_domain,pfam_Glutenin,superfamily_Thioredoxin-like_fold	p.W479C	ENST00000306084.6	37	c.1437	CCDS42414.1	18	.	.	.	.	.	.	.	.	.	.	G	13.69	2.312588	0.40895	.	.	ENSG00000168454	ENST00000536353;ENST00000357775;ENST00000306084;ENST00000426718	T;T	0.08546	3.08;3.08	4.05	4.05	0.47172	Thioredoxin domain (1);Thioredoxin-like fold (3);	0.000000	0.85682	D	0.000000	T	0.42765	0.1217	H	0.98646	4.29	0.80722	D	1	D	0.71674	0.998	D	0.70935	0.971	T	0.61387	-0.7073	9	.	.	.	-4.7511	12.032	0.53403	0.0:0.0:1.0:0.0	.	479	Q86VQ3	TXND2_HUMAN	C	277;412;479;464	ENSP00000350419:W412C;ENSP00000304908:W479C	.	W	+	3	0	TXNDC2	9877913	1.000000	0.71417	0.992000	0.48379	0.353000	0.29299	5.829000	0.69316	2.540000	0.85666	0.650000	0.86243	TGG	TXNDC2	-	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	ENSG00000168454		0.587	TXNDC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TXNDC2	HGNC	protein_coding	OTTHUMT00000254487.1	65	0.00	0	G			9887913	9887913	+1	no_errors	ENST00000306084	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	0.994	T
USP34	9736	genome.wustl.edu	37	2	61607496	61607496	+	Splice_Site	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr2:61607496C>A	ENST00000398571.2	-	7	898	c.822G>T	c.(820-822)agG>agT	p.R274S		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	274					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			TGCATAAATACCTGAAATGAT	0.343																																						dbGAP											0													71.0	61.0	64.0					2																	61607496		1853	4095	5948	-	-	-	SO:0001630	splice_region_variant	0			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.822-1G>T	2.37:g.61607496C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.R274S	ENST00000398571.2	37	c.822	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	C	8.961	0.970479	0.18659	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.03524	3.9	5.26	2.45	0.29901	.	0.086814	0.85682	D	0.000000	T	0.03695	0.0105	L	0.46157	1.445	0.54753	D	0.999981	B	0.29037	0.231	B	0.21917	0.037	T	0.46020	-0.9221	10	0.62326	D	0.03	.	6.186	0.20498	0.1323:0.6555:0.0:0.2122	.	274	Q70CQ2	UBP34_HUMAN	S	122;122;274	ENSP00000381577:R274S	ENSP00000263989:R122S	R	-	3	2	USP34	61461000	1.000000	0.71417	1.000000	0.80357	0.052000	0.14988	1.571000	0.36450	0.303000	0.22785	-0.188000	0.12872	AGG	USP34	-	NULL	ENSG00000115464		0.343	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	11	0.00	0	C		Missense_Mutation	61607496	61607496	-1	no_errors	ENST00000398571	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	A
VSIG8	391123	genome.wustl.edu	37	1	159832270	159832273	+	Frame_Shift_Del	DEL	CAGG	CAGG	-			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	CAGG	CAGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr1:159832270_159832273delCAGG	ENST00000368100.1	-	1	174_177	c.39_42delCCTG	c.(37-42)tgcctgfs	p.CL13fs	RP11-190A12.7_ENST00000544342.1_Intron	NM_001013661.1	NP_001013683.1	Q5VU13	VSIG8_HUMAN	V-set and immunoglobulin domain containing 8	13						integral component of membrane (GO:0016021)|intracellular (GO:0005622)	poly(A) RNA binding (GO:0044822)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	8	all_hematologic(112;0.0597)					TACCTGGGCTCAGGCACACGAGTA	0.632																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS30913.1	1q23.2	2013-01-11			ENSG00000243284	ENSG00000243284		"""Immunoglobulin superfamily / V-set domain containing"""	32063	protein-coding gene	gene with protein product							Standard	NM_001013661		Approved		uc001fuh.3	Q5VU13	OTTHUMG00000168834	ENST00000368100.1:c.39_42delCCTG	1.37:g.159832270_159832273delCAGG	ENSP00000357080:p.Cys13fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VU14	Frame_Shift_Del	DEL	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like	p.C13fs	ENST00000368100.1	37	c.42_39	CCDS30913.1	1																																																																																			VSIG8	-	NULL	ENSG00000243284		0.632	VSIG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VSIG8	HGNC	protein_coding	OTTHUMT00000085978.8	98	0.00	0	CAGG	NM_001013661		159832270	159832273	-1	no_errors	ENST00000368100	ensembl	human	known	69_37n	frame_shift_del	81	35.16	45	DEL	1.000:1.000:1.000:1.000	-
WSCD2	9671	genome.wustl.edu	37	12	108634216	108634216	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr12:108634216G>A	ENST00000332082.4	+	9	2058	c.1240G>A	c.(1240-1242)Gcc>Acc	p.A414T	WSCD2_ENST00000261400.3_Missense_Mutation_p.A414T|WSCD2_ENST00000549903.1_Missense_Mutation_p.A414T|WSCD2_ENST00000547525.1_Missense_Mutation_p.A414T			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	414						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						CTTCGACGCCGCCATCCTGCT	0.607																																						dbGAP											0													107.0	116.0	113.0					12																	108634216		2041	4197	6238	-	-	-	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.1240G>A	12.37:g.108634216G>A	ENSP00000331933:p.Ala414Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.A414T	ENST00000332082.4	37	c.1240	CCDS41828.1	12	.	.	.	.	.	.	.	.	.	.	G	21.2	4.119676	0.77323	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.36699	1.24;4.64;1.24;4.64	4.9	4.9	0.64082	.	0.097747	0.64402	D	0.000001	T	0.44008	0.1273	M	0.80028	2.48	0.58432	D	0.99999	P;P	0.43352	0.804;0.571	B;B	0.38156	0.266;0.078	T	0.57046	-0.7878	10	0.72032	D	0.01	-38.815	17.3052	0.87192	0.0:0.0:1.0:0.0	.	414;414	Q2TBF2-2;Q2TBF2	.;WSCD2_HUMAN	T	414	ENSP00000448047:A414T;ENSP00000261400:A414T;ENSP00000331933:A414T;ENSP00000447272:A414T	ENSP00000261400:A414T	A	+	1	0	WSCD2	107158346	1.000000	0.71417	0.956000	0.39512	0.968000	0.65278	5.793000	0.69060	2.551000	0.86045	0.644000	0.83932	GCC	WSCD2	-	NULL	ENSG00000075035		0.607	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	33	0.00	0	G	NM_014653		108634216	108634216	+1	no_errors	ENST00000261400	ensembl	human	known	69_37n	missense	51	13.56	8	SNP	0.994	A
XRCC6	2547	genome.wustl.edu	37	22	42032720	42032720	+	Missense_Mutation	SNP	G	G	C	rs377060517		TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr22:42032720G>C	ENST00000359308.4	+	4	1190	c.535G>C	c.(535-537)Gac>Cac	p.D179H	XRCC6_ENST00000360079.3_Missense_Mutation_p.D179H|XRCC6_ENST00000402580.3_Missense_Mutation_p.D138H|XRCC6_ENST00000405506.1_Missense_Mutation_p.D129H|XRCC6_ENST00000405878.1_Missense_Mutation_p.D179H|XRCC6_ENST00000428575.2_Missense_Mutation_p.D46H			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	179					brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						CCATGGCAATGACAGTGCCAA	0.483								Non-homologous end-joining																														dbGAP											0													72.0	70.0	71.0					22																	42032720		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.535G>C	22.37:g.42032720G>C	ENSP00000352257:p.Asp179His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Missense_Mutation	SNP	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_Ku_N,pfam_DNA_helicase_ATP-dep_Ku,pfam_Ku_C,pfam_SAP_DNA-bd,superfamily_SPOC-like,smart_DNA_helicase_ATP-dep_Ku,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd,tigrfam_DNA_helicase_ATP-dep_Ku70	p.D179H	ENST00000359308.4	37	c.535	CCDS14021.1	22	.	.	.	.	.	.	.	.	.	.	G	25.6	4.652226	0.88056	.	.	ENSG00000196419	ENST00000360079;ENST00000402580;ENST00000428575;ENST00000359308;ENST00000405878;ENST00000402409;ENST00000405506	.	.	.	5.39	5.39	0.77823	Ku70/Ku80, N-terminal alpha/beta (1);	0.000000	0.85682	D	0.000000	D	0.84768	0.5545	M	0.87758	2.905	0.80722	D	1	D;D;D;D	0.89917	0.998;0.99;1.0;0.996	D;P;D;D	0.75484	0.915;0.908;0.986;0.952	D	0.87111	0.2185	9	0.72032	D	0.01	-23.8221	19.1841	0.93635	0.0:0.0:1.0:0.0	.	129;179;138;179	B1AHC9;B1AHC7;B1AHC8;P12956	.;.;.;XRCC6_HUMAN	H	179;138;46;179;179;179;129	.	ENSP00000352257:D179H	D	+	1	0	XRCC6	40362666	1.000000	0.71417	0.990000	0.47175	0.995000	0.86356	9.476000	0.97823	2.537000	0.85549	0.655000	0.94253	GAC	XRCC6	-	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_Ku_N,tigrfam_DNA_helicase_ATP-dep_Ku70	ENSG00000196419		0.483	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	HGNC	protein_coding	OTTHUMT00000321688.1	45	0.00	0	G	NM_001469		42032720	42032720	+1	no_errors	ENST00000359308	ensembl	human	known	69_37n	missense	43	29.51	18	SNP	1.000	C
SPCS2	9789	genome.wustl.edu	37	11	74660143	74660143	+	5'Flank	SNP	G	G	C	rs2165163	byFrequency	TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr11:74660143G>C	ENST00000263672.6	+	0	0				XRRA1_ENST00000533598.1_5'Flank|SPCS2_ENST00000526361.1_5'Flank|XRRA1_ENST00000321448.8_5'UTR|XRRA1_ENST00000527087.1_5'UTR|SPCS2_ENST00000530257.1_5'Flank|XRRA1_ENST00000340360.6_5'UTR	NM_014752.2	NP_055567.2	Q15005	SPCS2_HUMAN	signal peptidase complex subunit 2 homolog (S. cerevisiae)						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|regulation of insulin secretion (GO:0050796)|signal peptide processing (GO:0006465)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|signal peptidase complex (GO:0005787)	peptidase activity (GO:0008233)			breast(1)	1						CAGTGTAGGCGGCAACCGACG	0.667													G|||	1346	0.26877	0.0915	0.4827	5008	,	,		15334	0.5069		0.2853	False		,,,				2504	0.0941					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			D14658	CCDS44681.1	11q13.4	2008-02-05			ENSG00000118363	ENSG00000118363			28962	protein-coding gene	gene with protein product						7788527	Standard	NM_014752		Approved	KIAA0102	uc001ovu.2	Q15005	OTTHUMG00000165517		11.37:g.74660143G>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15507|Q3KQT0|Q641R4|Q6FG65|Q6IRX0|Q6P1P4|Q96HU9	RNA	SNP	-	NULL	ENST00000263672.6	37	NULL	CCDS44681.1	11																																																																																			XRRA1	-	-	ENSG00000166435		0.667	SPCS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384587.1	22	0.00	0	G	NM_014752		74660143	74660143	-1	no_errors	ENST00000524430	ensembl	human	known	69_37n	rna	34	15.00	6	SNP	0.794	C
ZFHX4	79776	genome.wustl.edu	37	8	77767800	77767800	+	Silent	SNP	C	C	T			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr8:77767800C>T	ENST00000521891.2	+	10	9091	c.8643C>T	c.(8641-8643)gaC>gaT	p.D2881D	ZFHX4_ENST00000050961.6_Silent_p.D2836D|ZFHX4_ENST00000455469.2_Silent_p.D2836D|ZFHX4_ENST00000518282.1_Silent_p.D2855D	NM_024721.4	NP_078997.4	Q86UP3	ZFHX4_HUMAN	zinc finger homeobox 4	2836					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(3)|breast(11)|central_nervous_system(1)|endometrium(36)|haematopoietic_and_lymphoid_tissue(2)|kidney(15)|large_intestine(66)|liver(2)|lung(245)|ovary(11)|pancreas(3)|prostate(11)|skin(7)|upper_aerodigestive_tract(13)|urinary_tract(6)	432			BRCA - Breast invasive adenocarcinoma(89;0.0895)			AAGATGGCGACCACGACCAAA	0.517										HNSCC(33;0.089)																												dbGAP											0													88.0	90.0	89.0					8																	77767800		2002	4165	6167	-	-	-	SO:0001819	synonymous_variant	0				CCDS47878.1, CCDS47878.2	8q21.11	2012-07-02	2007-07-16		ENSG00000091656	ENSG00000091656		"""Homeoboxes / ZF class"""	30939	protein-coding gene	gene with protein product		606940	"""zinc finger homeodomain 4"""			10873665, 11935336	Standard	NM_024721		Approved	ZFH4, FLJ20980	uc003yau.2	Q86UP3	OTTHUMG00000164557	ENST00000521891.2:c.8643C>T	8.37:g.77767800C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V138|Q18PS0|Q6ZN20	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D2881	ENST00000521891.2	37	c.8643	CCDS47878.2	8																																																																																			ZFHX4	-	NULL	ENSG00000091656		0.517	ZFHX4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFHX4	HGNC	protein_coding	OTTHUMT00000379197.2	25	0.00	0	C	NM_024721		77767800	77767800	+1	no_errors	ENST00000521891	ensembl	human	known	69_37n	silent	33	10.81	4	SNP	1.000	T
ZNF610	162963	genome.wustl.edu	37	19	52857606	52857606	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr19:52857606G>A	ENST00000403906.3	+	5	749	c.293G>A	c.(292-294)aGg>aAg	p.R98K	ZNF610_ENST00000321287.8_Missense_Mutation_p.R98K|ZNF610_ENST00000601151.1_Intron|ZNF610_ENST00000327920.8_Missense_Mutation_p.R98K	NM_001161425.1	NP_001154897.1	Q8N9Z0	ZN610_HUMAN	zinc finger protein 610	98					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(8)|liver(2)|lung(9)|ovary(2)|stomach(2)|upper_aerodigestive_tract(2)	34				OV - Ovarian serous cystadenocarcinoma(262;0.00396)|GBM - Glioblastoma multiforme(134;0.00434)		ACAGATGGAAGGGAATGTGTC	0.403																																						dbGAP											0													72.0	76.0	74.0					19																	52857606		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093359	CCDS12851.1, CCDS54309.1	19q13.41	2013-01-08			ENSG00000167554	ENSG00000167554		"""Zinc fingers, C2H2-type"", ""-"""	26687	protein-coding gene	gene with protein product						12477932	Standard	NM_001161425		Approved	FLJ36040	uc002pyx.4	Q8N9Z0		ENST00000403906.3:c.293G>A	19.37:g.52857606G>A	ENSP00000383922:p.Arg98Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4C3|Q86YH8|Q8NDS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R98K	ENST00000403906.3	37	c.293	CCDS12851.1	19	.	.	.	.	.	.	.	.	.	.	G	5.404	0.259797	0.10239	.	.	ENSG00000167554	ENST00000403906;ENST00000327920	T;T	0.05199	3.48;3.48	1.3	1.3	0.21679	.	.	.	.	.	T	0.03827	0.0108	L	0.48642	1.525	0.09310	N	1	P	0.35139	0.486	B	0.17098	0.017	T	0.32561	-0.9902	9	0.06365	T	0.9	.	5.9952	0.19489	0.0:0.0:1.0:0.0	.	98	Q8N9Z0	ZN610_HUMAN	K	98	ENSP00000383922:R98K;ENSP00000327597:R98K	ENSP00000327597:R98K	R	+	2	0	ZNF610	57549418	0.000000	0.05858	0.003000	0.11579	0.006000	0.05464	0.337000	0.19841	1.017000	0.39495	0.514000	0.50259	AGG	ZNF610	-	NULL	ENSG00000167554		0.403	ZNF610-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF610	HGNC	protein_coding	OTTHUMT00000462880.1	23	0.00	0	G	NM_173530		52857606	52857606	+1	no_errors	ENST00000327920	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	0.003	A
ZSCAN1	284312	genome.wustl.edu	37	19	58565195	58565195	+	Missense_Mutation	SNP	C	C	A			TCGA-JL-A3YW-01A-12D-A23C-09	TCGA-JL-A3YW-10B-01D-A23C-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9db7757b-7f31-4a5e-aa19-480a3f63c744	59907891-205d-4fbe-ac2e-98cb412eee76	g.chr19:58565195C>A	ENST00000282326.1	+	6	1250	c.1003C>A	c.(1003-1005)Ctc>Atc	p.L335I		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	335					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CAACTCCGTCCTCACTGAGCA	0.647																																						dbGAP											0													62.0	56.0	58.0					19																	58565195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.1003C>A	19.37:g.58565195C>A	ENSP00000282326:p.Leu335Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B798|Q6WLH8|Q86WS8	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L335I	ENST00000282326.1	37	c.1003	CCDS12969.1	19	.	.	.	.	.	.	.	.	.	.	C	15.32	2.800037	0.50208	.	.	ENSG00000152467	ENST00000282326	T	0.41065	1.01	1.14	1.14	0.20703	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38692	0.1050	N	0.08118	0	0.80722	D	1	D	0.76494	0.999	D	0.75484	0.986	T	0.39742	-0.9599	9	0.87932	D	0	.	8.1621	0.31204	0.0:1.0:0.0:0.0	.	335	Q8NBB4	ZSCA1_HUMAN	I	335	ENSP00000282326:L335I	ENSP00000282326:L335I	L	+	1	0	ZSCAN1	63257007	0.470000	0.25854	0.004000	0.12327	0.003000	0.03518	3.617000	0.54181	0.930000	0.37217	0.491000	0.48974	CTC	ZSCAN1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000152467		0.647	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	HGNC	protein_coding	OTTHUMT00000466427.1	69	0.00	0	C	NM_182572		58565195	58565195	+1	no_errors	ENST00000282326	ensembl	human	known	69_37n	missense	80	15.79	15	SNP	0.416	A
