#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSS3	79611	genome.wustl.edu	37	12	81593142	81593142	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:81593142G>A	ENST00000548058.1	+	9	2183	c.1273G>A	c.(1273-1275)Gga>Aga	p.G425R	ACSS3_ENST00000261206.3_Missense_Mutation_p.G424R|ACSS3_ENST00000548324.1_Missense_Mutation_p.G107R			Q9H6R3	ACSS3_HUMAN	acyl-CoA synthetase short-chain family member 3	425						mitochondrion (GO:0005739)	acetate-CoA ligase activity (GO:0003987)|ATP binding (GO:0005524)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(7)|liver(3)|lung(20)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	51						ATTTGTGGCTGGAGAACGATG	0.348																																						dbGAP											0													75.0	72.0	73.0					12																	81593142		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9022.1	12q21.31	2014-08-08			ENSG00000111058	ENSG00000111058		"""Acyl-CoA synthetase family"""	24723	protein-coding gene	gene with protein product		614356				17762044	Standard	NM_024560		Approved	FLJ21963	uc001szl.1	Q9H6R3	OTTHUMG00000170179	ENST00000548058.1:c.1273G>A	12.37:g.81593142G>A	ENSP00000449535:p.Gly425Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC66	Nonsense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.W44*	ENST00000548058.1	37	c.131	CCDS9022.1	12	.	.	.	.	.	.	.	.	.	.	G	29.9	5.042366	0.93685	.	.	ENSG00000111058	ENST00000548058;ENST00000261206;ENST00000548324	T;T;T	0.73258	1.39;1.39;-0.73	6.05	6.05	0.98169	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	D	0.91425	0.7294	H	0.99058	4.415	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94118	0.7377	10	0.87932	D	0	-21.1248	19.3727	0.94495	0.0:0.0:1.0:0.0	.	107;425	Q9H6R3-2;Q9H6R3	.;ACSS3_HUMAN	R	425;424;107	ENSP00000449535:G425R;ENSP00000261206:G424R;ENSP00000448965:G107R	ENSP00000261206:G424R	G	+	1	0	ACSS3	80117273	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.583000	0.90794	2.878000	0.98634	0.650000	0.86243	GGA	ACSS3	-	pfam_AMP-dep_Synth/Lig	ENSG00000111058		0.348	ACSS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACSS3	HGNC	protein_coding	OTTHUMT00000407794.1	28	0.00	0	G	NM_024560		81593142	81593142	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000546664	ensembl	human	known	69_37n	nonsense	17	37.04	10	SNP	1.000	A
ADCY5	111	genome.wustl.edu	37	3	123046605	123046605	+	Splice_Site	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr3:123046605G>A	ENST00000462833.1	-	7	3019	c.1807C>T	c.(1807-1809)Cgc>Tgc	p.R603C	ADCY5_ENST00000309879.5_Splice_Site_p.R253C|ADCY5_ENST00000491190.1_Splice_Site_p.R236C	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	603					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		ATGTGGATGCGTCTACAGGGG	0.557																																						dbGAP											0													68.0	56.0	60.0					3																	123046605		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1806-1C>T	3.37:g.123046605G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R603C	ENST00000462833.1	37	c.1807	CCDS3022.1	3	.	.	.	.	.	.	.	.	.	.	G	23.2	4.382739	0.82792	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	D;D;D;D	0.81821	-1.54;-1.54;-1.54;-1.54	5.52	4.63	0.57726	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.64402	D	0.000001	D	0.90614	0.7057	M	0.86573	2.825	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.97110	0.89;1.0	D	0.91789	0.5442	10	0.56958	D	0.05	.	15.5175	0.75837	0.0:0.0:0.8606:0.1394	.	603;236	O95622;B3KWA8	ADCY5_HUMAN;.	C	603;236;253;162	ENSP00000419361:R603C;ENSP00000418537:R236C;ENSP00000308685:R253C;ENSP00000420082:R162C	ENSP00000308685:R253C	R	-	1	0	ADCY5	124529295	1.000000	0.71417	0.986000	0.45419	0.847000	0.48162	7.915000	0.87484	1.274000	0.44362	0.655000	0.94253	CGC	ADCY5	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase	ENSG00000173175		0.557	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	37	0.00	0	G	XM_171048	Missense_Mutation	123046605	123046605	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	missense	21	36.36	12	SNP	1.000	A
ALX4	60529	genome.wustl.edu	37	11	44297153	44297153	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr11:44297153C>T	ENST00000329255.3	-	2	625	c.522G>A	c.(520-522)ggG>ggA	p.G174G		NM_021926.3	NP_068745.2	Q9H161	ALX4_HUMAN	ALX homeobox 4	174					anterior/posterior pattern specification (GO:0009952)|digestive tract development (GO:0048565)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic skeletal system morphogenesis (GO:0048704)|hair follicle development (GO:0001942)|muscle organ development (GO:0007517)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of apoptotic process (GO:0042981)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G174G(1)		central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	16						TGCTGTCCATCCCCACAGTGT	0.587																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											53.0	58.0	56.0					11																	44297153		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF294629	CCDS31468.1	11p11.2	2011-06-20	2008-11-04		ENSG00000052850	ENSG00000052850		"""Homeoboxes / PRD class"""	450	protein-coding gene	gene with protein product		605420	"""parietal foramina 2"", ""aristaless-like homeobox 4"""	PFM2		11017806, 8644736	Standard	NM_021926		Approved	FPP, PFM, KIAA1788	uc001myb.3	Q9H161	OTTHUMG00000166557	ENST00000329255.3:c.522G>A	11.37:g.44297153C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JN7|Q9H198|Q9HAY9	Silent	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain	p.G174	ENST00000329255.3	37	c.522	CCDS31468.1	11																																																																																			ALX4	-	NULL	ENSG00000052850		0.587	ALX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALX4	HGNC	protein_coding	OTTHUMT00000390399.1	25	0.00	0	C			44297153	44297153	-1	no_errors	ENST00000329255	ensembl	human	known	69_37n	silent	15	31.82	7	SNP	0.996	T
APPL2	55198	genome.wustl.edu	37	12	105611446	105611447	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:105611446_105611447insT	ENST00000258530.3	-	3	435_436	c.210_211insA	c.(208-213)aaacagfs	p.Q71fs	APPL2_ENST00000539978.2_Frame_Shift_Ins_p.Q28fs|APPL2_ENST00000551662.1_Frame_Shift_Ins_p.Q71fs	NM_001251904.1|NM_018171.3	NP_001238833.1|NP_060641.2	Q06481	APLP2_HUMAN	adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 2	520					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						CAAGTTACCTGTTTTTCATATG	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY113704	CCDS9101.1, CCDS58275.1, CCDS58276.1	12q23.3	2014-08-12			ENSG00000136044	ENSG00000136044		"""Pleckstrin homology (PH) domain containing"""	18242	protein-coding gene	gene with protein product		606231				11431708, 17030088	Standard	NM_001251904		Approved	FLJ10659, DIP13B	uc010swu.1	Q8NEU8	OTTHUMG00000169853	ENST00000258530.3:c.211dupA	12.37:g.105611451_105611451dupT	ENSP00000258530:p.Gln71fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Frame_Shift_Ins	INS	pfam_PTyr_interaction_dom,pfam_Pleckstrin_homology,pfam_PTB,smart_Pleckstrin_homology,smart_PTyr_interaction_dom,pfscan_Pleckstrin_homology,pfscan_PTyr_interaction_dom	p.Q70fs	ENST00000258530.3	37	c.211_210	CCDS9101.1	12																																																																																			APPL2	-	NULL	ENSG00000136044		0.401	APPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPL2	HGNC	protein_coding	OTTHUMT00000406238.3	83	0.00	0	-	NM_018171		105611446	105611447	-1	no_errors	ENST00000551662	ensembl	human	known	69_37n	frame_shift_ins	57	30.49	25	INS	1.000:1.000	T
ARID1A	8289	genome.wustl.edu	37	1	27057874	27057874	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:27057874C>T	ENST00000324856.7	+	3	1953	c.1582C>T	c.(1582-1584)Cag>Tag	p.Q528*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q145*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q528*	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	528					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GCCTCCACATCAGCAGTCCCC	0.617			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																	dbGAP		Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													244.0	237.0	239.0					1																	27057874		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.1582C>T	1.37:g.27057874C>T	ENSP00000320485:p.Gln528*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q528*	ENST00000324856.7	37	c.1582	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.432722	0.96150	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.44	5.44	0.79542	.	0.231855	0.38326	N	0.001734	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-6.1739	19.4471	0.94852	0.0:1.0:0.0:0.0	rs35170002	.	.	.	X	528;528;145	.	ENSP00000320485:Q528X	Q	+	1	0	ARID1A	26930461	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.531000	0.53546	2.824000	0.97209	0.655000	0.94253	CAG	ARID1A	-	NULL	ENSG00000117713		0.617	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	67	0.00	0	C	NM_139135		27057874	27057874	+1	no_errors	ENST00000324856	ensembl	human	known	69_37n	nonsense	30	34.78	16	SNP	1.000	T
ASB13	79754	genome.wustl.edu	37	10	5683765	5683765	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr10:5683765C>T	ENST00000357700.6	-	5	703	c.677G>A	c.(676-678)aGc>aAc	p.S226N	ASB13_ENST00000479033.1_5'UTR	NM_024701.3	NP_078977.2	Q8WXK3	ASB13_HUMAN	ankyrin repeat and SOCS box containing 13	226					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					NS(1)|endometrium(3)|lung(3)|ovary(1)	8				GBM - Glioblastoma multiforme(2;9.59e-09)		GGCGGGAGCGCTGCTGCTCCA	0.607																																						dbGAP											0													76.0	70.0	72.0					10																	5683765		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091935	CCDS7070.1	10p15.1	2013-01-10	2011-01-25		ENSG00000196372	ENSG00000196372		"""Ankyrin repeat domain containing"""	19765	protein-coding gene	gene with protein product		615055	"""ankyrin repeat and SOCS box-containing 13"""			12076535	Standard	NM_024701		Approved	FLJ13134, MGC19879	uc001iig.2	Q8WXK3	OTTHUMG00000017603	ENST00000357700.6:c.677G>A	10.37:g.5683765C>T	ENSP00000350331:p.Ser226Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Q6|D3DRR2|Q96EP7|Q9H8Z1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.S226N	ENST00000357700.6	37	c.677	CCDS7070.1	10	.	.	.	.	.	.	.	.	.	.	C	27.7	4.851235	0.91355	.	.	ENSG00000196372	ENST00000357700	T	0.68181	-0.31	5.87	5.87	0.94306	.	0.083169	0.85682	D	0.000000	T	0.72334	0.3447	L	0.31578	0.945	0.48975	D	0.999737	D	0.76494	0.999	D	0.71870	0.975	T	0.64351	-0.6428	10	0.13470	T	0.59	-18.6345	19.7885	0.96447	0.0:1.0:0.0:0.0	.	226	Q8WXK3	ASB13_HUMAN	N	226	ENSP00000350331:S226N	ENSP00000350331:S226N	S	-	2	0	ASB13	5723771	1.000000	0.71417	0.975000	0.42487	0.800000	0.45204	5.725000	0.68507	2.779000	0.95612	0.591000	0.81541	AGC	ASB13	-	NULL	ENSG00000196372		0.607	ASB13-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB13	HGNC	protein_coding	OTTHUMT00000046564.1	40	0.00	0	C			5683765	5683765	-1	no_errors	ENST00000357700	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	0.998	T
ATP10B	23120	genome.wustl.edu	37	5	160047653	160047653	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr5:160047653G>T	ENST00000327245.5	-	15	2963	c.2117C>A	c.(2116-2118)cCa>cAa	p.P706Q	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	706					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GTCTGTGGCTGGGGCCTCCAA	0.622																																						dbGAP											0													33.0	37.0	36.0					5																	160047653		2101	4241	6342	-	-	-	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.2117C>A	5.37:g.160047653G>T	ENSP00000313600:p.Pro706Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.P706Q	ENST00000327245.5	37	c.2117	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	G	2.457	-0.325014	0.05350	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	D;D	0.86030	-2.06;-2.06	4.95	4.06	0.47325	HAD-like domain (1);	0.542433	0.19276	N	0.118273	D	0.83454	0.5258	N	0.20986	0.625	0.09310	N	1	D;P	0.54397	0.966;0.784	P;P	0.58331	0.837;0.472	T	0.73978	-0.3812	9	.	.	.	.	12.0352	0.53420	0.1412:0.0:0.8588:0.0	.	314;706	Q2YDW8;O94823	.;AT10B_HUMAN	Q	706;314	ENSP00000313600:P706Q;ENSP00000431081:P314Q	.	P	-	2	0	ATP10B	159980231	0.026000	0.19158	0.027000	0.17364	0.011000	0.07611	1.696000	0.37773	2.451000	0.82905	0.655000	0.94253	CCA	ATP10B	-	superfamily_HAD-like_dom	ENSG00000118322		0.622	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	58	0.00	0	G	NM_025153		160047653	160047653	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	missense	24	35.14	13	SNP	0.000	T
BFSP1	631	genome.wustl.edu	37	20	17475250	17475250	+	Missense_Mutation	SNP	G	G	C			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr20:17475250G>C	ENST00000377873.3	-	8	1506	c.1467C>G	c.(1465-1467)atC>atG	p.I489M	BFSP1_ENST00000377868.2_Missense_Mutation_p.I364M|BFSP1_ENST00000536626.1_Missense_Mutation_p.I350M|BFSP1_ENST00000544874.1_Missense_Mutation_p.I350M	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	489	Tail.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						CTTTAGCTGTGATGGAGGAGA	0.557																																						dbGAP											0													67.0	62.0	64.0					20																	17475250		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.1467C>G	20.37:g.17475250G>C	ENSP00000367104:p.Ile489Met	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin	p.I489M	ENST00000377873.3	37	c.1467	CCDS13126.1	20	.	.	.	.	.	.	.	.	.	.	G	11.07	1.530604	0.27387	.	.	ENSG00000125864	ENST00000377873;ENST00000377868;ENST00000536626;ENST00000544874	T;T;T;T	0.55052	0.54;0.54;0.54;0.54	5.21	4.27	0.50696	.	0.176599	0.49916	D	0.000132	T	0.56731	0.2005	L	0.47190	1.495	0.27535	N	0.950974	B;D	0.60160	0.441;0.987	P;P	0.56216	0.495;0.794	T	0.53337	-0.8453	10	0.72032	D	0.01	-7.0634	9.1613	0.37023	0.168:0.0:0.832:0.0	.	364;489	Q12934-2;Q12934	.;BFSP1_HUMAN	M	489;364;350;350	ENSP00000367104:I489M;ENSP00000367099:I364M;ENSP00000442522:I350M;ENSP00000439870:I350M	ENSP00000367099:I364M	I	-	3	3	BFSP1	17423250	1.000000	0.71417	0.060000	0.19600	0.001000	0.01503	1.162000	0.31786	1.179000	0.42884	-0.137000	0.14449	ATC	BFSP1	-	NULL	ENSG00000125864		0.557	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFSP1	HGNC	protein_coding	OTTHUMT00000078119.6	53	0.00	0	G	NM_001195		17475250	17475250	-1	no_errors	ENST00000377873	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	C
BFSP1	631	genome.wustl.edu	37	20	17475259	17475259	+	Silent	SNP	G	G	C			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr20:17475259G>C	ENST00000377873.3	-	8	1497	c.1458C>G	c.(1456-1458)gtC>gtG	p.V486V	BFSP1_ENST00000377868.2_Silent_p.V361V|BFSP1_ENST00000536626.1_Silent_p.V347V|BFSP1_ENST00000544874.1_Silent_p.V347V	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	486	Tail.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						TGATGGAGGAGACATAGAATC	0.572																																						dbGAP											0													72.0	66.0	68.0					20																	17475259		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.1458C>G	20.37:g.17475259G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Silent	SNP	pfam_F,superfamily_Prefoldin	p.V486	ENST00000377873.3	37	c.1458	CCDS13126.1	20																																																																																			BFSP1	-	NULL	ENSG00000125864		0.572	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFSP1	HGNC	protein_coding	OTTHUMT00000078119.6	52	0.00	0	G	NM_001195		17475259	17475259	-1	no_errors	ENST00000377873	ensembl	human	known	69_37n	silent	18	30.77	8	SNP	0.646	C
BTRC	8945	genome.wustl.edu	37	10	103190166	103190166	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr10:103190166G>A	ENST00000370187.3	+	2	231	c.113G>A	c.(112-114)cGa>cAa	p.R38Q	BTRC_ENST00000408038.2_Intron|BTRC_ENST00000393441.4_Missense_Mutation_p.R23Q	NM_033637.3	NP_378663.1	Q9Y297	FBW1A_HUMAN	beta-transducin repeat containing E3 ubiquitin protein ligase	38					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cellular response to organic cyclic compound (GO:0071407)|G2/M transition of mitotic cell cycle (GO:0000086)|mammary gland epithelial cell proliferation (GO:0033598)|mitotic cell cycle (GO:0000278)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of proteolysis (GO:0045862)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein dephosphorylation (GO:0006470)|protein destabilization (GO:0031648)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of circadian rhythm (GO:0042752)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|rhythmic process (GO:0048511)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|signal transduction (GO:0007165)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(2)|large_intestine(6)|lung(11)|ovary(2)|stomach(1)|urinary_tract(1)	27		Colorectal(252;0.234)		Epithelial(162;1.05e-08)|all cancers(201;6.59e-07)		CCTTCGCTGCGATGCCTGTAT	0.532																																						dbGAP											0													119.0	106.0	110.0					10																	103190166		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y14153	CCDS7511.1, CCDS7512.1, CCDS73183.1	10q24.32	2013-01-10	2012-02-23		ENSG00000166167	ENSG00000166167		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1144	protein-coding gene	gene with protein product		603482	"""beta-transducin repeat containing"""			9660940, 10331953, 18354483	Standard	NM_033637		Approved	bTrCP, betaTrCP, FBXW1A, Fwd1, beta-TrCP1, bTrCP1	uc001kta.4	Q9Y297	OTTHUMG00000018932	ENST00000370187.3:c.113G>A	10.37:g.103190166G>A	ENSP00000359206:p.Arg38Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD49|Q5W141|Q5W142|Q9Y213	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Beta-TrCP_D,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R38Q	ENST00000370187.3	37	c.113	CCDS7512.1	10	.	.	.	.	.	.	.	.	.	.	G	17.63	3.437842	0.62955	.	.	ENSG00000166167	ENST00000370187;ENST00000393441;ENST00000370183	T;T	0.63744	-0.06;0.05	5.72	5.72	0.89469	.	0.108668	0.40469	N	0.001097	T	0.44008	0.1273	N	0.14661	0.345	0.40928	D	0.984364	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.33954	-0.9848	10	0.21014	T	0.42	-5.6456	13.4506	0.61169	0.0716:0.0:0.9284:0.0	.	38;38	B7Z3H4;Q9Y297	.;FBW1A_HUMAN	Q	38;23;20	ENSP00000359206:R38Q;ENSP00000377088:R23Q	ENSP00000359202:R20Q	R	+	2	0	BTRC	103180156	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.432000	0.66514	2.857000	0.98124	0.650000	0.86243	CGA	BTRC	-	NULL	ENSG00000166167		0.532	BTRC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BTRC	HGNC	protein_coding	OTTHUMT00000049936.1	62	0.00	0	G	NM_033637		103190166	103190166	+1	no_errors	ENST00000370187	ensembl	human	known	69_37n	missense	39	23.53	12	SNP	1.000	A
C12orf65	91574	genome.wustl.edu	37	12	123741391	123741391	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:123741391G>T	ENST00000253233.1	+	3	958	c.314G>T	c.(313-315)aGa>aTa	p.R105I	RP11-282O18.3_ENST00000542427.2_RNA|RP11-282O18.3_ENST00000544890.1_RNA|C12orf65_ENST00000366329.2_Missense_Mutation_p.R105I|C12orf65_ENST00000429587.2_Missense_Mutation_p.R105I|RP11-282O18.3_ENST00000543217.2_RNA|RP11-282O18.3_ENST00000541002.3_RNA	NM_152269.4	NP_689482.1	Q9H3J6	CL065_HUMAN	chromosome 12 open reading frame 65	105	GGQ domain. {ECO:0000250}.				cell death (GO:0008219)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)			endometrium(1)|large_intestine(1)|lung(1)|prostate(1)	4	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000595)|Epithelial(86;0.00199)		GATCAGAACAGAAAGCTAGCT	0.373																																						dbGAP											0													57.0	59.0	58.0					12																	123741391		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095982	CCDS9244.1	12q24.31	2013-01-07			ENSG00000130921	ENSG00000130921			26784	protein-coding gene	gene with protein product		613541				20598281, 22688947, 23188110	Standard	NM_152269		Approved	FLJ38663, SPG55	uc001uen.3	Q9H3J6	OTTHUMG00000168852	ENST00000253233.1:c.314G>T	12.37:g.123741391G>T	ENSP00000253233:p.Arg105Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUC6	Missense_Mutation	SNP	pfam_Pep_chain_release_fac_I_II	p.R105I	ENST00000253233.1	37	c.314	CCDS9244.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.430979	0.96150	.	.	ENSG00000130921	ENST00000253233;ENST00000366329;ENST00000543139;ENST00000429587	T;T;T;T	0.17213	2.29;2.29;2.29;2.29	5.86	5.86	0.93980	Peptide chain release factor class I/class II (1);	0.000000	0.85682	D	0.000000	T	0.49592	0.1566	M	0.88570	2.965	0.80722	D	1	D	0.65815	0.995	D	0.67900	0.954	T	0.55724	-0.8096	10	0.87932	D	0	-14.5539	18.0323	0.89289	0.0:0.0:1.0:0.0	.	105	Q9H3J6	CL065_HUMAN	I	105	ENSP00000253233:R105I;ENSP00000390647:R105I;ENSP00000444843:R105I;ENSP00000391513:R105I	ENSP00000253233:R105I	R	+	2	0	C12orf65	122307344	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.840000	0.99478	2.784000	0.95788	0.644000	0.83932	AGA	C12orf65	-	pfam_Pep_chain_release_fac_I_II	ENSG00000130921		0.373	C12orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf65	HGNC	protein_coding	OTTHUMT00000401375.1	35	0.00	0	G	NM_152269		123741391	123741391	+1	no_errors	ENST00000253233	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	1.000	T
CCDC180	100499483	genome.wustl.edu	37	9	100077163	100077163	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr9:100077163G>T	ENST00000357054.1	+	22	2214	c.1279G>T	c.(1279-1281)Gtc>Ttc	p.V427F	CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000395220.1_Missense_Mutation_p.V427F|CCDC180_ENST00000411667.2_Missense_Mutation_p.V285F|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000529487.1_Missense_Mutation_p.V288F|CCDC180_ENST00000375202.2_Missense_Mutation_p.V288F			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	427						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											ATATGCAGAAGTCATAGAGAA	0.458																																						dbGAP											0													101.0	96.0	98.0					9																	100077163		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.1279G>T	9.37:g.100077163G>T	ENSP00000349562:p.Val427Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.V288F	ENST00000357054.1	37	c.862		9	.	.	.	.	.	.	.	.	.	.	G	8.832	0.940030	0.18281	.	.	ENSG00000197816	ENST00000357054;ENST00000395220;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T;T	0.22336	1.96;1.96;1.96;1.96;1.96	5.85	3.37	0.38596	.	0.364940	0.27231	N	0.020320	T	0.09468	0.0233	N	0.08118	0	0.26001	N	0.98212	P;P;P;P	0.42203	0.589;0.773;0.773;0.773	B;B;B;B	0.36766	0.215;0.232;0.165;0.232	T	0.11108	-1.0601	10	0.51188	T	0.08	-16.453	7.8624	0.29517	0.8374:0.0:0.1626:0.0	.	285;427;288;427	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	F	427;427;288;285;311;288	ENSP00000349562:V427F;ENSP00000378646:V427F;ENSP00000364348:V288F;ENSP00000414000:V285F;ENSP00000434727:V288F	ENSP00000349562:V427F	V	+	1	0	C9orf174	99116984	0.932000	0.31603	0.579000	0.28588	0.013000	0.08279	1.901000	0.39838	0.553000	0.29044	-1.202000	0.01658	GTC	C9orf174	-	NULL	ENSG00000197816		0.458	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		28	0.00	0	G	NM_020893		100077163	100077163	+1	no_errors	ENST00000375202	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.750	T
CHD1L	9557	genome.wustl.edu	37	1	146756023	146756023	+	Splice_Site	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:146756023G>A	ENST00000369258.4	+	16	1725		c.e16-1		CHD1L_ENST00000431239.1_Splice_Site|CHD1L_ENST00000369259.3_Splice_Site|CHD1L_ENST00000467213.1_Splice_Site|CHD1L_ENST00000361293.5_Splice_Site	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like						ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					TATGTTGTTAGAAAATCATAT	0.313																																						dbGAP											0													63.0	67.0	66.0					1																	146756023		2203	4297	6500	-	-	-	SO:0001630	splice_region_variant	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.1706-1G>A	1.37:g.146756023G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Splice_Site	SNP	-	e16-1	ENST00000369258.4	37	c.1706-1	CCDS927.1	1	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768794	0.49680	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	.	.	.	5.12	3.17	0.36434	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.2599	0.20893	0.0983:0.1888:0.7129:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CHD1L	145222647	1.000000	0.71417	0.999000	0.59377	0.917000	0.54804	0.973000	0.29422	2.661000	0.90470	0.655000	0.94253	.	CHD1L	-	-	ENSG00000131778		0.313	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	77	0.00	0	G	NM_004284	Intron	146756023	146756023	+1	no_errors	ENST00000369258	ensembl	human	known	69_37n	splice_site	97	18.49	22	SNP	0.993	A
CLCN4	1183	genome.wustl.edu	37	X	10176293	10176293	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chrX:10176293G>A	ENST00000380833.4	+	9	1443	c.1052G>A	c.(1051-1053)cGc>cAc	p.R351H	CLCN4_ENST00000421085.2_Missense_Mutation_p.R257H|CLCN4_ENST00000380829.1_Intron	NM_001256944.1|NM_001830.3	NP_001243873.1|NP_001821.2	P51793	CLCN4_HUMAN	chloride channel, voltage-sensitive 4	351					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CTCTTCATCCGCTGCAACATC	0.582																																					Melanoma(74;1050 1296 1576 30544 38374)	dbGAP											0													108.0	105.0	106.0					X																	10176293		2203	4300	6503	-	-	-	SO:0001583	missense	0			X77197	CCDS14137.1, CCDS59159.1	Xp22.3	2012-09-26	2012-02-23		ENSG00000073464	ENSG00000073464		"""Ion channels / Chloride channels : Voltage-sensitive"""	2022	protein-coding gene	gene with protein product		302910	"""chloride channel 4"""			8069296	Standard	NM_001830		Approved	CLC4, ClC-4	uc004csy.4	P51793	OTTHUMG00000021125	ENST00000380833.4:c.1052G>A	X.37:g.10176293G>A	ENSP00000370213:p.Arg351His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3U1|B7Z5Z4|Q9UBU1	Missense_Mutation	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-4	p.R351H	ENST00000380833.4	37	c.1052	CCDS14137.1	X	.	.	.	.	.	.	.	.	.	.	g	16.99	3.273700	0.59649	.	.	ENSG00000073464	ENST00000380833;ENST00000421085	D;D	0.95103	-3.61;-3.61	5.71	5.71	0.89125	Chloride channel, core (2);	0.000000	0.85682	D	0.000000	D	0.91523	0.7323	L	0.32530	0.975	0.80722	D	1	B	0.20671	0.047	B	0.15484	0.013	D	0.87575	0.2480	10	0.54805	T	0.06	-35.8823	18.9991	0.92826	0.0:0.0:1.0:0.0	.	351	P51793	CLCN4_HUMAN	H	351;257	ENSP00000370213:R351H;ENSP00000405754:R257H	ENSP00000370213:R351H	R	+	2	0	CLCN4	10136293	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	6.652000	0.74377	2.436000	0.82500	0.592000	0.82586	CGC	CLCN4	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000073464		0.582	CLCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN4	HGNC	protein_coding	OTTHUMT00000055730.1	72	0.00	0	G			10176293	10176293	+1	no_errors	ENST00000380833	ensembl	human	known	69_37n	missense	47	11.32	6	SNP	1.000	A
CLCN6	1185	genome.wustl.edu	37	1	11898987	11898987	+	Intron	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:11898987C>T	ENST00000346436.6	+	22	2581				NPPA-AS1_ENST00000446542.1_RNA|CLCN6_ENST00000376487.3_Intron|CLCN6_ENST00000376496.3_Silent_p.L933L|CLCN6_ENST00000312413.6_Intron	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6						cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AAATGTTGCTCTTCACTCCGT	0.527											OREG0013104	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.2529+270C>T	1.37:g.11898987C>T		Somatic	675	WXS	Illumina GAIIx	Phase_IV	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-6	p.L933	ENST00000346436.6	37	c.2799	CCDS138.1	1																																																																																			CLCN6	-	NULL	ENSG00000011021		0.527	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN6	HGNC	protein_coding	OTTHUMT00000006639.2	47	0.00	0	C	NM_001286		11898987	11898987	+1	no_errors	ENST00000376496	ensembl	human	novel	69_37n	silent	20	23.08	6	SNP	0.003	T
CLK2	1196	genome.wustl.edu	37	1	155237829	155237829	+	Missense_Mutation	SNP	T	T	C			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:155237829T>C	ENST00000368361.4	-	6	958	c.643A>G	c.(643-645)Atc>Gtc	p.I215V	CLK2_ENST00000497188.1_5'UTR|CLK2_ENST00000361168.5_Missense_Mutation_p.I214V|CLK2_ENST00000536801.1_Missense_Mutation_p.I215V|CLK2_ENST00000355560.4_Missense_Mutation_p.I213V			P49760	CLK2_HUMAN	CDC-like kinase 2	215	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of gluconeogenesis (GO:0045721)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)|response to ionizing radiation (GO:0010212)|response to retinoic acid (GO:0032526)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	22	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			TTCTCATTGATTTTCTCTAGC	0.498								Other conserved DNA damage response genes																														dbGAP											0													243.0	217.0	226.0					1																	155237829		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29218	CCDS1107.1, CCDS72939.1	1q21	2008-05-02			ENSG00000176444	ENSG00000176444		"""CDC-like kinases"""	2069	protein-coding gene	gene with protein product		602989				7990150, 9856501	Standard	XM_005244876		Approved	clk2	uc001fjw.3	P49760	OTTHUMG00000035873	ENST00000368361.4:c.643A>G	1.37:g.155237829T>C	ENSP00000357345:p.Ile215Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AVS9|B5MBX6|Q96CQ0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I215V	ENST00000368361.4	37	c.643		1	.	.	.	.	.	.	.	.	.	.	.	13.61	2.289312	0.40494	.	.	ENSG00000176444	ENST00000361168;ENST00000368361;ENST00000355560;ENST00000536801	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	5.51	5.51	0.81932	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.18509	0.0444	L	0.28458	0.855	0.80722	D	1	P;P	0.37688	0.605;0.55	P;P	0.50352	0.638;0.505	T	0.02909	-1.1095	10	0.72032	D	0.01	.	14.5968	0.68413	0.0:0.0:0.0:1.0	.	215;214	P49760;P49760-3	CLK2_HUMAN;.	V	214;215;213;215	ENSP00000354856:I214V;ENSP00000357345:I215V;ENSP00000347759:I213V;ENSP00000441023:I215V	ENSP00000347759:I213V	I	-	1	0	CLK2	153504453	1.000000	0.71417	0.993000	0.49108	0.112000	0.19704	7.868000	0.87116	2.317000	0.78254	0.459000	0.35465	ATC	CLK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000176444		0.498	CLK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CLK2	HGNC	protein_coding	OTTHUMT00000087391.1	114	0.00	0	T	NM_003993		155237829	155237829	-1	no_errors	ENST00000368361	ensembl	human	known	69_37n	missense	126	10.00	14	SNP	1.000	C
COL6A2	1292	genome.wustl.edu	37	21	47538573	47538573	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr21:47538573G>A	ENST00000300527.4	+	13	1266	c.1162G>A	c.(1162-1164)Ggg>Agg	p.G388R	COL6A2_ENST00000409416.1_Missense_Mutation_p.G388R|COL6A2_ENST00000397763.1_Missense_Mutation_p.G388R|COL6A2_ENST00000310645.5_Missense_Mutation_p.G388R|COL6A2_ENST00000357838.4_Missense_Mutation_p.G388R	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	388	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GGGAGAAATCGGGGCCAAGGG	0.657																																						dbGAP											0													31.0	33.0	32.0					21																	47538573		2192	4295	6487	-	-	-	SO:0001583	missense	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1162G>A	21.37:g.47538573G>A	ENSP00000300527:p.Gly388Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.G388R	ENST00000300527.4	37	c.1162	CCDS13728.1	21	.	.	.	.	.	.	.	.	.	.	G	12.78	2.041489	0.35989	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.99637	-6.29;-6.29;-6.29;-6.29;-6.29	4.69	4.69	0.59074	.	0.000000	0.85682	D	0.000000	D	0.99789	0.9911	H	0.97682	4.055	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96754	0.9556	10	0.87932	D	0	-23.3626	16.6052	0.84826	0.0:0.0:1.0:0.0	.	388;388;388	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	R	388	ENSP00000300527:G388R;ENSP00000350497:G388R;ENSP00000312529:G388R;ENSP00000387115:G388R;ENSP00000380870:G388R	ENSP00000300527:G388R	G	+	1	0	COL6A2	46363001	1.000000	0.71417	0.907000	0.35723	0.082000	0.17680	5.962000	0.70364	2.151000	0.67156	0.591000	0.81541	GGG	COL6A2	-	pfam_Collagen	ENSG00000142173		0.657	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	101	0.00	0	G			47538573	47538573	+1	no_errors	ENST00000300527	ensembl	human	known	69_37n	missense	56	26.32	20	SNP	0.998	A
CYTH4	27128	genome.wustl.edu	37	22	37690715	37690715	+	Silent	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr22:37690715G>A	ENST00000248901.6	+	3	304	c.117G>A	c.(115-117)gaG>gaA	p.E39E	CYTH4_ENST00000439667.1_3'UTR|CYTH4_ENST00000405206.3_Silent_p.E39E|CYTH4_ENST00000402997.1_Silent_p.E39E	NM_013385.3	NP_037517.1	Q9UIA0	CYH4_HUMAN	cytohesin 4	39					positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)	plasma membrane (GO:0005886)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(7)|ovary(2)|stomach(1)	15						TGAAGGATGAGATTGCAGATG	0.602																																						dbGAP											0													135.0	120.0	125.0					22																	37690715		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF075458	CCDS13946.1	22q12.3-q13.1	2014-05-02	2008-08-14	2008-08-14	ENSG00000100055	ENSG00000100055		"""Pleckstrin homology (PH) domain containing"""	9505	protein-coding gene	gene with protein product		606514	"""pleckstrin homology, Sec7 and coiled/coil domains 4"", ""pleckstrin homology, Sec7 and coiled-coil domains 4"""	PSCD4		10591208	Standard	NM_013385		Approved	CYT4, cytohesin-4	uc003arf.3	Q9UIA0	OTTHUMG00000150562	ENST00000248901.6:c.117G>A	22.37:g.37690715G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3F9|Q9UGT6	Silent	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Sec7	p.E39	ENST00000248901.6	37	c.117	CCDS13946.1	22																																																																																			CYTH4	-	NULL	ENSG00000100055		0.602	CYTH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTH4	HGNC	protein_coding	OTTHUMT00000318917.1	42	0.00	0	G			37690715	37690715	+1	no_errors	ENST00000248901	ensembl	human	known	69_37n	silent	30	26.83	11	SNP	0.999	A
DMD	1756	genome.wustl.edu	37	X	32591707	32591707	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chrX:32591707C>T	ENST00000357033.4	-	15	1958	c.1752G>A	c.(1750-1752)aaG>aaA	p.K584K	DMD_ENST00000288447.4_Silent_p.K576K|DMD_ENST00000378677.2_Silent_p.K580K	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	584					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TTGTGTGAATCTTGTTCACTG	0.323																																						dbGAP											0													103.0	94.0	97.0					X																	32591707		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.1752G>A	X.37:g.32591707C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.K584	ENST00000357033.4	37	c.1752	CCDS14233.1	X																																																																																			DMD	-	smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.323	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	63	0.00	0	C	NM_004006		32591707	32591707	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	silent	36	25.00	12	SNP	0.997	T
DSP	1832	genome.wustl.edu	37	6	7584585	7584585	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr6:7584585G>A	ENST00000379802.3	+	24	7431	c.7090G>A	c.(7090-7092)Ggt>Agt	p.G2364S	DSP_ENST00000418664.2_Missense_Mutation_p.G1765S	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	2364	4.5 X 38 AA tandem repeats (Domain B).|Globular 2.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		AAAGGGCCACGGTATTCGCTT	0.458																																						dbGAP											0													67.0	69.0	68.0					6																	7584585		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.7090G>A	6.37:g.7584585G>A	ENSP00000369129:p.Gly2364Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.G2364S	ENST00000379802.3	37	c.7090	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643530	0.87859	.	.	ENSG00000096696	ENST00000379802;ENST00000418664	T;T	0.72167	-0.63;-0.63	5.7	5.7	0.88788	.	0.000000	0.64402	D	0.000004	D	0.83266	0.5217	M	0.76838	2.35	0.44843	D	0.997856	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.84038	0.0363	10	0.66056	D	0.02	.	19.8433	0.96699	0.0:0.0:1.0:0.0	.	1812;2364	Q4LE79;P15924	.;DESP_HUMAN	S	2364;1765	ENSP00000369129:G2364S;ENSP00000396591:G1765S	ENSP00000369129:G2364S	G	+	1	0	DSP	7529584	1.000000	0.71417	0.950000	0.38849	0.977000	0.68977	9.828000	0.99408	2.690000	0.91761	0.655000	0.94253	GGT	DSP	-	smart_Plectin_repeat	ENSG00000096696		0.458	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	33	0.00	0	G	NM_004415		7584585	7584585	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	1.000	A
EPAS1	2034	genome.wustl.edu	37	2	46525023	46525023	+	5'UTR	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr2:46525023C>T	ENST00000263734.3	+	0	483				EPAS1_ENST00000467888.1_3'UTR	NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1						angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			TGCTCGGCGTCTGAACGTCTC	0.711																																						dbGAP											0													27.0	30.0	29.0					2																	46525023		2186	4299	6485	-	-	-	SO:0001623	5_prime_UTR_variant	0			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.-28C>T	2.37:g.46525023C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VA2|Q99630	RNA	SNP	-	NULL	ENST00000263734.3	37	NULL	CCDS1825.1	2																																																																																			EPAS1	-	-	ENSG00000116016		0.711	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	HGNC	protein_coding	OTTHUMT00000250752.2	31	0.00	0	C	NM_001430		46525023	46525023	+1	no_errors	ENST00000467888	ensembl	human	putative	69_37n	rna	21	32.26	10	SNP	0.006	T
ERBB3	2065	genome.wustl.edu	37	12	56482607	56482607	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:56482607C>T	ENST00000267101.3	+	9	1504	c.1064C>T	c.(1063-1065)aCc>aTc	p.T355I	ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000415288.2_Missense_Mutation_p.T296I	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	355					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GTGAACTGCACCAAGATCCTG	0.552																																						dbGAP											0													152.0	138.0	143.0					12																	56482607		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1064C>T	12.37:g.56482607C>T	ENSP00000267101:p.Thr355Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T355I	ENST00000267101.3	37	c.1064	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484368	0.84854	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	D;D	0.82526	-1.62;-1.62	5.52	4.63	0.57726	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000004	D	0.93096	0.7802	H	0.94658	3.565	0.80722	D	1	P;D	0.89917	0.873;1.0	B;D	0.97110	0.403;1.0	D	0.94648	0.7836	10	0.87932	D	0	.	13.3701	0.60709	0.0:0.9237:0.0:0.0763	.	35;355	O75810;P21860	.;ERBB3_HUMAN	I	355;296	ENSP00000267101:T355I;ENSP00000408340:T296I	ENSP00000267101:T355I	T	+	2	0	ERBB3	54768874	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.269000	0.78482	1.577000	0.49804	-0.251000	0.11542	ACC	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000065361		0.552	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	45	0.00	0	C			56482607	56482607	+1	no_errors	ENST00000267101	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	1.000	T
FAHD1	81889	genome.wustl.edu	37	16	1877749	1877749	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr16:1877749C>T	ENST00000427358.2	+	1	525	c.519C>T	c.(517-519)atC>atT	p.I173I	FAHD1_ENST00000382668.4_Silent_p.I173I|HAGH_ENST00000566709.1_5'Flank|FAHD1_ENST00000382666.4_Silent_p.I173I|HAGH_ENST00000397356.3_5'Flank|HAGH_ENST00000455446.2_5'Flank|HAGH_ENST00000397353.2_5'Flank	NM_031208.3	NP_112485.1	Q6P587	FAHD1_HUMAN	fumarylacetoacetate hydrolase domain containing 1	173						cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetylpyruvate hydrolase activity (GO:0018773)|acylpyruvate hydrolase activity (GO:0047621)|fumarylpyruvate hydrolase activity (GO:0034545)|metal ion binding (GO:0046872)			NS(1)|large_intestine(1)|liver(1)|ovary(2)|urinary_tract(1)	6						CCTACATCATCAGCTATGTTT	0.478																																						dbGAP											0													70.0	61.0	64.0					16																	1877749		2199	4300	6499	-	-	-	SO:0001819	synonymous_variant	0			BC063017	CCDS10448.1, CCDS32367.1, CCDS45380.1	16p13.3	2011-10-21	2004-08-19	2004-08-26	ENSG00000180185	ENSG00000180185			14169	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 36"""	C16orf36		21878618	Standard	NM_001018104		Approved	DKFZP566J2046	uc002cnd.3	Q6P587	OTTHUMG00000128663	ENST00000427358.2:c.519C>T	16.37:g.1877749C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK40|B1AK41|Q6FIC7|Q96RY1|Q9H0N6	Silent	SNP	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	p.I173	ENST00000427358.2	37	c.519	CCDS10448.1	16																																																																																			FAHD1	-	pfam_Fumarylacetoacetase_C,superfamily_Fumarylacetoacetase_C-rel	ENSG00000180185		0.478	FAHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAHD1	HGNC	protein_coding	OTTHUMT00000250550.2	45	0.00	0	C	NM_001018104		1877749	1877749	+1	no_errors	ENST00000382666	ensembl	human	known	69_37n	silent	32	21.95	9	SNP	1.000	T
FAM163A	148753	genome.wustl.edu	37	1	179782251	179782251	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:179782251G>A	ENST00000341785.4	+	4	415	c.19G>A	c.(19-21)Gtg>Atg	p.V7M		NM_173509.2	NP_775780.1	Q96GL9	F163A_HUMAN	family with sequence similarity 163, member A	7						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(1)	15						GGGAACGGTTGTGATCACTGG	0.642																																						dbGAP											0													130.0	98.0	109.0					1																	179782251		2097	4053	6150	-	-	-	SO:0001583	missense	0			BC009382	CCDS1333.1	1q25.2	2008-06-05	2008-06-05	2008-06-05	ENSG00000143340	ENSG00000143340			28274	protein-coding gene	gene with protein product		611727	"""chromosome 1 open reading frame 76"""	C1orf76		12477932	Standard	NM_173509		Approved	MGC16664	uc001gnj.3	Q96GL9	OTTHUMG00000035262	ENST00000341785.4:c.19G>A	1.37:g.179782251G>A	ENSP00000354891:p.Val7Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8R7	Missense_Mutation	SNP	NULL	p.V7M	ENST00000341785.4	37	c.19	CCDS1333.1	1	.	.	.	.	.	.	.	.	.	.	G	33	5.288225	0.95517	.	.	ENSG00000143340	ENST00000341785	.	.	.	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	T	0.79052	0.4381	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.80594	-0.1313	9	0.87932	D	0	-15.1638	19.0451	0.93016	0.0:0.0:1.0:0.0	.	7	Q96GL9	F163A_HUMAN	M	7	.	ENSP00000354891:V7M	V	+	1	0	FAM163A	178048874	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.276000	0.95745	2.579000	0.87056	0.561000	0.74099	GTG	FAM163A	-	NULL	ENSG00000143340		0.642	FAM163A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM163A	HGNC	protein_coding	OTTHUMT00000085300.1	77	0.00	0	G	NM_173509		179782251	179782251	+1	no_errors	ENST00000341785	ensembl	human	known	69_37n	missense	101	11.40	13	SNP	1.000	A
FAM86B2	653333	genome.wustl.edu	37	8	12283473	12283473	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr8:12283473C>T	ENST00000262365.4	-	8	917	c.918G>A	c.(916-918)gcG>gcA	p.A306A	FAM86B2_ENST00000351291.4_Silent_p.A272A|AC087203.1_ENST00000580058.1_RNA|FAM86B2_ENST00000393715.3_Missense_Mutation_p.G126R|FAM86B2_ENST00000309608.5_3'UTR	NM_001137610.1	NP_001131082.1	P0C5J1	F86B2_HUMAN	family with sequence similarity 86, member B2	306										endometrium(1)|kidney(2)	3						GATGAGCTTCCGCTTCCCATC	0.527																																						dbGAP											0													2.0	2.0	2.0					8																	12283473		521	1081	1602	-	-	-	SO:0001819	synonymous_variant	0				CCDS59092.1	8p23.1	2011-07-01			ENSG00000145002	ENSG00000145002			32222	protein-coding gene	gene with protein product							Standard	NM_001137610		Approved		uc003wvt.4	P0C5J1	OTTHUMG00000165462	ENST00000262365.4:c.918G>A	8.37:g.12283473C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G126R	ENST00000262365.4	37	c.376	CCDS59092.1	8	.	.	.	.	.	.	.	.	.	.	-	0.010	-1.795600	0.00617	.	.	ENSG00000145002	ENST00000393715	T	0.34072	1.38	2.22	-4.44	0.03557	.	.	.	.	.	T	0.12263	0.0298	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.29181	-1.0020	5	0.07175	T	0.84	.	4.0137	0.09634	0.0:0.4192:0.2034:0.3774	.	.	.	.	R	126	ENSP00000377318:G126R	ENSP00000377318:G126R	G	-	1	0	FAM86B2	12327844	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.923000	0.00169	-1.939000	0.01044	-1.565000	0.00878	GGA	FAM86B2	-	NULL	ENSG00000145002		0.527	FAM86B2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86B2	HGNC	protein_coding		32	0.00	0	C	XM_928336		12283473	12283473	-1	no_errors	ENST00000393715	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	0.000	T
FHL1	2273	genome.wustl.edu	37	X	135279279	135279279	+	Intron	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chrX:135279279C>T	ENST00000345434.3	+	2	55				FHL1_ENST00000543669.1_Intron|FHL1_ENST00000539015.1_Intron|FHL1_ENST00000370690.3_Intron|FHL1_ENST00000370683.1_Missense_Mutation_p.S3F|FHL1_ENST00000370676.3_Missense_Mutation_p.S3F|FHL1_ENST00000535737.1_Intron|FHL1_ENST00000394153.2_Intron|FHL1_ENST00000394155.2_Intron			Q13642	FHL1_HUMAN	four and a half LIM domains 1						cell differentiation (GO:0030154)|muscle organ development (GO:0007517)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of G2/M transition of mitotic cell cycle (GO:0010972)|organ morphogenesis (GO:0009887)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane depolarization (GO:0003254)|regulation of potassium ion transmembrane transporter activity (GO:1901016)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ion channel binding (GO:0044325)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	Acute lymphoblastic leukemia(192;0.000127)					GCCATGGCTTCCCATAGACAC	0.438																																						dbGAP											0													177.0	148.0	157.0					X																	135279279		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			U60115	CCDS14655.1, CCDS55505.1, CCDS55506.1, CCDS55507.1, CCDS76036.1	Xq26.3	2014-09-17			ENSG00000022267	ENSG00000022267			3702	protein-coding gene	gene with protein product	"""Four-and-a-half LIM domains 1"", ""LIM protein SLIMMER"""	300163				8753811, 9714789	Standard	NM_001449		Approved	SLIM1, KYO-T, bA535K18.1, FHL1B, XMPMA, FLH1A, MGC111107	uc004ezo.3	Q13642	OTTHUMG00000022504	ENST00000345434.3:c.-26-9287C>T	X.37:g.135279279C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z5T4|B7Z793|O95212|Q13230|Q13645|Q5JXI7|Q5M7Y6|Q6IB30|Q9NZ40|Q9UKZ8|Q9Y630	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S3F	ENST00000345434.3	37	c.8	CCDS55507.1	X	.	.	.	.	.	.	.	.	.	.	C	9.331	1.060554	0.19987	.	.	ENSG00000022267	ENST00000370683;ENST00000370676;ENST00000542704	T;T	0.61158	0.13;0.22	5.73	5.73	0.89815	.	.	.	.	.	T	0.28863	0.0716	N	0.03608	-0.345	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26573	-1.0099	9	0.11485	T	0.65	.	7.5287	0.27671	0.0:0.8121:0.0:0.1879	.	3	B7Z5T4	.	F	3	ENSP00000359717:S3F;ENSP00000359710:S3F	ENSP00000359710:S3F	S	+	2	0	FHL1	135106945	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.580000	0.46068	2.401000	0.81631	0.550000	0.68814	TCC	FHL1	-	NULL	ENSG00000022267		0.438	FHL1-002	KNOWN	basic|CCDS	protein_coding	FHL1	HGNC	protein_coding	OTTHUMT00000058461.1	118	0.00	0	C	NM_001449		135279279	135279279	+1	no_errors	ENST00000370683	ensembl	human	known	69_37n	missense	62	31.87	29	SNP	1.000	T
FLNA	2316	genome.wustl.edu	37	X	153587944	153587944	+	Silent	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chrX:153587944G>A	ENST00000369850.3	-	24	4286	c.4050C>T	c.(4048-4050)acC>acT	p.T1350T	FLNA_ENST00000422373.1_Silent_p.T1350T|FLNA_ENST00000344736.4_Silent_p.T1350T|FLNA_ENST00000369856.3_5'Flank|FLNA_ENST00000360319.4_Silent_p.T1350T	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	1350					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CGCAGCCCTCGGTCACGGGCA	0.652																																						dbGAP											0													75.0	81.0	79.0					X																	153587944		2028	4152	6180	-	-	-	SO:0001819	synonymous_variant	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.4050C>T	X.37:g.153587944G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9KL45|Q5HY53|Q5HY55|Q8NF52	Silent	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.T1350	ENST00000369850.3	37	c.4050	CCDS48194.1	X																																																																																			FLNA	-	superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.652	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	46	0.00	0	G			153587944	153587944	-1	no_errors	ENST00000369850	ensembl	human	known	69_37n	silent	31	31.11	14	SNP	0.005	A
FOXC1	2296	genome.wustl.edu	37	6	1610937	1610938	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr6:1610937_1610938insTA	ENST00000380874.2	+	1	257_258	c.257_258insTA	c.(256-261)ctcatcfs	p.I87fs		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	87			I -> M (in ARS). {ECO:0000269|PubMed:9792859}.		artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		TACATCGCGCTCATCACCATGG	0.634																																					Pancreas(133;719 1821 3197 26645 35015)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	Exception_encountered	6.37:g.1610937_1610938insTA	ENSP00000370256:p.Ile87fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Frame_Shift_Ins	INS	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.I87fs	ENST00000380874.2	37	c.257_258	CCDS4473.1	6																																																																																			FOXC1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000054598		0.634	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXC1	HGNC	protein_coding	OTTHUMT00000043450.1	81	0.00	0	-			1610937	1610938	+1	no_errors	ENST00000380874	ensembl	human	known	69_37n	frame_shift_ins	47	16.07	9	INS	1.000:1.000	TA
FOXC1	2296	genome.wustl.edu	37	6	1610938	1610938	+	Silent	SNP	C	C	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr6:1610938C>A	ENST00000380874.2	+	1	258	c.258C>A	c.(256-258)ctC>ctA	p.L86L		NM_001453.2	NP_001444.2	Q12948	FOXC1_HUMAN	forkhead box C1	86			L -> F (in ARS; does not affect nuclear localization of the protein; reduces DNA binding and significantly reduces transactivation). {ECO:0000269|PubMed:14578375}.		artery morphogenesis (GO:0048844)|blood vessel remodeling (GO:0001974)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|cardiac muscle cell proliferation (GO:0060038)|collagen fibril organization (GO:0030199)|embryonic heart tube development (GO:0035050)|eye development (GO:0001654)|germ cell migration (GO:0008354)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lacrimal gland development (GO:0032808)|lymph vessel development (GO:0001945)|negative regulation of apoptotic process involved in outflow tract morphogenesis (GO:1902257)|negative regulation of mitotic cell cycle (GO:0045930)|neural crest cell development (GO:0014032)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|ovarian follicle development (GO:0001541)|paraxial mesoderm formation (GO:0048341)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood vessel size (GO:0050880)|regulation of organ growth (GO:0046620)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|somitogenesis (GO:0001756)|ureteric bud development (GO:0001657)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(93;0.0733)	all_cancers(2;4.45e-07)|all_epithelial(2;4.33e-05)|all_lung(73;0.0713)|all_hematologic(90;0.0895)		Epithelial(2;0.0904)|OV - Ovarian serous cystadenocarcinoma(45;0.095)|all cancers(2;0.168)		ACATCGCGCTCATCACCATGG	0.632																																					Pancreas(133;719 1821 3197 26645 35015)	dbGAP											0													84.0	89.0	87.0					6																	1610938		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF048693	CCDS4473.1	6p25	2008-04-10			ENSG00000054598	ENSG00000054598		"""Forkhead boxes"""	3800	protein-coding gene	gene with protein product		601090		FKHL7, IRID1		7957066, 9620769	Standard	NM_001453		Approved	FREAC3, ARA, IGDA, IHG1	uc003mtp.3	Q12948	OTTHUMG00000016182	ENST00000380874.2:c.258C>A	6.37:g.1610938C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UP7|Q9BYM1|Q9NUE5|Q9UDD0|Q9UP06	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.L86	ENST00000380874.2	37	c.258	CCDS4473.1	6																																																																																			FOXC1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000054598		0.632	FOXC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXC1	HGNC	protein_coding	OTTHUMT00000043450.1	83	0.00	0	C			1610938	1610938	+1	no_errors	ENST00000380874	ensembl	human	known	69_37n	silent	47	20.34	12	SNP	1.000	A
FPGS	2356	genome.wustl.edu	37	9	130575807	130575807	+	Missense_Mutation	SNP	T	T	G			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr9:130575807T>G	ENST00000373247.2	+	15	1738	c.1688T>G	c.(1687-1689)aTc>aGc	p.I563S	FPGS_ENST00000460181.1_3'UTR|FPGS_ENST00000393706.2_Missense_Mutation_p.I537S|FPGS_ENST00000373225.3_Missense_Mutation_p.I513S|FPGS_ENST00000373245.1_3'UTR|RP11-228B15.4_ENST00000439298.1_RNA	NM_004957.4	NP_004948.4	Q05932	FOLC_HUMAN	folylpolyglutamate synthase	563					brain development (GO:0007420)|folic acid metabolic process (GO:0046655)|liver development (GO:0001889)|nucleobase-containing compound metabolic process (GO:0006139)|one-carbon metabolic process (GO:0006730)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|tetrahydrofolylpolyglutamate synthase activity (GO:0004326)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7					Methotrexate(DB00563)|Pralatrexate(DB06813)|Raltitrexed(DB00293)	GCTGCTGCCATCCATGTGCTA	0.657																																						dbGAP											0													55.0	53.0	54.0					9																	130575807		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35148.1, CCDS35149.1, CCDS75905.1	9q34.11	2013-09-19			ENSG00000136877	ENSG00000136877	6.3.2.17		3824	protein-coding gene	gene with protein product		136510					Standard	NM_004957		Approved		uc004bsg.1	Q05932	OTTHUMG00000020716	ENST00000373247.2:c.1688T>G	9.37:g.130575807T>G	ENSP00000362344:p.Ile563Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPW4|B7Z2Z3|F5H0K6|Q5JU19|Q5JU22|Q6P2P6	Missense_Mutation	SNP	superfamily_Mur_ligase_cen,superfamily_Mur_ligase_C,tigrfam_Folylpolyglutamate_synth	p.I563S	ENST00000373247.2	37	c.1688	CCDS35148.1	9	.	.	.	.	.	.	.	.	.	.	T	19.30	3.801414	0.70567	.	.	ENSG00000136877	ENST00000373247;ENST00000393706;ENST00000373225	T;T;T	0.16897	2.7;2.7;2.31	5.33	4.19	0.49359	Mur ligase, C-terminal (1);	0.210148	0.47852	D	0.000216	T	0.31702	0.0805	M	0.79614	2.46	0.80722	D	1	P;P	0.43788	0.817;0.534	P;P	0.50270	0.636;0.636	T	0.05022	-1.0911	10	0.87932	D	0	-19.2842	10.2354	0.43280	0.0:0.078:0.0:0.922	.	537;563	Q05932-4;Q05932	.;FOLC_HUMAN	S	563;537;513	ENSP00000362344:I563S;ENSP00000377309:I537S;ENSP00000362322:I513S	ENSP00000362322:I513S	I	+	2	0	FPGS	129615628	1.000000	0.71417	0.990000	0.47175	0.639000	0.38242	4.749000	0.62155	0.864000	0.35578	0.533000	0.62120	ATC	FPGS	-	tigrfam_Folylpolyglutamate_synth	ENSG00000136877		0.657	FPGS-011	KNOWN	basic|appris_principal|CCDS	protein_coding	FPGS	HGNC	protein_coding	OTTHUMT00000054251.1	44	0.00	0	T			130575807	130575807	+1	no_errors	ENST00000373247	ensembl	human	known	69_37n	missense	38	33.33	19	SNP	0.997	G
HAUS5	23354	genome.wustl.edu	37	19	36106161	36106161	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr19:36106161C>G	ENST00000203166.5	+	6	383	c.358C>G	c.(358-360)Caa>Gaa	p.Q120E	HAUS5_ENST00000379045.2_Missense_Mutation_p.Q120E|AC002115.9_ENST00000589603.1_lincRNA	NM_015302.1	NP_056117.1	O94927	HAUS5_HUMAN	HAUS augmin-like complex, subunit 5	120					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)				NS(1)|breast(2)|cervix(3)|endometrium(1)|large_intestine(2)|lung(5)|skin(2)	16						TCAGCACACTCAAGACACCCA	0.632																																						dbGAP											0													29.0	35.0	33.0					19																	36106161		2152	4260	6412	-	-	-	SO:0001583	missense	0			AB020648	CCDS42550.1	19q13.12	2012-02-22	2009-04-20	2009-04-20	ENSG00000249115	ENSG00000249115		"""HAUS augmin-like complex subunits"""	29130	protein-coding gene	gene with protein product		613432	"""KIAA0841"""	KIAA0841		10048485, 19427217	Standard	NM_015302		Approved	dgt5	uc002oam.1	O94927	OTTHUMG00000048110	ENST00000203166.5:c.358C>G	19.37:g.36106161C>G	ENSP00000439056:p.Gln120Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXK1|Q6P2P7|Q7L3D5|Q96CT8	Missense_Mutation	SNP	NULL	p.Q120E	ENST00000203166.5	37	c.358	CCDS42550.1	19	.	.	.	.	.	.	.	.	.	.	C	3.679	-0.065906	0.07273	.	.	ENSG00000249115	ENST00000203166;ENST00000379045	T;T	0.29397	1.57;1.57	5.52	3.36	0.38483	.	0.779486	0.12024	N	0.506571	T	0.26011	0.0634	L	0.49350	1.555	0.09310	N	1	B	0.18166	0.026	B	0.19391	0.025	T	0.26985	-1.0087	10	0.23891	T	0.37	-17.4614	6.8024	0.23758	0.1803:0.73:0.0:0.0897	.	120	O94927	HAUS5_HUMAN	E	120	ENSP00000439056:Q120E;ENSP00000444373:Q120E	ENSP00000439056:Q120E	Q	+	1	0	HAUS5	40798001	0.001000	0.12720	0.000000	0.03702	0.062000	0.15995	1.032000	0.30178	0.656000	0.30886	0.650000	0.86243	CAA	HAUS5	-	NULL	ENSG00000249115		0.632	HAUS5-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HAUS5	HGNC	protein_coding	OTTHUMT00000459055.2	32	0.00	0	C			36106161	36106161	+1	no_errors	ENST00000203166	ensembl	human	known	69_37n	missense	22	18.52	5	SNP	0.001	G
WDR37	22884	genome.wustl.edu	37	10	1094228	1094228	+	5'Flank	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr10:1094228C>T	ENST00000358220.1	+	0	0				IDI1_ENST00000491735.1_Intron|IDI1_ENST00000381344.3_Intron			Q9Y2I8	WDR37_HUMAN	WD repeat domain 37											breast(2)|endometrium(2)|kidney(1)|lung(9)|prostate(2)|skin(1)	17		all_epithelial(10;0.0449)|Colorectal(49;0.142)		Epithelial(11;0.134)		GGGAACACATCATCCAACCCA	0.423																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AB023199	CCDS7057.1	10p15.3	2013-01-09			ENSG00000047056	ENSG00000047056		"""WD repeat domain containing"""	31406	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_014023		Approved	KIAA0982	uc001igf.1	Q9Y2I8	OTTHUMG00000017540		10.37:g.1094228C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K976|D3DRQ7|Q5SW03|Q8WVG2|Q9NTJ6	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.D11N	ENST00000358220.1	37	c.31	CCDS7057.1	10	.	.	.	.	.	.	.	.	.	.	C	9.182	1.023734	0.19433	.	.	ENSG00000067064	ENST00000427898	.	.	.	1.18	0.213	0.15244	.	.	.	.	.	T	0.27524	0.0676	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	T	0.26467	-1.0102	5	0.44086	T	0.13	.	3.4449	0.07477	0.0:0.7117:0.0:0.2883	.	.	.	.	N	11	.	ENSP00000404771:D11N	D	-	1	0	IDI1	1084228	0.049000	0.20398	0.008000	0.14137	0.009000	0.06853	0.072000	0.14617	0.058000	0.16222	0.305000	0.20034	GAT	IDI1	-	NULL	ENSG00000067064		0.423	WDR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDI1	HGNC	protein_coding	OTTHUMT00000046418.1	49	0.00	0	C	NM_014023		1094228	1094228	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000427898	ensembl	human	known	69_37n	missense	32	27.27	12	SNP	0.011	T
IFIT2	3433	genome.wustl.edu	37	10	91066307	91066307	+	Silent	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr10:91066307G>A	ENST00000371826.3	+	2	763	c.594G>A	c.(592-594)ctG>ctA	p.L198L	LIPA_ENST00000371837.1_Intron|LIPA_ENST00000487618.1_Intron	NM_001547.4	NP_001538.4	P09913	IFIT2_HUMAN	interferon-induced protein with tetratricopeptide repeats 2	198					apoptotic mitochondrial changes (GO:0008637)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|negative regulation of protein binding (GO:0032091)|positive regulation of apoptotic process (GO:0043065)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|ovary(1)|skin(1)	12		Colorectal(252;0.0161)				TTGACCCTCTGAGGCAAGCCA	0.502																																						dbGAP											0													52.0	53.0	52.0					10																	91066307		2004	4190	6194	-	-	-	SO:0001819	synonymous_variant	0			M14660	CCDS41548.1	10q23.31	2013-01-11			ENSG00000119922	ENSG00000119922		"""Tetratricopeptide (TTC) repeat domain containing"""	5409	protein-coding gene	gene with protein product		147040		IFI54, G10P2		3175763, 3360121	Standard	NM_001547		Approved	IFI-54, ISG-54K, cig42, GARG-39	uc009xts.3	P09913	OTTHUMG00000018707	ENST00000371826.3:c.594G>A	10.37:g.91066307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T767	Silent	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L198	ENST00000371826.3	37	c.594	CCDS41548.1	10																																																																																			IFIT2	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000119922		0.502	IFIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIT2	HGNC	protein_coding	OTTHUMT00000049293.1	62	0.00	0	G	NM_001547		91066307	91066307	+1	no_errors	ENST00000371826	ensembl	human	known	69_37n	silent	34	24.44	11	SNP	0.996	A
IK	3550	genome.wustl.edu	37	5	140027518	140027518	+	Intron	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr5:140027518C>T	ENST00000417647.2	+	1	155				IK_ENST00000523672.1_3'UTR|MIR3655_ENST00000581765.1_RNA|NDUFA2_ENST00000512088.1_5'Flank|NDUFA2_ENST00000252102.4_5'Flank|NDUFA2_ENST00000510680.1_5'Flank	NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II						cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TAGTAAGGCTCAGGCCATCCG	0.512																																						dbGAP											0													154.0	165.0	161.0					5																	140027518		2115	4222	6337	-	-	-	SO:0001627	intron_variant	0			BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.16+9C>T	5.37:g.140027518C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPD8	RNA	SNP	-	NULL	ENST00000417647.2	37	NULL	CCDS47280.1	5																																																																																			IK	-	-	ENSG00000113141		0.512	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	IK	HGNC	protein_coding	OTTHUMT00000372897.1	51	0.00	0	C	NM_006083		140027518	140027518	+1	no_errors	ENST00000523672	ensembl	human	known	69_37n	rna	23	14.81	4	SNP	0.000	T
INTS1	26173	genome.wustl.edu	37	7	1526650	1526650	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr7:1526650C>T	ENST00000404767.3	-	21	2819	c.2734G>A	c.(2734-2736)Gag>Aag	p.E912K	INTS1_ENST00000389470.4_Missense_Mutation_p.E1055K	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	912					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		AGCAGGAACTCGCACAGACAC	0.672																																						dbGAP											0													48.0	51.0	50.0					7																	1526650		2184	4266	6450	-	-	-	SO:0001583	missense	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.2734G>A	7.37:g.1526650C>T	ENSP00000385722:p.Glu912Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.E1055K	ENST00000404767.3	37	c.3163	CCDS47526.1	7	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252342	0.80135	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.60299	0.29;0.2	4.68	4.68	0.58851	.	0.000000	0.85682	D	0.000000	T	0.77618	0.4157	M	0.81112	2.525	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.979;0.995	T	0.81831	-0.0752	10	0.72032	D	0.01	.	17.6833	0.88250	0.0:1.0:0.0:0.0	.	1061;912	A4D213;Q8N201	.;INT1_HUMAN	K	912;1055	ENSP00000385722:E912K;ENSP00000374121:E1055K	ENSP00000374121:E1055K	E	-	1	0	INTS1	1493176	1.000000	0.71417	0.993000	0.49108	0.244000	0.25665	7.258000	0.78371	2.160000	0.67779	0.650000	0.86243	GAG	INTS1	-	NULL	ENSG00000164880		0.672	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	11	0.00	0	C			1526650	1526650	-1	no_errors	ENST00000389470	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	1.000	T
KCNMA1	3778	genome.wustl.edu	37	10	78761245	78761245	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr10:78761245C>T	ENST00000286628.8	-	19	2185	c.2186G>A	c.(2185-2187)cGt>cAt	p.R729H	KCNMA1_ENST00000372443.1_Intron|KCNMA1_ENST00000372440.1_Intron|KCNMA1_ENST00000404857.1_Intron|KCNMA1_ENST00000354353.5_Intron|KCNMA1_ENST00000404771.3_Missense_Mutation_p.R729H|KCNMA1_ENST00000286627.5_Intron|KCNMA1_ENST00000406533.3_Missense_Mutation_p.R733H	NM_001161352.1	NP_001154824.1	Q12791	KCMA1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, alpha member 1	729					blood coagulation (GO:0007596)|cellular potassium ion homeostasis (GO:0030007)|micturition (GO:0060073)|negative regulation of cell volume (GO:0045794)|positive regulation of apoptotic process (GO:0043065)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|response to calcium ion (GO:0051592)|response to carbon monoxide (GO:0034465)|response to hypoxia (GO:0001666)|response to osmotic stress (GO:0006970)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	actin binding (GO:0003779)|calcium-activated potassium channel activity (GO:0015269)|large conductance calcium-activated potassium channel activity (GO:0060072)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(17)|lung(23)|ovary(2)|pancreas(2)|prostate(4)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	68	all_cancers(46;0.203)|all_epithelial(25;0.00604)|Prostate(51;0.0198)		OV - Ovarian serous cystadenocarcinoma(4;0.0586)|Epithelial(14;0.081)|all cancers(16;0.183)		Bendroflumethiazide(DB00436)|Chlorzoxazone(DB00356)|Cromoglicic acid(DB01003)|Diazoxide(DB01119)|Halothane(DB01159)|Hydrochlorothiazide(DB00999)|Hydroflumethiazide(DB00774)|Miconazole(DB01110)|Procaine(DB00721)	CACGTTACCACGCACACGGCC	0.488																																						dbGAP											0													181.0	146.0	156.0					10																	78761245		692	1591	2283	-	-	-	SO:0001583	missense	0			U11717	CCDS7352.1, CCDS60569.1, CCDS60571.1, CCDS60572.1, CCDS73156.1	10q22	2012-07-05			ENSG00000156113	ENSG00000156113		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6284	protein-coding gene	gene with protein product	"""BK channel alpha subunit"""	600150		SLO		7987297, 16382103	Standard	NM_002247		Approved	KCa1.1, mSLO1	uc001jxn.3	Q12791	OTTHUMG00000018543	ENST00000286628.8:c.2186G>A	10.37:g.78761245C>T	ENSP00000286628:p.Arg729His	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WA96|Q12886|Q12917|Q12921|Q12960|Q13150|Q5JQ23|Q5SQR9|Q96LG8|Q9UBB0|Q9UCX0|Q9UQK6	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_RCK_N,prints_K_chnl_Ca-activ_BK_asu,prints_K_chnl	p.R733H	ENST00000286628.8	37	c.2198		10	.	.	.	.	.	.	.	.	.	.	C	12.27	1.888262	0.33348	.	.	ENSG00000156113	ENST00000372437;ENST00000457953;ENST00000404771;ENST00000286628;ENST00000406533	D;D;D	0.83591	-1.73;-1.74;-1.74	5.93	4.07	0.47477	.	.	.	.	.	T	0.65344	0.2682	N	0.08118	0	0.80722	D	1	B	0.13145	0.007	B	0.04013	0.001	T	0.61302	-0.7090	9	0.38643	T	0.18	-7.3127	9.1455	0.36930	0.0:0.8165:0.0:0.1835	.	729	Q12791	KCMA1_HUMAN	H	664;703;666;703;733	ENSP00000361514:R664H;ENSP00000396608:R703H;ENSP00000385552:R733H	ENSP00000286628:R703H	R	-	2	0	KCNMA1	78431251	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.706000	0.47135	2.826000	0.97356	0.655000	0.94253	CGT	KCNMA1	-	NULL	ENSG00000156113		0.488	KCNMA1-009	KNOWN	basic|appris_candidate_longest	protein_coding	KCNMA1	HGNC	protein_coding	OTTHUMT00000048885.3	34	0.00	0	C	NM_002247		78761245	78761245	-1	no_errors	ENST00000406533	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	T
KCTD13	253980	genome.wustl.edu	37	16	29937238	29937238	+	Silent	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr16:29937238G>A	ENST00000568000.1	-	1	1118	c.117C>T	c.(115-117)aaC>aaT	p.N39N	KCTD13_ENST00000561540.1_Silent_p.N39N|CTD-2574D22.2_ENST00000450909.3_RNA|KCTD13_ENST00000568721.1_5'UTR	NM_178863.3	NP_849194.1	Q8WZ19	BACD1_HUMAN	potassium channel tetramerization domain containing 13	39					cell migration (GO:0016477)|DNA replication (GO:0006260)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of DNA replication (GO:0045740)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein homooligomerization (GO:0051260)|protein ubiquitination (GO:0016567)|stress fiber assembly (GO:0043149)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)	GTP-Rho binding (GO:0017049)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(2)	7						CGTATTTGCTGTTCGGGGTCA	0.692																																						dbGAP											0													69.0	49.0	56.0					16																	29937238		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF289573	CCDS10661.1	16p11.2	2013-06-20	2013-06-20		ENSG00000174943	ENSG00000174943			22234	protein-coding gene	gene with protein product	"""polymerase delta-interacting protein 1"", ""TNFAIP1-like"""	608947	"""potassium channel tetramerisation domain containing 13"""			11593007	Standard	NM_178863		Approved	PDIP1, FKSG86, POLDIP1	uc002duv.4	Q8WZ19	OTTHUMG00000132120	ENST00000568000.1:c.117C>T	16.37:g.29937238G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0R5|Q96P93|Q96SA1	Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.N39	ENST00000568000.1	37	c.117	CCDS10661.1	16																																																																																			KCTD13	-	NULL	ENSG00000174943		0.692	KCTD13-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	KCTD13	HGNC	protein_coding	OTTHUMT00000255162.2	51	0.00	0	G	NM_178863		29937238	29937238	-1	no_errors	ENST00000308768	ensembl	human	known	69_37n	silent	36	10.00	4	SNP	0.997	A
KIF4A	24137	genome.wustl.edu	37	X	69596001	69596001	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chrX:69596001G>A	ENST00000374403.3	+	18	2057	c.1975G>A	c.(1975-1977)Gag>Aag	p.E659K	KIF4A_ENST00000374388.3_Missense_Mutation_p.E659K	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	659					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AGAAGATGCTGAGAAGTTTAG	0.343																																						dbGAP											0													77.0	72.0	73.0					X																	69596001		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1975G>A	X.37:g.69596001G>A	ENSP00000363524:p.Glu659Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E659K	ENST00000374403.3	37	c.1975	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	28.3	4.904305	0.92035	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.18960	2.18;2.18	4.79	4.79	0.61399	.	0.000000	0.56097	D	0.000028	T	0.49541	0.1563	M	0.79926	2.475	0.80722	D	1	D;P	0.89917	1.0;0.926	D;P	0.87578	0.998;0.835	T	0.55636	-0.8110	10	0.72032	D	0.01	.	16.1063	0.81225	0.0:0.0:1.0:0.0	.	659;659	O95239;O95239-2	KIF4A_HUMAN;.	K	659	ENSP00000363509:E659K;ENSP00000363524:E659K	ENSP00000363509:E659K	E	+	1	0	KIF4A	69512726	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.603000	0.90871	2.347000	0.79759	0.594000	0.82650	GAG	KIF4A	-	NULL	ENSG00000090889		0.343	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	37	0.00	0	G	NM_012310		69596001	69596001	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	32	15.38	6	SNP	1.000	A
Unknown	0	genome.wustl.edu	37	GL000209.1	95627	95627	+	IGR	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chrGL000209.1:95627C>T								None (None upstream) : None (None downstream)																							AAGCCAAGATCATTGTCTCCT	0.498																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															GL000209.1.37:g.95627C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.S338L		37	c.1013		GL000209.1																																																																																			KIR2DL2	-	NULL	ENSG00000215764	0	0.498					KIR2DL2	HGNC			40	0.00	0	C			95627	95627	+1	no_errors	ENST00000391731	ensembl	human	known	69_37n	missense	9	64.00	16	SNP	NULL	T
LEPR	3953	genome.wustl.edu	37	1	66081710	66081710	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:66081710C>T	ENST00000349533.6	+	15	2200	c.2015C>T	c.(2014-2016)tCa>tTa	p.S672L	LEPR_ENST00000371060.3_Missense_Mutation_p.S672L|LEPR_ENST00000344610.8_Missense_Mutation_p.S672L|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371059.3_Missense_Mutation_p.S672L|LEPR_ENST00000371058.1_Missense_Mutation_p.S672L	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AAAAATGACTCATTGTGCAGT	0.383																																						dbGAP											0													90.0	85.0	86.0					1																	66081710		2203	4300	6503	-	-	-	SO:0001583	missense	0			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2015C>T	1.37:g.66081710C>T	ENSP00000330393:p.Ser672Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHL5	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S672L	ENST00000349533.6	37	c.2015	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.979980	0.74360	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54	5.37	5.37	0.77165	Fibronectin, type III (2);	0.283555	0.35096	N	0.003445	T	0.70307	0.3209	M	0.78637	2.42	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.73600	-0.3931	10	0.66056	D	0.02	-14.6632	19.104	0.93285	0.0:1.0:0.0:0.0	.	672;672;672	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	L	672	ENSP00000340884:S672L;ENSP00000330393:S672L;ENSP00000360099:S672L;ENSP00000360098:S672L;ENSP00000360097:S672L	ENSP00000340884:S672L	S	+	2	0	LEPR	65854298	0.981000	0.34729	0.980000	0.43619	0.590000	0.36582	3.778000	0.55371	2.528000	0.85240	0.655000	0.94253	TCA	LEPR	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000116678		0.383	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	40	0.00	0	C	NM_002303		66081710	66081710	+1	no_errors	ENST00000349533	ensembl	human	known	69_37n	missense	10	54.55	12	SNP	0.995	T
MARC1	64757	genome.wustl.edu	37	1	220960522	220960522	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:220960522G>A	ENST00000366910.5	+	1	422	c.236G>A	c.(235-237)tGc>tAc	p.C79Y		NM_022746.3	NP_073583.3	Q5VT66	MARC1_HUMAN	mitochondrial amidoxime reducing component 1	79					detoxification of nitrogen compound (GO:0051410)|nitrate metabolic process (GO:0042126)|oxidation-reduction process (GO:0055114)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	molybdenum ion binding (GO:0030151)|molybdopterin cofactor binding (GO:0043546)|nitrate reductase activity (GO:0008940)|pyridoxal phosphate binding (GO:0030170)										GAGGCGGAGTGCACGGCCATG	0.721																																						dbGAP											0													14.0	13.0	13.0					1																	220960522		2155	4243	6398	-	-	-	SO:0001583	missense	0			AK026043	CCDS1526.1	1q41	2011-11-02	2011-11-02	2011-11-02	ENSG00000186205	ENSG00000186205			26189	protein-coding gene	gene with protein product		614126	"""MOCO sulphurase C-terminal domain containing 1"""	MOSC1		11886751	Standard	NM_022746		Approved	FLJ22390	uc001hms.3	Q5VT66	OTTHUMG00000037353	ENST00000366910.5:c.236G>A	1.37:g.220960522G>A	ENSP00000355877:p.Cys79Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K447|B2D078|Q5VVS9|Q5VVT0|Q5VVT1|Q8N9P5|Q96FN8|Q9H6C7	Missense_Mutation	SNP	pfam_MOSC_N,pfam_MoCF_Sase_C,superfamily_Pyrv_Knase-like_insert_dom	p.C79Y	ENST00000366910.5	37	c.236	CCDS1526.1	1	.	.	.	.	.	.	.	.	.	.	G	14.76	2.630641	0.46944	.	.	ENSG00000186205	ENST00000366910	T	0.21361	2.01	3.99	3.04	0.35103	MOSC, N-terminal beta barrel (1);Pyruvate kinase-like, insert domain (1);	0.500026	0.17781	N	0.162221	T	0.46171	0.1379	M	0.80847	2.515	0.50467	D	0.99987	D;D	0.89917	1.0;0.998	D;D	0.75484	0.986;0.984	T	0.43491	-0.9388	10	0.87932	D	0	-19.4015	10.9755	0.47463	0.0:0.0:0.5917:0.4082	.	79;79	Q5VT66-2;Q5VT66	.;MOSC1_HUMAN	Y	79	ENSP00000355877:C79Y	ENSP00000355877:C79Y	C	+	2	0	MOSC1	219027145	1.000000	0.71417	0.980000	0.43619	0.405000	0.30901	3.320000	0.51991	0.588000	0.29660	0.313000	0.20887	TGC	MARC1	-	pfam_MOSC_N,superfamily_Pyrv_Knase-like_insert_dom	ENSG00000186205		0.721	MARC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARC1	HGNC	protein_coding	OTTHUMT00000090904.1	16	0.00	0	G	NM_022746		220960522	220960522	+1	no_errors	ENST00000366910	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.991	A
MIS18BP1	55320	genome.wustl.edu	37	14	45673353	45673353	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr14:45673353C>T	ENST00000310806.4	-	17	3816	c.3358G>A	c.(3358-3360)Gaa>Aaa	p.E1120K		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	1120					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						TCTTTCTCTTCTTCATCTAAA	0.289																																						dbGAP											0													31.0	34.0	33.0					14																	45673353		2199	4277	6476	-	-	-	SO:0001583	missense	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.3358G>A	14.37:g.45673353C>T	ENSP00000309790:p.Glu1120Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Missense_Mutation	SNP	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E1120K	ENST00000310806.4	37	c.3358	CCDS9684.1	14	.	.	.	.	.	.	.	.	.	.	C	31	5.081870	0.94050	.	.	ENSG00000129534	ENST00000310806	T	0.28895	1.59	5.66	5.66	0.87406	.	0.145914	0.64402	N	0.000011	T	0.57858	0.2082	M	0.73598	2.24	0.48762	D	0.999708	D	0.67145	0.996	D	0.72338	0.977	T	0.60316	-0.7287	10	0.87932	D	0	-29.7388	18.3146	0.90215	0.0:1.0:0.0:0.0	.	1120	Q6P0N0	M18BP_HUMAN	K	1120	ENSP00000309790:E1120K	ENSP00000309790:E1120K	E	-	1	0	MIS18BP1	44743103	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.505000	0.60421	2.671000	0.90904	0.555000	0.69702	GAA	MIS18BP1	-	NULL	ENSG00000129534		0.289	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	28	0.00	0	C			45673353	45673353	-1	no_errors	ENST00000310806	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	1.000	T
MRGPRX1	259249	genome.wustl.edu	37	11	18955912	18955912	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr11:18955912C>T	ENST00000302797.3	-	1	644	c.420G>A	c.(418-420)gcG>gcA	p.A140A	MRGPRX1_ENST00000526914.1_5'UTR|RP11-583F24.8_ENST00000528646.1_RNA	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	140					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						CACACACCACCGCTGACAGGT	0.622																																						dbGAP											0													91.0	79.0	83.0					11																	18955912		2194	4285	6479	-	-	-	SO:0001819	synonymous_variant	0				CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.420G>A	11.37:g.18955912C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4V9L2|Q8TDD8|Q8TDD9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.A140	ENST00000302797.3	37	c.420	CCDS7846.1	11																																																																																			MRGPRX1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000170255		0.622	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX1	HGNC	protein_coding	OTTHUMT00000369913.1	63	0.00	0	C	NM_147199		18955912	18955912	-1	no_errors	ENST00000302797	ensembl	human	known	69_37n	silent	51	25.00	17	SNP	0.000	T
MRPL11	65003	genome.wustl.edu	37	11	66204715	66204715	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr11:66204715C>T	ENST00000310999.7	-	4	426	c.333G>A	c.(331-333)ctG>ctA	p.L111L	MRPL11_ENST00000430466.2_Silent_p.L85L|MRPL11_ENST00000329819.4_Silent_p.L111L|MRPL11_ENST00000524576.1_5'UTR	NM_016050.3	NP_057134.1	Q9Y3B7	RM11_HUMAN	mitochondrial ribosomal protein L11	111					translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|prostate(1)	7						TCAAGGTCACCAGGCCTGCCA	0.552																																						dbGAP											0													88.0	82.0	84.0					11																	66204715		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			AB051338	CCDS8139.1, CCDS8140.1, CCDS44655.1	11q13.2	2012-11-14			ENSG00000174547	ENSG00000174547		"""Mitochondrial ribosomal proteins / large subunits"""	14042	protein-coding gene	gene with protein product		611826					Standard	XR_247672		Approved		uc001ohz.4	Q9Y3B7	OTTHUMG00000167097	ENST00000310999.7:c.333G>A	11.37:g.66204715C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLT0|A8K219|Q32P46|Q96Q73	Silent	SNP	pfam_Ribosomal_L11_N,pfam_Ribosomal_L11_C,superfamily_Ribosomal_L11_N,superfamily_Ribosomal_L11_C,smart_Ribosomal_L11,tigrfam_Ribosomal_L11_bac-typ	p.L111	ENST00000310999.7	37	c.333	CCDS8139.1	11																																																																																			MRPL11	-	pfam_Ribosomal_L11_C,superfamily_Ribosomal_L11_C,smart_Ribosomal_L11,tigrfam_Ribosomal_L11_bac-typ	ENSG00000174547		0.552	MRPL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL11	HGNC	protein_coding	OTTHUMT00000393098.2	81	0.00	0	C	NM_016050		66204715	66204715	-1	no_errors	ENST00000310999	ensembl	human	known	69_37n	silent	54	10.00	6	SNP	1.000	T
NCKAP1L	3071	genome.wustl.edu	37	12	54932707	54932707	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:54932707G>T	ENST00000293373.6	+	30	3302	c.3223G>T	c.(3223-3225)Gac>Tac	p.D1075Y	NCKAP1L_ENST00000545638.2_Missense_Mutation_p.D1025Y	NM_005337.4	NP_005328.2	P55160	NCKPL_HUMAN	NCK-associated protein 1-like	1075					actin polymerization-dependent cell motility (GO:0070358)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|chemotaxis (GO:0006935)|cortical actin cytoskeleton organization (GO:0030866)|erythrocyte development (GO:0048821)|maintenance of cell polarity (GO:0030011)|myeloid cell homeostasis (GO:0002262)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of myosin-light-chain-phosphatase activity (GO:0035509)|neutrophil chemotaxis (GO:0030593)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of CD8-positive, alpha-beta T cell differentiation (GO:0043378)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of gamma-delta T cell differentiation (GO:0045588)|positive regulation of lymphocyte differentiation (GO:0045621)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phagocytosis, engulfment (GO:0060100)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of T cell proliferation (GO:0042102)|protein complex assembly (GO:0006461)|response to drug (GO:0042493)|T cell homeostasis (GO:0043029)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|SCAR complex (GO:0031209)	protein complex binding (GO:0032403)|protein kinase activator activity (GO:0030295)|Rac GTPase activator activity (GO:0030675)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(37)|ovary(3)|prostate(3)|skin(3)|stomach(2)	80						CCAGGAGACTGACAAGCTTAA	0.453																																						dbGAP											0													97.0	87.0	90.0					12																	54932707		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI924363	CCDS31813.1, CCDS53799.1	12q13.1	2005-10-11	2005-10-11	2005-10-11		ENSG00000123338			4862	protein-coding gene	gene with protein product		141180	"""hematopoietic protein 1"""	HEM1		1932118	Standard	NM_005337		Approved		uc001sgc.4	P55160	OTTHUMG00000169843	ENST00000293373.6:c.3223G>T	12.37:g.54932707G>T	ENSP00000293373:p.Asp1075Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUT5|Q52LW0	Missense_Mutation	SNP	pfam_Nck-associated_protein-1,superfamily_Nucl_hormone_rcpt_ligand-bd	p.D1075Y	ENST00000293373.6	37	c.3223	CCDS31813.1	12	.	.	.	.	.	.	.	.	.	.	G	21.0	4.080871	0.76528	.	.	ENSG00000123338	ENST00000293373;ENST00000545638	T;T	0.37411	1.2;1.2	4.13	4.13	0.48395	.	0.074180	0.64402	D	0.000019	T	0.55433	0.1920	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.70935	0.971	T	0.60188	-0.7312	10	0.87932	D	0	-20.986	14.2786	0.66196	0.0:0.0:1.0:0.0	.	1075	P55160	NCKPL_HUMAN	Y	1075;1025	ENSP00000293373:D1075Y;ENSP00000445596:D1025Y	ENSP00000293373:D1075Y	D	+	1	0	NCKAP1L	53218974	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.733000	0.91539	2.323000	0.78572	0.655000	0.94253	GAC	NCKAP1L	-	pfam_Nck-associated_protein-1	ENSG00000123338		0.453	NCKAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCKAP1L	HGNC	protein_coding	OTTHUMT00000406195.1	47	0.00	0	G	NM_005337		54932707	54932707	+1	no_errors	ENST00000293373	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.999	T
NCOR1	9611	genome.wustl.edu	37	17	16062148	16062148	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr17:16062148C>T	ENST00000268712.3	-	6	915	c.658G>A	c.(658-660)Gag>Aag	p.E220K	NCOR1_ENST00000395851.1_Missense_Mutation_p.E220K|NCOR1_ENST00000395848.1_Missense_Mutation_p.E111K	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	220	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		ACGGGCTTCTCAGGCTCAGGA	0.488																																						dbGAP											0													87.0	77.0	80.0					17																	16062148		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.658G>A	17.37:g.16062148C>T	ENSP00000268712:p.Glu220Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.E220K	ENST00000268712.3	37	c.658	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704610	0.68615	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	T;T;T;T;T	0.46063	0.88;0.88;0.88;0.88;0.88	5.55	5.55	0.83447	.	0.000000	0.85682	D	0.000000	T	0.57902	0.2085	L	0.40543	1.245	0.80722	D	1	D;D;D;P;D;D	0.71674	0.97;0.97;0.97;0.757;0.978;0.998	P;P;P;B;P;D	0.78314	0.77;0.77;0.77;0.324;0.867;0.991	T	0.57808	-0.7747	10	0.59425	D	0.04	-12.7619	18.4883	0.90838	0.0:1.0:0.0:0.0	.	220;220;220;111;220;220	E7EU93;E7EV02;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;NCOR1_HUMAN;.	K	220;220;111;220;111;220;220	ENSP00000268712:E220K;ENSP00000379192:E220K;ENSP00000379189:E111K;ENSP00000407998:E220K;ENSP00000387727:E220K	ENSP00000268712:E220K	E	-	1	0	NCOR1	16002873	1.000000	0.71417	0.968000	0.41197	0.996000	0.88848	7.757000	0.85209	2.627000	0.88993	0.655000	0.94253	GAG	NCOR1	-	NULL	ENSG00000141027		0.488	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	22	0.00	0	C	NM_006311		16062148	16062148	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	T
NF1	4763	genome.wustl.edu	37	17	29684041	29684041	+	Nonsense_Mutation	SNP	C	C	G			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr17:29684041C>G	ENST00000358273.4	+	53	8185	c.7802C>G	c.(7801-7803)tCa>tGa	p.S2601*	NF1_ENST00000417592.2_3'UTR|NF1_ENST00000356175.3_Nonsense_Mutation_p.S2580*|NF1_ENST00000444181.2_Nonsense_Mutation_p.S394*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	2601					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(3)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		GTGTCTGAATCAAATGTTCTC	0.433			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																												dbGAP	yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	11	Whole gene deletion(8)|Unknown(3)	soft_tissue(7)|autonomic_ganglia(2)|lung(1)|central_nervous_system(1)	GRCh37	CM073227	NF1	M							196.0	185.0	189.0					17																	29684041		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.7802C>G	17.37:g.29684041C>G	ENSP00000351015:p.Ser2601*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.S2601*	ENST00000358273.4	37	c.7802	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.745951	0.96882	.	.	ENSG00000196712	ENST00000358273;ENST00000356175;ENST00000456735;ENST00000444181	.	.	.	5.87	4.89	0.63831	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	17.1873	0.86869	0.0:0.8738:0.1262:0.0	.	.	.	.	X	2601;2580;2246;394	.	ENSP00000348498:S2580X	S	+	2	0	NF1	26708167	1.000000	0.71417	0.991000	0.47740	0.995000	0.86356	5.338000	0.65947	1.587000	0.49959	0.655000	0.94253	TCA	NF1	-	superfamily_ARM-type_fold	ENSG00000196712		0.433	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	19	0.00	0	C	NM_000267		29684041	29684041	+1	no_errors	ENST00000358273	ensembl	human	known	69_37n	nonsense	8	68.00	17	SNP	1.000	G
NIPBL	25836	genome.wustl.edu	37	5	37049264	37049264	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr5:37049264C>T	ENST00000282516.8	+	40	7314	c.6815C>T	c.(6814-6816)tCa>tTa	p.S2272L	NIPBL_ENST00000448238.2_Missense_Mutation_p.S2272L	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	2272					brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			GATGTTTCCTCAGGGATGAGT	0.403																																						dbGAP											0													188.0	180.0	182.0					5																	37049264		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.6815C>T	5.37:g.37049264C>T	ENSP00000282516:p.Ser2272Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S2272L	ENST00000282516.8	37	c.6815	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	C	27.0	4.786958	0.90367	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.94723	-3.49;-3.5	5.55	5.55	0.83447	Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	D	0.97198	0.9084	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.97551	1.0092	10	0.87932	D	0	-7.7354	19.5056	0.95114	0.0:1.0:0.0:0.0	.	2272;2272	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	L	2272	ENSP00000282516:S2272L;ENSP00000406266:S2272L	ENSP00000282516:S2272L	S	+	2	0	NIPBL	37085021	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.611000	0.88343	0.585000	0.79938	TCA	NIPBL	-	superfamily_ARM-type_fold	ENSG00000164190		0.403	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	76	0.00	0	C	NM_015384		37049264	37049264	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	missense	38	29.63	16	SNP	1.000	T
OTOG	340990	genome.wustl.edu	37	11	17632432	17632432	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr11:17632432C>A	ENST00000399391.2	+	35	5621	c.5621C>A	c.(5620-5622)cCc>cAc	p.P1874H	OTOG_ENST00000342528.2_Missense_Mutation_p.P880H|OTOG_ENST00000399397.1_Missense_Mutation_p.P1801H	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	1874	Pro-rich.				adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						GCGCACCCACCCACTCACATA	0.632																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.5621C>A	11.37:g.17632432C>A	ENSP00000382323:p.Pro1874His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.P1874H	ENST00000399391.2	37	c.5621	CCDS59225.1	11	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644346	0.47258	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	T;T;T	0.16196	2.36;2.48;2.81	5.59	1.61	0.23674	.	0.756208	0.12361	N	0.475621	T	0.16685	0.0401	M	0.68317	2.08	0.09310	N	1	B	0.17667	0.023	B	0.16289	0.015	T	0.28554	-1.0040	10	0.51188	T	0.08	.	3.5591	0.07875	0.1767:0.5504:0.0:0.2729	.	880	Q6ZRI0-2	.	H	1874;1801;880	ENSP00000382323:P1874H;ENSP00000382329:P1801H;ENSP00000341666:P880H	ENSP00000341666:P880H	P	+	2	0	OTOG	17589008	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.249000	0.18216	0.305000	0.22832	0.655000	0.94253	CCC	OTOG	-	NULL	ENSG00000188162		0.632	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		27	0.00	0	C			17632432	17632432	+1	no_errors	ENST00000399391	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	0.000	A
NTM	50863	genome.wustl.edu	37	11	132205064	132205064	+	3'UTR	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr11:132205064G>A	ENST00000374786.1	+	0	1538				NTM_ENST00000474900.1_3'UTR|NTM_ENST00000374791.3_3'UTR|NTM_ENST00000425719.2_3'UTR	NM_001144058.1|NM_016522.2	NP_001137530.1|NP_057606.1	Q9P121	NTRI_HUMAN	neurotrimin						cell adhesion (GO:0007155)|neuron recognition (GO:0008038)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(9)|lung(30)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	56						TCCCCACCCGGGAAAGGCTGC	0.537																																						dbGAP											0													43.0	42.0	43.0					11																	132205064		2201	4297	6498	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF126426	CCDS8491.1, CCDS41733.1, CCDS44777.1, CCDS44778.1	11q25	2013-01-11			ENSG00000182667	ENSG00000182667		"""Immunoglobulin superfamily / I-set domain containing"""	17941	protein-coding gene	gene with protein product	"""neurotrimin"", ""IgLON family member 2"""	607938				7891157	Standard	NM_001048209		Approved	HNT, NTRI, IGLON2	uc001qgq.3	Q9P121	OTTHUMG00000066364	ENST00000374786.1:c.*24G>A	11.37:g.132205064G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0MTT2|Q6UXJ3|Q86VJ9	RNA	SNP	-	NULL	ENST00000374786.1	37	NULL	CCDS8491.1	11																																																																																			NTM	-	-	ENSG00000182667		0.537	NTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTM	HGNC	protein_coding	OTTHUMT00000141937.1	26	0.00	0	G	NM_016522		132205064	132205064	+1	no_errors	ENST00000474900	ensembl	human	known	69_37n	rna	16	38.46	10	SNP	0.752	A
P2RY13	53829	genome.wustl.edu	37	3	151046793	151046793	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr3:151046793C>T	ENST00000325602.5	-	2	70	c.51G>A	c.(49-51)gtG>gtA	p.V17V	MED12L_ENST00000474524.1_Intron|MED12L_ENST00000273432.4_Intron|MED12L_ENST00000491549.1_Intron	NM_176894.2	NP_795713.2	Q9BPV8	P2Y13_HUMAN	purinergic receptor P2Y, G-protein coupled, 13	17					negative regulation of adenylate cyclase activity (GO:0007194)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	14			LUSC - Lung squamous cell carcinoma(72;0.0189)|Lung(72;0.0278)			CTTCCAGTGTCACCTGTTACC	0.393																																						dbGAP											0													75.0	71.0	72.0					3																	151046793		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF295368	CCDS3158.2	3q24	2012-08-08	2004-07-12	2004-07-14	ENSG00000181631	ENSG00000181631		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	4537	protein-coding gene	gene with protein product		606380	"""G protein-coupled receptor 86"""	GPR94, GPR86		11273702, 11574155	Standard	NM_176894		Approved	FKSG77, P2Y13	uc003eyv.2	Q9BPV8	OTTHUMG00000155745	ENST00000325602.5:c.51G>A	3.37:g.151046793C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R827|Q05C50|Q6DKN4|Q8IUT5|Q8TDU7|Q9BY61	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_P2Y13_purnocptor,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_UDPG_rcpt	p.V17	ENST00000325602.5	37	c.51	CCDS3158.2	3																																																																																			P2RY13	-	NULL	ENSG00000181631		0.393	P2RY13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY13	HGNC	protein_coding	OTTHUMT00000341468.1	30	0.00	0	C	NM_023914		151046793	151046793	-1	no_errors	ENST00000325602	ensembl	human	known	69_37n	silent	17	32.00	8	SNP	0.000	T
PDE3A	5139	genome.wustl.edu	37	12	20806922	20806922	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:20806922C>T	ENST00000359062.3	+	15	3007	c.2967C>T	c.(2965-2967)ttC>ttT	p.F989F	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	989	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	TAAGCCCCTTCATGGATCGTT	0.458																																						dbGAP											0													79.0	75.0	76.0					12																	20806922		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2967C>T	12.37:g.20806922C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60865|Q13348|Q17RD1	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.F989	ENST00000359062.3	37	c.2967	CCDS31754.1	12																																																																																			PDE3A	-	pfam_PDEase_catalytic_dom	ENSG00000172572		0.458	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	27	0.00	0	C			20806922	20806922	+1	no_errors	ENST00000359062	ensembl	human	known	69_37n	silent	19	24.00	6	SNP	1.000	T
PHF12	57649	genome.wustl.edu	37	17	27238351	27238351	+	Intron	SNP	A	A	C			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr17:27238351A>C	ENST00000332830.4	-	10	2900				PHF12_ENST00000582655.1_Intron|PHF12_ENST00000577226.1_Intron	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			TTCGGACCCAAGGTGATGTTC	0.547																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.2090-96T>G	17.37:g.27238351A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000332830.4	37	NULL	CCDS32598.1	17																																																																																			PHF12	-	-	ENSG00000109118		0.547	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF12	HGNC	protein_coding	OTTHUMT00000255941.1	42	0.00	0	A	NM_020889		27238351	27238351	-1	no_errors	ENST00000579563	ensembl	human	known	69_37n	rna	16	40.74	11	SNP	1.000	C
PNPLA2	57104	genome.wustl.edu	37	11	823557	823557	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr11:823557C>T	ENST00000336615.4	+	6	929	c.727C>T	c.(727-729)Cgg>Tgg	p.R243W	AP006621.8_ENST00000528982.1_RNA|AP006621.8_ENST00000532946.1_RNA	NM_020376.3	NP_065109.1	Q96AD5	PLPL2_HUMAN	patatin-like phospholipase domain containing 2	243					acylglycerol acyl-chain remodeling (GO:0036155)|glycerophospholipid biosynthetic process (GO:0046474)|lipid particle organization (GO:0034389)|lipid storage (GO:0019915)|negative regulation of sequestering of triglyceride (GO:0010891)|phospholipid metabolic process (GO:0006644)|positive regulation of triglyceride catabolic process (GO:0010898)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)|plasma membrane (GO:0005886)	triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|lung(4)|prostate(1)|urinary_tract(1)	9		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.63e-25)|Epithelial(43;1.28e-24)|OV - Ovarian serous cystadenocarcinoma(40;7.09e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCAGGGATACCGGGATGGCCT	0.701																																						dbGAP											0													37.0	33.0	34.0					11																	823557		2197	4295	6492	-	-	-	SO:0001583	missense	0			AJ278475	CCDS7718.1	11p15.5	2014-03-14			ENSG00000177666	ENSG00000177666	3.1.1.3	"""Patatin-like phospholipase domain containing"""	30802	protein-coding gene	gene with protein product		609059				8619474, 16799181, 19029121	Standard	NM_020376		Approved	desnutrin, TTS-2.2, ATGL, FP17548, iPLA2zeta	uc001lrt.3	Q96AD5	OTTHUMG00000133309	ENST00000336615.4:c.727C>T	11.37:g.823557C>T	ENSP00000337701:p.Arg243Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60643|Q5EFF5|Q6XYE5|Q96ET6|Q9NQ61|Q9NQ62	Missense_Mutation	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.R243W	ENST00000336615.4	37	c.727	CCDS7718.1	11	.	.	.	.	.	.	.	.	.	.	C	17.53	3.412602	0.62511	.	.	ENSG00000177666	ENST00000336615	T	0.63580	-0.05	3.79	-7.58	0.01313	Acyl transferase/acyl hydrolase/lysophospholipase (1);	0.113345	0.56097	N	0.000035	T	0.69070	0.3070	M	0.74881	2.28	0.37896	D	0.930885	D	0.76494	0.999	P	0.57468	0.821	T	0.80589	-0.1315	10	0.66056	D	0.02	-26.1964	16.4373	0.83880	0.2246:0.6925:0.0:0.0828	.	243	Q96AD5	PLPL2_HUMAN	W	243	ENSP00000337701:R243W	ENSP00000337701:R243W	R	+	1	2	PNPLA2	813557	0.409000	0.25368	0.325000	0.25375	0.738000	0.42128	-0.157000	0.10085	-2.450000	0.00543	-0.500000	0.04577	CGG	PNPLA2	-	superfamily_Acyl_Trfase/lysoPLipase	ENSG00000177666		0.701	PNPLA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPLA2	HGNC	protein_coding	OTTHUMT00000257106.1	82	0.00	0	C	NM_020376		823557	823557	+1	no_errors	ENST00000336615	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	0.815	T
PROSER1	80209	genome.wustl.edu	37	13	39602423	39602423	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr13:39602423C>T	ENST00000352251.3	-	5	1143	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	PROSER1_ENST00000350125.3_Missense_Mutation_p.E82K	NM_025138.4	NP_079414.3	Q86XN7	PRSR1_HUMAN	proline and serine rich 1	104																	AATAAATCTTCAATAGGACGA	0.348																																						dbGAP											0													82.0	79.0	80.0					13																	39602423		1852	4095	5947	-	-	-	SO:0001583	missense	0			AK022723	CCDS9368.2	13q13.2	2011-08-09	2011-08-09	2011-08-09	ENSG00000120685	ENSG00000120685			20291	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 23"""	C13orf23			Standard	NM_025138		Approved	bA50D16.2, FLJ12661	uc001uwy.4	Q86XN7	OTTHUMG00000016764	ENST00000352251.3:c.310G>A	13.37:g.39602423C>T	ENSP00000332034:p.Glu104Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ97|Q6P2S2|Q7Z3X5|Q8N3D2|Q8N3P1|Q9H9M1	Missense_Mutation	SNP	NULL	p.E82K	ENST00000352251.3	37	c.244	CCDS9368.2	13	.	.	.	.	.	.	.	.	.	.	C	34	5.409025	0.96072	.	.	ENSG00000120685	ENST00000352251;ENST00000350125;ENST00000436678;ENST00000418503	T;T	0.36340	1.26;1.3	5.74	5.74	0.90152	.	.	.	.	.	T	0.46946	0.1419	N	0.24115	0.695	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.85130	0.997;0.991	T	0.29882	-0.9997	8	.	.	.	-17.6618	17.4256	0.87525	0.0:1.0:0.0:0.0	.	82;104	A6NJ97;Q86XN7	.;PRSR1_HUMAN	K	104;82;83;82	ENSP00000332034:E104K;ENSP00000339123:E82K	.	E	-	1	0	PROSER1	38500423	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.851000	0.75425	2.716000	0.92895	0.591000	0.81541	GAA	PROSER1	-	NULL	ENSG00000120685		0.348	PROSER1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSER1	HGNC	protein_coding	OTTHUMT00000044607.5	40	0.00	0	C	NM_025138		39602423	39602423	-1	no_errors	ENST00000350125	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	1.000	T
PSD2	84249	genome.wustl.edu	37	5	139193879	139193879	+	Missense_Mutation	SNP	C	C	T	rs550940684		TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr5:139193879C>T	ENST00000274710.3	+	4	1151	c.946C>T	c.(946-948)Cgg>Tgg	p.R316W		NM_032289.2	NP_115665.1	Q9BQI7	PSD2_HUMAN	pleckstrin and Sec7 domain containing 2	316	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				neuron differentiation (GO:0030182)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|phospholipid binding (GO:0005543)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(10)|liver(2)|lung(15)|ovary(1)|prostate(2)	38			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGCTCATCGGCTGGCACG	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17270	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													54.0	48.0	50.0					5																	139193879		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136559	CCDS4216.1	5q31.3	2013-01-10			ENSG00000146005	ENSG00000146005		"""Pleckstrin homology (PH) domain containing"""	19092	protein-coding gene	gene with protein product							Standard	NM_032289		Approved	DKFZp761B0514	uc003leu.1	Q9BQI7	OTTHUMG00000129240	ENST00000274710.3:c.946C>T	5.37:g.139193879C>T	ENSP00000274710:p.Arg316Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQD3|Q8N3J8	Missense_Mutation	SNP	pfam_Sec7,pfam_Pleckstrin_homology,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_Pleckstrin_homology,pfscan_Sec7	p.R316W	ENST00000274710.3	37	c.946	CCDS4216.1	5	.	.	.	.	.	.	.	.	.	.	C	16.51	3.144232	0.57044	.	.	ENSG00000146005	ENST00000274710	T	0.55930	0.49	4.7	1.31	0.21738	SEC7-like (4);	0.000000	0.85682	D	0.000000	T	0.75838	0.3904	M	0.91920	3.255	0.58432	D	0.999997	D	0.89917	1.0	D	0.79784	0.993	T	0.81671	-0.0827	10	0.87932	D	0	.	14.1832	0.65588	0.4573:0.5427:0.0:0.0	.	316	Q9BQI7	PSD2_HUMAN	W	316	ENSP00000274710:R316W	ENSP00000274710:R316W	R	+	1	2	PSD2	139174063	0.365000	0.25006	0.929000	0.37066	0.616000	0.37450	0.354000	0.20146	0.357000	0.24183	0.563000	0.77884	CGG	PSD2	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7	ENSG00000146005		0.647	PSD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSD2	HGNC	protein_coding	OTTHUMT00000251339.1	66	0.00	0	C	NM_032289		139193879	139193879	+1	no_errors	ENST00000274710	ensembl	human	known	69_37n	missense	52	22.39	15	SNP	0.706	T
RABEP1	9135	genome.wustl.edu	37	17	5253832	5253832	+	Nonsense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr17:5253832C>T	ENST00000546142.2	+	7	1058	c.871C>T	c.(871-873)Cag>Tag	p.Q291*	RABEP1_ENST00000262477.6_Nonsense_Mutation_p.Q291*|RABEP1_ENST00000341923.6_Nonsense_Mutation_p.Q291*|RABEP1_ENST00000408982.2_Nonsense_Mutation_p.Q291*|RABEP1_ENST00000537505.1_Nonsense_Mutation_p.Q248*			Q15276	RABE1_HUMAN	rabaptin, RAB GTPase binding effector protein 1	291					apoptotic process (GO:0006915)|endocytosis (GO:0006897)|membrane fusion (GO:0061025)|protein transport (GO:0015031)	early endosome (GO:0005769)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)|protein homodimerization activity (GO:0042803)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	8						TCTGGAATCTCAGCGTTTACT	0.448																																						dbGAP											0													97.0	94.0	95.0					17																	5253832		1974	4156	6130	-	-	-	SO:0001587	stop_gained	0			AF098638	CCDS42243.1, CCDS45592.1	17p13.2	2008-02-05				ENSG00000029725			17677	protein-coding gene	gene with protein product		603616				8521472	Standard	NM_001291582		Approved	neurocrescin, RAB5EP, RABPT5, rabaptin-5	uc002gbm.4	Q15276		ENST00000546142.2:c.871C>T	17.37:g.5253832C>T	ENSP00000437701:p.Gln291*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAG7|O95369|Q8IVX3	Nonsense_Mutation	SNP	pfam_Rabaptin_coiled-coil,pfam_Rabaptin_Rab5-bd_dom,prints_Rabaptin	p.Q291*	ENST00000546142.2	37	c.871	CCDS45592.1	17	.	.	.	.	.	.	.	.	.	.	C	39	7.503582	0.98325	.	.	ENSG00000029725	ENST00000262477;ENST00000408982;ENST00000539669;ENST00000546142;ENST00000341923;ENST00000537505	.	.	.	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-17.335	19.2026	0.93717	0.0:1.0:0.0:0.0	.	.	.	.	X	291;291;284;291;291;248	.	ENSP00000262477:Q291X	Q	+	1	0	RABEP1	5194556	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.328000	0.79160	2.850000	0.98022	0.650000	0.86243	CAG	RABEP1	-	NULL	ENSG00000029725		0.448	RABEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABEP1	HGNC	protein_coding	OTTHUMT00000439349.1	47	0.00	0	C	NM_004703		5253832	5253832	+1	no_errors	ENST00000262477	ensembl	human	known	69_37n	nonsense	34	27.66	13	SNP	1.000	T
RFC4	5984	genome.wustl.edu	37	3	186510310	186510310	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr3:186510310G>T	ENST00000392481.2	-	7	925	c.644C>A	c.(643-645)gCc>gAc	p.A215D	RFC4_ENST00000296273.2_Missense_Mutation_p.A215D|RFC4_ENST00000433496.1_Missense_Mutation_p.A215D	NM_181573.2	NP_853551.1	P35249	RFC4_HUMAN	replication factor C (activator 1) 4, 37kDa	215					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			breast(3)|kidney(3)|large_intestine(5)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26	all_cancers(143;2.92e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)	GBM - Glioblastoma multiforme(93;0.0739)		TTCCTTCTTGGCAATGTCTAG	0.348																																						dbGAP											0													92.0	101.0	98.0					3																	186510310		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3283.1	3q27	2010-04-21	2002-08-29		ENSG00000163918	ENSG00000163918		"""ATPases / AAA-type"""	9972	protein-coding gene	gene with protein product	"""A1 37 kDa subunit"", ""activator 1 37 kDa subunit"", ""RFC 37 kDa subunit"""	102577	"""replication factor C (activator 1) 4 (37kD)"""			7774928	Standard	NM_181573		Approved	A1, RFC37	uc003fqz.3	P35249	OTTHUMG00000156515	ENST00000392481.2:c.644C>A	3.37:g.186510310G>T	ENSP00000376272:p.Ala215Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM41|D3DNV2|Q6FHX7	Missense_Mutation	SNP	pfam_Rep_factorC_C_dom,pfam_ATPase_AAA_core,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.A215D	ENST00000392481.2	37	c.644	CCDS3283.1	3	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230847	0.58777	.	.	ENSG00000163918	ENST00000433496;ENST00000392481;ENST00000296273	T;T;T	0.49432	0.78;0.78;0.78	5.95	5.07	0.68467	.	0.138647	0.64402	D	0.000003	T	0.54095	0.1837	M	0.88570	2.965	0.39844	D	0.973156	B;B	0.33135	0.177;0.399	B;B	0.35182	0.197;0.197	T	0.63616	-0.6597	10	0.72032	D	0.01	.	9.0312	0.36260	0.0795:0.1473:0.7732:0.0	.	215;215	B4DM41;P35249	.;RFC4_HUMAN	D	215	ENSP00000399769:A215D;ENSP00000376272:A215D;ENSP00000296273:A215D	ENSP00000296273:A215D	A	-	2	0	RFC4	187993004	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	5.914000	0.69964	2.824000	0.97209	0.655000	0.94253	GCC	RFC4	-	NULL	ENSG00000163918		0.348	RFC4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC4	HGNC	protein_coding	OTTHUMT00000344471.1	51	0.00	0	G	NM_002916		186510310	186510310	-1	no_errors	ENST00000296273	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
RSF1	51773	genome.wustl.edu	37	11	77378341	77378341	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr11:77378341C>G	ENST00000308488.6	-	16	4249	c.3947G>C	c.(3946-3948)gGa>gCa	p.G1316A	RSF1_ENST00000360355.2_Missense_Mutation_p.G1285A|RSF1_ENST00000480887.1_Missense_Mutation_p.G1064A			Q96T23	RSF1_HUMAN	remodeling and spacing factor 1	1316					CENP-A containing nucleosome assembly (GO:0034080)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|nucleosome positioning (GO:0016584)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of viral transcription (GO:0050434)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|RSF complex (GO:0031213)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(2)|endometrium(3)|kidney(4)|large_intestine(9)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(14;1.54e-17)|all_epithelial(13;4.06e-20)|Ovarian(111;0.152)		Epithelial(5;3e-50)|all cancers(3;6.37e-47)|BRCA - Breast invasive adenocarcinoma(5;9.82e-31)			ATTTGCATCTCCATGAGCATT	0.547																																						dbGAP											0													140.0	123.0	129.0					11																	77378341		2200	4292	6492	-	-	-	SO:0001583	missense	0			AF380176, AF227948	CCDS8253.1	11q14.1	2013-01-28	2006-05-25	2006-05-25	ENSG00000048649	ENSG00000048649		"""Zinc fingers, PHD-type"""	18118	protein-coding gene	gene with protein product		608522	"""hepatitis B virus x associated protein"""	HBXAP		11788598, 12972596	Standard	NM_016578		Approved	XAP8, RSF-1, p325	uc001oyn.3	Q96T23	OTTHUMG00000150433	ENST00000308488.6:c.3947G>C	11.37:g.77378341C>G	ENSP00000311513:p.Gly1316Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86X86|Q9H3L8|Q9NVZ8|Q9NYU0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G1316A	ENST00000308488.6	37	c.3947	CCDS8253.1	11	.	.	.	.	.	.	.	.	.	.	C	12.87	2.066317	0.36470	.	.	ENSG00000048649	ENST00000308488;ENST00000480887;ENST00000360355	D;D;D	0.85629	-2.0;-2.01;-1.99	5.13	4.15	0.48705	.	0.307287	0.24132	N	0.041252	T	0.66376	0.2783	N	0.08118	0	0.39021	D	0.959752	B	0.34015	0.435	B	0.32677	0.15	T	0.66838	-0.5822	10	0.45353	T	0.12	-11.1457	4.4812	0.11767	0.0:0.7163:0.0:0.2837	.	1316	Q96T23	RSF1_HUMAN	A	1316;1064;1285	ENSP00000311513:G1316A;ENSP00000434509:G1064A;ENSP00000353511:G1285A	ENSP00000311513:G1316A	G	-	2	0	RSF1	77055989	0.788000	0.28762	1.000000	0.80357	0.953000	0.61014	2.696000	0.47052	2.681000	0.91329	0.462000	0.41574	GGA	RSF1	-	NULL	ENSG00000048649		0.547	RSF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RSF1	HGNC	protein_coding	OTTHUMT00000318075.2	83	0.00	0	C	NM_016578		77378341	77378341	-1	no_errors	ENST00000308488	ensembl	human	known	69_37n	missense	49	26.87	18	SNP	0.998	G
SAMSN1	64092	genome.wustl.edu	37	21	15954518	15954518	+	Missense_Mutation	SNP	G	G	C			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr21:15954518G>C	ENST00000285670.2	-	2	374	c.200C>G	c.(199-201)tCt>tGt	p.S67C	SAMSN1-AS1_ENST00000449214.1_RNA	NM_001256370.1	NP_001243299.1	Q9NSI8	SAMN1_HUMAN	SAM domain, SH3 domain and nuclear localization signals 1	0					negative regulation of adaptive immune response (GO:0002820)|negative regulation of B cell activation (GO:0050869)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)	cell projection (GO:0042995)|cytosol (GO:0005829)|nucleus (GO:0005634)	phosphotyrosine binding (GO:0001784)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	24				Epithelial(23;0.000155)|COAD - Colon adenocarcinoma(22;0.00118)|Colorectal(24;0.00961)|Lung(58;0.164)		GCGAATACAAGAGGAGCAGTG	0.468																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF222927	CCDS42906.1, CCDS58786.1, CCDS74774.1	21q11	2013-01-10	2006-12-13		ENSG00000155307	ENSG00000155307		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	10528	protein-coding gene	gene with protein product	"""nuclear localization signals, SAM and SH3 domain containing 1"", ""SAM and SH3 domain containing 2"", ""hematopoietic adapter-containing SH3 and sterile &#945;-motif (SAM) domains 1"", ""Src homology domain 3 (SH3)-containing adapter protein SH3 lymphocyte protein 2"""	607978				11536050, 11594764	Standard	NM_022136		Approved	NASH1, SASH2, SH3D6B, HACS1, SLy2	uc002yjv.1	Q9NSI8	OTTHUMG00000074317	ENST00000285670.2:c.200C>G	21.37:g.15954518G>C	ENSP00000285670:p.Ser67Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWJ3|F8WAA1|Q8NFF7|Q9C041	Missense_Mutation	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.S67C	ENST00000285670.2	37	c.200	CCDS58786.1	21	.	.	.	.	.	.	.	.	.	.	G	9.831	1.188474	0.21954	.	.	ENSG00000155307	ENST00000285670	T	0.44881	0.91	5.52	-6.49	0.01890	.	1.009510	0.07972	N	0.984102	T	0.21387	0.0515	.	.	.	0.09310	N	0.999994	B	0.02656	0.0	B	0.04013	0.001	T	0.18429	-1.0337	9	0.39692	T	0.17	-21.1494	2.0369	0.03542	0.157:0.381:0.2157:0.2464	.	67	F8WAA1	.	C	67	ENSP00000285670:S67C	ENSP00000285670:S67C	S	-	2	0	SAMSN1	14876389	0.000000	0.05858	0.000000	0.03702	0.205000	0.24178	-0.104000	0.10923	-1.355000	0.02186	0.561000	0.74099	TCT	SAMSN1	-	NULL	ENSG00000155307		0.468	SAMSN1-001	NOVEL	basic|CCDS	protein_coding	SAMSN1	HGNC	protein_coding	OTTHUMT00000157913.1	75	0.00	0	G			15954518	15954518	-1	no_errors	ENST00000285670	ensembl	human	novel	69_37n	missense	38	26.92	14	SNP	0.000	C
SLC12A3	6559	genome.wustl.edu	37	16	56921918	56921918	+	Missense_Mutation	SNP	G	G	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr16:56921918G>T	ENST00000563236.1	+	18	2285	c.2260G>T	c.(2260-2262)Gtg>Ttg	p.V754L	SLC12A3_ENST00000262502.5_Missense_Mutation_p.V753L|SLC12A3_ENST00000566786.1_Missense_Mutation_p.V753L|SLC12A3_ENST00000438926.2_Missense_Mutation_p.V754L			P55017	S12A3_HUMAN	solute carrier family 12 (sodium/chloride transporter), member 3	754					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium:chloride symporter activity (GO:0015378)|transporter activity (GO:0005215)			breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(28)|ovary(2)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50					Bendroflumethiazide(DB00436)|Benzthiazide(DB00562)|Chlorothiazide(DB00880)|Diazoxide(DB01119)|Hydrochlorothiazide(DB00999)|Metolazone(DB00524)|Polythiazide(DB01324)|Quinethazone(DB01325)	CCCGGCCACAGTGGAAGACTA	0.572																																						dbGAP											0													48.0	46.0	46.0					16																	56921918		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10770.1, CCDS45491.1, CCDS58464.1	16q13	2013-07-18	2013-07-18		ENSG00000070915	ENSG00000070915		"""Solute carriers"""	10912	protein-coding gene	gene with protein product		600968				8812482	Standard	NM_000339		Approved	NCCT	uc002ekd.4	P55017	OTTHUMG00000133284	ENST00000563236.1:c.2260G>T	16.37:g.56921918G>T	ENSP00000456149:p.Val754Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSJ2|C9JNN9	Missense_Mutation	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_NaCl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.V754L	ENST00000563236.1	37	c.2260	CCDS58464.1	16	.	.	.	.	.	.	.	.	.	.	G	3.887	-0.024835	0.07589	.	.	ENSG00000070915	ENST00000438926;ENST00000262502	.	.	.	4.7	2.54	0.30619	.	0.662256	0.15466	N	0.260882	T	0.14874	0.0359	N	0.04805	-0.155	0.09310	N	0.999995	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.001;0.002	T	0.25537	-1.0129	9	0.07175	T	0.84	.	9.1081	0.36710	0.0822:0.3966:0.5211:0.0	.	753;754;754	P55017-3;P55017;P55017-2	.;S12A3_HUMAN;.	L	753;754	.	ENSP00000262502:V754L	V	+	1	0	SLC12A3	55479419	0.080000	0.21391	0.887000	0.34795	0.697000	0.40408	0.427000	0.21379	1.093000	0.41377	0.563000	0.77884	GTG	SLC12A3	-	tigrfam_Na/K/Cl_cotransptS	ENSG00000070915		0.572	SLC12A3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC12A3	HGNC	protein_coding	OTTHUMT00000432337.1	50	0.00	0	G			56921918	56921918	+1	no_errors	ENST00000438926	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.109	T
SLCO1B7	338821	genome.wustl.edu	37	12	21172248	21172248	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:21172248G>A	ENST00000421593.2	+	2	152	c.152G>A	c.(151-153)gGa>gAa	p.G51E	LST3_ENST00000540229.1_Intron|SLCO1B3_ENST00000553473.1_Intron|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	51						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						AAGTTAATTGGAATTGGTTGT	0.333																																						dbGAP											0													180.0	174.0	176.0					12																	21172248		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.152G>A	12.37:g.21172248G>A	ENSP00000394168:p.Gly51Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q71QF0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.G51E	ENST00000421593.2	37	c.152	CCDS44843.1	12	.	.	.	.	.	.	.	.	.	.	.	13.97	2.394811	0.42512	.	.	ENSG00000205754	ENST00000421593	T	0.60171	0.21	3.31	3.31	0.37934	.	0.168416	0.50627	D	0.000115	T	0.79435	0.4445	M	0.93241	3.395	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.83277	-0.0040	10	0.87932	D	0	.	10.1143	0.42581	0.0:0.4225:0.5775:0.0	.	51	G3V0H7	.	E	51	ENSP00000394168:G51E	ENSP00000394168:G51E	G	+	2	0	SLCO1B7	21063515	0.981000	0.34729	0.991000	0.47740	0.582000	0.36321	1.898000	0.39809	1.661000	0.50771	0.505000	0.49811	GGA	SLCO1B7	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000205754		0.333	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	SLCO1B7	HGNC	protein_coding	OTTHUMT00000402066.1	88	0.00	0	G	NM_001009562		21172248	21172248	+1	no_errors	ENST00000421593	ensembl	human	known	69_37n	missense	63	27.59	24	SNP	0.977	A
SMG1	23049	genome.wustl.edu	37	16	18874988	18874988	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr16:18874988C>A	ENST00000446231.2	-	25	4091	c.3679G>T	c.(3679-3681)Gac>Tac	p.D1227Y	SMG1_ENST00000389467.3_Missense_Mutation_p.D1227Y			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	1227	FAT. {ECO:0000255|PROSITE- ProRule:PRU00534}.|Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TAGTTGAAGTCAGCTTTCAGG	0.373																																						dbGAP											0													138.0	146.0	144.0					16																	18874988		959	2068	3027	-	-	-	SO:0001583	missense	0			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.3679G>T	16.37:g.18874988C>A	ENSP00000402515:p.Asp1227Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.D1227Y	ENST00000446231.2	37	c.3679	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	.	20.8	4.054851	0.75960	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.66280	-0.2;-0.2	4.82	4.82	0.62117	PIK-related kinase (1);Armadillo-type fold (1);	0.109632	0.39475	N	0.001349	T	0.71204	0.3312	L	0.34521	1.04	0.58432	D	0.99999	D	0.76494	0.999	D	0.79784	0.993	T	0.72890	-0.4155	10	0.49607	T	0.09	.	18.3333	0.90277	0.0:1.0:0.0:0.0	.	1227	Q96Q15	SMG1_HUMAN	Y	1227	ENSP00000402515:D1227Y;ENSP00000374118:D1227Y	ENSP00000374118:D1227Y	D	-	1	0	SMG1	18782489	1.000000	0.71417	0.969000	0.41365	0.888000	0.51559	7.732000	0.84908	2.406000	0.81754	0.549000	0.68633	GAC	SMG1	-	superfamily_ARM-type_fold,pfscan_PIK_FAT	ENSG00000157106		0.373	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	130	0.00	0	C	NM_015092		18874988	18874988	-1	no_errors	ENST00000389467	ensembl	human	known	69_37n	missense	61	56.74	80	SNP	1.000	A
SMG7	9887	genome.wustl.edu	37	1	183486940	183486940	+	Missense_Mutation	SNP	T	T	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:183486940T>A	ENST00000347615.2	+	4	416	c.297T>A	c.(295-297)agT>agA	p.S99R	SMG7_ENST00000507469.1_Missense_Mutation_p.S99R|SMG7_ENST00000515829.2_Missense_Mutation_p.S99R|SMG7_ENST00000456731.2_Missense_Mutation_p.S57R|SMG7_ENST00000367537.3_Missense_Mutation_p.S128R|SMG7_ENST00000508461.1_Missense_Mutation_p.S57R	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	99					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						AGGCAGCTAGTGGCTTCTATA	0.413																																						dbGAP											0													170.0	160.0	163.0					1																	183486940		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.297T>A	1.37:g.183486940T>A	ENSP00000340766:p.Ser99Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Missense_Mutation	SNP	pfam_EST1	p.S99R	ENST00000347615.2	37	c.297	CCDS1355.1	1	.	.	.	.	.	.	.	.	.	.	T	18.17	3.565437	0.65651	.	.	ENSG00000116698	ENST00000456731;ENST00000367537;ENST00000508461;ENST00000419169;ENST00000347615;ENST00000507469;ENST00000515829	T;T;T;T;T;T;T	0.17054	2.3;2.3;2.3;2.3;2.3;2.3;2.3	5.43	4.31	0.51392	Telomerase activating protein Est1 (1);	0.041547	0.85682	D	0.000000	T	0.27731	0.0682	L	0.48362	1.52	0.58432	D	0.999995	P;P;P;P;P;P	0.49253	0.921;0.842;0.919;0.901;0.921;0.842	P;P;P;P;P;P	0.57502	0.811;0.808;0.805;0.704;0.822;0.808	T	0.00778	-1.1570	10	0.44086	T	0.13	-8.834	10.4807	0.44691	0.0:0.0772:0.0:0.9228	.	57;128;57;99;99;99	E9PCI0;E9PD50;E9PCE5;Q92540-2;Q92540;E9PEH2	.;.;.;.;SMG7_HUMAN;.	R	57;128;57;57;99;99;99	ENSP00000407629:S57R;ENSP00000356507:S128R;ENSP00000426915:S57R;ENSP00000388390:S57R;ENSP00000340766:S99R;ENSP00000425133:S99R;ENSP00000421358:S99R	ENSP00000340766:S99R	S	+	3	2	SMG7	181753563	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.944000	0.40263	0.898000	0.36418	0.533000	0.62120	AGT	SMG7	-	pfam_EST1	ENSG00000116698		0.413	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	HGNC	protein_coding	OTTHUMT00000085432.1	31	0.00	0	T	NM_014837		183486940	183486940	+1	no_errors	ENST00000507469	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	A
SRC	6714	genome.wustl.edu	37	20	36032817	36032817	+	3'UTR	SNP	G	G	C			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr20:36032817G>C	ENST00000373578.2	+	0	2995				SRC_ENST00000360723.4_3'UTR|SRC_ENST00000445403.1_3'UTR|SRC_ENST00000373567.2_3'UTR|SRC_ENST00000358208.4_3'UTR|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000373558.2_3'UTR	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	ctcggctctggaggcaatcaa	0.577																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.*1035G>C	20.37:g.36032817G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5V4|Q76P87|Q86VB9|Q9H5A8	RNA	SNP	-	NULL	ENST00000373578.2	37	NULL	CCDS13294.1	20																																																																																			SRC	-	-	ENSG00000197122		0.577	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SRC	HGNC	protein_coding	OTTHUMT00000268142.1	28	0.00	0	G	NM_005417		36032817	36032817	+1	no_errors	ENST00000477066	ensembl	human	known	69_37n	rna	17	37.04	10	SNP	0.907	C
STAT6	6778	genome.wustl.edu	37	12	57499083	57499083	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:57499083C>T	ENST00000300134.3	-	9	1177	c.852G>A	c.(850-852)aaG>aaA	p.K284K	STAT6_ENST00000556155.1_Silent_p.K284K|STAT6_ENST00000538913.2_Silent_p.K174K|STAT6_ENST00000543873.2_Silent_p.K284K|STAT6_ENST00000537215.2_Silent_p.K174K|STAT6_ENST00000454075.3_Silent_p.K284K	NM_001178078.1|NM_003153.4	NP_001171549.1|NP_003144.3	P42226	STAT6_HUMAN	signal transducer and activator of transcription 6, interleukin-4 induced	284					cellular response to hydrogen peroxide (GO:0070301)|cellular response to reactive nitrogen species (GO:1902170)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|mammary gland epithelial cell proliferation (GO:0033598)|mammary gland morphogenesis (GO:0060443)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of type 2 immune response (GO:0002829)|positive regulation of isotype switching to IgE isotypes (GO:0048295)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|T-helper 1 cell lineage commitment (GO:0002296)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane raft (GO:0045121)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein phosphatase binding (GO:0019903)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	28						TGGTCTGAGTCTTCAGTACCT	0.632																																						dbGAP											0													38.0	43.0	41.0					12																	57499083		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC005823, BQ028928	CCDS8931.1, CCDS53804.1	12q13	2013-02-14				ENSG00000166888		"""SH2 domain containing"""	11368	protein-coding gene	gene with protein product		601512				9605853, 8085155	Standard	NM_003153		Approved	D12S1644, IL-4-STAT	uc001sna.3	P42226		ENST00000300134.3:c.852G>A	12.37:g.57499083C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K316|B7ZA27|F5GXI9|Q5FBW5|Q71UP4	Silent	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.K284	ENST00000300134.3	37	c.852	CCDS8931.1	12																																																																																			STAT6	-	pfam_STAT_TF_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000166888		0.632	STAT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAT6	HGNC	protein_coding	OTTHUMT00000412248.3	47	0.00	0	C	NM_003153		57499083	57499083	-1	no_errors	ENST00000300134	ensembl	human	known	69_37n	silent	34	30.61	15	SNP	1.000	T
TCHH	7062	genome.wustl.edu	37	1	152082173	152082173	+	Missense_Mutation	SNP	C	C	G			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr1:152082173C>G	ENST00000368804.1	-	2	3519	c.3520G>C	c.(3520-3522)Gag>Cag	p.E1174Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	1174	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			tgcagctcctcttcctcGCGG	0.612																																						dbGAP											0													77.0	76.0	76.0					1																	152082173		2011	4172	6183	-	-	-	SO:0001583	missense	0			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.3520G>C	1.37:g.152082173C>G	ENSP00000357794:p.Glu1174Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.E1174Q	ENST00000368804.1	37	c.3520	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	C	14.05	2.419967	0.42918	.	.	ENSG00000159450	ENST00000368804	T	0.09445	2.98	3.88	0.411	0.16392	.	.	.	.	.	T	0.00998	0.0033	N	0.14661	0.345	0.19775	N	0.999957	P	0.41978	0.767	B	0.33846	0.171	T	0.32981	-0.9886	9	0.08381	T	0.77	-8.3493	3.0569	0.06187	0.1777:0.5401:0.1737:0.1085	.	1174	Q07283	TRHY_HUMAN	Q	1174	ENSP00000357794:E1174Q	ENSP00000357794:E1174Q	E	-	1	0	TCHH	150348797	0.000000	0.05858	0.050000	0.19076	0.690000	0.40134	-0.522000	0.06237	0.095000	0.17434	0.455000	0.32223	GAG	TCHH	-	NULL	ENSG00000159450		0.612	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	133	0.00	0	C	NM_007113		152082173	152082173	-1	no_errors	ENST00000368804	ensembl	human	known	69_37n	missense	145	15.70	27	SNP	0.736	G
TRMT1	55621	genome.wustl.edu	37	19	13223538	13223538	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr19:13223538C>A	ENST00000592062.1	-	8	1421	c.851G>T	c.(850-852)aGc>aTc	p.S284I	TRMT1_ENST00000592892.1_5'Flank|TRMT1_ENST00000357720.4_Missense_Mutation_p.S284I|TRMT1_ENST00000221504.8_Missense_Mutation_p.S284I|TRMT1_ENST00000437766.1_Missense_Mutation_p.S284I			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	284	Trm1 methyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00958}.						metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		GCAGGCCCGGCTCTTGAGGGC	0.642																																						dbGAP											0													51.0	53.0	52.0					19																	13223538		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.851G>T	19.37:g.13223538C>A	ENSP00000466967:p.Ser284Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O76103|Q548Y5|Q8WVA6	Missense_Mutation	SNP	pfam_tRNA_MeTrfase_TRM1,pfam_Znf_CCCH,pfam_tRNA_Trfase_Trm5/Tyw2,smart_Znf_CCCH,tigrfam_tRNA_MeTrfase_TRM1	p.S284I	ENST00000592062.1	37	c.851	CCDS12293.1	19	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709870	0.68730	.	.	ENSG00000104907	ENST00000357720;ENST00000437766;ENST00000221504	.	.	.	4.99	4.99	0.66335	.	0.333689	0.34628	N	0.003820	T	0.66528	0.2798	M	0.69248	2.105	0.47374	D	0.999402	D;P	0.57899	0.981;0.629	P;B	0.55303	0.773;0.439	T	0.69273	-0.5188	9	0.62326	D	0.03	-20.0257	11.475	0.50293	0.0:0.8187:0.1813:0.0	.	284;284	Q9NXH9-2;Q9NXH9	.;TRM1_HUMAN	I	284	.	ENSP00000221504:S284I	S	-	2	0	TRMT1	13084538	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.738000	0.38207	2.597000	0.87782	0.655000	0.94253	AGC	TRMT1	-	pfam_tRNA_MeTrfase_TRM1,tigrfam_tRNA_MeTrfase_TRM1	ENSG00000104907		0.642	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT1	HGNC	protein_coding	OTTHUMT00000452780.2	81	0.00	0	C	NM_017722		13223538	13223538	-1	no_errors	ENST00000357720	ensembl	human	known	69_37n	missense	46	33.33	23	SNP	1.000	A
UPF1	5976	genome.wustl.edu	37	19	18967087	18967087	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr19:18967087C>A	ENST00000599848.1	+	13	2044	c.1835C>A	c.(1834-1836)aCc>aAc	p.T612N	UPF1_ENST00000262803.5_Missense_Mutation_p.T601N			Q92900	RENT1_HUMAN	UPF1 regulator of nonsense transcripts homolog (yeast)	612					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|dosage compensation by inactivation of X chromosome (GO:0009048)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational termination (GO:0006449)|RNA metabolic process (GO:0016070)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	40						TTGAAGCGCACCGCAGAGAGA	0.602																																						dbGAP											0													45.0	46.0	46.0					19																	18967087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF074016	CCDS12386.1, CCDS74315.1	19p13.2-p13.11	2012-02-29	2006-02-07	2006-02-07	ENSG00000005007	ENSG00000005007			9962	protein-coding gene	gene with protein product	"""UP Frameshift 1"", ""smg-2 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	601430	"""regulator of nonsense transcripts 1"""	RENT1		8855285, 9064659	Standard	XM_005260015		Approved	HUPF1, KIAA0221, NORF1, pNORF1, smg-2	uc002nkf.3	Q92900		ENST00000599848.1:c.1835C>A	19.37:g.18967087C>A	ENSP00000470142:p.Thr612Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O00239|O43343|Q86Z25|Q92842	Missense_Mutation	SNP	pfam_RNA-helicase_UPF1_UPF2-interct,pfam_Helicase/UvrB_dom	p.T601N	ENST00000599848.1	37	c.1802		19	.	.	.	.	.	.	.	.	.	.	C	11.63	1.694898	0.30052	.	.	ENSG00000005007	ENST00000262803	D	0.81908	-1.55	4.29	4.29	0.51040	Helicase/UvrB domain (1);	0.000000	0.85682	D	0.000000	T	0.67869	0.2939	N	0.04880	-0.145	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.0	T	0.63976	-0.6515	10	0.35671	T	0.21	-29.8816	16.0865	0.81056	0.0:1.0:0.0:0.0	.	612;601	Q92900;Q92900-2	RENT1_HUMAN;.	N	601	ENSP00000262803:T601N	ENSP00000262803:T601N	T	+	2	0	UPF1	18828087	1.000000	0.71417	0.741000	0.31004	0.384000	0.30261	5.379000	0.66196	2.102000	0.63906	0.655000	0.94253	ACC	UPF1	-	pfam_Helicase/UvrB_dom	ENSG00000005007		0.602	UPF1-002	KNOWN	basic	protein_coding	UPF1	HGNC	protein_coding	OTTHUMT00000464684.1	33	0.00	0	C	NM_002911		18967087	18967087	+1	no_errors	ENST00000262803	ensembl	human	known	69_37n	missense	22	31.25	10	SNP	0.964	A
USP43	124739	genome.wustl.edu	37	17	9615433	9615433	+	Silent	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr17:9615433C>T	ENST00000285199.7	+	14	2415	c.2319C>T	c.(2317-2319)ctC>ctT	p.L773L	USP43_ENST00000570827.2_3'UTR|USP43_ENST00000570475.1_Silent_p.L768L	NM_001267576.1|NM_153210.4	NP_001254505.1|NP_694942.3	Q70EL4	UBP43_HUMAN	ubiquitin specific peptidase 43	773					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	26						CCAACAGCCTCTGCAATCAGG	0.522																																						dbGAP											0													38.0	39.0	39.0					17																	9615433		1948	4157	6105	-	-	-	SO:0001819	synonymous_variant	0			AK055188	CCDS45610.1, CCDS58516.1	17p12	2005-08-08	2005-08-08			ENSG00000154914		"""Ubiquitin-specific peptidases"""	20072	protein-coding gene	gene with protein product			"""ubiquitin specific protease 43"""			12838346	Standard	NM_153210		Approved	FLJ30626	uc010cod.4	Q70EL4		ENST00000285199.7:c.2319C>T	17.37:g.9615433C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDT9|B7ZLT9|B7ZVX5|Q8N2C5|Q96DQ6	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L773	ENST00000285199.7	37	c.2319	CCDS45610.1	17																																																																																			USP43	-	NULL	ENSG00000154914		0.522	USP43-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP43	HGNC	protein_coding	OTTHUMT00000439855.3	49	0.00	0	C	NM_153210		9615433	9615433	+1	no_errors	ENST00000285199	ensembl	human	known	69_37n	silent	33	13.16	5	SNP	0.000	T
WDR17	116966	genome.wustl.edu	37	4	177032726	177032726	+	Splice_Site	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr4:177032726G>A	ENST00000280190.4	+	3	223	c.67G>A	c.(67-69)Gca>Aca	p.A23T	WDR17_ENST00000508596.1_5'UTR|WDR17_ENST00000507824.2_Splice_Site_p.A23T|WDR17_ENST00000393643.2_5'UTR			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	23										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		GTTTTTCAAGGCAAACATGTC	0.438																																						dbGAP											0													126.0	119.0	121.0					4																	177032726		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.67-1G>A	4.37:g.177032726G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A23T	ENST00000280190.4	37	c.67	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891837	0.52014	.	.	ENSG00000150627	ENST00000280190;ENST00000507824	T	0.58060	0.36	5.21	3.38	0.38709	.	0.345502	0.25042	N	0.033597	T	0.31104	0.0786	N	0.14661	0.345	0.80722	D	1	B	0.28713	0.22	B	0.25140	0.058	T	0.08126	-1.0737	9	.	.	.	-3.946	10.4165	0.44325	0.0726:0.0:0.7936:0.1338	.	23	Q8IZU2	WDR17_HUMAN	T	23	ENSP00000280190:A23T	.	A	+	1	0	WDR17	177269720	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	3.488000	0.53229	1.324000	0.45282	0.467000	0.42956	GCA	WDR17	-	NULL	ENSG00000150627		0.438	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	49	0.00	0	G		Missense_Mutation	177032726	177032726	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	A
WSCD2	9671	genome.wustl.edu	37	12	108589947	108589947	+	Missense_Mutation	SNP	G	G	A	rs187550758		TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr12:108589947G>A	ENST00000332082.4	+	3	1156	c.338G>A	c.(337-339)cGa>cAa	p.R113Q	WSCD2_ENST00000549903.1_Missense_Mutation_p.R113Q|WSCD2_ENST00000261400.3_Missense_Mutation_p.R113Q|WSCD2_ENST00000547525.1_Missense_Mutation_p.R113Q			Q2TBF2	WSCD2_HUMAN	WSC domain containing 2	113						integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(1)|large_intestine(16)|liver(2)|lung(23)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	57						GCCTGGAGCCGAGCCCTCAAG	0.597													G|||	1	0.000199681	0.0	0.0	5008	,	,		19894	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													41.0	43.0	42.0					12																	108589947		1981	4163	6144	-	-	-	SO:0001583	missense	0				CCDS41828.1	12q23.3	2008-02-05				ENSG00000075035			29117	protein-coding gene	gene with protein product							Standard	NM_014653		Approved	KIAA0789	uc001tms.3	Q2TBF2		ENST00000332082.4:c.338G>A	12.37:g.108589947G>A	ENSP00000331933:p.Arg113Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN48|B4DES1|Q8IY35|Q9Y4B7	Missense_Mutation	SNP	pfam_WSC_carb-bd,smart_WSC_carb-bd_subgr,pfscan_WSC_carb-bd	p.R113Q	ENST00000332082.4	37	c.338	CCDS41828.1	12	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	G	15.84	2.952009	0.53293	.	.	ENSG00000075035	ENST00000547525;ENST00000261400;ENST00000332082;ENST00000549903	T;T;T;T	0.29655	1.57;1.56;1.57;1.56	5.6	5.6	0.85130	.	0.138485	0.48286	D	0.000194	T	0.30792	0.0776	M	0.62723	1.935	0.42354	D	0.992389	P	0.47545	0.897	B	0.38428	0.273	T	0.16778	-1.0391	10	0.12103	T	0.63	-11.1774	18.5769	0.91158	0.0:0.0:1.0:0.0	.	113	Q2TBF2	WSCD2_HUMAN	Q	113	ENSP00000448047:R113Q;ENSP00000261400:R113Q;ENSP00000331933:R113Q;ENSP00000447272:R113Q	ENSP00000261400:R113Q	R	+	2	0	WSCD2	107114077	1.000000	0.71417	0.968000	0.41197	0.987000	0.75469	7.149000	0.77396	2.617000	0.88574	0.655000	0.94253	CGA	WSCD2	-	NULL	ENSG00000075035		0.597	WSCD2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WSCD2	HGNC	protein_coding	OTTHUMT00000405554.1	36	0.00	0	G	NM_014653		108589947	108589947	+1	no_errors	ENST00000261400	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.998	A
ZC3H7A	29066	genome.wustl.edu	37	16	11868220	11868220	+	Missense_Mutation	SNP	C	C	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr16:11868220C>A	ENST00000396516.2	-	8	972	c.775G>T	c.(775-777)Gtg>Ttg	p.V259L	ZC3H7A_ENST00000575170.1_5'Flank|ZC3H7A_ENST00000355758.4_Missense_Mutation_p.V259L			Q8IWR0	Z3H7A_HUMAN	zinc finger CCCH-type containing 7A	259						nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(3)|kidney(5)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|urinary_tract(2)	25						TTTGCCAGCACTGCAGATGGC	0.458																																						dbGAP											0													95.0	87.0	90.0					16																	11868220		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF161540	CCDS10550.1	16p13-p12	2013-01-11	2005-06-02	2005-06-08	ENSG00000122299	ENSG00000122299		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30959	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 7"", ""zinc finger CCCH-type containing 7"""	ZC3HDC7, ZC3H7		11042152	Standard	NM_014153		Approved	HSPC055, FLJ20318	uc002dbl.3	Q8IWR0	OTTHUMG00000129825	ENST00000396516.2:c.775G>T	16.37:g.11868220C>A	ENSP00000379773:p.Val259Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUG5|Q9NPE9	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.V259L	ENST00000396516.2	37	c.775	CCDS10550.1	16	.	.	.	.	.	.	.	.	.	.	C	11.32	1.604385	0.28534	.	.	ENSG00000122299	ENST00000355758;ENST00000396516	T;T	0.09255	3.0;3.0	5.74	2.24	0.28232	.	0.295118	0.36778	N	0.002417	T	0.08537	0.0212	L	0.47716	1.5	0.09310	N	0.999999	B	0.14438	0.01	B	0.10450	0.005	T	0.32613	-0.9900	10	0.20519	T	0.43	.	6.5583	0.22471	0.1366:0.6441:0.0:0.2194	.	259	Q8IWR0	Z3H7A_HUMAN	L	259	ENSP00000347999:V259L;ENSP00000379773:V259L	ENSP00000347999:V259L	V	-	1	0	ZC3H7A	11775721	0.001000	0.12720	0.110000	0.21437	0.927000	0.56198	0.179000	0.16840	0.769000	0.33313	0.467000	0.42956	GTG	ZC3H7A	-	NULL	ENSG00000122299		0.458	ZC3H7A-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZC3H7A	HGNC	protein_coding	OTTHUMT00000437066.1	58	0.00	0	C	NM_014153		11868220	11868220	-1	no_errors	ENST00000355758	ensembl	human	known	69_37n	missense	28	61.11	44	SNP	0.008	A
ZNF16	7564	genome.wustl.edu	37	8	146156835	146156835	+	Silent	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr8:146156835G>A	ENST00000276816.4	-	4	1524	c.1338C>T	c.(1336-1338)tcC>tcT	p.S446S	ZNF16_ENST00000394909.2_Silent_p.S446S	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	446					cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GAATAAGGCTGGAGCTCTGAC	0.483																																						dbGAP											0													86.0	82.0	84.0					8																	146156835		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1338C>T	8.37:g.146156835G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S446	ENST00000276816.4	37	c.1338	CCDS6437.1	8																																																																																			ZNF16	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170631		0.483	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF16	HGNC	protein_coding	OTTHUMT00000382978.1	51	0.00	0	G	NM_006958		146156835	146156835	-1	no_errors	ENST00000276816	ensembl	human	known	69_37n	silent	21	36.36	12	SNP	0.010	A
ZNF185	7739	genome.wustl.edu	37	X	152087570	152087572	+	In_Frame_Del	DEL	GAG	GAG	-			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chrX:152087570_152087572delGAG	ENST00000370268.4	+	7	512_514	c.475_477delGAG	c.(475-477)gagdel	p.E165del	ZNF185_ENST00000318529.8_In_Frame_Del_p.E30del|ZNF185_ENST00000318504.7_In_Frame_Del_p.E165del|ZNF185_ENST00000539731.1_In_Frame_Del_p.E165del|ZNF185_ENST00000535861.1_In_Frame_Del_p.E165del|ZNF185_ENST00000370270.2_In_Frame_Del_p.E165del|ZNF185_ENST00000449285.2_In_Frame_Del_p.E165del|ZNF185_ENST00000324823.6_In_Frame_Del_p.E30del			O15231	ZN185_HUMAN	zinc finger protein 185 (LIM domain)	165	Poly-Glu.					actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(3)|ovary(3)	12	Acute lymphoblastic leukemia(192;6.56e-05)					AGGGGACACCgaggaggaggagg	0.596																																						dbGAP											0									,,,,,,	160,3115		6,91,57,1273,478					,,,,,,	-7.0	0.0			54	367,5848		0,178,189,2088,1494	no	coding,coding,coding,coding,coding,coding,coding	ZNF185	NM_007150.3,NM_001178113.1,NM_001178110.1,NM_001178109.1,NM_001178108.1,NM_001178107.1,NM_001178106.1	,,,,,,	6,269,246,3361,1972	A1A1,A1R,A1,RR,R		5.9051,4.8855,5.5532	,,,,,,	,,,,,,		527,8963				-	-	-	SO:0001651	inframe_deletion	0			AK056517	CCDS48184.1, CCDS55528.1, CCDS55529.1, CCDS55530.1, CCDS55531.1, CCDS55532.1, CCDS69832.1	Xq28	2012-08-08			ENSG00000147394	ENSG00000147394		"""Zinc fingers, C2H2-type"""	12976	protein-coding gene	gene with protein product		300381				9268636	Standard	NM_001178106		Approved		uc011myg.2	O15231	OTTHUMG00000024187	ENST00000370268.4:c.475_477delGAG	X.37:g.152087579_152087581delGAG	ENSP00000359291:p.Glu165del	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTV3|A6NME5|B4DLE9|B7Z771|B8K2L9|B8K2M0|B8K2M1|B8K2M2|E9PFR6|F5GXF7|F5GZL4|F8W8V7|H0Y4M8|O00345|Q8N1R8|Q9NSD2	In_Frame_Del	DEL	smart_Znf_LIM,pfscan_Znf_LIM	p.E162in_frame_del	ENST00000370268.4	37	c.475_477	CCDS48184.1	X																																																																																			ZNF185	-	NULL	ENSG00000147394		0.596	ZNF185-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF185	HGNC	protein_coding	OTTHUMT00000377480.1	52	0.00	0	GAG	NM_007150		152087570	152087572	+1	no_errors	ENST00000535861	ensembl	human	known	69_37n	in_frame_del	31	13.89	5	DEL	0.026:0.052:0.078	-
ZNF502	91392	genome.wustl.edu	37	3	44763241	44763241	+	Missense_Mutation	SNP	C	C	T			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr3:44763241C>T	ENST00000296091.4	+	4	1188	c.932C>T	c.(931-933)aCg>aTg	p.T311M	ZNF502_ENST00000449836.1_Missense_Mutation_p.T311M|ZNF502_ENST00000436624.2_Missense_Mutation_p.T311M	NM_001134440.1|NM_001282880.1|NM_033210.4	NP_001127912.1|NP_001269809.1|NP_149987.2	Q8TBZ5	ZN502_HUMAN	zinc finger protein 502	311					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(4)|large_intestine(8)|lung(4)|prostate(1)|urinary_tract(1)	19				BRCA - Breast invasive adenocarcinoma(193;0.00855)|KIRC - Kidney renal clear cell carcinoma(197;0.0471)|Kidney(197;0.0589)		TCAAATCTTACGCAACATCAG	0.403																																						dbGAP											0													135.0	142.0	139.0					3																	44763241		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK022577	CCDS2719.1	3p21.32	2013-01-08			ENSG00000196653	ENSG00000196653		"""Zinc fingers, C2H2-type"""	23718	protein-coding gene	gene with protein product							Standard	NM_033210		Approved	FLJ14855, FLJ12515	uc003cnt.3	Q8TBZ5	OTTHUMG00000133086	ENST00000296091.4:c.932C>T	3.37:g.44763241C>T	ENSP00000296091:p.Thr311Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T311M	ENST00000296091.4	37	c.932	CCDS2719.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.31|13.31	2.200235|2.200235	0.38905|0.38905	.|.	.|.	ENSG00000196653|ENSG00000196653	ENST00000427783|ENST00000449836;ENST00000296091;ENST00000436624	.|T;T;T	.|0.18810	.|2.19;2.19;2.19	4.27|4.27	-0.481|-0.481	0.12082|0.12082	.|Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	T|T	0.12050|0.12050	0.0293|0.0293	L|L	0.38649|0.38649	1.16|1.16	0.09310|0.09310	N|N	1|1	.|P	.|0.40282	.|0.711	.|B	.|0.33568	.|0.166	T|T	0.18085|0.18085	-1.0348|-1.0348	6|9	0.66056|0.52906	D|T	0.02|0.07	-0.2728|-0.2728	3.2846|3.2846	0.06927|0.06927	0.3061:0.3077:0.0:0.3862|0.3061:0.3077:0.0:0.3862	.|.	.|311	.|Q8TBZ5	.|ZN502_HUMAN	C|M	311|311	.|ENSP00000397390:T311M;ENSP00000296091:T311M;ENSP00000406469:T311M	ENSP00000397812:R311C|ENSP00000296091:T311M	R|T	+|+	1|2	0|0	ZNF502|ZNF502	44738245|44738245	0.000000|0.000000	0.05858|0.05858	0.054000|0.054000	0.19295|0.19295	0.945000|0.945000	0.59286|0.59286	-3.128000|-3.128000	0.00592|0.00592	0.080000|0.080000	0.16959|0.16959	0.655000|0.655000	0.94253|0.94253	CGC|ACG	ZNF502	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196653		0.403	ZNF502-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF502	HGNC	protein_coding	OTTHUMT00000256744.4	45	0.00	0	C	NM_033210		44763241	44763241	+1	no_errors	ENST00000296091	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	0.000	T
ZNF575	284346	genome.wustl.edu	37	19	44038585	44038585	+	Missense_Mutation	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr19:44038585G>A	ENST00000314228.5	+	3	523	c.11G>A	c.(10-12)cGa>cAa	p.R4Q	ZNF575_ENST00000458714.2_Missense_Mutation_p.R103Q|ZNF575_ENST00000601282.1_Missense_Mutation_p.R4Q	NM_174945.2	NP_777605.1	Q86XF7	ZN575_HUMAN	zinc finger protein 575	4					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|prostate(1)|urinary_tract(1)	4		Prostate(69;0.0199)				ATGCTGGAGCGAGGCGCGGAG	0.657																																						dbGAP											0													15.0	16.0	16.0					19																	44038585		2192	4293	6485	-	-	-	SO:0001583	missense	0			BC043611	CCDS12623.1	19q13.31	2013-09-20			ENSG00000176472	ENSG00000176472		"""Zinc fingers, C2H2-type"""	27606	protein-coding gene	gene with protein product							Standard	NM_174945		Approved	FLJ32567	uc002ows.3	Q86XF7	OTTHUMG00000182698	ENST00000314228.5:c.11G>A	19.37:g.44038585G>A	ENSP00000315870:p.Arg4Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX54	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R103Q	ENST00000314228.5	37	c.308	CCDS12623.1	19	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206044	0.58234	.	.	ENSG00000176472	ENST00000458714;ENST00000314228	T;T	0.08102	3.13;3.15	4.66	3.62	0.41486	.	0.672296	0.12367	N	0.475133	T	0.03520	0.0101	N	0.08118	0	0.24619	N	0.993687	B;B	0.24882	0.016;0.113	B;B	0.13407	0.002;0.009	T	0.37126	-0.9719	10	0.02654	T	1	3.0E-4	8.9407	0.35729	0.1038:0.0:0.8962:0.0	.	4;103	Q86XF7;B3KQ07	ZN575_HUMAN;.	Q	103;4	ENSP00000413956:R103Q;ENSP00000315870:R4Q	ENSP00000315870:R4Q	R	+	2	0	ZNF575	48730425	0.090000	0.21635	0.684000	0.30055	0.696000	0.40369	1.200000	0.32247	1.120000	0.41904	0.555000	0.69702	CGA	ZNF575	-	NULL	ENSG00000176472		0.657	ZNF575-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF575	HGNC	protein_coding	OTTHUMT00000463191.1	79	0.00	0	G	NM_174945		44038585	44038585	+1	no_errors	ENST00000458714	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	0.913	A
ZNF689	115509	genome.wustl.edu	37	16	30621185	30621185	+	Missense_Mutation	SNP	C	C	T	rs371972092		TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr16:30621185C>T	ENST00000287461.3	-	1	515	c.178G>A	c.(178-180)Gag>Aag	p.E60K	RP11-146F11.5_ENST00000563540.1_RNA|ZNF689_ENST00000566673.1_Intron	NM_138447.1	NP_612456.1	Q96CS4	ZN689_HUMAN	zinc finger protein 689	60	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|prostate(1)|urinary_tract(1)	14			Colorectal(24;0.198)			CCGTAGGTCTCCCGCATCACG	0.721																																						dbGAP											0													21.0	22.0	21.0					16																	30621185		2195	4298	6493	-	-	-	SO:0001583	missense	0			BC014000	CCDS10686.1	16p11.2	2013-01-08			ENSG00000156853	ENSG00000156853		"""Zinc fingers, C2H2-type"", ""-"""	25173	protein-coding gene	gene with protein product							Standard	NM_138447		Approved	FLJ90415	uc031qvq.1	Q96CS4	OTTHUMG00000132415	ENST00000287461.3:c.178G>A	16.37:g.30621185C>T	ENSP00000287461:p.Glu60Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658J5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E60K	ENST00000287461.3	37	c.178	CCDS10686.1	16	.	.	.	.	.	.	.	.	.	.	C	29.5	5.009248	0.93346	.	.	ENSG00000156853	ENST00000287461;ENST00000443190	T	0.04234	3.67	4.83	4.83	0.62350	Krueppel-associated box (4);	0.000000	0.44902	D	0.000417	T	0.29524	0.0736	H	0.94306	3.52	0.40545	D	0.981066	D	0.59767	0.986	D	0.64506	0.926	T	0.39035	-0.9633	10	0.72032	D	0.01	-42.9376	15.7793	0.78246	0.0:1.0:0.0:0.0	.	60	Q96CS4	ZN689_HUMAN	K	60	ENSP00000287461:E60K	ENSP00000287461:E60K	E	-	1	0	ZNF689	30528686	0.996000	0.38824	1.000000	0.80357	0.988000	0.76386	3.217000	0.51184	2.667000	0.90743	0.561000	0.74099	GAG	ZNF689	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000156853		0.721	ZNF689-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF689	HGNC	protein_coding	OTTHUMT00000255552.1	115	0.00	0	C	NM_138447		30621185	30621185	-1	no_errors	ENST00000287461	ensembl	human	known	69_37n	missense	103	13.45	16	SNP	1.000	T
ZRANB3	84083	genome.wustl.edu	37	2	135965355	135965355	+	Silent	SNP	G	G	A			TCGA-LL-A5YL-01A-12D-A29N-09	TCGA-LL-A5YL-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	85de3ba8-3c04-4590-a620-c7a602f0b266	e606da36-cc93-4759-886c-1fe07d617705	g.chr2:135965355G>A	ENST00000264159.6	-	19	2774	c.2658C>T	c.(2656-2658)gtC>gtT	p.V886V	ZRANB3_ENST00000412849.1_5'UTR|ZRANB3_ENST00000401392.1_Silent_p.V884V|ZRANB3_ENST00000536680.1_Silent_p.V884V	NM_032143.2	NP_115519.2	Q5FWF4	ZRAB3_HUMAN	zinc finger, RAN-binding domain containing 3	886					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|DNA rewinding (GO:0036292)|DNA strand renaturation (GO:0000733)|negative regulation of DNA recombination (GO:0045910)|replication fork processing (GO:0031297)|replication fork protection (GO:0048478)|response to UV (GO:0009411)	nuclear replication fork (GO:0043596)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|endodeoxyribonuclease activity (GO:0004520)|helicase activity (GO:0004386)|K63-linked polyubiquitin binding (GO:0070530)|zinc ion binding (GO:0008270)			NS(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|upper_aerodigestive_tract(1)	20				BRCA - Breast invasive adenocarcinoma(221;0.135)		GATCTGCCTGGACTGTGTATG	0.413																																						dbGAP											0													91.0	86.0	88.0					2																	135965355		1934	4137	6071	-	-	-	SO:0001819	synonymous_variant	0			AL136824	CCDS46419.1, CCDS67963.1, CCDS74580.1	2q21.3	2013-05-13			ENSG00000121988	ENSG00000121988		"""Zinc fingers, RAN-binding domain containing"""	25249	protein-coding gene	gene with protein product						11230166	Standard	XM_005263809		Approved	DKFZP434B1727	uc002tum.3	Q5FWF4	OTTHUMG00000150475	ENST00000264159.6:c.2658C>T	2.37:g.135965355G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KYA1|B4E375|B5MDI3|D3DP76|E9PBP0|Q53SM1|Q6P2C4|Q8N1P4|Q9H0E8	Silent	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HNH,pfam_Znf_RanBP2,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Znf_RanBP2,smart_HNH_nuc,pfscan_Znf_RanBP2,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V886	ENST00000264159.6	37	c.2658	CCDS46419.1	2																																																																																			ZRANB3	-	NULL	ENSG00000121988		0.413	ZRANB3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB3	HGNC	protein_coding	OTTHUMT00000318254.1	43	0.00	0	G	NM_032143		135965355	135965355	-1	no_errors	ENST00000264159	ensembl	human	known	69_37n	silent	28	22.22	8	SNP	0.000	A
