#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACAA1	30	genome.wustl.edu	37	3	38167948	38167948	+	Intron	SNP	C	C	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr3:38167948C>G	ENST00000333167.8	-	8	990				Y_RNA_ENST00000365095.1_RNA|ACAA1_ENST00000480865.1_5'UTR|ACAA1_ENST00000444607.2_3'UTR|ACAA1_ENST00000301810.7_Intron|ACAA1_ENST00000544624.1_3'UTR|ACAA1_ENST00000450296.1_Intron	NM_001607.3	NP_001598.1	P09110	THIK_HUMAN	acetyl-CoA acyltransferase 1						alpha-linolenic acid metabolic process (GO:0036109)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acetyl-CoA C-acyltransferase activity (GO:0003988)|palmitoyl-CoA oxidase activity (GO:0016401)			endometrium(1)|large_intestine(4)|lung(2)|ovary(1)|prostate(1)	9				KIRC - Kidney renal clear cell carcinoma(284;0.0523)|Kidney(284;0.0657)		GAGTACAGCACCCAGCATGGC	0.572																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X14813	CCDS2673.1, CCDS46794.1	3p22.2	2012-05-16	2010-04-30		ENSG00000060971	ENSG00000060971	2.3.1.16		82	protein-coding gene	gene with protein product	"""peroxisomal 3-oxoacyl-Coenzyme A thiolase"""	604054	"""acetyl-Coenzyme A acyltransferase 1"""				Standard	NM_001607		Approved		uc003cht.3	P09110	OTTHUMG00000131087	ENST00000333167.8:c.817+52G>C	3.37:g.38167948C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	G5E935|Q96CA6	RNA	SNP	-	NULL	ENST00000333167.8	37	NULL	CCDS2673.1	3																																																																																			ACAA1	-	-	ENSG00000060971		0.572	ACAA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAA1	HGNC	protein_coding	OTTHUMT00000342980.1	51	0.00	0	C	NM_001607		38167948	38167948	-1	no_errors	ENST00000480865	ensembl	human	known	69_37n	rna	34	19.05	8	SNP	0.027	G
ALOX15	246	genome.wustl.edu	37	17	4541604	4541604	+	Missense_Mutation	SNP	C	C	T	rs3892408		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr17:4541604C>T	ENST00000570836.1	-	7	811	c.715G>A	c.(715-717)Gtg>Atg	p.V239M	ALOX15_ENST00000545513.1_Missense_Mutation_p.V261M|ALOX15_ENST00000293761.3_Missense_Mutation_p.V239M|ALOX15_ENST00000574640.1_Missense_Mutation_p.V200M			P16050	LOX15_HUMAN	arachidonate 15-lipoxygenase	239	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.		V -> M (in dbSNP:rs3892408).		apoptotic cell clearance (GO:0043277)|arachidonic acid metabolic process (GO:0019369)|bone mineralization (GO:0030282)|cellular response to calcium ion (GO:0071277)|cellular response to interleukin-13 (GO:0035963)|hepoxilin biosynthetic process (GO:0051122)|inflammatory response (GO:0006954)|leukotriene metabolic process (GO:0006691)|lipoxin A4 biosynthetic process (GO:2001303)|lipoxygenase pathway (GO:0019372)|negative regulation of adaptive immune response (GO:0002820)|ossification (GO:0001503)|phosphatidylethanolamine biosynthetic process (GO:0006646)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|regulation of engulfment of apoptotic cell (GO:1901074)|regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035358)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|wound healing (GO:0042060)	cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|lipid particle (GO:0005811)|membrane (GO:0016020)|plasma membrane (GO:0005886)	arachidonate 12-lipoxygenase activity (GO:0004052)|arachidonate 15-lipoxygenase activity (GO:0050473)|eoxin A4 synthase activity (GO:0097260)|iron ion binding (GO:0005506)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(5)	20				READ - Rectum adenocarcinoma(115;0.0327)		CTCAGCACCACGGGGTTGGCG	0.592																																						dbGAP											0													1.0	1.0	1.0					17																	4541604		903	1912	2815	-	-	-	SO:0001583	missense	0			M23892	CCDS11049.1	17p13.3	2010-09-24			ENSG00000161905	ENSG00000161905	1.13.11.33	"""Arachidonate lipoxygenases"""	433	protein-coding gene	gene with protein product		152392				1570320	Standard	NM_001140		Approved	15-LOX-1	uc002fyh.3	P16050	OTTHUMG00000090746	ENST00000570836.1:c.715G>A	17.37:g.4541604C>T	ENSP00000458832:p.Val239Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P4|B7ZA11|Q8N6R7|Q99657	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C,pfscan_LipOase_LH2	p.V261M	ENST00000570836.1	37	c.781	CCDS11049.1	17	317	0.14514652014652016	95	0.19308943089430894	61	0.1685082872928177	74	0.12937062937062938	87	0.11477572559366754	C	0.005	-2.196159	0.00299	.	.	ENSG00000161905	ENST00000293761;ENST00000545513	T;T	0.07216	3.21;3.21	4.04	2.95	0.34219	Lipoxygenase, C-terminal (3);	0.316889	0.27469	N	0.019226	T	0.00012	0.0000	N	0.02266	-0.62	0.19775	N	0.99995	B;B;B	0.09022	0.002;0.002;0.002	B;B;B	0.08055	0.002;0.003;0.002	T	0.48080	-0.9066	10	0.06236	T	0.91	-15.1749	4.1582	0.10272	0.0:0.1104:0.2079:0.6817	rs9890466;rs12937345;rs62061508	261;200;239	F5H0G8;B7ZA11;P16050	.;.;LOX15_HUMAN	M	239;261	ENSP00000293761:V239M;ENSP00000439855:V261M	ENSP00000293761:V239M	V	-	1	0	ALOX15	4488353	0.950000	0.32346	0.998000	0.56505	0.180000	0.23129	0.313000	0.19415	0.629000	0.30376	-0.358000	0.07595	GTG	ALOX15	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000161905		0.592	ALOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX15	HGNC	protein_coding	OTTHUMT00000207487.2	25	0.00	0	C			4541604	4541604	-1	no_errors	ENST00000545513	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.997	T
ANXA7	310	genome.wustl.edu	37	10	75139669	75139669	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr10:75139669G>A	ENST00000372921.5	-	11	1189	c.1133C>T	c.(1132-1134)tCc>tTc	p.S378F	RP11-537A6.9_ENST00000427492.1_RNA|ANXA7_ENST00000535178.1_Missense_Mutation_p.S248F	NM_001156.3	NP_001147.1	P20073	ANXA7_HUMAN	annexin A7	400					autophagy (GO:0006914)|cell proliferation (GO:0008283)|cellular calcium ion homeostasis (GO:0006874)|cellular water homeostasis (GO:0009992)|epithelial cell differentiation (GO:0030855)|hemostasis (GO:0007599)|membrane fusion (GO:0061025)|negative regulation of gene expression (GO:0010629)|regulation of cell shape (GO:0008360)|response to calcium ion (GO:0051592)|response to organic cyclic compound (GO:0014070)|response to salt stress (GO:0009651)|social behavior (GO:0035176)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|integrin binding (GO:0005178)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	26	Prostate(51;0.0119)					TACATATCCGGAAAACTCACG	0.353																																						dbGAP											0													161.0	172.0	168.0					10																	75139669		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04543	CCDS7325.1, CCDS7326.1	10q22.2	2005-11-09			ENSG00000138279	ENSG00000138279		"""Annexins"""	545	protein-coding gene	gene with protein product		186360		ANX7		7515686	Standard	NM_001156		Approved		uc001jtz.2	P20073	OTTHUMG00000018463	ENST00000372921.5:c.1133C>T	10.37:g.75139669G>A	ENSP00000362012:p.Ser378Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5F2H3|Q5T0M6|Q5T0M7	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinVII,prints_AnnexinIV	p.S400F	ENST00000372921.5	37	c.1199	CCDS7325.1	10	.	.	.	.	.	.	.	.	.	.	G	20.8	4.055404	0.75960	.	.	ENSG00000138279	ENST00000372921;ENST00000372919;ENST00000535178	T;T;T	0.06687	3.27;3.27;3.27	5.65	5.65	0.86999	Annexin repeat, conserved site (1);	0.073451	0.64402	D	0.000019	T	0.42017	0.1184	H	0.95712	3.71	0.54753	D	0.999988	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.997;0.997;0.998	T	0.55186	-0.8180	10	0.87932	D	0	.	15.5869	0.76491	0.0:0.0:1.0:0.0	.	378;305;378;400	Q53HM8;B4DWU2;P20073-2;P20073	.;.;.;ANXA7_HUMAN	F	378;400;248	ENSP00000362012:S378F;ENSP00000362010:S400F;ENSP00000442864:S248F	ENSP00000362010:S400F	S	-	2	0	ANXA7	74809675	1.000000	0.71417	0.970000	0.41538	0.860000	0.49131	6.799000	0.75160	2.824000	0.97209	0.655000	0.94253	TCC	ANXA7	-	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat	ENSG00000138279		0.353	ANXA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA7	HGNC	protein_coding	OTTHUMT00000048646.2	33	0.00	0	G	NM_001156		75139669	75139669	-1	no_errors	ENST00000372919	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.997	A
ASIC3	9311	genome.wustl.edu	37	7	150747611	150747611	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:150747611C>A	ENST00000349064.5	+	3	927	c.729C>A	c.(727-729)agC>agA	p.S243R	ASIC3_ENST00000297512.8_Missense_Mutation_p.S243R|ASIC3_ENST00000357922.4_Missense_Mutation_p.S243R	NM_004769.3|NM_020321.3	NP_004760.1|NP_064717.1	Q9UHC3	ASIC3_HUMAN	acid-sensing (proton-gated) ion channel 3	243				SQ -> GH (in Ref. 1; BAA25897). {ECO:0000305}.	cation transmembrane transport (GO:0098655)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ion transmembrane transport (GO:0034220)|response to acid chemical (GO:0001101)|response to acidic pH (GO:0010447)|response to heat (GO:0009408)|sensory perception (GO:0007600)|sensory perception of sour taste (GO:0050915)|signal transduction (GO:0007165)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|enterobactin transporter activity (GO:0042931)|ligand-gated sodium channel activity (GO:0015280)|sodium channel activity (GO:0005272)										AGATCCACAGCCAGGAGGAGC	0.632																																						dbGAP											0													64.0	67.0	66.0					7																	150747611		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB010575	CCDS5914.1, CCDS5915.1, CCDS5916.1	7q35	2012-02-23	2012-02-22	2012-02-22	ENSG00000213199	ENSG00000213199		"""Ion channels / Acid-sensing (proton-gated) ion channels"""	101	protein-coding gene	gene with protein product	"""testis sodium channel 1"""	611741	"""amiloride-sensitive cation channel 3, testis"", ""amiloride-sensitive cation channel 3"""	ACCN3		9571199, 9744806	Standard	NM_004769		Approved	TNaC1, DRASIC	uc003wio.3	Q9UHC3	OTTHUMG00000158685	ENST00000349064.5:c.729C>A	7.37:g.150747611C>A	ENSP00000344838:p.Ser243Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9V0|O60263|O75906|Q59FN9|Q9UER8|Q9UHC4	Missense_Mutation	SNP	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	p.S243R	ENST00000349064.5	37	c.729	CCDS5916.1	7	.	.	.	.	.	.	.	.	.	.	C	18.32	3.598927	0.66332	.	.	ENSG00000213199	ENST00000357922;ENST00000349064;ENST00000297512	T;T;T	0.66099	-0.19;-0.19;-0.19	4.88	4.0	0.46444	.	0.326105	0.21565	U	0.072519	T	0.76856	0.4046	M	0.82517	2.595	0.38729	D	0.953611	P;P;P	0.51933	0.949;0.721;0.901	D;B;P	0.63283	0.913;0.281;0.697	T	0.78460	-0.2195	10	0.39692	T	0.17	-13.4063	11.4024	0.49878	0.0:0.9099:0.0:0.0901	.	243;243;243	Q9UHC3-2;Q9UHC3-3;Q9UHC3	.;.;ACCN3_HUMAN	R	243	ENSP00000350600:S243R;ENSP00000344838:S243R;ENSP00000297512:S243R	ENSP00000297512:S243R	S	+	3	2	ACCN3	150378544	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	2.676000	0.46883	1.173000	0.42796	0.555000	0.69702	AGC	ASIC3	-	pfam_Na+channel_ASC,prints_Na+channel_ASC,tigrfam_EnaC	ENSG00000213199		0.632	ASIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ASIC3	HGNC	protein_coding	OTTHUMT00000351725.1	33	0.00	0	C	NM_004769		150747611	150747611	+1	no_errors	ENST00000297512	ensembl	human	known	69_37n	missense	20	33.33	10	SNP	1.000	A
C12orf76	400073	genome.wustl.edu	37	12	110486272	110486272	+	Intron	SNP	T	T	C	rs7137233	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr12:110486272T>C	ENST00000309050.5	-	5	664				C12orf76_ENST00000551185.2_Missense_Mutation_p.Y10C|C12orf76_ENST00000547573.1_Missense_Mutation_p.Y10C|C12orf76_ENST00000546651.2_Missense_Mutation_p.Y10C|C12orf76_ENST00000548936.1_Intron|C12orf76_ENST00000549724.1_Missense_Mutation_p.Y10C|C12orf76_ENST00000546627.1_Missense_Mutation_p.Y10C	NM_207435.1	NP_997318.1	Q8N812	CL076_HUMAN	chromosome 12 open reading frame 76											endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6						GAGGCCAAGGTACAGCCACGG	0.682													C|||	1567	0.312899	0.6762	0.1859	5008	,	,		15708	0.1448		0.1779	False		,,,				2504	0.2239					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC041968	CCDS9141.1	12q24.11	2012-08-16			ENSG00000174456	ENSG00000174456			33790	protein-coding gene	gene with protein product							Standard	NM_207435		Approved	FLJ40142	uc001tqe.2	Q8N812	OTTHUMG00000169315	ENST00000309050.5:c.300-6008A>G	12.37:g.110486272T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Y10C	ENST00000309050.5	37	c.29	CCDS9141.1	12	558	0.2554945054945055	298	0.6056910569105691	76	0.20994475138121546	54	0.0944055944055944	130	0.17150395778364116	C	13.95	2.390118	0.42410	.	.	ENSG00000174456	ENST00000546651;ENST00000549724;ENST00000546627;ENST00000547573	T	0.21031	2.03	4.48	-1.48	0.08745	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	5.000000000032756E-6	B	0.02656	0.0	B	0.01281	0.0	T	0.38866	-0.9641	7	0.38643	T	0.18	.	3.8699	0.09031	0.538:0.244:0.1321:0.0858	rs7137233;rs7137233	10	F8W117	.	C	10	ENSP00000448915:Y10C	ENSP00000447574:Y10C	Y	-	2	0	C12orf76	108970655	0.000000	0.05858	0.000000	0.03702	0.053000	0.15095	-1.636000	0.02016	-0.305000	0.08831	-0.684000	0.03749	TAC	C12orf76	-	NULL	ENSG00000174456		0.682	C12orf76-001	KNOWN	basic|CCDS	protein_coding	C12orf76	HGNC	protein_coding	OTTHUMT00000403439.2	8	0.00	0	T	NM_207435		110486272	110486272	-1	no_errors	ENST00000551185	ensembl	human	known	69_37n	missense	5	54.55	6	SNP	0.000	C
C9orf131	138724	genome.wustl.edu	37	9	35045133	35045133	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr9:35045133C>A	ENST00000312292.5	+	2	2554	c.2507C>A	c.(2506-2508)cCc>cAc	p.P836H	C9orf131_ENST00000354479.5_Missense_Mutation_p.P763H|C9orf131_ENST00000421362.2_Missense_Mutation_p.P788H|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	836										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			ATTTATCCCCCCAATCCATGC	0.532																																						dbGAP											0													342.0	359.0	353.0					9																	35045133		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.2507C>A	9.37:g.35045133C>A	ENSP00000308279:p.Pro836His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	NULL	p.P836H	ENST00000312292.5	37	c.2507	CCDS6572.2	9	.	.	.	.	.	.	.	.	.	.	C	13.18	2.159076	0.38119	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292;ENST00000435140	T;T;T	0.15487	2.43;2.42;2.43	3.99	1.74	0.24563	.	0.589164	0.14381	N	0.323131	T	0.28234	0.0697	L	0.59436	1.845	0.09310	N	1	D;D;D;D	0.71674	0.998;0.998;0.998;0.998	P;P;P;P	0.61477	0.889;0.889;0.889;0.889	T	0.07309	-1.0779	10	0.52906	T	0.07	-0.433	5.0249	0.14379	0.0:0.6409:0.0:0.3591	.	311;836;763;788	B4DXT9;Q5VYM1;A6NLE6;E9PB26	.;CI131_HUMAN;.;.	H	788;763;836;311	ENSP00000393683:P788H;ENSP00000346472:P763H;ENSP00000308279:P836H	ENSP00000308279:P836H	P	+	2	0	C9orf131	35035133	0.000000	0.05858	0.000000	0.03702	0.042000	0.13812	-0.334000	0.07883	0.268000	0.21939	0.563000	0.77884	CCC	C9orf131	-	NULL	ENSG00000174038		0.532	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf131	HGNC	protein_coding	OTTHUMT00000052283.5	35	0.00	0	C	NM_203299		35045133	35045133	+1	no_errors	ENST00000312292	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.000	A
CADM2	253559	genome.wustl.edu	37	3	86010693	86010693	+	Missense_Mutation	SNP	A	A	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr3:86010693A>T	ENST00000407528.2	+	7	901	c.839A>T	c.(838-840)gAg>gTg	p.E280V	CADM2_ENST00000383699.3_Missense_Mutation_p.E289V|CADM2_ENST00000405615.2_Missense_Mutation_p.E282V	NM_001167674.1	NP_001161146.1	Q8N3J6	CADM2_HUMAN	cell adhesion molecule 2	280	Ig-like C2-type 2.				adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|synapse (GO:0045202)				endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(15)|ovary(1)|prostate(1)|skin(4)	38		Lung NSC(201;0.0148)		LUSC - Lung squamous cell carcinoma(29;0.000815)|Lung(72;0.00304)|BRCA - Breast invasive adenocarcinoma(55;0.156)|Epithelial(33;0.157)		AGTGGTAGGGAGCTAAACATT	0.438																																						dbGAP											0													164.0	153.0	157.0					3																	86010693		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF538973	CCDS33792.1, CCDS54613.1, CCDS54614.1	3p12.2	2013-01-11	2007-02-07	2007-02-07	ENSG00000175161	ENSG00000175161		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"""	29849	protein-coding gene	gene with protein product	"""nectin-like 3"""	609938	"""immunoglobulin superfamily, member 4D"""	IGSF4D			Standard	NM_153184		Approved	NECL3, Necl-3, SynCAM2	uc003dqj.3	Q8N3J6	OTTHUMG00000158990	ENST00000407528.2:c.839A>T	3.37:g.86010693A>T	ENSP00000384575:p.Glu280Val	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XHN7|G3XHN8|Q3KQY9|Q658Q7|Q8IZP8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,pfam_Ig_V-set,pfam_Ig_C1-set,smart_Ig_sub,smart_Ig_sub2,smart_Neurexin-like,pfscan_Ig-like	p.E282V	ENST00000407528.2	37	c.845	CCDS54614.1	3	.	.	.	.	.	.	.	.	.	.	A	13.32	2.201544	0.38905	.	.	ENSG00000175161	ENST00000383699;ENST00000407528;ENST00000405615	T;T;T	0.69926	-0.44;-0.44;-0.44	5.31	5.31	0.75309	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.151911	0.64402	D	0.000015	T	0.45696	0.1355	N	0.05608	-0.01	0.53688	D	0.999975	B;B;B	0.16603	0.001;0.003;0.018	B;B;B	0.20767	0.005;0.015;0.031	T	0.40384	-0.9566	10	0.30854	T	0.27	.	11.3696	0.49692	0.8564:0.0:0.0:0.1436	.	282;289;280	Q8N3J6-3;G3XHN4;Q8N3J6	.;.;CADM2_HUMAN	V	289;280;282	ENSP00000373200:E289V;ENSP00000384575:E280V;ENSP00000384193:E282V	ENSP00000373200:E289V	E	+	2	0	CADM2	86093383	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.620000	0.67736	2.124000	0.65301	0.528000	0.53228	GAG	CADM2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000175161		0.438	CADM2-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CADM2	HGNC	protein_coding	OTTHUMT00000352822.1	48	0.00	0	A	NM_153184		86010693	86010693	+1	no_errors	ENST00000405615	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	1.000	T
CCDC27	148870	genome.wustl.edu	37	1	3670688	3670688	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:3670688C>A	ENST00000294600.2	+	2	409	c.325C>A	c.(325-327)Ccc>Acc	p.P109T		NM_152492.2	NP_689705.2	Q2M243	CCD27_HUMAN	coiled-coil domain containing 27	109										breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|liver(2)|lung(17)|prostate(1)|skin(2)|urinary_tract(2)	36	all_cancers(77;0.0385)|Ovarian(185;0.0634)|Lung NSC(156;0.21)|all_lung(157;0.218)	all_epithelial(116;5.52e-17)|all_lung(118;1.04e-06)|Lung NSC(185;0.000214)|Renal(390;0.00357)|Breast(487;0.00446)|Hepatocellular(190;0.0218)|Lung SC(97;0.0367)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)		Epithelial(90;1.11e-38)|OV - Ovarian serous cystadenocarcinoma(86;1.35e-22)|GBM - Glioblastoma multiforme(42;3.46e-16)|Colorectal(212;1.17e-05)|COAD - Colon adenocarcinoma(227;5.76e-05)|Kidney(185;0.00036)|BRCA - Breast invasive adenocarcinoma(365;0.000696)|KIRC - Kidney renal clear cell carcinoma(229;0.00558)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.203)		CCAGAGTGAACCCAAGGATGC	0.582																																						dbGAP											0													107.0	99.0	102.0					1																	3670688		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS50.1	1p36.32	2008-02-05			ENSG00000162592	ENSG00000162592			26546	protein-coding gene	gene with protein product							Standard	NM_152492		Approved	FLJ32825	uc001akv.2	Q2M243	OTTHUMG00000003504	ENST00000294600.2:c.325C>A	1.37:g.3670688C>A	ENSP00000294600:p.Pro109Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBV3|Q96M50	Missense_Mutation	SNP	superfamily_Prefoldin	p.P109T	ENST00000294600.2	37	c.325	CCDS50.1	1	.	.	.	.	.	.	.	.	.	.	C	1.756	-0.488096	0.04352	.	.	ENSG00000162592	ENST00000294600	T	0.17854	2.25	2.97	-5.93	0.02254	.	3.816370	0.00735	N	0.000972	T	0.07098	0.0180	N	0.14661	0.345	0.09310	N	1	B	0.26876	0.162	B	0.22880	0.042	T	0.29243	-1.0018	10	0.06494	T	0.89	1.1469	3.3507	0.07151	0.1112:0.233:0.4401:0.2157	.	109	Q2M243	CCD27_HUMAN	T	109	ENSP00000294600:P109T	ENSP00000294600:P109T	P	+	1	0	CCDC27	3660548	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.619000	0.00879	-2.764000	0.00368	0.609000	0.83330	CCC	CCDC27	-	NULL	ENSG00000162592		0.582	CCDC27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC27	HGNC	protein_coding	OTTHUMT00000009740.1	37	0.00	0	C	NM_152492		3670688	3670688	+1	no_errors	ENST00000294600	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.000	A
CEP57L1	285753	genome.wustl.edu	37	6	109471414	109471414	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr6:109471414G>A	ENST00000517392.1	+	4	860	c.434G>A	c.(433-435)cGa>cAa	p.R145Q	CEP57L1_ENST00000368970.2_Missense_Mutation_p.R145Q|CEP57L1_ENST00000523787.1_Missense_Mutation_p.R148Q|CEP57L1_ENST00000520883.1_Missense_Mutation_p.R69Q|CEP57L1_ENST00000407272.1_Missense_Mutation_p.R145Q|CEP57L1_ENST00000521522.1_Missense_Mutation_p.R145Q|CEP57L1_ENST00000519095.1_Missense_Mutation_p.R145Q|CEP57L1_ENST00000336977.4_Missense_Mutation_p.R69Q|CEP57L1_ENST00000368968.2_Missense_Mutation_p.R145Q|CEP57L1_ENST00000359793.3_Missense_Mutation_p.R145Q|CEP57L1_ENST00000521277.1_Missense_Mutation_p.R129Q	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1	145					microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						AACGTAGAGCGAGAAAAGAAC	0.328																																						dbGAP											0													97.0	99.0	99.0					6																	109471414		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.434G>A	6.37:g.109471414G>A	ENSP00000427844:p.Arg145Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E992	Missense_Mutation	SNP	pfam_Cep57_MT-bd_dom	p.R145Q	ENST00000517392.1	37	c.434	CCDS5071.1	6	.	.	.	.	.	.	.	.	.	.	G	12.45	1.941036	0.34283	.	.	ENSG00000183137	ENST00000521277;ENST00000517392;ENST00000407272;ENST00000336977;ENST00000540778;ENST00000519286;ENST00000518853;ENST00000521522;ENST00000524064;ENST00000519407;ENST00000519095;ENST00000368968;ENST00000522490;ENST00000523209;ENST00000368970;ENST00000520883;ENST00000523787;ENST00000359793	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.43688	0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94;0.94	5.35	3.28	0.37604	.	0.591043	0.16711	N	0.202662	T	0.05686	0.0149	N	0.12182	0.205	0.24550	N	0.994028	P;B;P;P	0.42456	0.78;0.371;0.518;0.518	B;B;B;B	0.32393	0.145;0.05;0.053;0.053	T	0.09015	-1.0694	10	0.14252	T	0.57	-10.4807	2.5564	0.04761	0.1011:0.1406:0.4618:0.2965	.	145;145;145;129	Q8IYX8;G5E992;Q6P2R3;E5RJH1	CE57L_HUMAN;.;.;.	Q	129;145;145;69;145;145;145;145;145;7;145;145;7;7;145;69;148;145	ENSP00000430558:R129Q;ENSP00000427844:R145Q;ENSP00000383936:R145Q;ENSP00000337392:R69Q;ENSP00000429812:R145Q;ENSP00000430265:R145Q;ENSP00000428344:R145Q;ENSP00000427771:R145Q;ENSP00000430565:R7Q;ENSP00000430911:R145Q;ENSP00000357964:R145Q;ENSP00000429957:R7Q;ENSP00000430013:R7Q;ENSP00000357966:R145Q;ENSP00000430011:R69Q;ENSP00000430529:R148Q;ENSP00000352841:R145Q	ENSP00000337392:R69Q	R	+	2	0	CEP57L1	109578107	0.215000	0.23574	1.000000	0.80357	0.992000	0.81027	1.117000	0.31234	2.509000	0.84616	0.462000	0.41574	CGA	CEP57L1	-	pfam_Cep57_MT-bd_dom	ENSG00000183137		0.328	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	CEP57L1	HGNC	protein_coding	OTTHUMT00000041734.4	27	0.00	0	G	NM_173830		109471414	109471414	+1	no_errors	ENST00000359793	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.971	A
CFI	3426	genome.wustl.edu	37	4	110685842	110685842	+	Missense_Mutation	SNP	C	C	G	rs189153845		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr4:110685842C>G	ENST00000394634.2	-	3	540	c.333G>C	c.(331-333)aaG>aaC	p.K111N	CFI_ENST00000512148.1_Missense_Mutation_p.K111N|CFI_ENST00000394635.3_Missense_Mutation_p.K111N|CFI_ENST00000510800.1_Missense_Mutation_p.K111N	NM_000204.3	NP_000195	P05156	CFAI_HUMAN	complement factor I	111					complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	metal ion binding (GO:0046872)|scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|skin(2)|stomach(1)	27		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000331)		AAACACTAAACTTTCCTAAAA	0.289													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20403	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													89.0	78.0	82.0					4																	110685842		2203	4300	6503	-	-	-	SO:0001583	missense	0			J02770	CCDS34049.1	4q25	2014-09-17	2006-02-10	2006-02-10		ENSG00000205403	3.4.21.45	"""Complement system"""	5394	protein-coding gene	gene with protein product	"""Konglutinogen-activating factor"", ""C3b-inactivator"""	217030	"""I factor (complement)"""	IF		2956252	Standard	NM_000204		Approved	FI, C3b-INA, KAF	uc003hzr.4	P05156		ENST00000394634.2:c.333G>C	4.37:g.110685842C>G	ENSP00000378130:p.Lys111Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O60442	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_LDrepeatLR_classA_rpt,pfam_Srcr_rcpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_FacI_MAC,smart_Srcr_rcpt-rel,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,pfscan_LDrepeatLR_classA_rpt,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.K111N	ENST00000394634.2	37	c.333	CCDS34049.1	4	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	11.78	1.739459	0.30774	.	.	ENSG00000205403	ENST00000394635;ENST00000394634;ENST00000540104;ENST00000512148;ENST00000536228;ENST00000510800	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.71	-2.44	0.06502	Speract/scavenger receptor-related (1);	0.616089	0.15907	N	0.238772	T	0.19725	0.0474	L	0.49350	1.555	0.19945	N	0.999944	B;B;B	0.13145	0.003;0.006;0.007	B;B;B	0.11329	0.002;0.006;0.002	T	0.19224	-1.0312	10	0.23302	T	0.38	-9.2266	4.1199	0.10101	0.1039:0.3918:0.1065:0.3978	.	111;111;111	E7ETH0;G3XAM2;P05156	.;.;CFAI_HUMAN	N	111;111;111;111;93;111	ENSP00000378131:K111N;ENSP00000378130:K111N;ENSP00000427438:K111N;ENSP00000422009:K111N	ENSP00000378130:K111N	K	-	3	2	CFI	110905291	0.004000	0.15560	0.536000	0.28039	0.942000	0.58702	-0.513000	0.06305	-0.082000	0.12640	-0.793000	0.03317	AAG	CFI	-	superfamily_Srcr_rcpt-rel	ENSG00000205403		0.289	CFI-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	CFI	HGNC	protein_coding		26	0.00	0	C	NM_000204		110685842	110685842	-1	no_errors	ENST00000394634	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.159	G
CHD2	1106	genome.wustl.edu	37	15	93567820	93567820	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr15:93567820C>T	ENST00000394196.4	+	39	6440	c.5372C>T	c.(5371-5373)cCt>cTt	p.P1791L		NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	1791					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			CGCTCACCCCCTTCTCAGAAA	0.483																																						dbGAP											0													95.0	97.0	96.0					15																	93567820		1907	4116	6023	-	-	-	SO:0001583	missense	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.5372C>T	15.37:g.93567820C>T	ENSP00000377747:p.Pro1791Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.P1791L	ENST00000394196.4	37	c.5372	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	C	11.28	1.592403	0.28357	.	.	ENSG00000173575	ENST00000394196	D	0.88124	-2.34	5.77	5.77	0.91146	.	.	.	.	.	T	0.76997	0.4066	N	0.04508	-0.205	0.80722	D	1	B	0.09022	0.002	B	0.08055	0.003	T	0.69285	-0.5185	9	0.39692	T	0.17	-9.2288	20.3473	0.98799	0.0:1.0:0.0:0.0	.	1791	O14647	CHD2_HUMAN	L	1791	ENSP00000377747:P1791L	ENSP00000377747:P1791L	P	+	2	0	CHD2	91368824	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.022000	0.57203	2.884000	0.98904	0.655000	0.94253	CCT	CHD2	-	NULL	ENSG00000173575		0.483	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	47	0.00	0	C	NM_001271		93567820	93567820	+1	no_errors	ENST00000394196	ensembl	human	novel	69_37n	missense	40	13.04	6	SNP	1.000	T
CHRNA1	1134	genome.wustl.edu	37	2	175618413	175618413	+	Missense_Mutation	SNP	T	T	A	rs76911424		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr2:175618413T>A	ENST00000261007.5	-	7	737	c.671A>T	c.(670-672)aAg>aTg	p.K224M	CHRNA1_ENST00000409542.1_Missense_Mutation_p.K117M|CHRNA1_ENST00000348749.5_Missense_Mutation_p.K199M|CHRNA1_ENST00000409323.1_Missense_Mutation_p.K199M|CHRNA1_ENST00000409219.1_Missense_Mutation_p.K199M|AC018890.6_ENST00000442996.1_RNA	NM_001039523.2	NP_001034612.1	P02708	ACHA_HUMAN	cholinergic receptor, nicotinic, alpha 1 (muscle)	224					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|muscle cell cellular homeostasis (GO:0046716)|musculoskeletal movement (GO:0050881)|neuromuscular junction development (GO:0007528)|neuromuscular process (GO:0050905)|neuromuscular synaptic transmission (GO:0007274)|neuron cellular homeostasis (GO:0070050)|neuronal action potential (GO:0019228)|regulation of membrane potential (GO:0042391)|signal transduction (GO:0007165)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue growth (GO:0048630)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cell surface (GO:0009986)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ion channel activity (GO:0005216)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(15)|ovary(3)|prostate(3)|skin(4)	37					Galantamine(DB00674)	CCGGGACTCCTTGATCACCCA	0.602																																						dbGAP											0													94.0	91.0	92.0					2																	175618413		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00762	CCDS2261.1, CCDS33331.1	2q31.1	2012-02-11	2006-02-01		ENSG00000138435	ENSG00000138435		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1955	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 1 (muscle)"""	100690	"""cholinergic receptor, nicotinic, alpha polypeptide 1 (muscle)"""	CHRNA			Standard	NM_001039523		Approved		uc002uje.2	P02708	OTTHUMG00000132357	ENST00000261007.5:c.671A>T	2.37:g.175618413T>A	ENSP00000261007:p.Lys224Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRV6|D3DPE8	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel	p.K224M	ENST00000261007.5	37	c.671	CCDS33331.1	2	.	.	.	.	.	.	.	.	.	.	T	16.00	2.999853	0.54147	.	.	ENSG00000138435	ENST00000348749;ENST00000261007;ENST00000409542;ENST00000409219;ENST00000409323	T;T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13;-1.13	5.29	5.29	0.74685	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.81432	0.4821	L	0.28556	0.865	0.80722	D	1	P;D;P	0.64830	0.459;0.994;0.804	B;D;P	0.71184	0.321;0.972;0.771	T	0.82250	-0.0550	10	0.46703	T	0.11	.	15.5341	0.75990	0.0:0.0:0.0:1.0	.	199;199;224	G5E9G9;Q53SH4;P02708	.;.;ACHA_HUMAN	M	199;224;117;199;199	ENSP00000261008:K199M;ENSP00000261007:K224M;ENSP00000387026:K117M;ENSP00000386611:K199M;ENSP00000386684:K199M	ENSP00000261007:K224M	K	-	2	0	CHRNA1	175326659	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.891000	0.63185	2.127000	0.65507	0.528000	0.53228	AAG	CHRNA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd	ENSG00000138435		0.602	CHRNA1-002	KNOWN	basic|CCDS	protein_coding	CHRNA1	HGNC	protein_coding	OTTHUMT00000334116.1	25	0.00	0	T			175618413	175618413	-1	no_errors	ENST00000261007	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	1.000	A
CLCNKA	1187	genome.wustl.edu	37	1	16360382	16360382	+	3'UTR	SNP	G	G	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:16360382G>T	ENST00000331433.4	+	0	2312				CLCNKA_ENST00000375692.1_3'UTR|CLCNKA_ENST00000464764.1_3'UTR|CLCNKA_ENST00000420078.1_3'UTR			P51800	CLCKA_HUMAN	chloride channel, voltage-sensitive Ka						excretion (GO:0007588)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)|metal ion binding (GO:0046872)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|skin(1)	19		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.04e-08)|COAD - Colon adenocarcinoma(227;5.46e-06)|BRCA - Breast invasive adenocarcinoma(304;9.02e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)	Niflumic Acid(DB04552)	AGCTGAGTGTGAGAAGATGGA	0.512																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS167.1, CCDS41269.1, CCDS57973.1	1p36	2012-09-26	2012-02-23		ENSG00000186510	ENSG00000186510		"""Ion channels / Chloride channels : Voltage-sensitive"""	2026	protein-coding gene	gene with protein product		602024	"""chloride channel Ka"""			8544406	Standard	NM_004070		Approved	hClC-Ka	uc001axu.3	P51800	OTTHUMG00000009529	ENST00000331433.4:c.*229G>T	1.37:g.16360382G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPD3|E7EPH6|Q5T5P8|Q5T5Q4|Q7Z6D1|Q86VT1	RNA	SNP	-	NULL	ENST00000331433.4	37	NULL	CCDS167.1	1																																																																																			CLCNKA	-	-	ENSG00000186510		0.512	CLCNKA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLCNKA	HGNC	protein_coding	OTTHUMT00000026326.1	58	0.00	0	G			16360382	16360382	+1	no_errors	ENST00000464764	ensembl	human	known	69_37n	rna	24	14.29	4	SNP	0.000	T
DHX15	1665	genome.wustl.edu	37	4	24541821	24541821	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr4:24541821G>T	ENST00000336812.4	-	10	1852	c.1696C>A	c.(1696-1698)Cct>Act	p.P566T	DHX15_ENST00000508032.1_5'Flank	NM_001358.2	NP_001349.2	O43143	DHX15_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 15	566					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|U12-type spliceosomal complex (GO:0005689)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	30		Breast(46;0.0503)				GGATCTAGAGGAAACTCTGCC	0.418																																						dbGAP											0													138.0	136.0	137.0					4																	24541821		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001636	CCDS33966.1	4p15.3	2013-05-13	2013-05-13	2003-06-20	ENSG00000109606	ENSG00000109606		"""DEAH-boxes"""	2738	protein-coding gene	gene with protein product		603403	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 15"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 15"""	DDX15		9388478	Standard	NM_001358		Approved	HRH2, DBP1, PRP43, PrPp43p, PRPF43	uc003gqx.3	O43143	OTTHUMG00000160304	ENST00000336812.4:c.1696C>A	4.37:g.24541821G>T	ENSP00000336741:p.Pro566Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NQT7	Missense_Mutation	SNP	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P566T	ENST00000336812.4	37	c.1696	CCDS33966.1	4	.	.	.	.	.	.	.	.	.	.	G	27.1	4.800847	0.90538	.	.	ENSG00000109606	ENST00000336812;ENST00000535946	T	0.58060	0.36	6.16	6.16	0.99307	Helicase-associated domain (2);	0.000000	0.85682	D	0.000000	D	0.86736	0.6004	H	0.99668	4.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91735	0.5399	10	0.87932	D	0	-13.6391	20.8598	0.99761	0.0:0.0:1.0:0.0	.	566	O43143	DHX15_HUMAN	T	566;555	ENSP00000336741:P566T	ENSP00000336741:P566T	P	-	1	0	DHX15	24150919	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.937000	0.99478	0.650000	0.86243	CCT	DHX15	-	pfam_Helicase-assoc_dom,smart_Helicase-assoc_dom	ENSG00000109606		0.418	DHX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX15	HGNC	protein_coding	OTTHUMT00000360143.1	27	0.00	0	G	NM_001358		24541821	24541821	-1	no_errors	ENST00000336812	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	T
DIP2C	22982	genome.wustl.edu	37	10	486824	486824	+	Silent	SNP	G	G	T	rs146235358	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr10:486824G>T	ENST00000280886.6	-	4	468	c.381C>A	c.(379-381)gcC>gcA	p.A127A	RP11-490E15.2_ENST00000425723.2_RNA|DIP2C_ENST00000381496.3_Silent_p.A20A	NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	127						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		GAGGGGTGTAGGCGTCCATCG	0.592																																						dbGAP											0													118.0	92.0	101.0					10																	486824		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.381C>A	10.37:g.486824G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPI5|Q5SS78	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.A127	ENST00000280886.6	37	c.381	CCDS7054.1	10																																																																																			DIP2C	-	NULL	ENSG00000151240		0.592	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	HGNC	protein_coding	OTTHUMT00000046389.1	26	0.00	0	G	NM_014974		486824	486824	-1	no_errors	ENST00000280886	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	1.000	T
DISC1	27185	genome.wustl.edu	37	1	232144818	232144818	+	3'UTR	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:232144818C>T	ENST00000535983.1	+	0	2322				DISC1_ENST00000537876.1_3'UTR|DISC1_ENST00000439617.2_Intron|DISC1_ENST00000366637.3_Intron	NM_001164538.1|NM_001164541.1	NP_001158010.1|NP_001158013.1	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1						canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				CACATGGCCTCCAGAGGGGAC	0.463																																						dbGAP											0													49.0	45.0	46.0					1																	232144818		1854	4097	5951	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000535983.1:c.*181C>T	1.37:g.232144818C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	NULL	p.P180S	ENST00000535983.1	37	c.538	CCDS53483.1	1	.	.	.	.	.	.	.	.	.	.	C	9.819	1.185357	0.21870	.	.	ENSG00000162946	ENST00000422590	.	.	.	4.18	-0.686	0.11324	.	.	.	.	.	T	0.14399	0.0348	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.25847	-1.0120	5	.	.	.	.	3.6923	0.08351	0.0:0.2829:0.2042:0.5129	.	.	.	.	S	180	.	.	P	+	1	0	DISC1	230211441	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.266000	0.08631	0.001000	0.14605	-0.172000	0.13284	CCA	DISC1	-	NULL	ENSG00000162946		0.463	DISC1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	DISC1	HGNC	protein_coding		24	0.00	0	C	NM_018662		232144818	232144818	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000422590	ensembl	human	known	69_37n	missense	17	26.09	6	SNP	0.000	T
DLGAP4	22839	genome.wustl.edu	37	20	35128637	35128638	+	Missense_Mutation	DNP	GG	GG	CC			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr20:35128637_35128638GG>CC	ENST00000373907.2	+	9	2334_2335	c.2135_2136GG>CC	c.(2134-2136)cGG>cCC	p.R712P	DLGAP4_ENST00000373913.3_Missense_Mutation_p.R709P|DLGAP4_ENST00000340491.4_Missense_Mutation_p.R173P|DLGAP4_ENST00000401952.2_Missense_Mutation_p.R709P|DLGAP4_ENST00000475894.1_3'UTR|DLGAP4_ENST00000339266.5_Missense_Mutation_p.R712P			Q9Y2H0	DLGP4_HUMAN	discs, large (Drosophila) homolog-associated protein 4	712					cell-cell signaling (GO:0007267)	membrane (GO:0016020)|synapse (GO:0045202)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(20)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	37	Breast(12;0.0192)	Myeloproliferative disorder(115;0.00878)				TCCTCCCGACGGGACACAGACT	0.594																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF088030	CCDS13274.1, CCDS13275.1	20q11.23	2010-02-05			ENSG00000080845	ENSG00000080845			24476	protein-coding gene	gene with protein product						9115257	Standard	XM_005260329		Approved	DAP4, KIAA0964, SAPAP4	uc010zvp.2	Q9Y2H0	OTTHUMG00000032390	Exception_encountered	20.37:g.35128637_35128638delinsCC	ENSP00000363014:p.Arg712Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5T5|Q5QPG4|Q5T2Y4|Q5T2Y5|Q9H137|Q9H138|Q9H1L7	Missense_Mutation|Silent	SNP	pfam_GKAP	p.R712P|p.R712	ENST00000373907.2	37	c.2135|c.2136		20																																																																																			DLGAP4	-	pfam_GKAP	ENSG00000080845		0.594	DLGAP4-007	KNOWN	basic|appris_candidate_longest	protein_coding	DLGAP4	HGNC	protein_coding	OTTHUMT00000079025.2	26	0.00	0	G	NM_014902		35128637|35128638	35128637|35128638	+1	no_errors	ENST00000339266	ensembl	human	known	69_37n	missense|silent	25|23	21.88|25.81	7|8	SNP	1.000	C
DYRK4	8798	genome.wustl.edu	37	12	4705773	4705773	+	Silent	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr12:4705773G>A	ENST00000540757.2	+	6	598	c.438G>A	c.(436-438)ctG>ctA	p.L146L	DYRK4_ENST00000010132.5_Silent_p.L146L|DYRK4_ENST00000543431.1_Silent_p.L146L	NM_001282285.1|NM_001282286.1|NM_003845.1	NP_001269214.1|NP_001269215.1|NP_003836.1	Q9NR20	DYRK4_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 4	146	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27			Colorectal(7;0.103)			AGCAGGCCCTGATGGAGCTGA	0.512																																						dbGAP											0													79.0	71.0	74.0					12																	4705773		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y09305	CCDS8530.1	12p13.32	2014-09-11			ENSG00000010219	ENSG00000010219			3095	protein-coding gene	gene with protein product		609181				9748265	Standard	NM_003845		Approved		uc001qmx.3	Q9NR20	OTTHUMG00000168204	ENST00000540757.2:c.438G>A	12.37:g.4705773G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8F7|Q8NEF2|Q92631	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L146	ENST00000540757.2	37	c.438	CCDS8530.1	12																																																																																			DYRK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000010219		0.512	DYRK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DYRK4	HGNC	protein_coding	OTTHUMT00000398780.2	48	0.00	0	G			4705773	4705773	+1	no_errors	ENST00000010132	ensembl	human	known	69_37n	silent	38	19.15	9	SNP	0.998	A
EVC2	132884	genome.wustl.edu	37	4	5642369	5642369	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr4:5642369C>T	ENST00000344408.5	-	10	1395	c.1342G>A	c.(1342-1344)Gat>Aat	p.D448N	EVC2_ENST00000310917.2_Missense_Mutation_p.D368N|EVC2_ENST00000344938.1_Missense_Mutation_p.D448N	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	448					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						ATCTTCCGATCGTACTCCTCT	0.448																																						dbGAP											0													312.0	285.0	294.0					4																	5642369		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1342G>A	4.37:g.5642369C>T	ENSP00000342144:p.Asp448Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_EVC2-like	p.D448N	ENST00000344408.5	37	c.1342	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141431	0.57044	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	T;T;T	0.77229	-1.08;-1.08;-1.08	4.25	3.38	0.38709	.	0.079605	0.50627	D	0.000117	T	0.77745	0.4176	L	0.60455	1.87	0.25458	N	0.987945	D	0.59357	0.985	P	0.53861	0.736	T	0.67377	-0.5686	10	0.37606	T	0.19	-14.8172	6.9985	0.24797	0.0:0.7264:0.1775:0.0961	.	448	Q86UK5	LBN_HUMAN	N	448;368;448	ENSP00000339954:D448N;ENSP00000311683:D368N;ENSP00000342144:D448N	ENSP00000311683:D368N	D	-	1	0	EVC2	5693270	0.944000	0.32072	0.870000	0.34147	0.621000	0.37620	1.036000	0.30228	2.074000	0.62210	0.591000	0.81541	GAT	EVC2	-	pfam_EVC2-like	ENSG00000173040		0.448	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	68	0.00	0	C	NM_147127		5642369	5642369	-1	no_errors	ENST00000344408	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	0.837	T
FAM107B	83641	genome.wustl.edu	37	10	14563237	14563237	+	Silent	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr10:14563237G>A	ENST00000378470.1	-	4	634	c.348C>T	c.(346-348)ggC>ggT	p.G116G	FAM107B_ENST00000468747.1_Silent_p.G116G|FAM107B_ENST00000181796.2_Silent_p.G291G|FAM107B_ENST00000478076.1_Silent_p.G116G|FAM107B_ENST00000479731.1_Silent_p.G116G|FAM107B_ENST00000378467.4_Silent_p.G116G|FAM107B_ENST00000496330.1_Silent_p.G116G|FAM107B_ENST00000378458.2_Silent_p.G116G|FAM107B_ENST00000378462.1_Silent_p.G116G|FAM107B_ENST00000378465.3_Silent_p.G116G	NM_001282695.1|NM_001282696.1|NM_001282697.1|NM_001282698.1|NM_001282700.1|NM_001282701.1|NM_001282702.1|NM_001282703.1	NP_001269624.1|NP_001269625.1|NP_001269626.1|NP_001269627.1|NP_001269629.1|NP_001269630.1|NP_001269631.1|NP_001269632.1	Q9H098	F107B_HUMAN	family with sequence similarity 107, member B	116					sensory perception of sound (GO:0007605)					breast(7)|kidney(1)|large_intestine(4)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						TCCTGAGATTGCCTTTCACCT	0.483																																						dbGAP											0													172.0	153.0	159.0					10																	14563237		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK127413	CCDS7102.1, CCDS60486.1	10p14	2006-01-17	2006-01-17	2005-11-20	ENSG00000065809	ENSG00000065809			23726	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 45"""	C10orf45		11230166	Standard	XM_005252616		Approved	FLJ45505, MGC11034	uc001ina.1	Q9H098	OTTHUMG00000017709	ENST00000378470.1:c.348C>T	10.37:g.14563237G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1P4|D3DRT2|Q5T9K7|Q5T9K8|Q6ZSI4	Silent	SNP	pfam_DUF1151	p.G291	ENST00000378470.1	37	c.873		10																																																																																			FAM107B	-	pfam_DUF1151	ENSG00000065809		0.483	FAM107B-002	KNOWN	basic|appris_principal	protein_coding	FAM107B	HGNC	protein_coding	OTTHUMT00000046899.1	60	0.00	0	G	NM_031453		14563237	14563237	-1	no_errors	ENST00000181796	ensembl	human	known	69_37n	silent	42	22.22	12	SNP	1.000	A
SPATA31E1	286234	genome.wustl.edu	37	9	90497818	90497818	+	Silent	SNP	C	C	T	rs377006333		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr9:90497818C>T	ENST00000325643.5	+	1	78	c.12C>T	c.(10-12)ctC>ctT	p.L4L		NM_178828.4	NP_849150.3	Q6ZUB1	S31E1_HUMAN	SPATA31 subfamily E, member 1	4					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											TGGGAAATCTCGTCATCCCTC	0.607																																						dbGAP											0													59.0	52.0	54.0					9																	90497818		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093185	CCDS6676.1	9q22.1-q22.2	2012-10-12	2012-10-12	2012-10-12	ENSG00000177992	ENSG00000177992			26672	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 79"", ""family with sequence similarity 75, member E1"""	C9orf79, FAM75E1			Standard	NM_178828		Approved	FLJ35866	uc004app.4	Q6ZUB1	OTTHUMG00000020157	ENST00000325643.5:c.12C>T	9.37:g.90497818C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPB1|Q5SQC9|Q8NA41|Q8ND27	Silent	SNP	NULL	p.L4	ENST00000325643.5	37	c.12	CCDS6676.1	9																																																																																			FAM75E1	-	NULL	ENSG00000177992		0.607	SPATA31E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75E1	HGNC	protein_coding	OTTHUMT00000052954.2	40	0.00	0	C	NM_178828		90497818	90497818	+1	no_errors	ENST00000325643	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	0.176	T
FAT4	79633	genome.wustl.edu	37	4	126411541	126411541	+	Missense_Mutation	SNP	A	A	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr4:126411541A>T	ENST00000394329.3	+	17	13577	c.13564A>T	c.(13564-13566)Agc>Tgc	p.S4522C	FAT4_ENST00000335110.5_Missense_Mutation_p.S2763C	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	4522					branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CCTGGTCCTTAGCCTGATCCT	0.547																																						dbGAP											0													55.0	56.0	56.0					4																	126411541		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.13564A>T	4.37:g.126411541A>T	ENSP00000377862:p.Ser4522Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S4522C	ENST00000394329.3	37	c.13564	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	A	17.23	3.335653	0.60853	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.76316	-0.83;-1.01	5.17	4.0	0.46444	.	0.000000	0.40908	U	0.000997	T	0.74589	0.3736	L	0.38531	1.155	0.36690	D	0.879521	D;D;D	0.61697	0.99;0.983;0.99	P;P;P	0.53313	0.723;0.533;0.723	T	0.77469	-0.2576	10	0.39692	T	0.17	.	9.6102	0.39659	0.9179:0.0:0.0821:0.0	.	2763;4522;4521	Q6V0I7-2;Q6V0I7;Q6V0I7-3	.;FAT4_HUMAN;.	C	4522;2763	ENSP00000377862:S4522C;ENSP00000335169:S2763C	ENSP00000335169:S2763C	S	+	1	0	FAT4	126630991	1.000000	0.71417	0.998000	0.56505	0.948000	0.59901	4.037000	0.57311	1.941000	0.56285	0.459000	0.35465	AGC	FAT4	-	NULL	ENSG00000196159		0.547	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	55	0.00	0	A	NM_024582		126411541	126411541	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.941	T
FBXO18	84893	genome.wustl.edu	37	10	5945078	5945081	+	Frame_Shift_Del	DEL	ACAA	ACAA	-			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	ACAA	ACAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr10:5945078_5945081delACAA	ENST00000362091.4	+	2	212_215	c.97_100delACAA	c.(97-102)acaaacfs	p.TN33fs	FBXO18_ENST00000470089.1_Intron|FBXO18_ENST00000379999.5_Frame_Shift_Del_p.TN84fs|FBXO18_ENST00000397269.3_5'UTR	NM_001258453.1|NM_178150.2	NP_001245382.1|NP_835363.1	Q8NFZ0	FBX18_HUMAN	F-box protein, helicase, 18	33					DNA catabolic process, endonucleolytic (GO:0000737)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)|positive regulation of protein phosphorylation (GO:0001934)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)			NS(2)|breast(2)|kidney(2)|large_intestine(16)|lung(9)|ovary(2)|prostate(3)|skin(3)|stomach(1)	40						TCAAAGATGGACAAACAGAGATCC	0.475																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK095343	CCDS7072.1, CCDS7073.1, CCDS73064.1	10p15.1	2004-08-24	2004-06-15		ENSG00000134452	ENSG00000134452		"""F-boxes /  ""other"""""	13620	protein-coding gene	gene with protein product		607222	"""F-box only protein 18"""			10531037, 11956208	Standard	NM_032807		Approved	FBH1, FLJ14590, Fbx18	uc001iit.4	Q8NFZ0	OTTHUMG00000017609	ENST00000362091.4:c.97_100delACAA	10.37:g.5945078_5945081delACAA	ENSP00000355415:p.Thr33fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JVB0|Q5JVB1|Q7Z4Q6|Q7Z4R0|Q8N1P5|Q8N586|Q96E82|Q96K67|Q96SW7|Q9UFB2	Frame_Shift_Del	DEL	pfam_UvrD-like_ATP-bd,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.N85fs	ENST00000362091.4	37	c.250_253	CCDS7072.1	10																																																																																			FBXO18	-	NULL	ENSG00000134452		0.475	FBXO18-009	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO18	HGNC	protein_coding	OTTHUMT00000046596.1	51	0.00	0	ACAA	NM_032807		5945078	5945081	+1	no_errors	ENST00000379999	ensembl	human	known	69_37n	frame_shift_del	57	13.64	9	DEL	1.000:1.000:0.999:1.000	-
FN3K	64122	genome.wustl.edu	37	17	80708422	80708422	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr17:80708422C>G	ENST00000300784.7	+	6	783	c.721C>G	c.(721-723)Cat>Gat	p.H241D	TBCD_ENST00000397466.2_5'Flank|TBCD_ENST00000539345.2_5'Flank|TBCD_ENST00000355528.4_5'Flank	NM_022158.3	NP_071441.1	Q9H479	FN3K_HUMAN	fructosamine 3 kinase	241					epithelial cell differentiation (GO:0030855)|fructoselysine metabolic process (GO:0030393)		fructosamine-3-kinase activity (GO:0030387)			central_nervous_system(1)|kidney(1)|lung(1)|urinary_tract(1)	4	Breast(20;0.000523)|all_neural(118;0.0952)		BRCA - Breast invasive adenocarcinoma(99;0.0344)|OV - Ovarian serous cystadenocarcinoma(97;0.061)			CTTCTATGGCCATTCCGAGTT	0.587																																					Melanoma(10;391 597 14592 32548 32749)	dbGAP											0													159.0	158.0	159.0					17																	80708422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ404615	CCDS11818.1	17q25	2008-02-05				ENSG00000167363			24822	protein-coding gene	gene with protein product		608425				11522682, 14641062	Standard	NM_022158		Approved		uc010wvs.1	Q9H479		ENST00000300784.7:c.721C>G	17.37:g.80708422C>G	ENSP00000300784:p.His241Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fructo-/Ketosamine-3-kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,pirsf_Fructo-/Ketosamine-3-kinase	p.H241D	ENST00000300784.7	37	c.721	CCDS11818.1	17	.	.	.	.	.	.	.	.	.	.	C	27.8	4.867417	0.91511	.	.	ENSG00000167363	ENST00000300784	T	0.30981	1.51	4.47	4.47	0.54385	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.44932	0.1317	L	0.39467	1.215	0.80722	D	1	D	0.71674	0.998	D	0.67382	0.951	T	0.27773	-1.0064	9	.	.	.	-14.2229	16.4856	0.84183	0.0:1.0:0.0:0.0	.	241	Q9H479	FN3K_HUMAN	D	241	ENSP00000300784:H241D	.	H	+	1	0	FN3K	78301711	1.000000	0.71417	0.991000	0.47740	0.927000	0.56198	7.558000	0.82253	2.200000	0.70718	0.585000	0.79938	CAT	FN3K	-	pfam_Fructo-/Ketosamine-3-kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,pirsf_Fructo-/Ketosamine-3-kinase	ENSG00000167363		0.587	FN3K-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FN3K	HGNC	protein_coding	OTTHUMT00000439229.1	40	0.00	0	C	NM_022158		80708422	80708422	+1	no_errors	ENST00000300784	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	G
GABBR1	2550	genome.wustl.edu	37	6	29599375	29599375	+	Splice_Site	SNP	A	A	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr6:29599375A>T	ENST00000377034.4	-	3	422	c.87T>A	c.(85-87)ggT>ggA	p.G29G	GABBR1_ENST00000376977.3_Splice_Site_p.G29G|GABBR1_ENST00000377016.4_Splice_Site_p.G29G	NM_001470.2	NP_001461.1	Q9UBS5	GABR1_HUMAN	gamma-aminobutyric acid (GABA) B receptor, 1	29					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|gamma-aminobutyric acid signaling pathway (GO:0007214)|negative regulation of adenylate cyclase activity (GO:0007194)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|G-protein coupled receptor heterodimeric complex (GO:0038039)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	G-protein coupled GABA receptor activity (GO:0004965)			endometrium(3)|kidney(1)|large_intestine(13)|liver(1)|lung(16)|ovary(5)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47					Baclofen(DB00181)|Progabide(DB00837)|Vigabatrin(DB01080)	TGATCTGGCAACCTAAGGGGT	0.597																																						dbGAP											0													48.0	53.0	51.0					6																	29599375		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			Y11044	CCDS4663.1, CCDS4664.1, CCDS4665.1	6p21.3	2012-08-29			ENSG00000204681	ENSG00000204681		"""GABA receptors"", ""GPCR / Class C : GABA(B) receptors"""	4070	protein-coding gene	gene with protein product	"""GABA-B receptor"""	603540				9753614, 9798068	Standard	NM_001470		Approved	hGB1a, GPRC3A	uc003nmt.4	Q9UBS5	OTTHUMG00000031095	ENST00000377034.4:c.86-1T>A	6.37:g.29599375A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0UXY7|O95375|O95468|O95975|O96022|Q5STL4|Q5SUJ8|Q5SUL3|Q71SG6|Q86W60|Q9UQQ0	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,prints_GPCR_3_GABA_rcpt_B,prints_GPCR_3_GABA_rcpt_B1,pfscan_Sushi_SCR_CCP,pfscan_GPCR_3_C	p.G29	ENST00000377034.4	37	c.87	CCDS4663.1	6																																																																																			GABBR1	-	superfamily_Complement_control_module	ENSG00000204681		0.597	GABBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABBR1	HGNC	protein_coding	OTTHUMT00000076141.3	56	0.00	0	A		Silent	29599375	29599375	-1	no_errors	ENST00000377034	ensembl	human	known	69_37n	silent	38	17.02	8	SNP	1.000	T
GATA5	140628	genome.wustl.edu	37	20	61048600	61048600	+	Silent	SNP	A	A	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr20:61048600A>G	ENST00000252997.2	-	3	619	c.558T>C	c.(556-558)ggT>ggC	p.G186G		NM_080473.4	NP_536721.1	Q9BWX5	GATA5_HUMAN	GATA binding protein 5	186					blood coagulation (GO:0007596)|cellular response to BMP stimulus (GO:0071773)|intestinal epithelial cell differentiation (GO:0060575)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			kidney(1)|lung(3)|ovary(1)|stomach(1)	6	Breast(26;2.05e-08)		BRCA - Breast invasive adenocarcinoma(19;3.08e-06)			CACACTCACGACCCTCACCCG	0.672																																						dbGAP											0													43.0	38.0	39.0					20																	61048600		2197	4296	6493	-	-	-	SO:0001819	synonymous_variant	0			BC047790, BC117356	CCDS13499.1	20q13.33	2013-07-17	2001-11-28		ENSG00000130700	ENSG00000130700		"""GATA zinc finger domain containing"""	15802	protein-coding gene	gene with protein product		611496	"""GATA-binding protein 5"""			9566909	Standard	NM_080473		Approved	bB379O24.1, GATAS	uc002ycx.1	Q9BWX5	OTTHUMG00000032919	ENST00000252997.2:c.558T>C	20.37:g.61048600A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D9ZGF7|Q17RE2|Q86VU4	Silent	SNP	pfam_GATA_N,pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA_4/5/6,pfscan_Znf_GATA,prints_Znf_GATA	p.G186	ENST00000252997.2	37	c.558	CCDS13499.1	20																																																																																			GATA5	-	smart_Znf_GATA,pirsf_TF_GATA_4/5/6,pfscan_Znf_GATA,prints_Znf_GATA	ENSG00000130700		0.672	GATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA5	HGNC	protein_coding	OTTHUMT00000080038.2	55	0.00	0	A	NM_080473		61048600	61048600	-1	no_errors	ENST00000252997	ensembl	human	known	69_37n	silent	46	14.55	8	SNP	0.066	G
GPR149	344758	genome.wustl.edu	37	3	154146676	154146676	+	Silent	SNP	A	A	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr3:154146676A>G	ENST00000389740.2	-	1	828	c.729T>C	c.(727-729)ccT>ccC	p.P243P		NM_001038705.1	NP_001033794.1	Q86SP6	GP149_HUMAN	G protein-coupled receptor 149	243					antral ovarian follicle growth (GO:0001547)|estrous cycle phase (GO:0060206)|negative regulation of ovulation (GO:0060280)|preantral ovarian follicle growth (GO:0001546)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(22)|ovary(7)|prostate(1)|skin(1)|urinary_tract(2)	47			LUSC - Lung squamous cell carcinoma(72;0.114)|Lung(72;0.173)			TCCCCGCAGTAGGAGGGGTCC	0.622																																						dbGAP											0													40.0	44.0	43.0					3																	154146676		1867	4104	5971	-	-	-	SO:0001819	synonymous_variant	0			AY255534	CCDS43162.1	3q25.2	2012-08-21			ENSG00000174948	ENSG00000174948		"""GPCR / Class A : Orphans"""	23627	protein-coding gene	gene with protein product						12679517	Standard	NM_001038705		Approved	PGR10, IEDA	uc003faa.3	Q86SP6	OTTHUMG00000159131	ENST00000389740.2:c.729T>C	3.37:g.154146676A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.P243	ENST00000389740.2	37	c.729	CCDS43162.1	3																																																																																			GPR149	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174948		0.622	GPR149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR149	HGNC	protein_coding	OTTHUMT00000353430.1	43	0.00	0	A	XM_293580		154146676	154146676	-1	no_errors	ENST00000389740	ensembl	human	known	69_37n	silent	26	21.21	7	SNP	0.000	G
GPR31	2853	genome.wustl.edu	37	6	167570781	167570781	+	Missense_Mutation	SNP	G	G	C			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr6:167570781G>C	ENST00000366834.1	-	1	1036	c.539C>G	c.(538-540)gCa>gGa	p.A180G		NM_005299.2	NP_005290.2	O00270	GPR31_HUMAN	G protein-coupled receptor 31	180					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(4)|large_intestine(4)|lung(7)|prostate(1)	17		Breast(66;1.53e-05)|Ovarian(120;0.0606)		OV - Ovarian serous cystadenocarcinoma(33;4.81e-20)|BRCA - Breast invasive adenocarcinoma(81;4.45e-06)|GBM - Glioblastoma multiforme(31;0.00492)		GCAGGAGAGTGCTTCCTGCCA	0.577																																						dbGAP											0													94.0	101.0	99.0					6																	167570781		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65402	CCDS5299.1	6q27	2012-08-21				ENSG00000120436		"""GPCR / Class A : Orphans"""	4486	protein-coding gene	gene with protein product	"""hydroxyeicosatetraenoic (HETE) acid receptor 1"", ""12-(S)-HETE acid receptor"""	602043				9205127, 21712392	Standard	NM_005299		Approved	HETER1, 12-HETER	uc011egq.2	O00270		ENST00000366834.1:c.539C>G	6.37:g.167570781G>C	ENSP00000355799:p.Ala180Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M0K2|Q4VBL3|Q9NQ20	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.A180G	ENST00000366834.1	37	c.539	CCDS5299.1	6	.	.	.	.	.	.	.	.	.	.	G	6.848	0.525667	0.13066	.	.	ENSG00000120436	ENST00000366834	T	0.38240	1.15	3.65	-0.98	0.10272	GPCR, rhodopsin-like superfamily (1);	0.710561	0.11435	U	0.564429	T	0.17959	0.0431	M	0.61703	1.905	0.09310	N	1	B	0.32467	0.372	B	0.38921	0.285	T	0.33445	-0.9868	10	0.38643	T	0.18	-0.0778	7.6698	0.28453	0.4912:0.0:0.5088:0.0	.	180	O00270	GPR31_HUMAN	G	180	ENSP00000355799:A180G	ENSP00000355799:A180G	A	-	2	0	GPR31	167490771	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-0.646000	0.05403	-0.120000	0.11809	0.306000	0.20318	GCA	GPR31	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000120436		0.577	GPR31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR31	HGNC	protein_coding	OTTHUMT00000043111.1	36	0.00	0	G	NM_005299		167570781	167570781	-1	no_errors	ENST00000366834	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.002	C
HNRNPH2	3188	genome.wustl.edu	37	X	100667605	100667605	+	Missense_Mutation	SNP	A	A	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chrX:100667605A>T	ENST00000316594.5	+	2	707	c.629A>T	c.(628-630)tAt>tTt	p.Y210F		NM_001032393.2|NM_001199973.1|NM_001199974.1|NM_019597.4	NP_001027565.1|NP_001186902.1|NP_001186903.1|NP_062543.1	P55795	HNRH2_HUMAN	heterogeneous nuclear ribonucleoprotein H2 (H')	210					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|large_intestine(2)|lung(6)|skin(1)	12						CCAGGTCCCTATGATAGGCCG	0.552																																						dbGAP											0													53.0	50.0	51.0					X																	100667605		2203	4300	6503	-	-	-	SO:0001583	missense	0			U01923	CCDS14485.1	Xq22	2013-02-12		2008-04-18	ENSG00000126945	ENSG00000126945		"""RNA binding motif (RRM) containing"""	5042	protein-coding gene	gene with protein product		300610		HNRPH2		7499401	Standard	NM_019597		Approved	hnRNPH', FTP3, HNRPH'	uc004ehn.3	P55795	OTTHUMG00000022029	ENST00000316594.5:c.629A>T	X.37:g.100667605A>T	ENSP00000361927:p.Tyr210Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L400|Q9HHA7	Missense_Mutation	SNP	pfam_RRM_dom,pfam_Znf_CHHC,smart_RRM_dom,pfscan_RRM_dom	p.Y210F	ENST00000316594.5	37	c.629	CCDS14485.1	X	.	.	.	.	.	.	.	.	.	.	A	17.53	3.413876	0.62511	.	.	ENSG00000126945	ENST00000457902;ENST00000316594	T	0.12569	2.67	4.88	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.28433	0.0703	M	0.84846	2.72	0.58432	D	0.999999	P	0.41910	0.764	P	0.46389	0.515	T	0.08534	-1.0717	10	0.87932	D	0	-6.1163	11.5545	0.50739	1.0:0.0:0.0:0.0	.	210	P55795	HNRH2_HUMAN	F	165;210	ENSP00000361927:Y210F	ENSP00000361927:Y210F	Y	+	2	0	HNRNPH2	100554261	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.204000	0.77872	1.930000	0.55929	0.417000	0.27973	TAT	HNRNPH2	-	NULL	ENSG00000126945		0.552	HNRNPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPH2	HGNC	protein_coding	OTTHUMT00000057556.1	47	0.00	0	A	NM_019597		100667605	100667605	+1	no_errors	ENST00000316594	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	T
HAUS7	55559	genome.wustl.edu	37	X	152721081	152721081	+	Silent	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chrX:152721081G>A	ENST00000370211.4	-	8	922	c.879C>T	c.(877-879)tgC>tgT	p.C293C	TREX2_ENST00000334497.2_5'UTR|TREX2_ENST00000370232.1_5'UTR|HAUS7_ENST00000484394.1_5'UTR|HAUS7_ENST00000421080.2_Missense_Mutation_p.A115V|TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000370212.3_Silent_p.C293C|TREX2_ENST00000338525.2_5'UTR	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	293					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						GGCGCTGGCAGCACTCGCCCA	0.602																																						dbGAP											0													102.0	84.0	90.0					X																	152721081		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.879C>T	X.37:g.152721081G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Missense_Mutation	SNP	NULL	p.A115V	ENST00000370211.4	37	c.344	CCDS35438.1	X	.	.	.	.	.	.	.	.	.	.	G	11.84	1.757958	0.31137	.	.	ENSG00000213397	ENST00000435662;ENST00000421080	T	0.22539	1.95	4.99	4.13	0.48395	.	.	.	.	.	T	0.12178	0.0296	.	.	.	0.26880	N	0.967557	.	.	.	.	.	.	T	0.29822	-0.9999	6	0.11794	T	0.64	-6.2847	8.7043	0.34345	0.1097:0.0:0.8903:0.0	.	.	.	.	V	77;115	ENSP00000395447:A115V	ENSP00000395447:A115V	A	-	2	0	HAUS7	152374275	1.000000	0.71417	0.658000	0.29665	0.225000	0.24961	4.663000	0.61532	1.022000	0.39626	0.292000	0.19580	GCT	HAUS7	-	NULL	ENSG00000213397		0.602	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HAUS7	HGNC	protein_coding	OTTHUMT00000060963.2	45	0.00	0	G	NM_017518		152721081	152721081	-1	no_errors	ENST00000421080	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.873	A
HTR3B	9177	genome.wustl.edu	37	11	113815302	113815302	+	Silent	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr11:113815302C>T	ENST00000260191.2	+	8	1172	c.915C>T	c.(913-915)ttC>ttT	p.F305F	HTR3B_ENST00000537778.1_Silent_p.F294F	NM_006028.4	NP_006019.1	O95264	5HT3B_HUMAN	5-hydroxytryptamine (serotonin) receptor 3B, ionotropic	305					cation transmembrane transport (GO:0098655)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ion channel activity (GO:0005216)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(11)	20		all_cancers(61;6.81e-18)|all_epithelial(67;6.67e-11)|all_hematologic(158;4.67e-05)|Melanoma(852;0.000316)|Acute lymphoblastic leukemia(157;0.000976)|Breast(348;0.0101)|Prostate(24;0.0154)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.04e-06)|Epithelial(105;1.98e-05)|all cancers(92;0.000201)|OV - Ovarian serous cystadenocarcinoma(223;0.151)	Ergoloid mesylate(DB01049)	CAGGGCACTTCTTCACCATCT	0.488																																						dbGAP											0													203.0	160.0	174.0					11																	113815302		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AF080582	CCDS8364.1	11q23.1	2012-05-22	2012-02-03		ENSG00000149305	ENSG00000149305		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5298	protein-coding gene	gene with protein product		604654	"""5-hydroxytryptamine (serotonin) receptor 3B"""			9950429, 10521471	Standard	NM_006028		Approved	5-HT3B	uc001pok.3	O95264	OTTHUMG00000168210	ENST00000260191.2:c.915C>T	11.37:g.113815302C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ23|Q0VJC3	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_5HT3_rcpt_A,prints_Neur_channel	p.L164F	ENST00000260191.2	37	c.490	CCDS8364.1	11	.	.	.	.	.	.	.	.	.	.	C	6.973	0.549498	0.13374	.	.	ENSG00000149305	ENST00000543092	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	T	0.63965	0.2556	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.62402	-0.6862	4	.	.	.	-20.7016	12.2267	0.54463	0.0:0.9183:0.0:0.0817	.	.	.	.	F	164	.	.	L	+	1	0	HTR3B	113320512	1.000000	0.71417	1.000000	0.80357	0.106000	0.19336	4.045000	0.57368	2.388000	0.81334	0.655000	0.94253	CTT	HTR3B	-	NULL	ENSG00000149305		0.488	HTR3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR3B	HGNC	protein_coding	OTTHUMT00000398842.1	31	0.00	0	C	NM_006028		113815302	113815302	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000543092	ensembl	human	putative	69_37n	missense	23	37.84	14	SNP	1.000	T
INTS1	26173	genome.wustl.edu	37	7	1522191	1522191	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:1522191C>G	ENST00000404767.3	-	27	3779	c.3694G>C	c.(3694-3696)Gtg>Ctg	p.V1232L	INTS1_ENST00000389470.4_Missense_Mutation_p.V1394L	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	1232					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCGGCGTCCACCAGGCGGAGC	0.692																																						dbGAP											0													34.0	42.0	39.0					7																	1522191		2088	4218	6306	-	-	-	SO:0001583	missense	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.3694G>C	7.37:g.1522191C>G	ENSP00000385722:p.Val1232Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.V1394L	ENST00000404767.3	37	c.4180	CCDS47526.1	7	.	.	.	.	.	.	.	.	.	.	C	18.01	3.528864	0.64860	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.60797	0.16;0.16	4.67	3.75	0.43078	.	0.000000	0.42821	U	0.000643	T	0.71986	0.3405	M	0.78049	2.395	0.52099	D	0.999948	D	0.57571	0.98	P	0.58780	0.845	T	0.76495	-0.2938	10	0.72032	D	0.01	.	14.3771	0.66886	0.0:0.8507:0.1492:0.0	.	1232	Q8N201	INT1_HUMAN	L	1232;1394	ENSP00000385722:V1232L;ENSP00000374121:V1394L	ENSP00000374121:V1394L	V	-	1	0	INTS1	1488717	1.000000	0.71417	0.948000	0.38648	0.213000	0.24496	7.540000	0.82074	0.909000	0.36697	0.561000	0.74099	GTG	INTS1	-	NULL	ENSG00000164880		0.692	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	36	0.00	0	C			1522191	1522191	-1	no_errors	ENST00000389470	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	G
ICA1	3382	genome.wustl.edu	37	7	8196529	8196529	+	Intron	SNP	A	A	T	rs10282493	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:8196529A>T	ENST00000402384.3	-	8	1071				AC007009.2_ENST00000577980.1_RNA|ICA1_ENST00000407906.1_Missense_Mutation_p.Y341N|ICA1_ENST00000396675.3_Intron|ICA1_ENST00000422063.2_Intron|ICA1_ENST00000406470.2_Intron|ICA1_ENST00000401396.1_Intron|ICA1_ENST00000265577.7_Intron			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa						neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		GGATTGCAGTAGATTCTCATT	0.368													A|||	3794	0.757588	0.5401	0.8573	5008	,	,		16015	0.8929		0.8161	False		,,,				2504	0.7812					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.804+216T>A	7.37:g.8196529A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Missense_Mutation	SNP	pfam_Arfaptin_homology_dom,pfscan_Arfaptin_homology_dom	p.Y341N	ENST00000402384.3	37	c.1021	CCDS34602.1	7	1709	0.7825091575091575	282	0.573170731707317	302	0.8342541436464088	519	0.9073426573426573	606	0.7994722955145118	A	3.326	-0.137745	0.06711	.	.	ENSG00000003147	ENST00000407906	.	.	.	4.33	1.41	0.22369	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.09552	-1.0669	4	0.87932	D	0	.	6.4295	0.21788	0.3073:0.0:0.6927:0.0	rs10282493;rs59286128;rs10282493	.	.	.	N	341	.	ENSP00000386021:Y341N	Y	-	1	0	ICA1	8163054	0.001000	0.12720	0.003000	0.11579	0.005000	0.04900	0.206000	0.17375	0.354000	0.24105	-1.098000	0.02139	TAC	ICA1	-	NULL	ENSG00000003147		0.368	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ICA1	HGNC	protein_coding	OTTHUMT00000324793.1	39	0.00	0	A	NM_004968		8196529	8196529	-1	no_errors	ENST00000407906	ensembl	human	putative	69_37n	missense	33	10.81	4	SNP	0.003	T
SLC27A3	11000	genome.wustl.edu	37	1	153746474	153746474	+	5'Flank	SNP	G	G	T	rs369652122|rs200086354|rs200538501|rs372321518|rs577478018		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:153746474G>T	ENST00000368661.3	+	0	0				INTS3_ENST00000456435.1_3'UTR|SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000318967.2_3'UTR|INTS3_ENST00000476843.1_3'UTR	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			ttttttttttgtttttttttg	0.373																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155		1.37:g.153746474G>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	RNA	SNP	-	NULL	ENST00000368661.3	37	NULL	CCDS1053.1	1																																																																																			INTS3	-	-	ENSG00000143624		0.373	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	HGNC	protein_coding		24	0.00	0	G	NM_024330		153746474	153746474	+1	no_errors	ENST00000476843	ensembl	human	known	69_37n	rna	17	26.09	6	SNP	0.000	T
IQGAP3	128239	genome.wustl.edu	37	1	156533415	156533415	+	Silent	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:156533415G>A	ENST00000361170.2	-	7	559	c.549C>T	c.(547-549)ggC>ggT	p.G183G		NM_178229.4	NP_839943.2	Q86VI3	IQGA3_HUMAN	IQ motif containing GTPase activating protein 3	183					activation of MAPK activity (GO:0000187)|cellular response to organic substance (GO:0071310)|ERK1 and ERK2 cascade (GO:0070371)|G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of mammary gland epithelial cell proliferation (GO:0033601)|Ras protein signal transduction (GO:0007265)|regulation of cell size (GO:0008361)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)	Ras GTPase activator activity (GO:0005099)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(14)|lung(29)|ovary(5)|prostate(5)|skin(5)|urinary_tract(3)	75	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					GCAGCTGGAGGCCATATTTGG	0.597																																						dbGAP											0													57.0	51.0	53.0					1																	156533415		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY253300	CCDS1144.1	1q21.3	2008-02-05			ENSG00000183856	ENSG00000183856			20669	protein-coding gene	gene with protein product							Standard	NM_178229		Approved		uc001fpf.3	Q86VI3	OTTHUMG00000033114	ENST00000361170.2:c.549C>T	1.37:g.156533415G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H8	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_RasGAP	p.G183	ENST00000361170.2	37	c.549	CCDS1144.1	1																																																																																			IQGAP3	-	superfamily_CH-domain	ENSG00000183856		0.597	IQGAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP3	HGNC	protein_coding	OTTHUMT00000080657.1	29	0.00	0	G	NM_178229		156533415	156533415	-1	no_errors	ENST00000361170	ensembl	human	known	69_37n	silent	35	16.67	7	SNP	1.000	A
KAT8	84148	genome.wustl.edu	37	16	31142572	31142572	+	Missense_Mutation	SNP	A	A	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr16:31142572A>G	ENST00000543774.2	+	12	1704	c.1369A>G	c.(1369-1371)Aag>Gag	p.K457E	RP11-388M20.2_ENST00000563605.1_RNA|KAT8_ENST00000219797.4_Missense_Mutation_p.K457E|KAT8_ENST00000448516.2_3'UTR			Q9H7Z6	KAT8_HUMAN	K(lysine) acetyltransferase 8	457	Sufficient for interaction with KANSL1.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|myeloid cell differentiation (GO:0030099)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	histone acetyltransferase complex (GO:0000123)|kinetochore (GO:0000776)|MLL1 complex (GO:0071339)|MSL complex (GO:0072487)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|histone acetyltransferase activity (GO:0004402)|metal ion binding (GO:0046872)|methylated histone binding (GO:0035064)|transcription factor binding (GO:0008134)										CAAGCTCTCCAAGAAGTGAGC	0.577																																						dbGAP											0													48.0	48.0	48.0					16																	31142572		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF217501	CCDS10706.1, CCDS45468.1	16p11.1	2013-01-10	2011-07-21	2011-07-21	ENSG00000103510	ENSG00000103510	2.3.1.48	"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"""	17933	protein-coding gene	gene with protein product		609912	"""MYST histone acetyltransferase 1"""	MYST1		10786633	Standard	NM_032188		Approved	MOF, FLJ14040, hMOF, ZC2HC8	uc002eax.3	Q9H7Z6	OTTHUMG00000132410	ENST00000543774.2:c.1369A>G	16.37:g.31142572A>G	ENSP00000456933:p.Lys457Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Z1|G5E9P2|Q659G0|Q7LC17|Q8IY59|Q8WYB4|Q8WZ14|Q9HAC5|Q9NR35	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Tudor-knot,superfamily_Acyl_CoA_acyltransferase,superfamily_Chromodomain-like,smart_Chromo_domain/shadow	p.K457E	ENST00000543774.2	37	c.1369	CCDS10706.1	16	.	.	.	.	.	.	.	.	.	.	A	18.59	3.656333	0.67586	.	.	ENSG00000103510	ENST00000219797	.	.	.	5.83	5.83	0.93111	.	5.254660	0.00520	N	0.000197	T	0.60625	0.2283	L	0.54323	1.7	0.80722	D	1	P	0.43477	0.808	B	0.36464	0.225	T	0.55114	-0.8191	9	0.72032	D	0.01	.	15.1709	0.72872	1.0:0.0:0.0:0.0	.	457	Q9H7Z6	KAT8_HUMAN	E	457	.	ENSP00000219797:K457E	K	+	1	0	KAT8	31050073	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	7.524000	0.81866	2.231000	0.72958	0.454000	0.30748	AAG	KAT8	-	NULL	ENSG00000103510		0.577	KAT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	KAT8	HGNC	protein_coding	OTTHUMT00000255546.3	42	0.00	0	A	NM_032188		31142572	31142572	+1	no_errors	ENST00000219797	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	1.000	G
KIDINS220	57498	genome.wustl.edu	37	2	8888079	8888079	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr2:8888079G>A	ENST00000256707.3	-	25	3647	c.3466C>T	c.(3466-3468)Caa>Taa	p.Q1156*	KIDINS220_ENST00000473731.1_Nonsense_Mutation_p.Q1156*|KIDINS220_ENST00000427284.1_Nonsense_Mutation_p.Q1156*|KIDINS220_ENST00000418530.1_Intron	NM_020738.2	NP_065789.1	Q9ULH0	KDIS_HUMAN	kinase D-interacting substrate, 220kDa	1156					activation of MAPKK activity (GO:0000186)|cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|dendrite morphogenesis (GO:0048813)|in utero embryonic development (GO:0001701)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of neuron projection development (GO:0010976)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)|protein complex (GO:0043234)	PDZ domain binding (GO:0030165)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(25)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	60	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					ATGAGATGTTGGGAGCCGCCA	0.388																																						dbGAP											0													121.0	117.0	118.0					2																	8888079		1827	4094	5921	-	-	-	SO:0001587	stop_gained	0			AK025528	CCDS42650.1	2p24	2013-01-10			ENSG00000134313	ENSG00000134313		"""Ankyrin repeat domain containing"""	29508	protein-coding gene	gene with protein product	"""ankyrin repeat-rich membrane-spanning protein"""	615759				10998417, 10574462	Standard	NM_020738		Approved	ARMS	uc002qzc.2	Q9ULH0	OTTHUMG00000151658	ENST00000256707.3:c.3466C>T	2.37:g.8888079G>A	ENSP00000256707:p.Gln1156*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4N4|Q4VC08|Q6MZU2|Q9H889|Q9H9E4|Q9NT37|Q9UF42	Nonsense_Mutation	SNP	pfam_KAP_NTPase,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q1156*	ENST00000256707.3	37	c.3466	CCDS42650.1	2	.	.	.	.	.	.	.	.	.	.	G	43	10.280517	0.99375	.	.	ENSG00000134313	ENST00000256707;ENST00000427284;ENST00000473731	.	.	.	5.75	5.75	0.90469	.	0.706638	0.14254	N	0.331268	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	20.3046	0.98621	0.0:0.0:1.0:0.0	.	.	.	.	X	1156	.	ENSP00000256707:Q1156X	Q	-	1	0	KIDINS220	8805530	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.747000	0.62141	2.878000	0.98634	0.650000	0.86243	CAA	KIDINS220	-	NULL	ENSG00000134313		0.388	KIDINS220-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIDINS220	HGNC	protein_coding	OTTHUMT00000323408.2	74	0.00	0	G	NM_020738		8888079	8888079	-1	no_errors	ENST00000256707	ensembl	human	known	69_37n	nonsense	44	16.98	9	SNP	1.000	A
FAM230C	26080	genome.wustl.edu	37	22	21663672	21663672	+	lincRNA	SNP	T	T	C	rs368981756		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr22:21663672T>C	ENST00000436681.1	-	0	498																											GGCGTCCTCGTTGGCGATGCC	0.701																																						dbGAP											0																																										-	-	-			0																															22.37:g.21663672T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000436681.1	37	NULL		22																																																																																			LINC00281	-	-	ENSG00000206142		0.701	KB-1183D5.13-003	KNOWN	basic	lincRNA	LINC00281	HGNC	lincRNA	OTTHUMT00000320109.1	38	0.00	0	T			21663672	21663672	-1	no_errors	ENST00000436681	ensembl	human	known	69_37n	rna	19	13.64	3	SNP	0.827	C
LRCH1	23143	genome.wustl.edu	37	13	47243213	47243213	+	Silent	SNP	C	C	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr13:47243213C>G	ENST00000389798.3	+	3	698	c.501C>G	c.(499-501)ctC>ctG	p.L167L	LRCH1_ENST00000311191.6_Silent_p.L167L|LRCH1_ENST00000389797.3_Silent_p.L167L	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	167										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		GTCTGCCTCTCAAAGTCTTAA	0.433																																						dbGAP											0													171.0	158.0	163.0					13																	47243213		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.501C>G	13.37:g.47243213C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Silent	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.L167	ENST00000389798.3	37	c.501	CCDS31972.1	13																																																																																			LRCH1	-	NULL	ENSG00000136141		0.433	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRCH1	HGNC	protein_coding	OTTHUMT00000044824.2	28	0.00	0	C	NM_015116		47243213	47243213	+1	no_errors	ENST00000389798	ensembl	human	known	69_37n	silent	30	16.22	6	SNP	1.000	G
LRP12	29967	genome.wustl.edu	37	8	105511557	105511557	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr8:105511557C>T	ENST00000276654.5	-	4	571	c.463G>A	c.(463-465)Gca>Aca	p.A155T	LRP12_ENST00000424843.2_Missense_Mutation_p.A136T	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	155	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GAAAAATATGCCAGTCTGAAA	0.373																																						dbGAP											0													104.0	109.0	107.0					8																	105511557		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.463G>A	8.37:g.105511557C>T	ENSP00000276654:p.Ala155Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K137|B4DRQ2	Missense_Mutation	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.A136T	ENST00000276654.5	37	c.406	CCDS6303.1	8	.	.	.	.	.	.	.	.	.	.	C	15.48	2.847506	0.51164	.	.	ENSG00000147650	ENST00000424843;ENST00000276654	T;T	0.16597	2.33;2.33	5.63	3.82	0.43975	CUB (5);	0.158138	0.56097	D	0.000021	T	0.05960	0.0155	N	0.01618	-0.8	0.80722	D	1	B;B	0.06786	0.0;0.001	B;B	0.10450	0.003;0.005	T	0.23762	-1.0179	10	0.34782	T	0.22	-18.8807	8.1498	0.31134	0.2834:0.6452:0.0:0.0714	.	136;155	Q9Y561-2;Q9Y561	.;LRP12_HUMAN	T	136;155	ENSP00000399148:A136T;ENSP00000276654:A155T	ENSP00000276654:A155T	A	-	1	0	LRP12	105580733	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.193000	0.42658	1.365000	0.46057	0.557000	0.71058	GCA	LRP12	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000147650		0.373	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	35	0.00	0	C	NM_013437		105511557	105511557	-1	no_errors	ENST00000424843	ensembl	human	known	69_37n	missense	24	13.79	4	SNP	1.000	T
LRRC72	100506049	genome.wustl.edu	37	7	16606002	16606002	+	Silent	SNP	A	A	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:16606002A>T	ENST00000401542.2	+	6	549	c.492A>T	c.(490-492)ccA>ccT	p.P164P		NM_001195280.1	NP_001182209.1	A6NJI9	LRC72_HUMAN	leucine rich repeat containing 72	164	LRRCT.																ACCACCTTCCAGGAGTGGAGC	0.373																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS56464.1	7p21.1	2011-10-07			ENSG00000205858	ENSG00000205858			42972	protein-coding gene	gene with protein product							Standard	NM_001195280		Approved		uc022aaf.1	A6NJI9	OTTHUMG00000152446	ENST00000401542.2:c.492A>T	7.37:g.16606002A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.P164	ENST00000401542.2	37	c.492	CCDS56464.1	7																																																																																			LRRC72	-	NULL	ENSG00000205858		0.373	LRRC72-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC72	HGNC	protein_coding	OTTHUMT00000326249.2	19	0.00	0	A			16606002	16606002	+1	no_errors	ENST00000401542	ensembl	human	novel	69_37n	silent	11	21.43	3	SNP	0.450	T
LUC7L	55692	genome.wustl.edu	37	16	278856	278856	+	Intron	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr16:278856G>A	ENST00000293872.8	-	1	172				LUC7L_ENST00000494366.1_5'UTR|LUC7L_ENST00000397783.1_Intron|LUC7L_ENST00000397780.1_5'Flank|LUC7L_ENST00000337351.4_Intron	NM_201412.1	NP_958815.1	Q9NQ29	LUC7L_HUMAN	LUC7-like (S. cerevisiae)						mRNA splice site selection (GO:0006376)|negative regulation of striated muscle tissue development (GO:0045843)	U1 snRNP (GO:0005685)	identical protein binding (GO:0042802)|mRNA binding (GO:0003729)			NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	11		all_cancers(16;1.1e-06)|all_epithelial(16;2.71e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.0138)|all_lung(18;0.0306)				GGTTTTCGAGGCCCATCCGGC	0.592																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY005111	CCDS10401.1, CCDS32348.1	16p13.3	2010-01-25	2001-11-28		ENSG00000007392	ENSG00000007392			6723	protein-coding gene	gene with protein product		607782	"""LUC7 (S. cerevisiae)-like"""				Standard	NM_201412		Approved	LUC7B1, hLuc7B1, Luc7	uc002cgc.1	Q9NQ29	OTTHUMG00000060730	ENST00000293872.8:c.61+421C>T	16.37:g.278856G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZ13|Q96S32|Q9NPH4	RNA	SNP	-	NULL	ENST00000293872.8	37	NULL	CCDS32348.1	16																																																																																			LUC7L	-	-	ENSG00000007392		0.592	LUC7L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LUC7L	HGNC	protein_coding	OTTHUMT00000134239.1	26	0.00	0	G			278856	278856	-1	no_errors	ENST00000494366	ensembl	human	putative	69_37n	rna	15	15.79	3	SNP	0.023	A
MITF	4286	genome.wustl.edu	37	3	69987024	69987024	+	Missense_Mutation	SNP	C	C	T	rs200583343	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr3:69987024C>T	ENST00000448226.2	+	3	533	c.406C>T	c.(406-408)Cgg>Tgg	p.R136W	MITF_ENST00000352241.4_Missense_Mutation_p.R136W|MITF_ENST00000314557.6_Missense_Mutation_p.R29W|MITF_ENST00000531774.1_Missense_Mutation_p.R29W|MITF_ENST00000394351.3_Missense_Mutation_p.R29W|MITF_ENST00000314589.5_Missense_Mutation_p.R120W|MITF_ENST00000394355.2_Missense_Mutation_p.R111W|MITF_ENST00000328528.6_Missense_Mutation_p.R135W|MITF_ENST00000394348.1_3'UTR|MITF_ENST00000472437.1_Missense_Mutation_p.R84W			O75030	MITF_HUMAN	microphthalmia-associated transcription factor	136					bone remodeling (GO:0046849)|camera-type eye development (GO:0043010)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|cell fate commitment (GO:0045165)|melanocyte differentiation (GO:0030318)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)|regulation of osteoclast differentiation (GO:0045670)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			NS(1)|autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(6)|stomach(1)|urinary_tract(2)	30		Lung NSC(201;0.0384)|Prostate(884;0.0526)		BRCA - Breast invasive adenocarcinoma(55;3.07e-05)|Epithelial(33;0.000138)|LUSC - Lung squamous cell carcinoma(21;0.008)|Lung(16;0.0107)|KIRC - Kidney renal clear cell carcinoma(39;0.204)|Kidney(39;0.239)		GCAAGCCCAACGGCAGCAGGT	0.488			A		melanoma		"""Waardenburg syndrome type 2, Tietz syndrome"""						C|||	2	0.000399361	0.0	0.0029	5008	,	,		18950	0.0		0.0	False		,,,				2504	0.0				Melanoma(29;269 969 31479 41502 42961)	dbGAP		Dom	yes		3	3p14.1	4286	microphthalmia-associated transcription factor	yes	E	0													102.0	84.0	90.0					3																	69987024		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2913.1, CCDS43106.1, CCDS43107.1, CCDS46865.1, CCDS46866.1, CCDS46866.2, CCDS54607.1, CCDS74962.1	3p14.1-p12.3	2014-09-17			ENSG00000187098	ENSG00000187098		"""Basic helix-loop-helix proteins"""	7105	protein-coding gene	gene with protein product	"""homolog of mouse microphthalmia"""	156845	"""Waardenburg syndrome, type 2A"""	WS2A, WS2		8069297, 7874167, 7951321	Standard	NM_198159		Approved	MI, bHLHe32	uc003dnz.3	O75030	OTTHUMG00000149921	ENST00000448226.2:c.406C>T	3.37:g.69987024C>T	ENSP00000391803:p.Arg136Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJL2|D3K197|E9PFN0|Q14841|Q9P2V0|Q9P2V1|Q9P2V2|Q9P2Y8	Missense_Mutation	SNP	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.R136W	ENST00000448226.2	37	c.406		3	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	16.55	3.155902	0.57259	.	.	ENSG00000187098	ENST00000352241;ENST00000448226;ENST00000433517;ENST00000472437;ENST00000328528;ENST00000451708;ENST00000314589;ENST00000394355;ENST00000314557;ENST00000394351;ENST00000531774	T;T;T;T;T;T;T;T;T;T	0.27104	2.48;1.99;2.31;2.52;1.7;2.51;2.52;2.28;1.69;1.89	5.88	3.49	0.39957	.	0.097481	0.64402	D	0.000001	T	0.45677	0.1354	M	0.71871	2.18	0.45161	D	0.998178	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.85130	0.987;0.996;0.996;0.997;0.997;0.986;0.996	T	0.25152	-1.0140	9	.	.	.	.	8.6458	0.34005	0.5659:0.3265:0.0:0.1076	.	84;29;29;111;120;135;136	E9PFN0;O75030-9;O75030-10;O75030-4;O75030-8;O75030-6;O75030-2	.;.;.;.;.;.;.	W	136;136;84;84;135;120;120;111;29;29;29	ENSP00000295600:R136W;ENSP00000391803:R136W;ENSP00000418845:R84W;ENSP00000327867:R135W;ENSP00000398639:R120W;ENSP00000324443:R120W;ENSP00000377884:R111W;ENSP00000324246:R29W;ENSP00000377880:R29W;ENSP00000435909:R29W	.	R	+	1	2	MITF	70069714	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	2.538000	0.45710	0.458000	0.26988	-0.271000	0.10264	CGG	MITF	-	NULL	ENSG00000187098		0.488	MITF-007	KNOWN	not_organism_supported|basic	protein_coding	MITF	HGNC	protein_coding	OTTHUMT00000313947.1	33	0.00	0	C	NM_198159		69987024	69987024	+1	no_errors	ENST00000448226	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	1.000	T
MKKS	8195	genome.wustl.edu	37	20	10385993	10385993	+	Missense_Mutation	SNP	A	A	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr20:10385993A>T	ENST00000347364.3	-	6	2377	c.1615T>A	c.(1615-1617)Ttg>Atg	p.L539M	MKKS_ENST00000399054.2_Missense_Mutation_p.L539M	NM_170784.2	NP_740754.1	Q9NPJ1	MKKS_HUMAN	McKusick-Kaufman syndrome	539					artery smooth muscle contraction (GO:0014824)|brain morphogenesis (GO:0048854)|cartilage development (GO:0051216)|cerebral cortex development (GO:0021987)|chaperone-mediated protein complex assembly (GO:0051131)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|determination of left/right symmetry (GO:0007368)|fat cell differentiation (GO:0045444)|gonad development (GO:0008406)|heart development (GO:0007507)|heart looping (GO:0001947)|hippocampus development (GO:0021766)|intracellular transport (GO:0046907)|melanosome transport (GO:0032402)|negative regulation of appetite by leptin-mediated signaling pathway (GO:0038108)|negative regulation of blood pressure (GO:0045776)|negative regulation of gene expression (GO:0010629)|nonmotile primary cilium assembly (GO:0035058)|photoreceptor cell maintenance (GO:0045494)|pigment granule aggregation in cell center (GO:0051877)|positive regulation of multicellular organism growth (GO:0040018)|protein folding (GO:0006457)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|sensory perception of smell (GO:0007608)|social behavior (GO:0035176)|spermatid development (GO:0007286)|striatum development (GO:0021756)|vasodilation (GO:0042311)|visual perception (GO:0007601)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intracellular (GO:0005622)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|RNA polymerase II repressing transcription factor binding (GO:0001103)|unfolded protein binding (GO:0051082)			kidney(2)|large_intestine(2)|lung(8)|prostate(1)|skin(1)|stomach(2)	16						AAACAGTCCAAGGTCAGGTTG	0.448																																					Melanoma(79;1979 2212 6640)	dbGAP											0													62.0	59.0	60.0					20																	10385993		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF221993	CCDS13111.1	20p12	2013-01-08			ENSG00000125863	ENSG00000125863		"""Heat Shock Proteins / Chaperonins"""	7108	protein-coding gene	gene with protein product		604896		BBS6		9467007	Standard	NR_072977		Approved		uc002wnu.2	Q9NPJ1	OTTHUMG00000031868	ENST00000347364.3:c.1615T>A	20.37:g.10385993A>T	ENSP00000246062:p.Leu539Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7B0|D3DW18	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	p.L539M	ENST00000347364.3	37	c.1615	CCDS13111.1	20	.	.	.	.	.	.	.	.	.	.	A	16.24	3.068250	0.55539	.	.	ENSG00000125863	ENST00000347364;ENST00000399054	T;T	0.81163	-1.46;-1.46	5.83	-0.334	0.12666	.	0.470590	0.20740	N	0.086545	D	0.84750	0.5541	M	0.72118	2.19	0.25441	N	0.988092	D	0.64830	0.994	D	0.65323	0.934	T	0.76157	-0.3062	10	0.56958	D	0.05	-18.977	8.2026	0.31434	0.5318:0.2923:0.1759:0.0	.	539	Q9NPJ1	MKKS_HUMAN	M	539	ENSP00000246062:L539M;ENSP00000382008:L539M	ENSP00000246062:L539M	L	-	1	2	MKKS	10333993	0.000000	0.05858	0.275000	0.24674	0.801000	0.45260	-0.390000	0.07332	-0.287000	0.09064	-0.213000	0.12676	TTG	MKKS	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000125863		0.448	MKKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKKS	HGNC	protein_coding	OTTHUMT00000077991.3	28	0.00	0	A			10385993	10385993	-1	no_errors	ENST00000347364	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	0.190	T
MUC4	4585	genome.wustl.edu	37	3	195509322	195509322	+	Silent	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr3:195509322G>A	ENST00000463781.3	-	2	9588	c.9129C>T	c.(9127-9129)gtC>gtT	p.V3043V	MUC4_ENST00000346145.4_Intron|MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Silent_p.V3043V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	984					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.V3043V(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AAGTGTCGGTGACAGGAAGCG	0.612																																						dbGAP											1	Substitution - coding silent(1)	kidney(1)																																								-	-	-	SO:0001819	synonymous_variant	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.9129C>T	3.37:g.195509322G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Silent	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.V3043	ENST00000463781.3	37	c.9129	CCDS54700.1	3																																																																																			MUC4	-	NULL	ENSG00000145113		0.612	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	36	0.00	0	G	NM_018406		195509322	195509322	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	silent	22	29.03	9	SNP	0.000	A
NBPF9	400818	genome.wustl.edu	37	1	144822695	144822695	+	Intron	SNP	A	A	T	rs61807116	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:144822695A>T	ENST00000468645.1	+	8	1023				NBPF9_ENST00000440491.2_Intron|NBPF9_ENST00000338347.4_Intron|NBPF9_ENST00000281815.8_Intron			Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9							cytoplasm (GO:0005737)				NS(2)|prostate(1)	3						GAACCAAGTTACATTTTGACT	0.403																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000468645.1:c.1024-357A>T	1.37:g.144822695A>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000468645.1	37	NULL		1																																																																																			NBPF9	-	-	ENSG00000168614		0.403	NBPF9-002	KNOWN	not_best_in_genome_evidence|basic	processed_transcript	NBPF9	HGNC	protein_coding	OTTHUMT00000038846.1	8	0.00	0	A	NM_001037675		144822695	144822695	+1	no_errors	ENST00000473761	ensembl	human	known	69_37n	rna	9	52.63	10	SNP	0.000	T
NLRP7	199713	genome.wustl.edu	37	19	55449554	55449554	+	Missense_Mutation	SNP	G	G	C	rs142092846		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr19:55449554G>C	ENST00000590030.1	-	4	2027	c.1987C>G	c.(1987-1989)Ctc>Gtc	p.L663V	NLRP7_ENST00000592784.1_Missense_Mutation_p.L663V|NLRP7_ENST00000588756.1_Missense_Mutation_p.L663V|NLRP7_ENST00000448121.2_Intron|NLRP7_ENST00000340844.2_Missense_Mutation_p.L663V|NLRP7_ENST00000328092.5_Intron|NLRP7_ENST00000446217.1_Missense_Mutation_p.L691V			Q8WX94	NALP7_HUMAN	NLR family, pyrin domain containing 7	663							ATP binding (GO:0005524)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(17)|liver(1)|lung(33)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	73				GBM - Glioblastoma multiforme(193;0.0325)		TCTGTCCAGAGGCGAAGAGAG	0.493																																						dbGAP											0													110.0	108.0	109.0					19																	55449554		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF464765	CCDS12912.1, CCDS33109.1, CCDS46183.1	19q13.42	2008-02-05	2006-12-08	2006-12-08		ENSG00000167634		"""Nucleotide-binding domain and leucine rich repeat containing"""	22947	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 7"""	609661	"""NACHT, leucine rich repeat and PYD containing 7"""	NALP7		12563287, 12019269	Standard	NM_139176		Approved	PYPAF3, NOD12, PAN7, CLR19.4	uc002qii.4	Q8WX94		ENST00000590030.1:c.1987C>G	19.37:g.55449554G>C	ENSP00000465520:p.Leu663Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE16|Q32MH8|Q7RTR1	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L691V	ENST00000590030.1	37	c.2071	CCDS33109.1	19	.	.	.	.	.	.	.	.	.	.	G	0.076	-1.191975	0.01607	.	.	ENSG00000167634	ENST00000328092;ENST00000340844;ENST00000446217;ENST00000399724	T;T	0.61392	0.11;0.11	2.19	-4.38	0.03622	.	.	.	.	.	T	0.28433	0.0703	N	0.15975	0.35	0.09310	N	1	B;B;B	0.13145	0.007;0.007;0.007	B;B;B	0.11329	0.004;0.006;0.006	T	0.15665	-1.0429	9	0.17369	T	0.5	.	1.0784	0.01638	0.3044:0.269:0.2903:0.1363	.	691;663;663	E7EPM2;Q32MH9;Q8WX94	.;.;NALP7_HUMAN	V	663;663;691;430	ENSP00000339491:L663V;ENSP00000414273:L691V	ENSP00000329568:L663V	L	-	1	0	NLRP7	60141366	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.581000	0.05820	-1.775000	0.01287	-1.286000	0.01371	CTC	NLRP7	-	NULL	ENSG00000167634		0.493	NLRP7-003	KNOWN	basic|CCDS	protein_coding	NLRP7	HGNC	protein_coding	OTTHUMT00000451396.1	54	0.00	0	G	NM_139176		55449554	55449554	-1	no_errors	ENST00000446217	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.000	C
NPL	80896	genome.wustl.edu	37	1	182775362	182775362	+	Missense_Mutation	SNP	G	G	C			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:182775362G>C	ENST00000367553.1	+	4	269	c.225G>C	c.(223-225)aaG>aaC	p.K75N	NPL_ENST00000367555.1_Missense_Mutation_p.K75N|NPL_ENST00000367552.2_Missense_Mutation_p.K75N|NPL_ENST00000463899.1_3'UTR|NPL_ENST00000258317.2_Missense_Mutation_p.K75N|NPL_ENST00000367550.2_Missense_Mutation_p.K75N|NPL_ENST00000367554.3_5'UTR	NM_001200056.1|NM_030769.2	NP_001186985.1|NP_110396.1	Q9BXD5	NPL_HUMAN	N-acetylneuraminate pyruvate lyase (dihydrodipicolinate synthase)	75					carbohydrate metabolic process (GO:0005975)|N-acetylneuraminate catabolic process (GO:0019262)	cytoplasm (GO:0005737)	N-acetylneuraminate lyase activity (GO:0008747)			breast(1)|central_nervous_system(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(1)|stomach(1)	15						CAAAAGGGAAGGACAAGTGAG	0.532																																						dbGAP											0													115.0	113.0	114.0					1																	182775362		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF338436	CCDS1350.1, CCDS55666.1, CCDS55667.1, CCDS72990.1	1q25	2010-11-25	2003-09-16	2003-09-17	ENSG00000135838	ENSG00000135838	4.1.3.3		16781	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 1 (E. coli)"""	611412	"""chromosome 1 open reading frame 13"""	C1orf13		11318611	Standard	NM_001200056		Approved	NPL1, DHDPS1	uc009wyb.3	Q9BXD5	OTTHUMG00000035321	ENST00000367553.1:c.225G>C	1.37:g.182775362G>C	ENSP00000356524:p.Lys75Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R839|Q4G0Q8|Q4G0Z2|Q64L88|Q6PEL0	Missense_Mutation	SNP	pfam_Dihydrodipicolinate_synth-like,prints_Dihydrodipicolinate_synth-like	p.K75N	ENST00000367553.1	37	c.225	CCDS1350.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.38|15.38	2.816077|2.816077	0.50527|0.50527	.|.	.|.	ENSG00000135838|ENSG00000135838	ENST00000445965|ENST00000367555;ENST00000367553;ENST00000367552;ENST00000258317;ENST00000367550	.|D;D;D;D;D	.|0.95272	.|-3.66;-3.66;-3.66;-3.66;-1.89	5.14|5.14	1.89|1.89	0.25635|0.25635	.|Aldolase-type TIM barrel (1);	.|0.435832	.|0.27821	.|N	.|0.017705	D|D	0.91382|0.91382	0.7281|0.7281	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	.|P;P;B	.|0.52463	.|0.953;0.733;0.058	.|P;P;B	.|0.53401	.|0.725;0.622;0.068	D|D	0.86918|0.86918	0.2065|0.2065	6|10	0.87932|0.24483	D|T	0|0.36	-10.4821|-10.4821	6.8931|6.8931	0.24241|0.24241	0.3595:0.0:0.6405:0.0|0.3595:0.0:0.6405:0.0	.|.	.|75;75;75	.|Q9BXD5-4;Q9BXD5;Q9BXD5-3	.|.;NPL_HUMAN;.	R|N	3|75	.|ENSP00000356526:K75N;ENSP00000356524:K75N;ENSP00000356523:K75N;ENSP00000258317:K75N;ENSP00000356521:K75N	ENSP00000414118:G3R|ENSP00000258317:K75N	G|K	+|+	1|3	0|2	NPL|NPL	181041985|181041985	0.999000|0.999000	0.42202|0.42202	0.998000|0.998000	0.56505|0.56505	0.635000|0.635000	0.38103|0.38103	0.898000|0.898000	0.28404|0.28404	1.000000|1.000000	0.39049|0.39049	0.563000|0.563000	0.77884|0.77884	GGA|AAG	NPL	-	pfam_Dihydrodipicolinate_synth-like	ENSG00000135838		0.532	NPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPL	HGNC	protein_coding	OTTHUMT00000085463.1	44	0.00	0	G	NM_030769		182775362	182775362	+1	no_errors	ENST00000258317	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	0.989	C
OR1L4	254973	genome.wustl.edu	37	9	125486411	125486411	+	Missense_Mutation	SNP	T	T	C	rs199861911	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr9:125486411T>C	ENST00000259466.1	+	1	143	c.143T>C	c.(142-144)cTg>cCg	p.L48P		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	48						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						CTCATCATCCTGGCCATCTAC	0.498													T|||	4	0.000798722	0.0008	0.0014	5008	,	,		19700	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													191.0	173.0	179.0					9																	125486411		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.143T>C	9.37:g.125486411T>C	ENSP00000259466:p.Leu48Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFN0|Q96R81	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L48P	ENST00000259466.1	37	c.143	CCDS35129.1	9	2	9.157509157509158E-4	1	0.0020325203252032522	0	0.0	1	0.0017482517482517483	0	0.0	.	14.63	2.592154	0.46214	.	.	ENSG00000136939	ENST00000259466	T	0.01981	4.52	3.94	3.94	0.45596	GPCR, rhodopsin-like superfamily (1);	0.392356	0.18755	N	0.132077	T	0.11793	0.0287	M	0.92219	3.285	0.58432	D	0.999992	D	0.58620	0.983	P	0.53689	0.732	T	0.01504	-1.1338	10	0.72032	D	0.01	-0.7018	11.9185	0.52779	0.0:0.0:0.0:1.0	.	48	Q8NGR5	OR1L4_HUMAN	P	48	ENSP00000259466:L48P	ENSP00000259466:L48P	L	+	2	0	OR1L4	124526232	0.008000	0.16893	1.000000	0.80357	0.801000	0.45260	1.781000	0.38644	1.646000	0.50622	0.254000	0.18369	CTG	OR1L4	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000136939		0.498	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1L4	HGNC	protein_coding	OTTHUMT00000053951.1	61	0.00	0	T			125486411	125486411	+1	no_errors	ENST00000259466	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.997	C
OR4S2	219431	genome.wustl.edu	37	11	55418888	55418888	+	Missense_Mutation	SNP	A	A	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr11:55418888A>G	ENST00000312422.2	+	1	509	c.509A>G	c.(508-510)aAt>aGt	p.N170S		NM_001004059.2	NP_001004059.2	Q8NH73	OR4S2_HUMAN	olfactory receptor, family 4, subfamily S, member 2	170						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(2)|large_intestine(4)|lung(28)|ovary(2)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_epithelial(135;0.0748)				TGTGGACCCAATGAGATAGAT	0.443																																						dbGAP											0													244.0	188.0	208.0					11																	55418888		2181	4046	6227	-	-	-	SO:0001583	missense	0			BK004390	CCDS31505.1	11q11	2012-08-09	2002-11-13	2002-11-15	ENSG00000174982	ENSG00000174982		"""GPCR / Class A : Olfactory receptors"""	15183	protein-coding gene	gene with protein product			"""olfactory receptor, family 4, subfamily S, member 2 pseudogene"""	OR4S2P			Standard	NM_001004059		Approved	OST725	uc001nhs.1	Q8NH73	OTTHUMG00000166799	ENST00000312422.2:c.509A>G	11.37:g.55418888A>G	ENSP00000310337:p.Asn170Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF72	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.N170S	ENST00000312422.2	37	c.509	CCDS31505.1	11	.	.	.	.	.	.	.	.	.	.	A	15.18	2.756026	0.49362	.	.	ENSG00000174982	ENST00000312422	T	0.00241	8.46	5.35	5.35	0.76521	GPCR, rhodopsin-like superfamily (1);	0.322809	0.26567	N	0.023647	T	0.00328	0.0010	M	0.89095	3.005	0.34440	D	0.699532	B	0.14012	0.009	B	0.21151	0.033	T	0.36261	-0.9755	10	0.66056	D	0.02	.	9.5645	0.39389	0.8432:0.0:0.0:0.1568	.	170	Q8NH73	OR4S2_HUMAN	S	170	ENSP00000310337:N170S	ENSP00000310337:N170S	N	+	2	0	OR4S2	55175464	0.000000	0.05858	1.000000	0.80357	0.992000	0.81027	0.534000	0.23098	2.028000	0.59812	0.443000	0.29094	AAT	OR4S2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000174982		0.443	OR4S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4S2	HGNC	protein_coding	OTTHUMT00000391503.1	23	0.00	0	A	NM_001004059		55418888	55418888	+1	no_errors	ENST00000312422	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	G
OTOA	146183	genome.wustl.edu	37	16	21742185	21742185	+	Silent	SNP	C	C	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr16:21742185C>G	ENST00000286149.4	+	20	2278	c.2277C>G	c.(2275-2277)acC>acG	p.T759T	OTOA_ENST00000388958.3_Silent_p.T745T|OTOA_ENST00000388956.4_Silent_p.T666T|OTOA_ENST00000388957.3_Silent_p.T421T			Q7RTW8	OTOAN_HUMAN	otoancorin	759					cell-matrix adhesion (GO:0007160)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(9)|liver(2)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)	46				GBM - Glioblastoma multiforme(48;0.0414)		CAGCCGAGACCACGAAGGACT	0.453																																						dbGAP											0													96.0	77.0	84.0					16																	21742185		2195	4273	6468	-	-	-	SO:0001819	synonymous_variant	0			AK057335	CCDS10600.2, CCDS32403.1, CCDS53994.1	16p12.2	2009-08-18	2002-07-05		ENSG00000155719	ENSG00000155719			16378	protein-coding gene	gene with protein product	"""cancer/testis antigen 108"""	607038	"""deafness, autosomal recessive 22"""	DFNB22		11972037, 19088187	Standard	NM_170664		Approved	CT108	uc002djh.3	Q7RTW8	OTTHUMG00000090721	ENST00000286149.4:c.2277C>G	16.37:g.21742185C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A8|A2VDI0|B3KWU3|E9PF51|Q8NA86|Q96M76	Silent	SNP	NULL	p.T759	ENST00000286149.4	37	c.2277		16																																																																																			OTOA	-	NULL	ENSG00000155719		0.453	OTOA-003	KNOWN	basic	protein_coding	OTOA	HGNC	protein_coding	OTTHUMT00000430021.1	44	0.00	0	C			21742185	21742185	+1	no_errors	ENST00000286149	ensembl	human	known	69_37n	silent	23	17.86	5	SNP	0.000	G
PIK3C2B	5287	genome.wustl.edu	37	1	204423860	204423860	+	Missense_Mutation	SNP	G	G	C			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:204423860G>C	ENST00000367187.3	-	13	2559	c.2003C>G	c.(2002-2004)cCc>cGc	p.P668R	PIK3C2B_ENST00000424712.2_Missense_Mutation_p.P668R|PIK3C2B_ENST00000496872.1_5'UTR	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	668	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00041, ECO:0000255|PROSITE- ProRule:PRU00880}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			GGTCTGCAGGGGGCTGCACAG	0.577																																						dbGAP											0													114.0	117.0	116.0					1																	204423860		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.2003C>G	1.37:g.204423860G>C	ENSP00000356155:p.Pro668Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O95666|Q5SW99	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.P668R	ENST00000367187.3	37	c.2003	CCDS1446.1	1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712824	0.89112	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	T;T	0.80994	-1.44;-1.44	5.55	5.55	0.83447	C2 calcium/lipid-binding domain, CaLB (1);Phosphoinositide 3-kinase, C2 (2);	0.117332	0.64402	D	0.000020	D	0.85687	0.5754	L	0.36672	1.1	0.51767	D	0.999937	D;D	0.89917	0.991;1.0	D;D	0.91635	0.952;0.999	D	0.86696	0.1926	10	0.66056	D	0.02	.	17.2715	0.87103	0.0:0.0:1.0:0.0	.	668;668	F5GWN5;O00750	.;P3C2B_HUMAN	R	668	ENSP00000356155:P668R;ENSP00000400561:P668R	ENSP00000356155:P668R	P	-	2	0	PIK3C2B	202690483	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	8.735000	0.91549	2.602000	0.87976	0.655000	0.94253	CCC	PIK3C2B	-	pfam_PI3K_C2_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom	ENSG00000133056		0.577	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	14	0.00	0	G	NM_002646		204423860	204423860	-1	no_errors	ENST00000367187	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	C
PKD1L1	168507	genome.wustl.edu	37	7	47944109	47944109	+	Frame_Shift_Del	DEL	G	G	-			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:47944109delG	ENST00000289672.2	-	12	1847	c.1797delC	c.(1795-1797)cccfs	p.P599fs		NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	599	PKD 2. {ECO:0000255|PROSITE- ProRule:PRU00151}.				detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)		BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						GAGCTGAGGAGGGGGACGTGA	0.552																																						dbGAP											0													105.0	80.0	89.0					7																	47944109		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.1797delC	7.37:g.47944109delG	ENSP00000289672:p.Pro599fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Frame_Shift_Del	DEL	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.S600fs	ENST00000289672.2	37	c.1797	CCDS34633.1	7																																																																																			PKD1L1	-	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom	ENSG00000158683		0.552	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	23	0.00	0	G	NM_138295		47944109	47944109	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	frame_shift_del	9	25.00	3	DEL	0.000	-
PILRB	29990	genome.wustl.edu	37	7	99954396	99954396	+	De_novo_Start_OutOfFrame	SNP	C	C	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:99954396C>A	ENST00000452089.1	+	0	866				PILRB_ENST00000610247.1_De_novo_Start_OutOfFrame|PILRB_ENST00000448382.1_Missense_Mutation_p.T58N|PILRB_ENST00000609309.1_5'Flank|PILRB_ENST00000444073.1_De_novo_Start_OutOfFrame|STAG3L5P-PVRIG2P-PILRB_ENST00000310771.4_RNA			Q9UKJ0	PILRB_HUMAN	paired immunoglobin-like type 2 receptor beta						activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)				endometrium(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)	13	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GGATCTCGAACCTGCGGAAGG	0.592																																						dbGAP											0																																										-	-	-			0			AF161081, AJ400845	CCDS43622.1	7q22.1	2014-05-16			ENSG00000121716	ENSG00000121716		"""Immunoglobulin superfamily / V-set domain containing"""	18297	protein-coding gene	gene with protein product		605342				10660620	Standard	NM_178238		Approved	FDFACT1, FDFACT2	uc022ail.1	Q9UKJ0	OTTHUMG00000155363	ENST00000452089.1:c.-194C>A	7.37:g.99954396C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q69YF9|Q9HBS0	Missense_Mutation	SNP	NULL	p.T58N	ENST00000452089.1	37	c.173	CCDS43622.1	7	.	.	.	.	.	.	.	.	.	.	C	9.240	1.037983	0.19669	.	.	ENSG00000121716	ENST00000448382;ENST00000455145;ENST00000413850	.	.	.	2.54	0.551	0.17225	.	.	.	.	.	T	0.25005	0.0607	.	.	.	0.09310	N	0.999992	.	.	.	.	.	.	T	0.26292	-1.0107	4	.	.	.	.	5.1984	0.15250	0.0:0.6673:0.0:0.3327	.	.	.	.	N	58	.	.	T	+	2	0	PILRB	99792332	0.001000	0.12720	0.000000	0.03702	0.024000	0.10985	-0.339000	0.07832	-0.033000	0.13736	0.537000	0.68136	ACC	PILRB	-	NULL	ENSG00000121716		0.592	PILRB-008	KNOWN	basic|appris_principal|CCDS	protein_coding	PILRB	HGNC	protein_coding	OTTHUMT00000339923.2	27	0.00	0	C	NM_178238		99954396	99954396	+1	no_errors	ENST00000448382	ensembl	human	known	69_37n	missense	24	22.58	7	SNP	0.001	A
PKD1L2	114780	genome.wustl.edu	37	16	81208203	81208203	+	RNA	SNP	G	G	T	rs11150362	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr16:81208203G>T	ENST00000527937.1	-	0	781				PKD1L2_ENST00000337114.4_RNA|PKD1L2_ENST00000525539.1_RNA|PKD1L2_ENST00000531391.1_RNA|PKD1L2_ENST00000533478.1_RNA			Q7Z442	PK1L2_HUMAN	polycystic kidney disease 1-like 2						ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						CAGCCGCTTGGGAGACACCAC	0.557													G|||	1015	0.202676	0.0068	0.2176	5008	,	,		19448	0.256		0.2217	False		,,,				2504	0.3824					dbGAP											0																																										-	-	-			0			AY164483	CCDS61998.1, CCDS61999.1	16q23.2	2014-09-11			ENSG00000166473	ENSG00000166473			21715	protein-coding gene	gene with protein product		607894				12782129	Standard	NM_052892		Approved	KIAA1879	uc002fgf.1	Q7Z442	OTTHUMG00000166126		16.37:g.81208203G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UEE1|Q6ZN46|Q6ZSP2|Q8N1H9|Q96CL2|Q96Q08	Missense_Mutation	SNP	superfamily_Coatomer/clathrin_app_Ig-like,pfscan_REJ-like	p.P223H	ENST00000527937.1	37	c.668		16	416	0.19047619047619047	9	0.018292682926829267	80	0.22099447513812154	151	0.263986013986014	176	0.23218997361477572	G	13.68	2.310500	0.40895	.	.	ENSG00000166473	ENST00000527937	T	0.23754	1.89	3.43	2.45	0.29901	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.58432	P	1.0000000000287557E-6	D	0.71674	0.998	P	0.59889	0.865	T	0.11251	-1.0595	7	0.87932	D	0	.	7.1815	0.25776	0.1257:0.0:0.8743:0.0	rs11150362;rs60061515;rs11150362	223	Q7Z442-6	.	H	223	ENSP00000432818:P223H	ENSP00000432818:P223H	P	-	2	0	PKD1L2	79765704	0.001000	0.12720	0.001000	0.08648	0.036000	0.12997	0.391000	0.20784	0.993000	0.38866	0.555000	0.69702	CCC	PKD1L2	-	pfscan_REJ-like	ENSG00000166473		0.557	PKD1L2-007	KNOWN	basic|exp_conf	protein_coding	PKD1L2	HGNC	polymorphic_pseudogene	OTTHUMT00000387978.1	28	0.00	0	G			81208203	81208203	-1	no_errors	ENST00000527937	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	0.001	T
PPP1R3F	89801	genome.wustl.edu	37	X	49142944	49142944	+	Missense_Mutation	SNP	T	T	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chrX:49142944T>G	ENST00000055335.6	+	4	1808	c.1792T>G	c.(1792-1794)Tcg>Gcg	p.S598A	PPP1R3F_ENST00000495799.1_Missense_Mutation_p.S252A|PPP1R3F_ENST00000466508.1_Missense_Mutation_p.S252A|PPP1R3F_ENST00000376188.1_Missense_Mutation_p.S252A|PPP1R3F_ENST00000438316.1_Missense_Mutation_p.S269A	NM_033215.4	NP_149992.3	Q6ZSY5	PPR3F_HUMAN	protein phosphatase 1, regulatory subunit 3F	598					regulation of glycogen (starch) synthase activity (GO:2000465)|regulation of glycogen biosynthetic process (GO:0005979)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycogen binding (GO:2001069)|protein phosphatase binding (GO:0019903)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|skin(4)	27	Ovarian(276;0.236)					CCCCAAGGAATCGCCTCCAGA	0.617																																						dbGAP											0													32.0	26.0	28.0					X																	49142944		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS35254.1, CCDS55415.1	Xp11.23	2012-04-17	2011-10-04		ENSG00000049769	ENSG00000049769		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14944	protein-coding gene	gene with protein product			"""protein phosphatase 1, regulatory (inhibitor) subunit 3F"""			11948623	Standard	NM_033215		Approved	Hb2E	uc004dnh.2	Q6ZSY5	OTTHUMG00000024139	ENST00000055335.6:c.1792T>G	X.37:g.49142944T>G	ENSP00000055335:p.Ser598Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VDJ8|B3KPW2|E9PCM3	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.S598A	ENST00000055335.6	37	c.1792	CCDS35254.1	X	.	.	.	.	.	.	.	.	.	.	T	16.72	3.200609	0.58126	.	.	ENSG00000049769	ENST00000466508;ENST00000438316;ENST00000055335;ENST00000495799;ENST00000376188	T;T;T;T;T	0.65364	0.3;0.3;-0.15;0.3;0.3	5.55	5.55	0.83447	.	0.000000	0.49305	D	0.000160	T	0.68586	0.3017	L	0.32530	0.975	0.28804	N	0.8986	D;D;D	0.61697	0.99;0.99;0.984	D;D;D	0.75484	0.986;0.986;0.967	T	0.65998	-0.6032	10	0.87932	D	0	-10.2301	10.9538	0.47345	0.0:0.0:0.0:1.0	.	269;283;598	F5H262;A2VDJ8;Q6ZSY5	.;.;PPR3F_HUMAN	A	252;269;598;252;252	ENSP00000420687:S252A;ENSP00000415548:S269A;ENSP00000055335:S598A;ENSP00000417535:S252A;ENSP00000365359:S252A	ENSP00000055335:S598A	S	+	1	0	PPP1R3F	49029888	0.998000	0.40836	0.989000	0.46669	0.661000	0.39034	2.429000	0.44758	1.857000	0.53885	0.417000	0.27973	TCG	PPP1R3F	-	NULL	ENSG00000049769		0.617	PPP1R3F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R3F	HGNC	protein_coding	OTTHUMT00000060819.2	21	0.00	0	T	NM_033215		49142944	49142944	+1	no_errors	ENST00000055335	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	0.997	G
PRRC2A	7916	genome.wustl.edu	37	6	31605345	31605345	+	Silent	SNP	G	G	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr6:31605345G>T	ENST00000376033.2	+	31	6690	c.6456G>T	c.(6454-6456)ggG>ggT	p.G2152G	PRRC2A_ENST00000376007.4_Silent_p.G2152G	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	2152						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						AGGAGCCTGGGTTGCCCCCAC	0.647																																						dbGAP											0													23.0	31.0	28.0					6																	31605345		1506	2701	4207	-	-	-	SO:0001819	synonymous_variant	0			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.6456G>T	6.37:g.31605345G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Silent	SNP	pfam_BAT2_N	p.G2152	ENST00000376033.2	37	c.6456	CCDS4708.1	6																																																																																			PRRC2A	-	NULL	ENSG00000204469		0.647	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	25	0.00	0	G	NM_080686		31605345	31605345	+1	no_errors	ENST00000376007	ensembl	human	known	69_37n	silent	23	17.86	5	SNP	0.975	T
PSPH	5723	genome.wustl.edu	37	7	56088780	56088780	+	Silent	SNP	G	G	A	rs75497420	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:56088780G>A	ENST00000395471.3	-	4	931	c.126C>T	c.(124-126)gaC>gaT	p.D42D	PSPH_ENST00000275605.3_Silent_p.D42D|PSPH_ENST00000459834.1_Intron			P78330	SERB_HUMAN	phosphoserine phosphatase	42					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|dephosphorylation (GO:0016311)|L-serine biosynthetic process (GO:0006564)|L-serine metabolic process (GO:0006563)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to testosterone (GO:0033574)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|neuron projection (GO:0043005)	calcium ion binding (GO:0005509)|magnesium ion binding (GO:0000287)|phosphoserine phosphatase activity (GO:0004647)|protein homodimerization activity (GO:0042803)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(1)|skin(1)	11	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			CTGACACCGCGTCCTCAACGC	0.423																																						dbGAP											0													153.0	116.0	129.0					7																	56088780		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y10275	CCDS5522.1	7p11.2	2012-10-02			ENSG00000146733	ENSG00000146733	3.1.3.3		9577	protein-coding gene	gene with protein product		172480		PSP		6297854, 9188776	Standard	NM_004577		Approved		uc003trh.3	P78330	OTTHUMG00000023441	ENST00000395471.3:c.126C>T	7.37:g.56088780G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCR5|Q7Z3S5	Silent	SNP	pfam_Dehalogen-like_hydro,pfam_Pyrimidine_nucleotidase_eu,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	p.D42	ENST00000395471.3	37	c.126	CCDS5522.1	7																																																																																			PSPH	-	pfam_Dehalogen-like_hydro,pfam_Pase_PHOSPHO-typ,superfamily_HAD-like_dom,tigrfam_SerB,tigrfam_HAD-SF_hydro_IB_PSP-like	ENSG00000146733		0.423	PSPH-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PSPH	HGNC	protein_coding	OTTHUMT00000343304.1	26	0.00	0	G	NM_004577		56088780	56088780	-1	no_errors	ENST00000275605	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	0.854	A
PTPRQ	374462	genome.wustl.edu	37	12	81062884	81062884	+	Silent	SNP	A	A	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr12:81062884A>G	ENST00000266688.5	+	45	6279	c.6279A>G	c.(6277-6279)acA>acG	p.T2093T				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	2130	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						GAGCAAAAACATTAGTAATGC	0.338																																						dbGAP											0													108.0	95.0	99.0					12																	81062884		692	1590	2282	-	-	-	SO:0001819	synonymous_variant	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.6279A>G	12.37:g.81062884A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.H1794R	ENST00000266688.5	37	c.5381		12	.	.	.	.	.	.	.	.	.	.	A	9.331	1.060519	0.19987	.	.	ENSG00000139304	ENST00000532722	.	.	.	5.63	-1.49	0.08718	.	.	.	.	.	T	0.52322	0.1727	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47058	-0.9146	4	.	.	.	.	7.9137	0.29806	0.3598:0.4166:0.0:0.2236	.	.	.	.	R	1794	.	.	H	+	2	0	PTPRQ	79587015	0.751000	0.28327	0.999000	0.59377	0.998000	0.95712	-0.010000	0.12743	0.024000	0.15214	0.533000	0.62120	CAT	PTPRQ	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000139304		0.338	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		65	0.00	0	A	NM_001145026		81062884	81062884	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000532722	ensembl	human	novel	69_37n	missense	37	19.57	9	SNP	0.998	G
RBM15B	29890	genome.wustl.edu	37	3	51430822	51430824	+	In_Frame_Del	DEL	CCA	CCA	-	rs147738916	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr3:51430822_51430824delCCA	ENST00000323686.4	+	1	2092_2094	c.1992_1994delCCA	c.(1990-1995)ggccac>ggc	p.H670del		NM_013286.4	NP_037418.3	Q8NDT2	RB15B_HUMAN	RNA binding motif protein 15B	670	His-rich.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|large_intestine(5)|lung(3)	12				BRCA - Breast invasive adenocarcinoma(193;0.000224)|Kidney(197;0.000539)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		AGGAACGGGGCCACCACCACCAC	0.635																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AL831838	CCDS33764.1	3p21.1	2013-02-12			ENSG00000179837	ENSG00000259956		"""RNA binding motif (RRM) containing"""	24303	protein-coding gene	gene with protein product		612602				16129689	Standard	NM_013286		Approved	HUMAGCGB, OTT3	uc003dbd.3	Q8NDT2	OTTHUMG00000156896	ENST00000323686.4:c.1992_1994delCCA	3.37:g.51430831_51430833delCCA	ENSP00000313890:p.His670del	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPG7|Q6QE19|Q9BV96	In_Frame_Del	DEL	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.H668in_frame_del	ENST00000323686.4	37	c.1992_1994	CCDS33764.1	3																																																																																			RBM15B	-	NULL	ENSG00000179837		0.635	RBM15B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM15B	HGNC	protein_coding	OTTHUMT00000346489.1	16	0.00	0	CCA	NM_013286		51430822	51430824	+1	no_errors	ENST00000323686	ensembl	human	novel	69_37n	in_frame_del	3	40.00	2	DEL	1.000:1.000:0.998	-
RBM48	84060	genome.wustl.edu	37	7	92163949	92163949	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:92163949G>A	ENST00000265732.5	+	4	723	c.682G>A	c.(682-684)Ggt>Agt	p.G228S	RBM48_ENST00000481551.1_Missense_Mutation_p.G228S	NM_032120.2	NP_115496.2	Q5RL73	RBM48_HUMAN	RNA binding motif protein 48	228						nucleus (GO:0005634)	RNA binding (GO:0003723)										CTCTAAGGATGGTAGAAACCA	0.433																																						dbGAP											0													120.0	105.0	110.0					7																	92163949		1888	4107	5995	-	-	-	SO:0001583	missense	0			AL136619	CCDS43615.1	7q21.2	2013-02-12	2011-12-09	2011-12-09	ENSG00000127993	ENSG00000127993		"""RNA binding motif (RRM) containing"""	21785	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 64"""	C7orf64			Standard	NM_032120		Approved	DKFZp564O0523, HSPC304	uc003ulz.3	Q5RL73	OTTHUMG00000159535	ENST00000265732.5:c.682G>A	7.37:g.92163949G>A	ENSP00000265732:p.Gly228Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2K5|B7ZL51|Q5H9T2|Q8IYW7|Q96NS0|Q9H0V7	Missense_Mutation	SNP	NULL	p.G228S	ENST00000265732.5	37	c.682	CCDS43615.1	7	.	.	.	.	.	.	.	.	.	.	G	8.019	0.759300	0.15846	.	.	ENSG00000127993	ENST00000265732;ENST00000481551;ENST00000450580	.	.	.	5.19	3.39	0.38822	.	0.438355	0.28140	N	0.016460	T	0.29288	0.0729	L	0.40543	1.245	0.09310	N	1	B;B	0.24576	0.106;0.008	B;B	0.20767	0.031;0.005	T	0.17930	-1.0353	9	0.13108	T	0.6	-2.1705	9.6918	0.40134	0.1625:0.0:0.8375:0.0	.	228;228	B7Z2K5;Q5RL73	.;CG064_HUMAN	S	228	.	ENSP00000265732:G228S	G	+	1	0	C7orf64	92001885	0.001000	0.12720	0.003000	0.11579	0.012000	0.07955	0.505000	0.22642	0.761000	0.33130	0.591000	0.81541	GGT	RBM48	-	NULL	ENSG00000127993		0.433	RBM48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM48	HGNC	protein_coding	OTTHUMT00000356076.1	27	0.00	0	G	NM_032120		92163949	92163949	+1	no_errors	ENST00000265732	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.002	A
RBM6	10180	genome.wustl.edu	37	3	50005866	50005866	+	Silent	SNP	T	T	C			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr3:50005866T>C	ENST00000266022.4	+	3	1267	c.1008T>C	c.(1006-1008)caT>caC	p.H336H	RBM6_ENST00000422955.1_Intron|RBM6_ENST00000441115.1_Intron|RBM6_ENST00000539992.1_Intron|RBM6_ENST00000442092.1_Intron|RBM6_ENST00000443081.1_Silent_p.H204H	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	336					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		AATTTGAGCATTCAGAAACAA	0.428																																						dbGAP											0													82.0	74.0	77.0					3																	50005866		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1008T>C	3.37:g.50005866T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O60549|O75524|Q86SS3	Silent	SNP	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.H336	ENST00000266022.4	37	c.1008	CCDS2809.1	3																																																																																			RBM6	-	NULL	ENSG00000004534		0.428	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4	21	0.00	0	T	NM_005777		50005866	50005866	+1	no_errors	ENST00000266022	ensembl	human	known	69_37n	silent	19	24.00	6	SNP	1.000	C
REPIN1	29803	genome.wustl.edu	37	7	150069827	150069827	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:150069827G>T	ENST00000425389.2	+	1	1575	c.1497G>T	c.(1495-1497)aaG>aaT	p.K499N	REPIN1_ENST00000489432.2_Missense_Mutation_p.K556N|REPIN1_ENST00000397281.2_Missense_Mutation_p.K499N|RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000540729.1_Missense_Mutation_p.K499N|REPIN1_ENST00000444957.1_Missense_Mutation_p.K499N	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	499					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			TCAGCCAGAAGTCCAACCTGG	0.672																																						dbGAP											0													43.0	50.0	48.0					7																	150069827		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.1497G>T	7.37:g.150069827G>T	ENSP00000388287:p.Lys499Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K556N	ENST00000425389.2	37	c.1668	CCDS43677.1	7	.	.	.	.	.	.	.	.	.	.	G	13.69	2.313188	0.40895	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000425389	T;T;T;T;T	0.01015	5.44;5.44;5.44;5.44;5.44	4.11	2.0	0.26442	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.01800	0.0057	L	0.34521	1.04	0.80722	D	1	D;D	0.76494	0.988;0.999	P;D	0.78314	0.851;0.991	T	0.70868	-0.4755	9	0.14252	T	0.57	-16.2857	5.5162	0.16908	0.1209:0.0:0.6764:0.2026	.	556;499	C9J3L7;Q9BWE0	.;REPI1_HUMAN	N	499;499;499;556;499	ENSP00000445016:K499N;ENSP00000380451:K499N;ENSP00000407714:K499N;ENSP00000417291:K556N;ENSP00000388287:K499N	ENSP00000380451:K499N	K	+	3	2	REPIN1	149700760	0.000000	0.05858	0.991000	0.47740	0.929000	0.56500	-0.193000	0.09573	0.895000	0.36342	0.462000	0.41574	AAG	REPIN1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000214022		0.672	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	REPIN1	HGNC	protein_coding	OTTHUMT00000376940.1	22	0.00	0	G	NM_014374		150069827	150069827	+1	no_errors	ENST00000489432	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	0.921	T
RNASE9	390443	genome.wustl.edu	37	14	21026773	21026773	+	5'UTR	SNP	C	C	T	rs891297	byFrequency	TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr14:21026773C>T	ENST00000557068.1	-	0	181				RNASE9_ENST00000553706.1_Splice_Site|RNASE9_ENST00000554964.1_Intron|RNASE9_ENST00000404716.3_5'UTR|RNASE9_ENST00000556208.1_5'UTR|RNASE9_ENST00000557209.1_Splice_Site|RNASE9_ENST00000555230.1_5'UTR|RNASE9_ENST00000429244.2_Intron|RNASE9_ENST00000338904.3_Intron|RNASE9_ENST00000553541.1_Intron			P60153	RNAS9_HUMAN	ribonuclease, RNase A family, 9 (non-active)							extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|ovary(2)|urinary_tract(1)	8	all_cancers(95;0.00238)		Epithelial(56;3.32e-06)|all cancers(55;2.46e-05)	GBM - Glioblastoma multiforme(265;0.0141)		TCGGAACATACTCTCACAAGA	0.507													T|||	1571	0.313698	0.6868	0.2536	5008	,	,		18354	0.1171		0.1849	False		,,,				2504	0.1871					dbGAP											0													92.0	86.0	88.0					14																	21026773		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			AY665804	CCDS32036.1, CCDS53883.1, CCDS55904.1	14q11.2	2006-10-31				ENSG00000188655		"""Ribonucleases, RNase A"""	20673	protein-coding gene	gene with protein product		614014				15676279, 12920233	Standard	NM_001001673		Approved	h461	uc010ahu.3	P60153		ENST00000557068.1:c.-1545G>A	14.37:g.21026773C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RQR8|A8QJS1|Q5GAN7|Q6KG53	Splice_Site	SNP	-	e1+1	ENST00000557068.1	37	c.1+1	CCDS32036.1	14	612	0.2802197802197802	324	0.6585365853658537	91	0.2513812154696133	59	0.10314685314685315	138	0.1820580474934037	T	0.163	-1.079531	0.01903	.	.	ENSG00000188655	ENST00000553706;ENST00000557209	.	.	.	2.14	-4.27	0.03744	.	.	.	.	.	.	.	.	.	.	.	0.58432	P	1.0000000000287557E-6	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.911	0.05737	0.1585:0.4886:0.1496:0.2034	rs891297;rs1756412;rs891297	.	.	.	.	-1	.	.	.	-	.	.	RNASE9	20096613	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.794000	0.04584	-2.392000	0.00585	-1.341000	0.01249	.	RNASE9	-	-	ENSG00000188655		0.507	RNASE9-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RNASE9	HGNC	protein_coding	OTTHUMT00000411094.1	35	0.00	0	C	NM_001001673		21026773	21026773	-1	no_errors	ENST00000553706	ensembl	human	putative	69_37n	splice_site	22	18.52	5	SNP	0.000	T
SGMS1	259230	genome.wustl.edu	37	10	52103399	52103399	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr10:52103399C>T	ENST00000361781.2	-	7	1435	c.476G>A	c.(475-477)cGa>cAa	p.R159Q	SGMS1_ENST00000492601.2_5'Flank|SGMS1_ENST00000429490.1_Intron|SGMS1_ENST00000361543.2_Missense_Mutation_p.R159Q	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	165					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						AGGAGGTACTCGTTCGTGGAC	0.483																																						dbGAP											0													55.0	50.0	52.0					10																	52103399		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.476G>A	10.37:g.52103399C>T	ENSP00000354829:p.Arg159Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68U43|Q6EKK0|Q75SP1	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_P_Acid_Pase_2/haloperoxidase,pfscan_SAM	p.R159Q	ENST00000361781.2	37	c.476	CCDS7240.1	10	.	.	.	.	.	.	.	.	.	.	C	26.1	4.706852	0.89018	.	.	ENSG00000198964	ENST00000361781;ENST00000361543	T;T	0.63913	0.59;-0.07	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.79417	0.4442	M	0.75447	2.3	0.54753	D	0.99998	D	0.89917	1.0	D	0.81914	0.995	T	0.81272	-0.1008	10	0.87932	D	0	-29.2673	17.1838	0.86861	0.0:1.0:0.0:0.0	.	165	Q86VZ5	SMS1_HUMAN	Q	159	ENSP00000354829:R159Q;ENSP00000355235:R159Q	ENSP00000355235:R159Q	R	-	2	0	SGMS1	51773405	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.403000	0.79983	2.648000	0.89879	0.650000	0.86243	CGA	SGMS1	-	NULL	ENSG00000198964		0.483	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SGMS1	HGNC	protein_coding	OTTHUMT00000048074.2	36	0.00	0	C	NM_147156		52103399	52103399	-1	no_errors	ENST00000361781	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	T
SLC25A12	8604	genome.wustl.edu	37	2	172644449	172644449	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr2:172644449C>G	ENST00000422440.2	-	16	1631	c.1594G>C	c.(1594-1596)Gct>Cct	p.A532P	SLC25A12_ENST00000392592.4_Missense_Mutation_p.A425P	NM_003705.4	NP_003696.2	O75746	CMC1_HUMAN	solute carrier family 25 (aspartate/glutamate carrier), member 12	532					aspartate transport (GO:0015810)|carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|L-glutamate transport (GO:0015813)|malate-aspartate shuttle (GO:0043490)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|L-aspartate transmembrane transporter activity (GO:0015183)|L-glutamate transmembrane transporter activity (GO:0005313)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|upper_aerodigestive_tract(1)	23			OV - Ovarian serous cystadenocarcinoma(117;0.216)		L-Aspartic Acid(DB00128)	AGAGATGCAGCTGGGACACCT	0.468																																						dbGAP											0													46.0	46.0	46.0					2																	172644449		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14494	CCDS33327.1	2q24	2013-05-22	2012-03-29		ENSG00000115840	ENSG00000115840		"""Solute carriers"", ""EF-hand domain containing"""	10982	protein-coding gene	gene with protein product		603667	"""solute carrier family 25 (mitochondrial carrier, Aralar), member 12"""			9722566, 10702666, 11566871	Standard	NM_003705		Approved	Aralar	uc002uhh.3	O75746	OTTHUMG00000134290	ENST00000422440.2:c.1594G>C	2.37:g.172644449C>G	ENSP00000388658:p.Ala532Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KR64|Q96AM8	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.A532P	ENST00000422440.2	37	c.1594	CCDS33327.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.437843	0.96168	.	.	ENSG00000115840	ENST00000422440;ENST00000392592	D;D	0.81739	-1.53;-1.53	5.6	5.6	0.85130	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.92299	0.7557	H	0.94658	3.565	0.80722	D	1	P;P	0.50066	0.931;0.931	P;P	0.60345	0.873;0.651	D	0.93555	0.6890	10	0.72032	D	0.01	-14.1235	19.9823	0.97331	0.0:1.0:0.0:0.0	.	425;532	B3KR64;O75746	.;CMC1_HUMAN	P	532;425	ENSP00000388658:A532P;ENSP00000376371:A425P	ENSP00000376371:A425P	A	-	1	0	SLC25A12	172352695	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.556000	0.82233	2.788000	0.95919	0.650000	0.86243	GCT	SLC25A12	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	ENSG00000115840		0.468	SLC25A12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A12	HGNC	protein_coding	OTTHUMT00000259010.2	34	0.00	0	C	NM_003705		172644449	172644449	-1	no_errors	ENST00000422440	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	1.000	G
SLC2A7	155184	genome.wustl.edu	37	1	9074793	9074793	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:9074793G>T	ENST00000400906.1	-	7	849	c.850C>A	c.(850-852)Ctc>Atc	p.L284I		NM_207420.2	NP_997303.2	Q6PXP3	GTR7_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 7	284					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	substrate-specific transmembrane transporter activity (GO:0022891)			NS(1)|breast(1)|endometrium(4)|large_intestine(10)|lung(4)|prostate(2)|skin(2)	24	Ovarian(185;0.112)|all_lung(157;0.185)	all_epithelial(116;1.34e-15)|all_lung(118;9.46e-05)|Lung NSC(185;0.000172)|Renal(390;0.000469)|Colorectal(325;0.0062)|Breast(348;0.00715)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.04e-07)|COAD - Colon adenocarcinoma(227;7.66e-05)|Kidney(185;0.000249)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.00177)|BRCA - Breast invasive adenocarcinoma(304;0.00185)|READ - Rectum adenocarcinoma(331;0.0642)		ATGGAGAGGAGCTGCCAGCGC	0.687																																						dbGAP											0													21.0	20.0	20.0					1																	9074793		2188	4285	6473	-	-	-	SO:0001583	missense	0			AL356306	CCDS98.2	1p36.2	2013-05-22			ENSG00000197241	ENSG00000197241		"""Solute carriers"""	13445	protein-coding gene	gene with protein product	"""intestinal facilitative glucose transporter 7"""	610371				11780753	Standard	NM_207420		Approved	GLUT7	uc009vmo.1	Q6PXP3	OTTHUMG00000057499	ENST00000400906.1:c.850C>A	1.37:g.9074793G>T	ENSP00000383698:p.Leu284Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A333	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.L284I	ENST00000400906.1	37	c.850	CCDS98.2	1	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121607	0.56613	.	.	ENSG00000197241	ENST00000400906	T	0.75704	-0.96	4.12	4.12	0.48240	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.64402	D	0.000004	D	0.82522	0.5055	M	0.67625	2.065	0.38998	D	0.959282	D	0.67145	0.996	D	0.64237	0.923	T	0.82987	-0.0184	10	0.33141	T	0.24	.	15.5234	0.75881	0.0:0.0:1.0:0.0	.	284	Q6PXP3	GTR7_HUMAN	I	284	ENSP00000383698:L284I	ENSP00000383698:L284I	L	-	1	0	SLC2A7	8997380	1.000000	0.71417	0.978000	0.43139	0.506000	0.33950	4.975000	0.63777	2.106000	0.64143	0.491000	0.48974	CTC	SLC2A7	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000197241		0.687	SLC2A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A7	HGNC	protein_coding	OTTHUMT00000127768.3	34	0.00	0	G	NM_207420		9074793	9074793	-1	no_errors	ENST00000400906	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158650472	158650472	+	Silent	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:158650472G>A	ENST00000368147.4	-	5	759	c.579C>T	c.(577-579)acC>acT	p.T193T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	193					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GCAGAACTTCGGTGCGCTCCC	0.463																																						dbGAP											0													116.0	114.0	115.0					1																	158650472		1888	4127	6015	-	-	-	SO:0001819	synonymous_variant	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.579C>T	1.37:g.158650472G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.T193	ENST00000368147.4	37	c.579	CCDS41423.1	1																																																																																			SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.463	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	37	0.00	0	G	NM_003126		158650472	158650472	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	silent	48	18.64	11	SNP	1.000	A
TAS2R39	259285	genome.wustl.edu	37	7	142881277	142881277	+	Missense_Mutation	SNP	G	G	C	rs528998720		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr7:142881277G>C	ENST00000446620.1	+	1	766	c.766G>C	c.(766-768)Gct>Cct	p.A256P		NM_176881.2	NP_795362.2	P59534	T2R39_HUMAN	taste receptor, type 2, member 39	256					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	20	Melanoma(164;0.059)					CAGCATGGAGGCTCACATGGG	0.488																																						dbGAP											0													147.0	139.0	142.0					7																	142881277		1944	4136	6080	-	-	-	SO:0001583	missense	0			AF494230	CCDS47729.1	7q34	2012-08-22			ENSG00000236398	ENSG00000236398		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18886	protein-coding gene	gene with protein product						12379855	Standard	NM_176881		Approved		uc011ksw.2	P59534	OTTHUMG00000152636	ENST00000446620.1:c.766G>C	7.37:g.142881277G>C	ENSP00000405095:p.Ala256Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FUI7|Q3ZCN6|Q645W4	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.A256P	ENST00000446620.1	37	c.766	CCDS47729.1	7	.	.	.	.	.	.	.	.	.	.	G	16.48	3.134513	0.56828	.	.	ENSG00000236398	ENST00000446620	T	0.01516	4.81	4.45	3.57	0.40892	.	.	.	.	.	T	0.13884	0.0336	M	0.93375	3.41	0.38512	D	0.948491	D	0.89917	1.0	D	0.91635	0.999	T	0.04333	-1.0959	9	0.72032	D	0.01	.	12.0296	0.53390	0.0845:0.0:0.9155:0.0	.	256	P59534	T2R39_HUMAN	P	256	ENSP00000405095:A256P	ENSP00000405095:A256P	A	+	1	0	TAS2R39	142591399	1.000000	0.71417	0.987000	0.45799	0.579000	0.36224	2.739000	0.47409	1.238000	0.43771	0.650000	0.86243	GCT	TAS2R39	-	pfam_TAS2_rcpt	ENSG00000236398		0.488	TAS2R39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R39	HGNC	protein_coding	OTTHUMT00000327090.2	34	0.00	0	G	NM_176881		142881277	142881277	+1	no_errors	ENST00000446620	ensembl	human	known	69_37n	missense	39	11.36	5	SNP	1.000	C
TBKBP1	9755	genome.wustl.edu	37	17	45776851	45776851	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr17:45776851C>T	ENST00000361722.3	+	5	1649	c.800C>T	c.(799-801)aCc>aTc	p.T267I		NM_014726.2	NP_055541.1			TBK1 binding protein 1											endometrium(5)|kidney(1)|lung(1)	7						CTGCAGGAGACCCGGGCCCAG	0.692											OREG0024498	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													18.0	20.0	20.0					17																	45776851		1884	4103	5987	-	-	-	SO:0001583	missense	0			AB018318	CCDS45722.1	17q21.32	2012-05-17				ENSG00000198933			30140	protein-coding gene	gene with protein product		608476				14743216, 19481056	Standard	NM_014726		Approved	ProSAPiP2, KIAA0775	uc002ilu.3	A7MCY6		ENST00000361722.3:c.800C>T	17.37:g.45776851C>T	ENSP00000354777:p.Thr267Ile	Somatic	934	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.T267I	ENST00000361722.3	37	c.800	CCDS45722.1	17	.	.	.	.	.	.	.	.	.	.	C	16.44	3.125315	0.56721	.	.	ENSG00000198933	ENST00000361722	.	.	.	5.41	2.12	0.27331	.	0.548870	0.18324	N	0.144701	T	0.26122	0.0637	N	0.08118	0	0.26557	N	0.973806	B	0.23735	0.09	B	0.24974	0.057	T	0.33317	-0.9873	9	0.72032	D	0.01	-26.3404	15.1622	0.72793	0.0:0.5221:0.4779:0.0	.	267	A7MCY6	TBKB1_HUMAN	I	267	.	ENSP00000354777:T267I	T	+	2	0	TBKBP1	43131850	0.553000	0.26513	1.000000	0.80357	0.983000	0.72400	0.105000	0.15333	0.811000	0.34303	0.561000	0.74099	ACC	TBKBP1	-	NULL	ENSG00000198933		0.692	TBKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBKBP1	HGNC	protein_coding	OTTHUMT00000441363.1	31	0.00	0	C	NM_014726		45776851	45776851	+1	no_errors	ENST00000361722	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.993	T
TCTN1	79600	genome.wustl.edu	37	12	111085062	111085062	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr12:111085062C>A	ENST00000551590.1	+	13	1697	c.1541C>A	c.(1540-1542)aCt>aAt	p.T514N	TCTN1_ENST00000397655.3_Missense_Mutation_p.T500N|TCTN1_ENST00000397659.4_Missense_Mutation_p.T519N|HVCN1_ENST00000548312.1_Intron|TCTN1_ENST00000377654.3_Missense_Mutation_p.D260E			Q2MV58	TECT1_HUMAN	tectonic family member 1	514					central nervous system interneuron axonogenesis (GO:0021956)|cilium morphogenesis (GO:0060271)|dorsal/ventral neural tube patterning (GO:0021904)|in utero embryonic development (GO:0001701)|neural tube formation (GO:0001841)|regulation of smoothened signaling pathway (GO:0008589)|somatic motor neuron differentiation (GO:0021523)|telencephalon development (GO:0021537)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|membrane (GO:0016020)|TCTN-B9D complex (GO:0036038)				NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(9)|urinary_tract(1)	15						GTGAAGTGGACTAAATACGGA	0.413																																						dbGAP											0													136.0	121.0	126.0					12																	111085062		1854	4085	5939	-	-	-	SO:0001583	missense	0			AK055891	CCDS41833.1, CCDS41834.1, CCDS41835.1	12q24.11	2011-09-07			ENSG00000204852	ENSG00000204852		"""Tectonic proteins"""	26113	protein-coding gene	gene with protein product		609863				16357211	Standard	NM_001082537		Approved	FLJ21127, TECT1, JBTS13	uc001trn.4	Q2MV58	OTTHUMG00000150051	ENST00000551590.1:c.1541C>A	12.37:g.111085062C>A	ENSP00000448735:p.Thr514Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX11|Q49A60|Q6P5X1|Q6UXW2|Q8NAE9|Q96N72|Q9H798	Missense_Mutation	SNP	pfam_DUF1619	p.T519N	ENST00000551590.1	37	c.1556	CCDS41835.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.59|15.59	2.879157|2.879157	0.51801|0.51801	.|.	.|.	ENSG00000204852|ENSG00000204852	ENST00000377654|ENST00000397650;ENST00000551590;ENST00000397655;ENST00000397657;ENST00000397659;ENST00000397652;ENST00000547461;ENST00000552038;ENST00000485445;ENST00000491068	T|T;T;T	0.80033|0.79554	-1.33|-1.24;-1.28;-1.28	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	.|0.142736	.|0.45126	.|U	.|0.000394	D|D	0.89801|0.89801	0.6820|0.6820	M|M	0.70275|0.70275	2.135|2.135	0.36426|0.36426	D|D	0.864629|0.864629	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.91635	.|0.999;0.999;0.999	D|D	0.91365|0.91365	0.5115|0.5115	7|10	0.87932|0.62326	D|D	0|0.03	-16.6302|-16.6302	20.1632|20.1632	0.98142|0.98142	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|514;500;519	.|Q2MV58;Q2MV58-3;Q2MV58-2	.|TECT1_HUMAN;.;.	E|N	260|410;514;500;336;519;458;75;118;33;33	ENSP00000366882:D260E|ENSP00000448735:T514N;ENSP00000380775:T500N;ENSP00000380779:T519N	ENSP00000366882:D260E|ENSP00000380771:T410N	D|T	+|+	3|2	2|0	TCTN1|TCTN1	109569445|109569445	0.999000|0.999000	0.42202|0.42202	0.983000|0.983000	0.44433|0.44433	0.609000|0.609000	0.37215|0.37215	4.329000|4.329000	0.59260|0.59260	2.772000|2.772000	0.95346|0.95346	0.650000|0.650000	0.86243|0.86243	GAC|ACT	TCTN1	-	NULL	ENSG00000204852		0.413	TCTN1-001	KNOWN	non_canonical_TEC|basic|appris_candidate|CCDS	protein_coding	TCTN1	HGNC	protein_coding	OTTHUMT00000316016.2	26	0.00	0	C	NM_024549		111085062	111085062	+1	no_errors	ENST00000397659	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	1.000	A
TNFRSF13B	23495	genome.wustl.edu	37	17	16852070	16852070	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr17:16852070C>G	ENST00000261652.2	-	3	439	c.427G>C	c.(427-429)Ggc>Cgc	p.G143R	TNFRSF13B_ENST00000583789.1_Missense_Mutation_p.G97R|TNFRSF13B_ENST00000579315.1_Missense_Mutation_p.G143R|TNFRSF13B_ENST00000437538.2_Missense_Mutation_p.G97R|TNFRSF13B_ENST00000581616.2_5'UTR	NM_012452.2	NP_036584.1	O14836	TR13B_HUMAN	tumor necrosis factor receptor superfamily, member 13B	143					B cell homeostasis (GO:0001782)|cell surface receptor signaling pathway (GO:0007166)|hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of B cell proliferation (GO:0030889)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|skin(1)	16						GCTTCTGAGCCTCTGTGCTCC	0.557									IgA Deficiency, Selective																													dbGAP											0													176.0	150.0	158.0					17																	16852070		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	IGAD1, IGAD2	AF023614	CCDS11181.1	17p11.2	2014-09-17			ENSG00000240505	ENSG00000240505		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	18153	protein-coding gene	gene with protein product		604907				9311921	Standard	NM_012452		Approved	TACI, CD267	uc002gqs.1	O14836	OTTHUMG00000059262	ENST00000261652.2:c.427G>C	17.37:g.16852070C>G	ENSP00000261652:p.Gly143Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8B0|B7Z6V8|Q32LX4|Q7Z6F5	Missense_Mutation	SNP	pfam_TACI_Cys-rich-dom,prints_TNFR_13B	p.G143R	ENST00000261652.2	37	c.427	CCDS11181.1	17	.	.	.	.	.	.	.	.	.	.	C	10.87	1.473266	0.26423	.	.	ENSG00000240505	ENST00000437538;ENST00000261652	D;D	0.94046	-3.34;-3.27	4.43	4.43	0.53597	.	0.688326	0.12728	N	0.444102	D	0.95133	0.8423	L	0.60455	1.87	0.26408	N	0.976303	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.81914	0.974;0.995;0.988	D	0.88444	0.3044	10	0.21014	T	0.42	-28.0687	12.7463	0.57283	0.0:1.0:0.0:0.0	.	143;97;143	B7Z6V8;O14836-2;O14836	.;.;TR13B_HUMAN	R	97;143	ENSP00000413453:G97R;ENSP00000261652:G143R	ENSP00000261652:G143R	G	-	1	0	TNFRSF13B	16792795	0.982000	0.34865	0.933000	0.37362	0.050000	0.14768	1.199000	0.32235	2.455000	0.83008	0.650000	0.86243	GGC	TNFRSF13B	-	NULL	ENSG00000240505		0.557	TNFRSF13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF13B	HGNC	protein_coding	OTTHUMT00000131474.2	34	0.00	0	C			16852070	16852070	-1	no_errors	ENST00000261652	ensembl	human	known	69_37n	missense	23	39.47	15	SNP	0.962	G
TRAV9-1	28678	genome.wustl.edu	37	14	22280051	22280051	+	RNA	SNP	T	T	C			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr14:22280051T>C	ENST00000390431.3	+	0	240									T cell receptor alpha variable 9-1																		GGAACAAAGGTTTTGAAGCCA	0.468																																						dbGAP											0													89.0	83.0	85.0					14																	22280051		1945	4143	6088	-	-	-			0			AE000659		14q11.2	2012-02-07			ENSG00000211783	ENSG00000211783		"""T cell receptors / TRA locus"""	12153	other	T cell receptor gene						8188290	Standard	NG_001332		Approved				OTTHUMG00000168987		14.37:g.22280051T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.G80	ENST00000390431.3	37	c.240		14																																																																																			TRAV9-1	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000211783		0.468	TRAV9-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRAV9-1	HGNC	TR_V_gene	OTTHUMT00000401885.1	33	0.00	0	T	NG_001332		22280051	22280051	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390431	ensembl	human	known	69_37n	silent	23	17.86	5	SNP	0.998	C
TRIM2	23321	genome.wustl.edu	37	4	154178844	154178844	+	Intron	SNP	G	G	A			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr4:154178844G>A	ENST00000437508.2	+	2	153				TRIM2_ENST00000494872.1_Intron|TRIM2_ENST00000338700.5_Intron	NM_001130067.1	NP_001123539.1	Q9C040	TRIM2_HUMAN	tripartite motif containing 2						cell death (GO:0008219)|regulation of neuron apoptotic process (GO:0043523)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|prostate(1)	19	all_hematologic(180;0.093)	Medulloblastoma(177;0.00225)		GBM - Glioblastoma multiforme(119;0.0102)|LUSC - Lung squamous cell carcinoma(193;0.0703)		TTGGATTGCCGCGTAGCTGCA	0.458																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF220018	CCDS3781.2, CCDS47147.1	4q31.3	2013-01-09	2011-01-25		ENSG00000109654	ENSG00000109654		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	15974	protein-coding gene	gene with protein product		614141	"""tripartite motif-containing 2"""			9628581, 11331580	Standard	NM_015271		Approved	KIAA0517, RNF86	uc003inh.2	Q9C040	OTTHUMG00000155991	ENST00000437508.2:c.-48-12646G>A	4.37:g.154178844G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DP09|O60272|Q9BSI9|Q9UFZ1	RNA	SNP	-	NULL	ENST00000437508.2	37	NULL	CCDS47147.1	4																																																																																			TRIM2	-	-	ENSG00000109654		0.458	TRIM2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM2	HGNC	protein_coding	OTTHUMT00000342652.1	32	0.00	0	G			154178844	154178844	+1	no_errors	ENST00000502281	ensembl	human	putative	69_37n	rna	22	21.43	6	SNP	1.000	A
CFAP46	54777	genome.wustl.edu	37	10	134755513	134755513	+	Missense_Mutation	SNP	A	A	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr10:134755513A>T	ENST00000368586.5	-	2	245	c.145T>A	c.(145-147)Ttt>Att	p.F49I	TTC40_ENST00000368585.3_Missense_Mutation_p.F49I|RP13-137A17.4_ENST00000443633.1_lincRNA|TTC40_ENST00000368582.2_Missense_Mutation_p.F49I	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CACAGAACAAACAGGTCTGGG	0.572																																						dbGAP											0													121.0	115.0	117.0					10																	134755513		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000368586.5:c.145T>A	10.37:g.134755513A>T	ENSP00000357575:p.Phe49Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.F49I	ENST00000368586.5	37	c.145	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	A	12.57	1.976380	0.34848	.	.	ENSG00000171811	ENST00000368586;ENST00000368582;ENST00000368585	D;D;D	0.82619	-1.63;-1.63;-1.63	4.21	1.85	0.25348	.	0.829754	0.10349	N	0.685344	T	0.74558	0.3732	.	.	.	0.29145	N	0.878777	B;P	0.39022	0.228;0.655	B;B	0.35039	0.051;0.194	T	0.66156	-0.5994	9	0.72032	D	0.01	.	7.6694	0.28449	0.812:0.0:0.188:0.0	.	49;49	Q5SR76-2;Q5SR76-1	.;.	I	49	ENSP00000357575:F49I;ENSP00000357571:F49I;ENSP00000357574:F49I	ENSP00000357571:F49I	F	-	1	0	C10orf93	134605503	0.990000	0.36364	0.929000	0.37066	0.281000	0.26958	2.047000	0.41269	0.248000	0.21435	0.533000	0.62120	TTT	TTC40	-	NULL	ENSG00000171811		0.572	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	55	0.00	0	A			134755513	134755513	-1	no_errors	ENST00000368582	ensembl	human	known	69_37n	missense	33	13.16	5	SNP	0.940	T
VWA5A	4013	genome.wustl.edu	37	11	123993833	123993833	+	Silent	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr11:123993833C>T	ENST00000456829.2	+	8	1178	c.927C>T	c.(925-927)gcC>gcT	p.A309A	VWA5A_ENST00000392744.4_Silent_p.A325A|VWA5A_ENST00000360334.4_Silent_p.A309A|VWA5A_ENST00000361352.5_Silent_p.A309A|VWA5A_ENST00000449321.1_Silent_p.A309A|VWA5A_ENST00000392748.1_Silent_p.A309A	NM_001130142.1	NP_001123614.1	O00534	VMA5A_HUMAN	von Willebrand factor A domain containing 5A	309	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.									autonomic_ganglia(1)|breast(3)|endometrium(5)|kidney(2)|large_intestine(11)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	47						TACAGGCAGCCAAGGTAAAGC	0.488																																						dbGAP											0													67.0	56.0	60.0					11																	123993833		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AF002672	CCDS8444.1, CCDS8445.1	11q24.1	2008-07-25	2008-07-25	2008-07-25	ENSG00000110002	ENSG00000110002			6658	protein-coding gene	gene with protein product		602929	"""loss of heterozygosity, 11, chromosomal region 2, gene A"""	LOH11CR2A		9417908, 14504409	Standard	NM_001130142		Approved	BCSC-1	uc001pzt.3	O00534	OTTHUMG00000165971	ENST00000456829.2:c.927C>T	11.37:g.123993833C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UN19|Q6UN20|Q9BVF8	Silent	SNP	pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.A309	ENST00000456829.2	37	c.927	CCDS8444.1	11																																																																																			VWA5A	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000110002		0.488	VWA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5A	HGNC	protein_coding	OTTHUMT00000387273.1	28	0.00	0	C	NM_014622		123993833	123993833	+1	no_errors	ENST00000392748	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	1.000	T
WDR63	126820	genome.wustl.edu	37	1	85564233	85564233	+	Silent	SNP	G	G	A	rs199918615		TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr1:85564233G>A	ENST00000294664.6	+	13	1551	c.1371G>A	c.(1369-1371)ccG>ccA	p.P457P	WDR63_ENST00000370596.1_Silent_p.P418P|WDR63_ENST00000326813.8_Silent_p.P418P	NM_145172.3	NP_660155.2	Q8IWG1	WDR63_HUMAN	WD repeat domain 63	457										NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(13)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)	36				all cancers(265;0.00391)|Epithelial(280;0.00922)|Colorectal(170;0.166)		TCCTTGAACCGGAGAGTAATA	0.338													g|||	1	0.000199681	0.0	0.0	5008	,	,		19416	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													95.0	100.0	98.0					1																	85564233		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS702.1, CCDS72818.1	1p22.3	2014-02-21	2013-02-19	2013-02-19	ENSG00000162643	ENSG00000162643		"""WD repeat domain containing"""	30711	protein-coding gene	gene with protein product						21953912	Standard	XM_005270438		Approved	DIC3, FLJ30067, NYD-SP29	uc001dkt.3	Q8IWG1	OTTHUMG00000009953	ENST00000294664.6:c.1371G>A	1.37:g.85564233G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K988|Q96L72|Q96NU4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.P457	ENST00000294664.6	37	c.1371	CCDS702.1	1																																																																																			WDR63	-	superfamily_WD40_repeat_dom	ENSG00000162643		0.338	WDR63-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR63	HGNC	protein_coding	OTTHUMT00000027565.2	42	0.00	0	G	NM_145172		85564233	85564233	+1	no_errors	ENST00000294664	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	0.794	A
WDR72	256764	genome.wustl.edu	37	15	54008807	54008807	+	Silent	SNP	G	G	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chr15:54008807G>T	ENST00000396328.1	-	4	575	c.336C>A	c.(334-336)atC>atA	p.I112I	WDR72_ENST00000557913.1_Silent_p.I112I|WDR72_ENST00000360509.5_Silent_p.I112I|WDR72_ENST00000559418.1_Silent_p.I112I	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	112										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TACTTACACAGATTGCAGTGT	0.403																																						dbGAP											0													227.0	179.0	195.0					15																	54008807		2194	4293	6487	-	-	-	SO:0001819	synonymous_variant	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.336C>A	15.37:g.54008807G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3I3|Q8N8X2	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I112	ENST00000396328.1	37	c.336	CCDS10151.1	15																																																																																			WDR72	-	superfamily_WD40_repeat_dom	ENSG00000166415		0.403	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	27	0.00	0	G	NM_182758		54008807	54008807	-1	no_errors	ENST00000360509	ensembl	human	known	69_37n	silent	12	20.00	3	SNP	1.000	T
XIST	7503	genome.wustl.edu	37	X	73071058	73071058	+	lincRNA	SNP	C	C	T			TCGA-LL-A441-01A-11D-A243-09	TCGA-LL-A441-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	a4deb919-227b-42f0-8e50-b2963c13c4fc	20d61f40-5bee-48f5-8981-127982a0995c	g.chrX:73071058C>T	ENST00000429829.1	-	0	1530					NR_001564.2				X inactive specific transcript (non-protein coding)																		TTTAACAATGCGGCAAGCCCG	0.517																																						dbGAP											0													120.0	115.0	117.0					X																	73071058		876	1991	2867	-	-	-			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73071058C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.517	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	33	0.00	0	C	NR_001564		73071058	73071058	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	20	38.24	13	SNP	0.844	T
