#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSL6	23305	genome.wustl.edu	37	5	131295289	131295289	+	Missense_Mutation	SNP	T	T	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr5:131295289T>A	ENST00000379240.1	-	20	2049	c.1896A>T	c.(1894-1896)aaA>aaT	p.K632N	ACSL6_ENST00000379272.2_Missense_Mutation_p.K647N|AC034228.4_ENST00000446275.1_RNA|ACSL6_ENST00000379249.3_Missense_Mutation_p.K632N|ACSL6_ENST00000431707.1_Missense_Mutation_p.K612N|ACSL6_ENST00000296869.4_Missense_Mutation_p.K657N|ACSL6_ENST00000357096.1_Missense_Mutation_p.K557N|ACSL6_ENST00000544770.1_Missense_Mutation_p.K541N|ACSL6_ENST00000379244.1_Missense_Mutation_p.K632N|ACSL6_ENST00000379264.2_Missense_Mutation_p.K657N|ACSL6_ENST00000379246.1_Missense_Mutation_p.K643N|ACSL6_ENST00000379255.1_Missense_Mutation_p.K557N|ACSL6_ENST00000543479.1_Missense_Mutation_p.K632N			Q9UKU0	ACSL6_HUMAN	acyl-CoA synthetase long-chain family member 6	632					acyl-CoA metabolic process (GO:0006637)|cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|fatty acid transport (GO:0015908)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|phospholipid biosynthetic process (GO:0008654)|positive regulation of neuron projection development (GO:0010976)|positive regulation of plasma membrane long-chain fatty acid transport (GO:0010747)|positive regulation of triglyceride biosynthetic process (GO:0010867)|response to gravity (GO:0009629)|response to hypoxia (GO:0001666)|response to nutrient (GO:0007584)|response to steroid hormone (GO:0048545)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|long-chain fatty acid-CoA ligase activity (GO:0004467)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	35		all_cancers(142;0.107)|Breast(839;0.198)|Lung NSC(810;0.216)|all_lung(232;0.248)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			CCAAAATGGCTTTCTTCAGAT	0.388																																						dbGAP											0													115.0	104.0	107.0					5																	131295289		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020644	CCDS34228.1, CCDS34229.1, CCDS56381.1, CCDS56382.1, CCDS56383.1	5q31	2008-02-05	2004-02-19	2004-02-20	ENSG00000164398	ENSG00000164398		"""Acyl-CoA synthetase family"""	16496	protein-coding gene	gene with protein product		604443	"""fatty-acid-Coenzyme A ligase, long-chain 6"""	FACL6		10502316, 10548543	Standard	NM_015256		Approved	KIAA0837, ACS2, LACS5, LACS2	uc003kvy.2	Q9UKU0	OTTHUMG00000150692	ENST00000379240.1:c.1896A>T	5.37:g.131295289T>A	ENSP00000368542:p.Lys632Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KPG3|O94924|O95829|Q108M9|Q108N0|Q4G191|Q86TN7	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.K657N	ENST00000379240.1	37	c.1971		5	.	.	.	.	.	.	.	.	.	.	T	13.25	2.182309	0.38511	.	.	ENSG00000164398	ENST00000379249;ENST00000379264;ENST00000379272;ENST00000357096;ENST00000379255;ENST00000296869;ENST00000379246;ENST00000379244;ENST00000544770;ENST00000379240;ENST00000431707;ENST00000543479	T;T;T;T;T;T;T;T;T;T;T;T	0.17691	2.26;2.96;2.96;2.96;2.96;2.96;2.96;2.96;2.96;2.96;2.96;2.96	5.01	3.84	0.44239	.	0.088528	0.85682	D	0.000000	T	0.13500	0.0327	L	0.37800	1.135	0.58432	D	0.999997	B;B;B;B;B;B;B	0.12013	0.005;0.005;0.003;0.003;0.005;0.005;0.005	B;B;B;B;B;B;B	0.17979	0.018;0.02;0.009;0.008;0.012;0.02;0.02	T	0.06445	-1.0826	10	0.34782	T	0.22	.	9.4669	0.38817	0.0:0.1505:0.0:0.8495	.	632;647;622;632;557;657;657	Q9UKU0-3;Q9UKU0-6;B4DFW3;Q9UKU0;Q9UKU0-7;Q9UKU0-1;Q9UKU0-8	.;.;.;ACSL6_HUMAN;.;.;.	N	632;657;647;557;557;657;643;632;541;632;612;632	ENSP00000368551:K632N;ENSP00000368566:K657N;ENSP00000368574:K647N;ENSP00000349608:K557N;ENSP00000368557:K557N;ENSP00000296869:K657N;ENSP00000368548:K643N;ENSP00000368546:K632N;ENSP00000445154:K541N;ENSP00000368542:K632N;ENSP00000413329:K612N;ENSP00000442124:K632N	ENSP00000296869:K657N	K	-	3	2	ACSL6	131323188	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.186000	0.32078	0.872000	0.35775	0.460000	0.39030	AAA	ACSL6	-	NULL	ENSG00000164398		0.388	ACSL6-004	NOVEL	basic|appris_candidate_longest|exp_conf	protein_coding	ACSL6	HGNC	protein_coding	OTTHUMT00000132622.1	63	0.00	0	T	NM_015256		131295289	131295289	-1	no_errors	ENST00000296869	ensembl	human	known	69_37n	missense	42	31.15	19	SNP	1.000	A
ADAMTS14	140766	genome.wustl.edu	37	10	72520351	72520351	+	Silent	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr10:72520351G>A	ENST00000373207.1	+	22	3414	c.3414G>A	c.(3412-3414)acG>acA	p.T1138T	ADAMTS14_ENST00000373208.1_Silent_p.T1141T	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	1138	Pro-rich.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						GAAAGCCAACGGGATCAGAGG	0.627																																						dbGAP											0													59.0	60.0	60.0					10																	72520351		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.3414G>A	10.37:g.72520351G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.T1141	ENST00000373207.1	37	c.3423	CCDS7306.1	10																																																																																			ADAMTS14	-	NULL	ENSG00000138316		0.627	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	HGNC	protein_coding	OTTHUMT00000048522.1	27	0.00	0	G	NM_080722		72520351	72520351	+1	no_errors	ENST00000373208	ensembl	human	known	69_37n	silent	23	39.47	15	SNP	0.000	A
ADAMTS19	171019	genome.wustl.edu	37	5	128990004	128990004	+	Missense_Mutation	SNP	C	C	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr5:128990004C>A	ENST00000274487.4	+	14	2309	c.2164C>A	c.(2164-2166)Cca>Aca	p.P722T	CTC-575N7.1_ENST00000503616.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	722	Cys-rich.					proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		TGTAGAAAAACCATGTGCCTT	0.318																																						dbGAP											0													81.0	83.0	82.0					5																	128990004		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.2164C>A	5.37:g.128990004C>A	ENSP00000274487:p.Pro722Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P722T	ENST00000274487.4	37	c.2164	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	C	18.28	3.589961	0.66105	.	.	ENSG00000145808	ENST00000274487	T	0.70282	-0.47	4.32	4.32	0.51571	.	0.000000	0.64402	D	0.000001	D	0.85613	0.5737	M	0.85945	2.785	0.58432	D	0.999997	D	0.89917	1.0	D	0.91635	0.999	D	0.87048	0.2145	9	.	.	.	.	18.11	0.89532	0.0:1.0:0.0:0.0	.	722	Q8TE59	ATS19_HUMAN	T	722	ENSP00000274487:P722T	.	P	+	1	0	ADAMTS19	129017903	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	6.107000	0.71517	2.692000	0.91855	0.655000	0.94253	CCA	ADAMTS19	-	NULL	ENSG00000145808		0.318	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	86	0.00	0	C	NM_133638		128990004	128990004	+1	no_errors	ENST00000274487	ensembl	human	known	69_37n	missense	38	32.14	18	SNP	1.000	A
ASAP1	50807	genome.wustl.edu	37	8	131149217	131149217	+	Missense_Mutation	SNP	T	T	C			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr8:131149217T>C	ENST00000518721.1	-	14	1375	c.1148A>G	c.(1147-1149)aAa>aGa	p.K383R	ASAP1_ENST00000357668.1_Missense_Mutation_p.K383R	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	383	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						GTCAAAAGATTTTTTGTCTTC	0.423																																						dbGAP											0													193.0	181.0	185.0					8																	131149217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.1148A>G	8.37:g.131149217T>C	ENSP00000429900:p.Lys383Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,prints_ArfGAP,prints_p67phox,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP	p.K383R	ENST00000518721.1	37	c.1148	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	T	25.5	4.643744	0.87859	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721	T;T	0.75367	-0.93;-0.93	6.07	6.07	0.98685	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.094480	0.64402	D	0.000001	T	0.75576	0.3868	N	0.16037	0.36	0.80722	D	1	D;D;D	0.64830	0.994;0.994;0.993	D;D;D	0.85130	0.997;0.997;0.992	T	0.74657	-0.3592	10	0.25751	T	0.34	.	15.8218	0.78654	0.0:0.0:0.0:1.0	.	383;383;386	B2RNV3;Q9ULH1;Q9ULH1-2	.;ASAP1_HUMAN;.	R	386;383;383	ENSP00000350297:K383R;ENSP00000429900:K383R	ENSP00000344591:K386R	K	-	2	0	ASAP1	131218399	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	7.649000	0.83500	2.326000	0.78906	0.533000	0.62120	AAA	ASAP1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000153317		0.423	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1	95	0.00	0	T	NM_018482		131149217	131149217	-1	no_errors	ENST00000357668	ensembl	human	known	69_37n	missense	59	35.16	32	SNP	1.000	C
ASXL2	55252	genome.wustl.edu	37	2	25973043	25973043	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr2:25973043G>A	ENST00000435504.4	-	12	1675	c.1382C>T	c.(1381-1383)tCa>tTa	p.S461L	ASXL2_ENST00000336112.4_Missense_Mutation_p.S433L|ASXL2_ENST00000272341.4_Missense_Mutation_p.S201L|ASXL2_ENST00000404843.1_Missense_Mutation_p.S201L			Q76L83	ASXL2_HUMAN	additional sex combs like transcriptional regulator 2	461					adult heart development (GO:0007512)|embryonic skeletal system morphogenesis (GO:0048704)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of histone H3-K27 trimethylation (GO:1902466)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035360)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(3)	33	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGGCTCTGAAGATGTGGA	0.483																																						dbGAP											0													264.0	258.0	260.0					2																	25973043		2023	4191	6214	-	-	-	SO:0001583	missense	0					2p24.1	2014-06-17	2014-06-17		ENSG00000143970	ENSG00000143970			23805	protein-coding gene	gene with protein product		612991	"""additional sex combs like 2 (Drosophila)"""			12888926	Standard	NM_018263		Approved	ASXH2, FLJ10898, KIAA1685	uc002rgs.2	Q76L83	OTTHUMG00000152176	ENST00000435504.4:c.1382C>T	2.37:g.25973043G>A	ENSP00000391447:p.Ser461Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TC9|Q5H9U4|Q76L81|Q86XM1|Q9C0H8|Q9NV67	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.S461L	ENST00000435504.4	37	c.1382		2	.	.	.	.	.	.	.	.	.	.	G	9.212	1.031158	0.19590	.	.	ENSG00000143970	ENST00000435504;ENST00000336112;ENST00000404843;ENST00000272341	T;T;T;T	0.17854	2.25;2.25;2.28;2.28	5.78	5.78	0.91487	.	0.765147	0.12681	N	0.447979	T	0.09247	0.0228	N	0.03608	-0.345	0.09310	N	1	B;B	0.20887	0.0;0.049	B;B	0.16722	0.001;0.016	T	0.27606	-1.0069	10	0.26408	T	0.33	0.4422	14.2097	0.65756	0.0:0.1495:0.8505:0.0	.	201;461	Q76L83-2;Q76L83	.;ASXL2_HUMAN	L	461;433;201;201	ENSP00000391447:S461L;ENSP00000337250:S433L;ENSP00000383920:S201L;ENSP00000272341:S201L	ENSP00000272341:S201L	S	-	2	0	ASXL2	25826547	0.124000	0.22315	0.856000	0.33681	0.090000	0.18270	1.566000	0.36396	2.727000	0.93392	0.585000	0.79938	TCA	ASXL2	-	NULL	ENSG00000143970		0.483	ASXL2-001	KNOWN	basic|appris_principal	protein_coding	ASXL2	HGNC	protein_coding	OTTHUMT00000325593.3	115	0.00	0	G	NM_018263		25973043	25973043	-1	no_errors	ENST00000435504	ensembl	human	known	69_37n	missense	75	42.75	56	SNP	0.527	A
ATP2B4	493	genome.wustl.edu	37	1	203689684	203689684	+	Missense_Mutation	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:203689684C>G	ENST00000357681.5	+	16	3537	c.2414C>G	c.(2413-2415)gCa>gGa	p.A805G	ATP2B4_ENST00000367218.3_Missense_Mutation_p.A805G|ATP2B4_ENST00000367219.3_Missense_Mutation_p.A793G|ATP2B4_ENST00000341360.2_Missense_Mutation_p.A805G|ATP2B4_ENST00000391954.2_Missense_Mutation_p.A805G	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	805					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGGGCATCGCAGGCACAGAT	0.498																																						dbGAP											0													95.0	75.0	82.0					1																	203689684		2203	4300	6503	-	-	-	SO:0001583	missense	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.2414C>G	1.37:g.203689684C>G	ENSP00000350310:p.Ala805Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.A805G	ENST00000357681.5	37	c.2414	CCDS1440.1	1	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287131	0.80803	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000391954;ENST00000341360	D;D;D;D;D	0.97620	-4.46;-4.46;-4.46;-4.46;-4.46	4.96	4.96	0.65561	HAD-like domain (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.53938	D	0.000057	D	0.97670	0.9236	L	0.45744	1.44	0.80722	D	1	D;P;D	0.71674	0.998;0.902;0.995	D;P;D	0.77004	0.989;0.6;0.978	D	0.99010	1.0814	10	0.87932	D	0	-20.0776	17.8101	0.88613	0.0:1.0:0.0:0.0	.	805;805;805	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	G	805;805;793;805;805	ENSP00000350310:A805G;ENSP00000356187:A805G;ENSP00000356188:A793G;ENSP00000375816:A805G;ENSP00000340930:A805G	ENSP00000340930:A805G	A	+	2	0	ATP2B4	201956307	1.000000	0.71417	0.988000	0.46212	0.642000	0.38348	7.813000	0.86123	2.304000	0.77564	0.655000	0.94253	GCA	ATP2B4	-	pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000058668		0.498	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	91	0.00	0	C	NM_001001396		203689684	203689684	+1	no_errors	ENST00000357681	ensembl	human	known	69_37n	missense	99	33.11	49	SNP	1.000	G
BMPR2	659	genome.wustl.edu	37	2	203395559	203395559	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr2:203395559G>A	ENST00000374580.4	+	8	1549	c.1010G>A	c.(1009-1011)aGa>aAa	p.R337K	BMPR2_ENST00000374574.2_Missense_Mutation_p.R337K	NM_001204.6	NP_001195.2	Q13873	BMPR2_HUMAN	bone morphogenetic protein receptor, type II (serine/threonine kinase)	337	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|brain development (GO:0007420)|cellular response to starvation (GO:0009267)|chondrocyte development (GO:0002063)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm formation (GO:0001707)|negative regulation of cell growth (GO:0030308)|negative regulation of chondrocyte proliferation (GO:1902731)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of vasoconstriction (GO:0045906)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of bone mineralization (GO:0030501)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|regulation of cell proliferation (GO:0042127)|regulation of lung blood pressure (GO:0014916)|retina vasculature development in camera-type eye (GO:0061298)|transcription from RNA polymerase II promoter (GO:0006366)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|venous blood vessel development (GO:0060841)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|caveola (GO:0005901)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|fully spanning plasma membrane (GO:0044214)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	activin receptor activity, type II (GO:0016362)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(11)|lung(7)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|urinary_tract(2)	42						TTAAACAGCAGAAATGTCCTA	0.373																																						dbGAP											0													76.0	78.0	77.0					2																	203395559		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z48923	CCDS33361.1	2q33-q34	2014-09-17			ENSG00000204217	ENSG00000204217			1078	protein-coding gene	gene with protein product		600799	"""primary pulmonary hypertension 1"""	PPH1		7791754	Standard	NM_001204		Approved	BRK-3, T-ALK, BMPR3, BMPR-II	uc002uzf.4	Q13873	OTTHUMG00000133617	ENST00000374580.4:c.1010G>A	2.37:g.203395559G>A	ENSP00000363708:p.Arg337Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13161|Q16569|Q4ZG08|Q53SA5|Q585T8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R337K	ENST00000374580.4	37	c.1010	CCDS33361.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.503979	0.96371	.	.	ENSG00000204217	ENST00000374580;ENST00000374574	D;D	0.93488	-3.23;-3.23	5.7	5.7	0.88788	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.90390	0.6992	N	0.17922	0.545	0.80722	D	1	P;B	0.48350	0.909;0.281	P;B	0.48166	0.569;0.302	D	0.88917	0.3363	10	0.25106	T	0.35	.	18.0144	0.89235	0.0:0.0:1.0:0.0	.	337;337	Q13161;Q13873	.;BMPR2_HUMAN	K	337	ENSP00000363708:R337K;ENSP00000363702:R337K	ENSP00000363702:R337K	R	+	2	0	BMPR2	203103804	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.803000	0.99136	2.692000	0.91855	0.591000	0.81541	AGA	BMPR2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000204217		0.373	BMPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMPR2	HGNC	protein_coding	OTTHUMT00000257743.1	83	0.00	0	G	NM_001204		203395559	203395559	+1	no_errors	ENST00000374580	ensembl	human	known	69_37n	missense	68	25.27	23	SNP	1.000	A
BOD1L2	284257	genome.wustl.edu	37	18	54815025	54815025	+	Missense_Mutation	SNP	G	G	T	rs11151997	byFrequency	TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr18:54815025G>T	ENST00000585477.1	+	1	733	c.482G>T	c.(481-483)gGc>gTc	p.G161V	CTD-2526M8.3_ENST00000590942.1_lincRNA	NM_001257964.1	NP_001244893.1	Q8IYS8	BD1L2_HUMAN	biorientation of chromosomes in cell division 1-like 2	161																	GAGCCAGAAGGCCAGGACCCT	0.468													G|||	2845	0.568091	0.5893	0.5519	5008	,	,		20390	0.5794		0.5109	False		,,,				2504	0.5982					dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK127964	CCDS59322.1	18q21.31	2013-10-11	2012-04-10	2012-04-10	ENSG00000228075	ENSG00000228075			28505	protein-coding gene	gene with protein product			"""family with sequence similarity 44, member C"", ""biorientation of chromosomes in cell division 1 pseudogene"""	FAM44C, BOD1P		17938248	Standard	NM_001257964		Approved	MGC33608	uc002lgm.3	Q8IYS8	OTTHUMG00000180124	ENST00000585477.1:c.482G>T	18.37:g.54815025G>T	ENSP00000467843:p.Gly161Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXU4|Q8WW13	Missense_Mutation	SNP	NULL	p.G161V	ENST00000585477.1	37	c.482	CCDS59322.1	18	1153	0.5279304029304029	265	0.5386178861788617	189	0.5220994475138122	333	0.5821678321678322	366	0.48284960422163586	G	10.54	1.379007	0.24944	.	.	ENSG00000228075	ENST00000420277	.	.	.	2.73	-0.478	0.12093	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B	0.26400	0.148	B	0.15052	0.012	T	0.44097	-0.9350	6	0.44086	T	0.13	.	3.8142	0.08809	0.2348:0.4547:0.3104:0.0	rs11151997;rs57011054	161	Q8IYS8	BD1L2_HUMAN	V	133	.	ENSP00000442342:G133V	G	+	2	0	AC100775.1	52966023	0.037000	0.19845	0.001000	0.08648	0.009000	0.06853	0.004000	0.13106	0.012000	0.14892	-0.291000	0.09656	GGC	BOD1L2	-	NULL	ENSG00000228075		0.468	BOD1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BOD1L2	HGNC	protein_coding	OTTHUMT00000449763.1	45	0.00	0	G	NM_001257964		54815025	54815025	+1	no_errors	ENST00000585477	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.000	T
BRCA1	672	genome.wustl.edu	37	17	41244479	41244479	+	Silent	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr17:41244479C>T	ENST00000357654.3	-	10	3187	c.3069G>A	c.(3067-3069)gtG>gtA	p.V1023V	BRCA1_ENST00000354071.3_Silent_p.V1023V|BRCA1_ENST00000468300.1_Intron|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000351666.3_Intron|BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000471181.2_Silent_p.V1023V|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000493795.1_Silent_p.V976V|BRCA1_ENST00000309486.4_Silent_p.V727V|BRCA1_ENST00000346315.3_Silent_p.V1023V|BRCA1_ENST00000352993.3_Intron|BRCA1_ENST00000491747.2_Intron	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1023					androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		TAATTGTGCTCACTGTACTTG	0.348			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													129.0	124.0	126.0					17																	41244479		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.3069G>A	17.37:g.41244479C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Silent	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.V1023	ENST00000357654.3	37	c.3069	CCDS11453.1	17																																																																																			BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.348	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	93	0.00	0	C	NM_007294		41244479	41244479	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	silent	29	51.67	31	SNP	0.009	T
C2CD3	26005	genome.wustl.edu	37	11	73745615	73745615	+	Intron	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr11:73745615G>T	ENST00000334126.7	-	31	6108				C2CD3_ENST00000542452.1_5'Flank|C2CD3_ENST00000313663.7_3'UTR			Q4AC94	C2CD3_HUMAN	C2 calcium-dependent domain containing 3						brain development (GO:0007420)|centriole elongation (GO:0061511)|embryonic digit morphogenesis (GO:0042733)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|neural plate axis specification (GO:0021997)|neural tube development (GO:0021915)|nonmotile primary cilium assembly (GO:0035058)|protein localization to centrosome (GO:0071539)|protein processing (GO:0016485)|regulation of proteolysis (GO:0030162)|regulation of smoothened signaling pathway (GO:0008589)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)				NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(26)|ovary(4)|pancreas(2)|prostate(1)|skin(3)	64	Breast(11;4.16e-06)					TGGGAGTCCTGGTGGGCATGT	0.388																																						dbGAP											0													82.0	81.0	81.0					11																	73745615		2200	4293	6493	-	-	-	SO:0001627	intron_variant	0			BC035599	CCDS31636.1, CCDS66167.1	11q13.4	2014-02-12	2007-10-17		ENSG00000168014	ENSG00000168014			24564	protein-coding gene	gene with protein product		615944					Standard	XM_005273897		Approved	DKFZP586P0123	uc001ouu.2	Q4AC94	OTTHUMG00000168110	ENST00000334126.7:c.5882-292C>A	11.37:g.73745615G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JR55|E2QRD1|Q2NLE1|Q3C1U9|Q6ZU92|Q8IYM4|Q8NB87|Q8NDH7|Q9Y4M2	RNA	SNP	-	NULL	ENST00000334126.7	37	NULL		11																																																																																			C2CD3	-	-	ENSG00000168014		0.388	C2CD3-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2CD3	HGNC	protein_coding		44	0.00	0	G	NM_015531		73745615	73745615	-1	no_errors	ENST00000540452	ensembl	human	putative	69_37n	rna	29	12.12	4	SNP	1.000	T
CD97	976	genome.wustl.edu	37	19	14507268	14507268	+	Missense_Mutation	SNP	A	A	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr19:14507268A>G	ENST00000242786.5	+	5	541	c.461A>G	c.(460-462)gAt>gGt	p.D154G	CD97_ENST00000358600.3_Intron|CD97_ENST00000357355.3_Missense_Mutation_p.D154G|CD97_ENST00000587728.1_Intron	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	154	EGF-like 3; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						ATACCTGAGGATCCGAAGGTC	0.607																																						dbGAP											0													126.0	101.0	109.0					19																	14507268		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.461A>G	19.37:g.14507268A>G	ENSP00000242786:p.Asp154Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_secretin-like,prints_GPCR_2_EMR1_rcpt	p.D154G	ENST00000242786.5	37	c.461	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	a	7.798	0.712959	0.15306	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000393059	D;D	0.92249	-3.0;-3.0	4.09	0.14	0.14804	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	.	.	.	.	T	0.78898	0.4356	N	0.05012	-0.13	0.09310	N	0.999999	B;B	0.27351	0.005;0.176	B;B	0.27262	0.005;0.078	T	0.67738	-0.5593	9	0.42905	T	0.14	.	2.6456	0.04983	0.4883:0.0:0.3093:0.2023	.	154;154	P48960-3;P48960	.;CD97_HUMAN	G	154;154;153	ENSP00000242786:D154G;ENSP00000349918:D154G	ENSP00000242786:D154G	D	+	2	0	CD97	14368268	0.001000	0.12720	0.012000	0.15200	0.008000	0.06430	0.544000	0.23253	-0.233000	0.09797	0.454000	0.30748	GAT	CD97	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000123146		0.607	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2	154	0.00	0	A	NM_078481		14507268	14507268	+1	no_errors	ENST00000242786	ensembl	human	known	69_37n	missense	108	29.68	46	SNP	0.003	G
CDH1	999	genome.wustl.edu	37	16	68847304	68847304	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr16:68847304G>A	ENST00000261769.5	+	9	1417	c.1226G>A	c.(1225-1227)tGg>tAg	p.W409*	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Intron|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	409	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.Y380_K440del(2)|p.?(1)|p.T406fs*6(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ACCCCAGCGTGGGAGGCTGTA	0.473			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Deletion - In frame(2)|Unknown(1)|Deletion - Frameshift(1)	breast(3)|stomach(1)											201.0	171.0	181.0					16																	68847304		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1226G>A	16.37:g.68847304G>A	ENSP00000261769:p.Trp409*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.W409*	ENST00000261769.5	37	c.1226	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	22.7	4.327823	0.81690	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794	.	.	.	6.04	5.09	0.68999	.	0.000000	0.47852	D	0.000202	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0899	0.72185	0.0683:0.0:0.9317:0.0	.	.	.	.	X	409	.	ENSP00000261769:W409X	W	+	2	0	CDH1	67404805	1.000000	0.71417	0.567000	0.28434	0.028000	0.11728	6.780000	0.75063	1.571000	0.49722	0.561000	0.74099	TGG	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000039068		0.473	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	74	0.00	0	G	NM_004360		68847304	68847304	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	21	62.50	35	SNP	1.000	A
CDKN2A	1029	genome.wustl.edu	37	9	21971122	21971123	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr9:21971122_21971123delGT	ENST00000304494.5	-	2	505_506	c.235_236delAC	c.(235-237)accfs	p.T79fs	CDKN2A_ENST00000361570.3_Frame_Shift_Del_p.H134fs|RP11-145E5.5_ENST00000404796.2_Intron|CDKN2A_ENST00000578845.2_Frame_Shift_Del_p.T28fs|CDKN2A_ENST00000494262.1_Frame_Shift_Del_p.T28fs|CDKN2A_ENST00000446177.1_Frame_Shift_Del_p.T79fs|CDKN2A_ENST00000498628.2_Frame_Shift_Del_p.T28fs|CDKN2A_ENST00000479692.2_Frame_Shift_Del_p.T28fs|CDKN2A_ENST00000530628.2_Frame_Shift_Del_p.H93fs|CDKN2A_ENST00000579755.1_Frame_Shift_Del_p.H93fs|CDKN2A_ENST00000497750.1_Frame_Shift_Del_p.T28fs|CDKN2A_ENST00000498124.1_Frame_Shift_Del_p.T79fs|CDKN2A_ENST00000579122.1_Frame_Shift_Del_p.T79fs	NM_000077.4	NP_000068.1	P42771	CD2A1_HUMAN	cyclin-dependent kinase inhibitor 2A	79					cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular senescence (GO:2000774)|positive regulation of macrophage apoptotic process (GO:2000111)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|Ras protein signal transduction (GO:0007265)|replicative senescence (GO:0090399)|senescence-associated heterochromatin focus assembly (GO:0035986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|senescence-associated heterochromatin focus (GO:0035985)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)	p.0?(1315)|p.?(44)|p.T79I(2)|p.L65fs*38(1)|p.T79fs*37(1)|p.0(1)|p.A76fs*64(1)|p.T79fs*65(1)|p.T79fs*41(1)|p.E61_L94del(1)|p.A68fs*3(1)		NS(28)|adrenal_gland(6)|autonomic_ganglia(11)|biliary_tract(74)|bone(84)|breast(46)|central_nervous_system(522)|cervix(23)|endometrium(14)|eye(4)|genital_tract(15)|haematopoietic_and_lymphoid_tissue(698)|kidney(39)|large_intestine(11)|liver(92)|lung(365)|meninges(18)|oesophagus(239)|ovary(98)|pancreas(263)|pleura(94)|prostate(13)|salivary_gland(10)|skin(541)|small_intestine(1)|soft_tissue(93)|stomach(48)|thymus(4)|thyroid(24)|upper_aerodigestive_tract(436)|urinary_tract(283)|vulva(2)	4199		all_cancers(5;0)|Acute lymphoblastic leukemia(3;0)|all_hematologic(3;0)|all_epithelial(2;2.37e-290)|Lung NSC(2;1.26e-139)|all_lung(2;4.48e-131)|Glioma(2;3.26e-60)|all_neural(2;2.1e-52)|Renal(3;1.07e-46)|Esophageal squamous(3;3.83e-46)|Melanoma(2;2.74e-34)|Breast(3;1.14e-11)|Ovarian(3;0.000128)|Hepatocellular(5;0.00162)|Colorectal(97;0.172)		all cancers(2;0)|GBM - Glioblastoma multiforme(3;0)|Lung(2;4.07e-74)|Epithelial(2;1.08e-61)|LUSC - Lung squamous cell carcinoma(2;3.82e-48)|LUAD - Lung adenocarcinoma(2;4.56e-26)|OV - Ovarian serous cystadenocarcinoma(39;7.64e-10)|BRCA - Breast invasive adenocarcinoma(2;5.01e-09)|STAD - Stomach adenocarcinoma(4;4.63e-07)|Kidney(2;5.79e-07)|KIRC - Kidney renal clear cell carcinoma(2;7.27e-07)|COAD - Colon adenocarcinoma(8;5.15e-05)		CACGGGTCGGGTGAGAGTGGCG	0.728		17								HNSCC(2;<9.43e_08)|TSP Lung(5;3.83e-07)																												dbGAP											1369	Whole gene deletion(1316)|Unknown(44)|Deletion - Frameshift(5)|Substitution - Missense(2)|Deletion - In frame(1)|Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(283)|skin(174)|central_nervous_system(168)|lung(145)|urinary_tract(91)|bone(75)|soft_tissue(57)|oesophagus(55)|pleura(51)|upper_aerodigestive_tract(49)|ovary(36)|kidney(32)|breast(32)|pancreas(31)|thyroid(13)|biliary_tract(13)|NS(12)|stomach(12)|autonomic_ganglia(7)|meninges(7)|large_intestine(6)|liver(6)|salivary_gland(4)|thymus(4)|vulva(2)|endometrium(2)|prostate(2)																																								-	-	-	SO:0001589	frameshift_variant	0			L27211	CCDS6510.1, CCDS6511.1, CCDS6511.2, CCDS56565.1	9p21	2014-09-17	2012-03-08		ENSG00000147889	ENSG00000147889			1787	protein-coding gene	gene with protein product		600160	"""cyclin-dependent kinase inhibitor 2A (melanoma, p16, inhibits CDK4)"""	CDKN2, MLM		8152487, 7606716	Standard	NM_058195		Approved	CDK4I, p16, INK4a, MTS1, CMM2, ARF, p19, p14, INK4, p16INK4a, p19Arf	uc003zpk.3	P42771	OTTHUMG00000019686	ENST00000304494.5:c.235_236delAC	9.37:g.21971122_21971123delGT	ENSP00000307101:p.Thr79fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5X2G7|D3DRK1|O95440|Q15191|Q5VVJ5|Q96B52|Q9NP05	Frame_Shift_Del	DEL	pfam_Cyclin_kinase-Inhib_2A	p.H134fs	ENST00000304494.5	37	c.402_401	CCDS6510.1	9																																																																																			CDKN2A	-	NULL	ENSG00000147889		0.728	CDKN2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CDKN2A	HGNC	protein_coding	OTTHUMT00000051915.1	22	0.00	0	GT	NM_000077		21971122	21971123	-1	no_errors	ENST00000361570	ensembl	human	known	69_37n	frame_shift_del	1	80.00	4	DEL	1.000:0.999	-
CHSY3	337876	genome.wustl.edu	37	5	129520290	129520290	+	Silent	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr5:129520290G>A	ENST00000305031.4	+	3	1813	c.1455G>A	c.(1453-1455)caG>caA	p.Q485Q		NM_175856.4	NP_787052.3	Q70JA7	CHSS3_HUMAN	chondroitin sulfate synthase 3	485					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|urinary_tract(1)	28		all_cancers(142;0.0227)|Breast(839;0.198)|Prostate(80;0.215)|Lung NSC(810;0.239)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.136)		CCCCTCGACAGAGCCTCAGTA	0.498																																						dbGAP											0													49.0	48.0	48.0					5																	129520290		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB086062	CCDS34223.1	5q13	2013-02-19			ENSG00000198108	ENSG00000198108	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	24293	protein-coding gene	gene with protein product		609963				12907687	Standard	XM_005271982		Approved	CSS3, CHSY-2	uc003kvd.3	Q70JA7	OTTHUMG00000163043	ENST00000305031.4:c.1455G>A	5.37:g.129520290G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP97|Q76L22|Q86Y52	Silent	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.Q485	ENST00000305031.4	37	c.1455	CCDS34223.1	5																																																																																			CHSY3	-	pfam_Chond_GalNAc	ENSG00000198108		0.498	CHSY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY3	HGNC	protein_coding	OTTHUMT00000371453.1	52	0.00	0	G	NM_175856		129520290	129520290	+1	no_errors	ENST00000305031	ensembl	human	known	69_37n	silent	20	42.86	15	SNP	1.000	A
CMTM5	116173	genome.wustl.edu	37	14	23847889	23847889	+	Silent	SNP	C	C	T	rs188528711	byFrequency	TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr14:23847889C>T	ENST00000339180.4	+	3	507	c.291C>T	c.(289-291)caC>caT	p.H97H	CMTM5_ENST00000342473.4_Intron|CMTM5_ENST00000359320.3_Intron|CMTM5_ENST00000382809.2_Intron|CMTM5_ENST00000397227.3_Intron|CMTM5_ENST00000555731.1_Intron			Q96DZ9	CKLF5_HUMAN	CKLF-like MARVEL transmembrane domain containing 5	97	MARVEL. {ECO:0000255|PROSITE- ProRule:PRU00581}.				chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(4)|prostate(1)|stomach(1)	8	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.0064)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0382)		TGCAGGGCCACGGGCAATCAG	0.582													C|||	2	0.000399361	0.0008	0.0	5008	,	,		19191	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													39.0	38.0	39.0					14																	23847889		876	1991	2867	-	-	-	SO:0001819	synonymous_variant	0			BC013109	CCDS9598.1, CCDS32050.1, CCDS73617.1, CCDS73618.1, CCDS73619.1	14q11.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000166091	ENSG00000166091			19176	protein-coding gene	gene with protein product		607888	"""chemokine-like factor super family 5"", ""chemokine-like factor superfamily 5"""	CKLFSF5			Standard	NM_138460		Approved	FLJ37521	uc001wjs.3	Q96DZ9	OTTHUMG00000028751	ENST00000339180.4:c.291C>T	14.37:g.23847889C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PH91|Q5PY48	Silent	SNP	NULL	p.H97	ENST00000339180.4	37	c.291		14																																																																																			CMTM5	-	NULL	ENSG00000166091		0.582	CMTM5-003	KNOWN	basic	protein_coding	CMTM5	HGNC	protein_coding	OTTHUMT00000133708.2	65	0.00	0	C			23847889	23847889	+1	no_errors	ENST00000339180	ensembl	human	known	69_37n	silent	41	39.71	27	SNP	0.000	T
COL14A1	7373	genome.wustl.edu	37	8	121290773	121290773	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr8:121290773C>T	ENST00000297848.3	+	28	3707	c.3437C>T	c.(3436-3438)tCa>tTa	p.S1146L	COL14A1_ENST00000247781.3_Missense_Mutation_p.S1051L|COL14A1_ENST00000309791.4_Missense_Mutation_p.S1146L	NM_021110.1	NP_066933.1			collagen, type XIV, alpha 1											NS(1)|autonomic_ganglia(1)|breast(11)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(9)|large_intestine(31)|lung(42)|ovary(5)|pancreas(1)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	119	Lung NSC(37;6.52e-07)|Ovarian(258;0.00769)|Hepatocellular(40;0.161)		OV - Ovarian serous cystadenocarcinoma(1;6.47e-38)|STAD - Stomach adenocarcinoma(47;0.00503)			GATGGAAGATCACAAGATGAT	0.368																																						dbGAP											0													100.0	89.0	93.0					8																	121290773		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34938.1	8q23	2013-02-11	2008-02-04		ENSG00000187955	ENSG00000187955		"""Collagens"", ""Fibronectin type III domain containing"""	2191	protein-coding gene	gene with protein product		120324	"""undulin"""	UND		1716629, 9427527	Standard	NM_021110		Approved		uc003yox.4	Q05707	OTTHUMG00000149877	ENST00000297848.3:c.3437C>T	8.37:g.121290773C>T	ENSP00000297848:p.Ser1146Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VWF_A,pfam_Fibronectin_type3,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.S1146L	ENST00000297848.3	37	c.3437	CCDS34938.1	8	.	.	.	.	.	.	.	.	.	.	C	34	5.332355	0.95733	.	.	ENSG00000187955	ENST00000309791;ENST00000297848;ENST00000247781	D;D;D	0.85861	-2.04;-2.04;-2.04	5.47	5.47	0.80525	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.95655	0.8587	H	0.98048	4.135	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95832	0.8859	10	0.42905	T	0.14	.	19.6901	0.95998	0.0:1.0:0.0:0.0	.	1146	Q05707	COEA1_HUMAN	L	1146;1146;1051	ENSP00000311809:S1146L;ENSP00000297848:S1146L;ENSP00000247781:S1051L	ENSP00000247781:S1051L	S	+	2	0	COL14A1	121359954	1.000000	0.71417	0.996000	0.52242	0.983000	0.72400	7.741000	0.84997	2.718000	0.92993	0.637000	0.83480	TCA	COL14A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000187955		0.368	COL14A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL14A1	HGNC	protein_coding	OTTHUMT00000313657.2	50	0.00	0	C	NM_021110		121290773	121290773	+1	no_errors	ENST00000297848	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	T
CTNNA3	29119	genome.wustl.edu	37	10	67829089	67829089	+	Missense_Mutation	SNP	C	C	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr10:67829089C>A	ENST00000433211.2	-	15	2310	c.2136G>T	c.(2134-2136)atG>atT	p.M712I	CTNNA3_ENST00000373744.4_Missense_Mutation_p.M712I|CTNNA3_ENST00000373735.1_5'UTR	NM_013266.2	NP_037398.2			catenin (cadherin-associated protein), alpha 3											breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|liver(1)|lung(50)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|stomach(1)|urinary_tract(1)	95						TCATCTCCATCATGATCATAC	0.353																																						dbGAP											0													241.0	208.0	219.0					10																	67829089		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091606	CCDS7269.1	10q21	2006-11-24			ENSG00000183230	ENSG00000183230			2511	protein-coding gene	gene with protein product		607667				12596047, 11590244	Standard	XM_005269717		Approved	VR22, MGC26194	uc001jmw.2	Q9UI47	OTTHUMG00000018334	ENST00000433211.2:c.2136G>T	10.37:g.67829089C>A	ENSP00000389714:p.Met712Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	p.M712I	ENST00000433211.2	37	c.2136	CCDS7269.1	10	.	.	.	.	.	.	.	.	.	.	C	24.6	4.544048	0.86022	.	.	ENSG00000183230	ENST00000433211;ENST00000373744;ENST00000373735	T;T;T	0.57752	0.38;0.38;0.38	5.29	5.29	0.74685	.	0.130400	0.51477	D	0.000096	T	0.77329	0.4114	M	0.90198	3.095	0.80722	D	1	P	0.49559	0.925	D	0.67900	0.954	T	0.81577	-0.0869	10	0.62326	D	0.03	-21.1995	16.4194	0.83753	0.0:1.0:0.0:0.0	.	712	Q9UI47	CTNA3_HUMAN	I	712;712;51	ENSP00000389714:M712I;ENSP00000362849:M712I;ENSP00000362840:M51I	ENSP00000362840:M51I	M	-	3	0	CTNNA3	67499095	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.529000	0.81952	2.483000	0.83821	0.591000	0.81541	ATG	CTNNA3	-	pfam_Vinculin/catenin,superfamily_Vinculin/catenin,prints_Alpha_catenin,prints_Vinculin	ENSG00000183230		0.353	CTNNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNA3	HGNC	protein_coding	OTTHUMT00000048282.2	68	0.00	0	C	NM_013266		67829089	67829089	-1	no_errors	ENST00000373744	ensembl	human	known	69_37n	missense	66	10.81	8	SNP	1.000	A
DGKK	139189	genome.wustl.edu	37	X	50135384	50135384	+	RNA	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chrX:50135384C>T	ENST00000376025.2	-	0	1718							Q5KSL6	DGKK_HUMAN	diacylglycerol kinase, kappa						blood coagulation (GO:0007596)|diacylglycerol metabolic process (GO:0046339)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			central_nervous_system(1)|endometrium(12)|kidney(4)|large_intestine(5)|lung(18)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Ovarian(276;0.236)					AGACCCAGCTCACGCTGCCAT	0.468																																						dbGAP											0													104.0	96.0	98.0					X																	50135384		2011	4169	6180	-	-	-			0			AB183864	CCDS75980.1	Xp11.22	2006-02-08				ENSG00000274588			32395	protein-coding gene	gene with protein product		300837				16210324	Standard	NM_001013742		Approved		uc010njr.2	Q5KSL6			X.37:g.50135384C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP91	RNA	SNP	-	NULL	ENST00000376025.2	37	NULL		X																																																																																			DGKK	-	-	ENSG00000204466		0.468	DGKK-001	KNOWN	basic	processed_transcript	DGKK	HGNC	processed_transcript	OTTHUMT00000368187.1	86	0.00	0	C	NM_001013742		50135384	50135384	-1	no_errors	ENST00000376025	ensembl	human	known	69_37n	rna	35	16.67	7	SNP	1.000	T
DOCK7	85440	genome.wustl.edu	37	1	63114126	63114126	+	Missense_Mutation	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:63114126G>T	ENST00000340370.5	-	5	496	c.479C>A	c.(478-480)tCt>tAt	p.S160Y	DOCK7_ENST00000251157.5_Missense_Mutation_p.S160Y|DOCK7_ENST00000404627.2_Missense_Mutation_p.S160Y	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	160					activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						AGCTTCATCAGATTCAAAAAC	0.284																																						dbGAP											0													45.0	37.0	40.0					1																	63114126		2197	4290	6487	-	-	-	SO:0001583	missense	0				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.479C>A	1.37:g.63114126G>T	ENSP00000340742:p.Ser160Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.S160Y	ENST00000340370.5	37	c.479	CCDS30734.1	1	.	.	.	.	.	.	.	.	.	.	G	9.951	1.220216	0.22457	.	.	ENSG00000116641	ENST00000371140;ENST00000251157;ENST00000340370;ENST00000404627	T;T;T	0.20738	2.47;2.47;2.05	4.53	4.53	0.55603	.	0.117065	0.64402	D	0.000016	T	0.16428	0.0395	L	0.29908	0.895	0.58432	D	0.999994	B;P;P;P;P	0.47034	0.016;0.889;0.473;0.508;0.659	B;P;B;B;P	0.52267	0.011;0.5;0.273;0.221;0.694	T	0.02546	-1.1143	10	0.28530	T	0.3	.	17.4531	0.87597	0.0:0.0:1.0:0.0	.	160;160;160;160;160	Q96NI0;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3	.;.;.;.;.	Y	160	ENSP00000251157:S160Y;ENSP00000340742:S160Y;ENSP00000384446:S160Y	ENSP00000251157:S160Y	S	-	2	0	DOCK7	62886714	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	9.067000	0.93955	2.333000	0.79357	0.462000	0.41574	TCT	DOCK7	-	NULL	ENSG00000116641		0.284	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	85	0.00	0	G	NM_033407		63114126	63114126	-1	no_errors	ENST00000251157	ensembl	human	known	69_37n	missense	48	41.46	34	SNP	1.000	T
SAMD8	142891	genome.wustl.edu	37	10	76868889	76868889	+	5'Flank	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr10:76868889C>T	ENST00000542569.1	+	0	0				SAMD8_ENST00000372690.3_5'Flank|DUSP13_ENST00000372702.3_Silent_p.L9L|DUSP13_ENST00000372700.3_Silent_p.L9L|DUSP13_ENST00000607009.1_5'UTR|DUSP13_ENST00000491677.2_5'UTR|DUSP13_ENST00000607131.1_5'UTR|SAMD8_ENST00000372687.4_5'Flank	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8						ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					CCTCTCCCCCCAGCTCTGGGA	0.632																																						dbGAP											0													48.0	46.0	47.0					10																	76868889		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515		10.37:g.76868889C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSC5|Q5JSC8|Q66K52	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.L9	ENST00000542569.1	37	c.27	CCDS53543.1	10																																																																																			DUSP13	-	NULL	ENSG00000079393		0.632	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP13	HGNC	protein_coding		56	0.00	0	C	NM_144660		76868889	76868889	-1	no_errors	ENST00000372700	ensembl	human	known	69_37n	silent	28	37.78	17	SNP	0.000	T
DYNC2H1	79659	genome.wustl.edu	37	11	103025249	103025249	+	Missense_Mutation	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr11:103025249C>G	ENST00000375735.2	+	23	3516	c.3372C>G	c.(3370-3372)atC>atG	p.I1124M	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.I1124M	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	1124	Stem. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		CTAAAGATATCGAGAGCTGTG	0.353																																						dbGAP											0													26.0	25.0	25.0					11																	103025249		1806	4073	5879	-	-	-	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.3372C>G	11.37:g.103025249C>G	ENSP00000364887:p.Ile1124Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.I1124M	ENST00000375735.2	37	c.3372	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	C	12.22	1.872433	0.33069	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.62788	-0.0;-0.0	5.16	0.087	0.14448	Dynein heavy chain, domain-2 (1);	0.142020	0.28736	U	0.014318	T	0.49389	0.1554	L	0.41492	1.28	0.40781	D	0.98317	B;P	0.38535	0.308;0.635	B;B	0.38842	0.283;0.272	T	0.44772	-0.9306	10	0.51188	T	0.08	.	9.4953	0.38984	0.0:0.2788:0.0:0.7212	.	1124;1124	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	M	1124	ENSP00000364887:I1124M;ENSP00000381167:I1124M	ENSP00000364887:I1124M	I	+	3	3	DYNC2H1	102530459	1.000000	0.71417	0.999000	0.59377	0.846000	0.48090	2.722000	0.47269	0.015000	0.14971	-0.429000	0.05907	ATC	DYNC2H1	-	pfam_Dynein_heavy_dom-2	ENSG00000187240		0.353	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	48	0.00	0	C	XM_370652		103025249	103025249	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	missense	18	35.71	10	SNP	1.000	G
ENPEP	2028	genome.wustl.edu	37	4	111470954	111470954	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr4:111470954G>A	ENST00000265162.5	+	17	2755	c.2413G>A	c.(2413-2415)Gag>Aag	p.E805K		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	805					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		CTACACTCTTGAGCAATACCA	0.413																																						dbGAP											0													100.0	99.0	99.0					4																	111470954		2203	4300	6503	-	-	-	SO:0001583	missense	0			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.2413G>A	4.37:g.111470954G>A	ENSP00000265162:p.Glu805Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504U2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.E805K	ENST00000265162.5	37	c.2413	CCDS3691.1	4	.	.	.	.	.	.	.	.	.	.	G	11.54	1.669082	0.29604	.	.	ENSG00000138792	ENST00000265162	T	0.05786	3.39	5.27	0.0589	0.14330	.	0.573605	0.20767	N	0.086057	T	0.03915	0.0110	L	0.35487	1.065	0.09310	N	1	B	0.09022	0.002	B	0.14578	0.011	T	0.45234	-0.9275	10	0.13470	T	0.59	.	5.2163	0.15344	0.1404:0.3976:0.3605:0.1015	.	805	Q07075	AMPE_HUMAN	K	805	ENSP00000265162:E805K	ENSP00000265162:E805K	E	+	1	0	ENPEP	111690403	0.000000	0.05858	0.646000	0.29493	0.978000	0.69477	-0.523000	0.06230	0.208000	0.20626	0.655000	0.94253	GAG	ENPEP	-	NULL	ENSG00000138792		0.413	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	HGNC	protein_coding	OTTHUMT00000255747.2	74	0.00	0	G			111470954	111470954	+1	no_errors	ENST00000265162	ensembl	human	known	69_37n	missense	54	35.71	30	SNP	0.060	A
ERBB4	2066	genome.wustl.edu	37	2	212578349	212578349	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr2:212578349G>A	ENST00000342788.4	-	8	1218	c.908C>T	c.(907-909)tCt>tTt	p.S303F	ERBB4_ENST00000436443.1_Missense_Mutation_p.S303F|ERBB4_ENST00000402597.1_Missense_Mutation_p.S303F	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	303	Cys-rich.		S -> Y (in a lung squamous cell carcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.S303F(1)|p.S303Y(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	ACGCACACAAGAACTGGAATC	0.348										TSP Lung(8;0.080)																												dbGAP											2	Substitution - Missense(2)	lung(1)|endometrium(1)											99.0	95.0	96.0					2																	212578349		2203	4300	6503	-	-	-	SO:0001583	missense	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.908C>T	2.37:g.212578349G>A	ENSP00000342235:p.Ser303Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S303F	ENST00000342788.4	37	c.908	CCDS2394.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.9|25.9	4.680321|4.680321	0.88542|0.88542	.|.	.|.	ENSG00000178568|ENSG00000178568	ENST00000260943|ENST00000342788;ENST00000436443;ENST00000402597	.|T;T;T	.|0.31769	.|1.48;1.48;1.48	5.61|5.61	5.61|5.61	0.85477|0.85477	.|Growth factor, receptor (1);Furin-like cysteine-rich domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62648|0.62648	0.2445|0.2445	M|M	0.84585|0.84585	2.705|2.705	0.80722|0.80722	D|D	1|1	.|D;P;D;D;D	.|0.89917	.|1.0;0.913;0.97;1.0;1.0	.|D;P;P;D;D	.|0.91635	.|0.999;0.741;0.716;0.999;0.999	T|T	0.65191|0.65191	-0.6228|-0.6228	5|9	.|.	.|.	.|.	.|.	19.6299|19.6299	0.95698|0.95698	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|303;303;162;303;303	.|Q15303-4;Q15303-2;Q53QS8;Q15303-3;Q15303	.|.;.;.;.;ERBB4_HUMAN	F|F	303|303	.|ENSP00000342235:S303F;ENSP00000403204:S303F;ENSP00000385565:S303F	.|.	L|S	-|-	1|2	0|0	ERBB4|ERBB4	212286594|212286594	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	9.869000|9.869000	0.99810|0.99810	2.639000|2.639000	0.89480|0.89480	0.655000|0.655000	0.94253|0.94253	CTT|TCT	ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Furin-like_Cys-rich_dom,superfamily_Growth_fac_rcpt	ENSG00000178568		0.348	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	41	0.00	0	G	NM_001042599		212578349	212578349	-1	no_errors	ENST00000342788	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	A
FCGR3A	2214	genome.wustl.edu	37	1	161565622	161565622	+	Intron	SNP	A	A	G	rs115243106	byFrequency	TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:161565622A>G	ENST00000540048.1	-	2	94				RP11-25K21.6_ENST00000537821.2_RNA|FCGR2C_ENST00000543859.1_RNA|FCGR2B_ENST00000367962.4_Intron|FCGR2B_ENST00000428605.2_Intron|FCGR2B_ENST00000367960.5_Intron|FCGR2B_ENST00000403078.3_Intron|FCGR2C_ENST00000473530.2_RNA|FCGR2C_ENST00000466542.2_RNA			P08637	FCG3A_HUMAN	Fc fragment of IgG, low affinity IIIa, receptor (CD16a)						Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|regulation of immune response (GO:0050776)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(14)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	24	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	tctggtaaatatttatgttag	0.318													.|||	370	0.0738818	0.0537	0.0865	5008	,	,		17319	0.0397		0.1213	False		,,,				2504	0.0787					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC036723	CCDS1232.1, CCDS44266.1	1q23	2014-09-17	2005-02-02		ENSG00000203747	ENSG00000203747		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3619	protein-coding gene	gene with protein product		146740	"""Fc fragment of IgG, low affinity IIIa, receptor for (CD16)"""	FCGR3, FCG3		2139735	Standard	NM_001127592		Approved	CD16, CD16a	uc001gar.3	P08637	OTTHUMG00000034466	ENST00000540048.1:c.61+34535T>C	1.37:g.161565622A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2N6W9|Q53FJ0|Q53FL6|Q5EBR4|Q65ZM6|Q6PIJ0	RNA	SNP	-	NULL	ENST00000540048.1	37	NULL		1																																																																																			FCGR2C	-	-	ENSG00000244682		0.318	FCGR3A-203	KNOWN	basic|appris_principal	protein_coding	FCGR2C	HGNC	protein_coding		9	0.00	0	A	NM_000569		161565622	161565622	+1	no_errors	ENST00000473530	ensembl	human	known	69_37n	rna	9	40.00	6	SNP	0.036	G
FOXP1	27086	genome.wustl.edu	37	3	71101699	71101699	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr3:71101699G>A	ENST00000318789.4	-	9	1024	c.499C>T	c.(499-501)Cag>Tag	p.Q167*	FOXP1_ENST00000493089.1_Nonsense_Mutation_p.Q167*|FOXP1_ENST00000491238.1_Nonsense_Mutation_p.Q169*|FOXP1_ENST00000484350.1_Intron|FOXP1_ENST00000472382.1_5'UTR|FOXP1_ENST00000475937.1_Nonsense_Mutation_p.Q167*|FOXP1_ENST00000498215.1_Nonsense_Mutation_p.Q167*|FOXP1_ENST00000468577.1_Nonsense_Mutation_p.Q167*	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	167	Gln-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		TCTTTAGGCTGTTTTCCAGCA	0.373			T	PAX5	ALL																																	dbGAP		Dom	yes		3	3p14.1	27086	forkhead box P1		L	0													202.0	180.0	187.0					3																	71101699		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.499C>T	3.37:g.71101699G>A	ENSP00000318902:p.Gln167*	Somatic		WXS	Illumina GAIIx	Phase_IV	A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Nonsense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.Q167*	ENST00000318789.4	37	c.499	CCDS2914.1	3	.	.	.	.	.	.	.	.	.	.	G	38	6.692446	0.97768	.	.	ENSG00000114861	ENST00000318789;ENST00000318796;ENST00000475937;ENST00000339693;ENST00000491238;ENST00000493089;ENST00000498215;ENST00000468577;ENST00000485326;ENST00000497553	.	.	.	5.92	5.92	0.95590	.	0.146358	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	.	20.3206	0.98668	0.0:0.0:1.0:0.0	.	.	.	.	X	167;67;167;167;169;167;167;167;67;67	.	ENSP00000318902:Q167X	Q	-	1	0	FOXP1	71184389	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.849000	0.92178	2.809000	0.96659	0.655000	0.94253	CAG	FOXP1	-	NULL	ENSG00000114861		0.373	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1	130	0.00	0	G	NM_032682		71101699	71101699	-1	no_errors	ENST00000318789	ensembl	human	known	69_37n	nonsense	80	33.88	41	SNP	1.000	A
GABRA6	2559	genome.wustl.edu	37	5	161116116	161116116	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr5:161116116G>A	ENST00000274545.5	+	4	820	c.387G>A	c.(385-387)atG>atA	p.M129I	GABRA6_ENST00000523217.1_Missense_Mutation_p.M119I|RP11-348M17.2_ENST00000521984.1_RNA			Q16445	GBRA6_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 6	129					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	benzodiazepine receptor activity (GO:0008503)|chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|liver(2)|lung(22)|ovary(7)|skin(6)|urinary_tract(2)	57	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)		Acamprosate(DB00659)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)	CTCACAACATGACAACTCCTA	0.383										TCGA Ovarian(5;0.080)																												dbGAP											0													65.0	65.0	65.0					5																	161116116		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4356.1	5q34	2012-06-22			ENSG00000145863	ENSG00000145863		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4080	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 6"""	137143				8020978	Standard	NM_000811		Approved		uc003lyu.2	Q16445	OTTHUMG00000130351	ENST00000274545.5:c.387G>A	5.37:g.161116116G>A	ENSP00000274545:p.Met129Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K096|Q4VAV2	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa6_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.M129I	ENST00000274545.5	37	c.387	CCDS4356.1	5	.	.	.	.	.	.	.	.	.	.	G	15.85	2.955462	0.53293	.	.	ENSG00000145863	ENST00000274545;ENST00000523217;ENST00000517823;ENST00000523691	T;T;T;T	0.76839	-1.05;-1.05;-1.05;-1.05	5.65	5.65	0.86999	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	T	0.77994	0.4214	N	0.16166	0.38	0.80722	D	1	D	0.59767	0.986	D	0.64877	0.93	T	0.73183	-0.4063	10	0.16420	T	0.52	.	20.0965	0.97849	0.0:0.0:1.0:0.0	.	129	Q16445	GBRA6_HUMAN	I	129;119;76;24	ENSP00000274545:M129I;ENSP00000430527:M119I;ENSP00000430212:M76I;ENSP00000427989:M24I	ENSP00000274545:M129I	M	+	3	0	GABRA6	161048694	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.695000	0.98691	2.824000	0.97209	0.655000	0.94253	ATG	GABRA6	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000145863		0.383	GABRA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA6	HGNC	protein_coding	OTTHUMT00000252707.2	55	0.00	0	G			161116116	161116116	+1	no_errors	ENST00000274545	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	1.000	A
GAS7	8522	genome.wustl.edu	37	17	9843517	9843517	+	Splice_Site	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr17:9843517C>G	ENST00000432992.2	-	8	892	c.732G>C	c.(730-732)agG>agC	p.R244S	GAS7_ENST00000396115.2_Intron|GAS7_ENST00000580865.1_Splice_Site_p.R104S|GAS7_ENST00000583882.1_Intron|GAS7_ENST00000542249.1_Splice_Site_p.R180S|GAS7_ENST00000437099.2_Splice_Site_p.R180S|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000579158.1_Splice_Site_p.R180S|GAS7_ENST00000323816.4_Splice_Site_p.R184S|GAS7_ENST00000585266.1_Splice_Site_p.R184S	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7	244	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						CAATCTTTATCCTGCAAAGAG	0.527			T	MLL	AML*																																	dbGAP		Dom	yes		17	17p	8522	growth arrest-specific 7		L	0													155.0	140.0	145.0					17																	9843517		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.732-1G>C	17.37:g.9843517C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	Missense_Mutation	SNP	pfam_FCH,pfam_WW_Rsp5_WWP,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_WW_Rsp5_WWP,smart_SH3_domain,smart_WW_Rsp5_WWP,smart_FCH,pfscan_FCH,pfscan_SH3_domain,pfscan_WW_Rsp5_WWP	p.R244S	ENST00000432992.2	37	c.732	CCDS11152.1	17	.	.	.	.	.	.	.	.	.	.	C	22.1	4.244486	0.79912	.	.	ENSG00000007237	ENST00000323816;ENST00000396115;ENST00000437099;ENST00000432992;ENST00000537970;ENST00000541114	T;T	0.54279	0.96;0.58	4.88	3.91	0.45181	Fps/Fes/Fer/CIP4 homology (3);	0.000000	0.85682	D	0.000000	T	0.73729	0.3624	M	0.89095	3.005	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.998	T	0.77175	-0.2684	9	.	.	.	.	10.7653	0.46291	0.0:0.9063:0.0:0.0937	.	196;184;104;244	B7Z2L1;A8KAC2;O60861-2;O60861	.;.;.;GAS7_HUMAN	S	244;184;183;104;184;58	ENSP00000322608:R244S;ENSP00000379421:R184S	.	R	-	3	2	GAS7	9784242	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	3.256000	0.51492	2.696000	0.92011	0.655000	0.94253	AGG	GAS7	-	pfam_FCH,smart_FCH,pfscan_FCH	ENSG00000007237		0.527	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS7	HGNC	protein_coding	OTTHUMT00000439883.1	93	0.00	0	C	NM_003644, NM_201432, NM_201433	Missense_Mutation	9843517	9843517	-1	no_errors	ENST00000432992	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	G
GMIP	51291	genome.wustl.edu	37	19	19740898	19740898	+	Silent	SNP	C	C	T	rs531697199		TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr19:19740898C>T	ENST00000203556.4	-	21	2924	c.2787G>A	c.(2785-2787)ccG>ccA	p.P929P	GMIP_ENST00000587238.1_Silent_p.P903P|LPAR2_ENST00000586703.1_5'Flank|LPAR2_ENST00000589311.1_5'Flank|LPAR2_ENST00000542587.1_5'Flank|LPAR2_ENST00000407877.3_5'Flank|GMIP_ENST00000445806.2_Silent_p.P900P	NM_016573.2	NP_057657.2	Q9P107	GMIP_HUMAN	GEM interacting protein	929					intracellular signal transduction (GO:0035556)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|intracellular (GO:0005622)	metal ion binding (GO:0046872)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(6)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						GCTTGGGCAGCGGGGTGCGGC	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		14529	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													11.0	12.0	12.0					19																	19740898		2197	4293	6490	-	-	-	SO:0001819	synonymous_variant	0			AF132541	CCDS12408.1, CCDS74318.1	19p13.11	2011-09-07				ENSG00000089639		"""Rho GTPase activating proteins"""	24852	protein-coding gene	gene with protein product		609694				12093360, 16086184	Standard	XM_005259927		Approved	ARHGAP46	uc002nnd.3	Q9P107		ENST00000203556.4:c.2787G>A	19.37:g.19740898C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVN9|B7ZLZ0	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.P929	ENST00000203556.4	37	c.2787	CCDS12408.1	19																																																																																			GMIP	-	NULL	ENSG00000089639		0.682	GMIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GMIP	HGNC	protein_coding	OTTHUMT00000460551.1	59	0.00	0	C	NM_016573		19740898	19740898	-1	no_errors	ENST00000203556	ensembl	human	known	69_37n	silent	37	38.33	23	SNP	0.003	T
GON4L	54856	genome.wustl.edu	37	1	155785776	155785777	+	Intron	INS	-	-	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:155785776_155785777insA	ENST00000368331.1	-	8	1114				GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000361040.5_Intron|GON4L_ENST00000437809.1_Intron|GON4L_ENST00000271883.5_Intron	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					AAGCAGGGCAGAAAAAAAAAAA	0.351																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1066-85->T	1.37:g.155785787_155785787dupA		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	RNA	INS	-	NULL	ENST00000368331.1	37	NULL		1																																																																																			GON4L	-	-	ENSG00000116580		0.351	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		12	0.00	0	-	NM_032292		155785776	155785777	-1	no_errors	ENST00000471341	ensembl	human	known	69_37n	rna	15	11.76	2	INS	0.000:0.000	A
GRK5	2869	genome.wustl.edu	37	10	121201555	121201555	+	Nonsense_Mutation	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr10:121201555G>T	ENST00000392870.2	+	11	1341	c.1012G>T	c.(1012-1014)Gag>Tag	p.E338*	GRK5_ENST00000369108.3_Nonsense_Mutation_p.E233*	NM_005308.2	NP_005299.1	P34947	GRK5_HUMAN	G protein-coupled receptor kinase 5	338	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|tachykinin receptor signaling pathway (GO:0007217)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|phospholipid binding (GO:0005543)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)			endometrium(2)|large_intestine(5)|lung(15)|skin(3)|stomach(1)|urinary_tract(1)	27		Lung NSC(174;0.0971)|all_lung(145;0.127)|Ovarian(717;0.249)		all cancers(201;0.0227)		GAAGATCCCCGAGGGAGACCT	0.652																																						dbGAP											0													90.0	83.0	85.0					10																	121201555		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L15388	CCDS7612.1	10q26.11	2013-09-19	2004-02-04	2004-02-06	ENSG00000198873	ENSG00000198873			4544	protein-coding gene	gene with protein product		600870		GPRK5		7685906	Standard	NM_005308		Approved		uc001led.3	P34947	OTTHUMG00000019149	ENST00000392870.2:c.1012G>T	10.37:g.121201555G>T	ENSP00000376609:p.Glu338*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRD0|Q5T059	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom,prints_GPCR_kinase	p.E338*	ENST00000392870.2	37	c.1012	CCDS7612.1	10	.	.	.	.	.	.	.	.	.	.	g	39	7.893471	0.98548	.	.	ENSG00000198873	ENST00000392870;ENST00000369108	.	.	.	5.3	5.3	0.74995	.	0.093152	0.44285	D	0.000466	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-21.4578	18.9687	0.92707	0.0:0.0:1.0:0.0	.	.	.	.	X	338;233	.	ENSP00000358104:E233X	E	+	1	0	GRK5	121191545	1.000000	0.71417	0.945000	0.38365	0.960000	0.62799	9.827000	0.99397	2.477000	0.83638	0.561000	0.74099	GAG	GRK5	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198873		0.652	GRK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK5	HGNC	protein_coding	OTTHUMT00000050652.2	155	0.00	0	G	NM_005308		121201555	121201555	+1	no_errors	ENST00000392870	ensembl	human	known	69_37n	nonsense	35	62.37	58	SNP	1.000	T
GTPBP8	29083	genome.wustl.edu	37	3	112714087	112714087	+	Missense_Mutation	SNP	G	G	C			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr3:112714087G>C	ENST00000383678.2	+	3	623	c.541G>C	c.(541-543)Gag>Cag	p.E181Q	GTPBP8_ENST00000383677.3_Missense_Mutation_p.E148Q|GTPBP8_ENST00000473129.1_Missense_Mutation_p.E31Q|GTPBP8_ENST00000467752.1_Missense_Mutation_p.E70Q	NM_014170.2	NP_054889.2	Q8N3Z3	GTPB8_HUMAN	GTP-binding protein 8 (putative)	181	EngB-type G.				barrier septum assembly (GO:0000917)	mitochondrion (GO:0005739)	GTP binding (GO:0005525)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)	6						TGACATGGTAGAGACCTATCT	0.333																																						dbGAP											0													66.0	70.0	69.0					3																	112714087		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037163	CCDS33820.1, CCDS33821.1	3q13.2	2008-02-05			ENSG00000163607	ENSG00000163607			25007	protein-coding gene	gene with protein product							Standard	NM_014170		Approved	HSPC135	uc003dzn.3	Q8N3Z3	OTTHUMG00000159268	ENST00000383678.2:c.541G>C	3.37:g.112714087G>C	ENSP00000373176:p.Glu181Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE99|A6NN11|A8K0P6|Q5I0Y4	Missense_Mutation	SNP	pfam_GTP_binding_domain,pfam_ProtSyn_GTP-bd,pfam_Fe2_transport_prot_B_N,pfam_SRP_receptor_beta_su,tigrfam_GTP-bd_ribosome_bio_YsxC	p.E181Q	ENST00000383678.2	37	c.541	CCDS33820.1	3	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744578	0.69418	.	.	ENSG00000163607	ENST00000383678;ENST00000383677;ENST00000305485;ENST00000467752;ENST00000473129	T;T;T;T	0.71579	2.26;-0.58;2.26;-0.58	5.81	5.81	0.92471	GTP-binding domain, HSR1-related (1);	0.000000	0.85682	D	0.000000	D	0.84106	0.5399	M	0.73753	2.245	0.58432	D	0.999999	D;D	0.69078	0.976;0.997	P;D	0.68943	0.85;0.961	D	0.85003	0.0901	10	0.72032	D	0.01	-15.7007	18.8571	0.92257	0.0:0.0:1.0:0.0	.	148;181	Q8N3Z3-2;Q8N3Z3	.;GTPB8_HUMAN	Q	181;148;204;70;31	ENSP00000373176:E181Q;ENSP00000373175:E148Q;ENSP00000417632:E70Q;ENSP00000418514:E31Q	ENSP00000303802:E204Q	E	+	1	0	GTPBP8	114196777	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	9.011000	0.93618	2.753000	0.94483	0.655000	0.94253	GAG	GTPBP8	-	pfam_GTP_binding_domain,pfam_ProtSyn_GTP-bd,pfam_Fe2_transport_prot_B_N,pfam_SRP_receptor_beta_su,tigrfam_GTP-bd_ribosome_bio_YsxC	ENSG00000163607		0.333	GTPBP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP8	HGNC	protein_coding	OTTHUMT00000354260.2	49	0.00	0	G	NM_014170		112714087	112714087	+1	no_errors	ENST00000383678	ensembl	human	known	69_37n	missense	21	55.32	26	SNP	1.000	C
MROH2B	133558	genome.wustl.edu	37	5	40998210	40998210	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr5:40998210C>T	ENST00000399564.4	-	42	5152	c.4702G>A	c.(4702-4704)Gag>Aag	p.E1568K	MROH2B_ENST00000506092.2_Missense_Mutation_p.E1123K	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	1568								p.E1568K(1)									AAAGCAGCCTCAGCTGCTCTC	0.468																																						dbGAP											1	Substitution - Missense(1)	lung(1)											190.0	180.0	183.0					5																	40998210		1915	4139	6054	-	-	-	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.4702G>A	5.37:g.40998210C>T	ENSP00000382476:p.Glu1568Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E1568K	ENST00000399564.4	37	c.4702	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	18.12	3.552463	0.65311	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.64085	-0.08;-0.08	4.66	4.66	0.58398	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.49305	D	0.000156	T	0.69043	0.3067	L	0.51422	1.61	0.35544	D	0.803329	D	0.61697	0.99	D	0.69142	0.962	T	0.67094	-0.5757	10	0.10902	T	0.67	.	13.2229	0.59899	0.0:1.0:0.0:0.0	.	1568	Q7Z745	HTRB2_HUMAN	K	1123;1273;1568	ENSP00000441504:E1123K;ENSP00000382476:E1568K	ENSP00000296803:E1273K	E	-	1	0	HEATR7B2	41033967	0.942000	0.31987	0.873000	0.34254	0.834000	0.47266	1.952000	0.40343	2.587000	0.87381	0.655000	0.94253	GAG	HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.468	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	52	0.00	0	C	NM_173489		40998210	40998210	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	missense	43	30.65	19	SNP	0.940	T
HERC2P3	283755	genome.wustl.edu	37	15	20588458	20588458	+	RNA	SNP	G	G	C	rs2291971	byFrequency	TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr15:20588458G>C	ENST00000428453.1	-	0	4292							Q9BVR0	HRC23_HUMAN	hect domain and RLD 2 pseudogene 3								metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(1)|lung(14)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	35						TGCTGGCCATGACTGCAGTGC	0.458																																						dbGAP											0																																										-	-	-			0			AF041081		15q11.2	2010-08-02			ENSG00000180229	ENSG00000180229			4871	pseudogene	pseudogene						9730612	Standard	NR_036432		Approved	D15F37S4, LOC283755	uc001ytg.3	Q9BVR0	OTTHUMG00000157175		15.37:g.20588458G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000428453.1	37	NULL		15																																																																																			HERC2P3	-	-	ENSG00000180229		0.458	HERC2P3-014	KNOWN	basic	processed_transcript	HERC2P3	HGNC	pseudogene	OTTHUMT00000347772.2	17	0.00	0	G	NG_008269		20588458	20588458	-1	no_errors	ENST00000428453	ensembl	human	known	69_37n	rna	16	23.81	5	SNP	0.002	C
HOXB5	3215	genome.wustl.edu	37	17	46670817	46670817	+	Silent	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr17:46670817G>A	ENST00000239151.5	-	1	506	c.228C>T	c.(226-228)ttC>ttT	p.F76F	HOXB-AS3_ENST00000492897.3_RNA|HOXB-AS3_ENST00000480872.1_RNA|HOXB-AS3_ENST00000467155.2_RNA|HOXB-AS3_ENST00000476204.1_RNA|HOXB-AS3_ENST00000466037.2_RNA|HOXB-AS3_ENST00000474040.1_RNA|HOXB-AS3_ENST00000465846.2_RNA|HOXB-AS3_ENST00000481995.1_RNA|HOXB-AS3_ENST00000460041.1_RNA|HOXB3_ENST00000552000.2_Intron|HOXB-AS3_ENST00000477144.1_RNA|HOXB-AS3_ENST00000429755.4_RNA|HOXB-AS3_ENST00000487849.3_RNA|HOXB-AS3_ENST00000474324.1_RNA	NM_002147.3	NP_002138.1	P09067	HXB5_HUMAN	homeobox B5	76					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell differentiation (GO:0045446)	nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			large_intestine(1)|lung(2)	3						CGGGCGCGGGGAAGGCGCGCG	0.692																																						dbGAP											0													12.0	14.0	13.0					17																	46670817		2188	4256	6444	-	-	-	SO:0001819	synonymous_variant	0				CCDS11530.1	17q21.32	2011-06-20	2005-12-22		ENSG00000120075	ENSG00000120075		"""Homeoboxes / ANTP class : HOXL subclass"""	5116	protein-coding gene	gene with protein product		142960	"""homeo box B5"""	HOX2, HOX2A		1973146, 1358459	Standard	NM_002147		Approved		uc002inr.3	P09067	OTTHUMG00000159913	ENST00000239151.5:c.228C>T	17.37:g.46670817G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC69|P09069|Q17RP4	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.F76	ENST00000239151.5	37	c.228	CCDS11530.1	17																																																																																			HOXB5	-	NULL	ENSG00000120075		0.692	HOXB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB5	HGNC	protein_coding	OTTHUMT00000358148.2	43	0.00	0	G			46670817	46670817	-1	no_errors	ENST00000239151	ensembl	human	known	69_37n	silent	45	23.73	14	SNP	1.000	A
HRNR	388697	genome.wustl.edu	37	1	152191390	152191390	+	Silent	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:152191390G>A	ENST00000368801.2	-	3	2790	c.2715C>T	c.(2713-2715)agC>agT	p.S905S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	905					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTCGGCCATAGCTGGGAGACT	0.652																																						dbGAP											0													103.0	115.0	111.0					1																	152191390		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.2715C>T	1.37:g.152191390G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.S905	ENST00000368801.2	37	c.2715	CCDS30859.1	1																																																																																			HRNR	-	NULL	ENSG00000197915		0.652	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	118	0.00	0	G	XM_373868		152191390	152191390	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	silent	68	31.31	31	SNP	0.000	A
IL25	64806	genome.wustl.edu	37	14	23842413	23842413	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr14:23842413G>A	ENST00000329715.2	+	1	344	c.86G>A	c.(85-87)gGa>gAa	p.G29E	IL25_ENST00000397242.2_Missense_Mutation_p.G13E	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	29					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		ATGGTCATGGGAACCCACACC	0.587																																						dbGAP											0													131.0	101.0	111.0					14																	23842413		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.86G>A	14.37:g.23842413G>A	ENSP00000328111:p.Gly29Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3F0|Q8IZV3|Q8WXB0	Missense_Mutation	SNP	pfam_Interleukin-17	p.G29E	ENST00000329715.2	37	c.86	CCDS9597.1	14	.	.	.	.	.	.	.	.	.	.	G	34	5.331640	0.95733	.	.	ENSG00000166090	ENST00000397242;ENST00000329715	T;T	0.68479	-0.19;-0.33	5.55	5.55	0.83447	.	0.000000	0.64402	D	0.000019	T	0.73923	0.3649	L	0.34521	1.04	0.37108	D	0.900229	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78336	-0.2243	10	0.87932	D	0	-25.6587	14.877	0.70501	0.0:0.0:1.0:0.0	.	29;13	Q9H293;Q9H293-2	IL25_HUMAN;.	E	13;29	ENSP00000380417:G13E;ENSP00000328111:G29E	ENSP00000328111:G29E	G	+	2	0	IL25	22912253	0.997000	0.39634	0.990000	0.47175	0.795000	0.44927	3.061000	0.49963	2.894000	0.99253	0.655000	0.94253	GGA	IL25	-	pfam_Interleukin-17	ENSG00000166090		0.587	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL25	HGNC	protein_coding	OTTHUMT00000071789.2	96	0.00	0	G			23842413	23842413	+1	no_errors	ENST00000329715	ensembl	human	known	69_37n	missense	67	27.96	26	SNP	0.978	A
IGHV3-30	28439	genome.wustl.edu	37	14	106791024	106791024	+	RNA	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr14:106791024G>A	ENST00000390613.2	-	0	411									immunoglobulin heavy variable 3-30																		GTAATACACAGCCGTGTCCTC	0.552																																						dbGAP											0													268.0	320.0	303.0					14																	106791024		2102	4236	6338	-	-	-			0			M83134		14q32.33	2012-02-08			ENSG00000211953	ENSG00000270550		"""Immunoglobulins / IGH locus"""	5591	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000152069		14.37:g.106791024G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.A111V	ENST00000390613.2	37	c.332		14																																																																																			IGHV3-30	-	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211953		0.552	IGHV3-30-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-30	HGNC	IG_V_gene	OTTHUMT00000325163.1	311	0.00	0	G	NG_001019		106791024	106791024	-1	no_stop_codon	ENST00000390613	ensembl	human	known	69_37n	missense	235	13.28	36	SNP	0.974	A
JPH2	57158	genome.wustl.edu	37	20	42788490	42788490	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr20:42788490G>A	ENST00000372980.3	-	2	1809	c.937C>T	c.(937-939)Cgc>Tgc	p.R313C		NM_020433.4	NP_065166.2	Q9BR39	JPH2_HUMAN	junctophilin 2	313					calcium ion homeostasis (GO:0055074)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport into cytosol (GO:0060402)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle tissue development (GO:0055024)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	calcium-release channel activity (GO:0015278)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|liver(1)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	32		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			CCCTCGTAGCGGAGGCCACTG	0.667																																						dbGAP											0													56.0	48.0	51.0					20																	42788490		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL034419	CCDS13325.1, CCDS13326.1	20q12-q13.11	2014-09-17			ENSG00000149596	ENSG00000149596			14202	protein-coding gene	gene with protein product		605267				10891348, 10949023	Standard	XM_006723832		Approved	JP-2	uc002xli.1	Q9BR39	OTTHUMG00000033037	ENST00000372980.3:c.937C>T	20.37:g.42788490G>A	ENSP00000362071:p.Arg313Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5X1|O95913|Q5JY74|Q9UJN4	Missense_Mutation	SNP	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.R313C	ENST00000372980.3	37	c.937	CCDS13325.1	20	.	.	.	.	.	.	.	.	.	.	g	18.09	3.545916	0.65198	.	.	ENSG00000149596	ENST00000372980	T	0.45276	0.9	3.1	2.02	0.26589	.	0.062504	0.64402	D	0.000012	T	0.45816	0.1361	L	0.41236	1.265	0.80722	D	1	D	0.76494	0.999	P	0.60682	0.878	T	0.41822	-0.9487	10	0.56958	D	0.05	.	8.0695	0.30680	0.0:0.0:0.4593:0.5407	.	313	Q9BR39	JPH2_HUMAN	C	313	ENSP00000362071:R313C	ENSP00000362071:R313C	R	-	1	0	JPH2	42221904	1.000000	0.71417	0.999000	0.59377	0.773000	0.43773	5.029000	0.64121	1.545000	0.49373	0.298000	0.19748	CGC	JPH2	-	smart_MORN,pirsf_Junctophilin	ENSG00000149596		0.667	JPH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH2	HGNC	protein_coding	OTTHUMT00000080307.1	77	0.00	0	G			42788490	42788490	-1	no_errors	ENST00000372980	ensembl	human	known	69_37n	missense	50	31.51	23	SNP	1.000	A
KCTD3	51133	genome.wustl.edu	37	1	215792314	215792314	+	Missense_Mutation	SNP	G	G	C			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:215792314G>C	ENST00000259154.4	+	16	1943	c.1649G>C	c.(1648-1650)aGa>aCa	p.R550T	KCTD3_ENST00000495537.1_3'UTR	NM_016121.3	NP_057205.2	Q9Y597	KCTD3_HUMAN	potassium channel tetramerization domain containing 3	550					protein homooligomerization (GO:0051260)					breast(4)|endometrium(2)|kidney(1)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)	33				all cancers(67;0.0164)|OV - Ovarian serous cystadenocarcinoma(81;0.019)|GBM - Glioblastoma multiforme(131;0.0862)|Epithelial(68;0.13)		ATGGGCTCAAGACCAAGGCGC	0.433																																						dbGAP											0													133.0	128.0	129.0					1																	215792314		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024547	CCDS1515.1	1q41	2013-06-20	2013-06-20		ENSG00000136636	ENSG00000136636			21305	protein-coding gene	gene with protein product		613272	"""potassium channel tetramerisation domain containing 3"""			10508479	Standard	NM_016121		Approved	NY-REN-45	uc001hks.3	Q9Y597	OTTHUMG00000037019	ENST00000259154.4:c.1649G>C	1.37:g.215792314G>C	ENSP00000259154:p.Arg550Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV15|D3DTA6|Q49AG7|Q504Q9|Q6PJN6|Q8ND58|Q8NDJ0|Q8WX16	Missense_Mutation	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.R550T	ENST00000259154.4	37	c.1649	CCDS1515.1	1	.	.	.	.	.	.	.	.	.	.	G	24.3	4.511309	0.85389	.	.	ENSG00000136636	ENST00000259154	T	0.49720	0.77	5.6	4.69	0.59074	WD40/YVTN repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70613	0.3244	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.996;0.999;0.998;0.99	T	0.76141	-0.3068	10	0.87932	D	0	-20.8545	14.3418	0.66633	0.071:0.0:0.929:0.0	.	302;302;550;550	B7ZAF7;B4DJX2;Q9Y597-2;Q9Y597	.;.;.;KCTD3_HUMAN	T	550	ENSP00000259154:R550T	ENSP00000259154:R550T	R	+	2	0	KCTD3	213858937	1.000000	0.71417	0.328000	0.25416	0.848000	0.48234	9.476000	0.97823	1.357000	0.45904	0.650000	0.86243	AGA	KCTD3	-	smart_WD40_repeat	ENSG00000136636		0.433	KCTD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD3	HGNC	protein_coding	OTTHUMT00000089871.2	90	0.00	0	G	NM_016121		215792314	215792314	+1	no_errors	ENST00000259154	ensembl	human	known	69_37n	missense	121	12.32	17	SNP	0.993	C
KEL	3792	genome.wustl.edu	37	7	142640100	142640100	+	Silent	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr7:142640100G>A	ENST00000355265.2	-	17	2277	c.1803C>T	c.(1801-1803)aaC>aaT	p.N601N		NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	601					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GGAGGGCATGGTTGTCACAGG	0.517																																						dbGAP											0													70.0	64.0	66.0					7																	142640100		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1803C>T	7.37:g.142640100G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV4|Q96RS8|Q99885	Silent	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.N601	ENST00000355265.2	37	c.1803	CCDS34766.1	7																																																																																			KEL	-	pfam_Peptidase_M13_C	ENSG00000197993		0.517	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	HGNC	protein_coding	OTTHUMT00000347671.2	89	0.00	0	G	NM_000420		142640100	142640100	-1	no_errors	ENST00000355265	ensembl	human	known	69_37n	silent	37	43.94	29	SNP	0.000	A
KIF15	56992	genome.wustl.edu	37	3	44826336	44826336	+	Splice_Site	SNP	G	G	T	rs549556281		TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr3:44826336G>T	ENST00000326047.4	+	6	510		c.e6-1			NM_020242.2	NP_064627.1	Q9NS87	KIF15_HUMAN	kinesin family member 15						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|plus-end kinesin complex (GO:0005873)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(5)	36				BRCA - Breast invasive adenocarcinoma(193;0.0099)|KIRC - Kidney renal clear cell carcinoma(197;0.0564)|Kidney(197;0.0707)		CATTTTTTTAGGACCATCTGA	0.299																																						dbGAP											0													30.0	31.0	31.0					3																	44826336		2200	4288	6488	-	-	-	SO:0001630	splice_region_variant	0			AB035898	CCDS33744.1	3p21.31	2008-03-03	2005-03-15	2005-03-17	ENSG00000163808	ENSG00000163808		"""Kinesins"""	17273	protein-coding gene	gene with protein product			"""kinesin-like 7"""	KNSL7		10878014	Standard	NM_020242		Approved	HKLP2, NY-BR-62	uc003cnx.4	Q9NS87	OTTHUMG00000156307	ENST00000326047.4:c.362-1G>T	3.37:g.44826336G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RV9|Q69YL6|Q96JX7|Q9H280	Splice_Site	SNP	-	e6-1	ENST00000326047.4	37	c.362-1	CCDS33744.1	3	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474901	0.84640	.	.	ENSG00000163808	ENST00000326047;ENST00000396031	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7238	0.96153	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIF15	44801340	1.000000	0.71417	0.996000	0.52242	0.970000	0.65996	7.181000	0.77682	2.649000	0.89929	0.561000	0.74099	.	KIF15	-	-	ENSG00000163808		0.299	KIF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF15	HGNC	protein_coding	OTTHUMT00000343831.2	56	0.00	0	G		Intron	44826336	44826336	+1	no_errors	ENST00000326047	ensembl	human	known	69_37n	splice_site	42	38.24	26	SNP	1.000	T
LAMB1	3912	genome.wustl.edu	37	7	107569873	107569873	+	Nonsense_Mutation	SNP	C	C	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr7:107569873C>A	ENST00000222399.6	-	30	4959	c.4729G>T	c.(4729-4731)Gaa>Taa	p.E1577*	LAMB1_ENST00000474380.1_5'Flank|LAMB1_ENST00000393561.1_Nonsense_Mutation_p.E1601*	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	1577	Domain I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CTTTTAGCTTCTTCTAACAAC	0.383																																						dbGAP											0													157.0	138.0	144.0					7																	107569873		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.4729G>T	7.37:g.107569873C>A	ENSP00000222399:p.Glu1577*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14D91	Nonsense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.E1577*	ENST00000222399.6	37	c.4729	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	C	45	11.573190	0.99578	.	.	ENSG00000091136	ENST00000393561;ENST00000222399	.	.	.	5.22	5.22	0.72569	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	.	18.9673	0.92701	0.0:1.0:0.0:0.0	.	.	.	.	X	1601;1577	.	ENSP00000222399:E1577X	E	-	1	0	LAMB1	107357109	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	2.855000	0.48333	2.703000	0.92315	0.650000	0.86243	GAA	LAMB1	-	superfamily_Prefoldin	ENSG00000091136		0.383	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	137	0.00	0	C	NM_002291		107569873	107569873	-1	no_errors	ENST00000222399	ensembl	human	known	69_37n	nonsense	61	54.81	74	SNP	1.000	A
LINC00283	100874057	genome.wustl.edu	37	13	103396941	103396941	+	RNA	SNP	G	G	C			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr13:103396941G>C	ENST00000430111.1	+	0	1314									long intergenic non-protein coding RNA 283																		TGCACTATGTGAGACAAATTC	0.403																																						dbGAP											0													132.0	110.0	117.0					13																	103396941		692	1591	2283	-	-	-			0					13q33.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000231633	ENSG00000231633		"""Long non-coding RNAs"""	38809	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 283"""	NCRNA00283			Standard			Approved				OTTHUMG00000017311		13.37:g.103396941G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000430111.1	37	NULL		13																																																																																			LINC00283	-	-	ENSG00000231633		0.403	LINC00283-001	KNOWN	not_organism_supported|basic	antisense	LINC00283	HGNC	antisense	OTTHUMT00000045714.1	75	0.00	0	G			103396941	103396941	+1	no_errors	ENST00000430111	ensembl	human	known	69_37n	rna	38	37.70	23	SNP	0.000	C
LPA	4018	genome.wustl.edu	37	6	161071404	161071404	+	Nonsense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr6:161071404G>A	ENST00000316300.5	-	2	219	c.175C>T	c.(175-177)Caa>Taa	p.Q59*	LPA_ENST00000447678.1_Nonsense_Mutation_p.Q59*			P08519	APOA_HUMAN	lipoprotein, Lp(a)	2567	Kringle 1. {ECO:0000255|PROSITE- ProRule:PRU00121}.				blood circulation (GO:0008015)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|negative regulation of endopeptidase activity (GO:0010951)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|plasma lipoprotein particle (GO:0034358)	apolipoprotein binding (GO:0034185)|endopeptidase inhibitor activity (GO:0004866)|fibronectin binding (GO:0001968)|heparin binding (GO:0008201)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|lung(54)|ovary(4)|pancreas(1)|prostate(2)|skin(10)|stomach(1)|urinary_tract(1)	107		Breast(66;0.000496)|Ovarian(120;0.0303)|Prostate(117;0.0965)		OV - Ovarian serous cystadenocarcinoma(65;2.5e-17)|BRCA - Breast invasive adenocarcinoma(81;6.48e-06)	Aminocaproic Acid(DB00513)	CTATTATGTTGATGTGGTGTC	0.438																																						dbGAP											0													256.0	269.0	265.0					6																	161071404		2199	4300	6499	-	-	-	SO:0001587	stop_gained	0			X06290	CCDS43523.1	6q25-q26	2012-10-02			ENSG00000198670	ENSG00000198670			6667	protein-coding gene	gene with protein product		152200		LP		3670400	Standard	NM_005577		Approved		uc003qtl.3	P08519	OTTHUMG00000015956	ENST00000316300.5:c.175C>T	6.37:g.161071404G>A	ENSP00000321334:p.Gln59*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTD7|Q9UD88	Nonsense_Mutation	SNP	pfam_Kringle,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.Q59*	ENST00000316300.5	37	c.175	CCDS43523.1	6	.	.	.	.	.	.	.	.	.	.	g	8.230	0.804503	0.16467	.	.	ENSG00000198670	ENST00000316300;ENST00000447678	.	.	.	2.57	-5.13	0.02884	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	.	0.203	0.00147	0.2522:0.1587:0.2462:0.3429	.	.	.	.	X	59	.	ENSP00000321334:Q59X	Q	-	1	0	LPA	160991394	0.000000	0.05858	0.010000	0.14722	0.011000	0.07611	-1.837000	0.01689	-1.643000	0.01519	-0.424000	0.05967	CAA	LPA	-	pfam_Kringle,superfamily_Kringle-like,smart_Kringle,pfscan_Kringle	ENSG00000198670		0.438	LPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPA	HGNC	protein_coding	OTTHUMT00000042957.1	236	0.00	0	G	NM_005577		161071404	161071404	-1	no_errors	ENST00000316300	ensembl	human	known	69_37n	nonsense	146	35.68	81	SNP	0.063	A
LPPR4	9890	genome.wustl.edu	37	1	99772371	99772371	+	Silent	SNP	A	A	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:99772371A>T	ENST00000370185.3	+	7	2594	c.2097A>T	c.(2095-2097)ggA>ggT	p.G699G	LPPR4_ENST00000370184.1_Silent_p.G541G|LPPR4_ENST00000457765.1_Silent_p.G641G	NM_014839.4	NP_055654.2	Q7Z2D5	LPPR4_HUMAN		699					axonogenesis (GO:0007409)|inner ear development (GO:0048839)|phospholipid dephosphorylation (GO:0046839)	integral component of plasma membrane (GO:0005887)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(39)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	72		all_epithelial(167;3.54e-06)|all_lung(203;0.00139)|Lung NSC(277;0.00202)		Epithelial(280;0.0736)|all cancers(265;0.0975)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)|Colorectal(170;0.22)		ACCACCACGGAATTACCACCA	0.527																																						dbGAP											0													72.0	63.0	66.0					1																	99772371		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000370185.3:c.2097A>T	1.37:g.99772371A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPS1|O75043|Q5T9R9|Q86XQ5|Q8N3F1|Q96MP0	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.G699	ENST00000370185.3	37	c.2097	CCDS757.1	1																																																																																			RP4-788L13.1	-	NULL	ENSG00000117600		0.527	LPPR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR4	Clone_based_vega_gene	protein_coding	OTTHUMT00000029670.2	51	0.00	0	A			99772371	99772371	+1	no_errors	ENST00000370185	ensembl	human	known	69_37n	silent	32	33.33	16	SNP	0.101	T
LRP2	4036	genome.wustl.edu	37	2	170027154	170027154	+	Missense_Mutation	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr2:170027154C>G	ENST00000263816.3	-	59	11572	c.11287G>C	c.(11287-11289)Gag>Cag	p.E3763Q		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3763	LDL-receptor class A 32. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	CATCGAAACTCGCTCTCTGTG	0.527																																						dbGAP											0													145.0	120.0	128.0					2																	170027154		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11287G>C	2.37:g.170027154C>G	ENSP00000263816:p.Glu3763Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.E3763Q	ENST00000263816.3	37	c.11287	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	C	26.2	4.714879	0.89112	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.95756	-3.8	5.86	5.86	0.93980	.	0.000000	0.85682	D	0.000000	D	0.96784	0.8950	L	0.43554	1.36	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96309	0.9227	10	0.46703	T	0.11	.	20.2019	0.98263	0.0:1.0:0.0:0.0	.	3763	P98164	LRP2_HUMAN	Q	3763;458	ENSP00000263816:E3763Q	ENSP00000263816:E3763Q	E	-	1	0	LRP2	169735400	1.000000	0.71417	1.000000	0.80357	0.490000	0.33462	7.818000	0.86416	2.776000	0.95493	0.655000	0.94253	GAG	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.527	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	57	0.00	0	C	NM_004525		170027154	170027154	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	42	32.26	20	SNP	1.000	G
LY6H	4062	genome.wustl.edu	37	8	144239709	144239709	+	Silent	SNP	G	G	A	rs368121106		TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr8:144239709G>A	ENST00000430474.2	-	4	546	c.381C>T	c.(379-381)ctC>ctT	p.L127L	LY6H_ENST00000342752.4_Silent_p.L148L|LY6H_ENST00000414417.2_Silent_p.L148L	NM_002347.4	NP_002338.3	O94772	LY6H_HUMAN	lymphocyte antigen 6 complex, locus H	127					nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				endometrium(1)|lung(1)|stomach(2)	4	all_cancers(97;6.49e-11)|all_epithelial(106;2.77e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					GGCTGAGCAGGAGCCCCCCGG	0.677																																						dbGAP											0													31.0	38.0	36.0					8																	144239709		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB012293	CCDS6396.1, CCDS47926.1	8q24.3	2008-08-01			ENSG00000176956	ENSG00000176956			6728	protein-coding gene	gene with protein product		603625				9799603	Standard	NM_001130478		Approved	NMLY6	uc011lkb.2	O94772	OTTHUMG00000154890	ENST00000430474.2:c.381C>T	8.37:g.144239709G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAD2|J3KQI0|Q6IAX0	Silent	SNP	pfam_LY6_UPAR,smart_LY6_UPA_recep-like	p.L148	ENST00000430474.2	37	c.444	CCDS6396.1	8																																																																																			LY6H	-	NULL	ENSG00000176956		0.677	LY6H-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LY6H	HGNC	protein_coding	OTTHUMT00000337535.1	46	0.00	0	G			144239709	144239709	-1	no_errors	ENST00000342752	ensembl	human	known	69_37n	silent	26	44.68	21	SNP	0.978	A
MAN2C1	4123	genome.wustl.edu	37	15	75653437	75653437	+	Silent	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr15:75653437C>T	ENST00000267978.5	-	12	1456	c.1410G>A	c.(1408-1410)caG>caA	p.Q470Q	MAN2C1_ENST00000565683.1_Silent_p.Q470Q|MAN2C1_ENST00000569482.1_Silent_p.Q470Q|MAN2C1_ENST00000563622.1_Silent_p.Q371Q|MAN2C1_ENST00000563539.1_5'Flank	NM_006715.3	NP_006706.2	Q9NTJ4	MA2C1_HUMAN	mannosidase, alpha, class 2C, member 1	470					mannose metabolic process (GO:0006013)		alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(4)|kidney(6)|large_intestine(6)|lung(20)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	44						CCAGCATGGTCTGGGTGGGGC	0.647																																						dbGAP											0													41.0	44.0	43.0					15																	75653437		2197	4294	6491	-	-	-	SO:0001819	synonymous_variant	0			AF044414	CCDS32298.1, CCDS58389.1, CCDS58390.1, CCDS58391.1	15q24.2	2013-09-19			ENSG00000140400	ENSG00000140400	3.2.1.24		6827	protein-coding gene	gene with protein product		154580		MANA1, MANA		1757461, 752528	Standard	NM_006715		Approved		uc002bah.4	Q9NTJ4	OTTHUMG00000172698	ENST00000267978.5:c.1410G>A	15.37:g.75653437C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	H3BMX2|H3BQY8|H3BUT6|Q13358|Q68EM8|Q9UL64	Silent	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.Q470	ENST00000267978.5	37	c.1410	CCDS32298.1	15																																																																																			MAN2C1	-	pfam_Glyco_hydro_38_core,superfamily_Glyco_hydro/deAcase_b/a-brl	ENSG00000140400		0.647	MAN2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2C1	HGNC	protein_coding	OTTHUMT00000419965.1	76	0.00	0	C			75653437	75653437	-1	no_errors	ENST00000267978	ensembl	human	known	69_37n	silent	49	39.51	32	SNP	1.000	T
MAP2	4133	genome.wustl.edu	37	2	210570428	210570428	+	Missense_Mutation	SNP	C	C	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr2:210570428C>A	ENST00000360351.4	+	11	5215	c.4709C>A	c.(4708-4710)tCt>tAt	p.S1570Y	MAP2_ENST00000447185.1_Missense_Mutation_p.S1566Y|MAP2_ENST00000361559.4_Missense_Mutation_p.S214Y|MAP2_ENST00000199940.6_Missense_Mutation_p.S271Y|MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000392194.1_Missense_Mutation_p.S214Y	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1570					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.S1570F(1)|p.S271F(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AGTTCTATCTCTTCTTCAGCA	0.418																																					Pancreas(27;423 979 28787 29963)	dbGAP											2	Substitution - Missense(2)	lung(2)											146.0	149.0	148.0					2																	210570428		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4709C>A	2.37:g.210570428C>A	ENSP00000353508:p.Ser1570Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.S1570Y	ENST00000360351.4	37	c.4709	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	C	21.8	4.198247	0.79015	.	.	ENSG00000078018	ENST00000199940;ENST00000360351;ENST00000361559;ENST00000392194;ENST00000447185	T;T;T;T;T	0.21191	2.02;2.92;2.14;2.14;2.92	4.9	4.9	0.64082	.	0.000000	0.53938	D	0.000053	T	0.32376	0.0827	L	0.29908	0.895	0.58432	D	0.999996	D;P;D;D;D	0.89917	1.0;0.946;0.996;0.999;0.998	D;P;D;D;D	0.91635	0.999;0.698;0.982;0.997;0.994	T	0.03898	-1.0994	10	0.11794	T	0.64	-5.4949	17.0645	0.86556	0.0:1.0:0.0:0.0	.	1566;214;215;1570;271	P11137-3;P11137-2;Q59FX9;P11137;Q8IUX2	.;.;.;MAP2_HUMAN;.	Y	271;1570;214;214;1566	ENSP00000199940:S271Y;ENSP00000353508:S1570Y;ENSP00000355290:S214Y;ENSP00000376032:S214Y;ENSP00000392164:S1566Y	ENSP00000199940:S271Y	S	+	2	0	MAP2	210278673	1.000000	0.71417	0.998000	0.56505	0.845000	0.48019	5.882000	0.69714	2.269000	0.75478	0.591000	0.81541	TCT	MAP2	-	NULL	ENSG00000078018		0.418	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	70	0.00	0	C	NM_001039538		210570428	210570428	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	34	41.38	24	SNP	1.000	A
MARS	4141	genome.wustl.edu	37	12	57882184	57882184	+	Intron	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr12:57882184C>T	ENST00000262027.5	+	1	243				MARS_ENST00000447721.2_Intron|ARHGAP9_ENST00000393797.2_Intron|ARHGAP9_ENST00000550288.1_Intron|MARS_ENST00000315473.5_Intron	NM_004990.3	NP_004981.2	P56192	SYMC_HUMAN	methionyl-tRNA synthetase						gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	33			GBM - Glioblastoma multiforme(3;4.27e-41)		L-Methionine(DB00134)	ATATAATACCCTTCCCTTATC	0.507																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X94754	CCDS8942.1	12q13.3	2014-05-06	2007-02-26		ENSG00000166986	ENSG00000166986	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	6898	protein-coding gene	gene with protein product	"""methionine tRNA ligase 1, cytoplasmic"""	156560				10448063, 24482476	Standard	NM_004990		Approved	MetRS, SPG70	uc001sog.3	P56192	OTTHUMG00000169996	ENST00000262027.5:c.109+202C>T	12.37:g.57882184C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVK7|Q14895|Q53H14|Q96A15|Q96BZ0|Q9NSE0	RNA	SNP	-	NULL	ENST00000262027.5	37	NULL	CCDS8942.1	12																																																																																			MARS	-	-	ENSG00000166986		0.507	MARS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS	HGNC	protein_coding	OTTHUMT00000407014.1	47	0.00	0	C	NM_004990		57882184	57882184	+1	no_errors	ENST00000548146	ensembl	human	known	69_37n	rna	52	16.13	10	SNP	0.000	T
MC1R	4157	genome.wustl.edu	37	16	89980978	89980981	+	5'UTR	DEL	GTGG	GTGG	-	rs183901587		TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	GTGG	GTGG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr16:89980978_89980981delGTGG	ENST00000555427.1	+	0	1153_1156				RP11-566K11.7_ENST00000570217.1_RNA			Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)						G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		gcctgtgtgtgtgggtgcctgtgt	0.578									Melanoma, Familial Clustering of																													dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0	Familial Cancer Database			CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555427.1:c.-1148GTGG>-	16.37:g.89980978_89980981delGTGG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	RNA	DEL	-	NULL	ENST00000555427.1	37	NULL		16																																																																																			MC1R	-	-	ENSG00000258839		0.578	MC1R-002	PUTATIVE	basic	protein_coding	MC1R	HGNC	protein_coding	OTTHUMT00000412001.2	40	0.00	0	GTGG	NM_002386		89980978	89980981	+1	no_errors	ENST00000539976	ensembl	human	known	69_37n	rna	10	16.67	2	DEL	0.786:0.744:0.728:0.694	-
MC1R	4157	genome.wustl.edu	37	16	89981125	89981126	+	5'UTR	INS	-	-	TG			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr16:89981125_89981126insTG	ENST00000555427.1	+	0	1300_1301				RP11-566K11.7_ENST00000570217.1_RNA			Q01726	MSHR_HUMAN	melanocortin 1 receptor (alpha melanocyte stimulating hormone receptor)						G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|intracellular signal transduction (GO:0035556)|melanin biosynthetic process (GO:0042438)|multicellular organismal development (GO:0007275)|negative regulation of tumor necrosis factor production (GO:0032720)|pigmentation (GO:0043473)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein kinase C signaling (GO:0090037)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|sensory perception of pain (GO:0019233)|UV protection (GO:0009650)|UV-damage excision repair (GO:0070914)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled peptide receptor activity (GO:0008528)|melanocortin receptor activity (GO:0004977)|melanocyte-stimulating hormone receptor activity (GO:0004980)|ubiquitin protein ligase binding (GO:0031625)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	11		all_cancers(9;1.69e-11)|Lung NSC(15;8.94e-06)|all_lung(18;1.39e-05)|all_neural(9;0.00581)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.0273)		gggtgcacatttgtgtgtgtgt	0.55									Melanoma, Familial Clustering of																													dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0	Familial Cancer Database			CCDS56011.1	16q24.3	2012-10-05			ENSG00000258839	ENSG00000258839		"""GPCR / Class A : Melanocortin receptors"""	6929	protein-coding gene	gene with protein product		155555				8458079	Standard	NM_002386		Approved	MSH-R		Q01726		ENST00000555427.1:c.-1003->TG	16.37:g.89981134_89981135dupTG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q66K38|Q6UR93|Q8WWX6|Q8WWX7|Q96I33|Q96RU4|Q9UBF7|Q9UN58|Q9UN59|Q9UN60|Q9UN61|Q9UN62	RNA	INS	-	NULL	ENST00000555427.1	37	NULL		16																																																																																			MC1R	-	-	ENSG00000258839		0.550	MC1R-002	PUTATIVE	basic	protein_coding	MC1R	HGNC	protein_coding	OTTHUMT00000412001.2	93	0.00	0	-	NM_002386		89981125	89981126	+1	no_errors	ENST00000539976	ensembl	human	known	69_37n	rna	35	12.50	5	INS	0.616:0.614	TG
MCFD2	90411	genome.wustl.edu	37	2	47135039	47135039	+	Silent	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr2:47135039C>T	ENST00000409105.1	-	4	398	c.219G>A	c.(217-219)caG>caA	p.Q73Q	MCFD2_ENST00000319466.4_Silent_p.Q73Q|MCFD2_ENST00000409207.1_Silent_p.Q73Q|MCFD2_ENST00000409218.1_Silent_p.Q73Q|AC016722.4_ENST00000429761.1_RNA|MCFD2_ENST00000409913.1_Silent_p.Q21Q|MCFD2_ENST00000444761.2_Silent_p.Q54Q|MCFD2_ENST00000493804.1_Intron|MCFD2_ENST00000409147.1_Silent_p.Q21Q|MCFD2_ENST00000409973.1_Silent_p.Q73Q|MCFD2_ENST00000409800.1_Silent_p.Q21Q	NM_001171506.2	NP_001164977.1	Q8NI22	MCFD2_HUMAN	multiple coagulation factor deficiency 2	73	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			central_nervous_system(1)|large_intestine(1)|lung(2)	4		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.0792)|LUSC - Lung squamous cell carcinoma(58;0.114)		Antihemophilic Factor(DB00025)	AGTAATGGAGCTGCAATTCTT	0.438																																						dbGAP											0													165.0	143.0	151.0					2																	47135039		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF475284	CCDS33192.1, CCDS54354.1, CCDS54355.1	2p21	2014-09-17			ENSG00000180398	ENSG00000180398		"""EF-hand domain containing"""	18451	protein-coding gene	gene with protein product		607788				12717434, 2463956	Standard	NM_139279		Approved	F5F8D, LMAN1IP, SDNSF	uc021vha.1	Q8NI22	OTTHUMG00000153100	ENST00000409105.1:c.219G>A	2.37:g.47135039C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7W2|D6W5A9|E9PD95|Q53SS3|Q68D61|Q8N3M5	Silent	SNP	pfscan_EF_HAND_2	p.Q73	ENST00000409105.1	37	c.219	CCDS33192.1	2																																																																																			MCFD2	-	NULL	ENSG00000180398		0.438	MCFD2-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	MCFD2	HGNC	protein_coding	OTTHUMT00000329518.1	68	0.00	0	C	NM_139279		47135039	47135039	-1	no_errors	ENST00000319466	ensembl	human	known	69_37n	silent	41	31.67	19	SNP	1.000	T
MS4A3	932	genome.wustl.edu	37	11	59828754	59828754	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr11:59828754C>T	ENST00000278865.3	+	2	194	c.121C>T	c.(121-123)Cca>Tca	p.P41S	MS4A3_ENST00000526199.1_3'UTR|MS4A3_ENST00000534744.1_Missense_Mutation_p.P41S|MS4A3_ENST00000358152.2_Missense_Mutation_p.P41S|MS4A3_ENST00000395032.2_Intron	NM_006138.4	NP_006129.4	Q96HJ5	MS4A3_HUMAN	membrane-spanning 4-domains, subfamily A, member 3 (hematopoietic cell-specific)	41						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				endometrium(4)|kidney(2)|lung(9)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		all_epithelial(135;0.245)				AGATGGATCACCAGATTATCA	0.453																																						dbGAP											0													117.0	111.0	113.0					11																	59828754		2201	4295	6496	-	-	-	SO:0001583	missense	0			L35848	CCDS31567.1, CCDS31568.1, CCDS41651.1	11q12-q13.1	2008-03-25				ENSG00000149516			7317	protein-coding gene	gene with protein product		606498		CD20L		7524084	Standard	NM_006138		Approved	HTM4	uc001nom.3	Q96HJ5		ENST00000278865.3:c.121C>T	11.37:g.59828754C>T	ENSP00000278865:p.Pro41Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTP8|Q8NHW2	Missense_Mutation	SNP	pfam_CD20-like	p.P41S	ENST00000278865.3	37	c.121	CCDS31567.1	11	.	.	.	.	.	.	.	.	.	.	C	9.821	1.185824	0.21870	.	.	ENSG00000149516	ENST00000358152;ENST00000278865;ENST00000534744	T;T;T	0.31247	1.5;3.16;1.5	4.21	2.09	0.27110	.	1.774340	0.02535	N	0.094022	T	0.18467	0.0443	N	0.08118	0	0.09310	N	1	B;B	0.14012	0.009;0.005	B;B	0.16722	0.016;0.007	T	0.17440	-1.0369	10	0.21540	T	0.41	-12.1197	8.5073	0.33195	0.4225:0.5775:0.0:0.0	.	41;41	Q96HJ5-2;Q96HJ5	.;MS4A3_HUMAN	S	41	ENSP00000350872:P41S;ENSP00000278865:P41S;ENSP00000434117:P41S	ENSP00000278865:P41S	P	+	1	0	MS4A3	59585330	0.000000	0.05858	0.005000	0.12908	0.113000	0.19764	0.060000	0.14342	1.049000	0.40321	0.563000	0.77884	CCA	MS4A3	-	NULL	ENSG00000149516		0.453	MS4A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A3	HGNC	protein_coding	OTTHUMT00000394417.1	62	0.00	0	C			59828754	59828754	+1	no_errors	ENST00000278865	ensembl	human	known	69_37n	missense	18	50.00	18	SNP	0.001	T
LINC01317	104355287	genome.wustl.edu	37	2	33953083	33953083	+	lincRNA	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr2:33953083G>T	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							AGGAACTCACGGAGAAAAGGT	0.592																																						dbGAP											0																																										-	-	-			0																															2.37:g.33953083G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-	ENSG00000239649		0.592	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1	25	0.00	0	G			33953083	33953083	-1	no_errors	ENST00000474610	ensembl	human	known	69_37n	rna	13	51.85	14	SNP	0.129	T
NHSL1	57224	genome.wustl.edu	37	6	138754790	138754790	+	Missense_Mutation	SNP	T	T	C			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr6:138754790T>C	ENST00000427025.2	-	5	1332	c.704A>G	c.(703-705)gAt>gGt	p.D235G	MIR3145_ENST00000580727.1_RNA|NHSL1_ENST00000343505.5_Missense_Mutation_p.D231G	NM_020464.1	NP_065197.1	Q5SYE7	NHSL1_HUMAN	NHS-like 1	235										breast(2)|endometrium(4)|kidney(1)	7						TGAGTGGCCATCAGCATCATC	0.502																																						dbGAP											0													33.0	28.0	29.0					6																	138754790		692	1591	2283	-	-	-	SO:0001583	missense	0			AB037778	CCDS47487.1, CCDS55063.1	6q23.3	2009-02-18	2004-10-07	2004-10-07	ENSG00000135540	ENSG00000135540			21021	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 63"""	C6orf63			Standard	NM_001144060		Approved	bA43P8.1, KIAA1357	uc011edp.2	Q5SYE7	OTTHUMG00000016321	ENST00000427025.2:c.704A>G	6.37:g.138754790T>C	ENSP00000394546:p.Asp235Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCS5|Q5SYE8|Q9P2J0	Missense_Mutation	SNP	NULL	p.D235G	ENST00000427025.2	37	c.704	CCDS55063.1	6	.	.	.	.	.	.	.	.	.	.	T	1.666	-0.510181	0.04231	.	.	ENSG00000135540	ENST00000427025;ENST00000343505;ENST00000342260	T;T	0.35973	1.28;1.78	5.54	3.7	0.42460	.	0.390641	0.28895	N	0.013789	T	0.03477	0.0100	N	0.00538	-1.39	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.42999	-0.9418	10	0.22109	T	0.4	-0.267	12.22	0.54429	0.0:0.8631:0.0:0.1369	.	231;235	E2QRJ1;Q5SYE7	.;NHSL1_HUMAN	G	235;231;173	ENSP00000394546:D235G;ENSP00000344672:D231G	ENSP00000344582:D173G	D	-	2	0	NHSL1	138796483	0.070000	0.21116	0.002000	0.10522	0.001000	0.01503	0.759000	0.26461	0.700000	0.31782	-1.064000	0.02280	GAT	NHSL1	-	NULL	ENSG00000135540		0.502	NHSL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	NHSL1	HGNC	protein_coding	OTTHUMT00000043700.2	26	0.00	0	T	XM_050421		138754790	138754790	-1	no_errors	ENST00000427025	ensembl	human	known	69_37n	missense	13	50.00	13	SNP	0.018	C
OR9Q1	219956	genome.wustl.edu	37	11	57947195	57947195	+	Silent	SNP	T	T	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr11:57947195T>G	ENST00000335397.3	+	3	595	c.279T>G	c.(277-279)tcT>tcG	p.S93S		NM_001005212.3	NP_001005212.1	Q8NGQ5	OR9Q1_HUMAN	olfactory receptor, family 9, subfamily Q, member 1	93						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|liver(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	26		Breast(21;0.222)				CAGCTTTATCTTACACACGCT	0.522																																						dbGAP											0													153.0	124.0	134.0					11																	57947195		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065734	CCDS31543.1	11q12.1	2012-08-09				ENSG00000186509		"""GPCR / Class A : Olfactory receptors"""	14724	protein-coding gene	gene with protein product							Standard	NM_001005212		Approved		uc001nmj.3	Q8NGQ5		ENST00000335397.3:c.279T>G	11.37:g.57947195T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAN3|Q96RA7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.S93	ENST00000335397.3	37	c.279	CCDS31543.1	11																																																																																			OR9Q1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186509		0.522	OR9Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR9Q1	HGNC	protein_coding	OTTHUMT00000394538.2	94	0.00	0	T	NM_001005212		57947195	57947195	+1	no_errors	ENST00000335397	ensembl	human	known	69_37n	silent	34	28.57	14	SNP	0.001	G
PDPR	55066	genome.wustl.edu	37	16	70165273	70165273	+	Missense_Mutation	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr16:70165273C>G	ENST00000288050.4	+	8	1755	c.798C>G	c.(796-798)ttC>ttG	p.F266L	PDPR_ENST00000568530.1_Missense_Mutation_p.F266L|PDPR_ENST00000398122.3_Missense_Mutation_p.F166L	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	266					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		GCGAACACTTCTACCTCCTGA	0.512																																						dbGAP											0													20.0	20.0	20.0					16																	70165273		1791	4019	5810	-	-	-	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.798C>G	16.37:g.70165273C>G	ENSP00000288050:p.Phe266Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.F266L	ENST00000288050.4	37	c.798	CCDS45520.1	16	.	.	.	.	.	.	.	.	.	.	C	24.9	4.577725	0.86645	.	.	ENSG00000090857	ENST00000288050;ENST00000398122	T;T	0.81163	-1.46;-1.46	4.94	4.94	0.65067	FAD dependent oxidoreductase (1);	0.000000	0.85682	D	0.000000	D	0.82829	0.5122	L	0.56340	1.77	0.80722	D	1	P	0.40660	0.726	P	0.51297	0.665	T	0.78362	-0.2233	10	0.11794	T	0.64	.	17.1388	0.86748	0.0:1.0:0.0:0.0	.	266	Q8NCN5	PDPR_HUMAN	L	266;166	ENSP00000288050:F266L;ENSP00000381190:F166L	ENSP00000288050:F266L	F	+	3	2	PDPR	68722774	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.497000	0.45354	2.274000	0.75844	0.544000	0.68410	TTC	PDPR	-	pfam_FAD-dep_OxRdtase	ENSG00000090857		0.512	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	163	0.00	0	C	NM_017990		70165273	70165273	+1	no_errors	ENST00000288050	ensembl	human	known	69_37n	missense	60	41.18	42	SNP	1.000	G
PHLDB2	90102	genome.wustl.edu	37	3	111685514	111685514	+	Missense_Mutation	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr3:111685514G>T	ENST00000431670.2	+	14	3543	c.3132G>T	c.(3130-3132)caG>caT	p.Q1044H	PHLDB2_ENST00000393925.3_Missense_Mutation_p.Q1044H|PHLDB2_ENST00000470699.2_3'UTR|PHLDB2_ENST00000495180.1_Missense_Mutation_p.Q535H|PHLDB2_ENST00000393923.3_Missense_Mutation_p.Q1028H|PHLDB2_ENST00000412622.1_Missense_Mutation_p.Q1001H|PHLDB2_ENST00000481953.1_Missense_Mutation_p.Q1001H	NM_001134438.1	NP_001127910.1	Q86SQ0	PHLB2_HUMAN	pleckstrin homology-like domain, family B, member 2	1044						cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(8)|lung(23)|ovary(6)|skin(7)|stomach(1)	55						TTTTGAAGCAGGCTCATGCAG	0.468																																						dbGAP											0													82.0	92.0	89.0					3																	111685514		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2962.1, CCDS46885.1, CCDS46886.1	3q13.13	2013-01-10			ENSG00000144824	ENSG00000144824		"""Pleckstrin homology (PH) domain containing"""	29573	protein-coding gene	gene with protein product		610298				12376540	Standard	NM_145753		Approved	LL5beta, FLJ21791, LL5b	uc003dyg.3	Q86SQ0	OTTHUMG00000159282	ENST00000431670.2:c.3132G>T	3.37:g.111685514G>T	ENSP00000405405:p.Gln1044His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ3|Q59EA8|Q68CY3|Q6NT98|Q8N8U8|Q8NAB1|Q8NCU5	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q1044H	ENST00000431670.2	37	c.3132	CCDS46886.1	3	.	.	.	.	.	.	.	.	.	.	G	21.0	4.081213	0.76528	.	.	ENSG00000144824	ENST00000393923;ENST00000431670;ENST00000412622;ENST00000498699;ENST00000393925;ENST00000481953;ENST00000495180	T;T;T;T;T;T;T	0.47528	0.84;0.84;0.84;0.84;0.84;0.84;0.84	5.63	5.63	0.86233	.	0.059638	0.64402	D	0.000002	T	0.58308	0.2113	L	0.51422	1.61	0.43152	D	0.994928	P;D;D;D;D	0.71674	0.855;0.988;0.988;0.998;0.998	P;P;P;D;D	0.67725	0.459;0.885;0.885;0.953;0.953	T	0.59857	-0.7375	10	0.62326	D	0.03	.	9.0267	0.36234	0.1578:0.0:0.8422:0.0	.	163;535;1044;1001;1028	Q658P8;E9PGF6;Q86SQ0;Q86SQ0-2;Q86SQ0-3	.;.;PHLB2_HUMAN;.;.	H	1028;1044;1001;1001;1044;1001;535	ENSP00000377500:Q1028H;ENSP00000405405:Q1044H;ENSP00000405292:Q1001H;ENSP00000418296:Q1001H;ENSP00000377502:Q1044H;ENSP00000418319:Q1001H;ENSP00000420303:Q535H	ENSP00000377500:Q1028H	Q	+	3	2	PHLDB2	113168204	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.346000	0.33964	2.818000	0.97014	0.591000	0.81541	CAG	PHLDB2	-	NULL	ENSG00000144824		0.468	PHLDB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB2	HGNC	protein_coding	OTTHUMT00000354337.1	40	0.00	0	G	NM_145753		111685514	111685514	+1	no_errors	ENST00000393925	ensembl	human	known	69_37n	missense	40	34.43	21	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936083	178936083	+	Missense_Mutation	SNP	A	A	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr3:178936083A>G	ENST00000263967.3	+	10	1782	c.1625A>G	c.(1624-1626)gAa>gGa	p.E542G		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542V(8)|p.E542A(4)|p.E542G(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	CCTCTCTCTGAAATCACTGAG	0.333		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	13	Substitution - Missense(13)	large_intestine(5)|endometrium(5)|breast(2)|ovary(1)											57.0	57.0	57.0					3																	178936083		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1625A>G	3.37:g.178936083A>G	ENSP00000263967:p.Glu542Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542G	ENST00000263967.3	37	c.1625	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	18.14	3.558430	0.65538	.	.	ENSG00000121879	ENST00000263967	T	0.65178	-0.14	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.56761	0.2007	L	0.37850	1.14	0.80722	D	1	B	0.30634	0.288	B	0.36289	0.221	T	0.53380	-0.8447	10	0.27082	T	0.32	-23.9623	16.1026	0.81194	1.0:0.0:0.0:0.0	.	542	P42336	PK3CA_HUMAN	G	542	ENSP00000263967:E542G	ENSP00000263967:E542G	E	+	2	0	PIK3CA	180418777	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.962000	0.93254	2.198000	0.70561	0.383000	0.25322	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	74	0.00	0	A			178936083	178936083	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	43	33.85	22	SNP	1.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	34	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	1.000	G
PKD1	5310	genome.wustl.edu	37	16	2143825	2143825	+	Missense_Mutation	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr16:2143825C>G	ENST00000262304.4	-	36	11016	c.10808G>C	c.(10807-10809)tGg>tCg	p.W3603S	PKD1_ENST00000423118.1_Missense_Mutation_p.W3602S|RP11-304L19.3_ENST00000565937.1_RNA|RP11-304L19.1_ENST00000570072.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)	3603			W -> R (in PKD1). {ECO:0000269|PubMed:21115670}.		anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CAGTGGCTCCCAGCCGAGGAA	0.682																																						dbGAP											0													9.0	13.0	11.0					16																	2143825		2155	4261	6416	-	-	-	SO:0001583	missense	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795	ENST00000262304.4:c.10808G>C	16.37:g.2143825C>G	ENSP00000262304:p.Trp3603Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15140|Q15141	Missense_Mutation	SNP	pfam_PKD_dom,pfam_PKD1_2_channel,pfam_PKD/REJ-like,pfam_LipOase_LH2,pfam_C-type_lectin,pfam_WSC_carb-bd,pfam_GPS_dom,superfamily_C-type_lectin_fold,superfamily_Lipase_LipOase,superfamily_PKD_dom,superfamily_Fe_hydrogenase,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_WSC_carb-bd_subgr,smart_PKD/Chitinase_dom,smart_C-type_lectin,smart_GPS_dom,smart_LipOase_LH2,pfscan_GPS_dom,pfscan_C-type_lectin,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like,pfscan_WSC_carb-bd,prints_PKD_1,tigrfam_Polycystin_cat	p.W3603S	ENST00000262304.4	37	c.10808	CCDS32369.1	16	.	.	.	.	.	.	.	.	.	.	C	11.74	1.728320	0.30593	.	.	ENSG00000008710	ENST00000262304;ENST00000423118;ENST00000306101	T;T	0.33216	1.42;1.42	3.98	3.01	0.34805	.	0.449391	0.19569	N	0.111132	T	0.48205	0.1487	M	0.67953	2.075	0.50313	D	0.999863	D;D	0.76494	0.999;0.998	D;P	0.73708	0.981;0.899	T	0.34254	-0.9836	10	0.22109	T	0.4	.	11.1562	0.48489	0.3347:0.6653:0.0:0.0	.	3602;3603	P98161-3;P98161	.;PKD1_HUMAN	S	3603;3602;2937	ENSP00000262304:W3603S;ENSP00000399501:W3602S	ENSP00000262304:W3603S	W	-	2	0	PKD1	2083826	1.000000	0.71417	1.000000	0.80357	0.029000	0.11900	3.702000	0.54800	0.781000	0.33589	-0.428000	0.05917	TGG	PKD1	-	NULL	ENSG00000008710		0.682	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKD1	HGNC	protein_coding	OTTHUMT00000341688.1	36	0.00	0	C			2143825	2143825	-1	no_errors	ENST00000262304	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.999	G
PKHD1	5314	genome.wustl.edu	37	6	51612854	51612854	+	Missense_Mutation	SNP	G	G	T	rs550659796		TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr6:51612854G>T	ENST00000371117.3	-	58	9835	c.9560C>A	c.(9559-9561)tCt>tAt	p.S3187Y	PKHD1_ENST00000340994.4_Missense_Mutation_p.S3187Y	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	3187					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TTGTGGAGCAGAAAATACATA	0.413																																						dbGAP											0													115.0	124.0	121.0					6																	51612854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.9560C>A	6.37:g.51612854G>T	ENSP00000360158:p.Ser3187Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.S3187Y	ENST00000371117.3	37	c.9560	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	G	0.036	-1.306004	0.01353	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.87887	-2.1;-2.31	5.75	2.9	0.33743	.	0.407679	0.25590	N	0.029639	T	0.63581	0.2523	L	0.52364	1.645	0.09310	N	1	B;B;B	0.25850	0.067;0.136;0.067	B;B;B	0.19391	0.008;0.025;0.015	T	0.50890	-0.8774	10	0.20046	T	0.44	.	4.3581	0.11188	0.2546:0.0:0.513:0.2324	.	3187;3187;3187	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	Y	3187	ENSP00000360158:S3187Y;ENSP00000341097:S3187Y	ENSP00000341097:S3187Y	S	-	2	0	PKHD1	51720813	0.159000	0.22864	0.291000	0.24904	0.017000	0.09413	2.004000	0.40854	0.724000	0.32296	-0.136000	0.14681	TCT	PKHD1	-	NULL	ENSG00000170927		0.413	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	38	0.00	0	G	NM_138694		51612854	51612854	-1	no_errors	ENST00000371117	ensembl	human	known	69_37n	missense	23	36.11	13	SNP	0.006	T
PKM	5315	genome.wustl.edu	37	15	72492088	72492088	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr15:72492088C>T	ENST00000335181.5	-	11	1602	c.1499G>A	c.(1498-1500)cGa>cAa	p.R500Q	PKM_ENST00000565154.1_Missense_Mutation_p.R500Q|PKM_ENST00000568459.1_Missense_Mutation_p.R500Q|PKM_ENST00000319622.6_Missense_Mutation_p.R500Q|PKM_ENST00000568883.1_Missense_Mutation_p.R335Q|PKM_ENST00000449901.2_Missense_Mutation_p.R485Q|PKM_ENST00000565184.1_Missense_Mutation_p.R500Q|GRAMD2_ENST00000309731.7_5'Flank|PKM_ENST00000389093.3_Missense_Mutation_p.R500Q	NM_002654.4	NP_002645.3	P14618	KPYM_HUMAN	pyruvate kinase, muscle	500	Interaction with POU5F1.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|programmed cell death (GO:0012501)|small molecule metabolic process (GO:0044281)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			endometrium(1)|lung(7)	8					Pyruvic acid(DB00119)	GAAGAAGCCTCGGGCCTTGCC	0.582											OREG0023252	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													47.0	43.0	44.0					15																	72492088		2199	4297	6496	-	-	-	SO:0001583	missense	0			M23725	CCDS32284.1, CCDS32285.1, CCDS55972.1, CCDS73752.1	15q23	2012-10-02		2012-05-23	ENSG00000067225	ENSG00000067225	2.7.1.40		9021	protein-coding gene	gene with protein product		179050		PKM2		2040271	Standard	NM_002654		Approved	THBP1, OIP3, PK3	uc002atr.1	P14618	OTTHUMG00000172709	ENST00000335181.5:c.1499G>A	15.37:g.72492088C>T	ENSP00000334983:p.Arg500Gln	Somatic	1138	WXS	Illumina GAIIx	Phase_IV	A6NFK3|B2R5N8|B3KRY0|B4DFX8|B4DUU6|P14786|Q53GK4|Q96E76|Q9BWB5|Q9UCV6|Q9UPF2	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.R500Q	ENST00000335181.5	37	c.1499	CCDS32284.1	15	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418069	0.62622	.	.	ENSG00000067225	ENST00000319622;ENST00000335181;ENST00000434220;ENST00000327974;ENST00000389093;ENST00000449901	D;D;D;D	0.99005	-5.32;-5.32;-5.32;-5.32	5.33	4.4	0.53042	Pyruvate kinase, C-terminal (2);Pyruvate kinase, alpha/beta (1);	0.000000	0.85682	D	0.000000	D	0.95787	0.8629	N	0.16567	0.415	0.80722	D	1	B;B;B;B;B;P;B;P	0.34522	0.195;0.194;0.409;0.144;0.184;0.455;0.115;0.455	B;B;B;B;B;B;B;B	0.28784	0.04;0.039;0.054;0.017;0.022;0.094;0.027;0.094	D	0.95453	0.8536	10	0.41790	T	0.15	-5.2739	14.9008	0.70678	0.0:0.9273:0.0:0.0727	.	426;485;480;500;500;335;427;335	B4DNK4;B4DUU6;E7EUQ8;P14618;P14618-2;Q504U3;E9PF79;E7EUJ4	.;.;.;KPYM_HUMAN;.;.;.;.	Q	500;500;427;335;500;485	ENSP00000320171:R500Q;ENSP00000334983:R500Q;ENSP00000373745:R500Q;ENSP00000403365:R485Q	ENSP00000320171:R500Q	R	-	2	0	PKM2	70279142	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.082000	0.71318	2.659000	0.90383	0.561000	0.74099	CGA	PKM	-	pfam_Pyrv_Knase_C,superfamily_Pyrv_Knase_C,tigrfam_Pyr_Knase	ENSG00000067225		0.582	PKM-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKM	HGNC	protein_coding	OTTHUMT00000420056.1	23	0.00	0	C			72492088	72492088	-1	no_errors	ENST00000319622	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	1.000	T
PPEF2	5470	genome.wustl.edu	37	4	76797716	76797716	+	Silent	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr4:76797716G>A	ENST00000286719.7	-	11	1400	c.1044C>T	c.(1042-1044)ctC>ctT	p.L348L		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	348	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			GGCTTTCGGGGAGAAACCATG	0.582																																					NSCLC(105;1359 1603 15961 44567 47947)	dbGAP											0													86.0	88.0	87.0					4																	76797716		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1044C>T	4.37:g.76797716G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O14831	Silent	SNP	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,pfam_PPP_dom,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,prints_Ser/Thr-sp_prot-phosphatase,pfscan_EF_HAND_2	p.L348	ENST00000286719.7	37	c.1044	CCDS34013.1	4																																																																																			PPEF2	-	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase	ENSG00000156194		0.582	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	HGNC	protein_coding	OTTHUMT00000362929.1	88	0.00	0	G	NM_006239		76797716	76797716	-1	no_errors	ENST00000286719	ensembl	human	known	69_37n	silent	41	40.58	28	SNP	0.687	A
PPP6R2	9701	genome.wustl.edu	37	22	50857837	50857837	+	Missense_Mutation	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr22:50857837G>T	ENST00000216061.5	+	9	1161	c.791G>T	c.(790-792)tGc>tTc	p.C264F	PPP6R2_ENST00000395744.3_Missense_Mutation_p.C264F|PPP6R2_ENST00000395741.3_Missense_Mutation_p.C265F|PPP6R2_ENST00000359139.3_Missense_Mutation_p.C264F			O75170	PP6R2_HUMAN	protein phosphatase 6, regulatory subunit 2	264						cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	22						ACGGAGAGCTGCCTCGTCAGT	0.567																																						dbGAP											0													131.0	102.0	112.0					22																	50857837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014585	CCDS33681.1, CCDS56235.1, CCDS56236.1, CCDS74881.1	22q13.33	2012-04-17	2010-06-28	2010-06-28	ENSG00000100239	ENSG00000100239		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	19253	protein-coding gene	gene with protein product		610877	"""KIAA0685"", ""SAPS domain family, member 2"""	KIAA0685, SAPS2		16769727	Standard	NM_014678		Approved	dJ579N16.1, SAP190	uc003blc.3	O75170	OTTHUMG00000150199	ENST00000216061.5:c.791G>T	22.37:g.50857837G>T	ENSP00000216061:p.Cys264Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVG3|B7Z7T3|Q5U5P3|Q7Z2L2|Q7Z5G5|Q7Z731|Q9UGB9	Missense_Mutation	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.C264F	ENST00000216061.5	37	c.791		22	.	.	.	.	.	.	.	.	.	.	G	17.28	3.349861	0.61183	.	.	ENSG00000100239	ENST00000359139;ENST00000395741;ENST00000395744;ENST00000216061	T;T;T;T	0.30981	1.53;1.6;1.54;1.51	5.63	5.63	0.86233	.	0.045637	0.85682	D	0.000000	T	0.56381	0.1981	M	0.70595	2.14	0.43512	D	0.995777	D;D;D;D;D	0.76494	0.999;0.999;0.993;0.999;0.993	D;D;D;D;D	0.76071	0.977;0.987;0.921;0.977;0.921	T	0.57854	-0.7739	10	0.72032	D	0.01	-21.2589	17.1792	0.86850	0.0:0.0:1.0:0.0	.	264;264;265;264;264	O75170-5;O75170;O75170-3;O75170-4;O75170-2	.;PP6R2_HUMAN;.;.;.	F	264;265;264;264	ENSP00000352051:C264F;ENSP00000379090:C265F;ENSP00000379093:C264F;ENSP00000216061:C264F	ENSP00000216061:C264F	C	+	2	0	PPP6R2	49204703	1.000000	0.71417	1.000000	0.80357	0.479000	0.33129	2.188000	0.42612	2.657000	0.90304	0.549000	0.68633	TGC	PPP6R2	-	pfam_SAPS	ENSG00000100239		0.567	PPP6R2-004	KNOWN	basic|appris_candidate_longest	protein_coding	PPP6R2	HGNC	protein_coding	OTTHUMT00000316809.1	44	0.00	0	G	NM_014678		50857837	50857837	+1	no_errors	ENST00000216061	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
PTK2	5747	genome.wustl.edu	37	8	141762030	141762030	+	Intron	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr8:141762030C>T	ENST00000522684.1	-	17	1647				PTK2_ENST00000395218.2_Intron|PTK2_ENST00000340930.3_Intron|PTK2_ENST00000520151.1_Intron|PTK2_ENST00000517887.1_Intron|PTK2_ENST00000521059.1_Intron|PTK2_ENST00000538769.1_Intron|PTK2_ENST00000535192.1_Intron|PTK2_ENST00000519419.1_Intron|PTK2_ENST00000519465.1_Intron	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2						angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			tggGCAGCATCAACATTAGGA	0.443																																						dbGAP											0													44.0	40.0	41.0					8																	141762030		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.1417+300G>A	8.37:g.141762030C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2N6|F5H4S4|Q14291|Q9UD85	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_FERM_central,superfamily_Kinase-like_dom,pfscan_FERM_domain	p.L304	ENST00000522684.1	37	c.912	CCDS6381.1	8	.	.	.	.	.	.	.	.	.	.	C	12.23	1.875143	0.33162	.	.	ENSG00000169398	ENST00000342207	.	.	.	3.49	0.665	0.17896	.	.	.	.	.	T	0.27798	0.0684	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25502	-1.0130	5	0.42905	T	0.14	.	3.615	0.08074	0.0:0.5517:0.2104:0.2379	.	.	.	.	N	310	.	ENSP00000342839:D310N	D	-	1	0	PTK2	141831212	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.146000	0.16180	0.126000	0.18424	-0.142000	0.14014	GAT	PTK2	-	NULL	ENSG00000169398		0.443	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK2	HGNC	protein_coding	OTTHUMT00000378054.5	77	0.00	0	C	NM_005607		141762030	141762030	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524202	ensembl	human	known	69_37n	silent	68	12.82	10	SNP	0.000	T
RASA4	10156	genome.wustl.edu	37	7	102236503	102236503	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr7:102236503G>A	ENST00000262940.7	-	9	878	c.811C>T	c.(811-813)Cca>Tca	p.P271S	RASA4_ENST00000462172.1_Missense_Mutation_p.P199S|RP11-514P8.6_ENST00000519541.1_3'UTR|RASA4_ENST00000461209.1_Missense_Mutation_p.P199S|RASA4_ENST00000449970.2_Missense_Mutation_p.P271S	NM_006989.5	NP_008920.5	O43374	RASL2_HUMAN	RAS p21 protein activator 4	271					cellular response to calcium ion (GO:0071277)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			lung(1)|prostate(1)|urinary_tract(1)	3						TGCACCAGTGGCTGGTAGTAG	0.677																																						dbGAP											0													2.0	1.0	1.0					7																	102236503		856	1644	2500	-	-	-	SO:0001583	missense	0			AB011110	CCDS5725.1, CCDS47674.1	7q22-q31.1	2008-12-05			ENSG00000105808	ENSG00000105808			23181	protein-coding gene	gene with protein product		607943				11448776	Standard	NM_001079877		Approved	KIAA0538, CAPRI, GAPL	uc003vae.3	O43374	OTTHUMG00000150383	ENST00000262940.7:c.811C>T	7.37:g.102236503G>A	ENSP00000262940:p.Pro271Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O60286|Q14CQ4|Q86UW3|Q96QU0	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP	p.P271S	ENST00000262940.7	37	c.811	CCDS5725.1	7	.	.	.	.	.	.	.	.	.	.	g	12.20	1.865257	0.32977	.	.	ENSG00000105808	ENST00000262940;ENST00000461209;ENST00000449970;ENST00000541884;ENST00000462172;ENST00000522801	T;T;T;T;T;T	0.68903	2.27;2.27;2.27;2.27;2.27;-0.36	3.57	2.61	0.31194	Rho GTPase activation protein (1);Ras GTPase-activating protein (1);	0.000000	0.64402	D	0.000002	T	0.77818	0.4187	M	0.80183	2.485	0.48696	D	0.999695	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.995;0.999;0.998	T	0.76756	-0.2842	10	0.48119	T	0.1	.	6.3724	0.21489	0.0:0.2007:0.5937:0.2056	.	199;271;271	B7Z9G3;O43374-2;O43374	.;.;RASL2_HUMAN	S	271;199;271;199;199;252	ENSP00000262940:P271S;ENSP00000420352:P199S;ENSP00000412876:P271S;ENSP00000438250:P199S;ENSP00000417395:P199S;ENSP00000430418:P252S	ENSP00000262940:P271S	P	-	1	0	RASA4	102023572	1.000000	0.71417	1.000000	0.80357	0.062000	0.15995	3.889000	0.56212	1.536000	0.49237	0.194000	0.17425	CCA	RASA4	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP	ENSG00000105808		0.677	RASA4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASA4	HGNC	protein_coding	OTTHUMT00000317900.3	11	0.00	0	G	NM_006989		102236503	102236503	-1	no_errors	ENST00000262940	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	1.000	A
RIMS2	9699	genome.wustl.edu	37	8	104987653	104987653	+	Missense_Mutation	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr8:104987653G>T	ENST00000436393.2	+	14	2421	c.2180G>T	c.(2179-2181)tGt>tTt	p.C727F	RIMS2_ENST00000406091.3_Missense_Mutation_p.C949F|RIMS2_ENST00000507740.1_Missense_Mutation_p.C741F|RIMS2_ENST00000262231.10_Missense_Mutation_p.C788F			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1011	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			TCAAACCACTGTTCACCATCA	0.393										HNSCC(12;0.0054)																												dbGAP											0													100.0	100.0	100.0					8																	104987653		1923	4125	6048	-	-	-	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.2180G>T	8.37:g.104987653G>T	ENSP00000390665:p.Cys727Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.C949F	ENST00000436393.2	37	c.2846		8	.	.	.	.	.	.	.	.	.	.	G	22.4	4.283435	0.80803	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393	T;T;T;T;T;T	0.17370	2.28;2.76;2.44;2.44;2.35;2.75	5.11	5.11	0.69529	.	.	.	.	.	T	0.40619	0.1124	L	0.60455	1.87	0.80722	D	1	D;D;D;D;D;D	0.67145	0.994;0.993;0.991;0.994;0.996;0.996	P;D;D;D;D;D	0.80764	0.837;0.921;0.994;0.947;0.931;0.931	T	0.14980	-1.0453	9	0.59425	D	0.04	.	18.9147	0.92501	0.0:0.0:1.0:0.0	.	1011;1011;727;788;741;949	Q9UQ26;Q9UQ26-2;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.;.	F	949;964;949;1011;788;741;741;727	ENSP00000427018:C949F;ENSP00000384892:C949F;ENSP00000262231:C788F;ENSP00000423559:C741F;ENSP00000386228:C741F;ENSP00000390665:C727F	ENSP00000262231:C788F	C	+	2	0	RIMS2	105056829	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.067000	0.93955	2.544000	0.85801	0.655000	0.94253	TGT	RIMS2	-	NULL	ENSG00000176406		0.393	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	49	0.00	0	G	NM_001100117		104987653	104987653	+1	no_errors	ENST00000406091	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	T
RNF111	54778	genome.wustl.edu	37	15	59373484	59373484	+	Splice_Site	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr15:59373484G>A	ENST00000557998.1	+	8	2584		c.e8+1		RNF111_ENST00000348370.4_Splice_Site|RNF111_ENST00000434298.1_Splice_Site|RNF111_ENST00000559209.1_Splice_Site|RNF111_ENST00000561186.1_Splice_Site	NM_001270530.1	NP_001257459.1	Q6ZNA4	RN111_HUMAN	ring finger protein 111						gene expression (GO:0010467)|pattern specification process (GO:0007389)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein polyubiquitination (GO:0000209)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ligase activity (GO:0016874)|SUMO polymer binding (GO:0032184)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(11)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35				all cancers(107;0.194)		AGCATCCAACGTATGTTTTAC	0.433																																					NSCLC(72;983 1365 10746 34387 47081)	dbGAP											0													90.0	79.0	83.0					15																	59373484		2192	4291	6483	-	-	-	SO:0001630	splice_region_variant	0			AL157474	CCDS10169.1, CCDS58365.1, CCDS58366.1	15q21	2013-01-09			ENSG00000157450	ENSG00000157450		"""RING-type (C3HC4) zinc fingers"""	17384	protein-coding gene	gene with protein product		605840				11298452	Standard	NM_017610		Approved	ARK, Arkadia, FLJ38008, DKFZP761D081	uc002aft.4	Q6ZNA4	OTTHUMG00000132716	ENST00000557998.1:c.2297+1G>A	15.37:g.59373484G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JUS4|H0YN55|Q6P9A4|Q6ZMU2|Q7L428|Q7Z346|Q8N1P9|Q8WUA3|Q9NSR1	Splice_Site	SNP	-	e7+1	ENST00000557998.1	37	c.2297+1	CCDS58366.1	15	.	.	.	.	.	.	.	.	.	.	G	21.7	4.184472	0.78677	.	.	ENSG00000157450	ENST00000348370;ENST00000434298	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.5183	0.95174	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF111	57160776	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	9.230000	0.95299	2.613000	0.88420	0.467000	0.42956	.	RNF111	-	-	ENSG00000157450		0.433	RNF111-003	KNOWN	basic|CCDS	protein_coding	RNF111	HGNC	protein_coding	OTTHUMT00000416012.1	65	0.00	0	G	NM_017610	Intron	59373484	59373484	+1	no_errors	ENST00000434298	ensembl	human	known	69_37n	splice_site	12	68.42	26	SNP	1.000	A
ROPN1	54763	genome.wustl.edu	37	3	123694370	123694370	+	Silent	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr3:123694370G>A	ENST00000184183.4	-	5	592	c.252C>T	c.(250-252)atC>atT	p.I84I	ROPN1_ENST00000405845.3_Silent_p.I84I	NM_017578.2	NP_060048.2	Q9HAT0	ROP1A_HUMAN	rhophilin associated tail protein 1	84						cytoplasm (GO:0005737)|nucleus (GO:0005634)				lung(2)|ovary(1)|skin(1)	4				GBM - Glioblastoma multiforme(114;0.148)		CTGCACGGATGATCAGTCTGC	0.547																																						dbGAP											0													3.0	3.0	3.0					3																	123694370		1476	3269	4745	-	-	-	SO:0001819	synonymous_variant	0			AF231410	CCDS3026.1	3q21.1	2011-01-20	2011-01-20			ENSG00000065371			17692	protein-coding gene	gene with protein product	"""cancer/testis antigen 91"""	611757	"""ropporin, rhophilin associated protein 1"""			10591629	Standard	NM_017578		Approved	ODF6, ropporin, ROPN1A, CT91	uc003eha.3	Q9HAT0		ENST00000184183.4:c.252C>T	3.37:g.123694370G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN99|Q9UF38	Silent	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.I84	ENST00000184183.4	37	c.252	CCDS3026.1	3																																																																																			ROPN1	-	NULL	ENSG00000065371		0.547	ROPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROPN1	HGNC	protein_coding	OTTHUMT00000356188.2	35	0.00	0	G	NM_017578		123694370	123694370	-1	no_errors	ENST00000184183	ensembl	human	known	69_37n	silent	19	38.71	12	SNP	0.985	A
RPL18A	6142	genome.wustl.edu	37	19	17972988	17972988	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr19:17972988G>A	ENST00000222247.5	+	3	365	c.284G>A	c.(283-285)cGg>cAg	p.R95Q	RPL18A_ENST00000600147.1_Missense_Mutation_p.R95Q|SNORA68_ENST00000384437.1_RNA|RPL18A_ENST00000599870.1_Missense_Mutation_p.R66Q|RPL18A_ENST00000599898.1_Missense_Mutation_p.R56Q	NM_000980.3	NP_000971.1	Q02543	RL18A_HUMAN	ribosomal protein L18a	95					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|upper_aerodigestive_tract(1)	5						AACATGTACCGGGAATACCGG	0.612																																						dbGAP											0													59.0	63.0	61.0					19																	17972988		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB007175	CCDS12367.1	19p13.11	2011-04-06			ENSG00000105640	ENSG00000105640		"""L ribosomal proteins"""	10311	protein-coding gene	gene with protein product	"""60S ribosomal protein L18a"", ""ribosomal protein L18a-like protein"""	604178				9582194	Standard	NM_000980		Approved	L18A	uc002nhp.3	Q02543		ENST00000222247.5:c.284G>A	19.37:g.17972988G>A	ENSP00000222247:p.Arg95Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosomal_L18a/LX	p.R95Q	ENST00000222247.5	37	c.284	CCDS12367.1	19	.	.	.	.	.	.	.	.	.	.	G	19.77	3.888685	0.72524	.	.	ENSG00000105640	ENST00000420197;ENST00000222247	.	.	.	4.18	4.18	0.49190	Ribosomal protein L18a/LX (1);	0.052816	0.64402	D	0.000001	T	0.64605	0.2613	M	0.83603	2.65	0.80722	D	1	P	0.38250	0.624	B	0.35312	0.2	T	0.73294	-0.4028	9	0.66056	D	0.02	.	14.3756	0.66874	0.0:0.0:1.0:0.0	.	95	Q02543	RL18A_HUMAN	Q	95	.	ENSP00000222247:R95Q	R	+	2	0	RPL18A	17833988	1.000000	0.71417	0.997000	0.53966	0.700000	0.40528	9.577000	0.98196	2.060000	0.61445	0.557000	0.71058	CGG	RPL18A	-	pfam_Ribosomal_L18a/LX	ENSG00000105640		0.612	RPL18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL18A	HGNC	protein_coding	OTTHUMT00000466679.1	89	0.00	0	G	NM_000980		17972988	17972988	+1	no_errors	ENST00000222247	ensembl	human	known	69_37n	missense	72	32.71	35	SNP	1.000	A
SBF1	6305	genome.wustl.edu	37	22	50903481	50903481	+	Silent	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr22:50903481G>T	ENST00000390679.3	-	12	1465	c.1281C>A	c.(1279-1281)ggC>ggA	p.G427G	SBF1_ENST00000380817.3_Silent_p.G427G|SBF1_ENST00000348911.6_Silent_p.G428G			O95248	MTMR5_HUMAN	SET binding factor 1	427	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		CTGACACAAAGCCAGCAAAGG	0.642																																						dbGAP											0													82.0	89.0	86.0					22																	50903481		2157	4247	6404	-	-	-	SO:0001819	synonymous_variant	0			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.1281C>A	22.37:g.50903481G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Silent	SNP	pfam_SBF2,pfam_DENN_dom,pfam_uDENN_dom,pfam_Myotub-related,pfam_dDENN_dom,pfam_GRAM,pfam_Pleckstrin_homology,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_GRAM,smart_Pleckstrin_homology,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_Pleckstrin_homology	p.G427	ENST00000390679.3	37	c.1281		22																																																																																			SBF1	-	pfam_dDENN_dom,smart_dDENN_dom,pfscan_dDENN_dom	ENSG00000100241		0.642	SBF1-201	KNOWN	basic	protein_coding	SBF1	HGNC	protein_coding		58	0.00	0	G			50903481	50903481	-1	no_errors	ENST00000380817	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	1.000	T
SFSWAP	6433	genome.wustl.edu	37	12	132284271	132284271	+	3'UTR	SNP	T	T	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr12:132284271T>A	ENST00000261674.4	+	0	3235				RNA5SP378_ENST00000363646.1_RNA|SFSWAP_ENST00000539506.1_3'UTR	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family						mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						AGGAAACACCTTTTCTAGCTA	0.403																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.*238T>A	12.37:g.132284271T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN45|B7ZM97|F5H6B8|Q6PJF7	RNA	SNP	-	NULL	ENST00000261674.4	37	NULL	CCDS9273.1	12																																																																																			SFSWAP	-	-	ENSG00000061936		0.403	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SFSWAP	HGNC	protein_coding	OTTHUMT00000399276.1	35	0.00	0	T	NM_004592		132284271	132284271	+1	no_errors	ENST00000539506	ensembl	human	known	69_37n	rna	34	26.09	12	SNP	1.000	A
SI	6476	genome.wustl.edu	37	3	164776994	164776994	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr3:164776994C>T	ENST00000264382.3	-	11	1302	c.1240G>A	c.(1240-1242)Gat>Aat	p.D414N		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	414	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TCATGCAAATCTTGCACAAAT	0.338										HNSCC(35;0.089)																												dbGAP											0													138.0	129.0	132.0					3																	164776994		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.1240G>A	3.37:g.164776994C>T	ENSP00000264382:p.Asp414Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.D414N	ENST00000264382.3	37	c.1240	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	C	21.9	4.221465	0.79464	.	.	ENSG00000090402	ENST00000264382	D	0.91295	-2.82	5.59	5.59	0.84812	Glycoside hydrolase, superfamily (1);	0.097761	0.64402	D	0.000001	D	0.90235	0.6947	L	0.31120	0.905	0.39422	D	0.966934	P	0.52842	0.956	P	0.54664	0.758	D	0.91630	0.5318	10	0.66056	D	0.02	.	15.297	0.73916	0.1486:0.8514:0.0:0.0	.	414	P14410	SUIS_HUMAN	N	414	ENSP00000264382:D414N	ENSP00000264382:D414N	D	-	1	0	SI	166259688	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	4.855000	0.62925	2.630000	0.89119	0.557000	0.71058	GAT	SI	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000090402		0.338	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	46	0.00	0	C	NM_001041		164776994	164776994	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	missense	39	31.58	18	SNP	1.000	T
SLC15A5	729025	genome.wustl.edu	37	12	16430532	16430532	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr12:16430532C>T	ENST00000344941.3	-	1	87	c.88G>A	c.(88-90)Gat>Aat	p.D30N		NM_001170798.1	NP_001164269.1	A6NIM6	S15A5_HUMAN	solute carrier family 15, member 5	30					peptide transport (GO:0015833)|protein transport (GO:0015031)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			breast(2)|lung(1)	3						GAACACAAATCGCCAATATGT	0.418																																						dbGAP											0													143.0	118.0	126.0					12																	16430532		692	1591	2283	-	-	-	SO:0001583	missense	0					12p12.3	2013-07-18			ENSG00000188991	ENSG00000188991		"""Solute carriers"""	33455	protein-coding gene	gene with protein product						21044875	Standard	NM_001170798		Approved		uc021qvs.1	A6NIM6	OTTHUMG00000168793	ENST00000344941.3:c.88G>A	12.37:g.16430532C>T	ENSP00000340402:p.Asp30Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt	p.D30N	ENST00000344941.3	37	c.88		12	.	.	.	.	.	.	.	.	.	.	C	0.162	-1.079820	0.01888	.	.	ENSG00000188991	ENST00000344941	T	0.03553	3.89	4.93	-0.343	0.12632	.	.	.	.	.	T	0.03053	0.0090	L	0.29908	0.895	0.09310	N	1	.	.	.	.	.	.	T	0.48222	-0.9054	7	0.11182	T	0.66	.	8.6821	0.34214	0.253:0.5804:0.1666:0.0	.	.	.	.	N	30	ENSP00000340402:D30N	ENSP00000340402:D30N	D	-	1	0	SLC15A5	16321799	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.076000	0.11412	0.055000	0.16094	-0.262000	0.10625	GAT	SLC15A5	-	NULL	ENSG00000188991		0.418	SLC15A5-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	SLC15A5	HGNC	protein_coding	OTTHUMT00000401119.2	52	0.00	0	C	XM_001129090		16430532	16430532	-1	no_errors	ENST00000344941	ensembl	human	novel	69_37n	missense	47	17.54	10	SNP	0.000	T
SPEN	23013	genome.wustl.edu	37	1	16260594	16260595	+	Frame_Shift_Ins	INS	-	-	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:16260594_16260595insT	ENST00000375759.3	+	11	8063_8064	c.7859_7860insT	c.(7858-7863)tctgttfs	p.V2621fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2621	RID.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		AAAATTACCTCTGTTATTAGCC	0.505																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.7860dupT	1.37:g.16260595_16260595dupT	ENSP00000364912:p.Val2621fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.V2621fs	ENST00000375759.3	37	c.7859_7860	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.505	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	72	0.00	0	-	NM_015001		16260594	16260595	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	frame_shift_ins	17	65.31	32	INS	1.000:0.989	T
SLC1A7	6512	genome.wustl.edu	37	1	53608037	53608037	+	Missense_Mutation	SNP	C	C	T	rs201010691	byFrequency	TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:53608037C>T	ENST00000371494.4	-	1	212	c.85G>A	c.(85-87)Gtg>Atg	p.V29M	SLC1A7_ENST00000371491.4_Missense_Mutation_p.V29M	NM_006671.4	NP_006662.3	O00341	EAA5_HUMAN	solute carrier family 1 (glutamate transporter), member 7	29					dicarboxylic acid transport (GO:0006835)|ion transport (GO:0006811)|L-glutamate transport (GO:0015813)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)	p.V29M(1)		NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	26				Colorectal(1306;0.234)		AGGCAGCCCACGATGACAGAC	0.657													C|||	2	0.000399361	0.0	0.0014	5008	,	,		19032	0.0		0.001	False		,,,				2504	0.0				NSCLC(128;80 1811 21245 38490 51715)	dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	96.0	113.0					1																	53608037		2201	4300	6501	-	-	-	SO:0001583	missense	0			U76362	CCDS574.1, CCDS72796.1, CCDS72797.1, CCDS72798.1	1p32.3	2013-05-22			ENSG00000162383	ENSG00000162383		"""Solute carriers"""	10945	protein-coding gene	gene with protein product		604471				9108121	Standard	NM_001287597		Approved	EAAT5	uc001cuy.3	O00341	OTTHUMG00000008937	ENST00000371494.4:c.85G>A	1.37:g.53608037C>T	ENSP00000360549:p.Val29Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVZ0|Q969Z8|Q9BW45	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.V29M	ENST00000371494.4	37	c.85	CCDS574.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	18.29	3.590820	0.66219	.	.	ENSG00000162383	ENST00000371494;ENST00000371491	T;T	0.60171	0.21;0.21	5.53	4.61	0.57282	.	0.215071	0.39544	N	0.001337	T	0.46814	0.1412	L	0.46614	1.455	0.39222	D	0.96351	P;B	0.42039	0.769;0.305	B;B	0.37239	0.244;0.109	T	0.51020	-0.8758	10	0.38643	T	0.18	-4.0526	10.6033	0.45379	0.0:0.8331:0.0:0.1669	.	29;29	Q9BW45;O00341	.;EAA5_HUMAN	M	29	ENSP00000360549:V29M;ENSP00000360546:V29M	ENSP00000360546:V29M	V	-	1	0	SLC1A7	53380625	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.211000	0.32382	2.602000	0.87976	0.555000	0.69702	GTG	SLC1A7	-	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	ENSG00000162383		0.657	SLC1A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC1A7	HGNC	protein_coding	OTTHUMT00000024746.1	47	0.00	0	C	NM_006671		53608037	53608037	-1	no_errors	ENST00000371494	ensembl	human	known	69_37n	missense	24	38.46	15	SNP	1.000	T
SPRYD3	84926	genome.wustl.edu	37	12	53468492	53468492	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr12:53468492C>T	ENST00000301463.4	-	5	534	c.448G>A	c.(448-450)Gag>Aag	p.E150K	SPRYD3_ENST00000547837.1_Missense_Mutation_p.E187K	NM_032840.2	NP_116229.1	Q8NCJ5	SPRY3_HUMAN	SPRY domain containing 3	150	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.									central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						GACACAGGCTCAATGCCACAG	0.537																																						dbGAP											0													86.0	93.0	90.0					12																	53468492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074694	CCDS8845.1	12q13.13	2006-11-29		2006-02-02		ENSG00000167778			25920	protein-coding gene	gene with protein product						14702039	Standard	NM_032840		Approved	FLJ14800	uc001sbt.2	Q8NCJ5	OTTHUMG00000170101	ENST00000301463.4:c.448G>A	12.37:g.53468492C>T	ENSP00000301463:p.Glu150Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG99|Q96SK5	Missense_Mutation	SNP	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	p.E150K	ENST00000301463.4	37	c.448	CCDS8845.1	12	.	.	.	.	.	.	.	.	.	.	C	14.52	2.560803	0.45590	.	.	ENSG00000167778	ENST00000301463;ENST00000547837	.	.	.	5.08	5.08	0.68730	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.584478	0.18838	N	0.129755	T	0.34716	0.0907	N	0.05124	-0.11	0.44927	D	0.997941	B	0.10296	0.003	B	0.09377	0.004	T	0.20140	-1.0284	9	0.07644	T	0.81	.	16.3707	0.83357	0.0:1.0:0.0:0.0	.	150	Q8NCJ5	SPRY3_HUMAN	K	150;187	.	ENSP00000301463:E150K	E	-	1	0	SPRYD3	51754759	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.154000	0.42291	2.815000	0.96918	0.561000	0.74099	GAG	SPRYD3	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000167778		0.537	SPRYD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPRYD3	HGNC	protein_coding	OTTHUMT00000407264.1	57	0.00	0	C	NM_032840		53468492	53468492	-1	no_errors	ENST00000301463	ensembl	human	known	69_37n	missense	16	56.76	21	SNP	1.000	T
SPTA1	6708	genome.wustl.edu	37	1	158615326	158615326	+	Missense_Mutation	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:158615326C>G	ENST00000368147.4	-	28	4135	c.3955G>C	c.(3955-3957)Gaa>Caa	p.E1319Q		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	1319					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					GTTAAGTCTTCGGCCAGCTCC	0.428																																						dbGAP											0													158.0	156.0	157.0					1																	158615326		2025	4166	6191	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.3955G>C	1.37:g.158615326C>G	ENSP00000357129:p.Glu1319Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.E1319Q	ENST00000368147.4	37	c.3955	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536794	0.65085	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.50548	0.74;0.74	5.07	4.16	0.48862	.	.	.	.	.	T	0.30854	0.0778	M	0.62723	1.935	0.09310	N	0.999997	P	0.42357	0.777	P	0.49192	0.602	T	0.17228	-1.0376	9	0.14252	T	0.57	.	6.6029	0.22710	0.0:0.7351:0.0:0.2649	.	1319	P02549	SPTA1_HUMAN	Q	1319	ENSP00000357130:E1319Q;ENSP00000357129:E1319Q	ENSP00000357129:E1319Q	E	-	1	0	SPTA1	156881950	0.950000	0.32346	0.211000	0.23655	0.958000	0.62258	2.711000	0.47177	1.362000	0.46000	0.655000	0.94253	GAA	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.428	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	41	0.00	0	C	NM_003126		158615326	158615326	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.251	G
SUGP1	57794	genome.wustl.edu	37	19	19420925	19420925	+	Missense_Mutation	SNP	C	C	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr19:19420925C>A	ENST00000247001.5	-	3	638	c.291G>T	c.(289-291)caG>caT	p.Q97H	SUGP1_ENST00000334782.5_Missense_Mutation_p.Q97H|SUGP1_ENST00000585763.1_5'UTR	NM_172231.3	NP_757386.2	Q8IWZ8	SUGP1_HUMAN	SURP and G patch domain containing 1	97					gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)|urinary_tract(2)	22						TCTGTGCCTTCTGCAACTTCA	0.517																																						dbGAP											0													146.0	118.0	127.0					19																	19420925		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521128	CCDS12399.1	19p13	2013-01-28	2010-08-10	2010-08-10		ENSG00000105705		"""G patch domain containing"""	18643	protein-coding gene	gene with protein product		607992	"""splicing factor 4"""	SF4		12594045	Standard	NM_172231		Approved	F23858, DKFZp434E2216, RBP	uc002nmh.3	Q8IWZ8		ENST00000247001.5:c.291G>T	19.37:g.19420925C>A	ENSP00000247001:p.Gln97His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60378|Q6P3X9|Q8TCQ4|Q8WWT4|Q8WWT5|Q9NTG3	Missense_Mutation	SNP	pfam_Surp,pfam_G_patch_dom,superfamily_Surp,smart_Surp,smart_G_patch_dom,pfscan_Surp,pfscan_G_patch_dom	p.Q97H	ENST00000247001.5	37	c.291	CCDS12399.1	19	.	.	.	.	.	.	.	.	.	.	C	23.2	4.382155	0.82792	.	.	ENSG00000105705	ENST00000247001;ENST00000535070;ENST00000334782	T	0.30448	1.53	4.4	4.4	0.53042	.	0.057945	0.64402	D	0.000001	T	0.54838	0.1883	M	0.71036	2.16	0.80722	D	1	D	0.71674	0.998	D	0.79784	0.993	T	0.61078	-0.7135	10	0.87932	D	0	.	15.9176	0.79535	0.0:1.0:0.0:0.0	.	97	Q8IWZ8	SUGP1_HUMAN	H	97	ENSP00000247001:Q97H	ENSP00000247001:Q97H	Q	-	3	2	SUGP1	19281925	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.339000	0.59322	2.182000	0.69389	0.549000	0.68633	CAG	SUGP1	-	NULL	ENSG00000105705		0.517	SUGP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUGP1	HGNC	protein_coding	OTTHUMT00000460128.4	37	0.00	0	C	NM_021164		19420925	19420925	-1	no_errors	ENST00000247001	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	A
TPTE	7179	genome.wustl.edu	37	21	10916377	10916377	+	Silent	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr21:10916377C>T	ENST00000361285.4	-	20	1598	c.1269G>A	c.(1267-1269)tcG>tcA	p.S423S	TPTE_ENST00000415664.2_Intron|TPTE_ENST00000342420.5_Silent_p.S385S|TPTE_ENST00000298232.7_Silent_p.S405S	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	423	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.S405S(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TACGAGGAATCGAATAAATAA	0.388																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											112.0	99.0	104.0					21																	10916377		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.1269G>A	21.37:g.10916377C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Silent	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S423	ENST00000361285.4	37	c.1269	CCDS13560.2	21																																																																																			TPTE	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tensin_phosphatase_C2-dom	ENSG00000166157		0.388	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	208	0.00	0	C			10916377	10916377	-1	no_errors	ENST00000361285	ensembl	human	known	69_37n	silent	111	24.49	36	SNP	0.795	T
TRAV12-1	28674	genome.wustl.edu	37	14	22309792	22309792	+	RNA	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr14:22309792G>A	ENST00000390433.1	+	0	176									T cell receptor alpha variable 12-1																		TTCTGGTACAGACAGGATTGC	0.478																																						dbGAP											0													82.0	79.0	80.0					14																	22309792		1928	4126	6054	-	-	-			0			AE000659		14q11.2	2012-02-07			ENSG00000211785	ENSG00000211785		"""T cell receptors / TRA locus"""	12105	other	T cell receptor gene						8188290	Standard	NG_001332		Approved		uc001wbx.2		OTTHUMG00000168990		14.37:g.22309792G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R58K	ENST00000390433.1	37	c.173		14																																																																																			TRAV12-1	-	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000211785		0.478	TRAV12-1-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	TR_V_gene	TRAV12-1	HGNC	TR_V_gene	OTTHUMT00000401888.1	119	0.00	0	G	NG_001332		22309792	22309792	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000390433	ensembl	human	known	69_37n	missense	60	38.78	38	SNP	0.862	A
TRPM3	80036	genome.wustl.edu	37	9	73736264	73736264	+	Missense_Mutation	SNP	C	C	G	rs180792657	byFrequency	TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr9:73736264C>G	ENST00000377111.2	-	1	250	c.7G>C	c.(7-9)Gag>Cag	p.E3Q	TRPM3_ENST00000377110.3_Missense_Mutation_p.E3Q|TRPM3_ENST00000357533.2_Intron|TRPM3_ENST00000423814.3_Intron	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3	3					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						CCCCACGGCTCTGGCATCCCA	0.507													C|||	3	0.000599042	0.0023	0.0	5008	,	,		15442	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													57.0	59.0	59.0					9																	73736264		1953	4142	6095	-	-	-	SO:0001583	missense	0			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.7G>C	9.37:g.73736264C>G	ENSP00000366315:p.Glu3Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.E3Q	ENST00000377111.2	37	c.7		9	4	0.0018315018315018315	4	0.008130081300813009	0	0.0	0	0.0	0	0.0	C	14.09	2.432414	0.43224	.	.	ENSG00000083067	ENST00000377111;ENST00000377110	T;T	0.58652	0.32;0.49	5.68	4.76	0.60689	.	.	.	.	.	T	0.28466	0.0704	N	0.08118	0	0.80722	D	1	B;B;B	0.18310	0.001;0.016;0.027	B;B;B	0.13407	0.001;0.009;0.006	T	0.09164	-1.0687	9	0.27785	T	0.31	.	12.5894	0.56436	0.0:0.9158:0.0:0.0842	.	3;3;3	Q9HCF6;Q9HCF6-2;Q9HCF6-10	TRPM3_HUMAN;.;.	Q	3	ENSP00000366315:E3Q;ENSP00000366314:E3Q	ENSP00000366314:E3Q	E	-	1	0	TRPM3	72926084	0.992000	0.36948	1.000000	0.80357	0.998000	0.95712	1.070000	0.30653	1.344000	0.45657	0.557000	0.71058	GAG	TRPM3	-	NULL	ENSG00000083067		0.507	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	27	0.00	0	C	NM_206945		73736264	73736264	-1	no_errors	ENST00000377110	ensembl	human	known	69_37n	missense	15	44.44	12	SNP	1.000	G
TTC3	7267	genome.wustl.edu	37	21	38538480	38538480	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr21:38538480C>T	ENST00000399017.2	+	33	6711	c.3964C>T	c.(3964-3966)Cct>Tct	p.P1322S	TTC3_ENST00000354749.2_Missense_Mutation_p.P1322S|TTC3_ENST00000479930.1_3'UTR|TTC3_ENST00000355666.1_Missense_Mutation_p.P1322S	NM_003316.3	NP_003307.3	P53804	TTC3_HUMAN	tetratricopeptide repeat domain 3	1322					negative regulation of cell morphogenesis involved in differentiation (GO:0010771)|negative regulation of neuron differentiation (GO:0045665)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|vacuole (GO:0005773)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(5)|endometrium(7)|kidney(5)|large_intestine(17)|liver(1)|lung(18)|ovary(4)|prostate(2)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(5)	75		Myeloproliferative disorder(46;0.0412)				TACGTATCTTCCTTTCCAGAG	0.478																																					Ovarian(38;194 1649 35661)	dbGAP											0													132.0	134.0	134.0					21																	38538480		2203	4300	6503	-	-	-	SO:0001583	missense	0			D84296	CCDS13651.1	21q22.2	2013-01-11			ENSG00000182670	ENSG00000182670		"""RING-type (C3HC4) zinc fingers"", ""Tetratricopeptide (TTC) repeat domain containing"""	12393	protein-coding gene	gene with protein product		602259				8947847	Standard	NM_003316		Approved	TPRD, TPRDI, DCRR1, TPRDII, TPRDIII, RNF105	uc002yvz.3	P53804	OTTHUMG00000086654	ENST00000399017.2:c.3964C>T	21.37:g.38538480C>T	ENSP00000381981:p.Pro1322Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7H7|B2RPA7|D3DSG9|D3DSH2|D3DSH3|O60767|P78476|P78477|Q569I2|Q6P578|Q9UEK4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_DEATH-like,smart_TPR_repeat,smart_Znf_RING,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.P1322S	ENST00000399017.2	37	c.3964	CCDS13651.1	21	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342456	0.61073	.	.	ENSG00000182670	ENST00000355666;ENST00000399017;ENST00000354749	T;T;T	0.08193	3.12;3.12;3.12	4.95	3.09	0.35607	.	0.436525	0.21789	N	0.069100	T	0.20455	0.0492	L	0.60455	1.87	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.00655	-1.1624	9	.	.	.	-8.8842	8.0001	0.30291	0.0:0.798:0.0:0.202	.	380;1322	Q5GIT6;P53804	.;TTC3_HUMAN	S	1322	ENSP00000347889:P1322S;ENSP00000381981:P1322S;ENSP00000346791:P1322S	.	P	+	1	0	TTC3	37460350	0.769000	0.28531	0.844000	0.33320	0.451000	0.32288	1.378000	0.34328	1.223000	0.43536	0.561000	0.74099	CCT	TTC3	-	NULL	ENSG00000182670		0.478	TTC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC3	HGNC	protein_coding	OTTHUMT00000194776.1	91	0.00	0	C			38538480	38538480	+1	no_errors	ENST00000354749	ensembl	human	known	69_37n	missense	66	37.14	39	SNP	0.837	T
TTC34	100287898	genome.wustl.edu	37	1	2573070	2573070	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr1:2573070C>T	ENST00000401095.3	-	7	1517	c.1438G>A	c.(1438-1440)Gag>Aag	p.E480K	TTC34_ENST00000401094.6_Missense_Mutation_p.E283K	NM_001242672.1	NP_001229601.1	A8MYJ7	TTC34_HUMAN	tetratricopeptide repeat domain 34	480																	GCCGCCGCCTCATCCCCCAGG	0.716																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55565.1	1p36.32	2013-01-11			ENSG00000215912	ENSG00000215912		"""Tetratricopeptide (TTC) repeat domain containing"""	34297	protein-coding gene	gene with protein product							Standard	NM_001242672		Approved		uc021oey.1	A8MYJ7	OTTHUMG00000000539	ENST00000401095.3:c.1438G>A	1.37:g.2573070C>T	ENSP00000383873:p.Glu480Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXL8	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E480K	ENST00000401095.3	37	c.1438	CCDS55565.1	1	.	.	.	.	.	.	.	.	.	.	c	4.201	0.036047	0.08148	.	.	ENSG00000215912	ENST00000401094;ENST00000401095	T	0.37411	1.2	3.85	0.4	0.16331	.	0.279927	0.32703	N	0.005742	T	0.23886	0.0578	L	0.38175	1.15	0.09310	N	1	.	.	.	.	.	.	T	0.11966	-1.0566	8	0.26408	T	0.33	.	3.1906	0.06615	0.0:0.4589:0.2168:0.3243	.	.	.	.	K	480	ENSP00000383873:E480K	ENSP00000387700:E480K	E	-	1	0	TTC34	2562930	0.016000	0.18221	0.001000	0.08648	0.004000	0.04260	0.221000	0.17680	-0.099000	0.12263	-0.882000	0.02950	GAG	TTC34	-	smart_TPR_repeat,pfscan_TPR_repeat	ENSG00000215912		0.716	TTC34-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC34	HGNC	protein_coding		20	0.00	0	C	XM_002342015		2573070	2573070	-1	no_errors	ENST00000401095	ensembl	human	known	69_37n	missense	1	85.71	6	SNP	0.028	T
CFAP46	54777	genome.wustl.edu	37	10	134664664	134664664	+	Missense_Mutation	SNP	G	G	A			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr10:134664664G>A	ENST00000368586.5	-	40	5820	c.5720C>T	c.(5719-5721)gCg>gTg	p.A1907V	TTC40_ENST00000263170.5_Missense_Mutation_p.A68V	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CAGATAGTCCGCCAGCAGCTT	0.617																																						dbGAP											0													81.0	79.0	80.0					10																	134664664		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000368586.5:c.5720C>T	10.37:g.134664664G>A	ENSP00000357575:p.Ala1907Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.A68V	ENST00000368586.5	37	c.203	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	G	11.42	1.633266	0.29068	.	.	ENSG00000171811	ENST00000368586;ENST00000263170	T;T	0.13420	2.82;2.59	4.79	2.83	0.33086	.	0.706817	0.11589	N	0.548999	T	0.14830	0.0358	L	0.46157	1.445	0.09310	N	1	P	0.52842	0.956	P	0.45829	0.494	T	0.15206	-1.0445	10	0.56958	D	0.05	.	6.0952	0.20017	0.0915:0.0:0.5568:0.3517	.	68	Q8IYW2	CJ092_HUMAN	V	1907;68	ENSP00000357575:A1907V;ENSP00000263170:A68V	ENSP00000263170:A68V	A	-	2	0	C10orf93	134514654	0.000000	0.05858	0.016000	0.15963	0.035000	0.12851	0.069000	0.14552	0.368000	0.24481	0.655000	0.94253	GCG	TTC40	-	NULL	ENSG00000171811		0.617	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	57	0.00	0	G			134664664	134664664	-1	no_errors	ENST00000263170	ensembl	human	known	69_37n	missense	8	76.47	26	SNP	0.007	A
UBAP1L	390595	genome.wustl.edu	37	15	65394977	65394977	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr15:65394977C>T	ENST00000559089.1	-	3	386	c.166G>A	c.(166-168)Gcc>Acc	p.A56T	UBAP1L_ENST00000502113.2_Missense_Mutation_p.A56T			F5GYI3	UBA1L_HUMAN	ubiquitin associated protein 1-like	56										breast(1)|endometrium(1)|kidney(1)	3						CCCTGGCCGGCGGCCTCCACC	0.682																																						dbGAP											0													3.0	5.0	4.0					15																	65394977		638	1500	2138	-	-	-	SO:0001583	missense	0				CCDS53948.1	15q22.31	2011-08-15			ENSG00000246922	ENSG00000246922			40028	protein-coding gene	gene with protein product							Standard	NM_001163692		Approved		uc010uit.2	F5GYI3		ENST00000559089.1:c.166G>A	15.37:g.65394977C>T	ENSP00000454012:p.Ala56Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_UBA-like	p.A56T	ENST00000559089.1	37	c.166	CCDS53948.1	15	.	.	.	.	.	.	.	.	.	.	C	26.3	4.724851	0.89298	.	.	ENSG00000246922	ENST00000502113	.	.	.	4.98	4.04	0.47022	.	.	.	.	.	T	0.34395	0.0896	N	0.19112	0.55	0.21386	N	0.999705	D	0.69078	0.997	P	0.52066	0.689	T	0.13045	-1.0524	8	0.37606	T	0.19	.	12.9278	0.58270	0.1621:0.8379:0.0:0.0	.	56	F5GYI3	UBA1L_HUMAN	T	56	.	ENSP00000440243:A56T	A	-	1	0	AC013553.1	63182030	0.006000	0.16342	0.320000	0.25306	0.857000	0.48899	1.925000	0.40074	1.060000	0.40578	0.655000	0.94253	GCC	UBAP1L	-	NULL	ENSG00000246922		0.682	UBAP1L-002	NOVEL	basic|appris_principal|CCDS	protein_coding	UBAP1L	HGNC	protein_coding	OTTHUMT00000418469.1	47	0.00	0	C	NM_001163692		65394977	65394977	-1	no_errors	ENST00000502113	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	0.541	T
UROS	7390	genome.wustl.edu	37	10	127495986	127495986	+	Silent	SNP	A	A	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr10:127495986A>G	ENST00000368797.4	-	6	614	c.390T>C	c.(388-390)tgT>tgC	p.C130C	UROS_ENST00000368786.1_Silent_p.C130C|UROS_ENST00000368774.1_Silent_p.C130C|UROS_ENST00000368778.3_Silent_p.C130C|UROS_ENST00000462490.1_5'UTR	NM_000375.2	NP_000366.1	P10746	HEM4_HUMAN	uroporphyrinogen III synthase	130					cellular response to amine stimulus (GO:0071418)|cellular response to arsenic-containing substance (GO:0071243)|heme biosynthetic process (GO:0006783)|porphyrin-containing compound metabolic process (GO:0006778)|protoporphyrinogen IX biosynthetic process (GO:0006782)|response to antibiotic (GO:0046677)|small molecule metabolic process (GO:0044281)|uroporphyrinogen III biosynthetic process (GO:0006780)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cofactor binding (GO:0048037)|uroporphyrinogen-III synthase activity (GO:0004852)			endometrium(2)|large_intestine(2)|lung(2)|skin(1)	7		all_lung(145;0.00756)|Lung NSC(174;0.0116)|Colorectal(57;0.0855)|all_neural(114;0.0937)|Breast(234;0.203)				ACTTACTGGAACAAATATATT	0.358																																						dbGAP											0													146.0	135.0	139.0					10																	127495986		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			J03824	CCDS7648.1	10q25.2-q26.3	2008-07-31	2008-07-31		ENSG00000188690	ENSG00000188690	4.2.1.75		12592	protein-coding gene	gene with protein product	"""congenital erythropoietic porphyria"""	606938				2037278	Standard	NM_000375		Approved		uc001lix.4	P10746	OTTHUMG00000019236	ENST00000368797.4:c.390T>C	10.37:g.127495986A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC13|D3DRF7|Q9H2T1	Silent	SNP	pfam_4pyrrol_synth_uPrphyn_synth,superfamily_4pyrrol_synth_uPrphyn_synth	p.C130	ENST00000368797.4	37	c.390	CCDS7648.1	10																																																																																			UROS	-	pfam_4pyrrol_synth_uPrphyn_synth,superfamily_4pyrrol_synth_uPrphyn_synth	ENSG00000188690		0.358	UROS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UROS	HGNC	protein_coding	OTTHUMT00000050929.1	60	0.00	0	A	NM_000375		127495986	127495986	-1	no_errors	ENST00000368786	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	0.999	G
VPS25	84313	genome.wustl.edu	37	17	40931001	40931001	+	Missense_Mutation	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr17:40931001C>G	ENST00000253794.2	+	6	485	c.445C>G	c.(445-447)Cta>Gta	p.L149V	WNK4_ENST00000246914.5_5'Flank	NM_032353.2	NP_115729.1	Q9BRG1	VPS25_HUMAN	vacuolar protein sorting 25 homolog (S. cerevisiae)	149					endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)	5		Breast(137;0.00104)		BRCA - Breast invasive adenocarcinoma(366;0.0745)		TGAAGCCACTCTACTGCGGGC	0.592																																						dbGAP											0													68.0	61.0	64.0					17																	40931001		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014763	CCDS11438.1	17q21.31	2014-02-12	2006-04-04		ENSG00000131475	ENSG00000131475			28122	protein-coding gene	gene with protein product		610907	"""vacuolar protein sorting 25 (yeast)"""			15511219	Standard	NM_032353		Approved	MGC10540, EAP20, DERP9	uc002ibi.3	Q9BRG1		ENST00000253794.2:c.445C>G	17.37:g.40931001C>G	ENSP00000253794:p.Leu149Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R581	Missense_Mutation	SNP	pfam_ESCRT-II_cplx_vps25-sub	p.L149V	ENST00000253794.2	37	c.445	CCDS11438.1	17	.	.	.	.	.	.	.	.	.	.	C	18.13	3.556418	0.65425	.	.	ENSG00000131475	ENST00000253794	T	0.59906	0.23	5.25	3.27	0.37495	ESCRT-II complex, Vps25 subunit, C-terminal winged helix (1);	0.000000	0.64402	D	0.000001	T	0.68201	0.2975	M	0.92604	3.325	0.80722	D	1	P	0.40266	0.71	B	0.44085	0.44	T	0.71020	-0.4713	10	0.72032	D	0.01	-4.0626	8.8679	0.35298	0.0:0.7729:0.0:0.2271	.	149	Q9BRG1	VPS25_HUMAN	V	149	ENSP00000253794:L149V	ENSP00000253794:L149V	L	+	1	2	VPS25	38184527	1.000000	0.71417	0.992000	0.48379	0.909000	0.53808	2.600000	0.46240	0.611000	0.30052	0.655000	0.94253	CTA	VPS25	-	NULL	ENSG00000131475		0.592	VPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS25	HGNC	protein_coding	OTTHUMT00000452383.1	64	0.00	0	C	NM_032353		40931001	40931001	+1	no_errors	ENST00000253794	ensembl	human	known	69_37n	missense	17	63.04	29	SNP	1.000	G
VPS26B	112936	genome.wustl.edu	37	11	134115464	134115464	+	Missense_Mutation	SNP	G	G	C			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr11:134115464G>C	ENST00000281187.5	+	6	1469	c.991G>C	c.(991-993)Gac>Cac	p.D331H	VPS26B_ENST00000525095.2_Missense_Mutation_p.D331H	NM_052875.3	NP_443107.1	Q4G0F5	VP26B_HUMAN	vacuolar protein sorting 26 homolog B (S. pombe)	331					protein transport (GO:0015031)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)				breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)	14	all_hematologic(175;0.127)	all_cancers(12;1.1e-21)|all_epithelial(12;3.77e-16)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000182)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;2.43e-10)|all cancers(11;2.94e-09)|BRCA - Breast invasive adenocarcinoma(10;9.57e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.00164)|Lung(977;0.216)		CCAGCTGTCTGACAACAACTG	0.677																																					Colon(171;1263 1952 15904 45703 47982)	dbGAP											0													33.0	29.0	30.0					11																	134115464		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8495.1	11q25	2008-02-05	2007-01-12		ENSG00000151502	ENSG00000151502			28119	protein-coding gene	gene with protein product		610027	"""vacuolar protein sorting 26 homolog B (yeast)"""			16190980	Standard	NM_052875		Approved	MGC10485, Pep8b	uc001qhe.3	Q4G0F5	OTTHUMG00000167175	ENST00000281187.5:c.991G>C	11.37:g.134115464G>C	ENSP00000281187:p.Asp331His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96A55	Missense_Mutation	SNP	pfam_VPS26,superfamily_Ig_E-set	p.D331H	ENST00000281187.5	37	c.991	CCDS8495.1	11	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932319	0.52866	.	.	ENSG00000151502	ENST00000281187;ENST00000525095	.	.	.	4.69	3.78	0.43462	.	0.260033	0.35870	N	0.002940	T	0.47395	0.1443	L	0.36672	1.1	0.44469	D	0.997406	B	0.22480	0.07	B	0.25759	0.063	T	0.47711	-0.9096	9	0.59425	D	0.04	-32.0937	11.0111	0.47663	0.0866:0.0:0.9134:0.0	.	331	Q4G0F5	VP26B_HUMAN	H	331;330	.	ENSP00000281187:D331H	D	+	1	0	VPS26B	133620674	0.999000	0.42202	0.997000	0.53966	0.997000	0.91878	2.489000	0.45285	1.212000	0.43366	0.561000	0.74099	GAC	VPS26B	-	NULL	ENSG00000151502		0.677	VPS26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS26B	HGNC	protein_coding	OTTHUMT00000393591.1	70	0.00	0	G	NM_052875		134115464	134115464	+1	no_errors	ENST00000281187	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.996	C
WBP11	51729	genome.wustl.edu	37	12	14946764	14946764	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr12:14946764C>T	ENST00000261167.2	-	8	1047	c.814G>A	c.(814-816)Gat>Aat	p.D272N		NM_016312.2	NP_057396.1	Q9Y2W2	WBP11_HUMAN	WW domain binding protein 11	272	Asp-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|protein phosphatase type 1 regulator activity (GO:0008599)|single-stranded DNA binding (GO:0003697)|WW domain binding (GO:0050699)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(1)|prostate(1)	30						TCACTGTCATCAGTACTGTCA	0.448																																						dbGAP											0													303.0	254.0	270.0					12																	14946764		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029309	CCDS8666.1	12p12.3	2014-06-13			ENSG00000084463	ENSG00000084463			16461	protein-coding gene	gene with protein product	"""splicing factor, PQBP1 and PP1 interacting"", ""protein phosphatase 1, regulatory subunit 165"""					10593949	Standard	NM_016312		Approved	NPWBP, SIPP1, PPP1R165	uc001rci.3	Q9Y2W2	OTTHUMG00000168737	ENST00000261167.2:c.814G>A	12.37:g.14946764C>T	ENSP00000261167:p.Asp272Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AY8	Missense_Mutation	SNP	pfam_WW_dom-bd_prot_11	p.D272N	ENST00000261167.2	37	c.814	CCDS8666.1	12	.	.	.	.	.	.	.	.	.	.	C	20.8	4.049779	0.75846	.	.	ENSG00000084463	ENST00000261167;ENST00000537574	D	0.90069	-2.61	5.38	5.38	0.77491	.	0.263988	0.39020	N	0.001483	D	0.91597	0.7345	L	0.40543	1.245	0.37961	D	0.932963	D	0.57571	0.98	D	0.68192	0.956	D	0.92606	0.6095	10	0.49607	T	0.09	-4.3015	16.6127	0.84892	0.0:1.0:0.0:0.0	.	272	Q9Y2W2	WBP11_HUMAN	N	272	ENSP00000442868:D272N	ENSP00000261167:D272N	D	-	1	0	WBP11	14838031	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.110000	0.64622	2.536000	0.85505	0.655000	0.94253	GAT	WBP11	-	NULL	ENSG00000084463		0.448	WBP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP11	HGNC	protein_coding	OTTHUMT00000400850.1	140	0.00	0	C	NM_016312		14946764	14946764	-1	no_errors	ENST00000261167	ensembl	human	known	69_37n	missense	113	13.74	18	SNP	1.000	T
XIST	7503	genome.wustl.edu	37	X	73070710	73070710	+	lincRNA	SNP	G	G	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chrX:73070710G>T	ENST00000429829.1	-	0	1878					NR_001564.2				X inactive specific transcript (non-protein coding)																		CACTGGACAGGAGGGGACAAA	0.522																																						dbGAP											0													14.0	14.0	14.0					X																	73070710		875	1986	2861	-	-	-			0			M97168		Xq13.2	2013-12-18	2013-02-07		ENSG00000229807	ENSG00000229807		"""Long non-coding RNAs"", ""-"""	12810	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 1"""	314670	"""X (inactive)-specific transcript"", ""X (inactive)-specific transcript (non-protein coding)"""	DXS399E		1985261, 2034279	Standard	NR_001564		Approved	NCRNA00001, DXS1089, swd66, LINC00001	uc004ebm.2		OTTHUMG00000021839		X.37:g.73070710G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000429829.1	37	NULL		X																																																																																			XIST	-	-	ENSG00000229807		0.522	XIST-001	KNOWN	basic	lincRNA	XIST	HGNC	lincRNA	OTTHUMT00000057239.1	46	0.00	0	G	NR_001564		73070710	73070710	-1	no_errors	ENST00000429829	ensembl	human	known	69_37n	rna	21	22.22	6	SNP	0.001	T
XKRX	402415	genome.wustl.edu	37	X	100169375	100169375	+	Missense_Mutation	SNP	C	C	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chrX:100169375C>G	ENST00000372956.2	-	3	1906	c.1302G>C	c.(1300-1302)gaG>gaC	p.E434D	XKRX_ENST00000468904.1_3'UTR|XKRX_ENST00000328526.5_Missense_Mutation_p.E447D			Q6PP77	XKR2_HUMAN	XK, Kell blood group complex subunit-related, X-linked	434						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(3)	22						GCTCTGAGTTCTCAACCCTGG	0.473																																						dbGAP											0													160.0	150.0	154.0					X																	100169375		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY589511	CCDS14476.1, CCDS14476.2	Xq22	2008-02-05	2006-01-12		ENSG00000182489	ENSG00000182489			29845	protein-coding gene	gene with protein product		300684	"""X Kell blood group precursor-related, X-linked"""				Standard	NM_212559		Approved	XPLAC, XKR2	uc004egn.2	Q6PP77	OTTHUMG00000022010	ENST00000372956.2:c.1302G>C	X.37:g.100169375C>G	ENSP00000362047:p.Glu434Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNN6|B4DKU2|Q5H9J6	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.E447D	ENST00000372956.2	37	c.1341	CCDS14476.2	X	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418609	0.25552	.	.	ENSG00000182489	ENST00000328526;ENST00000372956	T;T	0.65364	-0.15;-0.14	5.69	3.87	0.44632	.	0.462580	0.25540	N	0.029966	T	0.36082	0.0954	N	0.08118	0	0.09310	N	1	B	0.28470	0.213	B	0.24006	0.05	T	0.15694	-1.0428	10	0.27082	T	0.32	-4.8719	7.6746	0.28478	0.1601:0.7528:0.0:0.0871	.	434	Q6PP77	XKR2_HUMAN	D	447;434	ENSP00000327570:E447D;ENSP00000362047:E434D	ENSP00000327570:E447D	E	-	3	2	XKRX	100056031	0.008000	0.16893	0.721000	0.30653	0.042000	0.13812	0.896000	0.28377	1.132000	0.42129	0.538000	0.68166	GAG	XKRX	-	NULL	ENSG00000182489		0.473	XKRX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKRX	HGNC	protein_coding	OTTHUMT00000057501.3	71	0.00	0	C	NM_212559		100169375	100169375	-1	no_errors	ENST00000328526	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	0.039	G
ZCCHC10	54819	genome.wustl.edu	37	5	132358535	132358535	+	Silent	SNP	A	A	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr5:132358535A>G	ENST00000509437.1	-	2	112	c.105T>C	c.(103-105)atT>atC	p.I35I	ZCCHC10_ENST00000504170.1_Silent_p.I35I|ZCCHC10_ENST00000508080.1_Intron|ZCCHC10_ENST00000513848.1_Intron|ZCCHC10_ENST00000324170.3_Intron|ZCCHC10_ENST00000355372.2_Silent_p.I35I|ZCCHC10_ENST00000509008.1_Intron|ZCCHC10_ENST00000513541.1_Silent_p.I35I			Q8TBK6	ZCH10_HUMAN	zinc finger, CCHC domain containing 10	35							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			skin(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			agggatacctaataacgatgg	0.408																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC005211	CCDS4165.1, CCDS75300.1, CCDS75301.1, CCDS75302.1	5q31.1	2008-05-02			ENSG00000155329	ENSG00000155329		"""Zinc fingers, CCHC domain containing"""	25954	protein-coding gene	gene with protein product						12477932	Standard	XM_005272024		Approved	FLJ20094	uc003kyg.3	Q8TBK6	OTTHUMG00000129013	ENST00000509437.1:c.105T>C	5.37:g.132358535A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NXR4	Silent	SNP	superfamily_Znf_CCHC	p.I35	ENST00000509437.1	37	c.105		5																																																																																			ZCCHC10	-	NULL	ENSG00000155329		0.408	ZCCHC10-004	NOVEL	basic|appris_candidate_longest	protein_coding	ZCCHC10	HGNC	protein_coding	OTTHUMT00000370163.1	44	0.00	0	A	NM_017665		132358535	132358535	-1	no_errors	ENST00000513541	ensembl	human	putative	69_37n	silent	22	47.62	20	SNP	0.089	G
ZNF814	730051	genome.wustl.edu	37	19	58385913	58385913	+	Missense_Mutation	SNP	A	A	G			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr19:58385913A>G	ENST00000435989.2	-	3	1079	c.845T>C	c.(844-846)gTt>gCt	p.V282A	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	282					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTGAAGCTAACATATTTGCT	0.348																																						dbGAP											0													24.0	18.0	20.0					19																	58385913		691	1585	2276	-	-	-	SO:0001583	missense	0				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.845T>C	19.37:g.58385913A>G	ENSP00000410545:p.Val282Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V282A	ENST00000435989.2	37	c.845	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	6.039	0.375547	0.11409	.	.	ENSG00000204514	ENST00000435989	T	0.07327	3.2	1.79	-1.06	0.10002	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04048	0.0113	N	0.05574	-0.02	0.09310	N	1	B	0.15719	0.014	B	0.13407	0.009	T	0.41822	-0.9487	9	0.40728	T	0.16	.	7.0474	0.25052	0.2692:0.0:0.7308:0.0	.	282	B7Z6K7	ZN814_HUMAN	A	282	ENSP00000410545:V282A	ENSP00000410545:V282A	V	-	2	0	ZNF814	63077725	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-5.338000	0.00130	-0.333000	0.08476	-1.550000	0.00899	GTT	ZNF814	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204514		0.348	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	69	0.00	0	A	XM_001725708		58385913	58385913	-1	no_errors	ENST00000435989	ensembl	human	known	69_37n	missense	52	16.13	10	SNP	0.000	G
ZP1	22917	genome.wustl.edu	37	11	60642617	60642617	+	Missense_Mutation	SNP	C	C	T			TCGA-LQ-A4E4-01A-11D-A25Q-09	TCGA-LQ-A4E4-10A-01D-A25Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7043c94f-65c4-4e87-b124-b6fe5b26a5c6	2aa15aea-b63c-4460-9211-586b8a360c8d	g.chr11:60642617C>T	ENST00000278853.5	+	11	1670	c.1670C>T	c.(1669-1671)tCa>tTa	p.S557L		NM_207341.2	NP_997224.2	P60852	ZP1_HUMAN	zona pellucida glycoprotein 1 (sperm receptor)	557					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				breast(3)|endometrium(2)|large_intestine(8)|lung(8)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	26						CGACGATCCTCAGGTCACCGT	0.607																																						dbGAP											0													74.0	78.0	77.0					11																	60642617		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC067899	CCDS31572.1	11q12.2	2013-01-17			ENSG00000149506	ENSG00000149506		"""Zona pellucida glycoproteins"""	13187	protein-coding gene	gene with protein product		195000				10542331	Standard	NM_207341		Approved		uc001nqd.3	P60852	OTTHUMG00000167797	ENST00000278853.5:c.1670C>T	11.37:g.60642617C>T	ENSP00000278853:p.Ser557Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.S557L	ENST00000278853.5	37	c.1670	CCDS31572.1	11	.	.	.	.	.	.	.	.	.	.	C	8.714	0.912749	0.17907	.	.	ENSG00000149506	ENST00000278853;ENST00000544498	T	0.24350	1.86	5.61	2.22	0.28083	.	1.071070	0.07299	N	0.873851	T	0.12305	0.0299	N	0.12182	0.205	0.09310	N	1	B	0.16166	0.016	B	0.14023	0.01	T	0.36504	-0.9745	10	0.10636	T	0.68	-0.0314	4.6092	0.12392	0.206:0.5691:0.0:0.2249	.	557	P60852	ZP1_HUMAN	L	557;264	ENSP00000278853:S557L	ENSP00000278853:S557L	S	+	2	0	ZP1	60399193	0.000000	0.05858	0.005000	0.12908	0.020000	0.10135	0.156000	0.16382	0.632000	0.30432	-0.229000	0.12294	TCA	ZP1	-	NULL	ENSG00000149506		0.607	ZP1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ZP1	HGNC	protein_coding	OTTHUMT00000396329.1	18	0.00	0	C	NM_207341		60642617	60642617	+1	no_errors	ENST00000278853	ensembl	human	known	69_37n	missense	6	40.00	4	SNP	0.001	T
