#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSBG1	23205	genome.wustl.edu	37	15	78474920	78474920	+	Missense_Mutation	SNP	T	T	C			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr15:78474920T>C	ENST00000258873.4	-	7	987	c.782A>G	c.(781-783)gAg>gGg	p.E261G	ACSBG1_ENST00000541759.1_Missense_Mutation_p.E19G|ACSBG1_ENST00000560817.1_Missense_Mutation_p.E19G	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	261					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CAGGGCTTCCTCAGGCACTTC	0.602																																						dbGAP											0													81.0	71.0	74.0					15																	78474920		2196	4293	6489	-	-	-	SO:0001583	missense	0			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.782A>G	15.37:g.78474920T>C	ENSP00000258873:p.Glu261Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB61|O75126|Q76N27|Q9HC26	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.E261G	ENST00000258873.4	37	c.782	CCDS10298.1	15	.	.	.	.	.	.	.	.	.	.	T	14.65	2.598938	0.46318	.	.	ENSG00000103740	ENST00000258873;ENST00000541759	T;T	0.41400	1.0;2.76	5.35	5.35	0.76521	AMP-dependent synthetase/ligase (1);	0.374332	0.25845	N	0.027931	T	0.45657	0.1353	L	0.46157	1.445	0.40206	D	0.977578	P;B	0.34699	0.464;0.029	B;B	0.42625	0.393;0.088	T	0.50516	-0.8819	10	0.66056	D	0.02	-18.4786	14.2276	0.65871	0.0:0.0:0.0:1.0	.	257;261	B7Z2Y6;Q96GR2	.;ACBG1_HUMAN	G	261;19	ENSP00000258873:E261G;ENSP00000439955:E19G	ENSP00000258873:E261G	E	-	2	0	ACSBG1	76261975	1.000000	0.71417	0.609000	0.28983	0.205000	0.24178	7.923000	0.87546	2.026000	0.59711	0.529000	0.55759	GAG	ACSBG1	-	pfam_AMP-dep_Synth/Lig	ENSG00000103740		0.602	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	HGNC	protein_coding	OTTHUMT00000289802.2	57	0.00	0	T	NM_015162		78474920	78474920	-1	no_errors	ENST00000258873	ensembl	human	known	69_37n	missense	40	39.39	26	SNP	0.997	C
ACTN4	81	genome.wustl.edu	37	19	39220426	39220426	+	3'UTR	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr19:39220426G>A	ENST00000252699.2	+	0	3166				ACTN4_ENST00000497637.1_3'UTR	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4						actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCTTTGCTCTGAGGTCCCTTC	0.617																																					Colon(168;199 1940 10254 46213 46384)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.*354G>A	19.37:g.39220426G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4K467|D6PXK4|O76048	RNA	SNP	-	NULL	ENST00000252699.2	37	NULL	CCDS12518.1	19																																																																																			ACTN4	-	-	ENSG00000130402		0.617	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	41	0.00	0	G			39220426	39220426	+1	no_errors	ENST00000497637	ensembl	human	putative	69_37n	rna	21	41.67	15	SNP	0.086	A
ARHGDIA	396	genome.wustl.edu	37	17	79827427	79827427	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr17:79827427C>T	ENST00000269321.7	-	3	400	c.265G>A	c.(265-267)Gac>Aac	p.D89N	ARHGDIA_ENST00000580685.1_Missense_Mutation_p.D89N|RP11-498C9.3_ENST00000576021.1_RNA|ARHGDIA_ENST00000582520.1_5'Flank|ARHGDIA_ENST00000400721.4_Missense_Mutation_p.D89N|ARHGDIA_ENST00000584461.1_Missense_Mutation_p.D89N|ARHGDIA_ENST00000541078.2_Missense_Mutation_p.D89N|ARHGDIA_ENST00000581876.1_Intron|RP11-498C9.3_ENST00000576554.1_RNA	NM_001185078.1|NM_004309.4	NP_001172007.1|NP_004300.1	P52565	GDIR1_HUMAN	Rho GDP dissociation inhibitor (GDI) alpha	89					cellular component movement (GO:0006928)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell adhesion (GO:0007162)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of axonogenesis (GO:0050772)|regulation of axonogenesis (GO:0050770)|regulation of protein localization (GO:0032880)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|semaphorin-plexin signaling pathway (GO:0071526)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)	GTPase activator activity (GO:0005096)|Rho GDP-dissociation inhibitor activity (GO:0005094)			endometrium(1)|lung(1)|prostate(1)	3	all_neural(118;0.0878)|Ovarian(332;0.12)		BRCA - Breast invasive adenocarcinoma(99;0.013)|OV - Ovarian serous cystadenocarcinoma(97;0.0382)			CCCGTCAGGTCCAGCTCCAGG	0.746																																						dbGAP											0													7.0	11.0	10.0					17																	79827427		2110	4159	6269	-	-	-	SO:0001583	missense	0			BC028333	CCDS11788.1, CCDS58609.1	17q25.3	2005-12-20				ENSG00000141522			678	protein-coding gene	gene with protein product		601925		GDIA1		9186513	Standard	NM_001185077		Approved	RHOGDI	uc002kbq.3	P52565		ENST00000269321.7:c.265G>A	17.37:g.79827427C>T	ENSP00000269321:p.Asp89Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXW0|B2R5X1|B4DDD3|B4DUV9|Q6IBM5	Missense_Mutation	SNP	pfam_Rho_GDI,superfamily_Ig_E-set,prints_Rho_GDI	p.D89N	ENST00000269321.7	37	c.265	CCDS11788.1	17	.	.	.	.	.	.	.	.	.	.	C	19.25	3.792247	0.70452	.	.	ENSG00000141522	ENST00000269321;ENST00000541078;ENST00000400721	.	.	.	4.37	3.4	0.38934	Immunoglobulin E-set (1);	0.103062	0.64402	D	0.000005	T	0.55353	0.1915	M	0.62723	1.935	0.80722	D	1	B;B;P	0.42757	0.329;0.329;0.789	B;B;B	0.43478	0.246;0.4;0.421	T	0.55774	-0.8088	9	0.45353	T	0.12	-47.0333	9.6475	0.39877	0.0:0.8227:0.0:0.1773	.	89;89;89	A8MXW0;B4DUV9;P52565	.;.;GDIR1_HUMAN	N	89	.	ENSP00000269321:D89N	D	-	1	0	ARHGDIA	77420716	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	3.261000	0.51530	1.052000	0.40392	0.563000	0.77884	GAC	ARHGDIA	-	pfam_Rho_GDI,superfamily_Ig_E-set,prints_Rho_GDI	ENSG00000141522		0.746	ARHGDIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGDIA	HGNC	protein_coding	OTTHUMT00000441679.2	22	0.00	0	C	NM_004309		79827427	79827427	-1	no_errors	ENST00000269321	ensembl	human	known	69_37n	missense	8	50.00	8	SNP	1.000	T
BRWD3	254065	genome.wustl.edu	37	X	79947371	79947371	+	Silent	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chrX:79947371G>A	ENST00000373275.4	-	30	3648	c.3432C>T	c.(3430-3432)gaC>gaT	p.D1144D	BRWD3_ENST00000473691.1_5'UTR	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	1144					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CACATTCTTCGTCTCTGGAAT	0.463																																						dbGAP											0													91.0	75.0	81.0					X																	79947371		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.3432C>T	X.37:g.79947371G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Silent	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.D1144	ENST00000373275.4	37	c.3432	CCDS14447.1	X																																																																																			BRWD3	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000165288		0.463	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	72	0.00	0	G	NM_153252		79947371	79947371	-1	no_errors	ENST00000373275	ensembl	human	known	69_37n	silent	48	28.36	19	SNP	1.000	A
C6orf136	221545	genome.wustl.edu	37	6	30615302	30615302	+	Intron	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr6:30615302G>A	ENST00000376473.5	+	1	231				C6orf136_ENST00000293604.6_Silent_p.L98L|C6orf136_ENST00000376471.4_Intron|C6orf136_ENST00000528347.2_5'Flank|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000493705.1_Intron	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						TCCCAGGTTTGAGGGCGGTCA	0.711																																						dbGAP											0													3.0	5.0	5.0					6																	30615302		640	1505	2145	-	-	-	SO:0001627	intron_variant	0			BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+222G>A	6.37:g.30615302G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Silent	SNP	pfam_DUF2358	p.L98	ENST00000376473.5	37	c.294	CCDS43443.1	6																																																																																			C6orf136	-	NULL	ENSG00000204564		0.711	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf136	HGNC	protein_coding	OTTHUMT00000076457.4	74	0.00	0	G	NM_145029		30615302	30615302	+1	no_errors	ENST00000293604	ensembl	human	known	69_37n	silent	40	35.48	22	SNP	0.000	A
CAMSAP3	57662	genome.wustl.edu	37	19	7676700	7676700	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr19:7676700G>A	ENST00000160298.4	+	11	1422	c.1321G>A	c.(1321-1323)Gcg>Acg	p.A441T	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.A468T	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	441	Pro-rich.				epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						CCCGCGTCCCGCGCCGGCCAG	0.701																																						dbGAP											0													11.0	14.0	13.0					19																	7676700		1894	4101	5995	-	-	-	SO:0001583	missense	0			AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1321G>A	19.37:g.7676700G>A	ENSP00000160298:p.Ala441Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDF1	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.A468T	ENST00000160298.4	37	c.1402	CCDS42489.1	19	.	.	.	.	.	.	.	.	.	.	g	0.024	-1.393875	0.01175	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.14516	2.5;2.5	4.48	3.34	0.38264	.	3.045200	0.00977	N	0.003324	T	0.08891	0.0220	N	0.08118	0	0.09310	N	1	B;B	0.31054	0.0;0.306	B;B	0.25140	0.0;0.058	T	0.19614	-1.0300	10	0.11485	T	0.65	-5.5204	14.0481	0.64716	0.0:0.0:0.8383:0.1617	.	441;468	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	T	468;441	ENSP00000416797:A468T;ENSP00000160298:A441T	ENSP00000160298:A441T	A	+	1	0	KIAA1543	7582700	0.001000	0.12720	0.004000	0.12327	0.031000	0.12232	0.779000	0.26746	2.036000	0.60181	0.551000	0.68910	GCG	CAMSAP3	-	NULL	ENSG00000076826		0.701	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAMSAP3	HGNC	protein_coding	OTTHUMT00000459300.1	28	0.00	0	G	XM_048362		7676700	7676700	+1	no_errors	ENST00000446248	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	0.000	A
CANT1	124583	genome.wustl.edu	37	17	76989950	76989950	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr17:76989950G>T	ENST00000302345.2	-	4	1382	c.888C>A	c.(886-888)ttC>ttA	p.F296L	CANT1_ENST00000392446.5_Missense_Mutation_p.F296L|CANT1_ENST00000591773.1_Missense_Mutation_p.F296L	NM_001159773.1|NM_138793.3	NP_001153245.1|NP_620148.1	Q8WVQ1	CANT1_HUMAN	calcium activated nucleotidase 1	296					positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|proteoglycan biosynthetic process (GO:0030166)|signal transduction (GO:0007165)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|signal transducer activity (GO:0004871)|uridine-diphosphatase activity (GO:0045134)		CANT1/ETV4(3)	cervix(1)|endometrium(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)	16			BRCA - Breast invasive adenocarcinoma(99;0.0362)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			GCGGCAGGAAGAACCAGCGCT	0.677			T	ETV4	prostate																																	dbGAP		Dom	yes		17	17q25	124583	calcium activated nucleotidase 1		E	0													17.0	13.0	15.0					17																	76989950		2200	4291	6491	-	-	-	SO:0001583	missense	0			AJ312208	CCDS11760.1	17q25.3	2008-02-05	2004-10-12	2004-10-15		ENSG00000171302			19721	protein-coding gene	gene with protein product	"""Soluble Ca-Activated Nucleotidase, isozyme 1"""	613165				12167635	Standard	NM_138793		Approved	SHAPY, SCAN-1	uc002jwk.3	Q8WVQ1		ENST00000302345.2:c.888C>A	17.37:g.76989950G>T	ENSP00000307674:p.Phe296Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ54|Q7Z2J7|Q8NG05|Q8NHP0|Q9BSD5	Missense_Mutation	SNP	pfam_Apyrase,superfamily_Apyrase	p.F296L	ENST00000302345.2	37	c.888	CCDS11760.1	17	.	.	.	.	.	.	.	.	.	.	G	27.7	4.855349	0.91355	.	.	ENSG00000171302	ENST00000302345;ENST00000392446;ENST00000339300	D;D	0.85088	-1.94;-1.94	5.26	2.9	0.33743	.	0.048673	0.85682	N	0.000000	D	0.90923	0.7147	M	0.86178	2.8	0.80722	D	1	D	0.60160	0.987	P	0.60117	0.869	D	0.91583	0.5280	10	0.54805	T	0.06	-5.2312	12.8077	0.57622	0.158:0.0:0.842:0.0	.	296	Q8WVQ1	CANT1_HUMAN	L	296;296;245	ENSP00000307674:F296L;ENSP00000376241:F296L	ENSP00000307674:F296L	F	-	3	2	CANT1	74501545	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	3.391000	0.52530	1.206000	0.43276	0.555000	0.69702	TTC	CANT1	-	pfam_Apyrase,superfamily_Apyrase	ENSG00000171302		0.677	CANT1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CANT1	HGNC	protein_coding	OTTHUMT00000437723.2	30	0.00	0	G	NM_138793		76989950	76989950	-1	no_errors	ENST00000302345	ensembl	human	known	69_37n	missense	10	58.33	14	SNP	1.000	T
CEP19	84984	genome.wustl.edu	37	3	196434521	196434523	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr3:196434521_196434523delCTT	ENST00000399942.4	-	2	580_582	c.286_288delAAG	c.(286-288)aagdel	p.K96del	RNU6-646P_ENST00000364571.1_RNA|CEP19_ENST00000409690.3_In_Frame_Del_p.K135del			Q96LK0	CEP19_HUMAN	centrosomal protein 19kDa	131						centriole (GO:0005814)|ciliary basal body (GO:0036064)|spindle pole (GO:0000922)				NS(1)|breast(2)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	10						TTGGATCATCCTTCTTCTTCTGA	0.414																																						dbGAP											0										4,3632		1,2,1815						5.7	1.0			167	0,7884		0,0,3942	no	coding	CEP19	NM_032898.3		1,2,5757	A1A1,A1R,RR		0.0,0.11,0.0347				4,11516				-	-	-	SO:0001651	inframe_deletion	0			BC007827	CCDS43193.2	3q29	2014-02-20	2011-05-06	2011-05-06	ENSG00000174007	ENSG00000174007			28209	protein-coding gene	gene with protein product		615586	"""chromosome 3 open reading frame 34"""	C3orf34		21399614	Standard	XM_005269370		Approved	MGC14126	uc011btw.2	Q96LK0	OTTHUMG00000153933	ENST00000399942.4:c.286_288delAAG	3.37:g.196434527_196434529delCTT	ENSP00000382823:p.Lys96del	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA74|Q96I48	In_Frame_Del	DEL	NULL	p.K135in_frame_del	ENST00000399942.4	37	c.405_403		3																																																																																			CEP19	-	NULL	ENSG00000174007		0.414	CEP19-002	NOVEL	not_organism_supported|basic|exp_conf	protein_coding	CEP19	HGNC	protein_coding	OTTHUMT00000333081.1	74	0.00	0	CTT	NM_032898		196434521	196434523	-1	no_errors	ENST00000409690	ensembl	human	known	69_37n	in_frame_del	56	13.64	9	DEL	0.995:1.000:1.000	-
COL28A1	340267	genome.wustl.edu	37	7	7561589	7561589	+	Nonsense_Mutation	SNP	C	C	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr7:7561589C>A	ENST00000399429.3	-	5	846	c.706G>T	c.(706-708)Gaa>Taa	p.E236*		NM_001037763.2	NP_001032852.2	Q2UY09	COSA1_HUMAN	collagen, type XXVIII, alpha 1	236					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	42		Ovarian(82;0.0789)		UCEC - Uterine corpus endometrioid carcinoma (126;0.228)		ATCTTGCGTTCACACTGAATC	0.353																																						dbGAP											0													89.0	85.0	87.0					7																	7561589		1874	4108	5982	-	-	-	SO:0001587	stop_gained	0			AJ890451	CCDS43553.1	7p21.3	2013-01-16			ENSG00000215018	ENSG00000215018		"""Collagens"""	22442	protein-coding gene	gene with protein product		609996				16330543	Standard	NM_001037763		Approved		uc003src.1	Q2UY09	OTTHUMG00000150034	ENST00000399429.3:c.706G>T	7.37:g.7561589C>A	ENSP00000382356:p.Glu236*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D101|A4D106|A4D107|A8MVR2|B9EGX9|Q2UY07|Q2UY08	Nonsense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,pfam_Prot_inh_Kunz-m,superfamily_Prot_inh_Kunz-m,smart_VWF_A,smart_Prot_inh_Kunz-m,pfscan_VWF_A,pfscan_Prot_inh_Kunz-m	p.E236*	ENST00000399429.3	37	c.706	CCDS43553.1	7	.	.	.	.	.	.	.	.	.	.	C	38	6.974196	0.97975	.	.	ENSG00000215018	ENST00000399429;ENST00000399419;ENST00000448652	.	.	.	4.65	4.65	0.58169	.	0.646253	0.13814	U	0.360925	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	-7.7319	16.8378	0.85961	0.0:1.0:0.0:0.0	.	.	.	.	X	236	.	ENSP00000382347:E236X	E	-	1	0	COL28A1	7528114	0.460000	0.25776	0.999000	0.59377	0.986000	0.74619	0.539000	0.23175	2.589000	0.87451	0.650000	0.86243	GAA	COL28A1	-	NULL	ENSG00000215018		0.353	COL28A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL28A1	HGNC	protein_coding	OTTHUMT00000315899.1	47	0.00	0	C	NM_001037763		7561589	7561589	-1	no_errors	ENST00000399429	ensembl	human	known	69_37n	nonsense	30	38.00	19	SNP	0.997	A
CSMD2	114784	genome.wustl.edu	37	1	34025030	34025030	+	Silent	SNP	A	A	G	rs16835593	byFrequency	TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr1:34025030A>G	ENST00000373381.4	-	54	8600	c.8424T>C	c.(8422-8424)acT>acC	p.T2808T		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	2785	Sushi 19. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GGTTACCCTGAGTGAGGCCGT	0.527													A|||	601	0.120008	0.0091	0.0893	5008	,	,		20421	0.2192		0.1531	False		,,,				2504	0.1554					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.8424T>C	1.37:g.34025030A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Silent	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.T2808	ENST00000373381.4	37	c.8424		1																																																																																			CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.527	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		44	0.00	0	A	NM_052896		34025030	34025030	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	silent	26	16.13	5	SNP	0.998	G
DHX8	1659	genome.wustl.edu	37	17	41570357	41570357	+	Missense_Mutation	SNP	A	A	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr17:41570357A>T	ENST00000262415.3	+	6	884	c.812A>T	c.(811-813)aAa>aTa	p.K271I	DHX8_ENST00000540306.1_Missense_Mutation_p.K271I	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	271	S1 motif. {ECO:0000255|PROSITE- ProRule:PRU00180}.				ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		TATAATGGCAAAGTTACCAGC	0.483																																					NSCLC(56;1548 1661 49258 49987)	dbGAP											0													138.0	131.0	134.0					17																	41570357		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.812A>T	17.37:g.41570357A>T	ENSP00000262415:p.Lys271Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K271I	ENST00000262415.3	37	c.812	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	A	13.08	2.130612	0.37630	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	T;T	0.44482	0.92;0.92	5.37	4.29	0.51040	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);RNA-binding domain, S1 (1);Ribosomal protein S1, RNA-binding domain (2);	0.000000	0.85682	D	0.000000	T	0.48484	0.1502	L	0.45698	1.435	0.80722	D	1	P;B	0.48162	0.906;0.261	P;B	0.54706	0.759;0.159	T	0.43621	-0.9380	10	0.54805	T	0.06	.	10.2965	0.43627	0.9226:0.0:0.0774:0.0	.	271;271	F5H658;Q14562	.;DHX8_HUMAN	I	271	ENSP00000437886:K271I;ENSP00000262415:K271I	ENSP00000262415:K271I	K	+	2	0	DHX8	38925883	1.000000	0.71417	0.999000	0.59377	0.516000	0.34256	7.102000	0.77005	0.887000	0.36136	-0.334000	0.08254	AAA	DHX8	-	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	ENSG00000067596		0.483	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	39	0.00	0	A			41570357	41570357	+1	no_errors	ENST00000262415	ensembl	human	known	69_37n	missense	23	48.89	22	SNP	1.000	T
GAPVD1	26130	genome.wustl.edu	37	9	128061327	128061327	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr9:128061327C>T	ENST00000495955.1	+	4	417	c.127C>T	c.(127-129)Cgt>Tgt	p.R43C	GAPVD1_ENST00000470056.1_Missense_Mutation_p.R43C|GAPVD1_ENST00000297933.6_Missense_Mutation_p.R43C|GAPVD1_ENST00000394105.2_Missense_Mutation_p.R43C|GAPVD1_ENST00000265956.4_Missense_Mutation_p.R43C|GAPVD1_ENST00000394084.1_Missense_Mutation_p.R43C|GAPVD1_ENST00000394104.2_Missense_Mutation_p.R43C|GAPVD1_ENST00000312123.9_Missense_Mutation_p.R43C|GAPVD1_ENST00000394083.2_Missense_Mutation_p.R43C			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	43					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						AAAGTTGTATCGTACAGCATG	0.403																																						dbGAP											0													113.0	102.0	106.0					9																	128061327		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.127C>T	9.37:g.128061327C>T	ENSP00000419063:p.Arg43Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Missense_Mutation	SNP	pfam_RasGAP,pfam_VPS9,superfamily_Rho_GTPase_activation_prot,smart_VPS9_subgr,pfscan_VPS9,pfscan_RasGAP	p.R43C	ENST00000495955.1	37	c.127		9	.	.	.	.	.	.	.	.	.	.	C	34	5.299131	0.95574	.	.	ENSG00000165219	ENST00000461379;ENST00000394084;ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.	.	.	5.91	5.91	0.95273	.	0.051074	0.85682	D	0.000000	T	0.59636	0.2208	N	0.22421	0.69	0.80722	D	1	D;D;D;D;D;D	0.71674	0.997;0.997;0.998;0.998;0.998;0.995	P;P;P;P;P;P	0.54100	0.548;0.653;0.653;0.653;0.742;0.517	T	0.63037	-0.6726	9	0.72032	D	0.01	.	19.3432	0.94352	0.0:1.0:0.0:0.0	.	43;43;43;43;43;43	Q14C86;Q14C86-3;Q14C86-4;Q14C86-2;Q14C86-6;B0QZ65	GAPD1_HUMAN;.;.;.;.;.	C	43	.	ENSP00000265956:R43C	R	+	1	0	GAPVD1	127101148	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.570000	0.82390	2.812000	0.96745	0.558000	0.71614	CGT	GAPVD1	-	NULL	ENSG00000165219		0.403	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	HGNC	protein_coding	OTTHUMT00000355644.1	19	0.00	0	C			128061327	128061327	+1	no_errors	ENST00000394105	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	1.000	T
GUSBP1	728411	genome.wustl.edu	37	5	21459636	21459636	+	RNA	SNP	C	C	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr5:21459636C>T	ENST00000607545.1	+	0	0					NR_027026.1		Q15486	GUSP1_HUMAN	glucuronidase, beta pseudogene 1						carbohydrate metabolic process (GO:0005975)|nervous system development (GO:0007399)|skeletal system development (GO:0001501)		hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)										TTTGGGCTGTCTCTGTGGCTG	0.657											OREG0016459	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-			0			BC064850, X75940		5p14.3	2012-10-04			ENSG00000183666	ENSG00000183666			13670	pseudogene	pseudogene						8565635	Standard	NR_027026		Approved		uc010iub.3	Q15486	OTTHUMG00000162474		5.37:g.21459636C>T		Somatic	748	WXS	Illumina GAIIx	Phase_IV	A6NLY8|A8K1B7|Q969T8|Q9BUH2	RNA	SNP	-	NULL	ENST00000607545.1	37	NULL		5																																																																																			RP11-823P9.1	-	-	ENSG00000183666		0.657	GUSBP1-006	KNOWN	basic	processed_transcript	GUSBP1	Clone_based_vega_gene	pseudogene	OTTHUMT00000470546.1	126	0.00	0	C	NG_008324		21459636	21459636	+1	no_errors	ENST00000508973	ensembl	human	known	69_37n	rna	106	37.65	64	SNP	0.000	T
KDM5C	8242	genome.wustl.edu	37	X	53223508	53223509	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chrX:53223508_53223509delCT	ENST00000375401.3	-	23	4382_4383	c.3850_3851delAG	c.(3850-3852)aggfs	p.R1284fs	KDM5C_ENST00000375379.3_Frame_Shift_Del_p.R1284fs|KDM5C_ENST00000404049.3_Frame_Shift_Del_p.R1283fs|KDM5C_ENST00000375383.3_Frame_Shift_Del_p.R1243fs|KDM5C_ENST00000452825.3_Frame_Shift_Del_p.R1217fs	NM_001282622.1|NM_004187.3	NP_001269551.1|NP_004178.2	P41229	KDM5C_HUMAN	lysine (K)-specific demethylase 5C	1284					histone H3-K4 demethylation (GO:0034720)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone demethylase activity (H3-K4 specific) (GO:0032453)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(30)|large_intestine(9)|lung(17)|oesophagus(1)|ovary(6)|prostate(1)|salivary_gland(1)|skin(1)|upper_aerodigestive_tract(2)	82						GCTGATGGCCCTCTCTGTGAGG	0.673			"""N, F, S"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		X	Xp11.22-p11.21	8242	lysine (K)-specific demethylase 5C (JARID1C)		E	0																																										-	-	-	SO:0001589	frameshift_variant	0			Z29650	CCDS14351.1, CCDS55417.1, CCDS65269.1	Xp11.22-p11.21	2014-01-31	2009-04-06	2009-04-06	ENSG00000126012	ENSG00000126012		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	11114	protein-coding gene	gene with protein product		314690	"""Jumonji, AT rich interactive domain 1C (RBP2-like)"", ""Smcy homolog, X-linked (mouse)"", ""jumonji, AT rich interactive domain 1C"", ""mental retardation, X-linked 13"""	SMCX, JARID1C, MRX13		7951230, 8162017, 19826449	Standard	NM_004187		Approved	DXS1272E, XE169	uc004drz.3	P41229	OTTHUMG00000021606	ENST00000375401.3:c.3850_3851delAG	X.37:g.53223512_53223513delCT	ENSP00000364550:p.Arg1284fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZ44|B4E3I2|F5H3T1|Q5JUX3|Q5JUX4|Q5JUX5|Q7Z5S5	Frame_Shift_Del	DEL	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_Znf_PHD-finger,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.R1284fs	ENST00000375401.3	37	c.3851_3850	CCDS14351.1	X																																																																																			KDM5C	-	NULL	ENSG00000126012		0.673	KDM5C-005	KNOWN	basic|CCDS	protein_coding	KDM5C	HGNC	protein_coding	OTTHUMT00000056737.2	99	0.00	0	CT	NM_004187		53223508	53223509	-1	no_errors	ENST00000375401	ensembl	human	known	69_37n	frame_shift_del	72	30.10	31	DEL	1.000:1.000	-
KIAA2022	340533	genome.wustl.edu	37	X	73961059	73961059	+	Missense_Mutation	SNP	T	T	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chrX:73961059T>A	ENST00000055682.6	-	3	3944	c.3333A>T	c.(3331-3333)aaA>aaT	p.K1111N		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	1111					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CCCACTTGATTTTTTCCACAC	0.443																																						dbGAP											0													78.0	72.0	74.0					X																	73961059		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.3333A>T	X.37:g.73961059T>A	ENSP00000055682:p.Lys1111Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.K1111N	ENST00000055682.6	37	c.3333	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	T	8.862	0.947253	0.18356	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.33654	1.4;1.4	5.28	1.45	0.22620	.	0.151034	0.64402	D	0.000015	T	0.34832	0.0911	N	0.14661	0.345	0.42656	D	0.993465	D	0.76494	0.999	D	0.69479	0.964	T	0.09640	-1.0665	10	0.44086	T	0.13	-12.8443	7.6082	0.28113	0.0:0.5656:0.0:0.4344	.	1111	Q5QGS0	K2022_HUMAN	N	1111	ENSP00000362567:K1111N;ENSP00000055682:K1111N	ENSP00000055682:K1111N	K	-	3	2	KIAA2022	73877784	1.000000	0.71417	0.968000	0.41197	0.641000	0.38312	1.793000	0.38764	0.161000	0.19458	0.486000	0.48141	AAA	KIAA2022	-	NULL	ENSG00000050030		0.443	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	84	0.00	0	T	NM_001008537		73961059	73961059	-1	no_errors	ENST00000055682	ensembl	human	known	69_37n	missense	49	34.67	26	SNP	1.000	A
JUP	3728	genome.wustl.edu	37	17	39784163	39784163	+	Intron	SNP	C	C	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr17:39784163C>T	ENST00000540235.1	-	5	909				KRT42P_ENST00000438131.1_RNA			P14923	PLAK_HUMAN	junction plakoglobin						adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		CTCCAGCAAGCGGCGGTAGGT	0.642																																					Colon(16;42 520 6044 17852 28530)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000540235.1:c.910-4879G>A	17.37:g.39784163C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	RNA	SNP	-	NULL	ENST00000540235.1	37	NULL		17																																																																																			KRT42P	-	-	ENSG00000214514		0.642	JUP-201	KNOWN	basic	protein_coding	KRT42P	HGNC	protein_coding		92	0.00	0	C			39784163	39784163	-1	no_errors	ENST00000398469	ensembl	human	known	69_37n	rna	60	39.39	39	SNP	0.996	T
KRTAP20-2	337976	genome.wustl.edu	37	21	32007597	32007597	+	Silent	SNP	C	C	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr21:32007597C>T	ENST00000330798.2	+	1	43	c.15C>T	c.(13-15)agC>agT	p.S5S		NM_181616.1	NP_853647.1	Q3LI61	KR202_HUMAN	keratin associated protein 20-2	5						intermediate filament (GO:0005882)				central_nervous_system(1)|endometrium(3)|kidney(1)|lung(2)|ovary(1)	8						GCTACTACAGCAACTACTATG	0.507																																						dbGAP											0													166.0	138.0	148.0					21																	32007597		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AP001708	CCDS13604.1	21q22.1	2006-03-13			ENSG00000184032	ENSG00000184032		"""Keratin associated proteins"""	18944	protein-coding gene	gene with protein product						12359730	Standard	NM_181616		Approved	KAP20.2	uc011adg.2	Q3LI61	OTTHUMG00000057786	ENST00000330798.2:c.15C>T	21.37:g.32007597C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_KRTAP	p.S5	ENST00000330798.2	37	c.15	CCDS13604.1	21																																																																																			KRTAP20-2	-	pfam_KRTAP	ENSG00000184032		0.507	KRTAP20-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP20-2	HGNC	protein_coding	OTTHUMT00000128238.3	144	0.00	0	C			32007597	32007597	+1	no_errors	ENST00000330798	ensembl	human	known	69_37n	silent	113	24.16	36	SNP	0.035	T
LATS1	9113	genome.wustl.edu	37	6	150039148	150039148	+	5'UTR	SNP	G	G	A	rs12174349	byFrequency	TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr6:150039148G>A	ENST00000543571.1	-	0	244				LATS1_ENST00000392273.3_5'UTR	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		CAGGGGTCGTGAGGACCTGGC	0.716													G|||	2750	0.549121	0.5681	0.6311	5008	,	,		11067	0.8244		0.3588	False		,,,				2504	0.3773					dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.-304C>T	6.37:g.150039148G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_UBA-like	p.S8L	ENST00000543571.1	37	c.23	CCDS34551.1	6	1220	0.5586080586080586	285	0.5792682926829268	216	0.5966850828729282	455	0.7954545454545454	264	0.3482849604221636	G	11.62	1.692228	0.30052	.	.	ENSG00000131023	ENST00000458696	T	0.35421	1.31	4.23	2.33	0.28932	.	.	.	.	.	T	0.15912	0.0383	.	.	.	0.09310	P	0.9999999999461435	.	.	.	.	.	.	T	0.10474	-1.0628	4	.	.	.	.	6.3622	0.21435	0.1028:0.3582:0.539:0.0	rs12174349;rs52837664;rs12174349	.	.	.	L	8	ENSP00000441265:S8L	.	S	-	2	0	LATS1	150080841	1.000000	0.71417	0.996000	0.52242	0.668000	0.39293	1.269000	0.33074	0.932000	0.37266	0.655000	0.94253	TCA	LATS1	-	NULL	ENSG00000131023		0.716	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS1	HGNC	protein_coding	OTTHUMT00000043923.4	9	0.00	0	G	NM_004690		150039148	150039148	-1	no_start_codon:no_stop_codon:bad_bp_length_for_coding_region	ENST00000458696	ensembl	human	putative	69_37n	missense	7	46.15	6	SNP	0.955	A
LRRN2	10446	genome.wustl.edu	37	1	204588367	204588368	+	Frame_Shift_Del	DEL	CC	CC	-	rs377246330		TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	CC	CC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr1:204588367_204588368delCC	ENST00000367175.1	-	1	2965_2966	c.753_754delGG	c.(751-756)cgggtgfs	p.V252fs	LRRN2_ENST00000367177.3_Frame_Shift_Del_p.V252fs|LRRN2_ENST00000496057.1_5'Flank|LRRN2_ENST00000367176.3_Frame_Shift_Del_p.V252fs|RP11-430C7.4_ENST00000453895.1_RNA			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	252					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			CGCCTGGGCACCCGGGCCAGCT	0.629																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.753_754delGG	1.37:g.204588367_204588368delCC	ENSP00000356143:p.Val252fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V252fs	ENST00000367175.1	37	c.754_753	CCDS1448.1	1																																																																																			LRRN2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000170382		0.629	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	HGNC	protein_coding	OTTHUMT00000089894.1	42	0.00	0	CC	NM_006338		204588367	204588368	-1	no_errors	ENST00000367175	ensembl	human	known	69_37n	frame_shift_del	70	17.65	15	DEL	0.996:0.013	-
MAP3K1	4214	genome.wustl.edu	37	5	56168489	56168490	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr5:56168489_56168490delAT	ENST00000399503.3	+	8	1445_1446	c.1445_1446delAT	c.(1444-1446)aatfs	p.N482fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	482					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TGTAGAAGAAATAGAGAACCTT	0.257																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.1445_1446delAT	5.37:g.56168489_56168490delAT	ENSP00000382423:p.Asn482fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.N482fs	ENST00000399503.3	37	c.1445_1446	CCDS43318.1	5																																																																																			MAP3K1	-	pfscan_Znf_RING	ENSG00000095015		0.257	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	57	0.00	0	AT	XM_042066		56168489	56168490	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	33	35.29	18	DEL	1.000:0.994	-
MAP3K1	4214	genome.wustl.edu	37	5	56181807	56181807	+	Nonsense_Mutation	SNP	C	C	G			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr5:56181807C>G	ENST00000399503.3	+	17	4031	c.4031C>G	c.(4030-4032)tCa>tGa	p.S1344*		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1344	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		TTCAAAGAATCAGTAGTTATT	0.348																																						dbGAP											0													100.0	93.0	95.0					5																	56181807		1833	4085	5918	-	-	-	SO:0001587	stop_gained	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.4031C>G	5.37:g.56181807C>G	ENSP00000382423:p.Ser1344*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.S1344*	ENST00000399503.3	37	c.4031	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	C	44	10.591411	0.99433	.	.	ENSG00000095015	ENST00000399503	.	.	.	5.51	5.51	0.81932	.	0.294600	0.29594	N	0.011713	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	12.7226	0.57149	0.0:0.9247:0.0:0.0753	.	.	.	.	X	1344	.	ENSP00000382423:S1344X	S	+	2	0	MAP3K1	56217564	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	3.561000	0.53770	2.591000	0.87537	0.655000	0.94253	TCA	MAP3K1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000095015		0.348	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	58	0.00	0	C	XM_042066		56181807	56181807	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	nonsense	46	32.35	22	SNP	0.996	G
KMT2E	55904	genome.wustl.edu	37	7	104654714	104654714	+	5'UTR	SNP	C	C	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr7:104654714C>T	ENST00000311117.3	+	0	89				KMT2E-AS1_ENST00000585013.1_RNA|KMT2E_ENST00000480368.1_3'UTR|KMT2E-AS1_ENST00000453677.1_RNA|KMT2E_ENST00000334914.7_5'UTR|KMT2E_ENST00000257745.4_5'UTR|KMT2E_ENST00000334877.4_5'UTR|LINC01004_ENST00000450686.1_RNA|LINC01004_ENST00000445184.1_RNA|KMT2E_ENST00000476671.1_5'UTR	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E						cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										TGCCGGAGTTCGGGAGCGGCA	0.706											OREG0018246	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.-457C>T	7.37:g.104654714C>T		Somatic	1383	WXS	Illumina GAIIx	Phase_IV	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	RNA	SNP	-	NULL	ENST00000311117.3	37	NULL	CCDS34723.1	7																																																																																			MLL5	-	-	ENSG00000005483		0.706	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL5	HGNC	protein_coding	OTTHUMT00000348697.1	109	0.00	0	C			104654714	104654714	+1	no_errors	ENST00000480368	ensembl	human	known	69_37n	rna	58	38.95	37	SNP	0.997	T
MPHOSPH8	54737	genome.wustl.edu	37	13	20216401	20216401	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr13:20216401G>T	ENST00000361479.5	+	2	428	c.360G>T	c.(358-360)aaG>aaT	p.K120N	MPHOSPH8_ENST00000414242.2_Missense_Mutation_p.K120N	NM_017520.3	NP_059990.2	Q99549	MPP8_HUMAN	M-phase phosphoprotein 8	120					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of DNA methylation (GO:0044030)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear heterochromatin (GO:0005720)|nuclear nucleosome (GO:0000788)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	methylated histone binding (GO:0035064)			breast(2)|endometrium(1)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_cancers(29;2.83e-16)|all_lung(29;1.16e-17)|all_epithelial(30;8.13e-16)|Lung NSC(5;6.91e-15)|Lung SC(185;0.0367)		all cancers(112;8.43e-05)|Epithelial(112;0.000426)|OV - Ovarian serous cystadenocarcinoma(117;0.00596)|Lung(94;0.015)|LUSC - Lung squamous cell carcinoma(192;0.0795)		CAGTCAGGAAGGATATTCAGG	0.333																																						dbGAP											0													80.0	86.0	84.0					13																	20216401		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056785, AJ293409	CCDS9287.1	13q12.11	2013-01-10			ENSG00000196199	ENSG00000196199		"""Ankyrin repeat domain containing"""	29810	protein-coding gene	gene with protein product		611626				8885239	Standard	NM_017520		Approved	mpp8, HSMPP8	uc001umh.3	Q99549	OTTHUMG00000016498	ENST00000361479.5:c.360G>T	13.37:g.20216401G>T	ENSP00000355388:p.Lys120Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6F9|Q5JPE5|Q5JTQ0|Q86TK3|Q96MK4|Q9BTP1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Chromo_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Chromo_domain/shadow	p.K120N	ENST00000361479.5	37	c.360	CCDS9287.1	13	.	.	.	.	.	.	.	.	.	.	G	8.671	0.902857	0.17760	.	.	ENSG00000196199	ENST00000414242;ENST00000361479;ENST00000538024	T;T	0.50001	0.76;0.77	5.24	-2.71	0.05986	.	2.632320	0.01205	N	0.007698	T	0.53012	0.1770	M	0.70275	2.135	0.45490	D	0.99845	P;P;P	0.43662	0.635;0.814;0.679	B;P;B	0.45558	0.075;0.485;0.274	T	0.49273	-0.8957	10	0.56958	D	0.05	.	7.8198	0.29282	0.5461:0.0:0.3459:0.108	.	120;120;120	Q99549;Q99549-2;B3KS10	MPP8_HUMAN;.;.	N	120	ENSP00000414663:K120N;ENSP00000355388:K120N	ENSP00000355388:K120N	K	+	3	2	MPHOSPH8	19114401	0.968000	0.33430	0.320000	0.25306	0.029000	0.11900	-0.010000	0.12743	-0.929000	0.03757	0.650000	0.86243	AAG	MPHOSPH8	-	NULL	ENSG00000196199		0.333	MPHOSPH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH8	HGNC	protein_coding	OTTHUMT00000044028.2	39	0.00	0	G	NM_017520		20216401	20216401	+1	no_errors	ENST00000414242	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	0.719	T
NADK2	133686	genome.wustl.edu	37	5	36195081	36195081	+	3'UTR	DEL	T	T	-			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr5:36195081delT	ENST00000381937.4	-	0	1493				NADK2_ENST00000397338.1_3'UTR|NADK2_ENST00000511613.1_5'UTR|NADK2_ENST00000282512.3_3'UTR	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial						NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)										AGTGAATGTCTTTTTTTCTAT	0.353																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.*165A>-	5.37:g.36195081delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC93|Q6UTX5|Q96NM0	RNA	DEL	-	NULL	ENST00000381937.4	37	NULL	CCDS47197.1	5																																																																																			NADKD1	-	-	ENSG00000152620		0.353	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	NADKD1	HGNC	protein_coding	OTTHUMT00000367541.1	17	0.00	0	T	NM_153013		36195081	36195081	-1	no_errors	ENST00000511613	ensembl	human	known	69_37n	rna	8	38.46	5	DEL	0.001	-
NUP85	79902	genome.wustl.edu	37	17	73201834	73201834	+	5'UTR	SNP	C	C	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr17:73201834C>T	ENST00000245544.4	+	0	49				NUP85_ENST00000447371.2_5'UTR|NUP85_ENST00000579298.1_5'UTR|NUP85_ENST00000579324.1_5'UTR|NUP85_ENST00000541827.1_5'UTR|NUP85_ENST00000449421.2_3'UTR	NM_024844.3	NP_079120.1	Q9BW27	NUP85_HUMAN	nucleoporin 85kDa						carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|lamellipodium assembly (GO:0030032)|macrophage chemotaxis (GO:0048246)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore outer ring (GO:0031080)				endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	16	all_lung(278;0.14)|Lung NSC(278;0.168)		all cancers(21;3.45e-06)			CGAGCGACTTCTAGGAGCCTG	0.642																																						dbGAP											0													69.0	62.0	64.0					17																	73201834		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AF514995	CCDS32730.1	17q25	2006-11-29	2005-11-03	2005-11-03		ENSG00000125450			8734	protein-coding gene	gene with protein product		170285				8124707	Standard	XM_005257690		Approved	NUP75, FLJ12549	uc002jng.1	Q9BW27		ENST00000245544.4:c.-23C>T	17.37:g.73201834C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMQ3|B4DPW1|Q8NDI4|Q9H9U1	RNA	SNP	-	NULL	ENST00000245544.4	37	NULL	CCDS32730.1	17																																																																																			NUP85	-	-	ENSG00000125450		0.642	NUP85-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP85	HGNC	protein_coding	OTTHUMT00000446619.1	71	0.00	0	C	NM_024844		73201834	73201834	+1	no_errors	ENST00000449421	ensembl	human	known	69_37n	rna	63	43.75	49	SNP	0.000	T
OTP	23440	genome.wustl.edu	37	5	76933023	76933023	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr5:76933023G>A	ENST00000306422.3	-	2	1208	c.70C>T	c.(70-72)Cgg>Tgg	p.R24W	OTP_ENST00000515716.1_5'Flank	NM_032109.2	NP_115485.1	Q5XKR4	OTP_HUMAN	orthopedia homeobox	24					forebrain neuron differentiation (GO:0021879)|hypothalamus cell differentiation (GO:0021979)|neurohypophysis development (GO:0021985)|positive regulation of neuroblast proliferation (GO:0002052)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|pancreas(1)	13		all_lung(232;0.00051)|Lung NSC(167;0.000601)|Ovarian(174;0.0105)|Prostate(461;0.214)		OV - Ovarian serous cystadenocarcinoma(54;9.04e-51)|Epithelial(54;1.62e-45)|all cancers(79;4.4e-41)		ACCGCCTCCCGGTGGCCCAGA	0.682																																						dbGAP											0													5.0	6.0	5.0					5																	76933023		2134	4191	6325	-	-	-	SO:0001583	missense	0				CCDS4039.1	5q14.1	2011-06-20	2007-02-15		ENSG00000171540	ENSG00000171540		"""Homeoboxes / PRD class"""	8518	protein-coding gene	gene with protein product		604529	"""orthopedia homolog (Drosophila)"""			10458915	Standard	NM_032109		Approved		uc003kfg.3	Q5XKR4	OTTHUMG00000102171	ENST00000306422.3:c.70C>T	5.37:g.76933023G>A	ENSP00000302814:p.Arg24Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,prints_HTH_motif,pfscan_OAR_dom,pfscan_Homeodomain	p.R24W	ENST00000306422.3	37	c.70	CCDS4039.1	5	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957486	0.92726	.	.	ENSG00000171540	ENST00000306422	D	0.92545	-3.06	5.46	5.46	0.80206	.	0.078210	0.51477	D	0.000097	D	0.93533	0.7936	L	0.27053	0.805	0.58432	D	0.999999	D	0.89917	1.0	D	0.77557	0.99	D	0.94385	0.7608	10	0.87932	D	0	.	19.2874	0.94084	0.0:0.0:1.0:0.0	.	24	Q5XKR4	OTP_HUMAN	W	24	ENSP00000302814:R24W	ENSP00000302814:R24W	R	-	1	2	OTP	76968779	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.550000	0.67268	2.732000	0.93576	0.655000	0.94253	CGG	OTP	-	NULL	ENSG00000171540		0.682	OTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTP	HGNC	protein_coding	OTTHUMT00000220016.2	69	0.00	0	G			76933023	76933023	-1	no_errors	ENST00000306422	ensembl	human	known	69_37n	missense	45	35.71	25	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	50	0.00	0	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	25	57.63	34	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr3:178938934G>A	ENST00000263967.3	+	14	2333	c.2176G>A	c.(2176-2178)Gaa>Aaa	p.E726K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	726			E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E726K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAGAAGGATGAAACACAAAA	0.428		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	8	Substitution - Missense(8)	lung(4)|large_intestine(2)|breast(2)											89.0	78.0	82.0					3																	178938934		1917	4118	6035	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2176G>A	3.37:g.178938934G>A	ENSP00000263967:p.Glu726Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E726K	ENST00000263967.3	37	c.2176	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308869	0.60305	.	.	ENSG00000121879	ENST00000263967	T	0.80653	-1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.166180	0.38778	U	0.001568	T	0.73450	0.3588	L	0.36672	1.1	0.80722	D	1	P	0.46064	0.872	B	0.42738	0.396	T	0.71401	-0.4604	10	0.02654	T	1	-19.3819	19.7612	0.96319	0.0:0.0:1.0:0.0	.	726	P42336	PK3CA_HUMAN	K	726	ENSP00000263967:E726K	ENSP00000263967:E726K	E	+	1	0	PIK3CA	180421628	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.476000	0.97823	2.670000	0.90874	0.655000	0.94253	GAA	PIK3CA	-	superfamily_Kinase-like_dom	ENSG00000121879		0.428	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	85	0.00	0	G			178938934	178938934	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	49	47.37	45	SNP	1.000	A
PRSS53	339105	genome.wustl.edu	37	16	31098175	31098175	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr16:31098175G>A	ENST00000280606.6	-	4	440	c.287C>T	c.(286-288)tCt>tTt	p.S96F		NM_001039503.2	NP_001034592.1	Q2L4Q9	PRS53_HUMAN	protease, serine, 53	96	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			large_intestine(1)|lung(3)	4						ACGCTGCAGAGAACCCAGGAC	0.617																																						dbGAP											0													42.0	44.0	44.0					16																	31098175		2068	4216	6284	-	-	-	SO:0001583	missense	0				CCDS42153.1	16p11.2	2010-05-07			ENSG00000151006	ENSG00000151006		"""Serine peptidases / Serine peptidases"""	34407	protein-coding gene	gene with protein product	"""polyserase 3"""	610561				16566820	Standard	NM_001039503		Approved	POL3S	uc002eaq.3	Q2L4Q9	OTTHUMG00000047358	ENST00000280606.6:c.287C>T	16.37:g.31098175G>A	ENSP00000280606:p.Ser96Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S96F	ENST00000280606.6	37	c.287	CCDS42153.1	16	.	.	.	.	.	.	.	.	.	.	G	16.51	3.142577	0.57044	.	.	ENSG00000151006	ENST00000280606	D	0.89343	-2.5	5.75	5.75	0.90469	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.36200	U	0.002726	D	0.93409	0.7898	M	0.71296	2.17	0.47949	D	0.999551	D	0.76494	0.999	D	0.83275	0.996	D	0.93184	0.6577	10	0.56958	D	0.05	.	13.1084	0.59259	0.0:0.1607:0.8393:0.0	.	96	Q2L4Q9	PRS53_HUMAN	F	96	ENSP00000280606:S96F	ENSP00000280606:S96F	S	-	2	0	PRSS53	31005676	1.000000	0.71417	1.000000	0.80357	0.495000	0.33615	3.044000	0.49830	2.720000	0.93068	0.655000	0.94253	TCT	PRSS53	-	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000151006		0.617	PRSS53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS53	HGNC	protein_coding	OTTHUMT00000108580.4	56	0.00	0	G	NM_001081268		31098175	31098175	-1	no_errors	ENST00000280606	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	1.000	A
PTPRM	5797	genome.wustl.edu	37	18	8394540	8394540	+	Missense_Mutation	SNP	G	G	C			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr18:8394540G>C	ENST00000332175.8	+	30	5273	c.4236G>C	c.(4234-4236)caG>caC	p.Q1412H	PTPRM_ENST00000580170.1_Missense_Mutation_p.Q1425H|PTPRM_ENST00000400053.4_Missense_Mutation_p.Q1350H|PTPRM_ENST00000444013.1_Missense_Mutation_p.Q1199H|PTPRM_ENST00000400060.4_Missense_Mutation_p.Q1426H	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	1412	Tyrosine-protein phosphatase 2. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				TCCGGCACCAGAGAACCGTGG	0.562																																						dbGAP											0													81.0	62.0	68.0					18																	8394540		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.4236G>C	18.37:g.8394540G>C	ENSP00000331418:p.Gln1412His	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN1|D3DUH8|J3QL11	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.Q1426H	ENST00000332175.8	37	c.4278	CCDS11840.1	18	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384458	0.82792	.	.	ENSG00000173482	ENST00000332175;ENST00000400060;ENST00000400053;ENST00000444013	D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76	5.75	5.75	0.90469	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.064020	0.64402	D	0.000005	D	0.84893	0.5573	N	0.17345	0.48	0.80722	D	1	D;P;D	0.54397	0.962;0.918;0.966	D;P;P	0.68483	0.958;0.765;0.77	D	0.84265	0.0485	10	0.35671	T	0.21	.	19.9923	0.97371	0.0:0.0:1.0:0.0	.	1199;1425;1412	E7EVX9;A7MBN1;P28827	.;.;PTPRM_HUMAN	H	1412;1426;1350;1199	ENSP00000331418:Q1412H;ENSP00000382933:Q1426H;ENSP00000382927:Q1350H;ENSP00000387608:Q1199H	ENSP00000331418:Q1412H	Q	+	3	2	PTPRM	8384540	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.006000	0.88564	2.727000	0.93392	0.650000	0.86243	CAG	PTPRM	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000173482		0.562	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	37	0.00	0	G			8394540	8394540	+1	no_errors	ENST00000400060	ensembl	human	known	69_37n	missense	25	40.48	17	SNP	1.000	C
RGPD1	400966	genome.wustl.edu	37	2	87205014	87205014	+	Missense_Mutation	SNP	C	C	G			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr2:87205014C>G	ENST00000559485.1	+	17	2415	c.2399C>G	c.(2398-2400)tCt>tGt	p.S800C	RGPD1_ENST00000409776.2_Missense_Mutation_p.S800C|RGPD1_ENST00000398193.3_Missense_Mutation_p.S808C	NM_001024457.3	NP_001019628.3	P0DJD0	RGPD1_HUMAN	RANBP2-like and GRIP domain containing 1	800					protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(1)|lung(1)	3						GATCAGAATTCTTTACGGAAA	0.343																																						dbGAP											0													2.0	3.0	3.0					2																	87205014		1082	2479	3561	-	-	-	SO:0001583	missense	0				CCDS46358.1, CCDS46358.2	2p11.2	2013-09-24			ENSG00000187627	ENSG00000187627		"""Tetratricopeptide (TTC) repeat domain containing"""	32414	protein-coding gene	gene with protein product		612704				15710750, 15815621	Standard	NM_001024457		Approved	RGP1	uc021vkh.1	P0DJD0	OTTHUMG00000153248	ENST00000559485.1:c.2399C>G	2.37:g.87205014C>G	ENSP00000453170:p.Ser800Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	P0C839|Q68DN6|Q6V1X0	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR_2,pfam_TPR-1,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.S808C	ENST00000559485.1	37	c.2423	CCDS46358.2	2	.	.	.	.	.	.	.	.	.	.	.	6.482	0.457091	0.12283	.	.	ENSG00000187627	ENST00000409776;ENST00000398193	T;T	0.25250	1.81;1.81	2.3	1.34	0.21922	.	.	.	.	.	T	0.19805	0.0476	L	0.39397	1.21	0.80722	D	1	B;B;B	0.10296	0.003;0.002;0.002	B;B;B	0.14023	0.01;0.004;0.004	T	0.05468	-1.0883	9	0.59425	D	0.04	-10.805	8.4574	0.32908	0.0:0.7556:0.2444:0.0	.	808;808;800	F8VYC4;E7ESF1;Q68DN6	.;.;RGPD1_HUMAN	C	800;808	ENSP00000386808:S800C;ENSP00000381253:S808C	ENSP00000381253:S808C	S	+	2	0	RGPD1	87058525	1.000000	0.71417	0.995000	0.50966	0.289000	0.27227	2.320000	0.43797	0.275000	0.22094	0.152000	0.16155	TCT	RGPD1	-	NULL	ENSG00000187627		0.343	RGPD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RGPD1	HGNC	protein_coding	OTTHUMT00000330684.4	19	0.00	0	C	NM_001024457		87205014	87205014	+1	no_errors	ENST00000398193	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	1.000	G
SLC22A9	114571	genome.wustl.edu	37	11	63137555	63137555	+	Silent	SNP	C	C	T	rs563758057		TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr11:63137555C>T	ENST00000279178.3	+	1	276	c.27C>T	c.(25-27)caC>caT	p.H9H	SLC22A9_ENST00000310969.4_Silent_p.H9H	NM_080866.2	NP_543142.2	Q8IVM8	S22A9_HUMAN	solute carrier family 22 (organic anion transporter), member 9	9					hormone transport (GO:0009914)|short-chain fatty acid import (GO:0015913)|sodium-independent organic anion transport (GO:0043252)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	anion:anion antiporter activity (GO:0015301)|short-chain fatty acid uptake transporter activity (GO:0015636)|sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	18						TCCTGGGTCACGCTGGTGACC	0.443																																						dbGAP											0													100.0	100.0	100.0					11																	63137555		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AP001880	CCDS8043.1	11q12.3	2014-05-20	2008-01-11		ENSG00000149742	ENSG00000149742		"""Solute carriers"""	16261	protein-coding gene	gene with protein product		607579				11327718, 17393504	Standard	NM_080866		Approved	OAT4, FLJ23666, UST3, OAT7	uc001nww.3	Q8IVM8	OTTHUMG00000167805	ENST00000279178.3:c.27C>T	11.37:g.63137555C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVB7|A4PB24|Q8TCC8|Q8TEC0|Q8WYN7	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.H9	ENST00000279178.3	37	c.27	CCDS8043.1	11																																																																																			SLC22A9	-	NULL	ENSG00000149742		0.443	SLC22A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A9	HGNC	protein_coding	OTTHUMT00000396371.1	85	0.00	0	C	NM_080866		63137555	63137555	+1	no_errors	ENST00000279178	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	0.001	T
SMC1A	8243	genome.wustl.edu	37	X	53439044	53439046	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chrX:53439044_53439046delCTT	ENST00000322213.4	-	6	1139_1141	c.1012_1014delAAG	c.(1012-1014)aagdel	p.K338del	SMC1A_ENST00000375340.6_Intron	NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	338					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						ACAGCATCTCCTTCTCCAGCTCA	0.502																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.1012_1014delAAG	X.37:g.53439044_53439046delCTT	ENSP00000323421:p.Lys338del	Somatic		WXS	Illumina GAIIx	Phase_IV	O14995|Q16351|Q2M228	In_Frame_Del	DEL	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge,prints_Tropomyosin	p.K338in_frame_del	ENST00000322213.4	37	c.1014_1012	CCDS14352.1	X																																																																																			SMC1A	-	pfam_RecF/RecN/SMC,prints_Tropomyosin	ENSG00000072501		0.502	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	HGNC	protein_coding	OTTHUMT00000056756.2	85	0.00	0	CTT	NM_006306		53439044	53439046	-1	no_errors	ENST00000322213	ensembl	human	known	69_37n	in_frame_del	64	27.27	24	DEL	0.999:1.000:0.999	-
CAPN15	6650	genome.wustl.edu	37	16	597356	597356	+	Missense_Mutation	SNP	C	C	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr16:597356C>T	ENST00000219611.2	+	4	881	c.518C>T	c.(517-519)tCg>tTg	p.S173L	LA16c-366D1.3_ENST00000565879.1_RNA	NM_005632.2	NP_005623.1	O75808	CAN15_HUMAN	calpain 15	173					proteolysis (GO:0006508)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|cysteine-type peptidase activity (GO:0008234)|peptidase activity (GO:0008233)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										CGCAGGCTCTCGCTGCCACGG	0.756																																						dbGAP											0													4.0	5.0	4.0					16																	597356		1917	3901	5818	-	-	-	SO:0001583	missense	0			U85647	CCDS10410.1	16p13.3	2013-06-27	2013-06-27	2013-06-27	ENSG00000103326	ENSG00000103326			11182	protein-coding gene	gene with protein product		603267	"""small optic lobes (Drosophila) homolog"", ""small optic lobes homolog (Drosophila)"""	SOLH		9722942	Standard	NM_005632		Approved		uc002chi.3	O75808	OTTHUMG00000119059	ENST00000219611.2:c.518C>T	16.37:g.597356C>T	ENSP00000219611:p.Ser173Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B1M4|Q2KHS2|Q8WTY9|Q9BUW0	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Znf_RanBP2,smart_Znf_RanBP2,smart_Peptidase_C2_calpain_cat,pfscan_Znf_RanBP2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.S173L	ENST00000219611.2	37	c.518	CCDS10410.1	16	.	.	.	.	.	.	.	.	.	.	c	18.89	3.719603	0.68844	.	.	ENSG00000103326	ENST00000219611;ENST00000397687	D	0.90844	-2.74	5.33	4.38	0.52667	.	0.259880	0.39985	N	0.001215	D	0.92133	0.7506	L	0.36672	1.1	0.58432	D	0.999996	D	0.89917	1.0	D	0.80764	0.994	D	0.92626	0.6112	10	0.87932	D	0	.	12.726	0.57170	0.0:0.9195:0.0:0.0805	.	173	O75808	CAN15_HUMAN	L	173	ENSP00000219611:S173L	ENSP00000219611:S173L	S	+	2	0	SOLH	537357	1.000000	0.71417	0.703000	0.30354	0.135000	0.20990	7.222000	0.78025	1.251000	0.43983	0.556000	0.70494	TCG	SOLH	-	NULL	ENSG00000103326		0.756	CAPN15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOLH	HGNC	protein_coding	OTTHUMT00000239271.1	8	0.00	0	C	NM_005632		597356	597356	+1	no_errors	ENST00000219611	ensembl	human	known	69_37n	missense	5	50.00	5	SNP	0.999	T
SMG1	23049	genome.wustl.edu	37	16	18879677	18879677	+	Splice_Site	SNP	C	C	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr16:18879677C>A	ENST00000446231.2	-	22	3443		c.e22-1		snoU13_ENST00000459248.1_RNA|SMG1_ENST00000389467.3_Splice_Site			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase						DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TTCTAATGACCTTTACGATAA	0.418																																						dbGAP											0													1.0	1.0	1.0					16																	18879677		402	853	1255	-	-	-	SO:0001630	splice_region_variant	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.3031-1G>T	16.37:g.18879677C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Splice_Site	SNP	-	e22-1	ENST00000446231.2	37	c.3031-1	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	C	16.05	3.014109	0.54468	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	.	.	.	4.94	4.94	0.65067	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5677	0.91122	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SMG1	18787178	1.000000	0.71417	1.000000	0.80357	0.624000	0.37722	7.734000	0.84928	2.463000	0.83235	0.555000	0.69702	.	SMG1	-	-	ENSG00000157106		0.418	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	93	0.00	0	C	NM_015092	Intron	18879677	18879677	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	splice_site	52	59.69	77	SNP	1.000	A
TMEM161B	153396	genome.wustl.edu	37	5	87492051	87492051	+	Missense_Mutation	SNP	G	G	T			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr5:87492051G>T	ENST00000296595.6	-	12	1565	c.1441C>A	c.(1441-1443)Cac>Aac	p.H481N	TMEM161B_ENST00000512429.1_Missense_Mutation_p.H470N|TMEM161B_ENST00000506536.1_3'UTR|TMEM161B_ENST00000514135.1_Intron|TMEM161B_ENST00000511218.1_Missense_Mutation_p.H272N|TMEM161B_ENST00000515293.1_5'Flank	NM_153354.3	NP_699185.1	Q8NDZ6	T161B_HUMAN	transmembrane protein 161B	481						integral component of membrane (GO:0016021)				endometrium(4)|large_intestine(3)|lung(9)|skin(3)|upper_aerodigestive_tract(1)	20		all_cancers(142;0.000275)|Lung NSC(167;0.00901)|all_lung(232;0.0111)|Colorectal(57;0.0959)|Ovarian(174;0.1)		OV - Ovarian serous cystadenocarcinoma(54;6.24e-36)|Epithelial(54;6.8e-31)|all cancers(79;1.07e-26)		AGATACTGGTGATAGAAAAGC	0.378																																						dbGAP											0													39.0	40.0	39.0					5																	87492051		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC037287	CCDS4065.1, CCDS75269.1, CCDS75270.1	5q14.3	2008-02-05			ENSG00000164180	ENSG00000164180			28483	protein-coding gene	gene with protein product						12477932	Standard	NM_001289008		Approved	MGC33214	uc003kjc.3	Q8NDZ6	OTTHUMG00000131323	ENST00000296595.6:c.1441C>A	5.37:g.87492051G>T	ENSP00000296595:p.His481Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5CZH7|Q6UWQ6	Missense_Mutation	SNP	pfam_Transmembrane_161A/B	p.H481N	ENST00000296595.6	37	c.1441	CCDS4065.1	5	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031746	0.75504	.	.	ENSG00000164180	ENST00000296595;ENST00000511218;ENST00000512429	.	.	.	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.78272	0.4257	L	0.59436	1.845	0.80722	D	1	D;D	0.62365	0.991;0.991	D;D	0.76575	0.988;0.988	T	0.77619	-0.2520	9	0.66056	D	0.02	-42.7414	20.4238	0.99064	0.0:0.0:1.0:0.0	.	272;481	B7Z6A5;Q8NDZ6	.;T161B_HUMAN	N	481;272;470	.	ENSP00000296595:H481N	H	-	1	0	TMEM161B	87527807	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.444000	0.97578	2.834000	0.97654	0.650000	0.86243	CAC	TMEM161B	-	pfam_Transmembrane_161A/B	ENSG00000164180		0.378	TMEM161B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM161B	HGNC	protein_coding	OTTHUMT00000254094.1	36	0.00	0	G	NM_153354		87492051	87492051	-1	no_errors	ENST00000296595	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	T
TRAP1	10131	genome.wustl.edu	37	16	3714413	3714413	+	Silent	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr16:3714413G>A	ENST00000246957.5	-	13	1519	c.1431C>T	c.(1429-1431)tcC>tcT	p.S477S	TRAP1_ENST00000538171.1_Silent_p.S424S|DNASE1_ENST00000575152.1_3'UTR|TRAP1_ENST00000573872.1_5'Flank|TRAP1_ENST00000575671.1_Silent_p.S268S	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	477					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				TTAGCTGCCCGGAGGGCAGCG	0.627																																						dbGAP											0													27.0	32.0	30.0					16																	3714413		2195	4299	6494	-	-	-	SO:0001819	synonymous_variant	0			AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1431C>T	16.37:g.3714413G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Silent	SNP	pfam_Hsp90,pfam_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pirsf_Hsp90,prints_Hsp90_N	p.S477	ENST00000246957.5	37	c.1431	CCDS10508.1	16																																																																																			TRAP1	-	pfam_Hsp90,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Hsp90	ENSG00000126602		0.627	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAP1	HGNC	protein_coding	OTTHUMT00000251586.2	80	0.00	0	G	NM_016292		3714413	3714413	-1	no_errors	ENST00000246957	ensembl	human	known	69_37n	silent	44	56.31	58	SNP	0.120	A
TRIM37	4591	genome.wustl.edu	37	17	57165759	57165759	+	Silent	SNP	G	G	C			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr17:57165759G>C	ENST00000262294.7	-	4	433	c.174C>G	c.(172-174)ctC>ctG	p.L58L	TRIM37_ENST00000376149.3_5'UTR|TRIM37_ENST00000393065.2_Silent_p.L24L|TRIM37_ENST00000393066.3_Silent_p.L58L|TRIM37_ENST00000584889.1_Silent_p.L58L	NM_015294.3	NP_056109.1	O94972	TRI37_HUMAN	tripartite motif containing 37	58					aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					CTCGTAGCTGGAGTGGAGCAC	0.358									Mulibrey Nanism																													dbGAP											0													123.0	102.0	109.0					17																	57165759		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972		ENST00000262294.7:c.174C>G	17.37:g.57165759G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	pfscan_Znf_RING	p.P58A	ENST00000262294.7	37	c.172	CCDS32694.1	17																																																																																			TRIM37	-	NULL	ENSG00000108395		0.358	TRIM37-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM37	HGNC	protein_coding	OTTHUMT00000445930.1	24	0.00	0	G	NM_015294		57165759	57165759	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000580122	ensembl	human	known	69_37n	missense	22	40.54	15	SNP	0.623	C
URB2	9816	genome.wustl.edu	37	1	229790001	229790001	+	Missense_Mutation	SNP	A	A	G			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr1:229790001A>G	ENST00000258243.2	+	9	4379	c.4243A>G	c.(4243-4245)Ata>Gta	p.I1415V		NM_014777.2	NP_055592.2	Q14146	URB2_HUMAN	URB2 ribosome biogenesis 2 homolog (S. cerevisiae)	1415						aggresome (GO:0016235)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(6)	73						TGTAGGAAGCATAGATGACCT	0.423																																						dbGAP											0													183.0	160.0	168.0					1																	229790001		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50923	CCDS31052.1	1q42.13	2009-11-06	2008-10-01	2008-10-01	ENSG00000135763	ENSG00000135763			28967	protein-coding gene	gene with protein product	"""nucleolar preribosomal-associated protein 1"""		"""KIAA0133"""	KIAA0133		8590280	Standard	NM_014777		Approved	NPA2, NET10	uc001hts.1	Q14146	OTTHUMG00000039464	ENST00000258243.2:c.4243A>G	1.37:g.229790001A>G	ENSP00000258243:p.Ile1415Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VYC9	Missense_Mutation	SNP	pfam_Urb2/Npa2_C	p.I1415V	ENST00000258243.2	37	c.4243	CCDS31052.1	1	.	.	.	.	.	.	.	.	.	.	A	13.51	2.259529	0.39995	.	.	ENSG00000135763	ENST00000258243;ENST00000434387	T;T	0.42513	0.97;0.97	5.17	-7.69	0.01263	Nucleolar 27S pre-rRNA processing, Urb2/Npa2, C-terminal (1);	0.951809	0.08906	N	0.876580	T	0.11153	0.0272	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.38866	-0.9641	9	.	.	.	0.8242	8.9008	0.35493	0.305:0.2813:0.4138:0.0	.	1415	Q14146	URB2_HUMAN	V	1415;31	ENSP00000258243:I1415V;ENSP00000395107:I31V	.	I	+	1	0	URB2	227856624	0.000000	0.05858	0.000000	0.03702	0.687000	0.40016	-0.458000	0.06737	-1.382000	0.02109	-0.321000	0.08615	ATA	URB2	-	pfam_Urb2/Npa2_C	ENSG00000135763		0.423	URB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB2	HGNC	protein_coding	OTTHUMT00000095232.1	98	0.00	0	A	NM_014777		229790001	229790001	+1	no_errors	ENST00000258243	ensembl	human	known	69_37n	missense	110	15.38	20	SNP	0.000	G
ZFP36L2	678	genome.wustl.edu	37	2	43452870	43452870	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr2:43452870G>A	ENST00000282388.3	-	2	366	c.73C>T	c.(73-75)Ctc>Ttc	p.L25F	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	25					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				TTCAGGTTGAGGTTGGCCAGG	0.652																																						dbGAP											0													19.0	21.0	20.0					2																	43452870		2195	4290	6485	-	-	-	SO:0001583	missense	0			X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.73C>T	2.37:g.43452870G>A	ENSP00000282388:p.Leu25Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TB4|Q9BSJ3	Missense_Mutation	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.L25F	ENST00000282388.3	37	c.73	CCDS1811.1	2	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198109	0.58126	.	.	ENSG00000152518	ENST00000282388	T	0.53640	0.61	5.48	4.59	0.56863	Tis11B-like protein, N-terminal (1);	0.000000	0.64402	D	0.000007	T	0.54029	0.1833	L	0.50333	1.59	0.80722	D	1	D	0.58268	0.982	P	0.60473	0.875	T	0.50841	-0.8780	10	0.31617	T	0.26	-16.8484	7.8737	0.29582	0.0805:0.0:0.7572:0.1623	.	25	P47974	TISD_HUMAN	F	25	ENSP00000282388:L25F	ENSP00000282388:L25F	L	-	1	0	ZFP36L2	43306374	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	3.322000	0.52007	1.270000	0.44297	0.655000	0.94253	CTC	ZFP36L2	-	pfam_Tis11B_N	ENSG00000152518		0.652	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L2	HGNC	protein_coding	OTTHUMT00000250513.2	34	0.00	0	G	NM_006887		43452870	43452870	-1	no_errors	ENST00000282388	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	1.000	A
ZSWIM4	65249	genome.wustl.edu	37	19	13941397	13941397	+	Missense_Mutation	SNP	G	G	A			TCGA-JL-A3YX-01A-11D-A22X-09	TCGA-JL-A3YX-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	72f91ad5-8d24-4a74-960c-646a15dd8d50	349f79fa-f1fa-4669-a522-7d33a00f78d6	g.chr19:13941397G>A	ENST00000254323.2	+	13	2692	c.2503G>A	c.(2503-2505)Gcc>Acc	p.A835T	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.A669T	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	835							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			GCTCAGCATCGCCTTCAACCA	0.682																																						dbGAP											0													69.0	65.0	67.0					19																	13941397		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.2503G>A	19.37:g.13941397G>A	ENSP00000254323:p.Ala835Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfscan_Znf_SWIM	p.A835T	ENST00000254323.2	37	c.2503	CCDS32924.1	19	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947669	0.73787	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.47177	0.85;0.85	4.37	3.33	0.38152	.	0.107337	0.39341	N	0.001384	T	0.37945	0.1022	L	0.51914	1.62	0.32772	N	0.503677	P;P	0.37594	0.601;0.556	B;B	0.34093	0.07;0.175	T	0.51379	-0.8713	10	0.41790	T	0.15	-6.9175	9.8569	0.41090	0.1037:0.0:0.8963:0.0	.	669;835	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	T	835;669	ENSP00000254323:A835T;ENSP00000405278:A669T	ENSP00000254323:A835T	A	+	1	0	ZSWIM4	13802397	1.000000	0.71417	0.994000	0.49952	0.961000	0.63080	3.210000	0.51129	0.818000	0.34468	0.491000	0.48974	GCC	ZSWIM4	-	NULL	ENSG00000132003		0.682	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	85	0.00	0	G	XM_031342		13941397	13941397	+1	no_errors	ENST00000254323	ensembl	human	known	69_37n	missense	97	10.19	11	SNP	1.000	A
