#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM21P1	145241	genome.wustl.edu	37	14	70713951	70713951	+	RNA	SNP	G	G	A	rs202183568		TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr14:70713951G>A	ENST00000530196.1	-	0	567					NR_003951.1				ADAM metallopeptidase domain 21 pseudogene 1																		TCAATTTCATGAGTGAGGCCG	0.438																																						dbGAP											0																																										-	-	-			0					14q24.2	2014-03-25	2010-01-12	2010-01-12	ENSG00000235812	ENSG00000235812			19822	pseudogene	pseudogene			"""a disintegrin and metalloproteinase domain 21 pseudogene"", ""ADAM metallopeptidase domain 21 pseudogene"""	ADAM21P			Standard	NR_003951		Approved		uc010ttg.2		OTTHUMG00000166565		14.37:g.70713951G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000530196.1	37	NULL		14																																																																																			ADAM21P1	-	-	ENSG00000235812		0.438	ADAM21P1-002	KNOWN	basic	processed_transcript	ADAM21P1	HGNC	pseudogene	OTTHUMT00000390451.1	34	0.00	0	G	NG_002467		70713951	70713951	-1	no_errors	ENST00000530196	ensembl	human	known	69_37n	rna	25	21.88	7	SNP	0.732	A
ADH4	127	genome.wustl.edu	37	4	100057690	100057690	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr4:100057690G>T	ENST00000265512.7	-	5	583	c.509C>A	c.(508-510)gCa>gAa	p.A170E	ADH4_ENST00000508393.1_Missense_Mutation_p.A189E|ADH4_ENST00000423445.1_Missense_Mutation_p.A189E|RP11-696N14.1_ENST00000500358.2_RNA|ADH4_ENST00000505590.1_Missense_Mutation_p.A189E	NM_000670.3	NP_000661.2	P08319	ADH4_HUMAN	alcohol dehydrogenase 4 (class II), pi polypeptide	170					alcohol catabolic process (GO:0046164)|alcohol metabolic process (GO:0006066)|cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|quinone metabolic process (GO:1901661)|retinoid metabolic process (GO:0001523)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|alcohol dehydrogenase activity, zinc-dependent (GO:0004024)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|all-trans retinal binding (GO:0005503)|benzaldehyde dehydrogenase activity (GO:0019115)|ethanol binding (GO:0035276)|NAD binding (GO:0051287)|NADPH:quinone reductase activity (GO:0003960)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)|retinol binding (GO:0019841)|retinol dehydrogenase activity (GO:0004745)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(2)|liver(2)|lung(8)|prostate(2)|skin(2)	18				OV - Ovarian serous cystadenocarcinoma(123;4.48e-08)		CTCTAAATTTGCATCATCATC	0.403																																						dbGAP											0													195.0	177.0	183.0					4																	100057690		2203	4300	6503	-	-	-	SO:0001583	missense	0			M15943	CCDS34032.1	4q22	2008-02-05				ENSG00000198099	1.1.1.1	"""Alcohol dehydrogenases"""	252	protein-coding gene	gene with protein product		103740					Standard	NM_000670		Approved	ADH-2	uc003hun.3	P08319		ENST00000265512.7:c.509C>A	4.37:g.100057690G>T	ENSP00000265512:p.Ala170Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K470|B4DIE7|C9J4A9|Q8TCD7	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.A189E	ENST00000265512.7	37	c.566	CCDS34032.1	4	.	.	.	.	.	.	.	.	.	.	G	20.9	4.069637	0.76301	.	.	ENSG00000198099	ENST00000508393;ENST00000265512;ENST00000423445;ENST00000505590;ENST00000512499;ENST00000504125	T;T;T;T;T;T	0.03889	3.77;3.77;3.77;3.77;3.77;3.77	4.55	1.75	0.24633	GroES-like (1);	0.000000	0.64402	D	0.000001	T	0.19725	0.0474	M	0.87827	2.91	0.80722	D	1	D;D	0.89917	1.0;0.991	D;D	0.81914	0.995;0.982	T	0.00460	-1.1726	10	0.87932	D	0	-6.3382	7.2356	0.26067	0.1483:0.0:0.7156:0.1361	.	189;170	P08319-2;P08319	.;ADH4_HUMAN	E	189;170;189;189;189;152	ENSP00000424630:A189E;ENSP00000265512:A170E;ENSP00000397939:A189E;ENSP00000425416:A189E;ENSP00000423571:A189E;ENSP00000427525:A152E	ENSP00000265512:A170E	A	-	2	0	ADH4	100276713	1.000000	0.71417	0.857000	0.33713	0.733000	0.41908	5.745000	0.68672	0.553000	0.29044	0.650000	0.86243	GCA	ADH4	-	superfamily_GroES-like,smart_PKS_ER	ENSG00000198099		0.403	ADH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH4	HGNC	protein_coding	OTTHUMT00000364220.2	56	0.00	0	G	NM_000670		100057690	100057690	-1	no_errors	ENST00000423445	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	0.994	T
ANKFN1	162282	genome.wustl.edu	37	17	54543866	54543866	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr17:54543866C>A	ENST00000318698.2	+	14	1751	c.1716C>A	c.(1714-1716)agC>agA	p.S572R	ANKFN1_ENST00000566473.2_Missense_Mutation_p.S572R	NM_153228.2	NP_694960.2	Q8N957	ANKF1_HUMAN	ankyrin-repeat and fibronectin type III domain containing 1	572										NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(11)|lung(27)|ovary(1)|prostate(1)|skin(1)	53						AGCTGCAAAGCCAGAGAAAGT	0.403																																						dbGAP											0													81.0	74.0	76.0					17																	54543866		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095654	CCDS32686.1	17q23.2	2014-02-12	2005-11-15		ENSG00000153930	ENSG00000153930		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	26766	protein-coding gene	gene with protein product							Standard	NM_153228		Approved	FLJ38335	uc002iun.1	Q8N957	OTTHUMG00000155010	ENST00000318698.2:c.1716C>A	17.37:g.54543866C>A	ENSP00000321627:p.Ser572Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Fibronectin_type3,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3	p.S572R	ENST00000318698.2	37	c.1716	CCDS32686.1	17	.	.	.	.	.	.	.	.	.	.	C	11.47	1.647505	0.29246	.	.	ENSG00000153930	ENST00000318698	T	0.22134	1.97	5.45	2.43	0.29744	.	0.077552	0.85682	D	0.000000	T	0.18215	0.0437	N	0.25144	0.715	0.47994	D	0.999566	D	0.56035	0.974	P	0.51657	0.676	T	0.03240	-1.1057	10	0.16896	T	0.51	-13.0719	10.0018	0.41933	0.0:0.7224:0.0:0.2776	.	572	Q8N957	ANKF1_HUMAN	R	572	ENSP00000321627:S572R	ENSP00000321627:S572R	S	+	3	2	ANKFN1	51898865	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.174000	0.31932	0.293000	0.22520	-0.140000	0.14226	AGC	ANKFN1	-	NULL	ENSG00000153930		0.403	ANKFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKFN1	HGNC	protein_coding	OTTHUMT00000338043.1	64	0.00	0	C	NM_153228		54543866	54543866	+1	no_errors	ENST00000318698	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	1.000	A
ARHGEF33	100271715	genome.wustl.edu	37	2	39185243	39185243	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr2:39185243C>G	ENST00000536934.1	+	13	1524	c.1439C>G	c.(1438-1440)cCc>cGc	p.P480R	ARHGEF33_ENST00000409978.1_Missense_Mutation_p.P480R|ARHGEF33_ENST00000398800.4_Missense_Mutation_p.P480R|ARHGEF33_ENST00000483305.1_3'UTR			A8MVX0	ARG33_HUMAN	Rho guanine nucleotide exchange factor (GEF) 33	480							Rho guanyl-nucleotide exchange factor activity (GO:0005089)			endometrium(3)|pancreas(1)|prostate(1)	5						GATGCTTCCCCCACTGCAGGT	0.547																																						dbGAP											0													118.0	106.0	110.0					2																	39185243		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46263.1, CCDS46263.2	2p22.1	2012-07-24			ENSG00000214694	ENSG00000214694		"""Rho guanine nucleotide exchange factors"""	37252	protein-coding gene	gene with protein product							Standard	NM_001145451		Approved		uc021vgd.1	A8MVX0	OTTHUMG00000153540	ENST00000536934.1:c.1439C>G	2.37:g.39185243C>G	ENSP00000445586:p.Pro480Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KPX2	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,superfamily_Prefoldin,smart_DH-domain,pfscan_DH-domain	p.P480R	ENST00000536934.1	37	c.1439		2	.	.	.	.	.	.	.	.	.	.	C	17.90	3.502359	0.64298	.	.	ENSG00000214694	ENST00000409978;ENST00000398800;ENST00000536934	T;T;T	0.50277	0.75;0.75;0.75	5.18	5.18	0.71444	.	.	.	.	.	T	0.36771	0.0979	N	0.19112	0.55	0.40896	D	0.984113	P	0.44627	0.839	B	0.41202	0.35	T	0.16217	-1.0410	9	0.25106	T	0.35	.	18.6875	0.91570	0.0:1.0:0.0:0.0	.	480	A8MVX0	ARG33_HUMAN	R	480	ENSP00000387020:P480R;ENSP00000381780:P480R;ENSP00000445586:P480R	ENSP00000381780:P480R	P	+	2	0	ARHGEF33	39038747	0.998000	0.40836	0.996000	0.52242	0.996000	0.88848	3.410000	0.52664	2.399000	0.81585	0.655000	0.94253	CCC	ARHGEF33	-	NULL	ENSG00000214694		0.547	ARHGEF33-202	KNOWN	basic	protein_coding	ARHGEF33	HGNC	protein_coding		80	0.00	0	C	NM_001145451		39185243	39185243	+1	no_errors	ENST00000398800	ensembl	human	known	69_37n	missense	71	17.44	15	SNP	1.000	G
ARPC1A	10552	genome.wustl.edu	37	7	98931019	98931019	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr7:98931019G>T	ENST00000262942.5	+	2	167	c.43G>T	c.(43-45)Gcc>Tcc	p.A15S	ARPC1A_ENST00000432884.2_5'UTR	NM_001190996.1|NM_006409.3	NP_001177925.1|NP_006400.2	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex, subunit 1A, 41kDa	15					actin cytoskeleton organization (GO:0030036)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of actin filament polymerization (GO:0030833)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|liver(2)|lung(7)|ovary(1)|prostate(1)	19	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			CACCTGTCATGCCTGGAACAG	0.353																																						dbGAP											0													206.0	201.0	203.0					7																	98931019		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08999	CCDS5660.1	7q22.1	2013-03-14	2002-08-29		ENSG00000241685	ENSG00000241685		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	703	protein-coding gene	gene with protein product	"""actin binding protein (Schizosaccharomyces pombe sop2-like)"", ""SOP2-like protein"""	604220	"""actin related protein 2/3 complex, subunit 1A (41 kD)"""			8978670, 9230079	Standard	NM_006409		Approved	SOP2Hs, SOP2L, Arc40	uc003upx.2	Q92747	OTTHUMG00000154553	ENST00000262942.5:c.43G>T	7.37:g.98931019G>T	ENSP00000262942:p.Ala15Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D276|B4DLQ7|D6W5S1|Q7Z5U8|Q86WU5|Q8IXQ0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A15S	ENST00000262942.5	37	c.43	CCDS5660.1	7	.	.	.	.	.	.	.	.	.	.	G	19.25	3.791462	0.70452	.	.	ENSG00000241685	ENST00000262942	T	0.69306	-0.39	5.9	5.9	0.94986	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.80613	0.4656	.	.	.	0.80722	D	1	D	0.53619	0.961	D	0.72625	0.978	T	0.74250	-0.3726	9	0.22109	T	0.4	.	19.8621	0.96787	0.0:0.0:1.0:0.0	.	15	Q92747	ARC1A_HUMAN	S	15	ENSP00000262942:A15S	ENSP00000262942:A15S	A	+	1	0	ARPC1A	98768955	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.400000	0.97290	2.789000	0.95967	0.655000	0.94253	GCC	ARPC1A	-	superfamily_WD40_repeat_dom,pirsf_ARPC2/3_su1	ENSG00000241685		0.353	ARPC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC1A	HGNC	protein_coding	OTTHUMT00000335908.1	54	0.00	0	G	NM_006409		98931019	98931019	+1	no_errors	ENST00000262942	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	1.000	T
BPTF	2186	genome.wustl.edu	37	17	65914930	65914930	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr17:65914930C>T	ENST00000321892.4	+	14	5843	c.5782C>T	c.(5782-5784)Cca>Tca	p.P1928S	BPTF_ENST00000424123.3_Missense_Mutation_p.P1789S|BPTF_ENST00000306378.6_Missense_Mutation_p.P1802S|BPTF_ENST00000335221.5_Missense_Mutation_p.P1928S			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1928					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CAAGGCTCCTCCAGGAGGAGG	0.493																																						dbGAP											0													126.0	121.0	123.0					17																	65914930		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.5782C>T	17.37:g.65914930C>T	ENSP00000315454:p.Pro1928Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.P1928S	ENST00000321892.4	37	c.5782		17	.	.	.	.	.	.	.	.	.	.	C	15.85	2.953934	0.53293	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.11169	2.8;2.8;2.8	5.53	4.56	0.56223	.	.	.	.	.	T	0.15392	0.0371	N	0.13098	0.295	0.51482	D	0.999929	P;D	0.89917	0.471;1.0	P;D	0.87578	0.517;0.998	T	0.15896	-1.0421	9	0.10377	T	0.69	-3.6258	14.5065	0.67755	0.0:0.9293:0.0:0.0707	.	1802;1928	Q12830-2;Q12830-4	.;.	S	1802;1928;1928	ENSP00000307208:P1802S;ENSP00000334351:P1928S;ENSP00000315454:P1928S	ENSP00000307208:P1802S	P	+	1	0	BPTF	63345392	0.999000	0.42202	0.999000	0.59377	0.995000	0.86356	2.052000	0.41316	1.342000	0.45619	0.650000	0.86243	CCA	BPTF	-	NULL	ENSG00000171634		0.493	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		64	0.00	0	C	NM_182641, NM_004459		65914930	65914930	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	1.000	T
DCLRE1C	64421	genome.wustl.edu	37	10	14968884	14968884	+	Silent	SNP	A	A	G			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr10:14968884A>G	ENST00000378278.2	-	11	967	c.930T>C	c.(928-930)agT>agC	p.S310S	DCLRE1C_ENST00000378255.1_Silent_p.S190S|DCLRE1C_ENST00000378254.1_Silent_p.S190S|DCLRE1C_ENST00000396817.2_Silent_p.S190S|DCLRE1C_ENST00000357717.2_Silent_p.S195S|DCLRE1C_ENST00000492201.1_5'UTR|DCLRE1C_ENST00000378258.1_Silent_p.S190S|DCLRE1C_ENST00000378249.1_Silent_p.S195S|DCLRE1C_ENST00000378289.4_Silent_p.S310S|DCLRE1C_ENST00000378246.2_Silent_p.S195S|DCLRE1C_ENST00000453695.2_Silent_p.S190S			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	310					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						CTCTGTATGAACTCTCTCCAG	0.408								Non-homologous end-joining																														dbGAP											0													85.0	82.0	83.0					10																	14968884		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.930T>C	10.37:g.14968884A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Silent	SNP	pfam_DRMBL	p.S310	ENST00000378278.2	37	c.930	CCDS31149.1	10																																																																																			DCLRE1C	-	pfam_DRMBL	ENSG00000152457		0.408	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	20	0.00	0	A	NM_022487		14968884	14968884	-1	no_errors	ENST00000378278	ensembl	human	known	69_37n	silent	28	22.22	8	SNP	1.000	G
DCUN1D3	123879	genome.wustl.edu	37	16	20873624	20873624	+	Silent	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr16:20873624G>A	ENST00000324344.4	-	2	522	c.237C>T	c.(235-237)tcC>tcT	p.S79S	DCUN1D3_ENST00000563934.1_Silent_p.S79S|ERI2_ENST00000564349.1_Intron	NM_173475.2	NP_775746.1	Q8IWE4	DCNL3_HUMAN	DCN1, defective in cullin neddylation 1, domain containing 3	79					negative regulation of cell growth (GO:0030308)|positive regulation of apoptotic process (GO:0043065)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)	perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(2)	14				GBM - Glioblastoma multiforme(48;0.249)		CATTGGACTTGGACTCCCTCC	0.572																																						dbGAP											0													150.0	146.0	148.0					16																	20873624		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			BC040442	CCDS10592.1	16p12.3	2013-06-10	2013-06-10		ENSG00000188215	ENSG00000188215			28734	protein-coding gene	gene with protein product			"""DCN1, defective in cullin neddylation 1, domain containing 3 (S. cerevisiae)"""			15988528	Standard	NM_173475		Approved	MGC48972, FLJ41725, DKFZp686O0290	uc002dhz.3	Q8IWE4	OTTHUMG00000131553	ENST00000324344.4:c.237C>T	16.37:g.20873624G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVY4	Silent	SNP	pfam_PONY_dom	p.S79	ENST00000324344.4	37	c.237	CCDS10592.1	16																																																																																			DCUN1D3	-	NULL	ENSG00000188215		0.572	DCUN1D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCUN1D3	HGNC	protein_coding	OTTHUMT00000254415.2	57	0.00	0	G	NM_173475		20873624	20873624	-1	no_errors	ENST00000324344	ensembl	human	known	69_37n	silent	56	20.00	14	SNP	0.948	A
DPCR1	135656	genome.wustl.edu	37	6	30919390	30919390	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr6:30919390C>T	ENST00000462446.1	+	2	3177	c.3149C>T	c.(3148-3150)tCg>tTg	p.S1050L	HCG21_ENST00000419481.1_RNA|DPCR1_ENST00000304311.2_5'UTR			Q3MIW9	DPCR1_HUMAN	diffuse panbronchiolitis critical region 1	0						integral component of membrane (GO:0016021)				endometrium(1)|kidney(2)|large_intestine(3)|lung(3)|pancreas(1)	10						ATGACCCCATCGGCCAATGAG	0.493																																						dbGAP											0													192.0	171.0	177.0					6																	30919390		692	1591	2283	-	-	-	SO:0001583	missense	0			AB064272	CCDS4692.1, CCDS4692.2	6p21.32	2008-02-05			ENSG00000168631	ENSG00000168631			21666	protein-coding gene	gene with protein product		613928				12185533, 10677310	Standard	NM_080870		Approved	PBLT, bCX105N19.6	uc003nsg.2	Q3MIW9	OTTHUMG00000031104	ENST00000462446.1:c.3149C>T	6.37:g.30919390C>T	ENSP00000417182:p.Ser1050Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZC0|Q658M7|Q8WYN2	Missense_Mutation	SNP	NULL	p.S1050L	ENST00000462446.1	37	c.3149	CCDS4692.2	6	.	.	.	.	.	.	.	.	.	.	c	7.394	0.631408	0.14322	.	.	ENSG00000168631	ENST00000462446	T	0.36878	1.23	3.45	-2.2	0.06994	.	.	.	.	.	T	0.04724	0.0128	N	0.08118	0	0.09310	N	0.999998	B	0.28178	0.202	B	0.26693	0.072	T	0.36553	-0.9743	9	0.30078	T	0.28	7.8341	4.3109	0.10971	0.1502:0.4603:0.0:0.3895	.	1050	E9PEI6	.	L	1050	ENSP00000417182:S1050L	ENSP00000417182:S1050L	S	+	2	0	DPCR1	31027369	0.000000	0.05858	0.000000	0.03702	0.012000	0.07955	-1.939000	0.01545	-0.731000	0.04862	0.447000	0.29281	TCG	DPCR1	-	NULL	ENSG00000168631		0.493	DPCR1-001	NOVEL	not_organism_supported|basic|CCDS	protein_coding	DPCR1	HGNC	protein_coding	OTTHUMT00000076173.3	63	0.00	0	C	NM_080870		30919390	30919390	+1	no_errors	ENST00000462446	ensembl	human	novel	69_37n	missense	44	13.73	7	SNP	0.000	T
G3BP2	9908	genome.wustl.edu	37	4	76584088	76584088	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr4:76584088G>A	ENST00000359707.4	-	3	901	c.116C>T	c.(115-117)tCc>tTc	p.S39F	G3BP2_ENST00000395719.3_Missense_Mutation_p.S39F|G3BP2_ENST00000357854.3_Missense_Mutation_p.S39F|G3BP2_ENST00000502654.1_5'UTR	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	39	NTF2. {ECO:0000255|PROSITE- ProRule:PRU00137}.				cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			ATGAACATAGGAAGAATTCCT	0.368																																						dbGAP											0													92.0	104.0	100.0					4																	76584088		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.116C>T	4.37:g.76584088G>A	ENSP00000352738:p.Ser39Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	pfam_NTF2,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Nuclear_transport_factor_2_euk	p.S39F	ENST00000359707.4	37	c.116	CCDS3571.1	4	.	.	.	.	.	.	.	.	.	.	G	29.7	5.031028	0.93575	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854;ENST00000503660;ENST00000507745;ENST00000509100;ENST00000511146;ENST00000515457;ENST00000507252;ENST00000511868;ENST00000509561;ENST00000508510;ENST00000499709	T;T;T	0.80123	-1.31;-1.31;-1.34	6.17	6.17	0.99709	Nuclear transport factor 2, Eukaryote (1);Nuclear transport factor 2 (1);	0.051481	0.85682	D	0.000000	D	0.88749	0.6521	L	0.59436	1.845	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85887	0.1426	10	0.39692	T	0.17	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	39;39	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	F	39	ENSP00000379069:S39F;ENSP00000352738:S39F;ENSP00000350518:S39F	ENSP00000350518:S39F	S	-	2	0	G3BP2	76803112	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	TCC	G3BP2	-	pfam_NTF2,pfscan_Nuclear_transport_factor_2_euk	ENSG00000138757		0.368	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	G3BP2	HGNC	protein_coding	OTTHUMT00000252399.2	54	0.00	0	G	NM_012297		76584088	76584088	-1	no_errors	ENST00000359707	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	1.000	A
GLUL	2752	genome.wustl.edu	37	1	182359762	182359762	+	5'UTR	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr1:182359762G>A	ENST00000339526.4	-	0	1165				GLUL_ENST00000331872.6_Intron|GLUL_ENST00000491322.1_5'Flank|GLUL_ENST00000417584.2_Intron|GLUL_ENST00000311223.5_5'UTR			P15104	GLNA_HUMAN	glutamate-ammonia ligase						cell proliferation (GO:0008283)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to starvation (GO:0009267)|glutamate catabolic process (GO:0006538)|glutamine biosynthetic process (GO:0006542)|neurotransmitter uptake (GO:0001504)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of insulin secretion (GO:0032024)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|protein homooligomerization (GO:0051260)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glial cell projection (GO:0097386)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|glutamate-ammonia ligase activity (GO:0004356)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)			endometrium(2)|large_intestine(5)|lung(8)|upper_aerodigestive_tract(1)	16					Ceftriaxone(DB01212)|Diazoxide(DB01119)|L-Glutamine(DB00130)|L-Methionine(DB00134)|Pegvisomant(DB00082)	CTGGGAGAGGGCGATGGAGAA	0.592																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AL161952	CCDS1344.1	1q31	2010-05-04	2010-05-04		ENSG00000135821	ENSG00000135821	6.3.1.2		4341	protein-coding gene	gene with protein product	"""glutamine synthetase"""	138290	"""glutamate-ammonia ligase (glutamine synthase)"""	GLNS		1681907, 2888076	Standard	NM_002065		Approved		uc001gpa.2	P15104	OTTHUMG00000037407	ENST00000339526.4:c.-144C>T	1.37:g.182359762G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q499Y9|Q5T9Z1|Q7Z3W4|Q8IZ17	RNA	SNP	-	NULL	ENST00000339526.4	37	NULL	CCDS1344.1	1																																																																																			GLUL	-	-	ENSG00000135821		0.592	GLUL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUL	HGNC	protein_coding	OTTHUMT00000091044.1	79	0.00	0	G	NM_002065		182359762	182359762	-1	no_errors	ENST00000480604	ensembl	human	known	69_37n	rna	91	15.74	17	SNP	0.335	A
GPRASP2	114928	genome.wustl.edu	37	X	101971061	101971061	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chrX:101971061G>A	ENST00000535209.1	+	4	2095	c.1264G>A	c.(1264-1266)Gcg>Acg	p.A422T	GPRASP2_ENST00000543253.1_Missense_Mutation_p.A422T|GPRASP2_ENST00000332262.5_Missense_Mutation_p.A422T			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	422						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						TGGCGGATCCGCGTACTGGGC	0.572																																						dbGAP											0													67.0	69.0	68.0					X																	101971061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.1264G>A	X.37:g.101971061G>A	ENSP00000437394:p.Ala422Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXA0|Q8NAB4	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.A422T	ENST00000535209.1	37	c.1264	CCDS14501.1	X	.	.	.	.	.	.	.	.	.	.	G	0.054	-1.242172	0.01481	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.06528	3.29;3.29;3.29	4.44	-2.38	0.06622	.	1.039220	0.07713	N	0.942441	T	0.02455	0.0075	N	0.08118	0	0.09310	N	1	B	0.15141	0.012	B	0.01281	0.0	T	0.47407	-0.9120	10	0.13470	T	0.59	.	2.0911	0.03657	0.1417:0.1887:0.4331:0.2364	.	422	Q96D09	GASP2_HUMAN	T	422	ENSP00000437872:A422T;ENSP00000437394:A422T;ENSP00000339057:A422T	ENSP00000339057:A422T	A	+	1	0	GPRASP2	101857717	0.225000	0.23685	0.058000	0.19502	0.625000	0.37756	-0.076000	0.11412	-0.551000	0.06175	-1.251000	0.01509	GCG	GPRASP2	-	NULL	ENSG00000158301		0.572	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	HGNC	protein_coding	OTTHUMT00000057626.2	66	0.00	0	G	NM_138437		101971061	101971061	+1	no_errors	ENST00000332262	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	0.033	A
GRB10	2887	genome.wustl.edu	37	7	50737517	50737517	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr7:50737517G>C	ENST00000401949.1	-	7	875	c.406C>G	c.(406-408)Ccg>Gcg	p.P136A	GRB10_ENST00000403097.1_Missense_Mutation_p.P130A|GRB10_ENST00000398812.2_Missense_Mutation_p.P136A|GRB10_ENST00000357271.5_Missense_Mutation_p.P136A|GRB10_ENST00000402578.1_Missense_Mutation_p.P78A|GRB10_ENST00000402497.1_Missense_Mutation_p.P78A|GRB10_ENST00000406641.1_Missense_Mutation_p.P78A|GRB10_ENST00000439599.1_Missense_Mutation_p.P130A|GRB10_ENST00000407526.1_Missense_Mutation_p.P78A|GRB10_ENST00000398810.2_Missense_Mutation_p.P78A|GRB10_ENST00000335866.3_Missense_Mutation_p.P78A			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	136					insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					GGGATGGCCGGCAGAGATGAG	0.597									Russell-Silver syndrome																													dbGAP											0													28.0	33.0	31.0					7																	50737517		1939	4136	6075	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.406C>G	7.37:g.50737517G>C	ENSP00000385770:p.Pro136Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.P136A	ENST00000401949.1	37	c.406	CCDS43582.1	7	.	.	.	.	.	.	.	.	.	.	.	32	5.109958	0.94292	.	.	ENSG00000106070	ENST00000398812;ENST00000439599;ENST00000335866;ENST00000398810;ENST00000402578;ENST00000403097;ENST00000406641;ENST00000357271;ENST00000407526;ENST00000401949;ENST00000402497	D;D;D;D;D;D;D;D;D;D;D	0.88354	-2.09;-2.09;-2.13;-2.13;-2.13;-2.09;-2.13;-2.37;-2.13;-2.09;-2.13	5.71	5.71	0.89125	.	0.000000	0.85682	D	0.000000	D	0.93318	0.7870	M	0.67397	2.05	0.80722	D	1	D;D;D	0.65815	0.957;0.985;0.995	P;P;P	0.60068	0.868;0.868;0.831	D	0.93435	0.6789	10	0.72032	D	0.01	-35.7664	19.8501	0.96736	0.0:0.0:1.0:0.0	.	130;136;136	Q13322-4;Q13322-2;Q13322	.;.;GRB10_HUMAN	A	136;130;78;78;78;130;78;136;78;136;78	ENSP00000381793:P136A;ENSP00000406716:P130A;ENSP00000338543:P78A;ENSP00000381790:P78A;ENSP00000385189:P78A;ENSP00000385544:P130A;ENSP00000385366:P78A;ENSP00000349818:P136A;ENSP00000385046:P78A;ENSP00000385770:P136A;ENSP00000385748:P78A	ENSP00000338543:P78A	P	-	1	0	GRB10	50705011	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	9.471000	0.97696	2.677000	0.91161	0.655000	0.94253	CCG	GRB10	-	NULL	ENSG00000106070		0.597	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB10	HGNC	protein_coding	OTTHUMT00000319157.1	47	0.00	0	G			50737517	50737517	-1	no_errors	ENST00000398812	ensembl	human	known	69_37n	missense	30	21.05	8	SNP	1.000	C
IQSEC2	23096	genome.wustl.edu	37	X	53265540	53265540	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chrX:53265540C>T	ENST00000375368.5	-	12	3585	c.3385G>A	c.(3385-3387)Gca>Aca	p.A1129T	IQSEC2_ENST00000375365.2_Missense_Mutation_p.A934T|IQSEC2_ENST00000396435.3_Missense_Mutation_p.A1139T			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	1129					actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						CTGCTGAGTGCGCCCCGTTTG	0.657																																						dbGAP											0													76.0	51.0	60.0					X																	53265540		2201	4300	6501	-	-	-	SO:0001583	missense	0			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.3385G>A	X.37:g.53265540C>T	ENSP00000364517:p.Ala1129Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.A1139T	ENST00000375368.5	37	c.3415		X	.	.	.	.	.	.	.	.	.	.	c	18.98	3.738494	0.69304	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.54071	0.59;0.59;0.59	5.08	5.08	0.68730	.	.	.	.	.	T	0.72399	0.3455	M	0.75777	2.31	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.87578	0.998;0.994	T	0.74896	-0.3508	9	0.51188	T	0.08	.	16.3491	0.83195	0.0:1.0:0.0:0.0	.	1139;934	Q5JU85-2;Q5JU85-3	.;.	T	1139;1129;934	ENSP00000379712:A1139T;ENSP00000364517:A1129T;ENSP00000364514:A934T	ENSP00000364514:A934T	A	-	1	0	IQSEC2	53282265	1.000000	0.71417	0.952000	0.39060	0.924000	0.55760	7.433000	0.80362	2.113000	0.64589	0.464000	0.42555	GCA	IQSEC2	-	NULL	ENSG00000124313		0.657	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		92	0.00	0	C	XM_291345		53265540	53265540	-1	no_errors	ENST00000396435	ensembl	human	known	69_37n	missense	56	26.32	20	SNP	1.000	T
LCE1A	353131	genome.wustl.edu	37	1	152800194	152800194	+	Silent	SNP	C	C	T			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr1:152800194C>T	ENST00000335123.2	+	1	246	c.246C>T	c.(244-246)ctC>ctT	p.L82L		NM_178348.2	NP_848125.1	Q5T7P2	LCE1A_HUMAN	late cornified envelope 1A	82	Cys-rich.				keratinization (GO:0031424)					endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	8	Lung NSC(65;9.06e-30)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCACAGACTCCAGAGCTCTG	0.692																																						dbGAP											0													19.0	24.0	23.0					1																	152800194		2187	4290	6477	-	-	-	SO:0001819	synonymous_variant	0				CCDS1028.1	1q21.3	2011-01-28			ENSG00000186844	ENSG00000186844		"""Late cornified envelopes"""	29459	protein-coding gene	gene with protein product		612603				11698679	Standard	NM_178348		Approved	LEP1	uc010pdw.2	Q5T7P2	OTTHUMG00000012447	ENST00000335123.2:c.246C>T	1.37:g.152800194C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L82	ENST00000335123.2	37	c.246	CCDS1028.1	1																																																																																			LCE1A	-	NULL	ENSG00000186844		0.692	LCE1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCE1A	HGNC	protein_coding	OTTHUMT00000034660.2	63	0.00	0	C	NM_178348		152800194	152800194	+1	no_errors	ENST00000335123	ensembl	human	known	69_37n	silent	70	10.26	8	SNP	0.043	T
MRPL28	10573	genome.wustl.edu	37	16	420169	420169	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr16:420169C>T	ENST00000199706.8	-	2	85	c.50G>A	c.(49-51)cGg>cAg	p.R17Q	MRPL28_ENST00000389675.2_Missense_Mutation_p.R17Q|MRPL28_ENST00000429738.1_5'Flank	NM_006428.4	NP_006419.2	Q13084	RM28_HUMAN	mitochondrial ribosomal protein L28	17					translation (GO:0006412)	cytoplasm (GO:0005737)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)	5		Hepatocellular(16;0.000105)|Lung NSC(18;0.0324)|all_lung(18;0.064)				GATGCCCTCCCGCAGCTGCAG	0.682																																						dbGAP											0													18.0	19.0	19.0					16																	420169		2168	4281	6449	-	-	-	SO:0001583	missense	0			U19796	CCDS32349.1	16p13.12	2012-09-26	2002-11-13		ENSG00000086504	ENSG00000086504		"""Mitochondrial ribosomal proteins / large subunits"""	14484	protein-coding gene	gene with protein product		604853	"""melanoma-associated antigen recognised by cytotoxic T lymphocytes"""	MAAT1		11551941, 19753307	Standard	NM_006428		Approved	p15	uc002cgs.2	Q13084	OTTHUMG00000047994	ENST00000199706.8:c.50G>A	16.37:g.420169C>T	ENSP00000199706:p.Arg17Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCM4|D3DU46|Q4TT39|Q96S26|Q9BQD8|Q9BR04	Missense_Mutation	SNP	NULL	p.R17Q	ENST00000199706.8	37	c.50	CCDS32349.1	16	.	.	.	.	.	.	.	.	.	.	C	7.937	0.741860	0.15642	.	.	ENSG00000086504	ENST00000397735;ENST00000199706;ENST00000397734;ENST00000389675;ENST00000441883;ENST00000447696;ENST00000450882	T;T;T;T;T	0.29655	1.98;1.98;1.98;1.56;1.56	4.74	-0.82	0.10826	.	0.492954	0.21963	N	0.066566	T	0.15003	0.0362	N	0.16130	0.375	0.09310	N	1	B;B;B	0.19935	0.04;0.04;0.04	B;B;B	0.12837	0.008;0.008;0.008	T	0.22103	-1.0226	10	0.25106	T	0.35	-17.7777	10.4599	0.44572	0.0:0.4166:0.0:0.5834	.	17;17;17	A2IDC6;Q13084;Q4TT38	.;RM28_HUMAN;.	Q	17	ENSP00000199706:R17Q;ENSP00000374326:R17Q;ENSP00000398684:R17Q;ENSP00000390399:R17Q;ENSP00000395305:R17Q	ENSP00000199706:R17Q	R	-	2	0	MRPL28	360170	0.045000	0.20229	0.019000	0.16419	0.003000	0.03518	0.148000	0.16224	-0.147000	0.11254	-0.140000	0.14226	CGG	MRPL28	-	NULL	ENSG00000086504		0.682	MRPL28-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL28	HGNC	protein_coding	OTTHUMT00000139285.2	35	0.00	0	C			420169	420169	-1	no_errors	ENST00000199706	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	0.110	T
MON1B	22879	genome.wustl.edu	37	16	77228780	77228780	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr16:77228780C>T	ENST00000248248.3	+	4	1374	c.1024C>T	c.(1024-1026)Cgc>Tgc	p.R342C	MON1B_ENST00000545553.1_Missense_Mutation_p.R196C|MON1B_ENST00000439557.2_Missense_Mutation_p.R233C|MON1B_ENST00000320859.6_Intron	NM_014940.2	NP_055755.1	Q7L1V2	MON1B_HUMAN	MON1 secretory trafficking family member B	342										breast(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	17						CTACGTGGCCCGCCTGGATGC	0.637																																						dbGAP											0													99.0	101.0	101.0					16																	77228780		2198	4300	6498	-	-	-	SO:0001583	missense	0			BC024277	CCDS10925.1, CCDS67082.1, CCDS67083.1	16q23.1	2013-08-21	2013-08-21		ENSG00000103111	ENSG00000103111			25020	protein-coding gene	gene with protein product		608954	"""MON1 homolog B (yeast)"""			10048485	Standard	NM_014940		Approved	SAND2, HSRG1, KIAA0872	uc002fez.3	Q7L1V2	OTTHUMG00000137618	ENST00000248248.3:c.1024C>T	16.37:g.77228780C>T	ENSP00000248248:p.Arg342Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDZ0|O94949	Missense_Mutation	SNP	pfam_Vacuolar_fusion_protein_MON1,prints_Vacuolar_fusion_protein_MON1	p.R342C	ENST00000248248.3	37	c.1024	CCDS10925.1	16	.	.	.	.	.	.	.	.	.	.	C	21.3	4.123419	0.77436	.	.	ENSG00000103111	ENST00000248248;ENST00000439557;ENST00000545553	.	.	.	4.8	2.83	0.33086	.	0.175557	0.51477	D	0.000093	T	0.39784	0.1091	N	0.19112	0.55	0.80722	D	1	B;D;D;D	0.62365	0.131;0.991;0.991;0.986	B;P;P;P	0.54706	0.015;0.759;0.759;0.683	T	0.26018	-1.0115	9	0.52906	T	0.07	.	5.6509	0.17616	0.0:0.6964:0.0:0.3036	.	196;233;222;342	B4DDZ0;E7EW32;Q6ZR87;Q7L1V2	.;.;.;MON1B_HUMAN	C	342;233;196	.	ENSP00000248248:R342C	R	+	1	0	MON1B	75786281	0.996000	0.38824	1.000000	0.80357	0.955000	0.61496	2.780000	0.47742	1.333000	0.45449	0.563000	0.77884	CGC	MON1B	-	pfam_Vacuolar_fusion_protein_MON1,prints_Vacuolar_fusion_protein_MON1	ENSG00000103111		0.637	MON1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON1B	HGNC	protein_coding	OTTHUMT00000269036.2	159	0.00	0	C	NM_014940		77228780	77228780	+1	no_errors	ENST00000248248	ensembl	human	known	69_37n	missense	89	21.24	24	SNP	1.000	T
NLGN2	57555	genome.wustl.edu	37	17	7317987	7317987	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr17:7317987C>G	ENST00000302926.2	+	4	737	c.664C>G	c.(664-666)Ctc>Gtc	p.L222V	NLGN2_ENST00000575301.1_Missense_Mutation_p.L222V	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	222					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				CCCAGGTTTTCTCAGCACCGG	0.617																																						dbGAP											0													60.0	68.0	66.0					17																	7317987		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.664C>G	17.37:g.7317987C>G	ENSP00000305288:p.Leu222Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2I1	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L222V	ENST00000302926.2	37	c.664	CCDS11103.1	17	.	.	.	.	.	.	.	.	.	.	C	14.29	2.492571	0.44352	.	.	ENSG00000169992	ENST00000302926	T	0.75260	-0.92	4.69	4.69	0.59074	Carboxylesterase, type B (1);	0.085403	0.48286	D	0.000192	D	0.88171	0.6365	H	0.95470	3.675	0.53688	D	0.999974	D	0.71674	0.998	D	0.65140	0.932	D	0.90330	0.4351	10	0.87932	D	0	.	10.2485	0.43356	0.1974:0.8026:0.0:0.0	.	222	Q8NFZ4	NLGN2_HUMAN	V	222	ENSP00000305288:L222V	ENSP00000305288:L222V	L	+	1	0	NLGN2	7258711	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	1.616000	0.36933	2.457000	0.83068	0.462000	0.41574	CTC	NLGN2	-	pfam_CarbesteraseB,pfam_AB_hydrolase_3	ENSG00000169992		0.617	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN2	HGNC	protein_coding	OTTHUMT00000226941.2	36	0.00	0	C	NM_020795		7317987	7317987	+1	no_errors	ENST00000302926	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	G
NYNRIN	57523	genome.wustl.edu	37	14	24884665	24884665	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr14:24884665G>A	ENST00000382554.3	+	9	4028	c.3710G>A	c.(3709-3711)cGg>cAg	p.R1237Q		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	1237					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TATGCCTCCCGGACCACTGCG	0.622																																						dbGAP											0													29.0	32.0	31.0					14																	24884665		1879	4092	5971	-	-	-	SO:0001583	missense	0			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.3710G>A	14.37:g.24884665G>A	ENSP00000371994:p.Arg1237Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P153|Q86TR3|Q9HAC4	Missense_Mutation	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.R1237Q	ENST00000382554.3	37	c.3710	CCDS45090.1	14	.	.	.	.	.	.	.	.	.	.	G	13.95	2.390109	0.42410	.	.	ENSG00000205978	ENST00000382554	T	0.41400	1.0	4.93	4.93	0.64822	.	.	.	.	.	T	0.23171	0.0560	N	0.24115	0.695	0.09310	N	1	P	0.47841	0.901	B	0.29942	0.109	T	0.14980	-1.0453	9	0.59425	D	0.04	.	9.1255	0.36812	0.0969:0.0:0.9031:0.0	.	1237	Q9P2P1	NYNRI_HUMAN	Q	1237	ENSP00000371994:R1237Q	ENSP00000371994:R1237Q	R	+	2	0	NYNRIN	23954505	0.598000	0.26882	0.929000	0.37066	0.540000	0.34992	3.483000	0.53194	2.551000	0.86045	0.655000	0.94253	CGG	NYNRIN	-	NULL	ENSG00000205978		0.622	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	94	0.00	0	G			24884665	24884665	+1	no_errors	ENST00000382554	ensembl	human	known	69_37n	missense	35	45.31	29	SNP	0.046	A
PIWIL1	9271	genome.wustl.edu	37	12	130827204	130827204	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr12:130827204G>A	ENST00000245255.3	+	2	340	c.68G>A	c.(67-69)gGc>gAc	p.G23D		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	23					gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		CAGCTGGTGGGCTCCACTGCC	0.507																																						dbGAP											0													32.0	42.0	39.0					12																	130827204		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.68G>A	12.37:g.130827204G>A	ENSP00000245255:p.Gly23Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.G23D	ENST00000245255.3	37	c.68	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	G	18.64	3.668146	0.67814	.	.	ENSG00000125207	ENST00000245255;ENST00000546060;ENST00000539400;ENST00000539995;ENST00000535956;ENST00000542723	T;T;T;T;T;T	0.35789	1.29;1.29;1.29;1.29;1.29;1.29	5.22	5.22	0.72569	.	0.707174	0.14101	N	0.341346	T	0.45155	0.1328	M	0.63843	1.955	0.37041	D	0.897148	P;P	0.47253	0.892;0.869	P;P	0.51266	0.664;0.534	T	0.37103	-0.9720	10	0.21014	T	0.42	-6.8444	11.2641	0.49099	0.0833:0.0:0.9167:0.0	.	23;23	Q96J94;Q96J94-2	PIWL1_HUMAN;.	D	23	ENSP00000245255:G23D;ENSP00000442086:G23D;ENSP00000440677:G23D;ENSP00000439096:G23D;ENSP00000444353:G23D;ENSP00000438582:G23D	ENSP00000245255:G23D	G	+	2	0	PIWIL1	129393157	0.996000	0.38824	0.116000	0.21606	0.005000	0.04900	3.000000	0.49481	2.421000	0.82119	0.655000	0.94253	GGC	PIWIL1	-	pfam_GAGE	ENSG00000125207		0.507	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	60	0.00	0	G			130827204	130827204	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	0.926	A
RASSF2	9770	genome.wustl.edu	37	20	4764003	4764003	+	3'UTR	SNP	C	C	T	rs1535381	byFrequency	TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr20:4764003C>T	ENST00000379400.3	-	0	2092				RASSF2_ENST00000379376.2_3'UTR|RASSF2_ENST00000478553.1_5'UTR	NM_014737.2	NP_055552.1	P50749	RASF2_HUMAN	Ras association (RalGDS/AF-6) domain family member 2						bone remodeling (GO:0046849)|cell cycle (GO:0007049)|epidermal growth factor receptor signaling pathway via I-kappaB kinase/NF-kappaB cascade (GO:0038168)|homeostasis of number of cells (GO:0048872)|negative regulation of NIK/NF-kappaB signaling (GO:1901223)|ossification (GO:0001503)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(8)|lung(12)|ovary(3)|pancreas(2)|prostate(2)|skin(2)	34						GCCCTGGCCACACTAGCTGGT	0.552													C|||	2651	0.529353	0.4728	0.5634	5008	,	,		21935	0.4921		0.5775	False		,,,				2504	0.5706				Melanoma(158;1891 3343 50738)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			D79990	CCDS13083.1	20p13	2011-08-12	2008-02-22		ENSG00000101265	ENSG00000101265			9883	protein-coding gene	gene with protein product	"""centromere protein 34"""	609492				8724849, 15806169	Standard	NM_014737		Approved	KIAA0168, CENP-34	uc002wld.3	P50749	OTTHUMG00000031790	ENST00000379400.3:c.*916G>A	20.37:g.4764003C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIX9|A8K5Z3|Q17S06|Q53HD0|Q6AHZ2|Q8IZA5	RNA	SNP	-	NULL	ENST00000379400.3	37	NULL	CCDS13083.1	20																																																																																			RASSF2	-	-	ENSG00000101265		0.552	RASSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASSF2	HGNC	protein_coding	OTTHUMT00000077828.1	8	0.00	0	C	NM_014737		4764003	4764003	-1	no_errors	ENST00000474232	ensembl	human	known	69_37n	rna	4	50.00	4	SNP	0.000	T
ROR2	4920	genome.wustl.edu	37	9	94487297	94487297	+	Missense_Mutation	SNP	G	G	T	rs368196613		TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr9:94487297G>T	ENST00000375708.3	-	9	1677	c.1479C>A	c.(1477-1479)ttC>ttA	p.F493L	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Missense_Mutation_p.F353L	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	493	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						GGGCAGGGCCGAACAGGTGAC	0.607																																						dbGAP											0													153.0	178.0	169.0					9																	94487297		2203	4300	6503	-	-	-	SO:0001583	missense	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1479C>A	9.37:g.94487297G>T	ENSP00000364860:p.Phe493Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.F493L	ENST00000375708.3	37	c.1479	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	G	0.015	-1.549712	0.00926	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	D;D	0.82167	-1.58;-1.58	4.47	-8.94	0.00768	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.43579	D	0.000550	T	0.50497	0.1619	N	0.02775	-0.495	0.51767	D	0.999936	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.46857	-0.9161	10	0.14252	T	0.57	.	8.7497	0.34609	0.3675:0.1936:0.4389:0.0	.	493;353	Q01974;B1APY4	ROR2_HUMAN;.	L	353;493	ENSP00000364867:F353L;ENSP00000364860:F493L	ENSP00000364860:F493L	F	-	3	2	ROR2	93527118	0.026000	0.19158	0.163000	0.22734	0.034000	0.12701	-0.576000	0.05854	-2.496000	0.00513	-1.861000	0.00560	TTC	ROR2	-	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169071		0.607	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	20	0.00	0	G			94487297	94487297	-1	no_errors	ENST00000375708	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	0.641	T
RP1L1	94137	genome.wustl.edu	37	8	10466026	10466026	+	Missense_Mutation	SNP	T	T	G			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr8:10466026T>G	ENST00000382483.3	-	4	5805	c.5582A>C	c.(5581-5583)cAg>cCg	p.Q1861P		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	1941					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.Q1861P(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		TTCAGCCTCCTGGGCATCCCC	0.632																																						dbGAP											1	Substitution - Missense(1)	lung(1)											160.0	170.0	167.0					8																	10466026		1897	4114	6011	-	-	-	SO:0001583	missense	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.5582A>C	8.37:g.10466026T>G	ENSP00000371923:p.Gln1861Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.Q1861P	ENST00000382483.3	37	c.5582	CCDS43708.1	8	.	.	.	.	.	.	.	.	.	.	T	1.224	-0.625955	0.03610	.	.	ENSG00000183638	ENST00000382483	T	0.08008	3.14	1.38	-0.124	0.13523	.	.	.	.	.	T	0.04815	0.0130	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.44097	-0.9350	9	0.25751	T	0.34	.	4.2122	0.10517	0.0:0.0:0.3633:0.6367	.	1861	A6NKC6	.	P	1861	ENSP00000371923:Q1861P	ENSP00000371923:Q1861P	Q	-	2	0	RP1L1	10503436	0.000000	0.05858	0.016000	0.15963	0.017000	0.09413	-1.001000	0.03690	-0.252000	0.09528	-1.694000	0.00725	CAG	RP1L1	-	NULL	ENSG00000183638		0.632	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	41	0.00	0	T			10466026	10466026	-1	no_errors	ENST00000382483	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.001	G
RYR2	6262	genome.wustl.edu	37	1	237604745	237604745	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr1:237604745G>A	ENST00000366574.2	+	13	1449	c.1132G>A	c.(1132-1134)Gac>Aac	p.D378N	RYR2_ENST00000360064.6_Missense_Mutation_p.D376N|RYR2_ENST00000542537.1_Missense_Mutation_p.D362N	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	378	MIR 5. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			CCAGTCTGTGGACGTGAAATC	0.363																																						dbGAP											0													146.0	137.0	140.0					1																	237604745		1865	4114	5979	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.1132G>A	1.37:g.237604745G>A	ENSP00000355533:p.Asp378Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.D376N	ENST00000366574.2	37	c.1126	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	28.8	4.954625	0.92726	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.86432	-2.12;-2.12;-2.12	5.34	5.34	0.76211	MIR motif (1);MIR (2);	0.000000	0.64402	D	0.000004	D	0.93093	0.7801	M	0.80616	2.505	0.80722	D	1	D	0.63880	0.993	P	0.60012	0.867	D	0.93719	0.7031	10	0.87932	D	0	.	19.3955	0.94605	0.0:0.0:1.0:0.0	.	378	Q92736	RYR2_HUMAN	N	378;376;362	ENSP00000355533:D378N;ENSP00000353174:D376N;ENSP00000443798:D362N	ENSP00000353174:D376N	D	+	1	0	RYR2	235671368	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	9.800000	0.99124	2.645000	0.89757	0.655000	0.94253	GAC	RYR2	-	pfam_MIR,superfamily_MIR,pfscan_MIR_motif	ENSG00000198626		0.363	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	29	0.00	0	G	NM_001035		237604745	237604745	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	16	54.29	19	SNP	1.000	A
RYR2	6262	genome.wustl.edu	37	1	237675055	237675055	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr1:237675055G>A	ENST00000366574.2	+	24	3103	c.2786G>A	c.(2785-2787)cGc>cAc	p.R929H	RYR2_ENST00000360064.6_Missense_Mutation_p.R927H|RYR2_ENST00000542537.1_Missense_Mutation_p.R913H	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	929	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			GAACAGGAGCGCAATTACAAC	0.388																																						dbGAP											0													58.0	55.0	56.0					1																	237675055		1881	4116	5997	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.2786G>A	1.37:g.237675055G>A	ENSP00000355533:p.Arg929His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.R927H	ENST00000366574.2	37	c.2780	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	27.0	4.793062	0.90453	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.92545	-3.06;-3.06;-3.06	5.54	5.54	0.83059	Ryanodine receptor Ryr (1);	0.000000	0.64402	D	0.000011	D	0.87966	0.6311	L	0.36672	1.1	0.80722	D	1	P	0.35401	0.499	B	0.24848	0.056	D	0.88165	0.2860	10	0.87932	D	0	.	19.4831	0.95018	0.0:0.0:1.0:0.0	.	929	Q92736	RYR2_HUMAN	H	929;927;913	ENSP00000355533:R929H;ENSP00000353174:R927H;ENSP00000443798:R913H	ENSP00000353174:R927H	R	+	2	0	RYR2	235741678	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	4.014000	0.57145	2.602000	0.87976	0.655000	0.94253	CGC	RYR2	-	pfam_Ryanodine_rcpt	ENSG00000198626		0.388	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	58	0.00	0	G	NM_001035		237675055	237675055	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	68	10.53	8	SNP	1.000	A
STAMBP	10617	genome.wustl.edu	37	2	74074806	74074806	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr2:74074806delC	ENST00000394070.2	+	5	1171	c.668delC	c.(667-669)acafs	p.T224fs	STAMBP_ENST00000394073.1_Frame_Shift_Del_p.T224fs|STAMBP_ENST00000409707.1_Frame_Shift_Del_p.T224fs|STAMBP_ENST00000536064.1_Intron|STAMBP_ENST00000339566.3_Frame_Shift_Del_p.T224fs	NM_213622.2	NP_998787.1	O95630	STABP_HUMAN	STAM binding protein	224					JAK-STAT cascade (GO:0007259)|mitotic cytokinesis (GO:0000281)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of cell proliferation (GO:0008284)|protein deubiquitination (GO:0016579)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|ubiquitin-specific protease activity (GO:0004843)			NS(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	18						GACTGTCACACAACTGTAAGG	0.522																																						dbGAP											0													112.0	97.0	102.0					2																	74074806		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC007682	CCDS1929.1	2p24.3-p24.1	2008-02-05			ENSG00000124356	ENSG00000124356			16950	protein-coding gene	gene with protein product		606247				10383417	Standard	NM_006463		Approved	AMSH	uc002sjs.3	O95630	OTTHUMG00000129817	ENST00000394070.2:c.668delC	2.37:g.74074806delC	ENSP00000377633:p.Thr224fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B5M0B6|D6W5H7|Q3MJE7	Frame_Shift_Del	DEL	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.T223fs	ENST00000394070.2	37	c.668	CCDS1929.1	2																																																																																			STAMBP	-	NULL	ENSG00000124356		0.522	STAMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBP	HGNC	protein_coding	OTTHUMT00000252048.2	42	0.00	0	C	NM_006463		74074806	74074806	+1	no_errors	ENST00000339566	ensembl	human	known	69_37n	frame_shift_del	23	23.33	7	DEL	0.846	-
TCF12	6938	genome.wustl.edu	37	15	57384057	57384057	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr15:57384057delC	ENST00000267811.5	+	5	597	c.293delC	c.(292-294)tccfs	p.S98fs	TCF12_ENST00000557843.1_Frame_Shift_Del_p.S98fs|TCF12_ENST00000333725.5_Frame_Shift_Del_p.S98fs|TCF12_ENST00000438423.2_Frame_Shift_Del_p.S98fs|TCF12_ENST00000452095.2_Frame_Shift_Del_p.S94fs	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	98					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		GAAGGCTTGTCCCCAACACCT	0.413			T	TEC	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0													112.0	109.0	110.0					15																	57384057		2192	4292	6484	-	-	-	SO:0001589	frameshift_variant	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.293delC	15.37:g.57384057delC	ENSP00000267811:p.Ser98fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3D9|Q86TC1|Q86VM2	Frame_Shift_Del	DEL	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.P99fs	ENST00000267811.5	37	c.293	CCDS10159.1	15																																																																																			TCF12	-	NULL	ENSG00000140262		0.413	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	82	0.00	0	C	NM_003205		57384057	57384057	+1	no_errors	ENST00000438423	ensembl	human	known	69_37n	frame_shift_del	56	22.22	16	DEL	1.000	-
TM9SF4	9777	genome.wustl.edu	37	20	30733013	30733013	+	Splice_Site	SNP	G	G	A			TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr20:30733013G>A	ENST00000398022.2	+	7	1006		c.e7+1		TM9SF4_ENST00000217315.5_Splice_Site	NM_014742.3	NP_055557.2	Q92544	TM9S4_HUMAN	transmembrane 9 superfamily protein member 4							integral component of membrane (GO:0016021)				central_nervous_system(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	20			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			CCACTGGGAGGTGAGAAGGGG	0.582																																						dbGAP											0													96.0	85.0	88.0					20																	30733013		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC021107	CCDS13196.2	20q11.21	2004-04-19			ENSG00000101337	ENSG00000101337			30797	protein-coding gene	gene with protein product						9039502	Standard	NM_014742		Approved	KIAA0255, dJ836N17.2	uc002wxj.2	Q92544	OTTHUMG00000032206	ENST00000398022.2:c.771+1G>A	20.37:g.30733013G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYT7|Q9NUA3	Splice_Site	SNP	-	e7+1	ENST00000398022.2	37	c.771+1	CCDS13196.2	20	.	.	.	.	.	.	.	.	.	.	G	27.2	4.805460	0.90623	.	.	ENSG00000101337	ENST00000398022;ENST00000421148;ENST00000217315	.	.	.	5.51	5.51	0.81932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.783	0.88529	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TM9SF4	30196674	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	8.983000	0.93477	2.873000	0.98535	0.561000	0.74099	.	TM9SF4	-	-	ENSG00000101337		0.582	TM9SF4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF4	HGNC	protein_coding	OTTHUMT00000323568.1	81	0.00	0	G	NM_014742	Intron	30733013	30733013	+1	no_errors	ENST00000398022	ensembl	human	known	69_37n	splice_site	56	12.50	8	SNP	1.000	A
TMEM14B	81853	genome.wustl.edu	37	6	10756864	10756864	+	3'UTR	DEL	A	A	-	rs398065562		TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr6:10756864delA	ENST00000379542.5	+	0	625				SYCP2L_ENST00000543878.1_Intron|TMEM14B_ENST00000491103.1_3'UTR|TMEM14B_ENST00000481240.1_Intron|TMEM14B_ENST00000467317.1_Intron|TMEM14B_ENST00000379530.3_3'UTR|RP11-637O19.3_ENST00000480294.1_Intron|TMEM14B_ENST00000473276.1_3'UTR	NM_030969.3	NP_112231.3	Q9NUH8	TM14B_HUMAN	transmembrane protein 14B							integral component of membrane (GO:0016021)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(2)|skin(2)	11	Ovarian(93;0.107)|Breast(50;0.137)	all_hematologic(90;0.135)				CATTTTACCTAAAAAAAAAAA	0.368																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AL024498	CCDS4515.1, CCDS47372.1, CCDS75395.1, CCDS75396.1, CCDS75397.1	6p25.1-p23	2008-08-12			ENSG00000137210	ENSG00000137210			21384	protein-coding gene	gene with protein product							Standard	NM_030969		Approved	MGC1223	uc003mzk.4	Q9NUH8	OTTHUMG00000014246	ENST00000379542.5:c.*113A>-	6.37:g.10756864delA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5THN7|Q5THN8|Q96IX7|Q9BVN8	RNA	DEL	-	NULL	ENST00000379542.5	37	NULL	CCDS4515.1	6																																																																																			TMEM14B	-	-	ENSG00000137210		0.368	TMEM14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM14B	HGNC	protein_coding	OTTHUMT00000039836.1	17	0.00	0	A	NM_030969		10756864	10756864	+1	no_errors	ENST00000486421	ensembl	human	known	69_37n	rna	15	16.67	3	DEL	0.005	-
TRANK1	9881	genome.wustl.edu	37	3	36872931	36872931	+	Missense_Mutation	SNP	G	G	A	rs186027341	byFrequency	TCGA-OL-A5RU-01A-11D-A28B-09	TCGA-OL-A5RU-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	71c2d95b-0f1d-4c32-ba5b-eb99b89b8b67	71f481a7-4ecb-462c-bab1-bdfea4575a56	g.chr3:36872931G>A	ENST00000429976.2	-	21	8258	c.8011C>T	c.(8011-8013)Cgg>Tgg	p.R2671W	TRANK1_ENST00000428977.2_Missense_Mutation_p.R2121W|TRANK1_ENST00000301807.6_Missense_Mutation_p.R2121W	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2671							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GAGGCCTTCCGTTGCTTTTGG	0.547													G|||	2	0.000399361	0.0	0.0	5008	,	,		21165	0.002		0.0	False		,,,				2504	0.0					dbGAP											0													67.0	69.0	68.0					3																	36872931		2079	4199	6278	-	-	-	SO:0001583	missense	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.8011C>T	3.37:g.36872931G>A	ENSP00000416168:p.Arg2671Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8K0	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.R2671W	ENST00000429976.2	37	c.8011	CCDS46789.2	3	2	9.157509157509158E-4	0	0.0	0	0.0	2	0.0034965034965034965	0	0.0	G	11.01	1.513229	0.27123	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.36340	1.26;1.67;1.26	5.49	0.514	0.17007	.	0.355124	0.24245	N	0.040228	T	0.20047	0.0482	N	0.19112	0.55	0.27171	N	0.960913	B	0.11235	0.004	B	0.04013	0.001	T	0.13202	-1.0518	10	0.72032	D	0.01	.	6.3302	0.21266	0.2594:0.0:0.6227:0.118	.	2671	O15050	TRNK1_HUMAN	W	2121;2671;2121	ENSP00000416826:R2121W;ENSP00000416168:R2671W;ENSP00000301807:R2121W	ENSP00000301807:R2121W	R	-	1	2	TRANK1	36847935	0.158000	0.22850	0.777000	0.31699	0.460000	0.32559	0.411000	0.21115	-0.111000	0.12001	0.561000	0.74099	CGG	TRANK1	-	NULL	ENSG00000168016		0.547	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		45	0.00	0	G	NM_014831		36872931	36872931	-1	no_errors	ENST00000429976	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.981	A
