#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AACS	65985	genome.wustl.edu	37	12	125550166	125550166	+	Silent	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr12:125550166C>A	ENST00000316519.6	+	1	242	c.36C>A	c.(34-36)atC>atA	p.I12I	AACS_ENST00000261686.6_Silent_p.I12I	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	12					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		GGGAGGAGATCCTGGAGTGCC	0.736																																						dbGAP											0													20.0	19.0	19.0					12																	125550166		1955	3881	5836	-	-	-	SO:0001819	synonymous_variant	0			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.36C>A	12.37:g.125550166C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448,tigrfam_Acac_CoA_synth	p.I12	ENST00000316519.6	37	c.36	CCDS9263.1	12																																																																																			AACS	-	NULL	ENSG00000081760		0.736	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AACS	HGNC	protein_coding	OTTHUMT00000400202.1	31	0.00	0	C	NM_023928		125550166	125550166	+1	no_errors	ENST00000316519	ensembl	human	known	69_37n	silent	77	18.95	18	SNP	0.999	A
AADAC	13	genome.wustl.edu	37	3	151545910	151545910	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:151545910A>T	ENST00000232892.7	+	5	1276	c.1150A>T	c.(1150-1152)Agt>Tgt	p.S384C	RP11-454C18.2_ENST00000483843.2_RNA|RP11-454C18.2_ENST00000475855.1_RNA	NM_001086.2	NP_001077.2	P22760	AAAD_HUMAN	arylacetamide deacetylase	384					positive regulation of triglyceride catabolic process (GO:0010898)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)|deacetylase activity (GO:0019213)|lipase activity (GO:0016298)|serine hydrolase activity (GO:0017171)|triglyceride lipase activity (GO:0004806)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|prostate(5)|skin(2)	19		Myeloproliferative disorder(1037;0.0255)|all_neural(597;0.112)	LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			ACTTAAAATTAGTCACAGACT	0.353																																					Ovarian(30;839 841 2699 32801 46334)	dbGAP											0													50.0	54.0	53.0					3																	151545910		2201	4298	6499	-	-	-	SO:0001583	missense	0			L32179	CCDS33877.1	3q25.1	2014-03-18	2012-07-13		ENSG00000114771	ENSG00000114771	3.1.1.3		17	protein-coding gene	gene with protein product		600338	"""arylacetamide deacetylase (esterase)"""			8063807	Standard	XM_005247103		Approved	DAC, CES5A1	uc003eze.3	P22760	OTTHUMG00000159876	ENST00000232892.7:c.1150A>T	3.37:g.151545910A>T	ENSP00000232892:p.Ser384Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3L3|D3DNJ6|Q8N1A9	Missense_Mutation	SNP	pfam_AB_hydrolase_3,pfam_CarbesteraseB,pirsf_Arylacetamide_deacetylase	p.S384C	ENST00000232892.7	37	c.1150	CCDS33877.1	3	.	.	.	.	.	.	.	.	.	.	A	12.74	2.027364	0.35797	.	.	ENSG00000114771	ENST00000232892	T	0.59364	0.27	4.79	-5.92	0.02261	.	0.705129	0.14127	N	0.339614	T	0.43743	0.1261	L	0.54965	1.715	0.09310	N	1	B	0.13145	0.007	B	0.15870	0.014	T	0.40515	-0.9559	10	0.72032	D	0.01	0.1918	6.8763	0.24149	0.2264:0.0:0.5523:0.2213	.	384	P22760	AAAD_HUMAN	C	384	ENSP00000232892:S384C	ENSP00000232892:S384C	S	+	1	0	AADAC	153028600	0.001000	0.12720	0.000000	0.03702	0.017000	0.09413	0.351000	0.20096	-0.872000	0.04037	0.482000	0.46254	AGT	AADAC	-	pirsf_Arylacetamide_deacetylase	ENSG00000114771		0.353	AADAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AADAC	HGNC	protein_coding	OTTHUMT00000357883.2	19	0.00	0	A	NM_001086		151545910	151545910	+1	no_errors	ENST00000232892	ensembl	human	known	69_37n	missense	31	37.25	19	SNP	0.000	T
ABCF1	23	genome.wustl.edu	37	6	30557749	30557749	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:30557749C>G	ENST00000326195.8	+	22	2343	c.2231C>G	c.(2230-2232)tCt>tGt	p.S744C	ABCF1_ENST00000396515.4_Missense_Mutation_p.S137C|ABCF1_ENST00000376545.3_Missense_Mutation_p.S706C	NM_001025091.1	NP_001020262.1	Q8NE71	ABCF1_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 1	744	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				inflammatory response (GO:0006954)|positive regulation of translation (GO:0045727)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|polysomal ribosome (GO:0042788)|ribosome (GO:0005840)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)|translation activator activity (GO:0008494)|translation factor activity, nucleic acid binding (GO:0008135)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(3)|skin(2)	21						TGCAAACTCTCTGGTACCACT	0.587																																						dbGAP											0													121.0	139.0	133.0					6																	30557749		1511	2709	4220	-	-	-	SO:0001583	missense	0			AF027302	CCDS34380.1, CCDS34381.1	6p21.33	2012-03-14			ENSG00000204574	ENSG00000204574		"""ATP binding cassette transporters / subfamily F"""	70	protein-coding gene	gene with protein product		603429		ABC50		9790762	Standard	NM_001025091		Approved	EST123147	uc003nql.3	Q8NE71	OTTHUMG00000031094	ENST00000326195.8:c.2231C>G	6.37:g.30557749C>G	ENSP00000313603:p.Ser744Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BF75|O14897|Q69YP6	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S744C	ENST00000326195.8	37	c.2231	CCDS34380.1	6	.	.	.	.	.	.	.	.	.	.	c	28.1	4.889783	0.91889	.	.	ENSG00000204574	ENST00000326195;ENST00000376545;ENST00000396515	D;D;T	0.98849	-5.18;-5.18;0.6	5.94	5.94	0.96194	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.053250	0.85682	N	0.000000	D	0.99704	0.9887	H	0.99777	4.77	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.97240	0.9890	10	0.87932	D	0	-14.4472	19.1419	0.93449	0.0:1.0:0.0:0.0	.	137;706;744	Q5STZ7;Q2L6I2;Q8NE71	.;.;ABCF1_HUMAN	C	744;706;137	ENSP00000313603:S744C;ENSP00000365728:S706C;ENSP00000379772:S137C	ENSP00000313603:S744C	S	+	2	0	ABCF1	30665728	1.000000	0.71417	0.997000	0.53966	0.982000	0.71751	7.032000	0.76498	2.821000	0.97095	0.651000	0.88453	TCT	ABCF1	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000204574		0.587	ABCF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABCF1	HGNC	protein_coding	OTTHUMT00000076137.3	24	0.00	0	C			30557749	30557749	+1	no_errors	ENST00000326195	ensembl	human	known	69_37n	missense	22	52.17	24	SNP	1.000	G
ACOX3	8310	genome.wustl.edu	37	4	8417577	8417577	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr4:8417577C>G	ENST00000356406.5	-	3	371	c.294G>C	c.(292-294)aaG>aaC	p.K98N	ACOX3_ENST00000413009.2_Missense_Mutation_p.K98N|ACOX3_ENST00000503233.1_Missense_Mutation_p.K98N	NM_003501.2	NP_003492.2	O15254	ACOX3_HUMAN	acyl-CoA oxidase 3, pristanoyl	98					cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|flavin adenine dinucleotide binding (GO:0050660)|pristanoyl-CoA oxidase activity (GO:0016402)|receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(17)|prostate(1)|skin(3)|stomach(1)	42						TCAGAGGGCTCTTGAACATGT	0.537																																						dbGAP											0													83.0	79.0	80.0					4																	8417577		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11411	CCDS3401.1, CCDS47017.1	4p15.3	2010-04-30	2010-04-30		ENSG00000087008	ENSG00000087008	1.3.3.6		121	protein-coding gene	gene with protein product		603402	"""acyl-Coenzyme A oxidase 3, pristanoyl"""			9271077	Standard	NM_003501		Approved		uc003glc.4	O15254	OTTHUMG00000090509	ENST00000356406.5:c.294G>C	4.37:g.8417577C>G	ENSP00000348775:p.Lys98Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AJ8	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_Oxase/DH_1,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	p.K98N	ENST00000356406.5	37	c.294	CCDS3401.1	4	.	.	.	.	.	.	.	.	.	.	C	10.63	1.403659	0.25291	.	.	ENSG00000087008	ENST00000413009;ENST00000356406;ENST00000503233;ENST00000514423	D;D;D;D	0.92805	-3.08;-3.07;-3.07;-3.11	5.39	2.71	0.32032	Acyl-CoA dehydrogenase/oxidase (1);	1.376980	0.04453	N	0.373019	D	0.86104	0.5853	L	0.27053	0.805	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.06405	0.0;0.002;0.002	T	0.70252	-0.4923	10	0.24483	T	0.36	-0.6118	6.2641	0.20917	0.0:0.6347:0.1358:0.2295	.	98;98;98	B2R856;O15254-2;O15254	.;.;ACOX3_HUMAN	N	98;98;98;3	ENSP00000413994:K98N;ENSP00000348775:K98N;ENSP00000421625:K98N;ENSP00000427321:K3N	ENSP00000348775:K98N	K	-	3	2	ACOX3	8468477	0.005000	0.15991	0.000000	0.03702	0.033000	0.12548	0.499000	0.22546	0.265000	0.21872	0.650000	0.86243	AAG	ACOX3	-	superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	ENSG00000087008		0.537	ACOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOX3	HGNC	protein_coding	OTTHUMT00000206997.4	39	0.00	0	C			8417577	8417577	-1	no_errors	ENST00000356406	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	0.001	G
ACTRT1	139741	genome.wustl.edu	37	X	127185327	127185327	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chrX:127185327C>G	ENST00000371124.3	-	1	1055	c.859G>C	c.(859-861)Gac>Cac	p.D287H		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	287						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						ATGTCAGTGTCACACTTCATG	0.522																																						dbGAP											0													105.0	99.0	101.0					X																	127185327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.859G>C	X.37:g.127185327C>G	ENSP00000360165:p.Asp287His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6X7C1|Q96L10	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.D287H	ENST00000371124.3	37	c.859	CCDS14611.1	X	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410202	0.42715	.	.	ENSG00000123165	ENST00000371124	D	0.96104	-3.91	3.58	3.58	0.41010	.	0.302566	0.28057	N	0.016761	D	0.98027	0.9350	H	0.94385	3.53	0.47214	D	0.999353	D	0.76494	0.999	D	0.70016	0.967	D	0.98514	1.0620	10	0.87932	D	0	.	12.2573	0.54631	0.0:1.0:0.0:0.0	.	287	Q8TDG2	ACTT1_HUMAN	H	287	ENSP00000360165:D287H	ENSP00000360165:D287H	D	-	1	0	ACTRT1	127013008	0.999000	0.42202	0.971000	0.41717	0.125000	0.20455	2.561000	0.45905	2.039000	0.60335	0.600000	0.82982	GAC	ACTRT1	-	pfam_Actin-like,smart_Actin-like	ENSG00000123165		0.522	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	HGNC	protein_coding	OTTHUMT00000058192.1	59	0.00	0	C	NM_138289		127185327	127185327	-1	no_errors	ENST00000371124	ensembl	human	known	69_37n	missense	62	40.38	42	SNP	1.000	G
ADD1	118	genome.wustl.edu	37	4	2930167	2930167	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr4:2930167C>T	ENST00000398129.1	+	14	2151	c.2131C>T	c.(2131-2133)Cca>Tca	p.P711S	ADD1_ENST00000446856.1_Missense_Mutation_p.P711S|ADD1_ENST00000503455.2_3'UTR|ADD1_ENST00000513328.2_3'UTR|ADD1_ENST00000398123.2_3'UTR|ADD1_ENST00000398125.1_3'UTR|ADD1_ENST00000355842.3_3'UTR|ADD1_ENST00000264758.7_Missense_Mutation_p.P742S			P35611	ADDA_HUMAN	adducin 1 (alpha)	711					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|activation of signaling protein activity involved in unfolded protein response (GO:0006987)|apoptotic process (GO:0006915)|barbed-end actin filament capping (GO:0051016)|cell morphogenesis (GO:0000902)|cell volume homeostasis (GO:0006884)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular protein metabolic process (GO:0044267)|cellular response to retinoic acid (GO:0071300)|endoplasmic reticulum unfolded protein response (GO:0030968)|erythrocyte differentiation (GO:0030218)|hemoglobin metabolic process (GO:0020027)|homeostasis of number of cells within a tissue (GO:0048873)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein binding (GO:0032092)	cytosol (GO:0005829)|dendritic spine (GO:0043197)|F-actin capping protein complex (GO:0008290)|focal adhesion (GO:0005925)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)|transcription factor binding (GO:0008134)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		CGATGGGTCTCCAGGCAAGTC	0.632																																					Esophageal Squamous(71;505 1201 20414 34538 37449)	dbGAP											0													57.0	72.0	67.0					4																	2930167		2202	4299	6501	-	-	-	SO:0001583	missense	0			L07261	CCDS3363.1, CCDS3364.1, CCDS43205.1, CCDS75094.1	4p16.3	2009-04-22			ENSG00000087274	ENSG00000087274			243	protein-coding gene	gene with protein product		102680				1840603	Standard	NM_001119		Approved		uc003gfq.3	P35611	OTTHUMG00000122080	ENST00000398129.1:c.2131C>T	4.37:g.2930167C>T	ENSP00000381197:p.Pro711Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3N8|A2A3P0|B4DI79|D3DVR3|D3DVR4|D3DVR5|Q13734|Q14729|Q16156|Q86XM2|Q9UJB6	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.P742S	ENST00000398129.1	37	c.2224	CCDS43205.1	4	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402854	0.83230	.	.	ENSG00000087274	ENST00000264758;ENST00000446856;ENST00000398129	T;T;T	0.51817	0.69;0.69;0.69	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	T	0.64494	0.2603	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.996;0.998	T	0.67440	-0.5670	10	0.87932	D	0	-14.6368	18.6169	0.91305	0.0:1.0:0.0:0.0	.	711;742	P35611;P35611-3	ADDA_HUMAN;.	S	742;711;711	ENSP00000264758:P742S;ENSP00000399828:P711S;ENSP00000381197:P711S	ENSP00000264758:P742S	P	+	1	0	ADD1	2899965	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.334000	0.79224	2.389000	0.81357	0.655000	0.94253	CCA	ADD1	-	NULL	ENSG00000087274		0.632	ADD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADD1	HGNC	protein_coding	OTTHUMT00000242840.1	27	0.00	0	C	NM_014189		2930167	2930167	+1	no_errors	ENST00000264758	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	T
ADPRH	141	genome.wustl.edu	37	3	119306705	119306705	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:119306705G>C	ENST00000478399.1	+	4	2459	c.1054G>C	c.(1054-1056)Gac>Cac	p.D352H	ADPRH_ENST00000465513.1_Missense_Mutation_p.D352H|ADPRH_ENST00000478927.1_Missense_Mutation_p.D352H|ADPRH_ENST00000357003.3_Missense_Mutation_p.D352H|ADPRH_ENST00000471850.1_3'UTR			P54922	ADPRH_HUMAN	ADP-ribosylarginine hydrolase	352					cellular protein modification process (GO:0006464)|protein de-ADP-ribosylation (GO:0051725)		ADP-ribosylarginine hydrolase activity (GO:0003875)|magnesium ion binding (GO:0000287)			breast(1)|kidney(1)|lung(10)|ovary(1)	13		Lung NSC(201;0.0977)		GBM - Glioblastoma multiforme(114;0.23)		GTCAAAAGAAGACACTGTAAT	0.393																																					GBM(133;579 1804 5989 9967 40052)	dbGAP											0													83.0	88.0	87.0					3																	119306705		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13291	CCDS2990.1	3q13.31-q13.33	2004-02-27			ENSG00000144843	ENSG00000144843			269	protein-coding gene	gene with protein product		603081				8349667, 12070318	Standard	NM_001125		Approved	ARH1	uc003ecs.3	P54922	OTTHUMG00000159420	ENST00000478399.1:c.1054G>C	3.37:g.119306705G>C	ENSP00000420200:p.Asp352His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8H1|D3DN83	Missense_Mutation	SNP	pfam_Ribosyl_crysJ1,superfamily_Ribosyl_crysJ1,pirsf_ADP-ribosylarg_hydro	p.D352H	ENST00000478399.1	37	c.1054	CCDS2990.1	3	.	.	.	.	.	.	.	.	.	.	G	15.59	2.879723	0.51801	.	.	ENSG00000144843	ENST00000478399;ENST00000478927;ENST00000357003;ENST00000465513	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.93	3.82	0.43975	.	0.413851	0.23523	N	0.047265	T	0.43743	0.1261	L	0.36672	1.1	0.30289	N	0.790556	P	0.43607	0.812	P	0.47573	0.55	T	0.49051	-0.8979	10	0.66056	D	0.02	-25.4894	9.0579	0.36416	0.192:0.0:0.808:0.0	.	352	P54922	ADPRH_HUMAN	H	352	ENSP00000420200:D352H;ENSP00000417528:D352H;ENSP00000349496:D352H;ENSP00000417430:D352H	ENSP00000349496:D352H	D	+	1	0	ADPRH	120789395	0.998000	0.40836	0.992000	0.48379	0.754000	0.42855	2.574000	0.46016	1.509000	0.48786	0.650000	0.86243	GAC	ADPRH	-	pirsf_ADP-ribosylarg_hydro	ENSG00000144843		0.393	ADPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPRH	HGNC	protein_coding	OTTHUMT00000355199.1	21	0.00	0	G	NM_001125		119306705	119306705	+1	no_errors	ENST00000357003	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.790	C
AFF3	3899	genome.wustl.edu	37	2	100623429	100623429	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:100623429G>C	ENST00000409236.2	-	5	650	c.538C>G	c.(538-540)Cag>Gag	p.Q180E	AFF3_ENST00000356421.2_Missense_Mutation_p.Q205E|AFF3_ENST00000317233.4_Missense_Mutation_p.Q180E|AFF3_ENST00000409579.1_Missense_Mutation_p.Q205E			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	180					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						GCCCGAGGCTGCTGTCTGCCA	0.582																																						dbGAP											0													48.0	50.0	50.0					2																	100623429		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.538C>G	2.37:g.100623429G>C	ENSP00000387207:p.Gln180Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.Q205E	ENST00000409236.2	37	c.613	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	G	12.51	1.961004	0.34565	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288	T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02	5.36	4.48	0.54585	.	0.250032	0.28317	N	0.015799	T	0.52549	0.1741	N	0.08118	0	0.25397	N	0.988472	B;B;D;B;B	0.59357	0.425;0.372;0.985;0.425;0.372	B;B;D;B;B	0.73708	0.192;0.085;0.981;0.252;0.163	T	0.49661	-0.8916	10	0.02654	T	1	.	8.8744	0.35337	0.0751:0.0:0.7765:0.1484	.	334;334;180;180;205	B7Z4I6;C9JXV5;A8K353;P51826;P51826-2	.;.;.;AFF3_HUMAN;.	E	180;205;205;180;180;334;205	ENSP00000317421:Q180E;ENSP00000348793:Q205E;ENSP00000386834:Q205E;ENSP00000387207:Q180E	ENSP00000317421:Q180E	Q	-	1	0	AFF3	99989861	1.000000	0.71417	0.988000	0.46212	0.886000	0.51366	6.148000	0.71788	1.259000	0.44117	0.585000	0.79938	CAG	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.582	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	24	0.00	0	G	NM_002285		100623429	100623429	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.994	C
AK9	221264	genome.wustl.edu	37	6	109849816	109849816	+	Intron	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:109849816T>C	ENST00000424296.2	-	29	3710				AK9_ENST00000341338.6_Missense_Mutation_p.T337A|AK9_ENST00000355283.1_3'UTR	NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9						ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										GTGCCTGCAGTTGCAGTTGCA	0.428																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.3633+397A>G	6.37:g.109849816T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,pfam_ATPase_AAA_core	p.T337A	ENST00000424296.2	37	c.1009	CCDS55048.1	6	.	.	.	.	.	.	.	.	.	.	T	8.838	0.941659	0.18281	.	.	ENSG00000155085	ENST00000341338	T	0.67345	-0.26	0.778	-1.17	0.09648	.	.	.	.	.	T	0.27134	0.0665	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25257	-1.0137	5	.	.	.	.	3.3676	0.07208	0.0:0.3935:0.0:0.6065	.	.	.	.	A	337	ENSP00000344637:T337A	.	T	-	1	0	AKD1	109956509	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.617000	0.05584	-0.395000	0.07715	-0.388000	0.06559	ACT	AKD1	-	NULL	ENSG00000155085		0.428	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		73	0.00	0	T	NM_001145128		109849816	109849816	-1	no_errors	ENST00000341338	ensembl	human	known	69_37n	missense	70	40.17	47	SNP	0.001	C
ASAP2	8853	genome.wustl.edu	37	2	9520932	9520932	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:9520932G>A	ENST00000281419.3	+	20	2351	c.2011G>A	c.(2011-2013)Gag>Aag	p.E671K	ASAP2_ENST00000315273.4_Missense_Mutation_p.E671K	NM_003887.2	NP_003878.1	O43150	ASAP2_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 2	671					positive regulation of catalytic activity (GO:0043085)|regulation of ARF GTPase activity (GO:0032312)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|enzyme activator activity (GO:0008047)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(15)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	36						GCACTGTGAGGAGCTGGTGAG	0.587																																						dbGAP											0													73.0	76.0	75.0					2																	9520932		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007860	CCDS1661.1, CCDS46224.1	2p24	2013-01-10	2008-09-22	2008-09-22	ENSG00000151693	ENSG00000151693		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2721	protein-coding gene	gene with protein product	"""centaurin, beta 3"""	603817	"""development and differentiation enhancing factor 2"""	DDEF2		10022920, 9455477	Standard	NM_003887		Approved	KIAA0400, PAP, SHAG1, CENTB3	uc002qzh.2	O43150	OTTHUMG00000117485	ENST00000281419.3:c.2011G>A	2.37:g.9520932G>A	ENSP00000281419:p.Glu671Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W4Y8	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,pfam_Ankyrin_rpt,pfam_SH3_domain,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP	p.E671K	ENST00000281419.3	37	c.2011	CCDS1661.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.255142	0.95336	.	.	ENSG00000151693	ENST00000281419;ENST00000315273	T;T	0.59502	0.26;0.26	5.5	5.5	0.81552	Ankyrin repeat-containing domain (3);	0.151508	0.64402	D	0.000017	T	0.72566	0.3476	M	0.69523	2.12	0.80722	D	1	D;P	0.56746	0.977;0.931	P;P	0.57101	0.813;0.462	T	0.74680	-0.3584	10	0.59425	D	0.04	.	19.4033	0.94639	0.0:0.0:1.0:0.0	.	671;671	O43150-2;O43150	.;ASAP2_HUMAN	K	671	ENSP00000281419:E671K;ENSP00000316404:E671K	ENSP00000281419:E671K	E	+	1	0	ASAP2	9438383	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.699000	0.98703	2.584000	0.87258	0.650000	0.86243	GAG	ASAP2	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000151693		0.587	ASAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASAP2	HGNC	protein_coding	OTTHUMT00000237522.1	35	0.00	0	G	NM_003887		9520932	9520932	+1	no_errors	ENST00000281419	ensembl	human	known	69_37n	missense	25	43.18	19	SNP	1.000	A
ANKAR	150709	genome.wustl.edu	37	2	190585369	190585369	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:190585369C>G	ENST00000520309.1	+	12	2579	c.2491C>G	c.(2491-2493)Cta>Gta	p.L831V	ANKAR_ENST00000438402.2_Missense_Mutation_p.L831V|ANKAR_ENST00000281412.6_Missense_Mutation_p.L595V|ANKAR_ENST00000431575.2_Missense_Mutation_p.L760V|ANKAR_ENST00000313581.4_Missense_Mutation_p.L831V	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	831						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			CCTGATAAATCTATTGAACTT	0.274																																						dbGAP											0													100.0	112.0	108.0					2																	190585369		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.2491C>G	2.37:g.190585369C>G	ENSP00000427882:p.Leu831Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Armadillo,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Armadillo	p.L831V	ENST00000520309.1	37	c.2491	CCDS33351.2	2	.	.	.	.	.	.	.	.	.	.	C	12.36	1.913608	0.33815	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000438402;ENST00000431575;ENST00000281412	T;T;T;T;T	0.37752	1.18;1.18;1.18;1.18;1.18	4.54	4.54	0.55810	.	0.000000	0.56097	D	0.000025	T	0.55033	0.1895	M	0.77313	2.365	0.38560	D	0.949682	.	.	.	.	.	.	T	0.63418	-0.6642	8	0.87932	D	0	-12.2912	12.9865	0.58594	0.0:0.8361:0.1639:0.0	.	.	.	.	V	831;831;831;760;595	ENSP00000427882:L831V;ENSP00000313513:L831V;ENSP00000397243:L831V;ENSP00000393043:L760V;ENSP00000281412:L595V	ENSP00000281412:L595V	L	+	1	2	ANKAR	190293614	1.000000	0.71417	0.962000	0.40283	0.109000	0.19521	5.148000	0.64857	2.539000	0.85634	0.655000	0.94253	CTA	ANKAR	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000151687		0.274	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKAR	HGNC	protein_coding	OTTHUMT00000335045.3	29	0.00	0	C	NM_144708		190585369	190585369	+1	no_errors	ENST00000313581	ensembl	human	known	69_37n	missense	52	11.86	7	SNP	0.992	G
ATM	472	genome.wustl.edu	37	11	108126963	108126963	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr11:108126963G>C	ENST00000452508.2	+	15	2335	c.2146G>C	c.(2146-2148)Gtc>Ctc	p.V716L	ATM_ENST00000278616.4_Missense_Mutation_p.V716L			Q13315	ATM_HUMAN	ATM serine/threonine kinase	716					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AGAAACTCTTGTCCGGTGTTC	0.323			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																												dbGAP	yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													98.0	91.0	94.0					11																	108126963		2201	4298	6499	-	-	-	SO:0001583	missense	0	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.2146G>C	11.37:g.108126963G>C	ENSP00000388058:p.Val716Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.V716L	ENST00000452508.2	37	c.2146	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133927	0.37630	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.76839	-1.05;-1.05;-1.05	5.45	2.54	0.30619	Armadillo-type fold (1);	0.130855	0.50627	D	0.000109	T	0.68531	0.3011	L	0.45581	1.43	0.30778	N	0.742244	B	0.22276	0.067	B	0.17979	0.02	T	0.64322	-0.6435	10	0.30854	T	0.27	.	11.6342	0.51194	0.2042:0.0:0.7958:0.0	.	716	Q13315	ATM_HUMAN	L	716	ENSP00000435747:V716L;ENSP00000278616:V716L;ENSP00000388058:V716L	ENSP00000278616:V716L	V	+	1	0	ATM	107632173	1.000000	0.71417	0.988000	0.46212	0.832000	0.47134	2.890000	0.48609	0.785000	0.33685	0.557000	0.71058	GTC	ATM	-	superfamily_ARM-type_fold	ENSG00000149311		0.323	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	63	0.00	0	G	NM_000051		108126963	108126963	+1	no_errors	ENST00000278616	ensembl	human	known	69_37n	missense	7	85.42	41	SNP	1.000	C
AUTS2	26053	genome.wustl.edu	37	7	70255866	70255866	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:70255866C>G	ENST00000342771.4	+	19	3985	c.3664C>G	c.(3664-3666)Ccg>Gcg	p.P1222A	AUTS2_ENST00000406775.2_Missense_Mutation_p.P1198A	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1222										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CGCACCTCCCCCGCTCATCTC	0.662																																						dbGAP											0													32.0	35.0	34.0					7																	70255866		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3664C>G	7.37:g.70255866C>G	ENSP00000344087:p.Pro1222Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Missense_Mutation	SNP	prints_AUTS2	p.P1222A	ENST00000342771.4	37	c.3664	CCDS5539.1	7	.	.	.	.	.	.	.	.	.	.	C	22.2	4.255063	0.80135	.	.	ENSG00000158321	ENST00000406775;ENST00000342771	T;T	0.80480	-1.38;-1.36	4.88	4.88	0.63580	.	0.051878	0.85682	D	0.000000	D	0.87156	0.6107	L	0.60067	1.865	0.80722	D	1	D;D;D	0.71674	0.993;0.998;0.998	P;D;D	0.66084	0.879;0.941;0.941	D	0.86779	0.1978	9	.	.	.	-12.4846	18.0148	0.89236	0.0:1.0:0.0:0.0	.	674;1198;1222	B4DLG0;Q8WXX7-2;Q8WXX7	.;.;AUTS2_HUMAN	A	1198;1222	ENSP00000385263:P1198A;ENSP00000344087:P1222A	.	P	+	1	0	AUTS2	69893802	1.000000	0.71417	0.989000	0.46669	0.952000	0.60782	5.596000	0.67570	2.262000	0.75019	0.655000	0.94253	CCG	AUTS2	-	NULL	ENSG00000158321		0.662	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	12	0.00	0	C			70255866	70255866	+1	no_errors	ENST00000342771	ensembl	human	known	69_37n	missense	10	50.00	10	SNP	1.000	G
AXIN1	8312	genome.wustl.edu	37	16	396354	396354	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr16:396354C>G	ENST00000262320.3	-	2	1043	c.672G>C	c.(670-672)caG>caC	p.Q224H	AXIN1_ENST00000354866.3_Missense_Mutation_p.Q224H|AXIN1_ENST00000481769.1_Intron	NM_003502.3	NP_003493.1	O15169	AXIN1_HUMAN	axin 1	224	Interaction with TP53. {ECO:0000250}.				activation of JUN kinase activity (GO:0007257)|activation of protein kinase activity (GO:0032147)|apoptotic process (GO:0006915)|axial mesoderm formation (GO:0048320)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060823)|cell death (GO:0008219)|cellular protein complex assembly (GO:0043623)|cellular response to organic cyclic compound (GO:0071407)|cytoplasmic microtubule organization (GO:0031122)|determination of left/right symmetry (GO:0007368)|dorsal/ventral axis specification (GO:0009950)|embryonic eye morphogenesis (GO:0048048)|embryonic skeletal joint morphogenesis (GO:0060272)|forebrain anterior/posterior pattern specification (GO:0021797)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|muscle cell development (GO:0055001)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of protein metabolic process (GO:0051248)|negative regulation of transcription elongation from RNA polymerase II promoter (GO:0034244)|negative regulation of Wnt signaling pathway (GO:0030178)|nucleocytoplasmic transport (GO:0006913)|olfactory placode formation (GO:0030910)|optic placode formation (GO:0001743)|positive regulation of GTPase activity (GO:0043547)|positive regulation of JNK cascade (GO:0046330)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|post-anal tail morphogenesis (GO:0036342)|protein catabolic process (GO:0030163)|protein homooligomerization (GO:0051260)|protein polyubiquitination (GO:0000209)|regulation of catenin import into nucleus (GO:0035412)|sensory perception of sound (GO:0007605)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)|Wnt-activated signaling pathway involved in forebrain neuron fate commitment (GO:0021881)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|cell periphery (GO:0071944)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|I-SMAD binding (GO:0070411)|identical protein binding (GO:0042802)|protein complex scaffold (GO:0032947)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|ubiquitin protein ligase binding (GO:0031625)			biliary_tract(27)|breast(4)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(20)|liver(81)|lung(5)|ovary(2)|prostate(3)|salivary_gland(7)|skin(5)|stomach(4)|thyroid(41)|upper_aerodigestive_tract(4)|urinary_tract(2)	221		all_cancers(16;2.75e-07)|all_epithelial(16;1.6e-06)|Hepatocellular(16;0.000105)|Lung NSC(18;0.00774)|all_lung(18;0.0187)				ACCCAGAGCTCTGGTCACTAC	0.493																																						dbGAP											0													90.0	89.0	89.0					16																	396354		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009674	CCDS10405.1, CCDS10406.1	16p13.3	2012-04-17			ENSG00000103126	ENSG00000103126		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	903	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 49"""	603816				9230313	Standard	NM_003502		Approved	PPP1R49	uc002cgp.2	O15169	OTTHUMG00000064930	ENST00000262320.3:c.672G>C	16.37:g.396354C>G	ENSP00000262320:p.Gln224His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4TT26|Q4TT27|Q86YA7|Q8WVW6|Q96S28	Missense_Mutation	SNP	pfam_DIX,pfam_Regulat_G_prot_signal,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.Q224H	ENST00000262320.3	37	c.672	CCDS10405.1	16	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559423	0.45590	.	.	ENSG00000103126	ENST00000262320;ENST00000354866	T;T	0.62105	0.05;0.07	5.21	4.26	0.50523	.	0.257362	0.40554	N	0.001075	T	0.57140	0.2033	M	0.63428	1.95	0.45762	D	0.998654	B;B	0.18013	0.025;0.025	B;B	0.24394	0.053;0.015	T	0.55854	-0.8075	10	0.46703	T	0.11	-25.0743	8.1989	0.31413	0.0:0.722:0.131:0.1471	.	224;224	O15169-2;O15169	.;AXIN1_HUMAN	H	224	ENSP00000262320:Q224H;ENSP00000346935:Q224H	ENSP00000262320:Q224H	Q	-	3	2	AXIN1	336355	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.953000	0.29162	1.198000	0.43158	0.655000	0.94253	CAG	AXIN1	-	NULL	ENSG00000103126		0.493	AXIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AXIN1	HGNC	protein_coding	OTTHUMT00000139441.3	66	0.00	0	C			396354	396354	-1	no_errors	ENST00000262320	ensembl	human	known	69_37n	missense	40	33.33	20	SNP	1.000	G
BAIAP2	10458	genome.wustl.edu	37	17	79078393	79078393	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:79078393C>G	ENST00000321300.6	+	10	1239	c.1146C>G	c.(1144-1146)atC>atG	p.I382M	BAIAP2_ENST00000321280.7_Missense_Mutation_p.I382M|BAIAP2_ENST00000435091.3_Missense_Mutation_p.I382M|BAIAP2_ENST00000392411.3_Missense_Mutation_p.I304M|BAIAP2_ENST00000416299.2_Missense_Mutation_p.I245M|BAIAP2_ENST00000428708.2_Missense_Mutation_p.I382M|BAIAP2_ENST00000575245.1_Missense_Mutation_p.I415M|BAIAP2_ENST00000575712.1_Missense_Mutation_p.I382M	NM_001144888.1|NM_017451.2	NP_001138360.1|NP_059345.1	Q9UQB8	BAIP2_HUMAN	BAI1-associated protein 2	382	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin crosslink formation (GO:0051764)|actin filament bundle assembly (GO:0051017)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|filopodium assembly (GO:0046847)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of synaptic plasticity (GO:0048167)|response to bacterium (GO:0009617)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	cytoskeletal adaptor activity (GO:0008093)|identical protein binding (GO:0042802)|proline-rich region binding (GO:0070064)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|skin(1)	18	all_neural(118;0.101)		BRCA - Breast invasive adenocarcinoma(99;0.0228)|OV - Ovarian serous cystadenocarcinoma(97;0.0524)			TGAAGGCCATCTTCTCCCACG	0.637																																						dbGAP											0													49.0	45.0	46.0					17																	79078393		2202	4298	6500	-	-	-	SO:0001583	missense	0			AB015019	CCDS11775.1, CCDS11776.1, CCDS11777.1, CCDS45806.1	17q25.3	2014-09-11			ENSG00000175866				947	protein-coding gene	gene with protein product		605475				10343108	Standard	NM_017451		Approved	BAP2	uc002jzg.2	Q9UQB8	OTTHUMG00000177698	ENST00000321300.6:c.1146C>G	17.37:g.79078393C>G	ENSP00000316338:p.Ile382Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O43858|Q53HB1|Q86WC1|Q8N5C0|Q96CR7|Q9UBR3|Q9UQ43	Missense_Mutation	SNP	pfam_IRSp53/MIM_homology_IMD,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.I382M	ENST00000321300.6	37	c.1146	CCDS11775.1	17	.	.	.	.	.	.	.	.	.	.	C	15.87	2.960609	0.53400	.	.	ENSG00000175866	ENST00000321300;ENST00000428708;ENST00000435091;ENST00000321280;ENST00000392411;ENST00000416299	T;T;T;T;T;T	0.50548	0.74;0.74;0.74;0.74;0.74;0.74	4.79	0.151	0.14888	Src homology-3 domain (3);Variant SH3 (1);	0.000000	0.85682	D	0.000000	T	0.51736	0.1692	L	0.39020	1.185	0.52099	D	0.999949	D;D;D;P;P;D;P;P;B	0.71674	0.991;0.995;0.998;0.788;0.749;0.969;0.749;0.51;0.313	P;D;D;P;B;P;B;B;B	0.69307	0.854;0.918;0.963;0.455;0.326;0.771;0.216;0.216;0.153	T	0.48387	-0.9040	10	0.72032	D	0.01	-49.8536	9.3109	0.37903	0.0:0.5509:0.0:0.4491	.	245;304;383;382;382;382;382;383;382	B4DWA1;F8W878;B3KPV9;Q9UQB8;Q9UQB8-2;Q9UQB8-3;Q9UQB8-5;Q9UQB8-6;Q9UQB8-4	.;.;.;BAIP2_HUMAN;.;.;.;.;.	M	382;382;382;382;304;245	ENSP00000316338:I382M;ENSP00000401022:I382M;ENSP00000413069:I382M;ENSP00000315685:I382M;ENSP00000376211:I304M;ENSP00000391837:I245M	ENSP00000315685:I382M	I	+	3	3	BAIAP2	76692988	1.000000	0.71417	0.997000	0.53966	0.954000	0.61252	1.015000	0.29963	-0.115000	0.11915	0.484000	0.47621	ATC	BAIAP2	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000175866		0.637	BAIAP2-003	KNOWN	basic|CCDS	protein_coding	BAIAP2	HGNC	protein_coding	OTTHUMT00000438553.1	74	0.00	0	C			79078393	79078393	+1	no_errors	ENST00000321300	ensembl	human	known	69_37n	missense	54	33.33	27	SNP	1.000	G
CEP131	22994	genome.wustl.edu	37	17	79172751	79172751	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:79172751C>T	ENST00000269392.4	-	11	1460	c.1213G>A	c.(1213-1215)Ggc>Agc	p.G405S	AZI1_ENST00000450824.2_Missense_Mutation_p.G405S|AZI1_ENST00000575907.1_Missense_Mutation_p.G405S|RP11-455O6.2_ENST00000571085.1_RNA|AZI1_ENST00000374782.3_Missense_Mutation_p.G405S|AZI1_ENST00000570482.2_5'Flank	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN		405					cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			TCTCCGGGGCCTGCAGCAGGG	0.667																																						dbGAP											0													53.0	44.0	47.0					17																	79172751		2171	4286	6457	-	-	-	SO:0001583	missense	0																														ENST00000269392.4:c.1213G>A	17.37:g.79172751C>T	ENSP00000269392:p.Gly405Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHI8|B2RN11|Q96F50	Missense_Mutation	SNP	superfamily_t-SNARE	p.G405S	ENST00000269392.4	37	c.1213		17	.	.	.	.	.	.	.	.	.	.	C	8.299	0.819538	0.16607	.	.	ENSG00000141577	ENST00000450824;ENST00000374782;ENST00000269392	T;T;T	0.22743	1.94;1.94;1.94	3.64	1.56	0.23342	.	1.025170	0.07734	N	0.945718	T	0.16128	0.0388	L	0.48362	1.52	0.09310	N	1	B;B;B;B	0.31193	0.084;0.091;0.107;0.312	B;B;B;B	0.31812	0.022;0.027;0.023;0.136	T	0.35773	-0.9775	10	0.11485	T	0.65	-9.2365	4.0072	0.09607	0.2328:0.6401:0.0:0.1271	.	405;405;405;405	B2RN10;Q9UPN4;Q9UPN4-3;Q9UPN4-2	.;AZI1_HUMAN;.;.	S	405	ENSP00000393583:G405S;ENSP00000363914:G405S;ENSP00000269392:G405S	ENSP00000269392:G405S	G	-	1	0	AZI1	76787346	0.000000	0.05858	0.008000	0.14137	0.031000	0.12232	-0.191000	0.09601	0.215000	0.20761	0.467000	0.42956	GGC	AZI1	-	NULL	ENSG00000141577		0.667	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	AZI1	HGNC	protein_coding	OTTHUMT00000256070.1	32	0.00	0	C			79172751	79172751	-1	no_errors	ENST00000269392	ensembl	human	known	69_37n	missense	37	45.59	31	SNP	0.059	T
C11orf48	79081	genome.wustl.edu	37	11	62432621	62432621	+	Intron	SNP	C	C	G	rs568429624		TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr11:62432621C>G	ENST00000431002.2	-	3	2350				SNORA57_ENST00000383870.1_RNA|C11orf48_ENST00000532208.1_Intron|C11orf48_ENST00000524958.1_Missense_Mutation_p.K7N|METTL12_ENST00000532971.1_5'Flank|C11orf48_ENST00000525675.1_Missense_Mutation_p.K7N|RP11-831H9.11_ENST00000528405.1_Missense_Mutation_p.K7N|C11orf48_ENST00000354588.3_Intron			Q9BQE6	CK048_HUMAN	chromosome 11 open reading frame 48											endometrium(1)|lung(5)|urinary_tract(1)	7						GCCGGTTGATCTTTCCCCCCG	0.647																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC001434	CCDS8028.1	11q12.3	2014-02-12			ENSG00000162194	ENSG00000162194			28351	protein-coding gene	gene with protein product						12477932	Standard	NM_024099		Approved	MGC2477	uc001nuf.3	Q9BQE6	OTTHUMG00000167588	ENST00000431002.2:c.617-176G>C	11.37:g.62432621C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96NA4	Missense_Mutation	SNP	NULL	p.K7N	ENST00000431002.2	37	c.21		11	.	.	.	.	.	.	.	.	.	.	C	19.17	3.775794	0.70107	.	.	ENSG00000255432;ENSG00000162194;ENSG00000162194	ENST00000528405;ENST00000524958;ENST00000525675	.	.	.	4.84	3.89	0.44902	.	.	.	.	.	T	0.47783	0.1464	.	.	.	0.26452	N	0.975598	.	.	.	.	.	.	T	0.42582	-0.9443	5	0.72032	D	0.01	.	10.8263	0.46633	0.0:0.8989:0.0:0.1011	.	.	.	.	N	7	.	ENSP00000432523:K7N	K	-	3	2	C11orf48;RP11-831H9.11	62189197	1.000000	0.71417	0.999000	0.59377	0.705000	0.40729	0.754000	0.26390	1.326000	0.45319	0.655000	0.94253	AAG	C11orf48	-	NULL	ENSG00000162194		0.647	C11orf48-004	KNOWN	basic	protein_coding	C11orf48	HGNC	protein_coding	OTTHUMT00000395233.1	60	0.00	0	C	NM_024099		62432621	62432621	-1	no_errors	ENST00000524958	ensembl	human	putative	69_37n	missense	87	20.18	22	SNP	1.000	G
C12orf56	115749	genome.wustl.edu	37	12	64712481	64712481	+	Silent	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr12:64712481G>C	ENST00000543942.2	-	4	1394	c.768C>G	c.(766-768)ctC>ctG	p.L256L	C12orf56_ENST00000333722.5_Intron|RPS11P6_ENST00000535684.1_RNA	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	256										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		GGGAATCTAAGAGGGAATTTC	0.373																																						dbGAP											0													104.0	87.0	92.0					12																	64712481		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.768C>G	12.37:g.64712481G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L256	ENST00000543942.2	37	c.768		12																																																																																			C12orf56	-	NULL	ENSG00000185306		0.373	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf56	HGNC	protein_coding	OTTHUMT00000401058.2	39	0.00	0	G	NM_001099676		64712481	64712481	-1	no_errors	ENST00000543942	ensembl	human	putative	69_37n	silent	42	16.00	8	SNP	0.001	C
C12orf56	115749	genome.wustl.edu	37	12	64712734	64712734	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr12:64712734G>A	ENST00000543942.2	-	4	1141	c.515C>T	c.(514-516)tCc>tTc	p.S172F	C12orf56_ENST00000333722.5_Intron|RPS11P6_ENST00000535684.1_RNA	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56	172										NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		TGAGTCCTTGGATGGTGTACT	0.493																																						dbGAP											0													201.0	168.0	178.0					12																	64712734		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.515C>T	12.37:g.64712734G>A	ENSP00000446101:p.Ser172Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S172F	ENST00000543942.2	37	c.515		12	.	.	.	.	.	.	.	.	.	.	G	1.587	-0.530148	0.04112	.	.	ENSG00000185306	ENST00000543942;ENST00000433716	.	.	.	4.45	0.365	0.16131	.	.	.	.	.	T	0.17662	0.0424	N	0.16066	0.365	0.09310	N	1	.	.	.	.	.	.	T	0.24548	-1.0157	5	.	.	.	.	3.5639	0.07892	0.1788:0.0:0.3729:0.4483	.	.	.	.	F	172;174	.	.	S	-	2	0	C12orf56	62999001	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.136000	0.10405	0.047000	0.15862	0.563000	0.77884	TCC	C12orf56	-	NULL	ENSG00000185306		0.493	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf56	HGNC	protein_coding	OTTHUMT00000401058.2	59	0.00	0	G	NM_001099676		64712734	64712734	-1	no_errors	ENST00000543942	ensembl	human	putative	69_37n	missense	42	40.00	28	SNP	0.001	A
C5orf15	56951	genome.wustl.edu	37	5	133295520	133295520	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr5:133295520G>C	ENST00000231512.3	-	2	533	c.331C>G	c.(331-333)Ctg>Gtg	p.L111V	C5orf15_ENST00000507191.1_5'UTR	NM_020199.2	NP_064584.1	Q8NC54	KCT2_HUMAN	chromosome 5 open reading frame 15	111						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(1)|lung(1)	4			KIRC - Kidney renal clear cell carcinoma(527;0.00806)|Kidney(363;0.02)			TCTTGAGACAGAGGAGTAGGC	0.493																																						dbGAP											0													68.0	60.0	63.0					5																	133295520		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF226055	CCDS4167.1	5q31.1	2012-02-22			ENSG00000113583	ENSG00000113583			20656	protein-coding gene	gene with protein product	"""keratinocytes associated transmembrane protein 2"""						Standard	NM_020199		Approved	KCT2, HTGN29	uc003kyo.3	Q8NC54	OTTHUMG00000129125	ENST00000231512.3:c.331C>G	5.37:g.133295520G>C	ENSP00000231512:p.Leu111Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD10|D3DQ92|Q9NRG2	Missense_Mutation	SNP	NULL	p.L111V	ENST00000231512.3	37	c.331	CCDS4167.1	5	.	.	.	.	.	.	.	.	.	.	G	5.921	0.353909	0.11182	.	.	ENSG00000113583	ENST00000231512	.	.	.	5.93	1.63	0.23807	.	1.165760	0.06274	N	0.696181	T	0.28101	0.0693	L	0.35414	1.06	0.09310	N	1	B	0.16802	0.019	B	0.14578	0.011	T	0.24154	-1.0168	9	0.18710	T	0.47	-0.0267	3.0715	0.06233	0.0931:0.365:0.3074:0.2344	.	111	Q8NC54	KCT2_HUMAN	V	111	.	ENSP00000231512:L111V	L	-	1	2	C5orf15	133323419	0.996000	0.38824	0.004000	0.12327	0.007000	0.05969	0.406000	0.21032	0.737000	0.32582	-0.345000	0.07892	CTG	C5orf15	-	NULL	ENSG00000113583		0.493	C5orf15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf15	HGNC	protein_coding	OTTHUMT00000251175.1	36	0.00	0	G	NM_020199		133295520	133295520	-1	no_errors	ENST00000231512	ensembl	human	known	69_37n	missense	32	54.17	39	SNP	0.000	C
C7orf60	154743	genome.wustl.edu	37	7	112535742	112535742	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:112535742C>G	ENST00000297145.4	-	3	520	c.355G>C	c.(355-357)Gat>Cat	p.D119H	C7orf60_ENST00000485446.1_5'UTR	NM_152556.2	NP_689769.2	Q1RMZ1	BMT2_HUMAN	chromosome 7 open reading frame 60	119							rRNA (adenine) methyltransferase activity (GO:0016433)			breast(1)|endometrium(2)|lung(7)|ovary(3)|prostate(2)|skin(1)|urinary_tract(1)	17						CTTTTTTCATCTTTCTCAAGT	0.358																																						dbGAP											0													154.0	140.0	144.0					7																	112535742		1843	4089	5932	-	-	-	SO:0001583	missense	0				CCDS43634.1	7q31.1	2011-01-11	2008-06-19		ENSG00000164603	ENSG00000164603			26475	protein-coding gene	gene with protein product	"""hypothetical protein FLJ31818"""						Standard	NM_152556		Approved	DKFZp762M126, FLJ31818	uc003vgo.1	Q1RMZ1	OTTHUMG00000155233	ENST00000297145.4:c.355G>C	7.37:g.112535742C>G	ENSP00000297145:p.Asp119His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3D0|Q96MV7	Missense_Mutation	SNP	pfam_DUF3321	p.D119H	ENST00000297145.4	37	c.355	CCDS43634.1	7	.	.	.	.	.	.	.	.	.	.	C	20.4	3.977788	0.74360	.	.	ENSG00000164603	ENST00000297145;ENST00000432572;ENST00000358032	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.80053	0.4553	M	0.70275	2.135	0.80722	D	1	D;P	0.89917	1.0;0.92	D;B	0.85130	0.997;0.196	T	0.80663	-0.1282	9	0.72032	D	0.01	-14.4182	19.9813	0.97326	0.0:1.0:0.0:0.0	.	66;119	B4DST1;Q1RMZ1	.;CG060_HUMAN	H	119;101;66	.	ENSP00000297145:D119H	D	-	1	0	C7orf60	112322978	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.075000	0.64407	2.726000	0.93360	0.655000	0.94253	GAT	C7orf60	-	NULL	ENSG00000164603		0.358	C7orf60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf60	HGNC	protein_coding	OTTHUMT00000338923.1	47	0.00	0	C	NM_152556		112535742	112535742	-1	no_errors	ENST00000297145	ensembl	human	known	69_37n	missense	144	12.73	21	SNP	1.000	G
C7orf49	78996	genome.wustl.edu	37	7	134853688	134853688	+	5'UTR	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:134853688C>G	ENST00000393114.3	-	0	168				C7orf49_ENST00000424142.1_5'UTR|C7orf49_ENST00000430372.1_5'UTR|C7orf49_ENST00000483029.2_Intron|RP11-134L10.1_ENST00000608819.1_RNA|C7orf49_ENST00000459937.1_5'UTR			Q9BWK5	MRI_HUMAN	chromosome 7 open reading frame 49							cytoplasm (GO:0005737)				endometrium(1)|large_intestine(4)|lung(1)|ovary(1)	7						TGTACCTTCTCACAAAGAAGA	0.473											OREG0018340	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													63.0	54.0	57.0					7																	134853688		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC000168	CCDS5838.2, CCDS59082.1, CCDS75663.1	7q33	2011-12-09			ENSG00000122783	ENSG00000122783			22432	protein-coding gene	gene with protein product	"""modulator of retrovirus infection"""					17043244	Standard	NM_001243755		Approved	MGC5242, FLJ27285, FLJ22450, MRI	uc003vsh.3	Q9BWK5	OTTHUMG00000155447	ENST00000393114.3:c.-14G>C	7.37:g.134853688C>G		Somatic	1613	WXS	Illumina GAIIx	Phase_IV	Q6NWZ4|Q6ZNR5	RNA	SNP	-	NULL	ENST00000393114.3	37	NULL	CCDS5838.2	7																																																																																			C7orf49	-	-	ENSG00000122783		0.473	C7orf49-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf49	HGNC	protein_coding	OTTHUMT00000340145.1	29	0.00	0	C	NM_024033		134853688	134853688	-1	no_errors	ENST00000459937	ensembl	human	known	69_37n	rna	7	75.00	21	SNP	0.000	G
CA11	770	genome.wustl.edu	37	19	49142659	49142659	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:49142659C>T	ENST00000084798.4	-	7	1377	c.698G>A	c.(697-699)gGc>gAc	p.G233D	DBP_ENST00000601104.1_5'Flank|SEC1P_ENST00000430145.2_RNA|DBP_ENST00000222122.5_5'Flank	NM_001217.3	NP_001208.2	O75493	CAH11_HUMAN	carbonic anhydrase XI	233						basolateral plasma membrane (GO:0016323)|extracellular region (GO:0005576)				breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)	14		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000103)|all cancers(93;0.000119)|GBM - Glioblastoma multiforme(486;0.00634)|Epithelial(262;0.016)	Zonisamide(DB00909)	GGTGATGAAGCCGAAGGATTC	0.557																																						dbGAP											0													74.0	75.0	74.0					19																	49142659		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF067662	CCDS12729.1	19q13.3	2012-07-02			ENSG00000063180	ENSG00000063180		"""Carbonic anhydrases"""	1370	protein-coding gene	gene with protein product	"""CA-RP XI"", ""carbonic anhydrase-related protein XI"", ""carbonic anhydrase-related protein 2"""	604644				9878252	Standard	XR_243956		Approved	CARP2, CARPX1	uc002pjz.1	O75493		ENST00000084798.4:c.698G>A	19.37:g.49142659C>T	ENSP00000084798:p.Gly233Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60596|Q6FHI1|Q9UEC4	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.G233D	ENST00000084798.4	37	c.698	CCDS12729.1	19	.	.	.	.	.	.	.	.	.	.	C	11.33	1.605705	0.28623	.	.	ENSG00000063180	ENST00000084798	T	0.71698	-0.59	3.22	3.22	0.36961	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.066257	0.64402	D	0.000010	T	0.50718	0.1632	N	0.04018	-0.295	0.38654	D	0.951927	P	0.50066	0.931	P	0.51833	0.681	T	0.55237	-0.8172	10	0.05525	T	0.97	.	10.0814	0.42393	0.0:1.0:0.0:0.0	.	233	O75493	CAH11_HUMAN	D	233	ENSP00000084798:G233D	ENSP00000084798:G233D	G	-	2	0	CA11	53834471	1.000000	0.71417	0.951000	0.38953	0.825000	0.46686	6.398000	0.73244	1.802000	0.52723	0.455000	0.32223	GGC	CA11	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000063180		0.557	CA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA11	HGNC	protein_coding	OTTHUMT00000466172.1	33	0.00	0	C	NM_001217		49142659	49142659	-1	no_errors	ENST00000084798	ensembl	human	known	69_37n	missense	47	15.79	9	SNP	0.985	T
CACNA1C	775	genome.wustl.edu	37	12	2797736	2797736	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr12:2797736C>T	ENST00000347598.4	+	48	6052	c.6052C>T	c.(6052-6054)Ccc>Tcc	p.P2018S	CACNA1C_ENST00000335762.5_Missense_Mutation_p.P1995S|CACNA1C_ENST00000327702.7_Missense_Mutation_p.P2005S|CACNA1C_ENST00000399629.1_Missense_Mutation_p.P1987S|CACNA1C_ENST00000399621.1_Missense_Mutation_p.P1989S|CACNA1C_ENST00000399617.1_Missense_Mutation_p.P2005S|CACNA1C_ENST00000399644.1_Missense_Mutation_p.P1970S|CACNA1C_ENST00000399649.1_Missense_Mutation_p.P1976S|CACNA1C_ENST00000399601.1_Missense_Mutation_p.P1970S|CACNA1C_ENST00000399638.1_Missense_Mutation_p.P1998S|CACNA1C_ENST00000402845.3_Missense_Mutation_p.P1989S|CACNA1C_ENST00000399641.1_Missense_Mutation_p.P1970S|CACNA1C_ENST00000344100.3_Missense_Mutation_p.P2011S|CACNA1C_ENST00000399603.1_Missense_Mutation_p.P1970S|CACNA1C-AS1_ENST00000541673.1_RNA|CACNA1C_ENST00000406454.3_Missense_Mutation_p.P2041S|CACNA1C-AS1_ENST00000544517.1_RNA|CACNA1C_ENST00000399591.1_Missense_Mutation_p.P1978S|CACNA1C_ENST00000399606.1_Missense_Mutation_p.P1990S|CACNA1C_ENST00000399637.1_Missense_Mutation_p.P1989S|CACNA1C_ENST00000399597.1_Missense_Mutation_p.P1970S|CACNA1C_ENST00000399595.1_Missense_Mutation_p.P1978S|CACNA1C_ENST00000399655.1_Missense_Mutation_p.P1970S|CACNA1C-AS1_ENST00000501371.1_RNA|CACNA1C_ENST00000399634.1_Missense_Mutation_p.P2041S	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	2053					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	ACAGCCCGTCCCCACCCTGCG	0.672																																						dbGAP											0													44.0	53.0	50.0					12																	2797736		1927	4124	6051	-	-	-	SO:0001583	missense	0			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.6052C>T	12.37:g.2797736C>T	ENSP00000266376:p.Pro2018Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.P2041S	ENST00000347598.4	37	c.6121	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	C	15.77	2.930550	0.52866	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	4.97	4.97	0.65823	.	0.829144	0.10974	N	0.613520	D	0.89368	0.6695	M	0.79926	2.475	0.46131	D	0.99888	D;D;P;P;P;P;P;P;B;B;P;P;P;P;B;D;P;B;P;B;B;P;P;P;P	0.76494	0.998;0.999;0.51;0.791;0.853;0.837;0.702;0.619;0.064;0.167;0.743;0.649;0.649;0.743;0.376;0.986;0.649;0.014;0.743;0.071;0.328;0.743;0.743;0.649;0.51	P;D;B;B;P;P;B;B;B;B;P;B;B;P;B;D;B;B;P;B;B;P;B;B;B	0.85130	0.901;0.997;0.185;0.219;0.447;0.628;0.398;0.329;0.098;0.053;0.447;0.322;0.439;0.628;0.141;0.934;0.439;0.041;0.447;0.075;0.116;0.628;0.329;0.322;0.185	D	0.86954	0.2087	10	0.44086	T	0.13	.	18.2339	0.89944	0.0:1.0:0.0:0.0	.	661;2011;1967;2053;2005;1989;1970;1987;1998;1970;1990;1970;2001;2018;1970;2005;2041;1978;1976;1978;1959;1989;1989;1970;1970	B7Z7Z5;Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;Q13936-12	.;.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	S	1995;1970;1970;1998;1970;1989;1989;1978;1970;2018;1990;1970;2011;1987;2005;1976;1989;1970;2041;2005;2041;1978;1871	ENSP00000336982:P1995S;ENSP00000382563:P1970S;ENSP00000382552:P1970S;ENSP00000382547:P1998S;ENSP00000382506:P1970S;ENSP00000382530:P1989S;ENSP00000382546:P1989S;ENSP00000382500:P1978S;ENSP00000382549:P1970S;ENSP00000266376:P2018S;ENSP00000382515:P1990S;ENSP00000382510:P1970S;ENSP00000341092:P2011S;ENSP00000382537:P1987S;ENSP00000329877:P2005S;ENSP00000382557:P1976S;ENSP00000385724:P1989S;ENSP00000382512:P1970S;ENSP00000382542:P2041S;ENSP00000382526:P2005S;ENSP00000385896:P2041S;ENSP00000382504:P1978S	ENSP00000323129:P1871S	P	+	1	0	CACNA1C	2667997	1.000000	0.71417	1.000000	0.80357	0.389000	0.30415	7.342000	0.79310	2.311000	0.77944	0.462000	0.41574	CCC	CACNA1C	-	NULL	ENSG00000151067		0.672	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	110	0.00	0	C	NM_000719		2797736	2797736	+1	no_errors	ENST00000399634	ensembl	human	known	69_37n	missense	141	45.17	117	SNP	1.000	T
CBLB	868	genome.wustl.edu	37	3	105421267	105421267	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:105421267G>C	ENST00000264122.4	-	12	1951	c.1630C>G	c.(1630-1632)Ctc>Gtc	p.L544V	CBLB_ENST00000405772.1_Missense_Mutation_p.L544V|CBLB_ENST00000394027.3_Missense_Mutation_p.L566V|CBLB_ENST00000403724.1_Missense_Mutation_p.L544V	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	544	Interaction with VAV1.|Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						GGTGCTGGGAGTGGTTTATCT	0.428			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	dbGAP		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													55.0	49.0	51.0					3																	105421267		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.1630C>G	3.37:g.105421267G>C	ENSP00000264122:p.Leu544Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.L544V	ENST00000264122.4	37	c.1630	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	G	10.62	1.401573	0.25291	.	.	ENSG00000114423	ENST00000264122;ENST00000394027;ENST00000403724;ENST00000405772	D;D;D;D	0.88201	-2.31;-2.28;-2.31;-2.35	5.42	4.55	0.56014	.	0.064522	0.64402	D	0.000009	D	0.84897	0.5574	L	0.57536	1.79	0.80722	D	1	B;B;B	0.27853	0.018;0.073;0.191	B;B;B	0.26770	0.025;0.055;0.073	T	0.80004	-0.1564	9	.	.	.	-14.6434	9.5919	0.39550	0.1744:0.0:0.8256:0.0	.	566;544;544	E7ENW2;Q13191-3;Q13191	.;.;CBLB_HUMAN	V	544;566;544;544	ENSP00000264122:L544V;ENSP00000377595:L566V;ENSP00000384816:L544V;ENSP00000384938:L544V	.	L	-	1	0	CBLB	106903957	1.000000	0.71417	0.998000	0.56505	0.389000	0.30415	3.982000	0.56909	1.274000	0.44362	-0.459000	0.05422	CTC	CBLB	-	NULL	ENSG00000114423		0.428	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	HGNC	protein_coding	OTTHUMT00000319417.2	47	0.00	0	G	NM_170662		105421267	105421267	-1	no_errors	ENST00000264122	ensembl	human	known	69_37n	missense	71	30.39	31	SNP	1.000	C
CCDC114	93233	genome.wustl.edu	37	19	48800320	48800320	+	Silent	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:48800320G>A	ENST00000315396.7	-	14	2608	c.1926C>T	c.(1924-1926)ctC>ctT	p.L642L		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	642	Ser-rich.				outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		TGCTGGACCCGAGGCCTCCGC	0.672																																						dbGAP											0													60.0	60.0	60.0					19																	48800320		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1926C>T	19.37:g.48800320G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRL4|Q96M06|Q9UFG8	Silent	SNP	NULL	p.L642	ENST00000315396.7	37	c.1926	CCDS12714.2	19																																																																																			CCDC114	-	NULL	ENSG00000105479		0.672	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC114	HGNC	protein_coding	OTTHUMT00000343207.1	41	0.00	0	G	NM_144577		48800320	48800320	-1	no_errors	ENST00000315396	ensembl	human	known	69_37n	silent	56	45.28	48	SNP	0.003	A
CCDC12	151903	genome.wustl.edu	37	3	46982546	46982546	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:46982546C>G	ENST00000546280.1	-	2	153	c.106G>C	c.(106-108)Gat>Cat	p.D36H	CCDC12_ENST00000605358.1_5'UTR|CCDC12_ENST00000425441.1_Missense_Mutation_p.D49H|CCDC12_ENST00000292314.2_Missense_Mutation_p.D49H	NM_144716.3	NP_653317.2	Q8WUD4	CCD12_HUMAN	coiled-coil domain containing 12	36										endometrium(1)|large_intestine(1)|urinary_tract(1)	3		Prostate(884;0.0143)|Ovarian(412;0.0448)|Acute lymphoblastic leukemia(5;0.143)		OV - Ovarian serous cystadenocarcinoma(275;2.2e-56)|BRCA - Breast invasive adenocarcinoma(193;0.00136)|KIRC - Kidney renal clear cell carcinoma(197;0.00703)|Kidney(197;0.00809)		GGCTCCCCATCTTCCTTGTCC	0.542																																						dbGAP											0													211.0	183.0	192.0					3																	46982546		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020830	CCDS2748.1, CCDS2748.2, CCDS2748.3, CCDS63612.1	3p21.31	2006-10-24			ENSG00000160799	ENSG00000160799			28332	protein-coding gene	gene with protein product						12477932	Standard	NM_001277074		Approved	MGC23918	uc003cqo.3	Q8WUD4	OTTHUMG00000133513	ENST00000546280.1:c.106G>C	3.37:g.46982546C>G	ENSP00000441327:p.Asp36His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8I4	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf18	p.D49H	ENST00000546280.1	37	c.145		3	.	.	.	.	.	.	.	.	.	.	C	17.77	3.472301	0.63737	.	.	ENSG00000160799	ENST00000425441;ENST00000292314;ENST00000546280;ENST00000446836	.	.	.	3.8	3.8	0.43715	.	0.294958	0.41001	D	0.000970	T	0.76133	0.3945	M	0.77103	2.36	0.45464	D	0.998437	D;D;P	0.76494	0.999;0.999;0.914	D;D;P	0.71870	0.975;0.928;0.589	T	0.77838	-0.2439	9	0.54805	T	0.06	-34.7982	11.4697	0.50261	0.0:1.0:0.0:0.0	.	36;36;36	B4DID2;B4DZZ9;Q8WUD4	.;.;CCD12_HUMAN	H	49;49;36;49	.	ENSP00000292314:D49H	D	-	1	0	CCDC12	46957550	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.233000	0.51311	2.412000	0.81896	0.555000	0.69702	GAT	CCDC12	-	pfam_mRNA_splic_Cwf18	ENSG00000160799		0.542	CCDC12-202	KNOWN	basic|appris_principal	protein_coding	CCDC12	HGNC	protein_coding		42	0.00	0	C	NM_144716		46982546	46982546	-1	no_errors	ENST00000292314	ensembl	human	known	69_37n	missense	7	85.42	41	SNP	1.000	G
CCDC159	126075	genome.wustl.edu	37	19	11464295	11464295	+	Intron	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:11464295T>C	ENST00000588790.1	+	10	1136				CCDC159_ENST00000458408.1_Intron|DKFZP761J1410_ENST00000591608.1_5'Flank|DKFZP761J1410_ENST00000251473.5_5'Flank			P0C7I6	CC159_HUMAN	coiled-coil domain containing 159											endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	5						TCTGAACCCGTTCCCCCAACG	0.617																																						dbGAP											0													21.0	22.0	22.0					19																	11464295		2034	4188	6222	-	-	-	SO:0001627	intron_variant	0			BC038439	CCDS45976.1	19p13.2	2010-02-17			ENSG00000183401	ENSG00000183401			26996	protein-coding gene	gene with protein product							Standard	NM_001080503		Approved		uc010xlt.2	P0C7I6		ENST00000588790.1:c.689+47T>C	19.37:g.11464295T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEG3|B4DWR8|B4E133|B7ZAM4	RNA	SNP	-	NULL	ENST00000588790.1	37	NULL	CCDS45976.1	19																																																																																			CCDC159	-	-	ENSG00000183401		0.617	CCDC159-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC159	HGNC	protein_coding	OTTHUMT00000458761.1	28	0.00	0	T	NM_001080503		11464295	11464295	+1	no_errors	ENST00000586479	ensembl	human	known	69_37n	rna	44	38.03	27	SNP	0.000	C
CDH26	60437	genome.wustl.edu	37	20	58564030	58564030	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr20:58564030C>G	ENST00000244047.5	+	9	1406	c.1095C>G	c.(1093-1095)ttC>ttG	p.F365L	CDH26_ENST00000348616.4_Missense_Mutation_p.F365L			Q8IXH8	CAD26_HUMAN	cadherin 26	365	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			GGCTCGTCTTCTGTGAGAGAG	0.567																																						dbGAP											0													56.0	63.0	61.0					20																	58564030		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1095C>G	20.37:g.58564030C>G	ENSP00000244047:p.Phe365Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F365L	ENST00000244047.5	37	c.1095		20	.	.	.	.	.	.	.	.	.	.	C	7.078	0.569576	0.13560	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.59083	0.29;0.4	5.26	-0.983	0.10263	.	1.245710	0.05338	N	0.529612	T	0.30103	0.0754	N	0.04297	-0.235	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.15723	-1.0427	10	0.15952	T	0.53	.	5.1977	0.15246	0.0:0.3168:0.3845:0.2987	.	365	Q8IXH8-4	.	L	365	ENSP00000244047:F365L;ENSP00000339390:F365L	ENSP00000244047:F365L	F	+	3	2	CDH26	57997425	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.832000	0.04400	0.190000	0.20209	0.655000	0.94253	TTC	CDH26	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000124215		0.567	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		33	0.00	0	C	NM_177980		58564030	58564030	+1	no_errors	ENST00000244047	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.000	G
CDK18	5129	genome.wustl.edu	37	1	205497037	205497037	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:205497037C>T	ENST00000360066.2	+	9	1146	c.845C>T	c.(844-846)gCc>gTc	p.A282V	CDK18_ENST00000429964.2_Missense_Mutation_p.A282V|CDK18_ENST00000509056.1_3'UTR|CDK18_ENST00000506784.1_Missense_Mutation_p.A312V	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18	280	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						CTGAAGCTGGCCGACTTTGGT	0.657																																					Pancreas(180;489 2072 28461 40831 44265)	dbGAP											0													69.0	70.0	70.0					1																	205497037		2203	4300	6503	-	-	-	SO:0001583	missense	0			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.845C>T	1.37:g.205497037C>T	ENSP00000353176:p.Ala282Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A312V	ENST00000360066.2	37	c.935	CCDS44300.1	1	.	.	.	.	.	.	.	.	.	.	C	25.5	4.643715	0.87859	.	.	ENSG00000117266	ENST00000429964;ENST00000506784;ENST00000360066;ENST00000437052	T;T;T	0.50001	0.76;0.76;0.76	4.95	4.95	0.65309	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72244	0.3436	M	0.84683	2.71	0.80722	D	1	D;D;D;D	0.89917	0.999;0.998;0.999;1.0	D;D;D;D	0.77004	0.989;0.975;0.982;0.98	T	0.78191	-0.2300	10	0.87932	D	0	-9.3115	16.7458	0.85471	0.0:1.0:0.0:0.0	.	244;280;312;282	Q59G02;Q07002;Q07002-3;Q07002-2	.;CDK18_HUMAN;.;.	V	282;312;282;46	ENSP00000399082:A282V;ENSP00000423665:A312V;ENSP00000353176:A282V	ENSP00000353176:A282V	A	+	2	0	CDK18	203763660	1.000000	0.71417	0.970000	0.41538	0.579000	0.36224	7.742000	0.85008	2.274000	0.75844	0.561000	0.74099	GCC	CDK18	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000117266		0.657	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	41	0.00	0	C	NM_002596		205497037	205497037	+1	no_errors	ENST00000506784	ensembl	human	known	69_37n	missense	47	43.37	36	SNP	1.000	T
CEACAM20	125931	genome.wustl.edu	37	19	45017248	45017248	+	RNA	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:45017248G>A	ENST00000454753.1	-	0	1688							Q6UY09	CEA20_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 20							integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)	15		Prostate(69;0.0352)				CATTTCTGATGTAGAGAAAAT	0.597											OREG0025538	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													71.0	69.0	69.0					19																	45017248		1976	4166	6142	-	-	-			0			AY358129	CCDS74390.1, CCDS74391.1, CCDS74392.1, CCDS74393.1	19q13.31	2013-01-30			ENSG00000176395	ENSG00000273777		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Immunoglobulin superfamily / I-set domain containing"""	24879	protein-coding gene	gene with protein product						12975309	Standard	NM_001102600		Approved	UNQ9366	uc010ejo.1	Q6UY09	OTTHUMG00000151532		19.37:g.45017248G>A		Somatic	928	WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000454753.1	37	NULL		19																																																																																			CEACAM20	-	-	ENSG00000176395		0.597	CEACAM20-001	KNOWN	basic	processed_transcript	CEACAM20	HGNC	processed_transcript	OTTHUMT00000323032.1	20	0.00	0	G	NM_198444		45017248	45017248	-1	no_errors	ENST00000316962	ensembl	human	known	69_37n	rna	16	44.83	13	SNP	0.068	A
COL27A1	85301	genome.wustl.edu	37	9	117027232	117027232	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr9:117027232G>A	ENST00000356083.3	+	30	3669	c.3278G>A	c.(3277-3279)gGc>gAc	p.G1093D		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1093	Collagen-like 8.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						GGCAGACCGGGCCGGCCTGGA	0.657																																						dbGAP											0													54.0	60.0	58.0					9																	117027232		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.3278G>A	9.37:g.117027232G>A	ENSP00000348385:p.Gly1093Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q66K43|Q96JF7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_Fib_collagen_C	p.G1093D	ENST00000356083.3	37	c.3278	CCDS6802.1	9	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966169	0.53507	.	.	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.99619	-6.28	5.21	4.31	0.51392	.	.	.	.	.	D	0.99625	0.9863	H	0.99573	4.635	0.53005	D	0.999963	P	0.50528	0.936	P	0.49301	0.606	D	0.98117	1.0423	9	0.87932	D	0	.	9.7218	0.40308	0.0956:0.0:0.9044:0.0	.	1093	Q8IZC6	CORA1_HUMAN	D	1093	ENSP00000348385:G1093D	ENSP00000348385:G1093D	G	+	2	0	COL27A1	116067053	1.000000	0.71417	0.993000	0.49108	0.975000	0.68041	4.878000	0.63093	1.210000	0.43336	0.549000	0.68633	GGC	COL27A1	-	NULL	ENSG00000196739		0.657	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1	30	0.00	0	G	NM_032888		117027232	117027232	+1	no_errors	ENST00000356083	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	0.999	A
COL3A1	1281	genome.wustl.edu	37	2	189873946	189873946	+	Splice_Site	SNP	T	T	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:189873946T>A	ENST00000304636.3	+	48	3992	c.3822T>A	c.(3820-3822)agT>agA	p.S1274R	COL3A1_ENST00000317840.5_Splice_Site_p.S971R	NM_000090.3	NP_000081	P02461	CO3A1_HUMAN	collagen, type III, alpha 1	1274	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.			S -> T (in Ref. 26; AAA52002). {ECO:0000305}.	aging (GO:0007568)|axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell-matrix adhesion (GO:0007160)|cellular response to amino acid stimulus (GO:0071230)|cerebral cortex development (GO:0021987)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|digestive tract development (GO:0048565)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of immune response (GO:0050777)|negative regulation of neuron migration (GO:2001223)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|positive regulation of Rho protein signal transduction (GO:0035025)|response to cytokine (GO:0034097)|response to mechanical stimulus (GO:0009612)|response to radiation (GO:0009314)|skeletal system development (GO:0001501)|skin development (GO:0043588)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	collagen type III trimer (GO:0005586)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(2)|breast(1)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(60)|ovary(4)|pancreas(1)|prostate(5)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	126			OV - Ovarian serous cystadenocarcinoma(117;0.0106)|Epithelial(96;0.141)		Collagenase(DB00048)	AACTCAAGAGTGGTATGTTTG	0.398																																						dbGAP											0													47.0	51.0	50.0					2																	189873946		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			X15332	CCDS2297.1	2q32.2	2014-09-17	2008-06-23		ENSG00000168542	ENSG00000168542		"""Collagens"""	2201	protein-coding gene	gene with protein product		120180	"""Ehlers-Danlos syndrome type IV, autosomal dominant"""	EDS4A		2780304, 2834369	Standard	NM_000090		Approved		uc002uqj.1	P02461	OTTHUMG00000132648	ENST00000304636.3:c.3823+1T>A	2.37:g.189873946T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D2JYH5|D3DPH4|P78429|Q15112|Q16403|Q53S91|Q541P8|Q6LDB3|Q6LDJ2|Q6LDJ3|Q7KZ56|Q8N6U4|Q9UC88|Q9UC89|Q9UC90|Q9UC91|R4N3C5|V9GZI1	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.S1274R	ENST00000304636.3	37	c.3822	CCDS2297.1	2	.	.	.	.	.	.	.	.	.	.	T	16.04	3.011356	0.54468	.	.	ENSG00000168542	ENST00000304636;ENST00000317840	T;T	0.74526	-0.85;-0.85	5.6	0.531	0.17108	Fibrillar collagen, C-terminal (3);	0.000000	0.64402	D	0.000010	D	0.87489	0.6190	H	0.94222	3.51	0.28629	N	0.907755	D	0.89917	1.0	D	0.91635	0.999	T	0.81004	-0.1129	10	0.87932	D	0	.	9.4066	0.38466	0.0:0.2726:0.0:0.7274	.	1274	P02461	CO3A1_HUMAN	R	1274;971	ENSP00000304408:S1274R;ENSP00000315243:S971R	ENSP00000304408:S1274R	S	+	3	2	COL3A1	189582191	0.990000	0.36364	1.000000	0.80357	0.984000	0.73092	0.242000	0.18087	0.070000	0.16634	0.482000	0.46254	AGT	COL3A1	-	pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C,smart_Fib_collagen_C	ENSG00000168542		0.398	COL3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL3A1	HGNC	protein_coding	OTTHUMT00000255899.3	55	0.00	0	T	NM_000090	Missense_Mutation	189873946	189873946	+1	no_errors	ENST00000304636	ensembl	human	known	69_37n	missense	53	36.90	31	SNP	0.998	A
COL6A6	131873	genome.wustl.edu	37	3	130290047	130290047	+	Silent	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:130290047C>G	ENST00000358511.6	+	6	2818	c.2787C>G	c.(2785-2787)ctC>ctG	p.L929L	COL6A6_ENST00000453409.2_Silent_p.L929L	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	929	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						CTGATAAACTCAATGCCACGG	0.562																																						dbGAP											0													65.0	65.0	65.0					3																	130290047		1966	4148	6114	-	-	-	SO:0001819	synonymous_variant	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2787C>G	3.37:g.130290047C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.L929	ENST00000358511.6	37	c.2787	CCDS46911.1	3																																																																																			COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.562	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	22	0.00	0	C	NM_001102608		130290047	130290047	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	silent	20	52.38	22	SNP	0.853	G
COX10	1352	genome.wustl.edu	37	17	14095510	14095510	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:14095510G>C	ENST00000261643.3	+	6	977	c.900G>C	c.(898-900)tgG>tgC	p.W300C	COX10_ENST00000536205.1_Missense_Mutation_p.W108C|COX10_ENST00000537334.1_Missense_Mutation_p.W83C	NM_001303.3	NP_001294.2	Q12887	COX10_HUMAN	cytochrome c oxidase assembly homolog 10 (yeast)	300					aerobic respiration (GO:0009060)|cellular respiration (GO:0045333)|heme a biosynthetic process (GO:0006784)|heme biosynthetic process (GO:0006783)|heme O biosynthetic process (GO:0048034)|hydrogen ion transmembrane transport (GO:1902600)|mitochondrial electron transport, cytochrome c to oxygen (GO:0006123)|mitochondrial fission (GO:0000266)|porphyrin-containing compound metabolic process (GO:0006778)|respiratory chain complex IV assembly (GO:0008535)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	farnesyltranstransferase activity (GO:0004311)|protoheme IX farnesyltransferase activity (GO:0008495)			cervix(1)|endometrium(3)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		all_lung(20;0.06)|Lung SC(565;0.168)		UCEC - Uterine corpus endometrioid carcinoma (92;0.106)		TCATGGGCTGGACAGCGGCCA	0.572																																						dbGAP											0													55.0	58.0	57.0					17																	14095510		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09466	CCDS11166.1	17p12	2013-05-24	2012-10-15		ENSG00000006695	ENSG00000006695		"""Mitochondrial respiratory chain complex assembly factors"""	2260	protein-coding gene	gene with protein product	"""heme A: farnesyltransferase"", ""protoheme IX farnesyltransferase, mitochondrial"", ""heme O synthase"""	602125	"""COX10 (yeast) homolog, cytochrome c oxidase assembly protein (heme A: farnesyltransferase)"", ""COX10 homolog, cytochrome c oxidase assembly protein, heme A: farnesyltransferase (yeast)"""			9177788, 12928484	Standard	NM_001303		Approved		uc002gof.4	Q12887	OTTHUMG00000058814	ENST00000261643.3:c.900G>C	17.37:g.14095510G>C	ENSP00000261643:p.Trp300Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6U5|B4DJ50|O15334|Q969F7	Missense_Mutation	SNP	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase	p.W300C	ENST00000261643.3	37	c.900	CCDS11166.1	17	.	.	.	.	.	.	.	.	.	.	G	21.8	4.198234	0.79015	.	.	ENSG00000006695	ENST00000261643;ENST00000536205;ENST00000537334	D;D;D	0.92858	-3.12;-3.12;-3.12	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.96993	0.9018	M	0.93978	3.48	0.80722	D	1	D;D	0.89917	1.0;0.986	D;D	0.81914	0.995;0.93	D	0.98091	1.0409	10	0.87932	D	0	-6.7577	16.1943	0.82015	0.0:0.0:1.0:0.0	.	108;300	B4DJ50;Q12887	.;COX10_HUMAN	C	300;108;83	ENSP00000261643:W300C;ENSP00000439494:W108C;ENSP00000443354:W83C	ENSP00000261643:W300C	W	+	3	0	COX10	14036235	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.009000	0.93606	2.334000	0.79466	0.655000	0.94253	TGG	COX10	-	pfam_UbiA_prenyltransferase,pirsf_Protohaem_IX_farnesylTrfase_mt,tigrfam_Protohaem_IX_farnesylTrfase	ENSG00000006695		0.572	COX10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX10	HGNC	protein_coding	OTTHUMT00000130003.1	99	0.00	0	G	NM_001303		14095510	14095510	+1	no_errors	ENST00000261643	ensembl	human	known	69_37n	missense	74	44.78	60	SNP	1.000	C
CPED1	79974	genome.wustl.edu	37	7	120906415	120906415	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:120906415G>C	ENST00000310396.5	+	19	2912	c.2445G>C	c.(2443-2445)ttG>ttC	p.L815F		NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	815						endoplasmic reticulum (GO:0005783)											GGAAGACTTTGATCAGTTATT	0.393																																						dbGAP											0													207.0	186.0	193.0					7																	120906415		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.2445G>C	7.37:g.120906415G>C	ENSP00000309772:p.Leu815Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.L815F	ENST00000310396.5	37	c.2445	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	G	6.491	0.458714	0.12342	.	.	ENSG00000106034	ENST00000310396	T	0.17691	2.26	5.84	3.99	0.46301	.	0.637689	0.14795	N	0.298020	T	0.07773	0.0195	N	0.08118	0	0.49915	D	0.999831	B	0.10296	0.003	B	0.14578	0.011	T	0.19778	-1.0295	10	0.13108	T	0.6	.	7.6488	0.28336	0.0:0.2666:0.4137:0.3198	.	815	A4D0V7	CG058_HUMAN	F	815	ENSP00000309772:L815F	ENSP00000309772:L815F	L	+	3	2	C7orf58	120693651	0.994000	0.37717	0.520000	0.27837	0.932000	0.56968	1.310000	0.33551	1.467000	0.48044	-0.310000	0.09108	TTG	CPED1	-	NULL	ENSG00000106034		0.393	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	70	0.00	0	G	NM_024913		120906415	120906415	+1	no_errors	ENST00000310396	ensembl	human	known	69_37n	missense	74	57.23	99	SNP	0.713	C
CREM	1390	genome.wustl.edu	37	10	35495832	35495832	+	Missense_Mutation	SNP	G	G	T	rs529802118	byFrequency	TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr10:35495832G>T	ENST00000395895.2	+	9	953	c.791G>T	c.(790-792)gGt>gTt	p.G264V	CREM_ENST00000490511.1_Missense_Mutation_p.G16V|CREM_ENST00000374728.3_Missense_Mutation_p.G124V|CREM_ENST00000488741.1_Missense_Mutation_p.G6V|CREM_ENST00000348787.2_Missense_Mutation_p.G124V|CREM_ENST00000361599.4_Missense_Mutation_p.G173V|CREM_ENST00000487763.1_Missense_Mutation_p.G24V|CREM_ENST00000479070.1_Missense_Mutation_p.G215V|CREM_ENST00000395887.3_Missense_Mutation_p.G185V|CREM_ENST00000374734.3_Missense_Mutation_p.G140V|CREM_ENST00000474362.1_5'UTR|CREM_ENST00000354759.3_Missense_Mutation_p.G152V|CREM_ENST00000473940.1_Missense_Mutation_p.G24V|CREM_ENST00000345491.3_Missense_Mutation_p.G203V|CREM_ENST00000344351.5_5'UTR|CREM_ENST00000374721.3_Missense_Mutation_p.G173V|CREM_ENST00000356917.5_Missense_Mutation_p.G12V|CREM_ENST00000474931.1_Missense_Mutation_p.G16V|CREM_ENST00000468236.1_Missense_Mutation_p.G28V|CREM_ENST00000463960.1_Missense_Mutation_p.G97V|CREM_ENST00000460270.1_5'UTR|CREM_ENST00000333809.8_Missense_Mutation_p.G252V|CREM_ENST00000484283.1_Missense_Mutation_p.G122V|CREM_ENST00000342105.3_Missense_Mutation_p.G148V|CREM_ENST00000488328.1_Missense_Mutation_p.G12V|CREM_ENST00000429130.3_Missense_Mutation_p.G248V|CREM_ENST00000439705.1_Missense_Mutation_p.G189V|CREM_ENST00000463314.1_Missense_Mutation_p.G41V|CREM_ENST00000337656.4_Missense_Mutation_p.G203V			Q03060	CREM_HUMAN	cAMP responsive element modulator	264					cell differentiation (GO:0030154)|glycosphingolipid metabolic process (GO:0006687)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding protein binding (GO:0008140)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14						GCTGCCACTGGTGACATGCCA	0.438																																						dbGAP											0													126.0	136.0	133.0					10																	35495832		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7180.1, CCDS7181.1, CCDS7182.1, CCDS7183.1, CCDS7184.1, CCDS7185.1, CCDS7186.1, CCDS7187.1, CCDS7188.1, CCDS31181.1, CCDS53519.1, CCDS53520.1, CCDS53517.1, CCDS53518.1, CCDS53521.1, CCDS58074.1, CCDS58075.1, CCDS58076.1	10p12.1-p11.1	2013-01-10			ENSG00000095794	ENSG00000095794		"""basic leucine zipper proteins"""	2352	protein-coding gene	gene with protein product		123812				1461747, 7916662	Standard	NM_182717		Approved	hCREM-2	uc001iyb.3	Q03060	OTTHUMG00000017953	ENST00000395895.2:c.791G>T	10.37:g.35495832G>T	ENSP00000379232:p.Gly264Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K014|A8K3J7|A8K6A1|A8MPQ2|B4DXC1|C9J785|C9JZ10|E9PAR4|E9PHM1|O75519|Q14501|Q14503|Q14504|Q14505|Q14506|Q15731|Q16114|Q16116|Q5T9H7|Q5W1A6|Q5W1A7|Q5W1A8|Q5W1A9|Q5W1B0|Q5W1B2|Q7Z2Q6|Q8IVD4|Q96AG7|Q9NZ98|Q9NZ99|Q9NZB9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_Coactivator_CBP_pKID,pfam_bZIP_2,smart_bZIP,pfscan_Coactivator_CBP_pKID,pfscan_bZIP,prints_Leuzip_CREB	p.G264V	ENST00000395895.2	37	c.791		10	.	.	.	.	.	.	.	.	.	.	G	29.9	5.048182	0.93740	.	.	ENSG00000095794	ENST00000354759;ENST00000345491;ENST00000395895;ENST00000374728;ENST00000487132;ENST00000333809;ENST00000439705;ENST00000374734;ENST00000337656;ENST00000479070;ENST00000462058;ENST00000429130;ENST00000489627;ENST00000493508;ENST00000490263;ENST00000374721;ENST00000348787;ENST00000374722;ENST00000361599;ENST00000484283;ENST00000395887;ENST00000494479;ENST00000463314;ENST00000342105;ENST00000463960;ENST00000487763;ENST00000473940;ENST00000488328;ENST00000356917;ENST00000488741;ENST00000474931;ENST00000468236;ENST00000490511	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.62941	0.36;0.54;0.39;0.76;0.21;-0.01;0.34;0.36;0.18;0.53;0.44;0.76;0.47;0.28;0.48;0.46;1.27;0.52;0.34;1.37;1.39;1.21;1.09;1.03;0.94;1.35;1.18	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.80171	0.4574	M	0.71206	2.165	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	0.991;0.996;1.0;1.0;1.0;0.999;1.0;1.0;0.984;1.0;1.0;1.0;0.982;1.0;1.0;1.0;0.997	P;D;D;D;D;D;D;D;D;D;D;D;P;D;D;D;D	0.97110	0.806;0.916;0.999;1.0;0.991;0.986;0.991;0.988;0.909;1.0;0.998;1.0;0.806;1.0;1.0;1.0;0.973	T	0.80826	-0.1209	10	0.87932	D	0	-2.3996	20.126	0.97982	0.0:0.0:1.0:0.0	.	16;16;6;12;12;24;24;252;264;148;122;173;140;203;124;203;152	A8K014;E9PAR4;A8K6A1;A8K3J7;Q03060-11;Q5W1B2;Q03060-10;Q03060-1;Q03060;Q03060-7;Q03060-13;Q03060-12;A8MPQ2;E9PHM1;Q5W1A7;Q03060-16;Q5W1B0	.;.;.;.;.;.;.;.;CREM_HUMAN;.;.;.;.;.;.;.;.	V	152;203;264;124;124;252;189;140;203;215;173;248;108;57;173;236;124;236;173;122;185;82;41;148;97;24;24;12;12;6;16;28;16	ENSP00000346804:G152V;ENSP00000265372:G203V;ENSP00000379232:G264V;ENSP00000363860:G124V;ENSP00000418798:G124V;ENSP00000333055:G252V;ENSP00000409220:G189V;ENSP00000363866:G140V;ENSP00000337138:G203V;ENSP00000420511:G215V;ENSP00000393538:G248V;ENSP00000345384:G124V;ENSP00000354593:G173V;ENSP00000417165:G122V;ENSP00000379225:G185V;ENSP00000417399:G82V;ENSP00000418336:G41V;ENSP00000341875:G148V;ENSP00000419684:G97V;ENSP00000417807:G24V;ENSP00000420681:G24V;ENSP00000417460:G12V;ENSP00000349387:G12V;ENSP00000419075:G6V;ENSP00000417562:G16V;ENSP00000419810:G28V;ENSP00000417327:G16V	ENSP00000333055:G252V	G	+	2	0	CREM	35535838	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.749000	0.94314	0.655000	0.94253	GGT	CREM	-	prints_Leuzip_CREB	ENSG00000095794		0.438	CREM-203	KNOWN	basic|appris_principal	protein_coding	CREM	HGNC	protein_coding		66	0.00	0	G	NM_001881		35495832	35495832	+1	no_errors	ENST00000395895	ensembl	human	known	69_37n	missense	106	28.38	42	SNP	1.000	T
CSMD2	114784	genome.wustl.edu	37	1	34128546	34128546	+	Missense_Mutation	SNP	A	A	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:34128546A>G	ENST00000373380.1	-	5	1038	c.818T>C	c.(817-819)cTg>cCg	p.L273P	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.L1400P			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1360	CUB 2. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GCTGAACTGCAGGACGACCGA	0.597																																						dbGAP											0													120.0	112.0	115.0					1																	34128546		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.818T>C	1.37:g.34128546A>G	ENSP00000362478:p.Leu273Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.L1400P	ENST00000373380.1	37	c.4199		1	.	.	.	.	.	.	.	.	.	.	A	25.2	4.610320	0.87258	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.66280	-0.2;-0.2	5.64	5.64	0.86602	CUB (5);	0.000000	0.64402	D	0.000003	D	0.85869	0.5797	H	0.96996	3.92	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.999	D;D;D	0.79108	0.978;0.992;0.992	D	0.90439	0.4430	10	0.72032	D	0.01	.	15.3326	0.74226	1.0:0.0:0.0:0.0	.	273;1360;1400	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	P	1400;273	ENSP00000362479:L1400P;ENSP00000362478:L273P	ENSP00000241312:L1360P	L	-	2	0	CSMD2	33901133	1.000000	0.71417	0.979000	0.43373	0.976000	0.68499	9.287000	0.95975	2.279000	0.76181	0.459000	0.35465	CTG	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.597	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4	24	0.00	0	A	NM_052896		34128546	34128546	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	37	38.33	23	SNP	1.000	G
CTNNB1	1499	genome.wustl.edu	37	3	41268809	41268809	+	Silent	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:41268809C>T	ENST00000349496.5	+	7	1327	c.1047C>T	c.(1045-1047)gtC>gtT	p.V349V	CTNNB1_ENST00000453024.1_Silent_p.V342V|CTNNB1_ENST00000396185.3_Silent_p.V349V|CTNNB1_ENST00000405570.1_Silent_p.V349V|CTNNB1_ENST00000396183.3_Silent_p.V349V	NM_001904.3	NP_001895.1	P35222	CTNB1_HUMAN	catenin (cadherin-associated protein), beta 1, 88kDa	349					adherens junction assembly (GO:0034333)|androgen receptor signaling pathway (GO:0030521)|anterior/posterior axis specification (GO:0009948)|apoptotic process (GO:0006915)|bone resorption (GO:0045453)|branching involved in ureteric bud morphogenesis (GO:0001658)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in positive regulation of epithelial to mesenchymal transition (GO:0044334)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cell maturation (GO:0048469)|cell-matrix adhesion (GO:0007160)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to growth factor stimulus (GO:0071363)|cellular response to indole-3-methanol (GO:0071681)|cellular response to mechanical stimulus (GO:0071260)|central nervous system vasculogenesis (GO:0022009)|cytoskeletal anchoring at plasma membrane (GO:0007016)|determination of dorsal/ventral asymmetry (GO:0048262)|dorsal/ventral axis specification (GO:0009950)|ectoderm development (GO:0007398)|embryonic axis specification (GO:0000578)|embryonic digit morphogenesis (GO:0042733)|embryonic foregut morphogenesis (GO:0048617)|embryonic forelimb morphogenesis (GO:0035115)|embryonic heart tube development (GO:0035050)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal limb joint morphogenesis (GO:0036023)|endodermal cell fate commitment (GO:0001711)|endothelial tube morphogenesis (GO:0061154)|epithelial cell differentiation involved in prostate gland development (GO:0060742)|epithelial to mesenchymal transition (GO:0001837)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|fungiform papilla formation (GO:0061198)|gastrulation with mouth forming second (GO:0001702)|genitalia morphogenesis (GO:0035112)|glial cell fate determination (GO:0007403)|hair cell differentiation (GO:0035315)|hair follicle morphogenesis (GO:0031069)|hair follicle placode formation (GO:0060789)|hindbrain development (GO:0030902)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|layer formation in cerebral cortex (GO:0021819)|lens morphogenesis in camera-type eye (GO:0002089)|liver development (GO:0001889)|lung cell differentiation (GO:0060479)|lung induction (GO:0060492)|lung-associated mesenchyme development (GO:0060484)|male genitalia development (GO:0030539)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|midgut development (GO:0007494)|muscle cell differentiation (GO:0042692)|myoblast differentiation (GO:0045445)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chondrocyte differentiation (GO:0032331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of neuron death (GO:1901215)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein sumoylation (GO:0033234)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nephron tubule formation (GO:0072079)|neural plate development (GO:0001840)|neuron migration (GO:0001764)|odontogenesis of dentin-containing tooth (GO:0042475)|oocyte development (GO:0048599)|osteoclast differentiation (GO:0030316)|oviduct development (GO:0060066)|pancreas development (GO:0031016)|patterning of blood vessels (GO:0001569)|positive regulation of apoptotic process (GO:0043065)|positive regulation of branching involved in lung morphogenesis (GO:0061047)|positive regulation of determination of dorsal identity (GO:2000017)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of epithelial cell proliferation involved in prostate gland development (GO:0060769)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of heparan sulfate proteoglycan biosynthetic process (GO:0010909)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein heterooligomerization (GO:0051291)|protein localization to cell surface (GO:0034394)|proximal/distal pattern formation (GO:0009954)|regulation of angiogenesis (GO:0045765)|regulation of calcium ion import (GO:0090279)|regulation of centriole-centriole cohesion (GO:0030997)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of fibroblast proliferation (GO:0048145)|regulation of myelination (GO:0031641)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of protein localization to cell surface (GO:2000008)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of smooth muscle cell proliferation (GO:0048660)|regulation of T cell proliferation (GO:0042129)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|renal vesicle formation (GO:0072033)|response to cadmium ion (GO:0046686)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|Schwann cell proliferation (GO:0014010)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle cell differentiation (GO:0051145)|synapse organization (GO:0050808)|synaptic vesicle transport (GO:0048489)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tongue morphogenesis (GO:0043587)|trachea formation (GO:0060440)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	adherens junction (GO:0005912)|apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|beta-catenin destruction complex (GO:0030877)|beta-catenin-TCF7L2 complex (GO:0070369)|catenin complex (GO:0016342)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell periphery (GO:0071944)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Scrib-APC-beta-catenin complex (GO:0034750)|synapse (GO:0045202)|tight junction (GO:0005923)|transcription factor complex (GO:0005667)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|androgen receptor binding (GO:0050681)|cadherin binding (GO:0045296)|chromatin binding (GO:0003682)|double-stranded DNA binding (GO:0003690)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|I-SMAD binding (GO:0070411)|ion channel binding (GO:0044325)|kinase binding (GO:0019900)|nuclear hormone receptor binding (GO:0035257)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|R-SMAD binding (GO:0070412)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)		CTNNB1/PLAG1(60)	NS(4)|adrenal_gland(103)|biliary_tract(43)|bone(21)|breast(7)|central_nervous_system(260)|cervix(9)|endometrium(293)|eye(1)|haematopoietic_and_lymphoid_tissue(60)|kidney(202)|large_intestine(269)|liver(1010)|lung(63)|oesophagus(6)|ovary(106)|pancreas(126)|parathyroid(11)|pituitary(111)|pleura(2)|prostate(31)|salivary_gland(13)|skin(103)|small_intestine(17)|soft_tissue(792)|stomach(165)|thyroid(55)|upper_aerodigestive_tract(2)|urinary_tract(8)	3893				KIRC - Kidney renal clear cell carcinoma(284;0.0028)|Kidney(284;0.00294)		TGCTATCTGTCTGCTCTAGTA	0.398		15	"""H, Mis, T"""	PLAG1	"""colorectal, cvarian,  hepatoblastoma, others, pleomorphic salivary adenoma"""				Pilomatrixoma, Familial Clustering of																												Colon(6;3 56 14213 18255)	dbGAP		Dom	yes		3	3p22-p21.3	1499	"""catenin (cadherin-associated protein), beta 1"""		"""E, M, O"""	0													113.0	108.0	110.0					3																	41268809		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pilomatricoma, Familial Clustering of, Epithelioma Calcificans of Malherbe	X87838	CCDS2694.1	3p21	2013-02-15	2002-08-29		ENSG00000168036	ENSG00000168036		"""Armadillo repeat containing"""	2514	protein-coding gene	gene with protein product		116806	"""catenin (cadherin-associated protein), beta 1 (88kD)"""	CTNNB		7829088	Standard	NM_001098210		Approved	beta-catenin, armadillo	uc003ckr.2	P35222	OTTHUMG00000131393	ENST00000349496.5:c.1047C>T	3.37:g.41268809C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1L7|Q8NEW9|Q8NI94|Q9H391	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,prints_Beta-catenin,pfscan_Armadillo	p.V349	ENST00000349496.5	37	c.1047	CCDS2694.1	3																																																																																			CTNNB1	-	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000168036		0.398	CTNNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTNNB1	HGNC	protein_coding	OTTHUMT00000254182.2	69	0.00	0	C	NM_001098210		41268809	41268809	+1	no_errors	ENST00000349496	ensembl	human	known	69_37n	silent	22	66.15	43	SNP	1.000	T
CYP2E1	1571	genome.wustl.edu	37	10	135347295	135347295	+	Missense_Mutation	SNP	C	C	A	rs527959204		TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr10:135347295C>A	ENST00000463117.2	+	8	1133	c.861C>A	c.(859-861)gaC>gaA	p.D287E	SPRN_ENST00000541506.1_Intron|CYP2E1_ENST00000252945.3_Missense_Mutation_p.D287E			P05181	CP2E1_HUMAN	cytochrome P450, family 2, subfamily E, polypeptide 1	287					drug metabolic process (GO:0017144)|heterocycle metabolic process (GO:0046483)|monoterpenoid metabolic process (GO:0016098)|oxidation-reduction process (GO:0055114)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to organonitrogen compound (GO:0010243)|response to ozone (GO:0010193)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|triglyceride metabolic process (GO:0006641)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|mitochondrion (GO:0005739)	enzyme binding (GO:0019899)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity (GO:0016491)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)|oxygen binding (GO:0019825)			NS(1)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(6)|liver(2)|lung(7)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;1.12e-06)|all cancers(32;1.43e-06)|Epithelial(32;1.71e-06)	Acetaminophen(DB00316)|Aldesleukin(DB00041)|Almotriptan(DB00918)|Alosetron(DB00969)|Aminophylline(DB01223)|Amitriptyline(DB00321)|Antipyrine(DB01435)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Bromazepam(DB01558)|Brompheniramine(DB00835)|Bupropion(DB01156)|Caffeine(DB00201)|Carbinoxamine(DB00748)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Chlorzoxazone(DB00356)|Cimetidine(DB00501)|Citalopram(DB00215)|Clevidipine(DB04920)|Clofibrate(DB00636)|Clomifene(DB00882)|Clonazepam(DB01068)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Dacarbazine(DB00851)|Dalfampridine(DB06637)|Dapsone(DB00250)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dexfenfluramine(DB01191)|Dexmedetomidine(DB00633)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Disulfiram(DB00822)|Econazole(DB01127)|Enflurane(DB00228)|Enfuvirtide(DB00109)|Estrone(DB00655)|Ethanol(DB00898)|Ethanolamine Oleate(DB06689)|Ethosuximide(DB00593)|Etoposide(DB00773)|Etoricoxib(DB01628)|Felbamate(DB00949)|Fingolimod(DB08868)|Flunitrazepam(DB01544)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluvoxamine(DB00176)|Folic Acid(DB00158)|Fomepizole(DB01213)|Glucosamine(DB01296)|Halothane(DB01159)|Hexobarbital(DB01355)|Iloperidone(DB04946)|Imipramine(DB00458)|Isoflurane(DB00753)|Isoniazid(DB00951)|Isosorbide Dinitrate(DB00883)|Itraconazole(DB01167)|Menadione(DB00170)|Meprobamate(DB00371)|Methazolamide(DB00703)|Methimazole(DB00763)|Methotrimeprazine(DB01403)|Methoxyflurane(DB01028)|Metyrapone(DB01011)|Mexiletine(DB00379)|Miconazole(DB01110)|Midazolam(DB00683)|Mitoxantrone(DB01204)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nitrazepam(DB01595)|Nortriptyline(DB00540)|Ondansetron(DB00904)|Orphenadrine(DB01173)|Oxaliplatin(DB00526)|Paramethadione(DB00617)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Pilocarpine(DB01085)|Pimozide(DB01100)|Proguanil(DB01131)|Propofol(DB00818)|Quinidine(DB00908)|Quinine(DB00468)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rufinamide(DB06201)|S-Adenosylmethionine(DB00118)|Selegiline(DB01037)|Sevoflurane(DB01236)|Sildenafil(DB00203)|Streptozocin(DB00428)|Sulfadiazine(DB00359)|Sulfanilamide(DB00259)|Tamoxifen(DB00675)|Thalidomide(DB01041)|Theobromine(DB01412)|Theophylline(DB00277)|Thiopental(DB00599)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Trabectedin(DB05109)|Tranylcypromine(DB00752)|Trimethadione(DB00347)|Ursodeoxycholic acid(DB01586)|Zafirlukast(DB00549)|Zopiclone(DB01198)	ACACAATGGACGGTATCACCG	0.542									Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of																													dbGAP											0													189.0	165.0	173.0					10																	135347295		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Familial Head and Neck Cancer	J02843	CCDS7686.1	10q26.3	2013-05-03	2003-01-14	2002-09-13	ENSG00000130649	ENSG00000130649		"""Cytochrome P450s"""	2631	protein-coding gene	gene with protein product		124040	"""cytochrome P450, subfamily IIE (ethanol-inducible), polypeptide 1"""	CYP2E			Standard	NM_000773		Approved		uc001lnj.1	P05181	OTTHUMG00000019322	ENST00000463117.2:c.861C>A	10.37:g.135347295C>A	ENSP00000440689:p.Asp287Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZD5|Q6NWT9|Q9UK47	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2E-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.D287E	ENST00000463117.2	37	c.861	CCDS7686.1	10	.	.	.	.	.	.	.	.	.	.	T	0.147	-1.095586	0.01858	.	.	ENSG00000130649	ENST00000463117;ENST00000252945;ENST00000421586;ENST00000418356	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	3.96	-6.25	0.02039	.	0.435725	0.27636	N	0.018483	T	0.15176	0.0366	N	0.00765	-1.205	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.42172	-0.9467	10	0.02654	T	1	.	1.0719	0.01623	0.4339:0.1847:0.2055:0.1758	.	183;287	Q59EW1;P05181	.;CP2E1_HUMAN	E	287;287;200;150	ENSP00000440689:D287E;ENSP00000252945:D287E;ENSP00000412754:D200E;ENSP00000397299:D150E	ENSP00000252945:D287E	D	+	3	2	CYP2E1	135197285	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	-0.745000	0.04834	-1.208000	0.02634	-0.189000	0.12847	GAC	CYP2E1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I_CYP2E-like	ENSG00000130649		0.542	CYP2E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2E1	HGNC	protein_coding	OTTHUMT00000051161.2	71	0.00	0	C	NM_000773		135347295	135347295	+1	no_errors	ENST00000252945	ensembl	human	known	69_37n	missense	15	71.43	40	SNP	0.001	A
DAZL	1618	genome.wustl.edu	37	3	16635178	16635178	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:16635178C>T	ENST00000399444.2	-	9	1012	c.719G>A	c.(718-720)gGa>gAa	p.G240E	DAZL_ENST00000250863.8_Missense_Mutation_p.G260E	NM_001351.3	NP_001342.2	Q92904	DAZL_HUMAN	deleted in azoospermia-like	240					female meiosis II (GO:0007147)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|oocyte maturation (GO:0001556)|positive regulation of meiosis (GO:0045836)|positive regulation of translational initiation (GO:0045948)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|polysome (GO:0005844)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|translation activator activity (GO:0008494)		RAF1/DAZL(2)	endometrium(1)|large_intestine(3)|lung(4)|prostate(3)	11						TGGGCCATTTCCAGAGGGTGG	0.343																																						dbGAP											0													61.0	55.0	57.0					3																	16635178		1824	4081	5905	-	-	-	SO:0001583	missense	0			BC027595	CCDS43059.1, CCDS54556.1	3p24	2013-02-12			ENSG00000092345	ENSG00000092345		"""RNA binding motif (RRM) containing"""	2685	protein-coding gene	gene with protein product		601486		DAZLA		8896558	Standard	NM_001351		Approved	DAZH, SPGYLA, MGC26406, DAZL1	uc003cbb.3	Q92904	OTTHUMG00000157050	ENST00000399444.2:c.719G>A	3.37:g.16635178C>T	ENSP00000382373:p.Gly240Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15396|Q5HYB4|Q92909	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G240E	ENST00000399444.2	37	c.719	CCDS43059.1	3	.	.	.	.	.	.	.	.	.	.	C	15.27	2.784164	0.49997	.	.	ENSG00000092345	ENST00000250863;ENST00000399444	T;T	0.25414	1.8;1.82	5.82	4.9	0.64082	.	0.453697	0.24508	N	0.037906	T	0.32466	0.0830	M	0.67953	2.075	0.42198	D	0.991757	P;P	0.48089	0.843;0.905	B;B	0.43658	0.311;0.426	T	0.18713	-1.0328	10	0.72032	D	0.01	-5.0955	14.0436	0.64690	0.0:0.747:0.253:0.0	.	240;260	Q92904;Q5HYB4	DAZL_HUMAN;.	E	260;240	ENSP00000250863:G260E;ENSP00000382373:G240E	ENSP00000250863:G260E	G	-	2	0	DAZL	16610182	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	1.008000	0.29872	2.765000	0.95021	0.650000	0.86243	GGA	DAZL	-	NULL	ENSG00000092345		0.343	DAZL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAZL	HGNC	protein_coding	OTTHUMT00000347261.2	169	0.00	0	C	NM_001351		16635178	16635178	-1	no_errors	ENST00000399444	ensembl	human	known	69_37n	missense	29	77.34	99	SNP	1.000	T
DCHS2	54798	genome.wustl.edu	37	4	155156012	155156012	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr4:155156012C>T	ENST00000357232.4	-	25	8426	c.8427G>A	c.(8425-8427)atG>atA	p.M2809I		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2809					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		GAATGCCAGGCATATGCAAAT	0.418																																						dbGAP											0													126.0	130.0	129.0					4																	155156012		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.8427G>A	4.37:g.155156012C>T	ENSP00000349768:p.Met2809Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.M2809I	ENST00000357232.4	37	c.8427	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	C	2.658	-0.280343	0.05642	.	.	ENSG00000197410	ENST00000357232	T	0.52526	0.66	5.8	-1.7	0.08159	.	1.297720	0.04734	N	0.421651	T	0.35913	0.0948	L	0.40543	1.245	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.14952	-1.0454	10	0.20519	T	0.43	.	6.9432	0.24504	0.3463:0.4369:0.0:0.2169	.	2809	Q6V1P9	PCD23_HUMAN	I	2809	ENSP00000349768:M2809I	ENSP00000349768:M2809I	M	-	3	0	DCHS2	155375462	0.069000	0.21087	0.000000	0.03702	0.274000	0.26718	0.144000	0.16135	-0.698000	0.05085	-1.357000	0.01221	ATG	DCHS2	-	NULL	ENSG00000197410		0.418	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	34	0.00	0	C	NM_001142552		155156012	155156012	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	missense	15	46.43	13	SNP	0.000	T
DENND2C	163259	genome.wustl.edu	37	1	115127989	115127989	+	3'UTR	DEL	A	A	-			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:115127989delA	ENST00000393274.1	-	0	3644				DENND2C_ENST00000393276.3_3'UTR|DENND2C_ENST00000481894.1_5'Flank	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C						positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		AGGCTGCTATAAAAAAAAAAT	0.408																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.*232T>-	1.37:g.115127989delA		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AL26|Q5TCX6|Q6P3R3	RNA	DEL	-	NULL	ENST00000393274.1	37	NULL	CCDS58018.1	1																																																																																			DENND2C	-	-	ENSG00000175984		0.408	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	20	0.00	0	A	NM_198459		115127989	115127989	-1	no_errors	ENST00000495031	ensembl	human	known	69_37n	rna	11	15.38	2	DEL	0.000	-
DHRS13	147015	genome.wustl.edu	37	17	27225510	27225510	+	Silent	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:27225510C>T	ENST00000378895.4	-	5	1209	c.1083G>A	c.(1081-1083)aaG>aaA	p.K361K	FLOT2_ENST00000577789.1_5'Flank|FLOT2_ENST00000585169.1_5'Flank|RP11-20B24.4_ENST00000580603.1_RNA|DHRS13_ENST00000581974.1_5'Flank|FLOT2_ENST00000394908.4_5'Flank|DHRS13_ENST00000394901.3_Silent_p.K311K|DHRS13_ENST00000426464.2_Silent_p.K280K|FLOT2_ENST00000394906.2_5'Flank|RP11-20B24.4_ENST00000579187.1_RNA	NM_144683.3	NP_653284.2	Q6UX07	DHR13_HUMAN	dehydrogenase/reductase (SDR family) member 13	361						extracellular region (GO:0005576)|membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			breast(1)|endometrium(2)|kidney(1)|large_intestine(1)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	9	all_cancers(5;2.12e-15)|all_epithelial(6;3.44e-19)|Lung NSC(42;0.01)		Epithelial(11;1.59e-06)|all cancers(11;9.27e-06)|BRCA - Breast invasive adenocarcinoma(11;5.78e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.0602)			ggtgcgtcatcttagacaaat	0.542																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BC015582	CCDS11246.2	17q11.2	2011-09-14			ENSG00000167536	ENSG00000167536	1.1.-.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	28326	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 5"""					12975309, 19027726	Standard	NM_144683		Approved	MGC23280, SDR7C5	uc002hde.4	Q6UX07	OTTHUMG00000132678	ENST00000378895.4:c.1083G>A	17.37:g.27225510C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BH7	Silent	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.K361	ENST00000378895.4	37	c.1083	CCDS11246.2	17																																																																																			DHRS13	-	NULL	ENSG00000167536		0.542	DHRS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS13	HGNC	protein_coding	OTTHUMT00000255952.1	38	0.00	0	C	NM_144683		27225510	27225510	-1	no_errors	ENST00000378895	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.655	T
DLG1	1739	genome.wustl.edu	37	3	196812529	196812529	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:196812529delT	ENST00000419354.1	-	17	2145	c.1859delA	c.(1858-1860)gatfs	p.D621fs	DLG1_ENST00000422288.1_Frame_Shift_Del_p.D570fs|DLG1_ENST00000314062.3_Frame_Shift_Del_p.D570fs|DLG1_ENST00000448528.2_Frame_Shift_Del_p.D621fs|DLG1_ENST00000357674.4_Frame_Shift_Del_p.D588fs|DLG1_ENST00000450955.1_Frame_Shift_Del_p.D588fs|DLG1_ENST00000346964.2_Frame_Shift_Del_p.D621fs|DLG1_ENST00000392382.2_Frame_Shift_Del_p.D588fs|DLG1_ENST00000443183.1_Frame_Shift_Del_p.D505fs|DLG1_ENST00000452595.1_Frame_Shift_Del_p.D505fs			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	621	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		CCATTCATCATCAGAAGCATT	0.458																																						dbGAP											0													146.0	141.0	143.0					3																	196812529		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.1859delA	3.37:g.196812529delT	ENSP00000407531:p.Asp621fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Frame_Shift_Del	DEL	pfam_Guanylate_kin,pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.D620fs	ENST00000419354.1	37	c.1859	CCDS43194.1	3																																																																																			DLG1	-	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pirsf_M-assoc_guanylate_kinase,pfscan_SH3_domain	ENSG00000075711		0.458	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	33	0.00	0	T	NM_004087		196812529	196812529	-1	no_errors	ENST00000346964	ensembl	human	known	69_37n	frame_shift_del	111	17.65	24	DEL	1.000	-
DNAH1	25981	genome.wustl.edu	37	3	52418012	52418012	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:52418012G>A	ENST00000420323.2	+	52	8548	c.8287G>A	c.(8287-8289)Gaa>Aaa	p.E2763K		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	2763	AAA 4. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGAGATCCCAGAACTGGAATC	0.567																																						dbGAP											0													32.0	34.0	33.0					3																	52418012		1892	4102	5994	-	-	-	SO:0001583	missense	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.8287G>A	3.37:g.52418012G>A	ENSP00000401514:p.Glu2763Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.E2763K	ENST00000420323.2	37	c.8287	CCDS46842.1	3	.	.	.	.	.	.	.	.	.	.	G	14.02	2.411232	0.42817	.	.	ENSG00000114841	ENST00000420323	T	0.39406	1.08	4.05	4.05	0.47172	.	0.411675	0.20585	N	0.089447	T	0.33147	0.0853	L	0.43923	1.385	0.40223	D	0.977767	B	0.23806	0.091	B	0.29440	0.102	T	0.08911	-1.0699	10	0.06099	T	0.92	.	13.3918	0.60829	0.0:0.1713:0.8287:0.0	.	2763	C9JXH6	.	K	2763	ENSP00000401514:E2763K	ENSP00000401514:E2763K	E	+	1	0	DNAH1	52393052	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	5.649000	0.67936	2.111000	0.64477	0.561000	0.74099	GAA	DNAH1	-	NULL	ENSG00000114841		0.567	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	34	0.00	0	G	NM_015512		52418012	52418012	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	missense	36	16.28	7	SNP	0.990	A
DNAH11	8701	genome.wustl.edu	37	7	21934280	21934280	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:21934280G>A	ENST00000409508.3	+	78	12821	c.12790G>A	c.(12790-12792)Gaa>Aaa	p.E4264K	DNAH11_ENST00000328843.6_Missense_Mutation_p.E4271K	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	4271					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GAAACTTCCAGAAGAGTTCAA	0.353									Kartagener syndrome																													dbGAP											0													115.0	113.0	114.0					7																	21934280		1831	4087	5918	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.12790G>A	7.37:g.21934280G>A	ENSP00000475939:p.Glu4264Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E4271K	ENST00000409508.3	37	c.12811		7	.	.	.	.	.	.	.	.	.	.	G	29.3	4.990979	0.93106	.	.	ENSG00000105877	ENST00000328843	T	0.08102	3.13	5.59	5.59	0.84812	Dynein heavy chain (1);	0.043430	0.85682	D	0.000000	T	0.28863	0.0716	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00361	-1.1789	9	0.30078	T	0.28	.	19.5911	0.95511	0.0:0.0:1.0:0.0	.	4271	Q96DT5	DYH11_HUMAN	K	4271	ENSP00000330671:E4271K	ENSP00000330671:E4271K	E	+	1	0	DNAH11	21900805	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.747000	0.68689	2.643000	0.89663	0.650000	0.86243	GAA	DNAH11	-	pfam_Dynein_heavy	ENSG00000105877		0.353	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	42	0.00	0	G	NM_003777		21934280	21934280	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	37	42.19	27	SNP	1.000	A
DOCK4	9732	genome.wustl.edu	37	7	111584876	111584876	+	Missense_Mutation	SNP	A	A	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:111584876A>C	ENST00000437633.1	-	10	1090	c.834T>G	c.(832-834)atT>atG	p.I278M	DOCK4_ENST00000476846.1_5'UTR|DOCK4_ENST00000428084.1_Missense_Mutation_p.I278M	NM_014705.3	NP_055520.3	Q8N1I0	DOCK4_HUMAN	dedicator of cytokinesis 4	278					cell chemotaxis (GO:0060326)|positive regulation of Rac GTPase activity (GO:0032855)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|stereocilium (GO:0032420)|stereocilium bundle (GO:0032421)	guanyl-nucleotide exchange factor activity (GO:0005085)|PDZ domain binding (GO:0030165)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|receptor tyrosine kinase binding (GO:0030971)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(13)|lung(31)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(4)	72		Acute lymphoblastic leukemia(1;0.0441)				CGATTCGGATAATGTGCACGG	0.418																																						dbGAP											0													133.0	127.0	129.0					7																	111584876		1913	4124	6037	-	-	-	SO:0001583	missense	0				CCDS47688.1	7q31.1	2007-08-07			ENSG00000128512	ENSG00000128512			19192	protein-coding gene	gene with protein product		607679				12432077, 12628187	Standard	XM_006716188		Approved	FLJ34238, KIAA0716	uc003vfx.3	Q8N1I0	OTTHUMG00000155077	ENST00000437633.1:c.834T>G	7.37:g.111584876A>C	ENSP00000404179:p.Ile278Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O14584|O94824|Q8NB45	Nonsense_Mutation	SNP	pfam_DOCK,superfamily_SH3_domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_SH3_domain,pfscan_SH3_domain	p.L266*	ENST00000437633.1	37	c.797	CCDS47688.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	19.20|19.20	3.780850|3.780850	0.70222|0.70222	.|.	.|.	ENSG00000128512|ENSG00000128512	ENST00000352877;ENST00000428084;ENST00000437633;ENST00000342288;ENST00000544250|ENST00000445943	T;T|.	0.04406|.	3.63;3.64|.	5.72|5.72	1.91|1.91	0.25777|0.25777	.|.	0.048291|.	0.85682|.	D|.	0.000000|.	T|.	0.61924|.	0.2386|.	M|M	0.75085|0.75085	2.285|2.285	0.80722|0.80722	D|D	1|1	D;P;P|.	0.56968|.	0.978;0.955;0.955|.	P;P;P|.	0.55871|.	0.786;0.635;0.635|.	T|.	0.57579|.	-0.7787|.	10|.	0.87932|.	D|.	0|.	.|.	5.1186|5.1186	0.14849|0.14849	0.6639:0.0:0.2137:0.1224|0.6639:0.0:0.2137:0.1224	.|.	278;278;278|.	A4D0S8;Q149N5;Q8N1I0|.	.;.;DOCK4_HUMAN|.	M|X	266;278;278;266;277|266	ENSP00000410746:I278M;ENSP00000404179:I278M|.	ENSP00000345432:I266M|.	I|L	-|-	3|2	3|0	DOCK4|DOCK4	111372112|111372112	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	0.551000|0.551000	0.23361|0.23361	0.482000|0.482000	0.27582|0.27582	0.528000|0.528000	0.53228|0.53228	ATT|TTA	DOCK4	-	NULL	ENSG00000128512		0.418	DOCK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK4	HGNC	protein_coding	OTTHUMT00000338369.4	58	0.00	0	A	NM_014705		111584876	111584876	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000445943	ensembl	human	novel	69_37n	nonsense	120	18.37	27	SNP	1.000	C
DPP3	10072	genome.wustl.edu	37	11	66276616	66276616	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr11:66276616G>A	ENST00000360510.2	+	18	2173	c.2108G>A	c.(2107-2109)cGt>cAt	p.R703H	DPP3_ENST00000531863.1_Missense_Mutation_p.R723H|BBS1_ENST00000393994.2_5'Flank|DPP3_ENST00000453114.1_Missense_Mutation_p.R703H|CTD-3074O7.11_ENST00000419755.3_5'UTR|BBS1_ENST00000455748.2_5'Flank|DPP3_ENST00000532677.1_Missense_Mutation_p.R722H|BBS1_ENST00000318312.7_5'Flank|DPP3_ENST00000541961.1_Missense_Mutation_p.R703H|BBS1_ENST00000537537.1_5'Flank|DPP3_ENST00000530165.1_Missense_Mutation_p.R673H			Q9NY33	DPP3_HUMAN	dipeptidyl-peptidase 3	703					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|skin(2)|stomach(1)	23						TTCTCTGAGCGTTTCCCAGAG	0.597																																						dbGAP											0													68.0	63.0	64.0					11																	66276616		2200	4295	6495	-	-	-	SO:0001583	missense	0			AB017970	CCDS8141.1, CCDS58147.1	11q12-q13.1	2008-02-05	2006-01-12		ENSG00000254986	ENSG00000254986	3.4.14.4		3008	protein-coding gene	gene with protein product		606818	"""dipeptidylpeptidase III"", ""dipeptidylpeptidase 3"""			10773679	Standard	NM_005700		Approved		uc001oif.2	Q9NY33	OTTHUMG00000167143	ENST00000360510.2:c.2108G>A	11.37:g.66276616G>A	ENSP00000353701:p.Arg703His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDB5|B4DLX4|F5H8L6|O95748|Q969H2|Q9BV67|Q9HAL6	Missense_Mutation	SNP	pirsf_Pept_49_dipeptidyl-pept-3_euk	p.R703H	ENST00000360510.2	37	c.2108	CCDS8141.1	11	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082736	0.76528	.	.	ENSG00000254986	ENST00000531863;ENST00000532677;ENST00000360510;ENST00000453114;ENST00000541961;ENST00000530165;ENST00000543807;ENST00000347422	T;T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56;1.56	5.09	4.18	0.49190	.	0.000000	0.85682	D	0.000000	T	0.54822	0.1882	M	0.84585	2.705	0.49483	D	0.999799	D;D	0.89917	1.0;0.982	D;D	0.83275	0.996;0.93	T	0.55457	-0.8138	10	0.29301	T	0.29	.	9.814	0.40840	0.0948:0.0:0.9052:0.0	.	722;703	G3V1D3;Q9NY33	.;DPP3_HUMAN	H	723;722;703;703;703;673;601;283	ENSP00000432782:R723H;ENSP00000435284:R722H;ENSP00000353701:R703H;ENSP00000389943:R703H;ENSP00000440502:R703H;ENSP00000436941:R673H	ENSP00000309957:R283H	R	+	2	0	DPP3	66033192	1.000000	0.71417	0.997000	0.53966	0.652000	0.38707	6.044000	0.71012	1.175000	0.42826	-0.222000	0.12452	CGT	DPP3	-	pirsf_Pept_49_dipeptidyl-pept-3_euk	ENSG00000254986		0.597	DPP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP3	HGNC	protein_coding	OTTHUMT00000393424.2	28	0.00	0	G			66276616	66276616	+1	no_errors	ENST00000360510	ensembl	human	known	69_37n	missense	18	55.00	22	SNP	1.000	A
EFTUD1P1	648809	genome.wustl.edu	37	15	84748967	84748967	+	RNA	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr15:84748967G>C	ENST00000558187.1	+	0	48									elongation factor Tu GTP binding domain containing 1 pseudogene 1																		GGCGCCGTAAGAGAAGCGTCC	0.677																																						dbGAP											0																																										-	-	-			0					15q25.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000259404	ENSG00000259404			31739	pseudogene	pseudogene	"""similar to hypothetical protein FLJ13119"""		"""family with sequence similarity 42, member B"""	FAM42B			Standard	NR_036652		Approved	HsT19321	uc021stg.1		OTTHUMG00000172493		15.37:g.84748967G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000558187.1	37	NULL		15																																																																																			EFTUD1P1	-	-	ENSG00000259404		0.677	EFTUD1P1-001	KNOWN	basic	processed_transcript	EFTUD1P1	HGNC	pseudogene	OTTHUMT00000418794.1	17	0.00	0	G	NR_036652		84748967	84748967	+1	no_errors	ENST00000558187	ensembl	human	known	69_37n	rna	13	50.00	13	SNP	0.009	C
EIF3A	8661	genome.wustl.edu	37	10	120802126	120802126	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr10:120802126C>G	ENST00000369144.3	-	19	3033	c.2906G>C	c.(2905-2907)aGa>aCa	p.R969T	EIF3A_ENST00000541549.1_Missense_Mutation_p.R935T	NM_003750.2	NP_003741.1	P56537	IF6_HUMAN	eukaryotic translation initiation factor 3, subunit A	0					mature ribosome assembly (GO:0042256)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal subunit export from nucleus (GO:0000054)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|lamin filament (GO:0005638)|nucleus (GO:0005634)	ribosomal large subunit binding (GO:0043023)|ribosome binding (GO:0043022)|translation initiation factor activity (GO:0003743)			endometrium(8)|kidney(4)|large_intestine(14)|lung(22)|prostate(1)|skin(4)|urinary_tract(3)	56		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0236)		AGGACCACGTCTAGGGCCTCT	0.597																																						dbGAP											0													116.0	113.0	114.0					10																	120802126		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78311	CCDS7608.1	10q26.11	2007-08-03	2007-07-27	2007-07-27	ENSG00000107581	ENSG00000107581			3271	protein-coding gene	gene with protein product		602039	"""eukaryotic translation initiation factor 3, subunit 10 theta, 150/170kDa"""	EIF3, EIF3S10		9054404, 8590280	Standard	NM_003750		Approved	eIF3-theta, eIF3-p170, KIAA0139, eIF3a, TIF32	uc001ldu.3	Q14152	OTTHUMG00000019144	ENST00000369144.3:c.2906G>C	10.37:g.120802126C>G	ENSP00000358140:p.Arg969Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBG9|Q6IBN8|Q96TD5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.R969T	ENST00000369144.3	37	c.2906	CCDS7608.1	10	.	.	.	.	.	.	.	.	.	.	C	24.7	4.558631	0.86231	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.24723	1.85;1.84	6.17	6.17	0.99709	.	0.000000	0.39146	N	0.001458	T	0.55178	0.1904	M	0.78801	2.425	0.32538	N	0.534105	D;D	0.76494	0.999;0.979	D;P	0.71414	0.973;0.628	T	0.58429	-0.7638	10	0.45353	T	0.12	-13.8271	20.8794	0.99867	0.0:1.0:0.0:0.0	.	935;969	F5H335;Q14152	.;EIF3A_HUMAN	T	969;935	ENSP00000358140:R969T;ENSP00000438178:R935T	ENSP00000358140:R969T	R	-	2	0	EIF3A	120792116	0.118000	0.22208	0.867000	0.34043	0.997000	0.91878	4.051000	0.57412	2.941000	0.99782	0.655000	0.94253	AGA	EIF3A	-	NULL	ENSG00000107581		0.597	EIF3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000050634.1	50	0.00	0	C	NM_003750		120802126	120802126	-1	no_errors	ENST00000369144	ensembl	human	known	69_37n	missense	20	69.70	46	SNP	0.308	G
EPHB1	2047	genome.wustl.edu	37	3	134670251	134670251	+	Silent	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:134670251C>G	ENST00000398015.3	+	3	532	c.162C>G	c.(160-162)acC>acG	p.T54T	EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	54	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						ACCTGAACACCATCCGCACCT	0.512																																						dbGAP											0													39.0	43.0	42.0					3																	134670251		2160	4282	6442	-	-	-	SO:0001819	synonymous_variant	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.162C>G	3.37:g.134670251C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.T54	ENST00000398015.3	37	c.162	CCDS46921.1	3																																																																																			EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000154928		0.512	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	36	0.00	0	C	NM_004441		134670251	134670251	+1	no_errors	ENST00000398015	ensembl	human	known	69_37n	silent	70	29.29	29	SNP	1.000	G
EPRS	2058	genome.wustl.edu	37	1	220152942	220152942	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:220152942G>C	ENST00000366923.3	-	27	3996	c.3727C>G	c.(3727-3729)Cat>Gat	p.H1243D		NM_004446.2	NP_004437.2	P07814	SYEP_HUMAN	glutamyl-prolyl-tRNA synthetase	1243	Proline--tRNA ligase.				cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|negative regulation of translation (GO:0017148)|prolyl-tRNA aminoacylation (GO:0006433)|protein complex assembly (GO:0006461)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|GAIT complex (GO:0097452)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|proline-tRNA ligase activity (GO:0004827)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(11)|kidney(2)|large_intestine(13)|lung(24)|ovary(1)|prostate(3)|skin(2)|stomach(2)|urinary_tract(3)	63				GBM - Glioblastoma multiforme(131;0.0735)	L-Proline(DB00172)	TGCCCTAAATGATGTGATGTT	0.343																																						dbGAP											0													78.0	81.0	80.0					1																	220152942		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54326	CCDS31027.1	1q41	2011-07-01			ENSG00000136628	ENSG00000136628	6.1.1.15, 6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"", ""Aminoacyl tRNA synthetases / Class II"""	3418	protein-coding gene	gene with protein product	"""glutamate tRNA ligase"", ""proline tRNA ligase"""	138295		QPRS, QARS		1988429	Standard	NM_004446		Approved	EARS, PARS, GLUPRORS	uc001hly.1	P07814	OTTHUMG00000037433	ENST00000366923.3:c.3727C>G	1.37:g.220152942G>C	ENSP00000355890:p.His1243Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVA9|B9EGH3|Q05BP6|Q05DF8|Q5DSM1|Q5H9S5|Q6PD57|Q86X73	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,pfam_WHEP-TRS,pfam_Glu/Gln-tRNA-synth_Ib_codon-bd,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Pro-tRNA_synth_II_C,pfam_Anticodon-bd,superfamily_Ribosomal_L25/Gln-tRNA_synth,superfamily_Anticodon-bd,superfamily_Pro-tRNA_synth_II,superfamily_S15_NS1_RNA-bd,superfamily_Glutathione-S-Trfase_C-like,smart_Pro-tRNA_synth_II_C,prints_Glu/Gln-tRNA-synth_Ib,prints_Pro-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,tigrfam_Pro-tRNA-synth_IIa_arc-type,tigrfam_Glu-tRNA-synth_Ib_arc/euk	p.H1243D	ENST00000366923.3	37	c.3727	CCDS31027.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.569051	0.86439	.	.	ENSG00000136628	ENST00000366923	T	0.28255	1.62	5.93	5.93	0.95920	Aminoacyl-tRNA synthetase, class II (1);	0.000000	0.85682	D	0.000000	T	0.65502	0.2697	M	0.89785	3.06	0.80722	D	1	D	0.71674	0.998	D	0.70487	0.969	T	0.70938	-0.4736	10	0.72032	D	0.01	-29.3948	20.3363	0.98740	0.0:0.0:1.0:0.0	.	1243	P07814	SYEP_HUMAN	D	1243	ENSP00000355890:H1243D	ENSP00000355890:H1243D	H	-	1	0	EPRS	218219565	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	9.476000	0.97823	2.814000	0.96858	0.563000	0.77884	CAT	EPRS	-	pfscan_aa-tRNA-synth_II,tigrfam_Pro-tRNA-synth_IIa_arc-type	ENSG00000136628		0.343	EPRS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPRS	HGNC	protein_coding	OTTHUMT00000091133.2	19	0.00	0	G	NM_004446		220152942	220152942	-1	no_errors	ENST00000366923	ensembl	human	known	69_37n	missense	25	35.90	14	SNP	1.000	C
FAM117B	150864	genome.wustl.edu	37	2	203589688	203589688	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:203589688C>G	ENST00000392238.2	+	3	802	c.802C>G	c.(802-804)Cac>Gac	p.H268D	FAM117B_ENST00000303116.6_Missense_Mutation_p.H24D			Q6P1L5	F117B_HUMAN	family with sequence similarity 117, member B	268										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)	17						GAAAGGGTCTCACAAGCGCTC	0.403																																						dbGAP											0													106.0	107.0	107.0					2																	203589688		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB053315	CCDS33362.1, CCDS33362.2	2q33	2008-08-18	2008-08-18	2008-08-18	ENSG00000138439	ENSG00000138439			14440	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 13"""	ALS2CR13		11586298	Standard	NM_173511		Approved	FLJ38771	uc010zhx.2	Q6P1L5	OTTHUMG00000154550	ENST00000392238.2:c.802C>G	2.37:g.203589688C>G	ENSP00000376071:p.His268Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QZ5|Q585T9|Q8N8W1|Q96Q34	Missense_Mutation	SNP	NULL	p.H268D	ENST00000392238.2	37	c.802	CCDS33362.2	2	.	.	.	.	.	.	.	.	.	.	C	26.0	4.695380	0.88830	.	.	ENSG00000138439	ENST00000303116;ENST00000392238	.	.	.	5.89	5.89	0.94794	.	0.141896	0.64402	D	0.000005	T	0.79305	0.4423	M	0.66297	2.02	0.58432	D	0.999997	D;D	0.76494	0.988;0.999	P;D	0.80764	0.871;0.994	T	0.79750	-0.1672	9	0.87932	D	0	-6.438	19.8459	0.96707	0.0:1.0:0.0:0.0	.	268;268	Q6P1L5;Q6P1L5-2	F117B_HUMAN;.	D	24;268	.	ENSP00000306299:H24D	H	+	1	0	FAM117B	203297933	1.000000	0.71417	0.998000	0.56505	0.897000	0.52465	6.610000	0.74178	2.788000	0.95919	0.585000	0.79938	CAC	FAM117B	-	NULL	ENSG00000138439		0.403	FAM117B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM117B	HGNC	protein_coding	OTTHUMT00000335888.3	73	0.00	0	C	NM_173511		203589688	203589688	+1	no_errors	ENST00000392238	ensembl	human	known	69_37n	missense	95	13.64	15	SNP	1.000	G
FANK1	92565	genome.wustl.edu	37	10	127585218	127585218	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr10:127585218C>A	ENST00000368693.1	+	1	111	c.7C>A	c.(7-9)Ccc>Acc	p.P3T	FANK1_ENST00000368695.1_5'UTR|FANK1_ENST00000449042.2_5'UTR			Q8TC84	FANK1_HUMAN	fibronectin type III and ankyrin repeat domains 1	3						cytoplasm (GO:0005737)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(10)|ovary(1)|urinary_tract(1)	21		all_lung(145;0.00752)|Lung NSC(174;0.0115)|Colorectal(57;0.0847)|all_neural(114;0.0936)				GACCATGGAGCCCCAGAGTAA	0.761																																						dbGAP											0													9.0	12.0	11.0					10																	127585218		2171	4258	6429	-	-	-	SO:0001583	missense	0			BC024189	CCDS31309.1	10q26.2	2013-02-11	2005-03-01		ENSG00000203780	ENSG00000203780		"""Ankyrin repeat domain containing"", ""Fibronectin type III domain containing"""	23527	protein-coding gene	gene with protein product		611640	"""fibronectin type 3 and ankyrin repeat domains 1"""			12477932	Standard	NM_145235		Approved		uc001ljh.4	Q8TC84	OTTHUMG00000019241	ENST00000368693.1:c.7C>A	10.37:g.127585218C>A	ENSP00000357682:p.Pro3Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXY9|Q6X7T6	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Fibronectin_type3,prints_Ankyrin_rpt	p.P3T	ENST00000368693.1	37	c.7	CCDS31309.1	10	.	.	.	.	.	.	.	.	.	.	C	10.21	1.288816	0.23478	.	.	ENSG00000203780	ENST00000368693	T	0.43688	0.94	2.62	2.62	0.31277	.	.	.	.	.	T	0.25195	0.0612	N	0.22421	0.69	0.80722	D	1	B;B	0.12013	0.003;0.005	B;B	0.12837	0.007;0.008	T	0.05835	-1.0861	9	0.18276	T	0.48	.	8.8836	0.35389	0.0:1.0:0.0:0.0	.	3;3	Q8TC84-3;Q8TC84	.;FANK1_HUMAN	T	3	ENSP00000357682:P3T	ENSP00000357682:P3T	P	+	1	0	FANK1	127575208	1.000000	0.71417	1.000000	0.80357	0.407000	0.30961	2.904000	0.48719	1.756000	0.51951	0.462000	0.41574	CCC	FANK1	-	NULL	ENSG00000203780		0.761	FANK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FANK1	HGNC	protein_coding		23	0.00	0	C	NM_145235		127585218	127585218	+1	no_errors	ENST00000368693	ensembl	human	known	69_37n	missense	28	15.15	5	SNP	1.000	A
MROH5	389690	genome.wustl.edu	37	8	142480722	142480722	+	RNA	SNP	T	T	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr8:142480722T>A	ENST00000430863.1	-	0	2227					NM_207414.2	NP_997297.2	Q6ZUA9	MROH5_HUMAN	maestro heat-like repeat family member 5																		GCTGCAGAGCTGGAAGATGTG	0.607																																						dbGAP											0													31.0	33.0	32.0					8																	142480722		1960	4146	6106	-	-	-			0					8q24.3	2012-12-20			ENSG00000226807	ENSG00000226807		"""maestro heat-like repeat containing"""	42976	protein-coding gene	gene with protein product							Standard	NM_207414		Approved	FLJ43860	uc003ywi.2	Q6ZUA9	OTTHUMG00000155944		8.37:g.142480722T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q716L	ENST00000430863.1	37	c.2147		8																																																																																			AC100803.1	-	NULL	ENSG00000226807		0.607	MROH5-001	KNOWN	non_canonical_polymorphism|basic	polymorphic_pseudogene	FLJ43860	Clone_based_vega_gene	polymorphic_pseudogene	OTTHUMT00000342412.4	34	0.00	0	T	NM_207414		142480722	142480722	-1	pseudogene	ENST00000430863	ensembl	human	known	69_37n	missense	24	74.19	69	SNP	0.004	A
FOXD4L3	286380	genome.wustl.edu	37	9	70918813	70918813	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr9:70918813C>G	ENST00000342833.2	+	1	1538	c.946C>G	c.(946-948)Cgc>Ggc	p.R316G		NM_199135.4	NP_954586.4	Q6VB84	FX4L3_HUMAN	forkhead box D4-like 3	316						nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			ovary(1)	1				all cancers(8;0.00136)|Epithelial(8;0.0288)|GBM - Glioblastoma multiforme(74;0.0402)|OV - Ovarian serous cystadenocarcinoma(323;0.18)		GGTCTGGCGTCGCCACCGGGA	0.647																																						dbGAP											0													2.0	1.0	1.0					9																	70918813		419	1255	1674	-	-	-	SO:0001583	missense	0			AY344642	CCDS43833.1	9q13	2008-05-13				ENSG00000187559			18523	protein-coding gene	gene with protein product		611086				12421752	Standard	NM_199135		Approved	OTTHUMG00000019959, FOXD6	uc004agm.1	Q6VB84	OTTHUMG00000019959	ENST00000342833.2:c.946C>G	9.37:g.70918813C>G	ENSP00000341961:p.Arg316Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTX9	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R316G	ENST00000342833.2	37	c.946	CCDS43833.1	9	.	.	.	.	.	.	.	.	.	.	.	10.98	1.504745	0.26949	.	.	ENSG00000187559	ENST00000342833	D	0.94613	-3.47	4.04	3.12	0.35913	.	30.252100	0.00691	U	0.000727	D	0.88887	0.6559	N	0.12182	0.205	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.78615	-0.2135	10	0.62326	D	0.03	.	5.839	0.18623	0.0:0.6901:0.2003:0.1097	.	316	Q6VB84	FX4L3_HUMAN	G	316	ENSP00000341961:R316G	ENSP00000341961:R316G	R	+	1	0	FOXD4L3	70108633	0.000000	0.05858	0.006000	0.13384	0.014000	0.08584	0.528000	0.23002	0.777000	0.33496	0.455000	0.32223	CGC	FOXD4L3	-	NULL	ENSG00000187559		0.647	FOXD4L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L3	HGNC	protein_coding	OTTHUMT00000052539.2	40	0.00	0	C	NM_199358		70918813	70918813	+1	no_errors	ENST00000342833	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	0.024	G
GOLGA8EP	390535	genome.wustl.edu	37	15	23445449	23445449	+	RNA	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr15:23445449G>A	ENST00000526079.1	+	0	2269				RN7SL106P_ENST00000488468.2_RNA|AC100757.1_ENST00000458911.1_RNA	NR_027407.1|NR_033350.1				golgin A8 family, member E, pseudogene																		TGGCTGCCAAGAAGAAGGAGA	0.463																																						dbGAP											0													65.0	73.0	70.0					15																	23445449		2128	4205	6333	-	-	-			0					15q11.2	2014-03-21	2012-10-05	2012-10-05	ENSG00000175676	ENSG00000175676			32377	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8E"", ""golgin A8 family, member E"""	GOLGA8E		12477932	Standard	NR_033350		Approved		uc001yvu.3		OTTHUMG00000167132		15.37:g.23445449G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000526079.1	37	NULL		15																																																																																			GOLGA8E	-	-	ENSG00000175676		0.463	GOLGA8EP-002	KNOWN	basic	processed_transcript	GOLGA8E	HGNC	pseudogene	OTTHUMT00000393312.1	138	0.00	0	G	NR_033350.1		23445449	23445449	+1	no_errors	ENST00000526079	ensembl	human	known	69_37n	rna	112	28.66	45	SNP	0.001	A
GOLGB1	2804	genome.wustl.edu	37	3	121415907	121415907	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:121415907G>A	ENST00000340645.5	-	13	3573	c.3448C>T	c.(3448-3450)Cct>Tct	p.P1150S	GOLGB1_ENST00000393667.3_Missense_Mutation_p.P1155S	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1150					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CCTGTACAAGGTGGACTTATC	0.418																																						dbGAP											0													157.0	146.0	150.0					3																	121415907		2203	4300	6503	-	-	-	SO:0001583	missense	0			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.3448C>T	3.37:g.121415907G>A	ENSP00000341848:p.Pro1150Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.P1150S	ENST00000340645.5	37	c.3448	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	G	0.087	-1.174256	0.01646	.	.	ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235	T;T;T	0.21734	2.59;2.59;1.99	5.9	0.722	0.18225	.	0.929610	0.09076	N	0.852145	T	0.16514	0.0397	L	0.39898	1.24	0.09310	N	1	B;B;B;B;B	0.31548	0.082;0.082;0.328;0.328;0.082	B;B;B;B;B	0.34242	0.085;0.085;0.124;0.178;0.058	T	0.33266	-0.9875	10	0.09084	T	0.74	.	9.7075	0.40225	0.0:0.4144:0.3854:0.2002	.	1075;1114;1155;1155;1150	F1T0J2;E7EU81;E7EP74;B2ZZ91;Q14789	.;.;.;.;GOGB1_HUMAN	S	1150;1155;1114;962	ENSP00000341848:P1150S;ENSP00000377275:P1155S;ENSP00000418231:P1114S	ENSP00000341848:P1150S	P	-	1	0	GOLGB1	122898597	0.000000	0.05858	0.039000	0.18376	0.024000	0.10985	0.002000	0.13061	0.099000	0.17552	-0.172000	0.13284	CCT	GOLGB1	-	superfamily_Prefoldin	ENSG00000173230		0.418	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	72	0.00	0	G	NM_004487		121415907	121415907	-1	no_errors	ENST00000340645	ensembl	human	known	69_37n	missense	169	27.78	65	SNP	0.028	A
GON4L	54856	genome.wustl.edu	37	1	155785925	155785925	+	Intron	SNP	T	T	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:155785925T>A	ENST00000368331.1	-	7	1114				GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000437809.1_Intron|GON4L_ENST00000271883.5_Intron|GON4L_ENST00000361040.5_Intron	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TCAAGAAAAGTTAAAGAGGAA	0.313																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.1065+77A>T	1.37:g.155785925T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	RNA	SNP	-	NULL	ENST00000368331.1	37	NULL		1																																																																																			GON4L	-	-	ENSG00000116580		0.313	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		39	0.00	0	T	NM_032292		155785925	155785925	-1	no_errors	ENST00000471341	ensembl	human	known	69_37n	rna	89	14.42	15	SNP	0.000	A
GPNMB	10457	genome.wustl.edu	37	7	23309658	23309658	+	Silent	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:23309658T>C	ENST00000381990.2	+	9	1490	c.1329T>C	c.(1327-1329)ccT>ccC	p.P443P	GPNMB_ENST00000258733.4_Silent_p.P431P|GPNMB_ENST00000453162.2_Silent_p.P385P|GPNMB_ENST00000539136.1_Silent_p.P332P	NM_001005340.1|NM_002510.2	NP_001005340.1|NP_002501.1	Q14956	GPNMB_HUMAN	glycoprotein (transmembrane) nmb	443					bone mineralization (GO:0030282)|cell adhesion (GO:0007155)|negative regulation of cell proliferation (GO:0008285)|osteoblast differentiation (GO:0001649)	cytoplasmic membrane-bounded vesicle (GO:0016023)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)			breast(5)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(2)|lung(17)|ovary(3)|stomach(2)	41			GBM - Glioblastoma multiforme(13;0.154)			TCTGCAGCCCTGTGGATGTGG	0.587																																						dbGAP											0													185.0	148.0	161.0					7																	23309658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X76534	CCDS5380.1, CCDS34610.1	7p	2008-07-18			ENSG00000136235	ENSG00000136235			4462	protein-coding gene	gene with protein product	"""transmembrane glycoprotein"", ""glycoprotein NMB"", ""glycoprotein nmb-like protein"", ""osteoactivin"""	604368				7814155	Standard	NM_002510		Approved	NMB, HGFIN	uc003swc.3	Q14956	OTTHUMG00000022811	ENST00000381990.2:c.1329T>C	7.37:g.23309658T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D155|Q6UVX1|Q8N1A1	Silent	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.P443	ENST00000381990.2	37	c.1329	CCDS34610.1	7																																																																																			GPNMB	-	NULL	ENSG00000136235		0.587	GPNMB-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPNMB	HGNC	protein_coding	OTTHUMT00000327152.1	81	0.00	0	T	NM_001005340		23309658	23309658	+1	no_errors	ENST00000381990	ensembl	human	known	69_37n	silent	170	32.54	82	SNP	0.001	C
GRAP2	9402	genome.wustl.edu	37	22	40364072	40364072	+	Silent	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr22:40364072G>C	ENST00000344138.4	+	6	749	c.486G>C	c.(484-486)cgG>cgC	p.R162R	GRAP2_ENST00000544756.1_Silent_p.R90R|GRAP2_ENST00000543252.1_Silent_p.R122R|GRAP2_ENST00000399090.2_Silent_p.R49R|GRAP2_ENST00000540310.1_Silent_p.R96R|GRAP2_ENST00000407075.3_Silent_p.R162R	NM_004810.2	NP_004801.1	O75791	GRAP2_HUMAN	GRB2-related adaptor protein 2	162					cell-cell signaling (GO:0007267)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|positive regulation of signal transduction (GO:0009967)|Ras protein signal transduction (GO:0007265)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	14						GCCTGGACCGGAGGTCCCAGG	0.632																																						dbGAP											0													25.0	24.0	24.0					22																	40364072		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF102694	CCDS13999.1	22q13.2	2013-02-14			ENSG00000100351	ENSG00000100351		"""SH2 domain containing"""	4563	protein-coding gene	gene with protein product		604518				9878555, 10224278	Standard	XM_005261836		Approved	Grf40, GrbX, GRBLG, GADS, Mona	uc003ayh.2	O75791	OTTHUMG00000151097	ENST00000344138.4:c.486G>C	22.37:g.40364072G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8I3|O43726|Q9NRB7	Silent	SNP	pfam_SH3_domain,pfam_SH2,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.R162	ENST00000344138.4	37	c.486	CCDS13999.1	22																																																																																			GRAP2	-	NULL	ENSG00000100351		0.632	GRAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRAP2	HGNC	protein_coding	OTTHUMT00000321295.1	23	0.00	0	G	NM_004810		40364072	40364072	+1	no_errors	ENST00000344138	ensembl	human	known	69_37n	silent	22	29.03	9	SNP	0.832	C
H19	283120	genome.wustl.edu	37	11	2018317	2018317	+	RNA	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr11:2018317C>G	ENST00000390168.4	-	0	0					NR_030533.1				H19, imprinted maternally expressed transcript (non-protein coding)																		GGGGACCCCTCTGTCCTGTGT	0.667									Beckwith-Wiedemann syndrome		OREG0003761|OREG0003763	type=REGULATORY REGION|Gene=AF118081|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay|type=REGULATORY REGION|Gene=H19|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0																																										-	-	-			0	Familial Cancer Database	BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AF087017		11p15.5	2012-10-19	2008-06-04		ENSG00000130600	ENSG00000130600		"""Long non-coding RNAs"", ""-"""	4713	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 8"", ""long intergenic non-protein coding RNA 8"""	103280	"""H19, imprinted maternally expressed untranslated mRNA"""			2595451, 1688465	Standard	NR_002196		Approved	D11S813E, ASM, ASM1, NCRNA00008, LINC00008	uc021qby.1		OTTHUMG00000012477		11.37:g.2018317C>G		Somatic	600	WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000390168.4	37	NULL		11																																																																																			H19	-	-	ENSG00000130600		0.667	H19-201	KNOWN	basic	miRNA	H19	HGNC	processed_transcript		81	0.00	0	C	NR_002196		2018317	2018317	-1	no_errors	ENST00000411754	ensembl	human	known	69_37n	rna	66	40.00	44	SNP	0.000	G
HBEGF	1839	genome.wustl.edu	37	5	139722294	139722294	+	Silent	SNP	A	A	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr5:139722294A>G	ENST00000230990.6	-	3	626	c.324T>C	c.(322-324)tgT>tgC	p.C108C	HBEGF_ENST00000507104.1_Silent_p.C108C	NM_001945.2	NP_001936.1	Q99075	HBEGF_HUMAN	heparin-binding EGF-like growth factor	108	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.				epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|muscle organ development (GO:0007517)|negative regulation of elastin biosynthetic process (GO:0051545)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of wound healing (GO:0090303)|regulation of heart contraction (GO:0008016)|signal transduction (GO:0007165)|wound healing, spreading of epidermal cells (GO:0035313)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)			breast(1)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)	7			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTCCGAAGACATGGGTCCC	0.527																																						dbGAP											0													378.0	380.0	379.0					5																	139722294		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4223.1	5q23	2012-10-02	2005-01-14	2005-01-14	ENSG00000113070	ENSG00000113070			3059	protein-coding gene	gene with protein product	"""Diphtheria toxin receptor (heparin-binding EGF-like growth factor)"", ""heparin-binding epidermal growth factor"""	126150	"""diphtheria toxin receptor (heparin-binding epidermal growth factor-like growth factor)"""	HEGFL, DTS, DTR		7590736, 12163414	Standard	NM_001945		Approved		uc003lfi.3	Q99075	OTTHUMG00000129496	ENST00000230990.6:c.324T>C	5.37:g.139722294A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R821	Silent	SNP	pfscan_EG-like_dom	p.C108	ENST00000230990.6	37	c.324	CCDS4223.1	5																																																																																			HBEGF	-	pfscan_EG-like_dom	ENSG00000113070		0.527	HBEGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBEGF	HGNC	protein_coding	OTTHUMT00000251665.2	78	0.00	0	A	NM_001945		139722294	139722294	-1	no_errors	ENST00000230990	ensembl	human	known	69_37n	silent	97	30.22	42	SNP	1.000	G
HDHD3	81932	genome.wustl.edu	37	9	116136803	116136803	+	5'UTR	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr9:116136803C>G	ENST00000238379.5	-	0	729				HDHD3_ENST00000374180.3_5'UTR|HDHD3_ENST00000485934.1_5'UTR	NM_031219.2	NP_112496.1	Q9BSH5	HDHD3_HUMAN	haloacid dehalogenase-like hydrolase domain containing 3							mitochondrion (GO:0005739)	hydrolase activity (GO:0016787)			large_intestine(2)|liver(1)	3						CTTCACAGCACAAGATCCTAG	0.483																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			AK097067	CCDS6793.1	9q33.1	2006-04-12	2004-08-09	2004-08-12	ENSG00000119431	ENSG00000119431			28171	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 158"""	C9orf158		12477932	Standard	NM_031219		Approved	MGC12904	uc004bhi.1	Q9BSH5	OTTHUMG00000020524	ENST00000238379.5:c.-169G>C	9.37:g.116136803C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD47	RNA	SNP	-	NULL	ENST00000238379.5	37	NULL	CCDS6793.1	9																																																																																			HDHD3	-	-	ENSG00000119431		0.483	HDHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDHD3	HGNC	protein_coding	OTTHUMT00000053731.1	19	0.00	0	C	NM_031219		116136803	116136803	-1	no_errors	ENST00000485934	ensembl	human	known	69_37n	rna	9	72.22	26	SNP	0.940	G
HERC2	8924	genome.wustl.edu	37	15	28501072	28501072	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr15:28501072C>T	ENST00000261609.7	-	19	2925	c.2817G>A	c.(2815-2817)atG>atA	p.M939I		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CTCCATCAGCCATCAAGCTGC	0.493																																						dbGAP											0													104.0	101.0	102.0					15																	28501072		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.2817G>A	15.37:g.28501072C>T	ENSP00000261609:p.Met939Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.M939I	ENST00000261609.7	37	c.2817	CCDS10021.1	15	.	.	.	.	.	.	.	.	.	.	C	18.38	3.612337	0.66672	.	.	ENSG00000128731	ENST00000261609	T	0.42900	0.96	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.52629	0.1746	M	0.72894	2.215	0.80722	D	1	P	0.35872	0.525	B	0.42214	0.38	T	0.54840	-0.8233	10	0.49607	T	0.09	.	19.0185	0.92903	0.0:1.0:0.0:0.0	.	939	O95714	HERC2_HUMAN	I	939	ENSP00000261609:M939I	ENSP00000261609:M939I	M	-	3	0	HERC2	26174667	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.770000	0.85390	2.500000	0.84329	0.539000	0.68188	ATG	HERC2	-	NULL	ENSG00000128731		0.493	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	82	0.00	0	C	NM_004667		28501072	28501072	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	missense	79	39.23	51	SNP	1.000	T
HEXIM1	10614	genome.wustl.edu	37	17	43227266	43227269	+	Frame_Shift_Del	DEL	AGCG	AGCG	-			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	AGCG	AGCG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:43227266_43227269delAGCG	ENST00000332499.2	+	1	2583_2586	c.709_712delAGCG	c.(709-714)agcgatfs	p.SD237fs	AC002117.1_ENST00000589950.1_RNA|AC002117.1_ENST00000452741.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	237	Autoinhibitory acidic region; in absence of 7SK snRNA interacts with the basic region preventing interaction with P-TEFb and modulating subcellular localization.				heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CGACGACACCAGCGATGACGACTT	0.608																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.709_712delAGCG	17.37:g.43227266_43227269delAGCG	ENSP00000328773:p.Ser237fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8Y5	Frame_Shift_Del	DEL	NULL	p.S237fs	ENST00000332499.2	37	c.709_712	CCDS11495.1	17																																																																																			HEXIM1	-	NULL	ENSG00000186834		0.608	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEXIM1	HGNC	protein_coding	OTTHUMT00000449821.2	32	0.00	0	AGCG	NM_006460		43227266	43227269	+1	no_errors	ENST00000332499	ensembl	human	known	69_37n	frame_shift_del	30	31.82	14	DEL	1.000:1.000:1.000:1.000	-
HIST1H2BD	3017	genome.wustl.edu	37	6	26158626	26158626	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:26158626G>C	ENST00000289316.2	+	1	253	c.229G>C	c.(229-231)Gag>Cag	p.E77Q	HIST1H2BD_ENST00000377777.4_Missense_Mutation_p.E77Q	NM_138720.2	NP_619790.1	P58876	H2B1D_HUMAN	histone cluster 1, H2bd	77					chromatin organization (GO:0006325)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E77K(2)|p.E77Q(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	24						CATCGCAGGCGAGGCTTCCCG	0.612																																						dbGAP											3	Substitution - Missense(3)	cervix(1)|lung(1)|breast(1)											141.0	138.0	139.0					6																	26158626		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60751	CCDS4587.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000158373	ENSG00000158373		"""Histones / Replication-dependent"""	4747	protein-coding gene	gene with protein product		602799	"""H2B histone family, member B"", ""histone 1, H2bd"""	H2BFB		1916825, 12408966	Standard	NM_021063		Approved	H2B/b	uc003ngr.3	P58876	OTTHUMG00000014426	ENST00000289316.2:c.229G>C	6.37:g.26158626G>C	ENSP00000289316:p.Glu77Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E77Q	ENST00000289316.2	37	c.229	CCDS4587.1	6	.	.	.	.	.	.	.	.	.	.	.	17.97	3.517666	0.64634	.	.	ENSG00000158373	ENST00000377777;ENST00000289316	T;T	0.36340	1.26;1.26	4.88	4.88	0.63580	Histone-fold (2);Histone core (1);	0.000000	0.42053	D	0.000772	T	0.62011	0.2393	H	0.98089	4.145	0.33785	D	0.624739	D	0.63880	0.993	P	0.62014	0.897	T	0.74833	-0.3530	10	0.87932	D	0	.	8.8585	0.35242	0.0815:0.0:0.7663:0.1522	.	77	P58876	H2B1D_HUMAN	Q	77	ENSP00000367008:E77Q;ENSP00000289316:E77Q	ENSP00000289316:E77Q	E	+	1	0	HIST1H2BD	26266605	1.000000	0.71417	0.972000	0.41901	0.251000	0.25915	5.677000	0.68142	2.657000	0.90304	0.650000	0.86243	GAG	HIST1H2BD	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000158373		0.612	HIST1H2BD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BD	HGNC	protein_coding	OTTHUMT00000040088.1	92	0.00	0	G	NM_021063		26158626	26158626	+1	no_errors	ENST00000289316	ensembl	human	known	69_37n	missense	66	69.44	150	SNP	0.976	C
HIST1H2BG	8339	genome.wustl.edu	37	6	26216532	26216532	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:26216532C>T	ENST00000244601.3	-	1	340	c.340G>A	c.(340-342)Gaa>Aaa	p.E114K	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	114					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				TTGGTACCTTCGGACACTGCG	0.532																																						dbGAP											0													97.0	97.0	97.0					6																	26216532		2203	4300	6503	-	-	-	SO:0001583	missense	0			M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.340G>A	6.37:g.26216532C>T	ENSP00000244601:p.Glu114Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E114K	ENST00000244601.3	37	c.340	CCDS4594.1	6	.	.	.	.	.	.	.	.	.	.	.	14.58	2.576653	0.45902	.	.	ENSG00000187990	ENST00000244601	T	0.48201	0.82	3.89	3.89	0.44902	.	0.000000	0.33457	U	0.004887	T	0.52224	0.1721	.	.	.	0.40452	D	0.980158	.	.	.	.	.	.	T	0.56878	-0.7906	7	0.52906	T	0.07	.	15.3699	0.74554	0.0:1.0:0.0:0.0	.	.	.	.	K	114	ENSP00000244601:E114K	ENSP00000244601:E114K	E	-	1	0	HIST1H2BG	26324511	1.000000	0.71417	0.999000	0.59377	0.102000	0.19082	7.499000	0.81566	2.172000	0.68678	0.561000	0.74099	GAA	HIST1H2BG	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000187990		0.532	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BG	HGNC	protein_coding	OTTHUMT00000040109.2	63	0.00	0	C	NM_003518		26216532	26216532	-1	no_errors	ENST00000244601	ensembl	human	known	69_37n	missense	72	30.77	32	SNP	1.000	T
HLA-DQB1	3119	genome.wustl.edu	37	6	32634373	32634373	+	Silent	SNP	C	C	T	rs9274522	byFrequency	TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:32634373C>T	ENST00000399082.3	-	1	56	c.12G>A	c.(10-12)aaG>aaA	p.K4K	HLA-DQB1_ENST00000399079.3_Silent_p.K4K|HLA-DQB1_ENST00000399084.1_Silent_p.K4K|HLA-DQB1_ENST00000434651.2_Silent_p.K4K|HLA-DQB1_ENST00000374943.4_Silent_p.K4K			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	4					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	GCAAAGCCTTCTTCCAAGACA	0.532									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				c|||	1621	0.323682	0.3722	0.3458	5008	,	,		14244	0.2381		0.3608	False		,,,				2504	0.2924				Esophageal Squamous(151;720 1825 15000 40336 43415)	dbGAP											0													39.0	38.0	38.0					6																	32634373		1927	4107	6034	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.12G>A	6.37:g.32634373C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Silent	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.K4	ENST00000399082.3	37	c.12		6																																																																																			HLA-DQB1	-	NULL	ENSG00000179344		0.532	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	HLA-DQB1	HGNC	protein_coding	OTTHUMT00000276131.1	29	0.00	0	C	NM_002123		32634373	32634373	-1	no_errors	ENST00000374943	ensembl	human	known	69_37n	silent	28	25.64	10	SNP	0.001	T
HNRNPA2B1	3181	genome.wustl.edu	37	7	26233203	26233203	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:26233203T>C	ENST00000354667.4	-	9	1037	c.869A>G	c.(868-870)tAt>tGt	p.Y290C	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.Y278C|HNRNPA2B1_ENST00000476233.1_5'Flank	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	290	Gly-rich.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)		HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						ACCTCCTCCATAGTTGTCATA	0.468			T	ETV1	prostate																																	dbGAP		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	0													127.0	123.0	124.0					7																	26233203		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.869A>G	7.37:g.26233203T>C	ENSP00000346694:p.Tyr290Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNPA1,smart_RRM_dom,pfscan_RRM_dom	p.Y290C	ENST00000354667.4	37	c.869	CCDS43557.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	12.39|12.39	1.924091|1.924091	0.34002|0.34002	.|.	.|.	ENSG00000122566|ENSG00000122566	ENST00000409814|ENST00000354667;ENST00000356674	.|D;D	.|0.86769	.|-2.17;-2.17	6.07|6.07	4.91|4.91	0.64330|0.64330	.|.	.|0.000000	.|0.64402	.|D	.|0.000008	D|D	0.87200|0.87200	0.6118|0.6118	M|M	0.62723|0.62723	1.935|1.935	0.39778|0.39778	D|D	0.972268|0.972268	.|P;P	.|0.48640	.|0.913;0.859	.|P;B	.|0.47162	.|0.54;0.339	D|D	0.86181|0.86181	0.1606|0.1606	6|10	0.87932|0.38643	D|T	0|0.18	.|.	12.4135|12.4135	0.55480|0.55480	0.1262:0.0:0.0:0.8738|0.1262:0.0:0.0:0.8738	.|.	.|278;290	.|P22626-2;P22626	.|.;ROA2_HUMAN	V|C	224|290;278	.|ENSP00000346694:Y290C;ENSP00000349101:Y278C	ENSP00000386735:M224V|ENSP00000346694:Y290C	M|Y	-|-	1|2	0|0	HNRNPA2B1|HNRNPA2B1	26199728|26199728	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.609000|0.609000	0.37215|0.37215	7.513000|7.513000	0.81739|0.81739	1.093000|1.093000	0.41377|0.41377	-0.333000|-0.333000	0.08304|0.08304	ATG|TAT	HNRNPA2B1	-	NULL	ENSG00000122566		0.468	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	HNRNPA2B1	HGNC	protein_coding	OTTHUMT00000214109.1	66	0.00	0	T	NM_002137		26233203	26233203	-1	no_errors	ENST00000354667	ensembl	human	known	69_37n	missense	72	43.75	56	SNP	1.000	C
HRNR	388697	genome.wustl.edu	37	1	152188940	152188940	+	Missense_Mutation	SNP	A	A	G	rs34655925	byFrequency	TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:152188940A>G	ENST00000368801.2	-	3	5240	c.5165T>C	c.(5164-5166)tTg>tCg	p.L1722S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1722					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GGAGTGCCCCAAACCGGACCC	0.632																																						dbGAP											0													5.0	3.0	4.0					1																	152188940		1101	2289	3390	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5165T>C	1.37:g.152188940A>G	ENSP00000357791:p.Leu1722Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.L1722S	ENST00000368801.2	37	c.5165	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	G	5.020	0.189336	0.09547	.	.	ENSG00000197915	ENST00000368801	T	0.01516	4.81	3.03	1.03	0.20045	.	.	.	.	.	T	0.00241	0.0007	N	0.02802	-0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31888	-0.9927	9	0.14656	T	0.56	.	2.8532	0.05564	0.3579:0.0:0.4426:0.1995	.	1722	Q86YZ3	HORN_HUMAN	S	1722	ENSP00000357791:L1722S	ENSP00000357791:L1722S	L	-	2	0	HRNR	150455564	0.635000	0.27199	0.000000	0.03702	0.003000	0.03518	0.914000	0.28624	-0.136000	0.11475	-0.171000	0.13296	TTG	HRNR	-	NULL	ENSG00000197915		0.632	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	18	0.00	0	A	XM_373868		152188940	152188940	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.000	G
HYDIN	54768	genome.wustl.edu	37	16	70871623	70871623	+	Silent	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr16:70871623G>C	ENST00000393567.2	-	77	13362	c.13212C>G	c.(13210-13212)gtC>gtG	p.V4404V		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4404					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				CTTTGATTTCGACTGTTTGTT	0.448																																						dbGAP											0													95.0	95.0	95.0					16																	70871623		1871	4102	5973	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.13212C>G	16.37:g.70871623G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like	p.V4403	ENST00000393567.2	37	c.13209	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.448	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	112	0.00	0	G			70871623	70871623	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	silent	40	63.30	69	SNP	0.793	C
IFNK	56832	genome.wustl.edu	37	9	27524613	27524613	+	Silent	SNP	G	G	A	rs534467297		TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr9:27524613G>A	ENST00000276943.2	+	1	302	c.279G>A	c.(277-279)caG>caA	p.Q93Q	MOB3B_ENST00000262244.5_Intron	NM_020124.2	NP_064509.2	Q9P0W0	IFNK_HUMAN	interferon, kappa	93					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation (GO:0030101)|natural killer cell activation involved in immune response (GO:0002323)|negative regulation of cell proliferation (GO:0008285)|positive regulation of innate immune response (GO:0045089)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of transcription, DNA-templated (GO:0006355)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|T cell activation involved in immune response (GO:0002286)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			large_intestine(1)	1		all_neural(11;7.9e-11)		LUSC - Lung squamous cell carcinoma(38;0.0001)|Lung(218;0.000158)		TGTCCCTACAGGCCTTCAACA	0.433													G|||	1	0.000199681	0.0008	0.0	5008	,	,		19607	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													116.0	123.0	121.0					9																	27524613		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF384048	CCDS6521.1	9p21.2	2008-02-05			ENSG00000147896	ENSG00000147896		"""Interferons"""	21714	protein-coding gene	gene with protein product		615326				12391192, 11514542	Standard	NM_020124		Approved		uc003zqp.3	Q9P0W0	OTTHUMG00000019715	ENST00000276943.2:c.279G>A	9.37:g.27524613G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T166	Silent	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.Q93	ENST00000276943.2	37	c.279	CCDS6521.1	9																																																																																			IFNK	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000147896		0.433	IFNK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNK	HGNC	protein_coding	OTTHUMT00000051968.1	24	0.00	0	G	NM_020124		27524613	27524613	+1	no_errors	ENST00000276943	ensembl	human	known	69_37n	silent	77	17.20	16	SNP	0.000	A
IGFALS	3483	genome.wustl.edu	37	16	1841132	1841132	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr16:1841132G>C	ENST00000215539.3	-	2	1397	c.1287C>G	c.(1285-1287)agC>agG	p.S429R	IGFALS_ENST00000415638.3_Missense_Mutation_p.S467R			P35858	ALS_HUMAN	insulin-like growth factor binding protein, acid labile subunit	429					cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin-like growth factor binding (GO:0005520)			endometrium(2)|lung(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	8						GCCCCCACAGGCTCTGCTCCT	0.687																																						dbGAP											0													16.0	20.0	19.0					16																	1841132		2184	4287	6471	-	-	-	SO:0001583	missense	0			M86826	CCDS10446.1, CCDS53982.1	16p13.3	2008-07-28			ENSG00000099769	ENSG00000099769			5468	protein-coding gene	gene with protein product		601489				1379671, 16114275	Standard	NM_004970		Approved	ALS	uc010uvn.2	P35858	OTTHUMG00000128638	ENST00000215539.3:c.1287C>G	16.37:g.1841132G>C	ENSP00000215539:p.Ser429Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZY8|E9PGU3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S467R	ENST00000215539.3	37	c.1401	CCDS10446.1	16	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456464	0.26161	.	.	ENSG00000099769	ENST00000215539;ENST00000415638	T;T	0.26810	1.71;1.71	4.68	2.67	0.31697	.	0.045500	0.85682	D	0.000000	T	0.37785	0.1016	L	0.56340	1.77	0.80722	D	1	D;D	0.62365	0.987;0.991	P;D	0.64877	0.908;0.93	T	0.06716	-1.0811	10	0.38643	T	0.18	.	8.0065	0.30327	0.2652:0.0:0.7348:0.0	.	467;429	E9PGU3;P35858	.;ALS_HUMAN	R	429;467	ENSP00000215539:S429R;ENSP00000416683:S467R	ENSP00000215539:S429R	S	-	3	2	IGFALS	1781133	1.000000	0.71417	0.996000	0.52242	0.756000	0.42949	1.464000	0.35288	0.956000	0.37904	0.561000	0.74099	AGC	IGFALS	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000099769		0.687	IGFALS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFALS	HGNC	protein_coding	OTTHUMT00000250509.2	30	0.00	0	G			1841132	1841132	-1	no_errors	ENST00000415638	ensembl	human	known	69_37n	missense	3	86.36	19	SNP	1.000	C
IL17RE	132014	genome.wustl.edu	37	3	9948736	9948736	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:9948736C>G	ENST00000383814.3	+	6	723	c.618C>G	c.(616-618)caC>caG	p.H206Q	IL17RE_ENST00000421412.1_Missense_Mutation_p.H239Q|IL17RE_ENST00000295980.3_Missense_Mutation_p.H206Q|IL17RE_ENST00000454190.2_Missense_Mutation_p.H206Q	NM_153480.1	NP_705613.1	Q8NFR9	I17RE_HUMAN	interleukin 17 receptor E	206					inflammatory response (GO:0006954)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(11)|skin(1)	21				OV - Ovarian serous cystadenocarcinoma(96;5.34e-64)		GTCTTTGTCACCAGTGGGCAC	0.552																																						dbGAP											0													188.0	158.0	168.0					3																	9948736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF458069	CCDS2589.1, CCDS54552.1	3p25.3	2008-02-05			ENSG00000163701	ENSG00000163701		"""Interleukins and interleukin receptors"""	18439	protein-coding gene	gene with protein product		614995					Standard	NM_153480		Approved	FLJ23658	uc003btu.3	Q8NFR9	OTTHUMG00000128649	ENST00000383814.3:c.618C>G	3.37:g.9948736C>G	ENSP00000373325:p.His206Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB34|B2RNR1|B9EH65|Q6P532|Q8N8H7|Q8N8H8|Q8TEC2	Missense_Mutation	SNP	pfam_SEFIR	p.H239Q	ENST00000383814.3	37	c.717	CCDS2589.1	3	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830325	0.71258	.	.	ENSG00000163701	ENST00000421412;ENST00000295980;ENST00000383814;ENST00000454190;ENST00000454992;ENST00000441648	T;T;T;T;T	0.16597	2.33;2.33;2.33;2.33;2.33	5.7	1.87	0.25490	.	0.415259	0.27258	N	0.020181	T	0.34774	0.0909	M	0.71581	2.175	0.30895	N	0.729941	D;D;D	0.89917	0.999;1.0;0.994	D;D;P	0.72625	0.974;0.978;0.832	T	0.26326	-1.0106	10	0.46703	T	0.11	-15.7756	8.7281	0.34483	0.0:0.6917:0.0:0.3083	.	206;206;206	Q8NFR9-3;Q8NFR9-5;Q8NFR9	.;.;I17RE_HUMAN	Q	239;206;206;206;166;89	ENSP00000404916:H239Q;ENSP00000295980:H206Q;ENSP00000373325:H206Q;ENSP00000388086:H206Q;ENSP00000400768:H166Q	ENSP00000295980:H206Q	H	+	3	2	IL17RE	9923736	0.985000	0.35326	0.999000	0.59377	0.997000	0.91878	-0.021000	0.12504	0.058000	0.16222	0.655000	0.94253	CAC	IL17RE	-	NULL	ENSG00000163701		0.552	IL17RE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL17RE	HGNC	protein_coding	OTTHUMT00000250529.1	46	0.00	0	C	NM_153480		9948736	9948736	+1	no_errors	ENST00000421412	ensembl	human	known	69_37n	missense	26	72.92	70	SNP	1.000	G
KCND1	3750	genome.wustl.edu	37	X	48825988	48825988	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chrX:48825988A>T	ENST00000218176.3	-	1	1988	c.691T>A	c.(691-693)Ttt>Att	p.F231I	KCND1_ENST00000376477.1_5'Flank	NM_004979.4	NP_004970.3	Q9NSA2	KCND1_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 1	231					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	cell projection (GO:0042995)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)	24					Dalfampridine(DB06637)	ATGCAGAAAAAGGCCTGTGGG	0.607																																						dbGAP											0													27.0	24.0	25.0					X																	48825988		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF166003	CCDS14314.1	Xp11.23	2012-07-05			ENSG00000102057	ENSG00000102057		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6237	protein-coding gene	gene with protein product		300281				10729221, 16382104	Standard	NM_004979		Approved	Kv4.1	uc004dlx.1	Q9NSA2	OTTHUMG00000024127	ENST00000218176.3:c.691T>A	X.37:g.48825988A>T	ENSP00000218176:p.Phe231Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEF1|B2RCG0|O75671	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.F231I	ENST00000218176.3	37	c.691	CCDS14314.1	X	.	.	.	.	.	.	.	.	.	.	A	24.7	4.557033	0.86231	.	.	ENSG00000102057	ENST00000218176	D	0.97480	-4.4	5.45	5.45	0.79879	.	0.000000	0.85682	D	0.000000	D	0.98466	0.9489	M	0.87097	2.86	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99501	1.0953	10	0.87932	D	0	.	13.4838	0.61353	1.0:0.0:0.0:0.0	.	231	Q9NSA2	KCND1_HUMAN	I	231	ENSP00000218176:F231I	ENSP00000218176:F231I	F	-	1	0	KCND1	48710932	1.000000	0.71417	0.998000	0.56505	0.919000	0.55068	9.339000	0.96797	1.827000	0.53221	0.481000	0.45027	TTT	KCND1	-	prints_K_chnl_volt-dep_Kv4	ENSG00000102057		0.607	KCND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND1	HGNC	protein_coding	OTTHUMT00000060774.1	36	0.00	0	A	NM_004979		48825988	48825988	-1	no_errors	ENST00000218176	ensembl	human	known	69_37n	missense	21	50.00	21	SNP	1.000	T
KCNK16	83795	genome.wustl.edu	37	6	39286819	39286819	+	Missense_Mutation	SNP	C	C	A	rs568188267		TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:39286819C>A	ENST00000373229.5	-	2	317	c.304G>T	c.(304-306)Gca>Tca	p.A102S	KCNK16_ENST00000437525.2_Missense_Mutation_p.A102S|KCNK16_ENST00000425054.2_Missense_Mutation_p.A102S|KCNK16_ENST00000373227.4_Missense_Mutation_p.A102S|KCNK16_ENST00000507712.1_Missense_Mutation_p.A37S	NM_032115.3	NP_115491.1	Q96T55	KCNKG_HUMAN	potassium channel, subfamily K, member 16	102					potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)	13						ACTGTGCCTGCAAAGAAGAAA	0.542																																						dbGAP											0													98.0	98.0	98.0					6																	39286819		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF358909	CCDS4843.1, CCDS47420.1, CCDS47421.1, CCDS47422.1	6p21.2-p21.1	2012-03-07			ENSG00000095981	ENSG00000095981		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	14464	protein-coding gene	gene with protein product		607369				11263999, 16382106	Standard	NM_032115		Approved	K2p16.1, TALK-1, TALK1	uc003ooq.3	Q96T55	OTTHUMG00000014645	ENST00000373229.5:c.304G>T	6.37:g.39286819C>A	ENSP00000362326:p.Ala102Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B5TJL9|Q2M2N9|Q5TCF3|Q6X6Z3|Q6X6Z4|Q6X6Z5|Q9H591	Missense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl	p.A102S	ENST00000373229.5	37	c.304	CCDS4843.1	6	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591488	0.66219	.	.	ENSG00000095981	ENST00000373229;ENST00000425054;ENST00000507712;ENST00000373227;ENST00000437525	T;T;T;T;T	0.27104	1.69;1.69;1.69;1.69;1.69	5.33	5.33	0.75918	Ion transport 2 (1);	0.000000	0.85682	D	0.000000	T	0.31199	0.0789	L	0.28649	0.875	0.80722	D	1	D;P;D;P	0.89917	1.0;0.678;1.0;0.623	D;B;D;P	0.87578	0.998;0.421;0.996;0.456	T	0.03761	-1.1006	10	0.38643	T	0.18	.	18.6337	0.91370	0.0:1.0:0.0:0.0	.	102;102;102;102	B5TJL9;Q96T55-5;Q96T55-4;Q96T55	.;.;.;KCNKG_HUMAN	S	102;102;37;102;102	ENSP00000362326:A102S;ENSP00000391498:A102S;ENSP00000423842:A37S;ENSP00000362324:A102S;ENSP00000415375:A102S	ENSP00000362324:A102S	A	-	1	0	KCNK16	39394797	1.000000	0.71417	0.971000	0.41717	0.846000	0.48090	7.046000	0.76592	2.483000	0.83821	0.561000	0.74099	GCA	KCNK16	-	pfam_Ion_trans_2	ENSG00000095981		0.542	KCNK16-001	KNOWN	basic|CCDS	protein_coding	KCNK16	HGNC	protein_coding	OTTHUMT00000040452.2	47	0.00	0	C	NM_032115		39286819	39286819	-1	no_errors	ENST00000425054	ensembl	human	known	69_37n	missense	37	50.00	37	SNP	1.000	A
KDM4B	23030	genome.wustl.edu	37	19	5144267	5144267	+	Silent	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:5144267C>G	ENST00000159111.4	+	20	2963	c.2745C>G	c.(2743-2745)ctC>ctG	p.L915L	KDM4B_ENST00000536461.1_Silent_p.L949L	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	915					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						AGGTCCAACTCCTGAGGGCCG	0.706																																						dbGAP											0													35.0	26.0	29.0					19																	5144267		2198	4296	6494	-	-	-	SO:0001819	synonymous_variant	0			AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.2745C>G	19.37:g.5144267C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Silent	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.L915	ENST00000159111.4	37	c.2745	CCDS12138.1	19																																																																																			KDM4B	-	NULL	ENSG00000127663		0.706	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	HGNC	protein_coding	OTTHUMT00000450558.1	13	0.00	0	C	NM_015015		5144267	5144267	+1	no_errors	ENST00000159111	ensembl	human	known	69_37n	silent	34	32.00	16	SNP	0.001	G
KIAA2018	205717	genome.wustl.edu	37	3	113374644	113374644	+	Missense_Mutation	SNP	T	T	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:113374644T>G	ENST00000478658.1	-	5	5902	c.5885A>C	c.(5884-5886)gAt>gCt	p.D1962A	KIAA2018_ENST00000316407.4_Missense_Mutation_p.D1962A|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1962						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						AGGGCCTTGATCGCCATTTCC	0.532																																						dbGAP											0													93.0	89.0	90.0					3																	113374644		2129	4251	6380	-	-	-	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.5885A>C	3.37:g.113374644T>G	ENSP00000420721:p.Asp1962Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D1962A	ENST00000478658.1	37	c.5885	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	t	13.07	2.127711	0.37533	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.17528	2.27;2.27	5.56	5.56	0.83823	.	0.348647	0.29964	N	0.010741	T	0.14917	0.0360	L	0.27053	0.805	0.46654	D	0.999142	B	0.24258	0.1	B	0.21708	0.036	T	0.03443	-1.1036	10	0.51188	T	0.08	-5.9049	15.9973	0.80260	0.0:0.0:0.0:1.0	.	1962	Q68DE3	K2018_HUMAN	A	1962	ENSP00000320794:D1962A;ENSP00000420721:D1962A	ENSP00000320794:D1962A	D	-	2	0	KIAA2018	114857334	1.000000	0.71417	0.980000	0.43619	0.873000	0.50193	7.299000	0.78831	2.239000	0.73571	0.456000	0.33151	GAT	KIAA2018	-	NULL	ENSG00000176542		0.532	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	31	0.00	0	T	NM_001009899		113374644	113374644	-1	no_errors	ENST00000316407	ensembl	human	known	69_37n	missense	52	34.18	27	SNP	0.998	G
KLF10	7071	genome.wustl.edu	37	8	103667808	103667808	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr8:103667808G>C	ENST00000285407.6	-	1	322	c.22C>G	c.(22-24)Ctc>Gtc	p.L8V	KLF10_ENST00000395884.3_5'Flank	NM_005655.2	NP_005646.1	Q13118	KLF10_HUMAN	Kruppel-like factor 10	8					bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular response to peptide (GO:1901653)|cellular response to starvation (GO:0009267)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of osteoclast differentiation (GO:0045672)|regulation of circadian rhythm (GO:0042752)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|prostate(3)	18	all_epithelial(15;5.63e-07)|Lung NSC(17;8.18e-05)|all_lung(17;0.000169)		OV - Ovarian serous cystadenocarcinoma(57;0.000112)|STAD - Stomach adenocarcinoma(118;0.0826)			GTCTGCTGGAGAGAGGCACCG	0.662																																					Esophageal Squamous(16;495 519 2144 16528 44005)	dbGAP											0													86.0	80.0	82.0					8																	103667808		2203	4300	6503	-	-	-	SO:0001583	missense	0			U21847	CCDS6294.1, CCDS47905.1	8q22.3	2014-09-17	2004-11-29	2004-12-01	ENSG00000155090	ENSG00000155090		"""Kruppel-like transcription factors"", ""Zinc fingers, C2H2-type"""	11810	protein-coding gene	gene with protein product		601878	"""TGFB inducible early growth response"""	TIEG		8584037, 9721211	Standard	NM_001032282		Approved	EGRA, TIEG1	uc011lhk.1	Q13118	OTTHUMG00000164735	ENST00000285407.6:c.22C>G	8.37:g.103667808G>C	ENSP00000285407:p.Leu8Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVH0|B2R794|L0R4P6|L0R679|O75411|Q503B2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L8V	ENST00000285407.6	37	c.22	CCDS6294.1	8	.	.	.	.	.	.	.	.	.	.	G	12.32	1.903469	0.33628	.	.	ENSG00000155090	ENST00000285407	T	0.12569	2.67	4.12	3.21	0.36854	.	0.352416	0.20594	N	0.089291	T	0.09113	0.0225	N	0.21448	0.665	0.80722	D	1	B	0.18013	0.025	B	0.15870	0.014	T	0.13229	-1.0517	10	0.49607	T	0.09	.	8.2113	0.31486	0.1212:0.0:0.8788:0.0	.	8	Q13118	KLF10_HUMAN	V	8	ENSP00000285407:L8V	ENSP00000285407:L8V	L	-	1	0	KLF10	103736984	1.000000	0.71417	0.996000	0.52242	0.985000	0.73830	1.184000	0.32053	0.889000	0.36185	0.455000	0.32223	CTC	KLF10	-	NULL	ENSG00000155090		0.662	KLF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLF10	HGNC	protein_coding	OTTHUMT00000379967.1	117	0.00	0	G			103667808	103667808	-1	no_errors	ENST00000285407	ensembl	human	known	69_37n	missense	430	10.97	53	SNP	0.995	C
KRTAP4-9	100132386	genome.wustl.edu	37	17	39261862	39261862	+	Silent	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:39261862T>C	ENST00000391415.1	+	1	279	c.222T>C	c.(220-222)tgT>tgC	p.C74C		NM_001146041.1	NP_001139513.1	Q9BYQ8	KRA49_HUMAN	keratin associated protein 4-9	74	29 X 5 AA repeats of C-C-[RQVHIEK]- [SPTR]-[VSTQCRNP].		Missing (in allele KAP.9-v1).		aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|urinary_tract(3)	14						AGACCACCTGTTGCAGGACCA	0.652																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AJ406941	CCDS54124.1	17q21.2	2013-06-25			ENSG00000212722	ENSG00000212722		"""Keratin associated proteins"""	18910	protein-coding gene	gene with protein product							Standard	NM_001146041		Approved	KAP4.9	uc010wfp.2	Q9BYQ8	OTTHUMG00000133584	ENST00000391415.1:c.222T>C	17.37:g.39261862T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Keratin-assoc	p.C74	ENST00000391415.1	37	c.222	CCDS54124.1	17																																																																																			KRTAP4-9	-	pfam_Keratin-assoc	ENSG00000212722		0.652	KRTAP4-9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-9	HGNC	protein_coding	OTTHUMT00000257688.1	67	0.00	0	T	NM_001146041		39261862	39261862	+1	no_errors	ENST00000391415	ensembl	human	known	69_37n	silent	13	43.48	10	SNP	0.039	C
KRT35	3886	genome.wustl.edu	37	17	39637188	39637188	+	Silent	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:39637188C>A	ENST00000393989.1	-	1	204	c.162G>T	c.(160-162)gtG>gtT	p.V54V	KRT35_ENST00000246639.2_Silent_p.V24V	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	54	Head.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				TGCCCAGACCCACTGAGCAGG	0.627																																						dbGAP											0													35.0	43.0	40.0					17																	39637188		2088	4223	6311	-	-	-	SO:0001819	synonymous_variant	0			X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.162G>T	17.37:g.39637188C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O76012|Q92651	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.V54	ENST00000393989.1	37	c.162	CCDS11394.2	17																																																																																			KRT35	-	NULL	ENSG00000197079		0.627	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT35	HGNC	protein_coding		41	0.00	0	C	NM_002280		39637188	39637188	-1	no_errors	ENST00000393989	ensembl	human	known	69_37n	silent	11	86.59	71	SNP	0.000	A
L1CAM	3897	genome.wustl.edu	37	X	153134351	153134351	+	Missense_Mutation	SNP	T	T	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chrX:153134351T>G	ENST00000370060.1	-	12	1513	c.1324A>C	c.(1324-1326)Agc>Cgc	p.S442R	L1CAM_ENST00000543994.1_Missense_Mutation_p.S444R|L1CAM_ENST00000361981.3_Missense_Mutation_p.S437R|L1CAM_ENST00000370055.1_Missense_Mutation_p.S437R|L1CAM_ENST00000361699.4_Missense_Mutation_p.S442R|L1CAM_ENST00000538883.1_Missense_Mutation_p.S444R|L1CAM_ENST00000370057.3_Missense_Mutation_p.S442R	NM_001278116.1	NP_001265045.1	P32004	L1CAM_HUMAN	L1 cell adhesion molecule	442	Ig-like C2-type 5.		Missing (in HSAS). {ECO:0000269|PubMed:9195224}.		axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cell surface receptor signaling pathway (GO:0007166)|cell-cell adhesion mediated by integrin (GO:0033631)|chemotaxis (GO:0006935)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|homotypic cell-cell adhesion (GO:0034109)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|nervous system development (GO:0007399)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell-cell adhesion (GO:0022409)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	sialic acid binding (GO:0033691)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|liver(1)|lung(31)|ovary(13)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	81	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					TAGGCAGTGCTGCCCTGGACA	0.607																																						dbGAP											0													178.0	132.0	147.0					X																	153134351		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74387	CCDS14733.1, CCDS14734.1, CCDS48192.1	Xq28	2014-09-17	2003-04-07		ENSG00000198910	ENSG00000198910		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	6470	protein-coding gene	gene with protein product		308840	"""antigen identified by monoclonal antibody R1"""	HSAS1, SPG1, HSAS, MASA, MIC5, S10			Standard	NM_001278116		Approved	CD171	uc031tks.1	P32004	OTTHUMG00000024221	ENST00000370060.1:c.1324A>C	X.37:g.153134351T>G	ENSP00000359077:p.Ser442Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV65|A4ZYW4|B2RMU7|G3XAF4|Q8TA87	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S444R	ENST00000370060.1	37	c.1330	CCDS14733.1	X	.	.	.	.	.	.	.	.	.	.	T	0.041	-1.285742	0.01387	.	.	ENSG00000198910	ENST00000370060;ENST00000543994;ENST00000370057;ENST00000538883;ENST00000361981;ENST00000370055;ENST00000361699	T;T;T;T;T;T;T	0.78481	-1.18;-1.18;-1.18;-1.18;-1.18;-1.18;-1.18	5.67	5.67	0.87782	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.165674	0.42964	N	0.000631	T	0.61073	0.2318	N	0.26162	0.8	0.32550	N	0.532533	B;B;B	0.12630	0.005;0.006;0.006	B;B;B	0.16722	0.009;0.009;0.016	T	0.57033	-0.7880	10	0.02654	T	1	.	10.4062	0.44258	0.0:0.0:0.1615:0.8385	.	437;442;442	G3XAF4;P32004-2;P32004	.;.;L1CAM_HUMAN	R	442;444;442;444;437;437;442	ENSP00000359077:S442R;ENSP00000438430:S444R;ENSP00000359074:S442R;ENSP00000439645:S444R;ENSP00000354712:S437R;ENSP00000359072:S437R;ENSP00000355380:S442R	ENSP00000355380:S442R	S	-	1	0	L1CAM	152787545	0.991000	0.36638	0.985000	0.45067	0.112000	0.19704	2.178000	0.42519	1.916000	0.55485	0.430000	0.28490	AGC	L1CAM	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000198910		0.607	L1CAM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	L1CAM	HGNC	protein_coding	OTTHUMT00000061094.2	70	0.00	0	T	NM_024003		153134351	153134351	-1	no_errors	ENST00000543994	ensembl	human	known	69_37n	missense	98	42.35	72	SNP	0.726	G
LILRB1	10859	genome.wustl.edu	37	19	55147342	55147342	+	Intron	SNP	C	C	A	rs113645220	byFrequency	TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:55147342C>A	ENST00000396331.1	+	14	2007				LILRB1_ENST00000396317.1_Intron|LILRB1_ENST00000396327.3_Intron|AC009892.10_ENST00000456337.1_3'UTR|LILRB1_ENST00000427581.2_Intron|LILRB1_ENST00000396315.1_Intron|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron|LILRB1_ENST00000396321.2_Intron|LILRB1_ENST00000324602.7_Intron|LILRB1_ENST00000434867.2_Intron|LILRB1_ENST00000396332.4_Intron|LILRB1_ENST00000462628.1_3'UTR	NM_006669.3	NP_006660.3	Q8NHL6	LIRB1_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 1						cellular response to lipopolysaccharide (GO:0071222)|defense response to virus (GO:0051607)|dendritic cell differentiation (GO:0097028)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma production (GO:0032609)|interferon-gamma secretion (GO:0072643)|negative regulation of alpha-beta T cell activation (GO:0046636)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of CD8-positive, alpha-beta T cell activation (GO:2001186)|negative regulation of cell cycle (GO:0045786)|negative regulation of cytokine secretion involved in immune response (GO:0002740)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of endocytosis (GO:0045806)|negative regulation of interferon-beta secretion (GO:0035548)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-12 secretion (GO:2001183)|negative regulation of mononuclear cell proliferation (GO:0032945)|negative regulation of natural killer cell mediated cytotoxicity (GO:0045953)|negative regulation of osteoclast development (GO:2001205)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell (GO:2001189)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|negative regulation of T cell proliferation (GO:0042130)|negative regulation of transforming growth factor-beta secretion (GO:2001202)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cytolysis (GO:0045919)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of gamma-delta T cell activation involved in immune response (GO:2001193)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor internalization (GO:0031623)|regulation of immune response (GO:0050776)|response to virus (GO:0009615)|signal transduction (GO:0007165)|T cell proliferation involved in immune response (GO:0002309)	cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	HLA-A specific inhibitory MHC class I receptor activity (GO:0030107)|HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)|MHC class I protein binding (GO:0042288)|MHC class I receptor activity (GO:0032393)|protein homodimerization activity (GO:0042803)|protein phosphatase 1 binding (GO:0008157)|SH2 domain binding (GO:0042169)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(38)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	74				GBM - Glioblastoma multiforme(193;0.0188)		AAATGAACCACCCCGGTCCCC	0.607										HNSCC(37;0.09)																												dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF009220	CCDS42614.1, CCDS42615.1, CCDS42616.1, CCDS42617.1, CCDS62803.1	19q13.4	2013-01-11						"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6605	protein-coding gene	gene with protein product		604811				9285411, 9382880	Standard	XM_006726246		Approved	LIR-1, ILT2, MIR-7, CD85, LIR1, CD85j	uc002qgm.3	Q8NHL6		ENST00000396331.1:c.1650+282C>A	19.37:g.55147342C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2IXV4|A8MXT0|O75024|O75025|Q8NHJ9|Q8NHK0	RNA	SNP	-	NULL	ENST00000396331.1	37	NULL	CCDS42617.1	19																																																																																			LILRB1	-	-	ENSG00000104972		0.607	LILRB1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB1	HGNC	protein_coding	OTTHUMT00000140796.4	30	0.00	0	C			55147342	55147342	+1	no_errors	ENST00000462628	ensembl	human	known	69_37n	rna	37	21.28	10	SNP	0.003	A
LIN28B	389421	genome.wustl.edu	37	6	105526342	105526342	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:105526342C>T	ENST00000345080.4	+	4	640	c.437C>T	c.(436-438)cCt>cTt	p.P146L		NM_001004317.3	NP_001004317.1	Q6ZN17	LN28B_HUMAN	lin-28 homolog B (C. elegans)	146					miRNA catabolic process (GO:0010587)|pre-miRNA processing (GO:0031054)|regulation of transcription, DNA-templated (GO:0006355)|RNA 3'-end processing (GO:0031123)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.P146L(1)		large_intestine(1)|lung(10)|ovary(1)	12		all_cancers(87;0.00346)|Acute lymphoblastic leukemia(125;2.26e-08)|all_hematologic(75;2.79e-06)|all_epithelial(87;0.204)				AGTCTACCTCCTCAGCCAAAG	0.453																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											134.0	118.0	123.0					6																	105526342		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131411	CCDS34504.1	6q21	2010-04-06			ENSG00000187772	ENSG00000187772			32207	protein-coding gene	gene with protein product		611044					Standard	NM_001004317		Approved	FLJ16517, CSDD2	uc003pqv.2	Q6ZN17	OTTHUMG00000015290	ENST00000345080.4:c.437C>T	6.37:g.105526342C>T	ENSP00000344401:p.Pro146Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L165|B2RPN6|Q5TCM4	Missense_Mutation	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold-like,superfamily_Znf_CCHC,smart_Cold_shock_prot,smart_Znf_CCHC,prints_CSP_DNA-bd,pfscan_Znf_CCHC	p.P146L	ENST00000345080.4	37	c.437	CCDS34504.1	6	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733753	0.89482	.	.	ENSG00000187772	ENST00000345080	.	.	.	6.02	6.02	0.97574	Zinc finger, CCHC retroviral-type (1);	0.000000	0.85682	D	0.000000	T	0.74619	0.3740	L	0.57536	1.79	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.73723	-0.3893	9	0.62326	D	0.03	-7.8972	20.5407	0.99260	0.0:1.0:0.0:0.0	.	146	Q6ZN17	LN28B_HUMAN	L	146	.	ENSP00000344401:P146L	P	+	2	0	LIN28B	105633035	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.794000	0.85869	2.865000	0.98341	0.655000	0.94253	CCT	LIN28B	-	superfamily_Znf_CCHC	ENSG00000187772		0.453	LIN28B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN28B	HGNC	protein_coding	OTTHUMT00000041646.2	81	0.00	0	C	NM_001004317		105526342	105526342	+1	no_errors	ENST00000345080	ensembl	human	known	69_37n	missense	86	41.50	61	SNP	1.000	T
LRRC37A2	474170	genome.wustl.edu	37	17	44623731	44623731	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:44623731C>T	ENST00000576629.1	+	9	3659	c.3164C>T	c.(3163-3165)aCa>aTa	p.T1055I	ARL17A_ENST00000329240.4_Intron|ARL17A_ENST00000337845.7_Intron|LRRC37A2_ENST00000333412.3_Missense_Mutation_p.T1055I|ARL17A_ENST00000445552.2_Intron			A6NM11	L37A2_HUMAN	leucine rich repeat containing 37, member A2	1055						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|pancreas(4)|prostate(2)	15		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		ACAAACACCACACATTGTCGT	0.368																																						dbGAP											0													1.0	2.0	2.0					17																	44623731		518	1407	1925	-	-	-	SO:0001583	missense	0			AY386262	CCDS42353.1	17q21.31	2013-05-14			ENSG00000238083	ENSG00000238083			32404	protein-coding gene	gene with protein product	"""c114 SLIT-like testicular protein"""						Standard	NM_001006607		Approved	FLJ45049	uc002ikn.1	A6NM11	OTTHUMG00000178032	ENST00000576629.1:c.3164C>T	17.37:g.44623731C>T	ENSP00000459551:p.Thr1055Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMC3	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.T1055I	ENST00000576629.1	37	c.3164	CCDS42353.1	17	.	.	.	.	.	.	.	.	.	.	c	4.323	0.059256	0.08339	.	.	ENSG00000238083	ENST00000333412	T	0.60920	0.15	3.66	1.55	0.23275	.	.	.	.	.	T	0.27027	0.0662	N	0.02158	-0.66	0.09310	N	1	B	0.11235	0.004	B	0.11329	0.006	T	0.19811	-1.0294	9	0.29301	T	0.29	.	6.1629	0.20373	0.182:0.7024:0.0:0.1157	.	1055	A6NM11	L37A2_HUMAN	I	1055	ENSP00000333071:T1055I	ENSP00000333071:T1055I	T	+	2	0	LRRC37A2	41979047	0.000000	0.05858	0.001000	0.08648	0.060000	0.15804	-0.973000	0.03798	-0.048000	0.13401	-1.514000	0.00941	ACA	LRRC37A2	-	NULL	ENSG00000238083		0.368	LRRC37A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC37A2	HGNC	protein_coding	OTTHUMT00000440299.2	12	0.00	0	C	NM_001006607		44623731	44623731	+1	no_errors	ENST00000333412	ensembl	human	known	69_37n	missense	4	55.56	5	SNP	0.001	T
LTN1	26046	genome.wustl.edu	37	21	30332984	30332984	+	Silent	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr21:30332984G>C	ENST00000361371.5	-	12	2287	c.2208C>G	c.(2206-2208)ctC>ctG	p.L736L	LTN1_ENST00000389194.2_Silent_p.L782L			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	736					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TATCGCCTTTGAGCCAAGGAG	0.383																																						dbGAP											0													107.0	96.0	100.0					21																	30332984		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.2208C>G	21.37:g.30332984G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Silent	SNP	pfam_Znf_C3HC4_RING-type,superfamily_ARM-type_fold,smart_Znf_RING-CH,pfscan_Znf_RING	p.L736	ENST00000361371.5	37	c.2208		21																																																																																			LTN1	-	NULL	ENSG00000198862		0.383	LTN1-008	NOVEL	basic|appris_principal	protein_coding	LTN1	HGNC	protein_coding	OTTHUMT00000472108.1	36	0.00	0	G	NM_015565		30332984	30332984	-1	no_errors	ENST00000361371	ensembl	human	known	69_37n	silent	61	12.68	9	SNP	0.736	C
MAML3	55534	genome.wustl.edu	37	4	140811075	140811075	+	Silent	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr4:140811075C>T	ENST00000509479.2	-	2	2371	c.1515G>A	c.(1513-1515)caG>caA	p.Q505Q	MAML3_ENST00000327122.5_Silent_p.Q349Q|MAML3_ENST00000398940.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					gctgctgctgctgctgctgct	0.517																																						dbGAP											0													30.0	39.0	36.0					4																	140811075		2174	4288	6462	-	-	-	SO:0001819	synonymous_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.1515G>A	4.37:g.140811075C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q505	ENST00000509479.2	37	c.1515	CCDS54805.1	4																																																																																			MAML3	-	NULL	ENSG00000196782		0.517	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	25	0.00	0	C			140811075	140811075	-1	no_errors	ENST00000509479	ensembl	human	known	69_37n	silent	41	24.07	13	SNP	0.993	T
MAP4K4	9448	genome.wustl.edu	37	2	102490547	102490547	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:102490547G>C	ENST00000347699.4	+	23	2639	c.2639G>C	c.(2638-2640)gGa>gCa	p.G880A	MAP4K4_ENST00000413150.2_Missense_Mutation_p.G795A|MAP4K4_ENST00000456652.1_Missense_Mutation_p.G679A|MAP4K4_ENST00000302217.5_Missense_Mutation_p.G683A|MAP4K4_ENST00000324219.4_Missense_Mutation_p.G961A|MAP4K4_ENST00000425019.1_Missense_Mutation_p.G913A|MAP4K4_ENST00000350878.4_Missense_Mutation_p.G920A|MAP4K4_ENST00000350198.4_Missense_Mutation_p.G799A	NM_001242559.1|NM_145687.3	NP_001229488.1|NP_663720.1	O95819	M4K4_HUMAN	mitogen-activated protein kinase kinase kinase kinase 4	880	Mediates interaction with RAP2A.				intracellular signal transduction (GO:0035556)|protein phosphorylation (GO:0006468)|regulation of JNK cascade (GO:0046328)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(15)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41						GTTTCAGTGGGATTTTCCTGT	0.428																																						dbGAP											0													86.0	84.0	85.0					2																	102490547		1924	4113	6037	-	-	-	SO:0001583	missense	0			AF096300	CCDS56130.1, CCDS74546.1	2q11.2-q12	2011-06-09			ENSG00000071054	ENSG00000071054		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6866	protein-coding gene	gene with protein product	"""HPK/GCK-like kinase"", ""hepatocyte progenitor kinase-like/germinal center kinase-like kinase"""	604666				9890973, 9734811, 9135144	Standard	NM_004834		Approved	HGK, NIK, FLH21957	uc002tbf.3	O95819	OTTHUMG00000155394	ENST00000347699.4:c.2639G>C	2.37:g.102490547G>C	ENSP00000314363:p.Gly880Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O75172|Q9NST7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.G961A	ENST00000347699.4	37	c.2882	CCDS56130.1	2	.	.	.	.	.	.	.	.	.	.	G	13.83	2.354797	0.41700	.	.	ENSG00000071054	ENST00000425019;ENST00000324219;ENST00000350198;ENST00000302217;ENST00000413150;ENST00000456652;ENST00000347699;ENST00000417294;ENST00000350878	T;T;T;T;T;T;T;T;T	0.74209	-0.74;-0.68;-0.68;-0.19;-0.7;-0.19;-0.7;-0.82;-0.71	5.22	5.22	0.72569	.	0.195991	0.43260	D	0.000585	T	0.68155	0.2970	N	0.17474	0.49	0.80722	D	1	D;P;B;B;D;P;P;D;B;B	0.56968	0.978;0.956;0.02;0.238;0.974;0.874;0.956;0.974;0.198;0.257	P;B;B;B;P;P;B;P;B;B	0.49752	0.621;0.299;0.05;0.1;0.494;0.471;0.299;0.494;0.155;0.13	T	0.66544	-0.5897	10	0.23302	T	0.38	.	18.7789	0.91924	0.0:0.0:1.0:0.0	.	920;876;679;683;798;880;913;799;852;961	B7Z388;B7Z3V5;E7EX83;C9J840;O95819-4;O95819;E7EN19;G3XAA2;O95819-2;G5E948	.;.;.;.;.;M4K4_HUMAN;.;.;.;.	A	913;961;799;683;795;679;880;811;920	ENSP00000392830:G913A;ENSP00000313644:G961A;ENSP00000281111:G799A;ENSP00000303600:G683A;ENSP00000389752:G795A;ENSP00000387370:G679A;ENSP00000314363:G880A;ENSP00000409720:G811A;ENSP00000343658:G920A	ENSP00000303600:G683A	G	+	2	0	MAP4K4	101856979	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	6.647000	0.74354	2.435000	0.82474	0.655000	0.94253	GGA	MAP4K4	-	NULL	ENSG00000071054		0.428	MAP4K4-001	KNOWN	basic|CCDS	protein_coding	MAP4K4	HGNC	protein_coding	OTTHUMT00000339839.1	40	0.00	0	G	NM_004834		102490547	102490547	+1	no_errors	ENST00000324219	ensembl	human	known	69_37n	missense	31	36.73	18	SNP	1.000	C
MED12	9968	genome.wustl.edu	37	X	70355014	70355014	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chrX:70355014C>T	ENST00000374080.3	+	36	4968	c.4936C>T	c.(4936-4938)Cga>Tga	p.R1646*	MED12_ENST00000333646.6_Nonsense_Mutation_p.R1646*|MED12_ENST00000374102.1_Nonsense_Mutation_p.R1646*			Q93074	MED12_HUMAN	mediator complex subunit 12	1646	Interaction with CTNNB1 and GLI3.				androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CAAGCAGACCCGAGATGTCAT	0.552			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													70.0	69.0	69.0					X																	70355014		2094	4208	6302	-	-	-	SO:0001587	stop_gained	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4936C>T	X.37:g.70355014C>T	ENSP00000363193:p.Arg1646*	Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Nonsense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.R1646*	ENST00000374080.3	37	c.4936	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	-	45	11.983329	0.99623	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072;ENST00000439750	.	.	.	3.97	3.97	0.46021	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-6.865	15.8412	0.78845	0.0:1.0:0.0:0.0	.	.	.	.	X	1646;1646;1646;1646;1614;391	.	ENSP00000333125:R1646X	R	+	1	2	MED12	70271739	0.977000	0.34250	1.000000	0.80357	0.998000	0.95712	2.456000	0.44997	1.987000	0.57996	0.529000	0.55759	CGA	MED12	-	NULL	ENSG00000184634		0.552	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	38	0.00	0	C	NM_005120		70355014	70355014	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	nonsense	36	41.94	26	SNP	1.000	T
METTL2A	339175	genome.wustl.edu	37	17	60503872	60503872	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:60503872G>C	ENST00000311506.5	+	3	451	c.415G>C	c.(415-417)Gaa>Caa	p.E139Q		NM_181725.3	NP_859076.3	Q96IZ6	MET2A_HUMAN	methyltransferase like 2A	139					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(2)|central_nervous_system(1)|endometrium(1)|upper_aerodigestive_tract(2)	6			BRCA - Breast invasive adenocarcinoma(2;1.08e-10)			AATAATGGAAGAACAGCACAA	0.388																																						dbGAP											0													47.0	39.0	42.0					17																	60503872		2203	4298	6501	-	-	-	SO:0001583	missense	0			AK000991	CCDS45752.1	17q23.3	2012-12-20		2006-02-10	ENSG00000087995	ENSG00000087995			25755	protein-coding gene	gene with protein product						12477932	Standard	NM_181725		Approved	FLJ12760, METTL2	uc002izv.2	Q96IZ6	OTTHUMG00000164527	ENST00000311506.5:c.415G>C	17.37:g.60503872G>C	ENSP00000309610:p.Glu139Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNC4|Q9H9G9|Q9NUI8|Q9P0B5	Missense_Mutation	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase_METTL2_prd	p.E139Q	ENST00000311506.5	37	c.415	CCDS45752.1	17	.	.	.	.	.	.	.	.	.	.	G	26.0	4.698973	0.88830	.	.	ENSG00000087995	ENST00000311506;ENST00000333483	D	0.82526	-1.62	5.44	5.44	0.79542	.	0.604609	0.14659	N	0.306064	D	0.87557	0.6207	L	0.45581	1.43	0.30622	N	0.758419	D	0.76494	0.999	D	0.66716	0.946	T	0.82853	-0.0252	10	0.23302	T	0.38	-6.8906	16.7329	0.85440	0.0:0.0:1.0:0.0	.	139	Q96IZ6	MTL2A_HUMAN	Q	139	ENSP00000309610:E139Q	ENSP00000309610:E139Q	E	+	1	0	METTL2A	57857604	1.000000	0.71417	0.992000	0.48379	0.901000	0.52897	3.882000	0.56160	2.549000	0.85964	0.555000	0.69702	GAA	METTL2A	-	pirsf_MeTrfase_METTL2_prd	ENSG00000087995		0.388	METTL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2A	HGNC	protein_coding	OTTHUMT00000445130.1	33	0.00	0	G	NM_181725		60503872	60503872	+1	no_errors	ENST00000311506	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	0.984	C
METTL2B	55798	genome.wustl.edu	37	7	128119424	128119424	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:128119424G>C	ENST00000262432.8	+	3	452	c.415G>C	c.(415-417)Gaa>Caa	p.E139Q	METTL2B_ENST00000480046.1_Missense_Mutation_p.E74Q|RP11-212P7.3_ENST00000462662.1_RNA	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	139					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						AATAATGGAAGAACAGCACAA	0.388																																						dbGAP											0													127.0	135.0	133.0					7																	128119424		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.415G>C	7.37:g.128119424G>C	ENSP00000262432:p.Glu139Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ68|Q0IJ54|Q3B7J1	Missense_Mutation	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase_METTL2_prd	p.E139Q	ENST00000262432.8	37	c.415	CCDS5803.2	7	.	.	.	.	.	.	.	.	.	.	G	12.13	1.844969	0.32606	.	.	ENSG00000165055	ENST00000462662;ENST00000262432;ENST00000480046	T;D;T	0.82526	2.14;-1.62;2.69	2.65	2.65	0.31530	.	0.604609	0.14659	N	0.306064	D	0.85995	0.5827	L	0.50333	1.59	0.24078	N	0.99595	D;B	0.76494	0.999;0.017	D;B	0.83275	0.996;0.007	T	0.73880	-0.3843	10	0.27082	T	0.32	-6.8906	8.9073	0.35532	0.0:0.0:1.0:0.0	.	74;139	Q6P1Q9-2;Q6P1Q9	.;MTL2B_HUMAN	Q	133;139;74	ENSP00000418634:E133Q;ENSP00000262432:E139Q;ENSP00000418402:E74Q	ENSP00000262432:E139Q	E	+	1	0	METTL2B	127906660	1.000000	0.71417	0.767000	0.31495	0.083000	0.17756	3.242000	0.51384	1.492000	0.48499	0.405000	0.27470	GAA	METTL2B	-	pirsf_MeTrfase_METTL2_prd	ENSG00000165055		0.388	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2B	HGNC	protein_coding	OTTHUMT00000289817.1	70	0.00	0	G	NM_018396		128119424	128119424	+1	no_errors	ENST00000262432	ensembl	human	known	69_37n	missense	92	11.54	12	SNP	0.868	C
MGA	23269	genome.wustl.edu	37	15	42059326	42059326	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr15:42059326C>A	ENST00000570161.1	+	23	9046	c.9046C>A	c.(9046-9048)Cct>Act	p.P3016T	MGA_ENST00000219905.7_Missense_Mutation_p.P3016T|MGA_ENST00000545763.1_Missense_Mutation_p.P2807T|MGA_ENST00000389936.4_Missense_Mutation_p.P2977T|MGA_ENST00000566586.1_Missense_Mutation_p.P2807T			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TTGTTTGGCACCTATAGCTGC	0.493																																						dbGAP											0													118.0	115.0	116.0					15																	42059326		1957	4163	6120	-	-	-	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.9046C>A	15.37:g.42059326C>A	ENSP00000457035:p.Pro3016Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.P3016T	ENST00000570161.1	37	c.9046	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	17.29	3.352146	0.61183	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.91894	-2.83;-2.8;-2.93	5.65	5.65	0.86999	.	0.123916	0.36200	N	0.002737	D	0.93700	0.7987	L	0.27053	0.805	0.36419	D	0.864181	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.95302	0.8404	10	0.87932	D	0	.	19.9142	0.97043	0.0:1.0:0.0:0.0	.	2807;3016	F5H7K2;E7ENI0	.;.	T	3016;2977;2807	ENSP00000219905:P3016T;ENSP00000374586:P2977T;ENSP00000442467:P2807T	ENSP00000219905:P3016T	P	+	1	0	MGA	39846618	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.878000	0.56130	2.941000	0.99782	0.655000	0.94253	CCT	MGA	-	NULL	ENSG00000174197		0.493	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	17	0.00	0	C	NM_001164273.1		42059326	42059326	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	missense	5	73.68	14	SNP	1.000	A
MGAT4A	11320	genome.wustl.edu	37	2	99274686	99274686	+	Silent	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:99274686C>T	ENST00000264968.3	-	5	942	c.579G>A	c.(577-579)gaG>gaA	p.E193E	MGAT4A_ENST00000393487.1_Silent_p.E193E|MGAT4A_ENST00000461884.1_5'UTR|MGAT4A_ENST00000409391.1_Silent_p.E193E|MGAT4A_ENST00000414521.2_Silent_p.E65E			Q9UM21	MGT4A_HUMAN	mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme A	193					cellular protein metabolic process (GO:0044267)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|stomach(1)	19						CTTACTCTTTCTCCAGGTTGG	0.274																																						dbGAP											0													46.0	51.0	49.0					2																	99274686		2200	4290	6490	-	-	-	SO:0001819	synonymous_variant	0			AB000616	CCDS2036.1, CCDS54380.1	2q12	2013-02-25	2005-11-16		ENSG00000071073	ENSG00000071073	2.4.1.145	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	7047	protein-coding gene	gene with protein product		604623	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isoenzyme A"""			10024668	Standard	NM_001160154		Approved	GnT-Iva, GnT-4a	uc002sze.3	Q9UM21	OTTHUMG00000130563	ENST00000264968.3:c.579G>A	2.37:g.99274686C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2R6|D3DVH6|E9PEN2|Q53S97|Q86Z15	Silent	SNP	pfam_Glyco_transf_54	p.E193	ENST00000264968.3	37	c.579	CCDS2036.1	2																																																																																			MGAT4A	-	pfam_Glyco_transf_54	ENSG00000071073		0.274	MGAT4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MGAT4A	HGNC	protein_coding	OTTHUMT00000252988.2	80	0.00	0	C	NM_012214		99274686	99274686	-1	no_errors	ENST00000264968	ensembl	human	known	69_37n	silent	69	27.37	26	SNP	1.000	T
MIA3	375056	genome.wustl.edu	37	1	222794527	222794527	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:222794527G>C	ENST00000344922.5	+	2	185	c.160G>C	c.(160-162)Gaa>Caa	p.E54Q	MIA3_ENST00000470521.1_3'UTR|MIA3_ENST00000344507.1_Missense_Mutation_p.E54Q|MIA3_ENST00000344441.6_Missense_Mutation_p.E54Q	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3	54	SH3.				chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		TGAGGCTCTTGAAGATTTCAC	0.388																																						dbGAP											0													112.0	107.0	108.0					1																	222794527		1816	4080	5896	-	-	-	SO:0001583	missense	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.160G>C	1.37:g.222794527G>C	ENSP00000340900:p.Glu54Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.E54Q	ENST00000344922.5	37	c.160	CCDS41470.1	1	.	.	.	.	.	.	.	.	.	.	G	6.937	0.542614	0.13250	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000344507	T;T;T	0.10005	2.92;2.92;2.92	5.58	-0.19	0.13256	Src homology-3 domain (2);Variant SH3 (1);	.	.	.	.	T	0.07324	0.0185	N	0.13198	0.31	0.09310	N	1	B	0.30068	0.267	B	0.30495	0.116	T	0.36890	-0.9729	9	0.35671	T	0.21	.	13.879	0.63672	0.0829:0.6109:0.3062:0.0	.	54	Q5JRA6	MIA3_HUMAN	Q	54	ENSP00000340900:E54Q;ENSP00000340587:E54Q;ENSP00000341348:E54Q	ENSP00000325973:E54Q	E	+	1	0	MIA3	220861150	0.222000	0.23652	0.198000	0.23420	0.715000	0.41141	0.749000	0.26320	0.295000	0.22570	-0.127000	0.14921	GAA	MIA3	-	pfam_SH3_2,superfamily_SH3_domain	ENSG00000154305		0.388	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4	82	0.00	0	G	NM_198551		222794527	222794527	+1	no_errors	ENST00000344441	ensembl	human	known	69_37n	missense	96	11.11	12	SNP	0.001	C
MICAL3	57553	genome.wustl.edu	37	22	18301523	18301523	+	Missense_Mutation	SNP	T	T	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr22:18301523T>G	ENST00000441493.2	-	26	4256	c.3904A>C	c.(3904-3906)Agt>Cgt	p.S1302R		NM_015241.2	NP_056056.2	Q7RTP6	MICA3_HUMAN	microtubule associated monooxygenase, calponin and LIM domain containing 3	1302	Pro-rich.				actin filament depolymerization (GO:0030042)|cytoskeleton organization (GO:0007010)|exocytosis (GO:0006887)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|FAD binding (GO:0071949)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, NAD(P)H as one donor, and incorporation of one atom of oxygen (GO:0016709)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	4		all_epithelial(15;0.198)		Lung(27;0.0427)		TTGGTGTCACTTTGGCTTTGG	0.632																																						dbGAP											0													56.0	64.0	61.0					22																	18301523		1989	4162	6151	-	-	-	SO:0001583	missense	0			AB037785	CCDS46659.1, CCDS46660.1, CCDS46661.1	22q11.21	2013-03-26	2013-03-26		ENSG00000243156	ENSG00000243156			24694	protein-coding gene	gene with protein product		608882				12110185	Standard	NM_015241		Approved	KIAA0819	uc002zng.4	Q7RTP6	OTTHUMG00000150067	ENST00000441493.2:c.3904A>C	22.37:g.18301523T>G	ENSP00000416015:p.Ser1302Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXJ5|E9PEF0|O94909|Q5U4P4|Q6ICK4|Q96DF2|Q9P2I3	Missense_Mutation	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,pfam_mOase_FAD-bd,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM,prints_Rng_hydrolase-like	p.S1302R	ENST00000441493.2	37	c.3904	CCDS46659.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.854|3.854	-0.031201|-0.031201	0.07543|0.07543	.|.	.|.	ENSG00000093100|ENSG00000093100	ENST00000252134|ENST00000441493	.|T	.|0.61859	.|0.07	4.21|4.21	1.98|1.98	0.26296|0.26296	.|.	.|.	.|.	.|.	.|.	T|T	0.35480|0.35480	0.0933|0.0933	N|N	0.08118|0.08118	0|0	0.20074|0.20074	N|N	0.999936|0.999936	.|B	.|0.09022	.|0.002	.|B	.|0.04013	.|0.001	T|T	0.22312|0.22312	-1.0220|-1.0220	5|9	.|0.39692	.|T	.|0.17	.|.	9.9174|9.9174	0.41444|0.41444	0.0:0.832:0.0:0.168|0.0:0.832:0.0:0.168	.|.	.|1302	.|Q7RTP6	.|MICA3_HUMAN	N|R	283|1302	.|ENSP00000416015:S1302R	.|ENSP00000416015:S1302R	K|S	-|-	3|1	2|0	XXbac-B461K10.4|XXbac-B461K10.4	16681523|16681523	0.018000|0.018000	0.18449|0.18449	0.005000|0.005000	0.12908|0.12908	0.002000|0.002000	0.02628|0.02628	1.734000|1.734000	0.38166|0.38166	0.427000|0.427000	0.26145|0.26145	-0.624000|-0.624000	0.04008|0.04008	AAA|AGT	MICAL3	-	NULL	ENSG00000243156		0.632	MICAL3-010	KNOWN	basic|appris_principal|CCDS	protein_coding	MICAL3	HGNC	protein_coding	OTTHUMT00000447351.1	78	0.00	0	T			18301523	18301523	-1	no_errors	ENST00000441493	ensembl	human	known	69_37n	missense	58	18.31	13	SNP	0.003	G
MIR516A1	574498	genome.wustl.edu	37	19	54257356	54257356	+	RNA	SNP	A	A	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:54257356A>G	ENST00000385033.1	+	0	0				MIR522_ENST00000385071.1_RNA|MIR519A1_ENST00000385257.1_RNA|MIR527_ENST00000385244.1_RNA	NR_030220.1				microRNA 516a-1																		ACGGTTTGAGAAAAGCAACGT	0.433																																						dbGAP											0													99.0	94.0	95.0					19																	54257356		1568	3582	5150	-	-	-			0					19q13.42	2011-09-12	2007-10-23	2008-12-18	ENSG00000207767	ENSG00000207767		"""ncRNAs / Micro RNAs"""	32130	non-coding RNA	RNA, micro			"""microRNA 516-1"""	MIRN516-1, MIRN516A1			Standard	NR_030220		Approved	hsa-mir-516-1, hsa-mir-516a-1	uc021vaw.1				19.37:g.54257356A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000385033.1	37	NULL		19																																																																																			MIR527	-	-	ENSG00000207979		0.433	MIR516A1-201	KNOWN	basic	miRNA	MIR527	HGNC	miRNA		52	0.00	0	A	NR_030220		54257356	54257356	+1	no_errors	ENST00000385244	ensembl	human	known	69_37n	rna	68	36.45	39	SNP	0.881	G
MTHFD1	4522	genome.wustl.edu	37	14	64894165	64894165	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr14:64894165C>T	ENST00000545908.1	+	12	1635	c.1406C>T	c.(1405-1407)tCt>tTt	p.S469F	CTD-2555O16.2_ENST00000556640.1_RNA|MTHFD1_ENST00000216605.8_Missense_Mutation_p.S413F			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	413	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	CGACAGCCTTCTCAGGGCCCC	0.562																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	dbGAP											0													135.0	122.0	126.0					14																	64894165		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.1406C>T	14.37:g.64894165C>T	ENSP00000438588:p.Ser469Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.S469F	ENST00000545908.1	37	c.1406		14	.	.	.	.	.	.	.	.	.	.	C	31	5.092985	0.94149	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.41400	1.0;1.0;1.0;1.0	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.80884	0.4709	H	0.98965	4.385	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.88015	0.2765	10	0.87932	D	0	-18.9341	20.2983	0.98569	0.0:1.0:0.0:0.0	.	469;413;413	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	F	469;413;469;393	ENSP00000438588:S469F;ENSP00000450560:S413F;ENSP00000216605:S469F;ENSP00000451309:S393F	ENSP00000216605:S413F	S	+	2	0	MTHFD1	63963918	1.000000	0.71417	0.970000	0.41538	0.767000	0.43475	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	TCT	MTHFD1	-	pfam_Formate_THF_ligase	ENSG00000100714		0.562	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	HGNC	protein_coding	OTTHUMT00000412167.1	57	0.00	0	C			64894165	64894165	+1	no_errors	ENST00000216605	ensembl	human	known	69_37n	missense	7	92.78	90	SNP	1.000	T
MTHFD1	4522	genome.wustl.edu	37	14	64894167	64894167	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr14:64894167C>T	ENST00000545908.1	+	12	1637	c.1408C>T	c.(1408-1410)Cag>Tag	p.Q470*	CTD-2555O16.2_ENST00000556640.1_RNA|MTHFD1_ENST00000216605.8_Nonsense_Mutation_p.Q414*			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	414	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	ACAGCCTTCTCAGGGCCCCAC	0.557																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	dbGAP											0													134.0	121.0	125.0					14																	64894167		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.1408C>T	14.37:g.64894167C>T	ENSP00000438588:p.Gln470*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Nonsense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.Q470*	ENST00000545908.1	37	c.1408		14	.	.	.	.	.	.	.	.	.	.	C	36	5.779341	0.96929	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	.	.	.	5.91	5.91	0.95273	.	0.060772	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.2155	20.2983	0.98569	0.0:1.0:0.0:0.0	.	.	.	.	X	470;414;470;394	.	ENSP00000216605:Q414X	Q	+	1	0	MTHFD1	63963920	1.000000	0.71417	0.998000	0.56505	0.793000	0.44817	7.818000	0.86416	2.802000	0.96397	0.655000	0.94253	CAG	MTHFD1	-	pfam_Formate_THF_ligase	ENSG00000100714		0.557	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	HGNC	protein_coding	OTTHUMT00000412167.1	60	0.00	0	C			64894167	64894167	+1	no_errors	ENST00000216605	ensembl	human	known	69_37n	nonsense	7	92.86	91	SNP	1.000	T
MYCBPAP	84073	genome.wustl.edu	37	17	48598683	48598683	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:48598683G>A	ENST00000323776.5	+	9	1330	c.1168G>A	c.(1168-1170)Gat>Aat	p.D390N	MYCBPAP_ENST00000436259.2_Missense_Mutation_p.D353N	NM_032133.4	NP_115509.4			MYCBP associated protein											breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(8)|ovary(4)|pancreas(1)|skin(2)|urinary_tract(2)	31	Breast(11;1.23e-18)		BRCA - Breast invasive adenocarcinoma(22;1.23e-09)			GGAGGATATTGATGGCCTGGA	0.547																																						dbGAP											0													74.0	74.0	74.0					17																	48598683		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC028393	CCDS32680.2	17q21.33	2004-02-19			ENSG00000136449	ENSG00000136449			19677	protein-coding gene	gene with protein product		609835				12151104	Standard	NM_032133		Approved	AMAP-1, DKFZp434N1415	uc010wmr.2	Q8TBZ2	OTTHUMG00000157184	ENST00000323776.5:c.1168G>A	17.37:g.48598683G>A	ENSP00000323184:p.Asp390Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.D390N	ENST00000323776.5	37	c.1168	CCDS32680.2	17	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713233	0.89112	.	.	ENSG00000136449	ENST00000323776;ENST00000436259	T;T	0.50813	0.73;0.73	5.47	5.47	0.80525	.	0.059716	0.64402	D	0.000005	T	0.70474	0.3228	M	0.80183	2.485	0.47308	D	0.999384	D;D	0.89917	1.0;1.0	D;D	0.71870	0.975;0.975	T	0.74166	-0.3753	10	0.66056	D	0.02	-15.0246	17.0987	0.86642	0.0:0.0:1.0:0.0	.	353;390	Q8TBZ2;B4DZQ1	MYBPP_HUMAN;.	N	390;353	ENSP00000323184:D390N;ENSP00000397209:D353N	ENSP00000323184:D390N	D	+	1	0	MYCBPAP	45953682	1.000000	0.71417	0.960000	0.40013	0.862000	0.49288	5.055000	0.64282	2.555000	0.86185	0.555000	0.69702	GAT	MYCBPAP	-	NULL	ENSG00000136449		0.547	MYCBPAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYCBPAP	HGNC	protein_coding	OTTHUMT00000347814.1	33	0.00	0	G	NM_032133		48598683	48598683	+1	no_errors	ENST00000323776	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.992	A
MYOF	26509	genome.wustl.edu	37	10	95095846	95095846	+	Intron	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr10:95095846G>C	ENST00000359263.4	-	41	4437				MYOF_ENST00000358334.5_Intron|MYOF_ENST00000371502.4_Intron|MYOF_ENST00000371501.4_Intron	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin						blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						TTAAAATGCAGGTAAGGTcta	0.443																																						dbGAP											0													49.0	45.0	47.0					10																	95095846		1870	4107	5977	-	-	-	SO:0001627	intron_variant	0			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.4438-43C>G	10.37:g.95095846G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	RNA	SNP	-	NULL	ENST00000359263.4	37	NULL	CCDS41551.1	10																																																																																			MYOF	-	-	ENSG00000138119		0.443	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2	33	0.00	0	G	NM_013451		95095846	95095846	-1	no_errors	ENST00000463541	ensembl	human	known	69_37n	rna	7	68.18	15	SNP	0.121	C
MROH6	642475	genome.wustl.edu	37	8	144657806	144657806	+	5'Flank	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr8:144657806C>A	ENST00000398882.3	-	0	0				NAPRT1_ENST00000426292.3_Missense_Mutation_p.G392C|NAPRT1_ENST00000449291.2_Missense_Mutation_p.G392C|NAPRT1_ENST00000276844.7_Missense_Mutation_p.G392C|NAPRT1_ENST00000460623.1_5'UTR|NAPRT1_ENST00000435154.3_Missense_Mutation_p.G392C|RP11-661A12.9_ENST00000531730.1_RNA	NM_001100878.1	NP_001094348.1	A6NGR9	MROH6_HUMAN	maestro heat-like repeat family member 6																		TAGACGCCACCCAGGGAAGGC	0.647																																						dbGAP											0													23.0	22.0	22.0					8																	144657806		2192	4298	6490	-	-	-	SO:0001631	upstream_gene_variant	0			AF289596	CCDS47928.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000204839	ENSG00000204839		"""maestro heat-like repeat containing"""	27814	protein-coding gene	gene with protein product			"""chromosome 8 open reading frame 73"""	C8orf73		12477932	Standard	NM_001100878		Approved		uc010mff.3	A6NGR9	OTTHUMG00000165164		8.37:g.144657806C>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWB1	Missense_Mutation	SNP	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nic_PRibTrfase-rel,tigrfam_Nic_PRibTrfase_put	p.G392C	ENST00000398882.3	37	c.1174	CCDS47928.1	8	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537534	0.85917	.	.	ENSG00000147813	ENST00000435154;ENST00000449291;ENST00000340490;ENST00000426292;ENST00000276844	T;T;T;T;T	0.58940	0.44;0.43;0.39;0.3;0.41	4.65	4.65	0.58169	Quinolinate phosphoribosyl transferase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.81437	0.4822	M	0.92784	3.345	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.86776	0.1976	10	0.87932	D	0	-22.0754	16.1097	0.81250	0.0:1.0:0.0:0.0	.	392;392;392;392	C9J8U2;G5E977;Q6XQN6-3;Q6XQN6	.;.;.;PNCB_HUMAN	C	392	ENSP00000405670:G392C;ENSP00000401508:G392C;ENSP00000341136:G392C;ENSP00000390949:G392C;ENSP00000276844:G392C	ENSP00000276844:G392C	G	-	1	0	NAPRT1	144728949	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.005000	0.63972	2.123000	0.65237	0.655000	0.94253	GGT	NAPRT1	-	pfam_Nic_PRibTrfase-like,superfamily_Quinolinate_PRibosylTrfase_C,pirsf_Nic_PRibTrfase-rel,tigrfam_Nic_PRibTrfase_put	ENSG00000147813		0.647	MROH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAPRT1	HGNC	protein_coding	OTTHUMT00000382330.3	36	0.00	0	C	NM_001100878		144657806	144657806	-1	no_errors	ENST00000276844	ensembl	human	known	69_37n	missense	95	36.67	55	SNP	1.000	A
NEK9	91754	genome.wustl.edu	37	14	75558062	75558062	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr14:75558062C>G	ENST00000238616.5	-	19	2511	c.2353G>C	c.(2353-2355)Gac>Cac	p.D785H		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	785	Interaction with NEK6.|Pro/Ser/Thr-rich.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		ATTCCTCGGTCTGCTTCCATT	0.572																																						dbGAP											0													114.0	102.0	106.0					14																	75558062		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.2353G>C	14.37:g.75558062C>G	ENSP00000238616:p.Asp785His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D785H	ENST00000238616.5	37	c.2353	CCDS9839.1	14	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479427	0.63849	.	.	ENSG00000119638	ENST00000238616	T	0.74842	-0.88	5.66	5.66	0.87406	.	0.092767	0.64402	D	0.000001	T	0.78773	0.4336	N	0.19112	0.55	0.42144	D	0.991522	P;D	0.71674	0.937;0.998	P;D	0.69479	0.501;0.964	T	0.81575	-0.0870	10	0.66056	D	0.02	.	19.752	0.96271	0.0:1.0:0.0:0.0	.	785;128	Q8TD19;Q6PKF2	NEK9_HUMAN;.	H	785	ENSP00000238616:D785H	ENSP00000238616:D785H	D	-	1	0	NEK9	74627815	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.500000	0.60387	2.668000	0.90789	0.462000	0.41574	GAC	NEK9	-	NULL	ENSG00000119638		0.572	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK9	HGNC	protein_coding	OTTHUMT00000415021.1	39	0.00	0	C	NM_033116		75558062	75558062	-1	no_errors	ENST00000238616	ensembl	human	known	69_37n	missense	51	26.09	18	SNP	1.000	G
NKPD1	284353	genome.wustl.edu	37	19	45656343	45656343	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:45656343C>G	ENST00000438936.2	-	3	897	c.686G>C	c.(685-687)aGg>aCg	p.R229T	NKPD1_ENST00000589776.1_Missense_Mutation_p.R229T|AC005757.7_ENST00000589594.1_lincRNA|NKPD1_ENST00000317951.4_Missense_Mutation_p.R451T|NKPD1_ENST00000429338.1_Missense_Mutation_p.R229T			Q17RQ9	NKPD1_HUMAN	NTPase, KAP family P-loop domain containing 1	229	KAP NTPase.					integral component of membrane (GO:0016021)				endometrium(1)|lung(4)|prostate(2)|urinary_tract(1)	8		Ovarian(192;0.0728)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00863)|GBM - Glioblastoma multiforme(486;0.231)		CACGCGCAGCCTGCGCCGCTG	0.637																																						dbGAP											0													9.0	11.0	10.0					19																	45656343		2118	4237	6355	-	-	-	SO:0001583	missense	0			AK090919		19q13.32	2012-07-02		2012-07-02	ENSG00000179846	ENSG00000179846			24739	protein-coding gene	gene with protein product						14702039	Standard	NM_198478		Approved	FLJ33600	uc010xxi.2	Q17RQ9	OTTHUMG00000160521	ENST00000438936.2:c.686G>C	19.37:g.45656343C>G	ENSP00000401739:p.Arg229Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLG6|D6RH15|Q8N2A2	Missense_Mutation	SNP	pfam_KAP_NTPase	p.R451T	ENST00000438936.2	37	c.1352		19	.	.	.	.	.	.	.	.	.	.	C	14.30	2.493186	0.44352	.	.	ENSG00000179846	ENST00000317951;ENST00000438936;ENST00000429338	T;T;T	0.29142	1.58;1.58;1.58	4.76	4.76	0.60689	KAP P-loop (1);	0.070765	0.52532	D	0.000073	T	0.46112	0.1376	M	0.61703	1.905	0.37128	D	0.901144	D	0.69078	0.997	D	0.65874	0.939	T	0.50224	-0.8853	10	0.34782	T	0.22	-28.2619	8.9956	0.36050	0.0:0.8974:0.0:0.1026	.	229	Q17RQ9	NKPD1_HUMAN	T	451;229;229	ENSP00000321976:R451T;ENSP00000401739:R229T;ENSP00000404706:R229T	ENSP00000321976:R451T	R	-	2	0	NKPD1	50348183	0.706000	0.27856	1.000000	0.80357	0.634000	0.38068	1.536000	0.36072	2.179000	0.69175	0.313000	0.20887	AGG	NKPD1	-	pfam_KAP_NTPase	ENSG00000179846		0.637	NKPD1-001	KNOWN	basic	protein_coding	NKPD1	HGNC	protein_coding	OTTHUMT00000360950.2	38	0.00	0	C	NM_198478		45656343	45656343	-1	no_errors	ENST00000317951	ensembl	human	known	69_37n	missense	59	32.18	28	SNP	1.000	G
NLRP13	126204	genome.wustl.edu	37	19	56423221	56423221	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:56423221C>T	ENST00000342929.3	-	5	1961	c.1962G>A	c.(1960-1962)atG>atA	p.M654I	NLRP13_ENST00000588751.1_Missense_Mutation_p.M654I	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	654							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TACGACCCAACATCTTCTTTG	0.403																																						dbGAP											0													108.0	105.0	106.0					19																	56423221		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1962G>A	19.37:g.56423221C>T	ENSP00000343891:p.Met654Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7RTR5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.M654I	ENST00000342929.3	37	c.1962	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	C	1.070	-0.670118	0.03403	.	.	ENSG00000173572	ENST00000342929	D	0.87491	-2.26	2.48	-0.263	0.12954	.	.	.	.	.	T	0.65365	0.2684	N	0.03608	-0.345	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.53187	-0.8474	9	0.19147	T	0.46	.	3.254	0.06824	0.3737:0.4092:0.2171:0.0	.	654	Q86W25	NAL13_HUMAN	I	654	ENSP00000343891:M654I	ENSP00000343891:M654I	M	-	3	0	NLRP13	61115033	0.000000	0.05858	0.003000	0.11579	0.088000	0.18126	-0.975000	0.03790	0.260000	0.21731	0.543000	0.68304	ATG	NLRP13	-	NULL	ENSG00000173572		0.403	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	34	0.00	0	C	NM_176810		56423221	56423221	-1	no_errors	ENST00000342929	ensembl	human	known	69_37n	missense	22	12.00	3	SNP	0.000	T
NOMO1	23420	genome.wustl.edu	37	16	14962408	14962408	+	Missense_Mutation	SNP	T	T	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr16:14962408T>G	ENST00000287667.7	+	16	1981	c.1810T>G	c.(1810-1812)Ttt>Gtt	p.F604V		NM_014287.3	NP_055102.3	Q15155	NOMO1_HUMAN	NODAL modulator 1	604						integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)			endometrium(6)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|skin(2)	30						TCCTTAGGAATTTTATCAGGA	0.413																																						dbGAP											0													215.0	222.0	220.0					16																	14962408		2196	4300	6496	-	-	-	SO:0001583	missense	0			X57398	CCDS10556.1	16p13.11	2008-02-05			ENSG00000103512	ENSG00000103512			30060	protein-coding gene	gene with protein product		609157				1310294, 15257293	Standard	NM_014287		Approved	PM5	uc002dcv.3	Q15155	OTTHUMG00000090541	ENST00000287667.7:c.1810T>G	16.37:g.14962408T>G	ENSP00000287667:p.Phe604Val	Somatic		WXS	Illumina GAIIx	Phase_IV	P78421|Q8IW21|Q96DG0	Missense_Mutation	SNP	pfam_DUF2012,superfamily_CarboxyPept-like_regulatory,superfamily_Carb-bd-like_fold,superfamily_Collagen-bd_Cna_B-typ_dom	p.F604V	ENST00000287667.7	37	c.1810	CCDS10556.1	16	.	.	.	.	.	.	.	.	.	.	.	18.42	3.620346	0.66787	.	.	ENSG00000103512	ENST00000287667;ENST00000456867;ENST00000536948	T	0.03607	3.87	2.93	2.93	0.34026	.	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	M	0.68317	2.08	0.80722	D	1	D	0.57257	0.979	P	0.49999	0.628	T	0.45571	-0.9252	10	0.11182	T	0.66	-18.7487	9.3114	0.37908	0.0:0.0:0.0:1.0	.	604	Q15155	NOMO1_HUMAN	V	604;604;437	ENSP00000287667:F604V	ENSP00000287667:F604V	F	+	1	0	NOMO1	14869909	1.000000	0.71417	0.995000	0.50966	0.856000	0.48823	7.465000	0.80898	1.335000	0.45486	0.327000	0.21459	TTT	NOMO1	-	NULL	ENSG00000103512		0.413	NOMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOMO1	HGNC	protein_coding	OTTHUMT00000207065.1	66	0.00	0	T			14962408	14962408	+1	no_errors	ENST00000287667	ensembl	human	known	69_37n	missense	72	36.28	41	SNP	1.000	G
NR1H3	10062	genome.wustl.edu	37	11	47289890	47289890	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr11:47289890C>G	ENST00000467728.1	+	8	2419	c.1181C>G	c.(1180-1182)tCc>tGc	p.S394C	MADD_ENST00000407859.3_5'Flank|RP11-17G12.3_ENST00000545474.1_RNA|MADD_ENST00000402799.1_5'Flank|MADD_ENST00000349238.3_5'Flank|NR1H3_ENST00000407404.1_Missense_Mutation_p.S334C|MADD_ENST00000311027.5_5'Flank|MADD_ENST00000406482.1_5'Flank|NR1H3_ENST00000527949.1_Missense_Mutation_p.S243C|NR1H3_ENST00000405853.3_Missense_Mutation_p.S334C|MADD_ENST00000342922.4_5'Flank|MADD_ENST00000402192.2_5'Flank|NR1H3_ENST00000441012.2_Missense_Mutation_p.S394C|NR1H3_ENST00000481889.2_Missense_Mutation_p.S413C|MADD_ENST00000395344.3_5'Flank|RP11-17G12.3_ENST00000543925.1_RNA|NR1H3_ENST00000395397.3_Missense_Mutation_p.S349C|NR1H3_ENST00000529540.1_3'UTR|NR1H3_ENST00000405576.1_Missense_Mutation_p.S289C|MADD_ENST00000395336.3_5'Flank			Q13133	NR1H3_HUMAN	nuclear receptor subfamily 1, group H, member 3	394	Ligand-binding. {ECO:0000255}.				apoptotic cell clearance (GO:0043277)|cellular lipid metabolic process (GO:0044255)|cellular response to lipopolysaccharide (GO:0071222)|cholesterol homeostasis (GO:0042632)|gene expression (GO:0010467)|lipid homeostasis (GO:0055088)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage activation (GO:0043031)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of pinocytosis (GO:0048550)|negative regulation of proteolysis (GO:0045861)|negative regulation of secretion of lysosomal enzymes (GO:0090341)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|response to progesterone (GO:0032570)|sterol homeostasis (GO:0055092)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|steroid hormone receptor activity (GO:0003707)|sterol response element binding (GO:0032810)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|large_intestine(6)|lung(6)|ovary(5)	20						GCCTACGTCTCCATCCACCAT	0.542																																						dbGAP											0													139.0	115.0	123.0					11																	47289890		2201	4298	6499	-	-	-	SO:0001583	missense	0			U22662	CCDS7929.1, CCDS44584.1, CCDS44585.1, CCDS73285.1	11p11.2	2013-01-16			ENSG00000025434	ENSG00000025434		"""Nuclear hormone receptors"""	7966	protein-coding gene	gene with protein product	"""liver X receptor-alpha"""	602423				8621574, 7744246	Standard	NM_005693		Approved	LXR-a, RLD-1	uc009ylm.3	Q13133	OTTHUMG00000150628	ENST00000467728.1:c.1181C>G	11.37:g.47289890C>G	ENSP00000420656:p.Ser394Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3J9|D3DQR1|Q8IW13|Q96H87	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Liver_X_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Ecdystd_rcpt	p.S394C	ENST00000467728.1	37	c.1181	CCDS7929.1	11	.	.	.	.	.	.	.	.	.	.	C	13.65	2.300004	0.40694	.	.	ENSG00000025434	ENST00000395397;ENST00000405576;ENST00000481889;ENST00000407404;ENST00000441012;ENST00000467728;ENST00000405853;ENST00000527949	D;D;D;D;D;D;D;D	0.97016	-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21;-4.21	5.4	5.4	0.78164	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.350545	0.33712	N	0.004621	D	0.91818	0.7411	N	0.17082	0.46	0.30489	N	0.771599	B;B;B;B;B	0.19445	0.003;0.005;0.022;0.036;0.016	B;B;B;B;B	0.20184	0.007;0.02;0.028;0.027;0.028	D	0.88204	0.2886	10	0.51188	T	0.08	.	14.1174	0.65164	0.0:0.732:0.268:0.0	.	400;289;394;413;334	B4DXU5;B5MBY7;Q13133;E9PLL4;Q13133-2	.;.;NR1H3_HUMAN;.;.	C	349;289;413;334;394;394;334;243	ENSP00000378793:S349C;ENSP00000385073:S289C;ENSP00000433271:S413C;ENSP00000385801:S334C;ENSP00000387946:S394C;ENSP00000420656:S394C;ENSP00000384745:S334C;ENSP00000432073:S243C	ENSP00000378793:S349C	S	+	2	0	NR1H3	47246466	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.672000	0.54583	2.701000	0.92244	0.655000	0.94253	TCC	NR1H3	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core	ENSG00000025434		0.542	NR1H3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1H3	HGNC	protein_coding	OTTHUMT00000319214.3	17	0.00	0	C			47289890	47289890	+1	no_errors	ENST00000441012	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	1.000	G
NRXN1	9378	genome.wustl.edu	37	2	50246399	50246399	+	Intron	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:50246399C>A	ENST00000406316.2	-	20	5515				NRXN1_ENST00000406859.3_Intron|NRXN1_ENST00000402717.3_Intron|NRXN1_ENST00000404971.1_Intron|NRXN1_ENST00000342183.5_Intron|NRXN1_ENST00000401710.1_Intron|NRXN1_ENST00000401669.2_Intron|NRXN1_ENST00000405472.3_Intron	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1						adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			gggttttggcctgttctccat	0.388																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.4038+34009G>T	2.37:g.50246399C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Missense_Mutation	SNP	smart_Neurexin-like	p.G5C	ENST00000406316.2	37	c.13	CCDS54360.1	2	.	.	.	.	.	.	.	.	.	.	C	8.501	0.864364	0.17250	.	.	ENSG00000179915	ENST00000378262	.	.	.	4.97	-4.88	0.03113	.	.	.	.	.	T	0.16214	0.0390	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.26018	-1.0115	4	.	.	.	.	0.9082	0.01289	0.2429:0.1772:0.3412:0.2386	.	.	.	.	C	5	.	.	G	-	1	0	NRXN1	50099903	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.123000	0.01319	-0.786000	0.04516	0.655000	0.94253	GGC	NRXN1	-	NULL	ENSG00000179915		0.388	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	163	0.00	0	C			50246399	50246399	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000378262	ensembl	human	novel	69_37n	missense	151	41.25	106	SNP	0.000	A
OBSCN	84033	genome.wustl.edu	37	1	228462358	228462358	+	Silent	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:228462358C>T	ENST00000422127.1	+	20	5813	c.5769C>T	c.(5767-5769)tcC>tcT	p.S1923S	RP5-1139B12.3_ENST00000602947.1_RNA|OBSCN_ENST00000366707.4_5'UTR|RP5-1139B12.2_ENST00000602517.1_RNA|OBSCN_ENST00000284548.11_Silent_p.S1923S|OBSCN_ENST00000359599.6_Silent_p.S770S|OBSCN_ENST00000570156.2_Silent_p.S2298S|OBSCN_ENST00000366709.4_5'UTR|RP5-1139B12.3_ENST00000602529.1_RNA	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	1923	Ig-like 19.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCGTGGTGTCCCCCAGTGATG	0.632																																						dbGAP											0													44.0	60.0	55.0					1																	228462358		2140	4243	6383	-	-	-	SO:0001819	synonymous_variant	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.5769C>T	1.37:g.228462358C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.S1923	ENST00000422127.1	37	c.5769	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000154358		0.632	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		97	0.00	0	C	NM_052843		228462358	228462358	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	silent	134	41.74	96	SNP	0.993	T
OR11H1	81061	genome.wustl.edu	37	22	16449539	16449539	+	Missense_Mutation	SNP	A	A	G	rs199856986	byFrequency	TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr22:16449539A>G	ENST00000252835.4	-	1	266	c.266T>C	c.(265-267)gTc>gCc	p.V89A		NM_001005239.1	NP_001005239.1	Q8NG94	O11H1_HUMAN	olfactory receptor, family 11, subfamily H, member 1	89						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)	11	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.208)		Kidney(3;0.00216)|KIRC - Kidney renal clear cell carcinoma(3;0.00244)|Lung(27;0.0724)|COAD - Colon adenocarcinoma(3;0.211)		TGTAGAAGAGACATACCATAT	0.418																																						dbGAP											0													1.0	1.0	1.0					22																	16449539		71	200	271	-	-	-	SO:0001583	missense	0			AP000535, AF399611	CCDS74807.1	22q11.1	2012-08-09			ENSG00000130538	ENSG00000130538		"""GPCR / Class A : Olfactory receptors"""	15404	protein-coding gene	gene with protein product						12213199	Standard	NM_001005239		Approved	OR22-1	uc011agd.2	Q8NG94	OTTHUMG00000030069	ENST00000252835.4:c.266T>C	22.37:g.16449539A>G	ENSP00000252835:p.Val89Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEX0|Q96R32	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V89A	ENST00000252835.4	37	c.266	CCDS33594.1	22	.	.	.	.	.	.	.	.	.	.	a	9.377	1.072113	0.20147	.	.	ENSG00000130538	ENST00000252835	T	0.00418	7.49	2.19	2.19	0.27852	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37715	N	0.001976	T	0.00328	0.0010	L	0.47078	1.49	0.09310	N	1	P	0.42409	0.779	B	0.40636	0.335	T	0.53158	-0.8478	10	0.37606	T	0.19	.	8.3461	0.32275	1.0:0.0:0.0:0.0	.	89	Q8NG94	O11H1_HUMAN	A	89	ENSP00000252835:V89A	ENSP00000252835:V89A	V	-	2	0	OR11H1	14829539	0.000000	0.05858	0.990000	0.47175	0.581000	0.36288	0.456000	0.21859	0.966000	0.38159	0.302000	0.19851	GTC	OR11H1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000130538		0.418	OR11H1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	OR11H1	HGNC	protein_coding	OTTHUMT00000074923.2	32	0.00	0	A	NM_001005239		16449539	16449539	-1	no_errors	ENST00000252835	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	0.234	G
OR51B4	79339	genome.wustl.edu	37	11	5322396	5322396	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr11:5322396A>T	ENST00000380224.1	-	1	830	c.781T>A	c.(781-783)Ttt>Att	p.F261I	HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron|HBG2_ENST00000380259.2_Intron	NM_033179.2	NP_149419.2	Q9Y5P0	O51B4_HUMAN	olfactory receptor, family 51, subfamily B, member 4	261					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	20		Medulloblastoma(188;0.00225)|Breast(177;0.0155)|all_neural(188;0.0212)		Epithelial(150;2.76e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TGTTTCCCAAACCTGTGAATG	0.423																																						dbGAP											0													110.0	100.0	103.0					11																	5322396		2201	4297	6498	-	-	-	SO:0001583	missense	0			BC069094	CCDS7757.1	11p15.4	2012-08-09			ENSG00000183251	ENSG00000183251		"""GPCR / Class A : Olfactory receptors"""	14708	protein-coding gene	gene with protein product							Standard	NM_033179		Approved		uc010qza.2	Q9Y5P0	OTTHUMG00000066665	ENST00000380224.1:c.781T>A	11.37:g.5322396A>T	ENSP00000369573:p.Phe261Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MAV5|Q6NTD7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F261I	ENST00000380224.1	37	c.781	CCDS7757.1	11	.	.	.	.	.	.	.	.	.	.	A	14.48	2.548653	0.45383	.	.	ENSG00000183251	ENST00000380224	T	0.00042	8.84	4.24	4.24	0.50183	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48767	D	0.000176	T	0.00468	0.0015	M	0.87097	2.86	0.26490	N	0.974961	D	0.89917	1.0	D	0.97110	1.0	T	0.25047	-1.0143	10	0.87932	D	0	.	7.2635	0.26217	0.8987:0.0:0.1013:0.0	.	261	Q9Y5P0	O51B4_HUMAN	I	261	ENSP00000369573:F261I	ENSP00000369573:F261I	F	-	1	0	OR51B4	5278972	0.990000	0.36364	1.000000	0.80357	0.332000	0.28634	3.157000	0.50716	1.779000	0.52309	0.528000	0.53228	TTT	OR51B4	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183251		0.423	OR51B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51B4	HGNC	protein_coding	OTTHUMT00000142956.2	56	0.00	0	A	NM_033179		5322396	5322396	-1	no_errors	ENST00000380224	ensembl	human	known	69_37n	missense	68	39.29	44	SNP	0.998	T
PCDHB7	56129	genome.wustl.edu	37	5	140552633	140552633	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr5:140552633C>T	ENST00000231137.3	+	1	391	c.217C>T	c.(217-219)Caa>Taa	p.Q73*		NM_018940.2	NP_061763.1	Q9Y5E2	PCDB7_HUMAN	protocadherin beta 7	73	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(20)|lung(54)|ovary(5)|prostate(7)|skin(7)|upper_aerodigestive_tract(4)|urinary_tract(1)	119			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCAGAACATGCAAATTTTACT	0.493																																						dbGAP											0													85.0	88.0	87.0					5																	140552633		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF152500	CCDS4249.1	5q31	2010-01-26			ENSG00000113212	ENSG00000113212		"""Cadherins / Protocadherins : Clustered"""	8692	other	protocadherin		606333				10380929	Standard	NM_018940		Approved	PCDH-BETA7	uc003lit.3	Q9Y5E2	OTTHUMG00000129608	ENST00000231137.3:c.217C>T	5.37:g.140552633C>T	ENSP00000231137:p.Gln73*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3Y8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q73*	ENST00000231137.3	37	c.217	CCDS4249.1	5	.	.	.	.	.	.	.	.	.	.	C	10.19	1.280764	0.23392	.	.	ENSG00000113212	ENST00000231137	.	.	.	4.61	0.493	0.16878	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	10.4552	0.44546	0.1385:0.4302:0.4313:0.0	.	.	.	.	X	73	.	ENSP00000231137:Q73X	Q	+	1	0	PCDHB7	140532817	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.731000	0.01853	-0.154000	0.11118	-0.176000	0.13171	CAA	PCDHB7	-	pfam_Cadherin_N,superfamily_Cadherin-like,prints_Cadherin	ENSG00000113212		0.493	PCDHB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB7	HGNC	protein_coding	OTTHUMT00000251803.2	27	0.00	0	C	NM_018940		140552633	140552633	+1	no_errors	ENST00000231137	ensembl	human	known	69_37n	nonsense	20	20.00	5	SNP	0.000	T
PCDHGA4	56111	genome.wustl.edu	37	5	140735578	140735578	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr5:140735578G>A	ENST00000571252.1	+	1	811	c.811G>A	c.(811-813)Gaa>Aaa	p.E271K	PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	271	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGATCCAGATGAAGGAGCCAA	0.453																																						dbGAP											0													41.0	44.0	43.0					5																	140735578		1983	4162	6145	-	-	-	SO:0001583	missense	0			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.811G>A	5.37:g.140735578G>A	ENSP00000458570:p.Glu271Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5D3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E271K	ENST00000571252.1	37	c.811	CCDS58979.1	5																																																																																			PCDHGA4	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000262576		0.453	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	22	0.00	0	G	NM_018917		140735578	140735578	+1	no_errors	ENST00000571252	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	1.000	A
PFDN1	5201	genome.wustl.edu	37	5	139680102	139680102	+	Silent	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr5:139680102C>T	ENST00000261813.4	-	2	146	c.99G>A	c.(97-99)caG>caA	p.Q33Q	PFDN1_ENST00000524074.1_Silent_p.Q33Q|PFDN1_ENST00000514611.1_5'UTR|PFDN1_ENST00000510217.1_Intron	NM_002622.4	NP_002613.2	O60925	PFD1_HUMAN	prefoldin subunit 1	33					'de novo' posttranslational protein folding (GO:0051084)|actin cytoskeleton organization (GO:0030036)|B cell activation (GO:0042113)|cell cycle (GO:0007049)|cellular protein metabolic process (GO:0044267)|cerebellum development (GO:0021549)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)|telencephalon development (GO:0021537)	prefoldin complex (GO:0016272)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|prostate(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGTTCAATCTGTATGTCTG	0.383																																						dbGAP											0													250.0	205.0	220.0					5																	139680102		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y17392	CCDS4222.1	5q31	2008-02-05	2006-02-24		ENSG00000113068	ENSG00000113068			8866	protein-coding gene	gene with protein product		604897	"""prefoldin 1"""			9630229	Standard	XM_005268465		Approved	PFD1	uc003lff.1	O60925	OTTHUMG00000129249	ENST00000261813.4:c.99G>A	5.37:g.139680102C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD02|Q53F95|Q96EX6	Silent	SNP	pfam_PFD_beta-like,superfamily_Prefoldin	p.Q33	ENST00000261813.4	37	c.99	CCDS4222.1	5																																																																																			PFDN1	-	pfam_PFD_beta-like,superfamily_Prefoldin	ENSG00000113068		0.383	PFDN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFDN1	HGNC	protein_coding	OTTHUMT00000251354.3	74	0.00	0	C	NM_002622		139680102	139680102	-1	no_errors	ENST00000261813	ensembl	human	known	69_37n	silent	100	31.03	45	SNP	1.000	T
PCDHGA6	56109	genome.wustl.edu	37	5	140754608	140754608	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr5:140754608G>A	ENST00000517434.1	+	1	958	c.958G>A	c.(958-960)Gaa>Aaa	p.E320K	PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	320	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCTGGGTGTTGAAGCCCGGGA	0.403																																						dbGAP											0													133.0	137.0	135.0					5																	140754608		1848	4082	5930	-	-	-	SO:0001583	missense	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.958G>A	5.37:g.140754608G>A	ENSP00000429601:p.Glu320Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8K7|B2RN55|Q9Y5D1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E320K	ENST00000517434.1	37	c.958	CCDS54926.1	5	.	.	.	.	.	.	.	.	.	.	.	16.08	3.020632	0.54576	.	.	ENSG00000253731	ENST00000517434	T	0.60797	0.16	5.14	5.14	0.70334	Cadherin (5);Cadherin-like (1);	0.758636	0.09899	U	0.741322	T	0.56108	0.1963	L	0.31207	0.915	0.22050	N	0.9994	B;P	0.41710	0.264;0.76	B;P	0.46208	0.187;0.507	T	0.52139	-0.8615	10	0.54805	T	0.06	.	14.2298	0.65885	0.0:0.2492:0.7508:0.0	.	320;320	Q9Y5G7-2;Q9Y5G7	.;PCDG6_HUMAN	K	320	ENSP00000429601:E320K	ENSP00000429601:E320K	E	+	1	0	PCDHGA6	140734792	0.000000	0.05858	1.000000	0.80357	0.975000	0.68041	0.723000	0.25939	2.814000	0.96858	0.655000	0.94253	GAA	PCDHGA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000253731		0.403	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1	27	0.00	0	G	NM_018919		140754608	140754608	+1	no_errors	ENST00000517434	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	0.971	A
PHEX	5251	genome.wustl.edu	37	X	22056654	22056654	+	Splice_Site	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chrX:22056654G>C	ENST00000379374.4	+	2	751	c.186G>C	c.(184-186)gcG>gcC	p.A62A	PHEX_ENST00000537599.1_Splice_Site_p.A62A|PHEX_ENST00000535894.1_5'UTR	NM_000444.4	NP_000435.3	P78562	PHEX_HUMAN	phosphate regulating endopeptidase homolog, X-linked	62					bone mineralization (GO:0030282)|cell-cell signaling (GO:0007267)|cellular protein modification process (GO:0006464)|organophosphate metabolic process (GO:0019637)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|cervix(2)|endometrium(2)|large_intestine(12)|liver(1)|lung(19)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	42						GCATCGAAGCGGGTAAGTCAC	0.418																																						dbGAP											0													194.0	173.0	180.0					X																	22056654		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U82970	CCDS14204.1	Xp22.2-p22.1	2008-07-31	2008-07-31		ENSG00000102174	ENSG00000102174			8918	protein-coding gene	gene with protein product		300550	"""phosphate regulating gene with homologies to endopeptidases on the X chromosome (hypophosphatemia, vitamin D resistant rickets)"""	HYP, HPDR		7550339, 9070861	Standard	NM_000444		Approved	PEX, HPDR1, HYP1, XLH	uc004dah.3	P78562	OTTHUMG00000021241	ENST00000379374.4:c.187+1G>C	X.37:g.22056654G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O00678|Q13646|Q2M325|Q93032|Q99827	Silent	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.A62	ENST00000379374.4	37	c.186	CCDS14204.1	X																																																																																			PHEX	-	NULL	ENSG00000102174		0.418	PHEX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHEX	HGNC	protein_coding	OTTHUMT00000056035.1	42	0.00	0	G	NM_000444	Silent	22056654	22056654	+1	no_errors	ENST00000379374	ensembl	human	known	69_37n	silent	58	12.12	8	SNP	0.945	C
PKHD1L1	93035	genome.wustl.edu	37	8	110394764	110394764	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr8:110394764C>A	ENST00000378402.5	+	4	485	c.381C>A	c.(379-381)tgC>tgA	p.C127*		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	127	IPT/TIG 1.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ATAACACCTGCAAAGGTCACA	0.403										HNSCC(38;0.096)																												dbGAP											0													125.0	124.0	124.0					8																	110394764		1948	4155	6103	-	-	-	SO:0001587	stop_gained	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.381C>A	8.37:g.110394764C>A	ENSP00000367655:p.Cys127*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Nonsense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.C127*	ENST00000378402.5	37	c.381	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.837717	0.97009	.	.	ENSG00000205038	ENST00000378402	.	.	.	5.94	4.14	0.48551	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	.	11.448	0.50136	0.0:0.8517:0.0:0.1483	.	.	.	.	X	127	.	ENSP00000367655:C127X	C	+	3	2	PKHD1L1	110463940	0.985000	0.35326	0.979000	0.43373	0.991000	0.79684	0.185000	0.16958	0.844000	0.35094	-0.127000	0.14921	TGC	PKHD1L1	-	smart_IPT_TIG_rcpt	ENSG00000205038		0.403	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	35	0.00	0	C	NM_177531		110394764	110394764	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	nonsense	66	25.00	22	SNP	0.997	A
PHF20L1	51105	genome.wustl.edu	37	8	133855028	133855028	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr8:133855028G>C	ENST00000395386.2	+	19	2955	c.2656G>C	c.(2656-2658)Gat>Cat	p.D886H	PHF20L1_ENST00000395390.2_Missense_Mutation_p.D861H|AF230666.2_ENST00000608375.1_RNA|AF230666.2_ENST00000429151.1_RNA|PHF20L1_ENST00000220847.7_Missense_Mutation_p.D273H	NM_016018.4	NP_057102.4	A8MW92	P20L1_HUMAN	PHD finger protein 20-like 1	886							zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(1)|lung(10)|ovary(2)	15	all_neural(3;2.72e-06)|Medulloblastoma(3;7.08e-05)|Ovarian(258;0.00438)|Esophageal squamous(12;0.00507)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;4.46e-05)			AGATGATGATGATGTTAGTAG	0.388																																						dbGAP											0													106.0	100.0	102.0					8																	133855028		1862	4123	5985	-	-	-	SO:0001583	missense	0			AF230666	CCDS6367.2, CCDS6368.1, CCDS75791.1	8q24.22	2014-03-24			ENSG00000129292	ENSG00000129292		"""Tudor domain containing"", ""Zinc fingers, PHD-type"""	24280	protein-coding gene	gene with protein product	"""tudor domain containing 20B"""					10810093, 24492612	Standard	NM_016018		Approved	CGI-72, FLJ13649, MGC64923, FLJ21615, TDRD20B	uc003ytt.3	A8MW92	OTTHUMG00000148656	ENST00000395386.2:c.2656G>C	8.37:g.133855028G>C	ENSP00000378784:p.Asp886His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZC9|Q86U89|Q86W43|Q96BT0|Q9H702|Q9HBK3|Q9NYR3|Q9Y381	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD	p.D273H	ENST00000395386.2	37	c.817	CCDS6367.2	8	.	.	.	.	.	.	.	.	.	.	G	20.9	4.066369	0.76187	.	.	ENSG00000129292	ENST00000395386;ENST00000220847;ENST00000395390	T;T	0.33865	1.4;1.39	5.41	5.41	0.78517	.	0.977540	0.08267	U	0.972072	T	0.53142	0.1778	L	0.55481	1.735	0.36928	D	0.89175	D;D	0.55172	0.969;0.97	P;P	0.53593	0.73;0.541	T	0.53493	-0.8431	10	0.52906	T	0.07	-10.3384	18.18	0.89775	0.0:0.0:1.0:0.0	.	861;886	F8W9L8;A8MW92	.;P20L1_HUMAN	H	886;273;861	ENSP00000378784:D886H;ENSP00000378788:D861H	ENSP00000220847:D273H	D	+	1	0	PHF20L1	133924210	1.000000	0.71417	0.971000	0.41717	0.997000	0.91878	5.521000	0.67086	2.539000	0.85634	0.650000	0.86243	GAT	PHF20L1	-	NULL	ENSG00000129292		0.388	PHF20L1-008	PUTATIVE	basic|appris_principal|CCDS	protein_coding	PHF20L1	HGNC	protein_coding	OTTHUMT00000308949.3	23	0.00	0	G	NM_016018		133855028	133855028	+1	no_errors	ENST00000220847	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	0.954	C
PLXNB3	5365	genome.wustl.edu	37	X	153043682	153043682	+	Intron	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chrX:153043682C>A	ENST00000361971.5	+	33	5523				PLXNB3_ENST00000538776.1_Intron|SRPK3_ENST00000370104.1_5'Flank|SRPK3_ENST00000489426.1_5'UTR|PLXNB3_ENST00000485980.1_Intron|SRPK3_ENST00000393786.3_5'Flank|SRPK3_ENST00000370100.1_5'Flank|SRPK3_ENST00000370108.3_5'Flank|SRPK3_ENST00000370101.3_5'Flank|PLXNB3_ENST00000538966.1_Intron	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3						axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					CACCTCCGAGCTCATGCCTAG	0.622																																						dbGAP											0													46.0	41.0	43.0					X																	153043682		2202	4300	6502	-	-	-	SO:0001627	intron_variant	0			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.5410-34C>A	X.37:g.153043682C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	p.A151D	ENST00000361971.5	37	c.452	CCDS14729.1	X	.	.	.	.	.	.	.	.	.	.	C	11.13	1.548136	0.27652	.	.	ENSG00000198753	ENST00000448847	.	.	.	5.25	3.02	0.34903	.	.	.	.	.	T	0.25680	0.0625	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.19516	-1.0303	4	.	.	.	.	4.3922	0.11346	0.3482:0.5166:0.0:0.1352	.	.	.	.	D	151	.	.	A	+	2	0	PLXNB3	152696876	0.024000	0.19004	0.008000	0.14137	0.056000	0.15407	0.094000	0.15107	0.760000	0.33108	0.529000	0.55759	GCT	PLXNB3	-	NULL	ENSG00000198753		0.622	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	HGNC	protein_coding	OTTHUMT00000061063.1	72	0.00	0	C			153043682	153043682	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000448847	ensembl	human	known	69_37n	missense	74	60.22	112	SNP	0.002	A
PMEL	6490	genome.wustl.edu	37	12	56351273	56351273	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr12:56351273G>A	ENST00000548747.1	-	6	1476	c.814C>T	c.(814-816)Cgg>Tgg	p.R272W	PMEL_ENST00000550464.1_Missense_Mutation_p.R186W|PMEL_ENST00000539511.1_Missense_Mutation_p.R186W|PMEL_ENST00000552882.1_Missense_Mutation_p.R272W|PMEL_ENST00000550447.1_Intron|PMEL_ENST00000548493.1_Missense_Mutation_p.R272W|PMEL_ENST00000449260.2_Missense_Mutation_p.R272W|PMEL_ENST00000548689.1_5'Flank|PMEL_ENST00000360714.4_Missense_Mutation_p.R272W|PMEL_ENST00000536427.1_Missense_Mutation_p.R272W			P40967	PMEL_HUMAN	premelanosome protein	272	PKD. {ECO:0000255|PROSITE- ProRule:PRU00151}.				melanin biosynthetic process (GO:0042438)|melanosome organization (GO:0032438)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|multivesicular body membrane (GO:0032585)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						ACAAGTGCCCGAGAGATCAGG	0.597																																						dbGAP											0													103.0	104.0	104.0					12																	56351273		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092881	CCDS8897.1, CCDS55833.1, CCDS55834.1	12q13-q14	2010-12-17	2010-12-17	2010-12-17	ENSG00000185664	ENSG00000185664			10880	protein-coding gene	gene with protein product		155550	"""silver (mouse homolog) like"", ""silver homolog (mouse)"""	SIL, SILV		8739560	Standard	NM_001200053		Approved	D12S53E, SI, Pmel17, gp100	uc001siq.3	P40967		ENST00000548747.1:c.814C>T	12.37:g.56351273G>A	ENSP00000448828:p.Arg272Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KS57|B7Z6D7|Q12763|Q14448|Q14817|Q16565	Missense_Mutation	SNP	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	p.R272W	ENST00000548747.1	37	c.814	CCDS8897.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.5|20.5	4.005487|4.005487	0.74932|0.74932	.|.	.|.	ENSG00000185664|ENSG00000185664	ENST00000449260;ENST00000552882;ENST00000550464;ENST00000548747;ENST00000548493;ENST00000360714;ENST00000536427;ENST00000539511;ENST00000547137;ENST00000546543|ENST00000549404	T;T;T;T;T;T;T;T;T;T|T	0.61510|0.59364	0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1;0.1|0.27	5.73|5.73	3.89|3.89	0.44902|0.44902	PKD/Chitinase domain (1);PKD domain (3);|.	0.000000|.	0.56097|.	D|.	0.000029|.	T|T	0.73032|0.73032	0.3535|0.3535	M|M	0.81239|0.81239	2.535|2.535	0.58432|0.58432	D|D	0.999992|0.999992	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.997;1.0;1.0|.	T|T	0.77267|0.77267	-0.2651|-0.2651	10|7	0.87932|0.87932	D|D	0|0	-4.2396|-4.2396	14.4605|14.4605	0.67445|0.67445	0.0:0.0:0.731:0.269|0.0:0.0:0.731:0.269	.|.	186;272;272|.	P40967-3;P40967-2;P40967|.	.;.;PMEL_HUMAN|.	W|L	272;272;186;272;272;272;272;186;218;223|159	ENSP00000402758:R272W;ENSP00000449690:R272W;ENSP00000450036:R186W;ENSP00000448828:R272W;ENSP00000447374:R272W;ENSP00000353940:R272W;ENSP00000438695:R272W;ENSP00000445005:R186W;ENSP00000448849:R218W;ENSP00000446662:R223W|ENSP00000449520:S159L	ENSP00000353940:R272W|ENSP00000449520:S159L	R|S	-|-	1|2	2|0	PMEL|PMEL	54637540|54637540	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	2.341000|2.341000	0.43983|0.43983	0.874000|0.874000	0.35823|0.35823	0.650000|0.650000	0.86243|0.86243	CGG|TCG	PMEL	-	pfam_PKD_dom,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_PKD_dom	ENSG00000185664		0.597	PMEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMEL	HGNC	protein_coding	OTTHUMT00000409626.1	44	0.00	0	G	NM_006928		56351273	56351273	-1	no_errors	ENST00000360714	ensembl	human	known	69_37n	missense	12	80.33	49	SNP	1.000	A
POM121L9P	29774	genome.wustl.edu	37	22	24649081	24649081	+	RNA	SNP	C	C	G	rs535643814		TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr22:24649081C>G	ENST00000414583.2	+	0	1286					NR_003714.1				POM121 transmembrane nucleoporin-like 9, pseudogene																		CATGGCACTTCTGCTCCTGCA	0.607																																						dbGAP											0																																										-	-	-			0			AL040062, AL117401		22q11.22	2012-03-13	2012-03-13		ENSG00000128262	ENSG00000128262			30080	pseudogene	pseudogene			"""POM121 membrane glycoprotein-like 9, pseudogene"""				Standard	NR_003714		Approved				OTTHUMG00000150763		22.37:g.24649081C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000414583.2	37	NULL		22																																																																																			POM121L9P	-	-	ENSG00000128262		0.607	POM121L9P-001	KNOWN	basic	processed_transcript	POM121L9P	HGNC	pseudogene	OTTHUMT00000319991.1	108	0.00	0	C	NM_014549		24649081	24649081	+1	no_errors	ENST00000414583	ensembl	human	known	69_37n	rna	88	16.98	18	SNP	0.898	G
PPP1R15A	23645	genome.wustl.edu	37	19	49378977	49378977	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:49378977G>T	ENST00000200453.5	+	3	2041	c.1772G>T	c.(1771-1773)cGc>cTc	p.R591L		NM_014330.3	NP_055145.3	O75807	PR15A_HUMAN	protein phosphatase 1, regulatory subunit 15A	591					apoptotic process (GO:0006915)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of translation (GO:0006417)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)	protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(8)|skin(2)|urinary_tract(1)	23		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000244)|all cancers(93;0.000694)|GBM - Glioblastoma multiforme(486;0.0222)|Epithelial(262;0.033)		GATCGCAGCCGCTTCGCACGC	0.701																																						dbGAP											0													53.0	63.0	60.0					19																	49378977		2201	4298	6499	-	-	-	SO:0001583	missense	0			U83981	CCDS12738.1	19q13.2	2012-04-17	2011-10-04		ENSG00000087074	ENSG00000087074		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14375	protein-coding gene	gene with protein product	"""growth arrest and DNA-damage-inducible 34"""	611048	"""protein phosphatase 1, regulatory (inhibitor) subunit 15A"""			9153226, 9413226	Standard	NM_014330		Approved	GADD34	uc002pky.4	O75807		ENST00000200453.5:c.1772G>T	19.37:g.49378977G>T	ENSP00000200453:p.Arg591Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKQ3|Q6IA96|Q9NVU6	Missense_Mutation	SNP	pfam_Prot_Pase1_reg-su15A/B_C	p.R591L	ENST00000200453.5	37	c.1772	CCDS12738.1	19	.	.	.	.	.	.	.	.	.	.	G	17.78	3.474682	0.63737	.	.	ENSG00000087074	ENST00000200453;ENST00000540695;ENST00000544084	T	0.45276	0.9	4.96	4.96	0.65561	Protein phosphatase 1, regulatory subunit 15A/B, C-terminal (1);	0.000000	0.64402	D	0.000002	T	0.68430	0.3000	M	0.87180	2.865	0.54753	D	0.99998	D	0.89917	1.0	D	0.91635	0.999	T	0.74009	-0.3802	10	0.87932	D	0	-17.0519	14.4357	0.67279	0.0:0.0:1.0:0.0	.	591	O75807	PR15A_HUMAN	L	591;431;549	ENSP00000200453:R591L	ENSP00000200453:R591L	R	+	2	0	PPP1R15A	54070789	1.000000	0.71417	0.994000	0.49952	0.023000	0.10783	4.723000	0.61965	2.676000	0.91093	0.655000	0.94253	CGC	PPP1R15A	-	pfam_Prot_Pase1_reg-su15A/B_C	ENSG00000087074		0.701	PPP1R15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R15A	HGNC	protein_coding	OTTHUMT00000466226.1	20	0.00	0	G	NM_014330		49378977	49378977	+1	no_errors	ENST00000200453	ensembl	human	known	69_37n	missense	17	48.48	16	SNP	1.000	T
PPP2R5C	5527	genome.wustl.edu	37	14	102368210	102368210	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr14:102368210C>A	ENST00000334743.5	+	9	1055	c.1007C>A	c.(1006-1008)tCc>tAc	p.S336Y	PPP2R5C_ENST00000350249.3_Missense_Mutation_p.S336Y|PPP2R5C_ENST00000557095.1_Missense_Mutation_p.S336Y|PPP2R5C_ENST00000422945.2_Missense_Mutation_p.S367Y|PPP2R5C_ENST00000328724.5_Missense_Mutation_p.S391Y|PPP2R5C_ENST00000445439.3_Missense_Mutation_p.S336Y	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	336					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AAATGTGTCTCCAGCCCACAC	0.448																																						dbGAP											0													56.0	59.0	58.0					14																	102368210		2203	4300	6503	-	-	-	SO:0001583	missense	0			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.1007C>A	14.37:g.102368210C>A	ENSP00000333905:p.Ser336Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.S367Y	ENST00000334743.5	37	c.1100	CCDS9964.1	14	.	.	.	.	.	.	.	.	.	.	C	26.1	4.708342	0.89018	.	.	ENSG00000078304	ENST00000422945;ENST00000328724;ENST00000557268;ENST00000350249;ENST00000334756;ENST00000445439;ENST00000334743;ENST00000557095;ENST00000557716	T;T;T;T;T	0.51817	0.69;0.69;0.69;0.72;0.69	5.3	5.3	0.74995	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78477	0.4289	H	0.94771	3.58	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;0.998;1.0;1.0;0.998;0.999	D;P;D;D;D;D	0.81914	0.985;0.893;0.995;0.991;0.98;0.991	D	0.85013	0.0907	10	0.87932	D	0	-16.7014	18.9542	0.92653	0.0:1.0:0.0:0.0	.	367;234;336;336;336;391	F5GWP3;E9PHN5;Q13362-3;Q13362;Q13362-2;Q6ZN33	.;.;.;2A5G_HUMAN;.;.	Y	367;391;365;336;234;336;336;336;132	ENSP00000412324:S367Y;ENSP00000329009:S391Y;ENSP00000450931:S365Y;ENSP00000262239:S336Y;ENSP00000333905:S336Y	ENSP00000329009:S391Y	S	+	2	0	PPP2R5C	101437963	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.729000	0.84864	2.490000	0.84030	0.655000	0.94253	TCC	PPP2R5C	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000078304		0.448	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	HGNC	protein_coding	OTTHUMT00000414373.2	28	0.00	0	C	NM_002719		102368210	102368210	+1	no_errors	ENST00000422945	ensembl	human	known	69_37n	missense	33	36.54	19	SNP	1.000	A
PRIM2	5558	genome.wustl.edu	37	6	57512874	57512874	+	3'UTR	SNP	G	G	A	rs71214002	byFrequency	TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:57512874G>A	ENST00000389488.2	+	0	1789				PRIM2_ENST00000607273.1_3'UTR			P49643	PRI2_HUMAN	primase, DNA, polypeptide 2 (58kDa)						DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	nucleoplasm (GO:0005654)|primosome complex (GO:1990077)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA primase activity (GO:0003896)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(34)|prostate(6)|stomach(4)|upper_aerodigestive_tract(1)	59				Colorectal(6;0.041)|READ - Rectum adenocarcinoma(7;0.193)		ccaagtagttgggaccacagg	0.493																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS75476.1, CCDS75477.1	6p12-p11.1	2013-01-31	2007-06-19	2007-06-19	ENSG00000146143	ENSG00000146143			9370	protein-coding gene	gene with protein product		176636	"""primase, polypeptide 2A (58kD)"", ""primase, polypeptide 2A, 58kDa"""	PRIM2A		8530050, 20675616	Standard	NM_001282487		Approved		uc003pdx.3	P49643	OTTHUMG00000016190	ENST00000389488.2:c.*1786G>A	6.37:g.57512874G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FJ8|Q6P1Q7|Q8WVL2|Q9H413	RNA	SNP	-	NULL	ENST00000389488.2	37	NULL		6																																																																																			PRIM2	-	-	ENSG00000146143		0.493	PRIM2-001	KNOWN	sequence_error|basic	processed_transcript	PRIM2	HGNC	protein_coding	OTTHUMT00000043468.3	9	0.00	0	G	NM_000947		57512874	57512874	+1	no_errors	ENST00000389488	ensembl	human	known	69_37n	rna	7	36.36	4	SNP	0.050	A
PTPRVP	148713	genome.wustl.edu	37	1	202137637	202137637	+	RNA	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:202137637G>C	ENST00000482597.1	+	0	459					NR_002930.2				protein tyrosine phosphatase, receptor type, V, pseudogene																		GCATCAGGAAGAGGTGGGCTT	0.572																																						dbGAP											0																																										-	-	-			0			AJ629456		1q32.1	2013-09-26	2010-03-16	2010-03-16	ENSG00000243323	ENSG00000243323		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	13421	pseudogene	pseudogene				PTPRV		15358244	Standard	NR_002930		Approved	OST-PTP, ESP	uc009xaa.2		OTTHUMG00000040524		1.37:g.202137637G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000482597.1	37	NULL		1																																																																																			PTPRVP	-	-	ENSG00000243323		0.572	PTPRVP-003	KNOWN	basic	processed_transcript	PTPRVP	HGNC	pseudogene	OTTHUMT00000334021.1	10	0.00	0	G	XM_086287		202137637	202137637	+1	no_errors	ENST00000482597	ensembl	human	known	69_37n	rna	19	44.44	16	SNP	0.014	C
RABGGTA	5875	genome.wustl.edu	37	14	24738317	24738317	+	Silent	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr14:24738317G>C	ENST00000399409.3	-	6	1167	c.684C>G	c.(682-684)gcC>gcG	p.A228A	RABGGTA_ENST00000559586.1_5'Flank|RABGGTA_ENST00000216840.6_Silent_p.A228A|RABGGTA_ENST00000560777.1_5'UTR	NM_004581.5	NP_004572.3	Q92696	PGTA_HUMAN	Rab geranylgeranyltransferase, alpha subunit	228					cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	12				GBM - Glioblastoma multiforme(265;0.0184)		GATAAAACCAGGCACTCTGGT	0.547																																						dbGAP											0													91.0	99.0	96.0					14																	24738317		2012	4186	6198	-	-	-	SO:0001819	synonymous_variant	0				CCDS45088.1	14q11.2	2011-06-27				ENSG00000100949		"""Prenyltransferase alpha subunit repeat containing"""	9795	protein-coding gene	gene with protein product	"""protein prenyltransferase alpha subunit repeat containing 3"""	601905				8954794	Standard	NM_182836		Approved	PTAR3	uc001wog.4	Q92696		ENST00000399409.3:c.684C>G	14.37:g.24738317G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5N2|D3DS69	Silent	SNP	pfam_Prenyl_trans_a,pfam_RabGGT_asu_insert-domain,pfam_Leu-rich_rpt,superfamily_RabGGT_asu_insert-domain,pfscan_Prenyl_trans_a	p.A228	ENST00000399409.3	37	c.684	CCDS45088.1	14																																																																																			RABGGTA	-	pfam_Prenyl_trans_a,pfscan_Prenyl_trans_a	ENSG00000100949		0.547	RABGGTA-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RABGGTA	HGNC	protein_coding	OTTHUMT00000415308.5	40	0.00	0	G	NM_182836		24738317	24738317	-1	no_errors	ENST00000216840	ensembl	human	known	69_37n	silent	7	89.06	57	SNP	0.998	C
RAF1	5894	genome.wustl.edu	37	3	12641238	12641238	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:12641238G>A	ENST00000251849.4	-	10	1499	c.1060C>T	c.(1060-1062)Cgg>Tgg	p.R354W	RAF1_ENST00000542177.1_Missense_Mutation_p.R273W|RAF1_ENST00000534997.1_Missense_Mutation_p.R139W|RAF1_ENST00000442415.2_Missense_Mutation_p.R374W	NM_002880.3	NP_002871.1	P04049	RAF1_HUMAN	Raf-1 proto-oncogene, serine/threonine kinase	354	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of adenylate cyclase activity (GO:0007190)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|death-inducing signaling complex assembly (GO:0071550)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intermediate filament cytoskeleton organization (GO:0045104)|ion transmembrane transport (GO:0034220)|MAPK cascade (GO:0000165)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of protein complex assembly (GO:0031333)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of Rho protein signal transduction (GO:0035023)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		ESRP1/RAF1(4)|RAF1/DAZL(2)|SRGAP3/RAF1(6)	biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)	32					Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)	GACCCAATCCGAGTGGACAGC	0.458			T	SRGAP3	pilocytic astrocytoma				Noonan syndrome																													dbGAP		Dom	yes		3	3p25	5894	v-raf-1 murine leukemia viral oncogene homolog 1		M	0													89.0	86.0	87.0					3																	12641238		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Male Turner syndrome, Pterygium Colli syndrome, incl. Noonan-like/Multiple Giant Cell Lesion syndrome; Noonan s. with multiple lentigines/LEOPARD syndrome	X03484	CCDS2612.1	3p25	2014-09-17	2014-06-26		ENSG00000132155	ENSG00000132155			9829	protein-coding gene	gene with protein product	"""C-Raf proto-oncogene, serine/threonine kinase"""	164760	"""v-raf-1 murine leukemia viral oncogene homolog 1"""			1611909	Standard	NM_002880		Approved	Raf-1, c-Raf, CRAF	uc003bxf.4	P04049	OTTHUMG00000129789	ENST00000251849.4:c.1060C>T	3.37:g.12641238G>A	ENSP00000251849:p.Arg354Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH8|B2R5N3|Q15278|Q9UC20	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.R374W	ENST00000251849.4	37	c.1120	CCDS2612.1	3	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324356	0.81580	.	.	ENSG00000132155	ENST00000251849;ENST00000442415;ENST00000432427;ENST00000534997;ENST00000542177	D;D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7;-1.7	5.52	4.52	0.55395	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.106914	0.64402	D	0.000004	D	0.88400	0.6426	M	0.63428	1.95	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.83275	0.996;0.993;0.986	D	0.88432	0.3036	10	0.87932	D	0	.	10.8241	0.46622	0.0:0.0:0.7047:0.2953	.	273;139;354	B4E0X2;B4E1N6;P04049	.;.;RAF1_HUMAN	W	354;374;233;139;273	ENSP00000251849:R354W;ENSP00000401888:R374W;ENSP00000398591:R233W;ENSP00000441186:R139W;ENSP00000443567:R273W	ENSP00000251849:R354W	R	-	1	2	RAF1	12616238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.965000	0.70387	2.752000	0.94435	0.655000	0.94253	CGG	RAF1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000132155		0.458	RAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAF1	HGNC	protein_coding	OTTHUMT00000252015.2	34	0.00	0	G	NM_002880		12641238	12641238	-1	no_errors	ENST00000442415	ensembl	human	known	69_37n	missense	4	90.48	38	SNP	1.000	A
RGS20	8601	genome.wustl.edu	37	8	54852174	54852174	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr8:54852174G>C	ENST00000297313.3	+	3	641	c.549G>C	c.(547-549)caG>caC	p.Q183H	RGS20_ENST00000276500.4_Missense_Mutation_p.Q36H|RGS20_ENST00000344277.6_Missense_Mutation_p.Q68H|RGS20_ENST00000522225.1_Intron	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	183					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			GGAAGCGGCAGATGCCCGCCG	0.662																																						dbGAP											0													17.0	23.0	21.0					8																	54852174		2197	4297	6494	-	-	-	SO:0001583	missense	0			AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.549G>C	8.37:g.54852174G>C	ENSP00000297313:p.Gln183His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BG9	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,prints_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.Q183H	ENST00000297313.3	37	c.549	CCDS6155.1	8	.	.	.	.	.	.	.	.	.	.	G	13.88	2.367993	0.42003	.	.	ENSG00000147509	ENST00000297313;ENST00000344277;ENST00000276500	T;T;T	0.54279	0.59;0.8;0.58	4.89	3.05	0.35203	.	18.728200	0.00166	N	0.000000	T	0.74007	0.3660	M	0.72479	2.2	0.33335	D	0.569092	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.74023	0.982;0.982;0.935	T	0.52223	-0.8604	10	0.72032	D	0.01	.	10.8462	0.46744	0.0:0.1421:0.7103:0.1476	.	36;68;183	O76081-6;O76081-2;O76081	.;.;RGS20_HUMAN	H	183;68;36	ENSP00000297313:Q183H;ENSP00000344630:Q68H;ENSP00000276500:Q36H	ENSP00000276500:Q36H	Q	+	3	2	RGS20	55014727	1.000000	0.71417	0.071000	0.20095	0.010000	0.07245	6.111000	0.71541	0.552000	0.29026	-0.182000	0.12963	CAG	RGS20	-	NULL	ENSG00000147509		0.662	RGS20-001	KNOWN	basic|CCDS	protein_coding	RGS20	HGNC	protein_coding	OTTHUMT00000380058.1	23	0.00	0	G			54852174	54852174	+1	no_errors	ENST00000297313	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	1.000	C
RPS6	6194	genome.wustl.edu	37	9	19376334	19376334	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr9:19376334G>C	ENST00000380394.4	-	6	765	c.707C>G	c.(706-708)tCt>tGt	p.S236C	RPS6_ENST00000315377.4_Missense_Mutation_p.S205C|RPS6_ENST00000380384.1_Missense_Mutation_p.S205C|RP11-513M16.8_ENST00000609982.1_RNA|RPS6_ENST00000498815.1_5'UTR	NM_001010.2	NP_001001.2	P62753	RS6_HUMAN	ribosomal protein S6	236					activation-induced cell death of T cells (GO:0006924)|cellular protein metabolic process (GO:0044267)|erythrocyte development (GO:0048821)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|oogenesis stage (GO:0022605)|placenta development (GO:0001890)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell differentiation in thymus (GO:0033077)|T cell proliferation involved in immune response (GO:0002309)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|dendrite (GO:0030425)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|urinary_tract(1)	7		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		AGCTCGCAGAGAGGAAAGTCT	0.388																																						dbGAP											0													63.0	66.0	65.0					9																	19376334		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6492.1	9p21	2011-04-05			ENSG00000137154	ENSG00000137154		"""S ribosomal proteins"""	10429	protein-coding gene	gene with protein product	"""40S ribosomal protein S6"", ""phosphoprotein NP33"""	180460				1577483	Standard	NM_001010		Approved	S6	uc003znv.1	P62753	OTTHUMG00000019642	ENST00000380394.4:c.707C>G	9.37:g.19376334G>C	ENSP00000369757:p.Ser236Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	P08227|P10660|Q4VBY7|Q8N6Z7	Missense_Mutation	SNP	pfam_Ribosomal_S6e,pirsf_Ribosomal_S6_euk	p.S236C	ENST00000380394.4	37	c.707	CCDS6492.1	9	.	.	.	.	.	.	.	.	.	.	G	19.62	3.860902	0.71834	.	.	ENSG00000137154	ENST00000380394;ENST00000380384;ENST00000315377	T;T;T	0.54071	0.59;0.61;0.61	5.08	5.08	0.68730	.	0.000000	0.85682	D	0.000000	T	0.73768	0.3629	M	0.91510	3.215	0.80722	D	1	P	0.46578	0.88	P	0.52481	0.7	T	0.79829	-0.1638	9	.	.	.	-15.3944	18.8394	0.92176	0.0:0.0:1.0:0.0	.	236	P62753	RS6_HUMAN	C	236;205;205	ENSP00000369757:S236C;ENSP00000369745:S205C;ENSP00000369743:S205C	.	S	-	2	0	RPS6	19366334	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	9.785000	0.99042	2.498000	0.84270	0.655000	0.94253	TCT	RPS6	-	pirsf_Ribosomal_S6_euk	ENSG00000137154		0.388	RPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6	HGNC	protein_coding	OTTHUMT00000051858.1	35	0.00	0	G	NM_001010		19376334	19376334	-1	no_errors	ENST00000380394	ensembl	human	known	69_37n	missense	67	22.99	20	SNP	1.000	C
RYR1	6261	genome.wustl.edu	37	19	38955362	38955362	+	Splice_Site	SNP	C	C	G	rs201827275		TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:38955362C>G	ENST00000359596.3	+	23	2870	c.2870C>G	c.(2869-2871)aCg>aGg	p.T957R	RYR1_ENST00000355481.4_Splice_Site_p.T957R|RYR1_ENST00000360985.3_Splice_Site_p.T957R			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	957	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	CTCCCCAAGACGTGAGTGTGG	0.652																																						dbGAP											0													87.0	67.0	73.0					19																	38955362		2194	4293	6487	-	-	-	SO:0001630	splice_region_variant	0			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.2870+1C>G	19.37:g.38955362C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.T957R	ENST00000359596.3	37	c.2870	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	c	9.453	1.091004	0.20471	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.96716	-4.1;-4.1;-4.1	4.03	2.97	0.34412	.	0.000000	0.64402	U	0.000002	D	0.96327	0.8802	L	0.44542	1.39	0.44055	D	0.996799	D;B	0.56287	0.975;0.427	D;B	0.65140	0.932;0.133	D	0.95622	0.8682	10	0.52906	T	0.07	.	12.322	0.54989	0.1711:0.8289:0.0:0.0	.	957;957	P21817-2;P21817	.;RYR1_HUMAN	R	957	ENSP00000352608:T957R;ENSP00000347667:T957R;ENSP00000354254:T957R	ENSP00000347667:T957R	T	+	2	0	RYR1	43647202	1.000000	0.71417	1.000000	0.80357	0.758000	0.43043	2.709000	0.47160	1.040000	0.40099	0.430000	0.28490	ACG	RYR1	-	NULL	ENSG00000196218		0.652	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	19	0.00	0	C		Missense_Mutation	38955362	38955362	+1	no_errors	ENST00000359596	ensembl	human	known	69_37n	missense	27	37.21	16	SNP	1.000	G
RYR2	6262	genome.wustl.edu	37	1	237949315	237949315	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:237949315A>T	ENST00000366574.2	+	91	13624	c.13307A>T	c.(13306-13308)aAa>aTa	p.K4436I	RYR2_ENST00000609119.1_3'UTR|RYR2_ENST00000542537.1_Missense_Mutation_p.K4420I|RYR2_ENST00000360064.6_Missense_Mutation_p.K4442I	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	4436	Glu-rich (acidic).				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)	p.K4434T(1)		NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			gaagaaACCAAATCTGAACCT	0.368																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											122.0	127.0	125.0					1																	237949315		1833	4095	5928	-	-	-	SO:0001583	missense	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.13307A>T	1.37:g.237949315A>T	ENSP00000355533:p.Lys4436Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.K4442I	ENST00000366574.2	37	c.13325	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	A	15.78	2.934598	0.52866	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537;ENST00000542288	D;D;D	0.94330	-3.4;-3.4;-3.4	4.93	4.93	0.64822	Ryanodine Receptor TM 4-6 (1);	0.079168	0.49305	D	0.000143	D	0.89815	0.6824	L	0.32530	0.975	0.80722	D	1	P;P	0.42827	0.791;0.791	B;B	0.42995	0.404;0.404	D	0.90265	0.4303	10	0.56958	D	0.05	-3.5115	12.239	0.54532	1.0:0.0:0.0:0.0	.	1410;4436	B4DGV4;Q92736	.;RYR2_HUMAN	I	4436;4442;4420;1410	ENSP00000355533:K4436I;ENSP00000353174:K4442I;ENSP00000443798:K4420I	ENSP00000353174:K4442I	K	+	2	0	RYR2	236015938	1.000000	0.71417	0.780000	0.31762	0.899000	0.52679	1.838000	0.39211	1.961000	0.56991	0.533000	0.62120	AAA	RYR2	-	pfam_Ryanrecept_TM4-6	ENSG00000198626		0.368	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	61	0.00	0	A	NM_001035		237949315	237949315	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	missense	74	32.11	35	SNP	0.991	T
SAFB2	9667	genome.wustl.edu	37	19	5587292	5587292	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:5587292G>A	ENST00000252542.4	-	21	3088	c.2824C>T	c.(2824-2826)Cat>Tat	p.H942Y		NM_014649.2	NP_055464.1	Q14151	SAFB2_HUMAN	scaffold attachment factor B2	942	Interacts with SAFB1.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(4)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;0.000228)		ggggggggatgagggtgtggg	0.657																																					Ovarian(127;888 1728 23957 44128 52668)	dbGAP											0													24.0	22.0	23.0					19																	5587292		2203	4300	6503	-	-	-	SO:0001583	missense	0			D50928	CCDS32879.1	19p13.3	2013-02-12				ENSG00000130254		"""RNA binding motif (RRM) containing"""	21605	protein-coding gene	gene with protein product		608066				12660241	Standard	NM_014649		Approved	KIAA0138	uc002mcd.3	Q14151		ENST00000252542.4:c.2824C>T	19.37:g.5587292G>A	ENSP00000252542:p.His942Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKG3|Q8TB13	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.H942Y	ENST00000252542.4	37	c.2824	CCDS32879.1	19	.	.	.	.	.	.	.	.	.	.	g	9.051	0.992125	0.18966	.	.	ENSG00000130254	ENST00000252542	T	0.08720	3.06	2.59	1.52	0.23074	.	0.456805	0.17207	N	0.182891	T	0.04318	0.0119	N	0.08118	0	0.24859	N	0.992356	P	0.37663	0.604	B	0.37650	0.255	T	0.37549	-0.9701	10	0.46703	T	0.11	.	7.4775	0.27385	0.0:0.2676:0.7324:0.0	.	942	Q14151	SAFB2_HUMAN	Y	942	ENSP00000252542:H942Y	ENSP00000252542:H942Y	H	-	1	0	SAFB2	5538292	0.980000	0.34600	0.749000	0.31150	0.371000	0.29859	1.572000	0.36461	0.635000	0.30488	0.561000	0.74099	CAT	SAFB2	-	NULL	ENSG00000130254		0.657	SAFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAFB2	HGNC	protein_coding	OTTHUMT00000451016.1	21	0.00	0	G	NM_014649		5587292	5587292	-1	no_errors	ENST00000252542	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	0.823	A
SAMD8	142891	genome.wustl.edu	37	10	76924488	76924488	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr10:76924488C>G	ENST00000542569.1	+	3	767	c.664C>G	c.(664-666)Cac>Gac	p.H222D	SAMD8_ENST00000372690.3_Missense_Mutation_p.H285D|SAMD8_ENST00000372687.4_Missense_Mutation_p.H222D	NM_001174156.1|NM_144660.2	NP_001167627.1|NP_653261.1	Q96LT4	SAMD8_HUMAN	sterile alpha motif domain containing 8	222					ceramide biosynthetic process (GO:0046513)|regulation of ceramide biosynthetic process (GO:2000303)|sphingomyelin biosynthetic process (GO:0006686)	integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)	transferase activity (GO:0016740)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)	12	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					TCTTCTTCTTCACAAGCACAG	0.403																																						dbGAP											0													207.0	180.0	190.0					10																	76924488		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057811	CCDS7347.1, CCDS53543.1	10q22.3	2013-01-10			ENSG00000156671	ENSG00000156671		"""Sterile alpha motif (SAM) domain containing"""	26320	protein-coding gene	gene with protein product		611575					Standard	NM_144660		Approved	FLJ25082	uc001jwx.2	Q96LT4	OTTHUMG00000018515	ENST00000542569.1:c.664C>G	10.37:g.76924488C>G	ENSP00000438042:p.His222Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSC5|Q5JSC8|Q66K52	Missense_Mutation	SNP	pfam_SAM_type1,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.H285D	ENST00000542569.1	37	c.853	CCDS53543.1	10	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739672	0.89573	.	.	ENSG00000156671	ENST00000447533;ENST00000372690;ENST00000542569;ENST00000372687	D;D;D;D	0.93604	-3.25;-3.25;-3.25;-3.25	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	D	0.97052	0.9037	M	0.87180	2.865	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.79784	0.943;0.993	D	0.97637	1.0146	10	0.62326	D	0.03	-11.1305	17.8372	0.88701	0.0:1.0:0.0:0.0	.	222;222	Q96LT4-2;Q96LT4	.;SAMD8_HUMAN	D	222;285;222;222	ENSP00000391799:H222D;ENSP00000361775:H285D;ENSP00000438042:H222D;ENSP00000361772:H222D	ENSP00000361772:H222D	H	+	1	0	SAMD8	76594494	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.463000	0.80869	2.315000	0.78130	0.591000	0.81541	CAC	SAMD8	-	NULL	ENSG00000156671		0.403	SAMD8-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD8	HGNC	protein_coding		46	0.00	0	C	NM_144660		76924488	76924488	+1	no_errors	ENST00000372690	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	G
SECTM1	6398	genome.wustl.edu	37	17	80280173	80280173	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:80280173C>G	ENST00000269389.3	-	5	961	c.611G>C	c.(610-612)aGa>aCa	p.R204T	SECTM1_ENST00000580437.1_3'UTR	NM_003004.2	NP_002995.1	Q8WVN6	SCTM1_HUMAN	secreted and transmembrane 1	204					immune response (GO:0006955)|mesoderm development (GO:0007498)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cytokine activity (GO:0005125)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(2)|lung(1)	4	Breast(20;0.000675)|all_neural(118;0.0804)|Lung NSC(278;0.128)|all_lung(278;0.145)|Ovarian(332;0.249)		OV - Ovarian serous cystadenocarcinoma(97;0.00928)|BRCA - Breast invasive adenocarcinoma(99;0.0833)			AGCGGAGGCTCTGCTCAGGCC	0.637																																						dbGAP											0													65.0	68.0	67.0					17																	80280173		2203	4300	6503	-	-	-	SO:0001583	missense	0			U77643	CCDS11808.1	17q25	2008-07-18				ENSG00000141574			10707	protein-coding gene	gene with protein product	"""K12 protein"", ""type 1a transmembrane protein"""	602602				9480746	Standard	NM_003004		Approved	K12	uc002keo.3	Q8WVN6		ENST00000269389.3:c.611G>C	17.37:g.80280173C>G	ENSP00000269389:p.Arg204Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7H0|O00466	Missense_Mutation	SNP	NULL	p.R204T	ENST00000269389.3	37	c.611	CCDS11808.1	17	.	.	.	.	.	.	.	.	.	.	C	7.442	0.640878	0.14386	.	.	ENSG00000141574	ENST00000269389	.	.	.	0.775	-0.438	0.12268	.	.	.	.	.	T	0.12987	0.0315	N	0.14661	0.345	0.09310	N	1	P;P	0.40282	0.711;0.711	B;B	0.32724	0.151;0.151	T	0.13548	-1.0505	8	0.42905	T	0.14	.	4.5183	0.11947	0.0:0.5841:0.4159:0.0	.	204;204	Q8WVN6;A8K3U3	SCTM1_HUMAN;.	T	204	.	ENSP00000269389:R204T	R	-	2	0	SECTM1	77873462	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.786000	0.00770	-0.129000	0.11620	0.467000	0.42956	AGA	SECTM1	-	NULL	ENSG00000141574		0.637	SECTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SECTM1	HGNC	protein_coding	OTTHUMT00000442856.1	26	0.00	0	C	NM_003004		80280173	80280173	-1	no_errors	ENST00000269389	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	0.000	G
SELL	6402	genome.wustl.edu	37	1	169677698	169677698	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:169677698G>C	ENST00000236147.4	-	3	531	c.371C>G	c.(370-372)gCa>gGa	p.A124G	SELL_ENST00000463108.1_5'UTR|C1orf112_ENST00000498289.1_Intron	NM_000655.4	NP_000646.2	P14151	LYAM1_HUMAN	selectin L	111	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|leukocyte migration (GO:0050900)|regulation of immune response (GO:0050776)|response to ATP (GO:0033198)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|glycosphingolipid binding (GO:0043208)|heparin binding (GO:0008201)|protease binding (GO:0002020)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(3)|lung(5)|urinary_tract(1)	15	all_hematologic(923;0.208)					CCAGTTCTCTGCTTCTTCAGT	0.458																																						dbGAP											0													91.0	90.0	90.0					1																	169677698		2022	4200	6222	-	-	-	SO:0001583	missense	0			M25280	CCDS53427.1	1q23-q25	2008-07-31	2008-07-31		ENSG00000188404	ENSG00000188404		"""CD molecules"""	10720	protein-coding gene	gene with protein product		153240	"""lymphocyte adhesion molecule 1"""	LYAM1, LNHR		2664786, 1375831	Standard	NR_029467		Approved	LSEL, LAM1, LAM-1, hLHRc, Leu-8, Lyam-1, PLNHR, CD62L	uc001ggk.3	P14151	OTTHUMG00000034809	ENST00000236147.4:c.371C>G	1.37:g.169677698G>C	ENSP00000236147:p.Ala124Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Q8|P15023|Q9UJ43	Missense_Mutation	SNP	pirsf_L-selectin,pfam_C-type_lectin,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_C-type_lectin,smart_EGF-like,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Sushi_SCR_CCP,prints_Selectin_superfamily	p.A124G	ENST00000236147.4	37	c.371	CCDS53427.1	1	.	.	.	.	.	.	.	.	.	.	G	27.4	4.826371	0.90955	.	.	ENSG00000188404	ENST00000236147	T	0.19532	2.14	5.62	5.62	0.85841	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.000000	0.50627	D	0.000104	T	0.47673	0.1458	M	0.86864	2.845	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.54483	-0.8287	10	0.72032	D	0.01	-16.0873	18.2015	0.89839	0.0:0.0:1.0:0.0	.	124;111	Q8WW79;P14151	.;LYAM1_HUMAN	G	124	ENSP00000236147:A124G	ENSP00000236147:A124G	A	-	2	0	SELL	167944322	1.000000	0.71417	0.958000	0.39756	0.821000	0.46438	7.609000	0.82925	2.651000	0.90000	0.585000	0.79938	GCA	SELL	-	pirsf_L-selectin,pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000188404		0.458	SELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELL	HGNC	protein_coding	OTTHUMT00000084233.1	77	0.00	0	G	NM_000655		169677698	169677698	-1	no_errors	ENST00000236147	ensembl	human	known	69_37n	missense	56	66.67	112	SNP	1.000	C
SEPT4	5414	genome.wustl.edu	37	17	56603978	56603978	+	Intron	SNP	G	G	A	rs2079703	byFrequency	TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:56603978G>A	ENST00000317268.3	-	2	534				RP11-112H10.4_ENST00000580769.1_RNA|SEPT4_ENST00000583114.1_Intron|SEPT4_ENST00000393086.1_Intron|SEPT4_ENST00000580809.1_Intron|SEPT4_ENST00000426861.1_Intron|SEPT4_ENST00000412945.3_Intron|SEPT4_ENST00000457347.2_Intron|SEPT4_ENST00000317256.6_Intron|SEPT4_ENST00000580791.1_Intron|SEPT4_ENST00000579371.1_Intron|RP11-112H10.4_ENST00000578022.1_RNA|SEPT4_ENST00000580844.1_Intron|RP11-112H10.4_ENST00000580589.1_RNA	NM_004574.3	NP_004565.1	O43236	SEPT4_HUMAN	septin 4						apoptotic process (GO:0006915)|brain development (GO:0007420)|cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of protein ubiquitination (GO:0031398)|regulation of apoptotic process (GO:0042981)|sperm capacitation (GO:0048240)|sperm mitochondrion organization (GO:0030382)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm annulus (GO:0097227)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	18	Medulloblastoma(34;0.127)|all_neural(34;0.237)					cacacacTCTGCTCCCTGCCC	0.552													G|||	1969	0.393171	0.2511	0.5692	5008	,	,		13818	0.5198		0.3668	False		,,,				2504	0.3569					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF073312	CCDS11609.1, CCDS11610.1, CCDS45743.1, CCDS56041.1, CCDS58581.1, CCDS58582.1	17q22	2013-01-21	2005-01-11	2005-01-12	ENSG00000108387	ENSG00000108387		"""Septins"""	9165	protein-coding gene	gene with protein product	"""bradeoin"", ""septin-M"""	603696	"""peanut-like 2 (Drosophila)"""	PNUTL2		9889007	Standard	NM_001198713		Approved	H5, CE5B3, hucep-7, ARTS, hCDCREL-2, MART	uc002iwm.2	O43236		ENST00000317268.3:c.357+64C>T	17.37:g.56603978G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD42|B3KSX9|B4DXC6|B4DXV5|Q6IAP3|Q9H315|Q9UM58	RNA	SNP	-	NULL	ENST00000317268.3	37	NULL	CCDS11610.1	17																																																																																			SEPT4	-	-	ENSG00000108387		0.552	SEPT4-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEPT4	HGNC	protein_coding	OTTHUMT00000445420.1	9	0.00	0	G	NM_080417		56603978	56603978	-1	no_errors	ENST00000580740	ensembl	human	known	69_37n	rna	2	89.47	17	SNP	0.003	A
SERPIND1	3053	genome.wustl.edu	37	22	21134011	21134011	+	Silent	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr22:21134011C>G	ENST00000215727.5	+	2	694	c.411C>G	c.(409-411)ctC>ctG	p.L137L	PI4KA_ENST00000572273.1_Intron|PI4KA_ENST00000466162.1_Intron|SERPIND1_ENST00000406799.1_Silent_p.L137L|PI4KA_ENST00000255882.6_Intron	NM_000185.3	NP_000176.2	P05546	HEP2_HUMAN	serpin peptidase inhibitor, clade D (heparin cofactor), member 1	137					blood coagulation (GO:0007596)|chemotaxis (GO:0006935)|negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|heparin binding (GO:0008201)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	13	all_cancers(11;6.16e-25)|all_epithelial(7;1.02e-22)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000536)|Lung(15;0.0108)|Epithelial(17;0.196)		Ardeparin(DB00407)|Sulodexide(DB06271)	CTTTCAACCTCTACCGAGTGC	0.488																																						dbGAP											0													94.0	79.0	84.0					22																	21134011		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M12849	CCDS13783.1	22q11.21	2014-02-18	2005-08-18		ENSG00000099937	ENSG00000099937		"""Serine (or cysteine) peptidase inhibitors"""	4838	protein-coding gene	gene with protein product	"""heparin cofactor II"""	142360	"""serine (or cysteine) proteinase inhibitor, clade D (heparin cofactor), member 1"""	HCF2		1671335, 24172014	Standard	XM_005261597		Approved	HC-II, HLS2, HC2, D22S673	uc002ztb.1	P05546	OTTHUMG00000150755	ENST00000215727.5:c.411C>G	22.37:g.21134011C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAI1|D3DX34|Q6IBZ5	Silent	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom,prints_Prot_inh_Lserp2	p.L137	ENST00000215727.5	37	c.411	CCDS13783.1	22																																																																																			SERPIND1	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom,prints_Prot_inh_Lserp2	ENSG00000099937		0.488	SERPIND1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPIND1	HGNC	protein_coding	OTTHUMT00000319961.1	27	0.00	0	C	NM_000185		21134011	21134011	+1	no_errors	ENST00000215727	ensembl	human	known	69_37n	silent	26	21.21	7	SNP	0.119	G
SHANK1	50944	genome.wustl.edu	37	19	51219970	51219970	+	Silent	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:51219970G>A	ENST00000293441.1	-	1	225	c.207C>T	c.(205-207)caC>caT	p.H69H	SHANK1_ENST00000391814.1_Silent_p.H69H|SHANK1_ENST00000359082.3_Silent_p.H69H	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	69					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)			breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		TCATGCTGAAGTGGGCGTCGT	0.672																																						dbGAP											0													91.0	76.0	81.0					19																	51219970		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.207C>T	19.37:g.51219970G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXP5|B7WNY6|Q9NYW9	Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.H69	ENST00000293441.1	37	c.207	CCDS12799.1	19																																																																																			SHANK1	-	NULL	ENSG00000161681		0.672	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	25	0.00	0	G	NM_016148		51219970	51219970	-1	no_errors	ENST00000391814	ensembl	human	known	69_37n	silent	24	45.45	20	SNP	1.000	A
SIPA1	6494	genome.wustl.edu	37	11	65413412	65413412	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr11:65413412C>G	ENST00000394224.3	+	6	1543	c.1247C>G	c.(1246-1248)cCt>cGt	p.P416R	SIPA1_ENST00000394227.3_Missense_Mutation_p.P416R|SIPA1_ENST00000527525.1_Missense_Mutation_p.P416R|SIPA1_ENST00000534313.1_Missense_Mutation_p.P416R	NM_153253.29	NP_694985.29	Q96FS4	SIPA1_HUMAN	signal-induced proliferation-associated 1	416	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				cell proliferation (GO:0008283)|cellular response to water deprivation (GO:0042631)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rap GTPase activity (GO:0032854)|signal transduction (GO:0007165)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|protein complex (GO:0043234)|transport vesicle (GO:0030133)	GTPase activator activity (GO:0005096)|Rap GTPase activator activity (GO:0046582)			cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	10						CCTTACACCCCTAATAACCAG	0.607																																						dbGAP											0													122.0	89.0	100.0					11																	65413412		2201	4296	6497	-	-	-	SO:0001583	missense	0			AH006363, BC010492, BM677738	CCDS8108.1	11q13.3	2008-09-12	2008-09-12		ENSG00000213445	ENSG00000213445			10885	protein-coding gene	gene with protein product		602180				9027487	Standard	NM_006747		Approved	SPA1	uc001ofb.2	Q96FS4	OTTHUMG00000166541	ENST00000394224.3:c.1247C>G	11.37:g.65413412C>G	ENSP00000377771:p.Pro416Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O14518|O60484|O60618|Q2YD83	Missense_Mutation	SNP	pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.P416R	ENST00000394224.3	37	c.1247	CCDS8108.1	11	.	.	.	.	.	.	.	.	.	.	C	17.54	3.416150	0.62511	.	.	ENSG00000213445	ENST00000534313;ENST00000527525;ENST00000394224;ENST00000394227	D;D;D;D	0.93859	-3.3;-3.3;-3.3;-3.3	4.07	3.13	0.36017	Rap/ran-GAP (2);	0.122249	0.33110	U	0.005278	D	0.95626	0.8578	M	0.80422	2.495	0.42251	D	0.99197	D;D	0.71674	0.998;0.998	D;D	0.69142	0.962;0.951	D	0.95325	0.8424	10	0.87932	D	0	-16.9236	9.0793	0.36542	0.0:0.8883:0.0:0.1117	.	416;416	F6RY50;Q96FS4	.;SIPA1_HUMAN	R	416	ENSP00000436269:P416R;ENSP00000433686:P416R;ENSP00000377771:P416R;ENSP00000377774:P416R	ENSP00000377771:P416R	P	+	2	0	SIPA1	65169988	1.000000	0.71417	0.996000	0.52242	0.638000	0.38207	5.813000	0.69201	2.001000	0.58596	0.462000	0.41574	CCT	SIPA1	-	pfam_Rap_GAP,pfscan_Rap_GAP	ENSG00000213445		0.607	SIPA1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SIPA1	HGNC	protein_coding	OTTHUMT00000390356.1	48	0.00	0	C	NM_006747		65413412	65413412	+1	no_errors	ENST00000394224	ensembl	human	known	69_37n	missense	51	43.96	40	SNP	1.000	G
SMG6	23293	genome.wustl.edu	37	17	1985179	1985179	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:1985179G>C	ENST00000263073.6	-	15	3656	c.3606C>G	c.(3604-3606)atC>atG	p.I1202M	SMG6_ENST00000573166.1_5'UTR|SMG6_ENST00000544865.1_Missense_Mutation_p.I1171M|SMG6_ENST00000536871.2_Missense_Mutation_p.I294M|SMG6_ENST00000354901.4_Missense_Mutation_p.I294M	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	1202					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GAAGCTCCCTGATGTCATCCT	0.582																																					Melanoma(59;28 1088 11621 25887 46638 50814)	dbGAP											0													116.0	95.0	102.0					17																	1985179		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.3606C>G	17.37:g.1985179G>C	ENSP00000263073:p.Ile1202Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	pfam_EST1,smart_PINc_nuc-bd	p.I1202M	ENST00000263073.6	37	c.3606	CCDS11016.1	17	.	.	.	.	.	.	.	.	.	.	G	22.6	4.305397	0.81247	.	.	ENSG00000070366	ENST00000263073;ENST00000544865;ENST00000354901;ENST00000536871	T;T;T	0.23147	2.74;2.74;1.92	5.15	5.15	0.70609	.	0.000000	0.64402	D	0.000001	T	0.38453	0.1041	L	0.27053	0.805	0.54753	D	0.999983	D	0.76494	0.999	D	0.66196	0.942	T	0.18178	-1.0345	10	0.48119	T	0.1	-5.0378	18.615	0.91299	0.0:0.0:1.0:0.0	.	1202	Q86US8	EST1A_HUMAN	M	1202;1171;113;294	ENSP00000263073:I1202M;ENSP00000443920:I1171M;ENSP00000440283:I294M	ENSP00000263073:I1202M	I	-	3	3	SMG6	1931929	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.034000	0.76511	2.403000	0.81681	0.561000	0.74099	ATC	SMG6	-	NULL	ENSG00000070366		0.582	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	34	0.00	0	G			1985179	1985179	-1	no_errors	ENST00000263073	ensembl	human	known	69_37n	missense	7	86.79	46	SNP	1.000	C
SNAP91	9892	genome.wustl.edu	37	6	84371309	84371309	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:84371309T>C	ENST00000439399.2	-	5	680	c.364A>G	c.(364-366)Acc>Gcc	p.T122A	SNAP91_ENST00000521743.1_Missense_Mutation_p.T122A|SNAP91_ENST00000195649.6_Missense_Mutation_p.T122A|SNAP91_ENST00000428679.2_Missense_Mutation_p.T122A|SNAP91_ENST00000520302.1_Missense_Mutation_p.T122A|SNAP91_ENST00000520213.1_Missense_Mutation_p.T122A|SNAP91_ENST00000369694.2_Missense_Mutation_p.T122A|SNAP91_ENST00000521485.1_Missense_Mutation_p.T122A|SNAP91_ENST00000437520.1_Missense_Mutation_p.T122A	NM_014841.2	NP_055656.1	O60641	AP180_HUMAN	synaptosomal-associated protein, 91kDa	122	ENTH. {ECO:0000255|PROSITE- ProRule:PRU00243}.				clathrin coat assembly (GO:0048268)|protein transport (GO:0015031)	clathrin coat (GO:0030118)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|protein kinase binding (GO:0019901)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(22)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		all_cancers(76;0.000243)|Acute lymphoblastic leukemia(125;2.91e-07)|all_hematologic(105;0.000337)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0967)		CTTATGAAGGTAGACATATCA	0.333																																						dbGAP											0													52.0	49.0	50.0					6																	84371309		1802	4070	5872	-	-	-	SO:0001583	missense	0			AB014556	CCDS47455.1, CCDS56437.1, CCDS56438.1	6q15	2012-12-07	2012-12-07		ENSG00000065609	ENSG00000065609			14986	protein-coding gene	gene with protein product		607923	"""synaptosomal-associated protein, 91 kDa (mouse) homolog"", ""synaptosomal-associated protein, 91kDa homolog (mouse)"""			9734811, 12493563, 10436022	Standard	NM_014841		Approved	KIAA0656, AP180, CALM	uc003pka.3	O60641	OTTHUMG00000015114	ENST00000439399.2:c.364A>G	6.37:g.84371309T>C	ENSP00000400459:p.Thr122Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L7|E5RI02|Q5JX13|Q68DL9|Q6P9D3|Q9NTY7	Missense_Mutation	SNP	pfam_ANTH,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	p.T122A	ENST00000439399.2	37	c.364	CCDS47455.1	6	.	.	.	.	.	.	.	.	.	.	T	16.58	3.164125	0.57476	.	.	ENSG00000065609	ENST00000521485;ENST00000369694;ENST00000439399;ENST00000195649;ENST00000428679;ENST00000437520;ENST00000520302;ENST00000521743;ENST00000520213;ENST00000521931;ENST00000519779;ENST00000518309;ENST00000369690	T;T;T;T;T;T;T;T;T;T;T;T;T	0.26373	1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74;1.74	5.13	5.13	0.70059	ENTH/VHS (2);ANTH (1);Epsin-like, N-terminal (2);	0.050604	0.85682	D	0.000000	T	0.10380	0.0254	L	0.33710	1.025	0.54753	D	0.999986	B;B;B;B	0.16396	0.008;0.002;0.017;0.002	B;B;B;B	0.12156	0.007;0.005;0.006;0.005	T	0.04413	-1.0953	10	0.56958	D	0.05	-12.3109	11.2669	0.49116	0.0:0.0742:0.0:0.9258	.	122;122;122;122	O60641-3;E5RI02;O60641;E1P549	.;.;AP180_HUMAN;.	A	122	ENSP00000429776:T122A;ENSP00000358708:T122A;ENSP00000400459:T122A;ENSP00000195649:T122A;ENSP00000412492:T122A;ENSP00000413277:T122A;ENSP00000428511:T122A;ENSP00000428215:T122A;ENSP00000428026:T122A;ENSP00000430071:T122A;ENSP00000429429:T122A;ENSP00000430441:T122A;ENSP00000358704:T122A	ENSP00000195649:T122A	T	-	1	0	SNAP91	84428028	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.187000	0.72039	2.056000	0.61249	0.460000	0.39030	ACC	SNAP91	-	pfam_ANTH,pfam_Epsin_dom_N,superfamily_ENTH_VHS,smart_Epsin-like_N,pfscan_Epsin-like_N	ENSG00000065609		0.333	SNAP91-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SNAP91	HGNC	protein_coding	OTTHUMT00000375296.1	21	0.00	0	T			84371309	84371309	-1	no_errors	ENST00000369694	ensembl	human	known	69_37n	missense	28	36.96	17	SNP	1.000	C
SORT1	6272	genome.wustl.edu	37	1	109865579	109865579	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:109865579G>A	ENST00000256637.6	-	15	2057	c.1999C>T	c.(1999-2001)Ctc>Ttc	p.L667F	SORT1_ENST00000538502.1_Missense_Mutation_p.L530F	NM_002959.5	NP_002950.3	Q99523	SORT_HUMAN	sortilin 1	667	Interactions with LRPAP1 and NGFB.				endocytosis (GO:0006897)|endosome to lysosome transport (GO:0008333)|endosome transport via multivesicular body sorting pathway (GO:0032509)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose import (GO:0046323)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|myotube differentiation (GO:0014902)|negative regulation of lipoprotein lipase activity (GO:0051005)|nerve growth factor signaling pathway (GO:0038180)|neuropeptide signaling pathway (GO:0007218)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ossification (GO:0001503)|plasma membrane to endosome transport (GO:0048227)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|vesicle organization (GO:0016050)	cell surface (GO:0009986)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasmic membrane-bounded vesicle (GO:0016023)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network transport vesicle (GO:0030140)	enzyme binding (GO:0019899)|nerve growth factor binding (GO:0048406)|nerve growth factor receptor activity (GO:0010465)|neurotensin receptor activity, non-G-protein coupled (GO:0030379)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(5)|ovary(2)|prostate(1)|skin(1)	26		all_epithelial(167;4.69e-05)|all_lung(203;0.00016)|Lung NSC(277;0.000318)|Breast(1374;0.244)		Lung(183;0.0529)|Colorectal(144;0.142)|Epithelial(280;0.145)|Kidney(133;0.169)|all cancers(265;0.184)		AGGGAACAGAGGCAGATGGAG	0.493																																						dbGAP											0													94.0	85.0	88.0					1																	109865579		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC023542	CCDS798.1, CCDS55618.1	1p13.3	2008-05-14			ENSG00000134243	ENSG00000134243			11186	protein-coding gene	gene with protein product		602458					Standard	NM_002959		Approved	Gp95, NT3	uc001dxm.2	Q99523	OTTHUMG00000011999	ENST00000256637.6:c.1999C>T	1.37:g.109865579G>A	ENSP00000256637:p.Leu667Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWI3|C0JYZ0|Q8IZ49	Missense_Mutation	SNP	pfam_BNR_rpt,smart_VPS10	p.L667F	ENST00000256637.6	37	c.1999	CCDS798.1	1	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184860	0.38609	.	.	ENSG00000134243	ENST00000256637;ENST00000538502	T;T	0.14022	2.54;2.54	5.64	3.6	0.41247	VPS10 (1);	0.676372	0.15029	N	0.284557	T	0.03783	0.0107	L	0.40543	1.245	0.21762	N	0.999553	B;P	0.44309	0.001;0.832	B;B	0.35182	0.012;0.197	T	0.28073	-1.0055	10	0.59425	D	0.04	-0.1344	7.3668	0.26779	0.0:0.2534:0.4878:0.2588	.	530;667	B4DWI3;Q99523	.;SORT_HUMAN	F	667;530	ENSP00000256637:L667F;ENSP00000438597:L530F	ENSP00000256637:L667F	L	-	1	0	SORT1	109667102	0.592000	0.26832	0.952000	0.39060	0.941000	0.58515	0.582000	0.23834	1.383000	0.46405	0.561000	0.74099	CTC	SORT1	-	smart_VPS10	ENSG00000134243		0.493	SORT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SORT1	HGNC	protein_coding	OTTHUMT00000033179.1	52	0.00	0	G	NM_002959		109865579	109865579	-1	no_errors	ENST00000256637	ensembl	human	known	69_37n	missense	53	36.90	31	SNP	0.547	A
ST3GAL5	8869	genome.wustl.edu	37	2	86067514	86067514	+	Splice_Site	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:86067514T>C	ENST00000377332.3	-	7	1118	c.1010A>G	c.(1009-1011)aAc>aGc	p.N337S	ST3GAL5_ENST00000393805.1_Splice_Site_p.N309S|ST3GAL5_ENST00000393808.3_Splice_Site_p.N314S	NM_003896.3	NP_003887.3	Q9UNP4	SIAT9_HUMAN	ST3 beta-galactoside alpha-2,3-sialyltransferase 5	337					carbohydrate metabolic process (GO:0005975)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid biosynthetic process (GO:0006688)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	lactosylceramide alpha-2,3-sialyltransferase activity (GO:0047291)|neolactotetraosylceramide alpha-2,3-sialyltransferase activity (GO:0004513)|sialyltransferase activity (GO:0008373)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15						TGTGGGGACGTTCTGAGAAAG	0.433																																						dbGAP											0													70.0	67.0	68.0					2																	86067514		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB018356	CCDS1986.2, CCDS42705.1	2p11.2	2013-03-01	2005-02-07	2005-02-07	ENSG00000115525	ENSG00000115525	2.4.99.9	"""Sialyltransferases"""	10872	protein-coding gene	gene with protein product		604402	"""sialyltransferase 9 (CMP-NeuAc:lactosylceramide alpha-2,3-sialyltransferase; GM3 synthase)"""	SIAT9		9822625	Standard	NM_003896		Approved	ST3GalV, SIATGM3S	uc002sqq.1	Q9UNP4	OTTHUMG00000130171	ENST00000377332.3:c.1009-1A>G	2.37:g.86067514T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KM82|D6W5L9|O94902|Q53QU1|Q6NZX4|Q6YFL1	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.N337S	ENST00000377332.3	37	c.1010	CCDS1986.2	2	.	.	.	.	.	.	.	.	.	.	T	16.56	3.158153	0.57368	.	.	ENSG00000115525	ENST00000393808;ENST00000393805;ENST00000377332;ENST00000393803	T;T;T	0.30182	1.54;1.54;1.54	5.6	5.6	0.85130	.	0.042005	0.85682	D	0.000000	T	0.52837	0.1759	M	0.66939	2.045	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.997	D;D;D	0.67725	0.921;0.953;0.921	T	0.55642	-0.8109	10	0.66056	D	0.02	-37.5683	14.9834	0.71327	0.0:0.0:0.0:1.0	.	309;337;314	Q9UNP4-2;Q9UNP4;Q9UNP4-3	.;SIAT9_HUMAN;.	S	314;309;337;42	ENSP00000377397:N314S;ENSP00000377394:N309S;ENSP00000366549:N337S	ENSP00000366549:N337S	N	-	2	0	ST3GAL5	85921025	1.000000	0.71417	0.914000	0.36105	0.046000	0.14306	7.922000	0.87538	2.137000	0.66172	0.533000	0.62120	AAC	ST3GAL5	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000115525		0.433	ST3GAL5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ST3GAL5	HGNC	protein_coding	OTTHUMT00000252486.1	19	0.00	0	T	NM_003896	Missense_Mutation	86067514	86067514	-1	no_errors	ENST00000377332	ensembl	human	known	69_37n	missense	24	45.45	20	SNP	0.998	C
ST8SIA2	8128	genome.wustl.edu	37	15	92981772	92981772	+	Silent	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr15:92981772G>C	ENST00000268164.3	+	4	717	c.480G>C	c.(478-480)gtG>gtC	p.V160V	ST8SIA2_ENST00000539113.1_Silent_p.V139V	NM_006011.3	NP_006002.1	Q92186	SIA8B_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 2	160					axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	early endosome (GO:0005769)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|recycling endosome (GO:0055037)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			endometrium(2)|large_intestine(6)|lung(9)|skin(2)|urinary_tract(1)	20	Lung NSC(78;0.0893)|all_lung(78;0.125)		BRCA - Breast invasive adenocarcinoma(143;0.0355)|OV - Ovarian serous cystadenocarcinoma(32;0.203)			GTGCCATCGTGGGCAACTCGG	0.582																																						dbGAP											0													71.0	64.0	66.0					15																	92981772		2198	4298	6496	-	-	-	SO:0001819	synonymous_variant	0			U33551	CCDS10372.1	15q26	2013-03-01	2003-01-14	2005-02-07	ENSG00000140557	ENSG00000140557		"""Sialyltransferases"""	10870	protein-coding gene	gene with protein product		602546	"""sialyltransferase 8 (alpha-2, 8-sialytransferase) B"""	SIAT8B		7559389	Standard	NM_006011		Approved	STX, ST8SIA-II, HsT19690	uc002bra.3	Q92186	OTTHUMG00000149843	ENST00000268164.3:c.480G>C	15.37:g.92981772G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAZ0|Q92470|Q92746	Silent	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.V160	ENST00000268164.3	37	c.480	CCDS10372.1	15																																																																																			ST8SIA2	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans	ENSG00000140557		0.582	ST8SIA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA2	HGNC	protein_coding	OTTHUMT00000313526.1	51	0.00	0	G	NM_006011		92981772	92981772	+1	no_errors	ENST00000268164	ensembl	human	known	69_37n	silent	81	15.62	15	SNP	1.000	C
TDRKH	11022	genome.wustl.edu	37	1	151747603	151747603	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:151747603C>T	ENST00000368822.1	-	11	2107	c.1474G>A	c.(1474-1476)Gca>Aca	p.A492T	TDRKH_ENST00000458431.2_Missense_Mutation_p.A492T|TDRKH_ENST00000368824.3_Missense_Mutation_p.A492T|TDRKH_ENST00000368827.6_Missense_Mutation_p.A492T|TDRKH_ENST00000440583.2_Missense_Mutation_p.A268T|TDRKH_ENST00000368825.3_Missense_Mutation_p.A447T|TDRKH_ENST00000368823.1_Missense_Mutation_p.A488T			Q9Y2W6	TDRKH_HUMAN	tudor and KH domain containing	492					cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|male meiosis (GO:0007140)|piRNA metabolic process (GO:0034587)|spermatogenesis (GO:0007283)	mitochondrion (GO:0005739)|pi-body (GO:0071546)|piP-body (GO:0071547)	RNA binding (GO:0003723)			breast(5)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			AGCTCAATTGCGTATCCTTTG	0.408																																						dbGAP											0													154.0	136.0	142.0					1																	151747603		1882	4123	6005	-	-	-	SO:0001583	missense	0			AF227192	CCDS41394.1, CCDS41395.1	1q21	2013-01-23	2003-11-07		ENSG00000182134	ENSG00000182134		"""Tudor domain containing"""	11713	protein-coding gene	gene with protein product		609501	"""tudor and KH domain containing"""			10767542	Standard	NM_001083964		Approved	TDRD2	uc001eza.4	Q9Y2W6	OTTHUMG00000013062	ENST00000368822.1:c.1474G>A	1.37:g.151747603C>T	ENSP00000357812:p.Ala492Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV24|Q5SZR3|Q5SZR5|Q8N582|Q9NYV5	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_Tudor,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.A492T	ENST00000368822.1	37	c.1474	CCDS41394.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.072557	0.93950	.	.	ENSG00000182134	ENST00000368827;ENST00000368825;ENST00000368824;ENST00000368823;ENST00000368822;ENST00000458431;ENST00000440583	T;T;T;T;T;T;T	0.62232	0.4;0.04;0.4;0.44;0.4;0.4;0.05	6.03	6.03	0.97812	.	0.231802	0.44285	D	0.000475	T	0.74779	0.3761	M	0.73217	2.22	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.996;0.996;0.996	T	0.76366	-0.2985	10	0.87932	D	0	-17.366	16.0597	0.80832	0.0:1.0:0.0:0.0	.	447;488;492	Q5SZR5;Q5SZR4;Q9Y2W6	.;.;TDRKH_HUMAN	T	492;447;492;488;492;492;268	ENSP00000357819:A492T;ENSP00000357817:A447T;ENSP00000357815:A492T;ENSP00000357813:A488T;ENSP00000357812:A492T;ENSP00000395718:A492T;ENSP00000416645:A268T	ENSP00000357812:A492T	A	-	1	0	TDRKH	150014227	0.985000	0.35326	0.992000	0.48379	0.973000	0.67179	3.741000	0.55090	2.868000	0.98415	0.555000	0.69702	GCA	TDRKH	-	NULL	ENSG00000182134		0.408	TDRKH-005	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TDRKH	HGNC	protein_coding	OTTHUMT00000036648.2	56	0.00	0	C	NM_006862		151747603	151747603	-1	no_errors	ENST00000368822	ensembl	human	known	69_37n	missense	88	26.05	31	SNP	0.999	T
TEAD4	7004	genome.wustl.edu	37	12	3131102	3131102	+	Missense_Mutation	SNP	C	C	G	rs548956335		TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr12:3131102C>G	ENST00000397122.2	+	8	714	c.429C>G	c.(427-429)gaC>gaG	p.D143E	TEAD4_ENST00000359864.2_Missense_Mutation_p.D272E|TEAD4_ENST00000358409.2_Missense_Mutation_p.D229E	NM_201443.2	NP_958851.1	Q15561	TEAD4_HUMAN	TEA domain family member 4	272					gene expression (GO:0010467)|hippo signaling (GO:0035329)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10	Ovarian(42;0.211)		OV - Ovarian serous cystadenocarcinoma(31;0.000563)|COAD - Colon adenocarcinoma(12;0.0831)			AAATCTATGACAAATTCCCGG	0.527																																						dbGAP											0													148.0	152.0	150.0					12																	3131102		2203	4300	6503	-	-	-	SO:0001583	missense	0			X94438	CCDS31729.1, CCDS31730.1, CCDS41737.1	12p13.3-p13.2	2008-05-14				ENSG00000197905			11717	protein-coding gene	gene with protein product		601714		TCF13L1		9889009, 8921372	Standard	NM_003213		Approved	TEF-3, TEFR-1, EFTR-2, RTEF-1	uc010sej.2	Q15561		ENST00000397122.2:c.429C>G	12.37:g.3131102C>G	ENSP00000380311:p.Asp143Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	H0Y308|Q6MZR9|Q8NEV5|Q92883|Q96BK2	Missense_Mutation	SNP	pfam_TEA/ATTS,smart_TEA/ATTS,pirsf_TEF,pfscan_TEA/ATTS,prints_TEA/ATTS	p.D272E	ENST00000397122.2	37	c.816	CCDS41737.1	12	.	.	.	.	.	.	.	.	.	.	C	17.88	3.497449	0.64186	.	.	ENSG00000197905	ENST00000358409;ENST00000359864;ENST00000397122	T;T;T	0.32272	1.46;1.46;1.46	4.19	4.19	0.49359	.	0.218239	0.41712	D	0.000829	T	0.37237	0.0996	M	0.80982	2.52	0.80722	D	1	P	0.36909	0.573	B	0.34991	0.193	T	0.43048	-0.9415	10	0.40728	T	0.16	-18.7091	15.6724	0.77289	0.0:1.0:0.0:0.0	.	272	Q15561	TEAD4_HUMAN	E	229;272;143	ENSP00000351184:D229E;ENSP00000352926:D272E;ENSP00000380311:D143E	ENSP00000351184:D229E	D	+	3	2	TEAD4	3001363	1.000000	0.71417	1.000000	0.80357	0.257000	0.26127	4.813000	0.62620	2.167000	0.68274	0.655000	0.94253	GAC	TEAD4	-	pfam_TEA/ATTS,pirsf_TEF	ENSG00000197905		0.527	TEAD4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TEAD4	HGNC	protein_coding	OTTHUMT00000398477.1	43	0.00	0	C	NM_003213		3131102	3131102	+1	no_errors	ENST00000359864	ensembl	human	known	69_37n	missense	50	41.86	36	SNP	1.000	G
THSD1	55901	genome.wustl.edu	37	13	52952529	52952529	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr13:52952529G>A	ENST00000258613.4	-	5	1754	c.1576C>T	c.(1576-1578)Cct>Tct	p.P526S	THSD1_ENST00000544466.1_Missense_Mutation_p.P147S|THSD1_ENST00000349258.4_Missense_Mutation_p.P473S	NM_018676.3	NP_061146.1	Q9NS62	THSD1_HUMAN	thrombospondin, type I, domain containing 1	526					hematopoietic progenitor cell differentiation (GO:0002244)	cell periphery (GO:0071944)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Breast(56;0.000207)|Lung NSC(96;0.00145)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;2.8e-08)		CTGAACAGAGGTGGGATTATC	0.557																																						dbGAP											0													134.0	140.0	138.0					13																	52952529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096289	CCDS9432.1, CCDS9433.1	13q14.13	2010-04-20	2004-03-11		ENSG00000136114	ENSG00000136114			17754	protein-coding gene	gene with protein product			"""thrombospondin, type I, domain 1"""				Standard	NM_018676		Approved	TMTSP	uc001vgo.3	Q9NS62	OTTHUMG00000016963	ENST00000258613.4:c.1576C>T	13.37:g.52952529G>A	ENSP00000258613:p.Pro526Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3J3|B2RCF5|Q6P3U1|Q6UXZ2	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.P526S	ENST00000258613.4	37	c.1576	CCDS9432.1	13	.	.	.	.	.	.	.	.	.	.	g	21.7	4.185474	0.78677	.	.	ENSG00000136114	ENST00000349258;ENST00000544466;ENST00000258613	T;T;T	0.36157	1.98;1.27;2.16	5.87	5.87	0.94306	.	0.114885	0.64402	D	0.000011	T	0.62490	0.2432	M	0.71581	2.175	0.54753	D	0.999988	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	T	0.63323	-0.6663	10	0.87932	D	0	-18.6824	19.2108	0.93753	0.0:0.0:1.0:0.0	.	473;526	Q9NS62-2;Q9NS62	.;THSD1_HUMAN	S	473;147;526	ENSP00000340650:P473S;ENSP00000438512:P147S;ENSP00000258613:P526S	ENSP00000258613:P526S	P	-	1	0	THSD1	51850530	0.998000	0.40836	0.767000	0.31495	0.982000	0.71751	5.097000	0.64542	2.778000	0.95560	0.650000	0.86243	CCT	THSD1	-	NULL	ENSG00000136114		0.557	THSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD1	HGNC	protein_coding	OTTHUMT00000045058.3	13	0.00	0	G			52952529	52952529	-1	no_errors	ENST00000258613	ensembl	human	known	69_37n	missense	4	76.47	13	SNP	0.979	A
TIMM17B	10245	genome.wustl.edu	37	X	48751358	48751358	+	Intron	SNP	G	G	T	rs375193997		TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chrX:48751358G>T	ENST00000376582.3	-	5	468				TIMM17B_ENST00000465150.2_Intron|TIMM17B_ENST00000495490.2_Intron|TIMM17B_ENST00000396779.3_Intron|TIMM17B_ENST00000472645.1_Intron	NM_005834.3	NP_005825.1	O60830	TI17B_HUMAN	translocase of inner mitochondrial membrane 17 homolog B (yeast)						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane presequence translocase complex (GO:0005744)	P-P-bond-hydrolysis-driven protein transmembrane transporter activity (GO:0015450)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)	6						AGGGGCTGGGGCCAGGGCCAG	0.647																																						dbGAP											0													21.0	22.0	22.0					X																	48751358		2188	4290	6478	-	-	-	SO:0001627	intron_variant	0			AF034790	CCDS14308.1, CCDS55411.1	Xp11.23	2008-02-05			ENSG00000126768	ENSG00000126768			17310	protein-coding gene	gene with protein product		300249				10339406	Standard	NM_001167947		Approved	DXS9822, JM3	uc004dla.2	O60830	OTTHUMG00000034498	ENST00000376582.3:c.319+21C>A	X.37:g.48751358G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2E2|J3KPV3|Q9UJV0	RNA	SNP	-	NULL	ENST00000376582.3	37	NULL	CCDS14308.1	X																																																																																			TIMM17B	-	-	ENSG00000126768		0.647	TIMM17B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIMM17B	HGNC	protein_coding	OTTHUMT00000083411.2	54	0.00	0	G	NM_005834		48751358	48751358	-1	no_errors	ENST00000466995	ensembl	human	known	69_37n	rna	38	47.95	35	SNP	0.001	T
TMEM60	85025	genome.wustl.edu	37	7	77423617	77423617	+	Missense_Mutation	SNP	A	A	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:77423617A>C	ENST00000257663.3	-	2	450	c.74T>G	c.(73-75)tTg>tGg	p.L25W		NM_032936.3	NP_116325.1	Q9H2L4	TMM60_HUMAN	transmembrane protein 60	25						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(2)	4						ATCCAGTTTCAACACCAACAT	0.413																																						dbGAP											0													76.0	76.0	76.0					7																	77423617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF260336	CCDS5593.1	7q11.23	2005-07-25	2005-07-25	2005-07-25	ENSG00000135211	ENSG00000135211			21754	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 35"""	C7orf35			Standard	NM_032936		Approved	DC32	uc003ugn.3	Q9H2L4	OTTHUMG00000130689	ENST00000257663.3:c.74T>G	7.37:g.77423617A>C	ENSP00000257663:p.Leu25Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C3|Q86UM0	Missense_Mutation	SNP	pfam_TM_Fragile-X-F-assoc	p.L25W	ENST00000257663.3	37	c.74	CCDS5593.1	7	.	.	.	.	.	.	.	.	.	.	A	20.4	3.989608	0.74589	.	.	ENSG00000135211	ENST00000257663	T	0.56941	0.43	6.07	6.07	0.98685	.	0.000000	0.64402	D	0.000001	T	0.74176	0.3682	M	0.77313	2.365	0.48696	D	0.999696	D	0.89917	1.0	D	0.91635	0.999	T	0.77354	-0.2619	10	0.87932	D	0	-10.1371	16.6406	0.85098	1.0:0.0:0.0:0.0	.	25	Q9H2L4	TMM60_HUMAN	W	25	ENSP00000257663:L25W	ENSP00000257663:L25W	L	-	2	0	TMEM60	77261553	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.388000	0.79795	2.326000	0.78906	0.533000	0.62120	TTG	TMEM60	-	pfam_TM_Fragile-X-F-assoc	ENSG00000135211		0.413	TMEM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM60	HGNC	protein_coding	OTTHUMT00000253185.2	32	0.00	0	A	NM_032936		77423617	77423617	-1	no_errors	ENST00000257663	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	1.000	C
TP53	7157	genome.wustl.edu	37	17	7578222	7578223	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:7578222_7578223delTC	ENST00000269305.4	-	6	815_816	c.626_627delGA	c.(625-627)agafs	p.R209fs	TP53_ENST00000420246.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000413465.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000455263.2_Frame_Shift_Del_p.R209fs|TP53_ENST00000574684.1_Intron|TP53_ENST00000359597.4_Frame_Shift_Del_p.R209fs|TP53_ENST00000445888.2_Frame_Shift_Del_p.R209fs	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	209	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		R -> I (in sporadic cancers; somatic mutation).|R -> K (in sporadic cancers; somatic mutation).|R -> S (in a sporadic cancer; somatic mutation).|R -> T (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R209fs*6(38)|p.0?(8)|p.R209K(7)|p.?(5)|p.R209T(3)|p.R77fs*6(2)|p.R209fs*35(2)|p.D207fs*6(2)|p.R209fs*38(2)|p.R116fs*6(2)|p.R77K(1)|p.R116K(1)|p.E204_N210delEYLDDRN(1)|p.R209fs*36(1)|p.D207_R213delDDRNTFR(1)|p.D208_V216delDRNTFRHSV(1)|p.D208fs*1(1)|p.N210fs*7(1)|p.R209S(1)|p.R209I(1)|p.R209_R213delRNTFR(1)|p.D207_V216del10(1)|p.R209fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GAAAAGTGTTTCTGTCATCCAA	0.535		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	84	Deletion - Frameshift(51)|Substitution - Missense(14)|Whole gene deletion(8)|Deletion - In frame(5)|Unknown(5)|Insertion - Frameshift(1)	biliary_tract(11)|breast(9)|upper_aerodigestive_tract(8)|oesophagus(7)|large_intestine(6)|central_nervous_system(5)|haematopoietic_and_lymphoid_tissue(5)|prostate(5)|lung(4)|bone(4)|stomach(3)|soft_tissue(3)|ovary(3)|pancreas(3)|salivary_gland(2)|skin(2)|cervix(1)|urinary_tract(1)|liver(1)|thyroid(1)	GRCh37	CD962734	TP53	D																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.626_627delGA	17.37:g.7578222_7578223delTC	ENSP00000269305:p.Arg209fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Frame_Shift_Del	DEL	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R209fs	ENST00000269305.4	37	c.627_626	CCDS11118.1	17																																																																																			TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.535	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	33	0.00	0	TC	NM_000546		7578222	7578223	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	frame_shift_del	14	75.00	42	DEL	0.000:0.000	-
TRIM11	81559	genome.wustl.edu	37	1	228584876	228584876	+	Intron	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr1:228584876G>C	ENST00000284551.6	-	4	1014				TRIM11_ENST00000493030.2_Intron|RP11-245P10.8_ENST00000602963.1_RNA|TRIM11_ENST00000366699.3_Intron|TRIM11_ENST00000460651.1_Intron	NM_145214.2	NP_660215.1	Q96F44	TRI11_HUMAN	tripartite motif containing 11						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of neurogenesis (GO:0050768)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of viral entry into host cell (GO:0046598)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|skin(1)	18		Prostate(94;0.0724)				CCTATGTGGGGAGGAGAAACA	0.657																																						dbGAP											0													83.0	88.0	86.0					1																	228584876		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF220125	CCDS31048.1	1q42.13	2013-01-09	2011-01-25		ENSG00000154370	ENSG00000154370		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16281	protein-coding gene	gene with protein product		607868	"""tripartite motif-containing 11"""			11331580	Standard	NM_145214		Approved	RNF92, BIA1	uc001hss.3	Q96F44	OTTHUMG00000039773	ENST00000284551.6:c.736-10C>G	1.37:g.228584876G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKE2|B2RB82|B3KUS3|B4DX88|Q5VSU1|Q8NCA6|Q9C022	RNA	SNP	-	NULL	ENST00000284551.6	37	NULL	CCDS31048.1	1																																																																																			TRIM11	-	-	ENSG00000154370		0.657	TRIM11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM11	HGNC	protein_coding	OTTHUMT00000095995.3	86	0.00	0	G	NM_145214		228584876	228584876	-1	no_errors	ENST00000475775	ensembl	human	known	69_37n	rna	149	10.24	17	SNP	0.000	C
TSC22D2	9819	genome.wustl.edu	37	3	150176290	150176290	+	Nonsense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:150176290C>G	ENST00000361875.3	+	4	3226	c.2210C>G	c.(2209-2211)tCa>tGa	p.S737*	TSC22D2_ENST00000361136.2_Nonsense_Mutation_p.S713*	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	737					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AAATCTCTTTCAAGCAATGAT	0.408																																						dbGAP											0													113.0	110.0	111.0					3																	150176290		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.2210C>G	3.37:g.150176290C>G	ENSP00000354543:p.Ser737*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Nonsense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.S737*	ENST00000361875.3	37	c.2210	CCDS3149.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	43|43	9.892719|9.892719	0.99289|0.99289	.|.	.|.	ENSG00000196428|ENSG00000196428	ENST00000466814|ENST00000543241;ENST00000361875;ENST00000361136	.|.	.|.	.|.	5.38|5.38	3.5|3.5	0.40072|0.40072	.|.	.|0.300336	.|0.22801	.|N	.|0.055464	T|.	0.74030|.	0.3663|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.76653|.	-0.2880|.	4|.	.|0.72032	.|D	.|0.01	.|.	14.3986|14.3986	0.67027|0.67027	0.2699:0.7301:0.0:0.0|0.2699:0.7301:0.0:0.0	.|.	.|.	.|.	.|.	L|X	160|186;737;713	.|.	.|ENSP00000354893:S713X	F|S	+|+	3|2	2|0	TSC22D2|TSC22D2	151658980|151658980	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.002000|0.002000	0.02628|0.02628	7.445000|7.445000	0.80570|0.80570	0.686000|0.686000	0.31488|0.31488	0.655000|0.655000	0.94253|0.94253	TTC|TCA	TSC22D2	-	pfam_TSC-22_Dip_Bun	ENSG00000196428		0.408	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	HGNC	protein_coding	OTTHUMT00000357123.2	33	0.00	0	C	NM_014779		150176290	150176290	+1	no_errors	ENST00000361875	ensembl	human	known	69_37n	nonsense	81	13.83	13	SNP	1.000	G
TSHZ2	128553	genome.wustl.edu	37	20	51870687	51870687	+	Silent	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr20:51870687G>A	ENST00000371497.5	+	2	1577	c.690G>A	c.(688-690)ctG>ctA	p.L230L	TSHZ2_ENST00000603338.2_Silent_p.L227L|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Silent_p.L227L	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	230					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			TAGTCGAGCTGACTGTGCACA	0.547																																						dbGAP											0													59.0	52.0	54.0					20																	51870687		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.690G>A	20.37:g.51870687G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.L230	ENST00000371497.5	37	c.690	CCDS33490.1	20																																																																																			TSHZ2	-	smart_Znf_C2H2-like	ENSG00000182463		0.547	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	27	0.00	0	G	NM_173485		51870687	51870687	+1	no_errors	ENST00000371497	ensembl	human	known	69_37n	silent	26	31.58	12	SNP	0.995	A
TTC29	83894	genome.wustl.edu	37	4	147788723	147788723	+	Missense_Mutation	SNP	T	T	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr4:147788723T>A	ENST00000325106.4	-	8	1038	c.812A>T	c.(811-813)aAg>aTg	p.K271M	TTC29_ENST00000513335.1_Missense_Mutation_p.K297M|TTC29_ENST00000398886.4_Missense_Mutation_p.K297M	NM_031956.2	NP_114162.2	Q8NA56	TTC29_HUMAN	tetratricopeptide repeat domain 29	271										breast(2)|cervix(2)|endometrium(3)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					CGCTTCCATCTTTTTGTCACT	0.348																																						dbGAP											0													60.0	57.0	58.0					4																	147788723		1816	4077	5893	-	-	-	SO:0001583	missense	0			AF345910	CCDS47141.1, CCDS75200.1	4q31.23	2013-01-11				ENSG00000137473		"""Tetratricopeptide (TTC) repeat domain containing"""	29936	protein-coding gene	gene with protein product						12477932	Standard	NM_031956		Approved	NYD-SP14	uc003ikw.4	Q8NA56		ENST00000325106.4:c.812A>T	4.37:g.147788723T>A	ENSP00000316740:p.Lys271Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4GU95|Q9BXB6	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.K297M	ENST00000325106.4	37	c.890	CCDS47141.1	4	.	.	.	.	.	.	.	.	.	.	T	6.241	0.412549	0.11812	.	.	ENSG00000137473	ENST00000513335;ENST00000398886;ENST00000325106;ENST00000398883;ENST00000504425	T;T;T;T	0.76448	-1.02;-1.02;-1.02;-1.02	5.45	1.61	0.23674	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.315023	0.35903	N	0.002902	T	0.78991	0.4371	L	0.46157	1.445	0.24392	N	0.994748	P;D;P	0.71674	0.722;0.998;0.722	B;D;B	0.63113	0.08;0.911;0.08	T	0.68591	-0.5368	10	0.66056	D	0.02	-7.7005	6.2883	0.21045	0.0:0.1437:0.1346:0.7217	.	271;297;271	E7EQ14;G5E9Z5;Q8NA56	.;.;TTC29_HUMAN	M	297;297;271;271;271	ENSP00000423505:K297M;ENSP00000381861:K297M;ENSP00000316740:K271M;ENSP00000425778:K271M	ENSP00000316740:K271M	K	-	2	0	TTC29	148008173	0.993000	0.37304	0.412000	0.26496	0.048000	0.14542	0.299000	0.19138	0.108000	0.17862	0.482000	0.46254	AAG	TTC29	-	pfscan_TPR-contain_dom	ENSG00000137473		0.348	TTC29-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC29	HGNC	protein_coding		24	0.00	0	T	NM_031956		147788723	147788723	-1	no_errors	ENST00000398886	ensembl	human	known	69_37n	missense	3	72.73	8	SNP	0.929	A
TTC6	319089	genome.wustl.edu	37	14	38218445	38218445	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr14:38218445G>A	ENST00000553443.1	+	11	2665	c.2665G>A	c.(2665-2667)Gat>Aat	p.D889N				Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	0										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		TGTGGAGTCTGATCTTCCACA	0.318																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000553443.1:c.2665G>A	14.37:g.38218445G>A	ENSP00000451131:p.Asp889Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY88|Q96CE6	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D889N	ENST00000553443.1	37	c.2665		14	.	.	.	.	.	.	.	.	.	.	G	0.272	-0.992490	0.02162	.	.	ENSG00000139865	ENST00000553443	T	0.70516	-0.49	5.38	-3.82	0.04281	.	.	.	.	.	T	0.49440	0.1557	.	.	.	.	.	.	.	.	.	.	.	.	T	0.41680	-0.9495	4	.	.	.	.	2.2502	0.04042	0.3714:0.1932:0.3367:0.0987	.	.	.	.	N	889	ENSP00000451131:D889N	.	D	+	1	0	TTC6	37288196	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.350000	0.07721	-0.870000	0.04047	-1.839000	0.00587	GAT	TTC6	-	NULL	ENSG00000139865		0.318	TTC6-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	TTC6	HGNC	protein_coding	OTTHUMT00000348620.4	23	0.00	0	G	XM_002343299		38218445	38218445	+1	no_errors	ENST00000553443	ensembl	human	novel	69_37n	missense	29	16.67	6	SNP	0.000	A
TTC6	319089	genome.wustl.edu	37	14	38295446	38295446	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr14:38295446T>C	ENST00000476979.1	+	10	1210	c.923T>C	c.(922-924)aTa>aCa	p.I308T	TTC6_ENST00000267368.7_Missense_Mutation_p.I308T|TTC6_ENST00000382320.3_Missense_Mutation_p.I388T|TTC6_ENST00000553443.1_Missense_Mutation_p.I1674T|RNU6-1277P_ENST00000364561.1_RNA			Q86TZ1	TTC6_HUMAN	tetratricopeptide repeat domain 6	308										central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	14	Hepatocellular(127;0.213)|Esophageal squamous(585;0.22)		Lung(238;1.59e-06)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0543)|all cancers(34;0.108)|BRCA - Breast invasive adenocarcinoma(188;0.156)|LUSC - Lung squamous cell carcinoma(13;0.176)	GBM - Glioblastoma multiforme(112;0.00551)		ACCATTGCCATAGATACTGAT	0.393																																						dbGAP											0													122.0	118.0	119.0					14																	38295446		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014342		14q13.1	2013-01-10			ENSG00000139865	ENSG00000139865		"""Tetratricopeptide (TTC) repeat domain containing"""	19739	protein-coding gene	gene with protein product			"""non-protein coding RNA 291"", ""chromosome 14 open reading frame 25"""	NCRNA00291, C14orf25			Standard	XM_006709976		Approved		uc001wuj.3	Q86TZ1	OTTHUMG00000157369	ENST00000476979.1:c.923T>C	14.37:g.38295446T>C	ENSP00000417788:p.Ile308Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY88|Q96CE6	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I405T	ENST00000476979.1	37	c.1214		14	.	.	.	.	.	.	.	.	.	.	T	5.868	0.344336	0.11126	.	.	ENSG00000139865	ENST00000553443;ENST00000476979;ENST00000267368;ENST00000382320	T;T;T;T	0.63096	0.34;0.34;0.34;-0.02	5.36	4.18	0.49190	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.849336	0.10614	N	0.654086	T	0.72162	0.3426	M	0.92555	3.32	0.36354	D	0.860297	B;B	0.20550	0.046;0.003	B;B	0.28232	0.087;0.008	T	0.73056	-0.4103	9	0.51188	T	0.08	-0.015	10.0865	0.42421	0.0:0.0848:0.0:0.9152	.	1674;308	G3V3A5;Q86TZ1	.;TTC6_HUMAN	T	1674;308;308;388	ENSP00000451131:I1674T;ENSP00000417788:I308T;ENSP00000267368:I308T;ENSP00000371757:I388T	ENSP00000267368:I308T	I	+	2	0	TTC6	37365197	0.963000	0.33076	0.015000	0.15790	0.015000	0.08874	2.299000	0.43611	0.828000	0.34709	-0.417000	0.06048	ATA	TTC6	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000139865		0.393	TTC6-002	KNOWN	basic	protein_coding	TTC6	HGNC	protein_coding	OTTHUMT00000348621.2	34	0.00	0	T	XM_002343299		38295446	38295446	+1	no_errors	ENST00000478811	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	0.094	C
USP11	8237	genome.wustl.edu	37	X	47104842	47104842	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chrX:47104842T>C	ENST00000218348.3	+	17	2360	c.2360T>C	c.(2359-2361)cTc>cCc	p.L787P	USP11_ENST00000377107.2_Missense_Mutation_p.L744P	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	787	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						TGCATTGAGCTCTTCACCACT	0.557																																						dbGAP											0													57.0	46.0	50.0					X																	47104842		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.2360T>C	X.37:g.47104842T>C	ENSP00000218348:p.Leu787Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.L787P	ENST00000218348.3	37	c.2360	CCDS14277.1	X	.	.	.	.	.	.	.	.	.	.	T	23.9	4.469484	0.84533	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.32988	1.43;1.43	5.08	5.08	0.68730	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.157646	0.42682	D	0.000662	T	0.56001	0.1956	M	0.78637	2.42	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.61292	-0.7092	10	0.72032	D	0.01	-20.4613	12.938	0.58327	0.0:0.0:0.0:1.0	.	513;787	B3KP28;P51784	.;UBP11_HUMAN	P	744;787	ENSP00000366311:L744P;ENSP00000218348:L787P	ENSP00000218348:L787P	L	+	2	0	USP11	46989786	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.764000	0.85297	1.694000	0.51137	0.356000	0.21956	CTC	USP11	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000102226		0.557	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		84	0.00	0	T	NM_004651		47104842	47104842	+1	no_errors	ENST00000218348	ensembl	human	known	69_37n	missense	95	48.09	88	SNP	1.000	C
VAMP5	10791	genome.wustl.edu	37	2	85818859	85818859	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:85818859G>T	ENST00000306384.4	+	2	98	c.15G>T	c.(13-15)gaG>gaT	p.E5D		NM_006634.2	NP_006625.1	O95183	VAMP5_HUMAN	vesicle-associated membrane protein 5	5	v-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00290}.				cell differentiation (GO:0030154)|Golgi to plasma membrane protein transport (GO:0043001)|muscle organ development (GO:0007517)|skeletal muscle tissue development (GO:0007519)	cell surface (GO:0009986)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|integral component of organelle membrane (GO:0031301)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|late endosome (GO:0005770)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|large_intestine(3)|lung(1)	5						CAGGAATAGAGTTGGAGCGGT	0.612																																						dbGAP											0													93.0	81.0	85.0					2																	85818859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054825	CCDS1980.1	2p11.2	2013-02-13	2012-10-17		ENSG00000168899	ENSG00000168899		"""Vesicle-associated membrane proteins"""	12646	protein-coding gene	gene with protein product	"""myobrevin"""	607029				9725904	Standard	NM_006634		Approved		uc002spu.1	O95183	OTTHUMG00000130169	ENST00000306384.4:c.15G>T	2.37:g.85818859G>T	ENSP00000305647:p.Glu5Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P0T2	Missense_Mutation	SNP	pfam_Synaptobrevin,pirsf_Synaptobrevin_met/fun,pfscan_Synaptobrevin,prints_Synaptobrevin	p.E5D	ENST00000306384.4	37	c.15	CCDS1980.1	2	.	.	.	.	.	.	.	.	.	.	G	13.90	2.374326	0.42105	.	.	ENSG00000168899	ENST00000306384	.	.	.	4.84	1.76	0.24704	Synaptobrevin (1);	0.473959	0.19919	N	0.103122	T	0.39358	0.1075	M	0.67953	2.075	0.27978	N	0.936135	B	0.11235	0.004	B	0.16289	0.015	T	0.44143	-0.9347	9	0.87932	D	0	.	1.9736	0.03411	0.1247:0.2662:0.4348:0.1743	.	5	O95183	VAMP5_HUMAN	D	5	.	ENSP00000305647:E5D	E	+	3	2	VAMP5	85672370	0.967000	0.33354	1.000000	0.80357	0.992000	0.81027	0.188000	0.17018	0.402000	0.25451	0.561000	0.74099	GAG	VAMP5	-	pirsf_Synaptobrevin_met/fun,pfscan_Synaptobrevin	ENSG00000168899		0.612	VAMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAMP5	HGNC	protein_coding	OTTHUMT00000252484.2	46	0.00	0	G	NM_006634		85818859	85818859	+1	no_errors	ENST00000306384	ensembl	human	known	69_37n	missense	46	38.67	29	SNP	0.998	T
VILL	50853	genome.wustl.edu	37	3	38039609	38039609	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:38039609G>T	ENST00000283713.6	+	8	1059	c.793G>T	c.(793-795)Gtc>Ttc	p.V265F	VILL_ENST00000383759.2_Missense_Mutation_p.V265F|VILL_ENST00000465644.1_Intron			O15195	VILL_HUMAN	villin-like	265					actin filament capping (GO:0051693)|cytoskeleton organization (GO:0007010)	actin cytoskeleton (GO:0015629)	structural constituent of cytoskeleton (GO:0005200)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|liver(1)|lung(7)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|urinary_tract(2)	28				KIRC - Kidney renal clear cell carcinoma(284;0.0525)|Kidney(284;0.0661)		AGACCTGGTGGTCCTGGAGTT	0.632																																						dbGAP											0													66.0	62.0	63.0					3																	38039609		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS2670.2	3p21	2004-07-28			ENSG00000136059	ENSG00000136059			30906	protein-coding gene	gene with protein product						9179494	Standard	XM_005265191		Approved		uc003chl.3	O15195	OTTHUMG00000130814	ENST00000283713.6:c.793G>T	3.37:g.38039609G>T	ENSP00000283713:p.Val265Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZP1|Q9BT80|Q9BWH7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,pfscan_Villin_headpiece,prints_Gelsolin	p.V265F	ENST00000283713.6	37	c.793	CCDS2670.2	3	.	.	.	.	.	.	.	.	.	.	G	10.40	1.338629	0.24253	.	.	ENSG00000136059	ENST00000283713;ENST00000383759	T;T	0.35789	1.29;1.29	4.22	-1.74	0.08056	.	0.409055	0.25836	N	0.027993	T	0.16811	0.0404	N	0.08118	0	0.32170	N	0.58181	B	0.18013	0.025	B	0.23150	0.044	T	0.05616	-1.0874	10	0.54805	T	0.06	-6.7389	8.9808	0.35964	0.3733:0.0:0.6267:0.0	.	265	O15195	VILL_HUMAN	F	265	ENSP00000283713:V265F;ENSP00000373266:V265F	ENSP00000283713:V265F	V	+	1	0	VILL	38014613	0.986000	0.35501	0.969000	0.41365	0.174000	0.22865	0.148000	0.16224	-0.692000	0.05128	-0.266000	0.10368	GTC	VILL	-	smart_Gelsolin	ENSG00000136059		0.632	VILL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VILL	HGNC	protein_coding	OTTHUMT00000253360.3	27	0.00	0	G	NM_015873		38039609	38039609	+1	no_errors	ENST00000283713	ensembl	human	known	69_37n	missense	7	87.50	49	SNP	1.000	T
WDR12	55759	genome.wustl.edu	37	2	203747488	203747488	+	Nonsense_Mutation	SNP	A	A	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:203747488A>T	ENST00000261015.4	-	12	1889	c.1140T>A	c.(1138-1140)taT>taA	p.Y380*		NM_018256.3	NP_060726.3			WD repeat domain 12											endometrium(3)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)	13						CAGCCAGATCATAGAGAGGAG	0.323																																						dbGAP											0													91.0	95.0	94.0					2																	203747488		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF242546	CCDS2356.1	2q33.1	2013-01-09			ENSG00000138442	ENSG00000138442		"""WD repeat domain containing"""	14098	protein-coding gene	gene with protein product						16043514, 17353269	Standard	NM_018256		Approved	YTM1, FLJ10881	uc002uzl.3	Q9GZL7	OTTHUMG00000132855	ENST00000261015.4:c.1140T>A	2.37:g.203747488A>T	ENSP00000261015:p.Tyr380*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_NLE,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Y380*	ENST00000261015.4	37	c.1140	CCDS2356.1	2	.	.	.	.	.	.	.	.	.	.	A	44	10.923451	0.99489	.	.	ENSG00000138442	ENST00000261015	.	.	.	5.62	3.25	0.37280	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-15.7962	9.2834	0.37742	0.7872:0.0:0.2128:0.0	.	.	.	.	X	380	.	ENSP00000261015:Y380X	Y	-	3	2	WDR12	203455733	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.602000	0.36783	1.097000	0.41459	0.524000	0.50904	TAT	WDR12	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000138442		0.323	WDR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR12	HGNC	protein_coding	OTTHUMT00000256329.4	22	0.00	0	A	NM_018256		203747488	203747488	-1	no_errors	ENST00000261015	ensembl	human	known	69_37n	nonsense	28	45.10	23	SNP	1.000	T
VWC2L	402117	genome.wustl.edu	37	2	215278990	215278990	+	Missense_Mutation	SNP	A	A	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:215278990A>G	ENST00000312504.5	+	2	875	c.73A>G	c.(73-75)Agt>Ggt	p.S25G	VWC2L_ENST00000427124.1_Missense_Mutation_p.S25G|AC107218.3_ENST00000412896.1_RNA|AC107218.3_ENST00000437883.1_RNA	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	25					negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						TGCTGCTATCAGTCATGAAGA	0.473																																						dbGAP											0													106.0	103.0	104.0					2																	215278990		1944	4165	6109	-	-	-	SO:0001583	missense	0			AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.73A>G	2.37:g.215278990A>G	ENSP00000308976:p.Ser25Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC69|B2RUW7|B7X8X1	Missense_Mutation	SNP	smart_VWF_C,pfscan_VWF_C	p.S25G	ENST00000312504.5	37	c.73	CCDS46509.1	2	.	.	.	.	.	.	.	.	.	.	A	11.47	1.647956	0.29336	.	.	ENSG00000174453	ENST00000312504;ENST00000427124	T;T	0.15256	2.44;2.44	6.08	6.08	0.98989	.	0.177095	0.64402	D	0.000009	T	0.07863	0.0197	N	0.02011	-0.69	0.30703	N	0.750046	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.13629	-1.0502	10	0.19147	T	0.46	-5.1171	16.6438	0.85155	1.0:0.0:0.0:0.0	.	25;25	B7ZW27;B2RUY7	.;VWC2L_HUMAN	G	25	ENSP00000308976:S25G;ENSP00000403779:S25G	ENSP00000308976:S25G	S	+	1	0	VWC2L	214987235	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.111000	0.89564	2.333000	0.79357	0.533000	0.62120	AGT	VWC2L	-	NULL	ENSG00000174453		0.473	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWC2L	HGNC	protein_coding	OTTHUMT00000337175.1	63	0.00	0	A	NM_001080500		215278990	215278990	+1	no_errors	ENST00000312504	ensembl	human	known	69_37n	missense	82	40.58	56	SNP	1.000	G
WNK4	65266	genome.wustl.edu	37	17	40936480	40936480	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr17:40936480G>T	ENST00000246914.5	+	4	1074	c.1053G>T	c.(1051-1053)aaG>aaT	p.K351N		NM_032387.4	NP_115763.2	Q96J92	WNK4_HUMAN	WNK lysine deficient protein kinase 4	351	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chloride transport (GO:0006821)|distal tubule morphogenesis (GO:0072156)|intracellular signal transduction (GO:0035556)|ion homeostasis (GO:0050801)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)|renal sodium ion absorption (GO:0070294)	cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|prostate(1)|skin(5)|stomach(1)	35		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.0749)		ACGAGGAAAAGTACGATGAGG	0.597																																					Esophageal Squamous(6;201 374 4964 23855 42828)	dbGAP											0													104.0	83.0	90.0					17																	40936480		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ309861	CCDS11439.1	17q21-q22	2005-01-19	2005-01-19	2005-01-19		ENSG00000126562			14544	protein-coding gene	gene with protein product		601844	"""protein kinase, lysine deficient 4"""	PRKWNK4			Standard	NM_032387		Approved		uc002ibj.3	Q96J92		ENST00000246914.5:c.1053G>T	17.37:g.40936480G>T	ENSP00000246914:p.Lys351Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPI0|Q8N8X3|Q8N8Z2|Q96DT8|Q9BYS5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K351N	ENST00000246914.5	37	c.1053	CCDS11439.1	17	.	.	.	.	.	.	.	.	.	.	g	14.32	2.501261	0.44455	.	.	ENSG00000126562	ENST00000246914;ENST00000316085	T	0.66099	-0.19	4.62	1.31	0.21738	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.49305	D	0.000144	T	0.49081	0.1536	N	0.26092	0.79	0.35486	D	0.798539	B;B	0.29115	0.233;0.233	B;B	0.35470	0.203;0.203	T	0.58188	-0.7680	10	0.72032	D	0.01	-23.8256	10.021	0.42044	0.3132:0.0:0.6868:0.0	.	351;351	B0LPI0;Q96J92	.;WNK4_HUMAN	N	351;123	ENSP00000246914:K351N	ENSP00000246914:K351N	K	+	3	2	WNK4	38190006	1.000000	0.71417	1.000000	0.80357	0.784000	0.44337	1.436000	0.34980	0.568000	0.29311	-0.320000	0.08662	AAG	WNK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000126562		0.597	WNK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK4	HGNC	protein_coding	OTTHUMT00000452389.1	30	0.00	0	G			40936480	40936480	+1	no_errors	ENST00000246914	ensembl	human	known	69_37n	missense	35	54.55	42	SNP	0.999	T
ZC3H12D	340152	genome.wustl.edu	37	6	149782951	149782951	+	Intron	SNP	A	A	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:149782951A>G	ENST00000409806.3	-	3	764				ZC3H12D_ENST00000416573.2_Intron|ZC3H12D_ENST00000389942.5_Intron|ZC3H12D_ENST00000542614.1_Intron|ZC3H12D_ENST00000409948.1_Intron			A2A288	ZC12D_HUMAN	zinc finger CCCH-type containing 12D						negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|prostate(1)	6		Ovarian(120;0.0907)		OV - Ovarian serous cystadenocarcinoma(155;1.23e-11)|GBM - Glioblastoma multiforme(68;0.0921)		TTGAGCATACATCTGCTCCAG	0.433																																						dbGAP											0													69.0	76.0	74.0					6																	149782951		1993	4126	6119	-	-	-	SO:0001627	intron_variant	0					6q25.1	2012-07-05	2005-06-30	2005-06-30	ENSG00000178199	ENSG00000178199		"""Zinc fingers, CCCH-type domain containing"""	21175	protein-coding gene	gene with protein product	"""MCP induced protein 4"""	611106	"""chromosome 6 open reading frame 95"""	C6orf95		18178554	Standard	NM_207360		Approved	dJ281H8.1, MCPIP4	uc010kid.3	A2A288	OTTHUMG00000015786	ENST00000409806.3:c.445+15T>C	6.37:g.149782951A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L178|B2RXF4|B7WNU7|B9ZZP9|B9ZZQ0|Q6ZRW2	RNA	SNP	-	NULL	ENST00000409806.3	37	NULL		6																																																																																			ZC3H12D	-	-	ENSG00000178199		0.433	ZC3H12D-003	KNOWN	basic|appris_principal	protein_coding	ZC3H12D	HGNC	protein_coding	OTTHUMT00000286400.2	71	0.00	0	A	NM_207360		149782951	149782951	-1	no_errors	ENST00000462655	ensembl	human	known	69_37n	rna	20	68.25	43	SNP	0.000	G
ZC3H15	55854	genome.wustl.edu	37	2	187366134	187366134	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr2:187366134G>C	ENST00000337859.6	+	4	651	c.424G>C	c.(424-426)Gat>Cat	p.D142H	ZC3H15_ENST00000468120.1_3'UTR|ZC3H15_ENST00000544130.1_Intron	NM_018471.2	NP_060941.2	Q8WU90	ZC3HF_HUMAN	zinc finger CCCH-type containing 15	142					cytokine-mediated signaling pathway (GO:0019221)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|skin(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Epithelial(96;0.0922)|all cancers(119;0.233)			TGATGCAAGAGATGAAGAACT	0.313																																						dbGAP											0													91.0	92.0	92.0					2																	187366134		1839	4078	5917	-	-	-	SO:0001583	missense	0				CCDS42791.1	2q32.1	2012-07-05			ENSG00000065548	ENSG00000065548		"""Zinc fingers, CCCH-type domain containing"""	29528	protein-coding gene	gene with protein product	"""likely ortholog of mouse immediate early response, erythropoietin 4"""					10880228	Standard	NM_018471		Approved	LEREPO4	uc002upo.3	Q8WU90	OTTHUMG00000154251	ENST00000337859.6:c.424G>C	2.37:g.187366134G>C	ENSP00000338788:p.Asp142His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMW2|D3DPG7|Q5QTQ4|Q8WZ06|Q9NUZ3|Q9NZ37|Q9P079	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.D142H	ENST00000337859.6	37	c.424	CCDS42791.1	2	.	.	.	.	.	.	.	.	.	.	G	28.8	4.950670	0.92660	.	.	ENSG00000065548	ENST00000337859;ENST00000536434	T	0.35789	1.29	5.94	5.94	0.96194	.	0.000000	0.85682	D	0.000000	T	0.69504	0.3118	M	0.90019	3.08	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.74636	-0.3599	10	0.87932	D	0	-30.854	20.3736	0.98901	0.0:0.0:1.0:0.0	.	142	Q8WU90	ZC3HF_HUMAN	H	142	ENSP00000338788:D142H	ENSP00000338788:D142H	D	+	1	0	ZC3H15	187074379	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.496000	0.97967	2.820000	0.97059	0.650000	0.86243	GAT	ZC3H15	-	NULL	ENSG00000065548		0.313	ZC3H15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H15	HGNC	protein_coding	OTTHUMT00000334547.2	30	0.00	0	G	NM_018471		187366134	187366134	+1	no_errors	ENST00000337859	ensembl	human	known	69_37n	missense	37	31.48	17	SNP	1.000	C
ZDHHC8	29801	genome.wustl.edu	37	22	20128842	20128842	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr22:20128842C>G	ENST00000334554.7	+	8	1138	c.997C>G	c.(997-999)Ccg>Gcg	p.P333A	ZDHHC8_ENST00000468112.1_3'UTR|ZDHHC8_ENST00000405930.3_Missense_Mutation_p.P333A|ZDHHC8_ENST00000320602.7_Missense_Mutation_p.P241A	NM_013373.3	NP_037505.1	Q9ULC8	ZDHC8_HUMAN	zinc finger, DHHC-type containing 8	333					locomotory behavior (GO:0007626)|protein palmitoylation (GO:0018345)	cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	20	Colorectal(54;0.0993)					CCTGCAGACCCCGCGCCCAGG	0.637																																						dbGAP											0													32.0	37.0	35.0					22																	20128842		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB033118	CCDS13776.1, CCDS54502.1	22q11.21	2009-10-06		2003-02-28	ENSG00000099904	ENSG00000099904		"""Zinc fingers, DHHC-type"""	18474	protein-coding gene	gene with protein product		608784				10574462, 15184899	Standard	NM_013373		Approved	ZNF378, KIAA1292	uc002zrr.2	Q9ULC8	OTTHUMG00000150499	ENST00000334554.7:c.997C>G	22.37:g.20128842C>G	ENSP00000334490:p.Pro333Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TGE9|Q6ICL1|Q6ZNF5|Q7Z6L9	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.P333A	ENST00000334554.7	37	c.997	CCDS13776.1	22	.	.	.	.	.	.	.	.	.	.	.	2.046	-0.418900	0.04766	.	.	ENSG00000099904	ENST00000334554;ENST00000320602;ENST00000405930	T;T;T	0.71934	1.42;-0.61;1.39	4.55	2.39	0.29439	.	0.546595	0.17760	N	0.162926	T	0.69314	0.3097	L	0.38175	1.15	0.25395	N	0.988497	P;B;B	0.38535	0.635;0.035;0.001	P;B;B	0.55011	0.766;0.026;0.001	T	0.57412	-0.7816	10	0.19147	T	0.46	.	7.2702	0.26252	0.0:0.7758:0.0:0.2242	.	241;333;333	Q9ULC8-2;Q9ULC8-3;Q9ULC8	.;.;ZDHC8_HUMAN	A	333;241;333	ENSP00000334490:P333A;ENSP00000317804:P241A;ENSP00000384716:P333A	ENSP00000317804:P241A	P	+	1	0	ZDHHC8	18508842	0.000000	0.05858	0.850000	0.33497	0.240000	0.25518	0.299000	0.19138	0.574000	0.29417	-0.137000	0.14449	CCG	ZDHHC8	-	NULL	ENSG00000099904		0.637	ZDHHC8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC8	HGNC	protein_coding	OTTHUMT00000318564.1	95	0.00	0	C	NM_013373		20128842	20128842	+1	no_errors	ENST00000405930	ensembl	human	known	69_37n	missense	24	78.38	87	SNP	0.865	G
ZNF195	7748	genome.wustl.edu	37	11	3392236	3392236	+	Silent	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr11:3392236C>T	ENST00000399602.4	-	3	321	c.195G>A	c.(193-195)gtG>gtA	p.V65V	ZNF195_ENST00000438262.2_Silent_p.V69V|ZNF195_ENST00000005082.9_Silent_p.V65V|ZNF195_ENST00000343338.7_Silent_p.V69V|ZNF195_ENST00000354599.6_Silent_p.V65V|ZNF195_ENST00000526601.1_Silent_p.V69V|ZNF195_ENST00000527386.1_5'UTR|AC123788.1_ENST00000581561.1_RNA|ZNF195_ENST00000528796.1_Silent_p.V65V|ZNF195_ENST00000429541.2_Silent_p.V69V	NM_001130520.2	NP_001123992.1	O14628	ZN195_HUMAN	zinc finger protein 195	65	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)	17		Medulloblastoma(188;0.00106)|Breast(177;0.00328)|all_neural(188;0.00681)|Ovarian(85;0.00965)		BRCA - Breast invasive adenocarcinoma(625;0.0361)|LUSC - Lung squamous cell carcinoma(625;0.2)		CCTGTCTCTTCACATTCCAGG	0.522																																						dbGAP											0													172.0	177.0	176.0					11																	3392236		2175	4281	6456	-	-	-	SO:0001819	synonymous_variant	0				CCDS41604.1, CCDS44521.1, CCDS44522.1, CCDS55736.1, CCDS55737.1, CCDS58111.1	11p15.5	2013-01-08			ENSG00000005801	ENSG00000005801		"""Zinc fingers, C2H2-type"", ""-"""	12986	protein-coding gene	gene with protein product		602187				9344677	Standard	NM_001130520		Approved		uc001lxt.3	O14628	OTTHUMG00000011694	ENST00000399602.4:c.195G>A	11.37:g.3392236C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K234|B3KTK2|B4DEL0|C9JLY9|L7MNK2|Q0VAJ6|Q658N8|Q6ZNA9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V65	ENST00000399602.4	37	c.195	CCDS44522.1	11																																																																																			ZNF195	-	pfscan_Krueppel-associated_box	ENSG00000005801		0.522	ZNF195-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF195	HGNC	protein_coding	OTTHUMT00000032321.2	24	0.00	0	C			3392236	3392236	-1	no_errors	ENST00000399602	ensembl	human	known	69_37n	silent	29	50.85	30	SNP	0.001	T
ZNF335	63925	genome.wustl.edu	37	20	44594384	44594384	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr20:44594384C>T	ENST00000322927.2	-	7	1085	c.985G>A	c.(985-987)Gag>Aag	p.E329K	ZNF335_ENST00000426788.1_Missense_Mutation_p.E174K|ZNF335_ENST00000494955.1_5'Flank	NM_022095.3	NP_071378.1	Q9H4Z2	ZN335_HUMAN	zinc finger protein 335	329					brain development (GO:0007420)|brain morphogenesis (GO:0048854)|cerebral cortex neuron differentiation (GO:0021895)|histone H3-K4 trimethylation (GO:0080182)|in utero embryonic development (GO:0001701)|neuron projection morphogenesis (GO:0048812)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neurogenesis (GO:0050769)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(13)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	51		Myeloproliferative disorder(115;0.0122)				CCTCGGGGCTCATCCTCAGCT	0.657																																						dbGAP											0													50.0	60.0	57.0					20																	44594384		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK026157	CCDS13389.1	20q13.12	2011-09-12			ENSG00000198026	ENSG00000198026		"""Zinc fingers, C2H2-type"""	15807	protein-coding gene	gene with protein product	"""NRC-interacting factor 1"""	610827				12215545, 19131338	Standard	NM_022095		Approved	bA465L10.2, NIF-1	uc002xqw.3	Q9H4Z2	OTTHUMG00000032637	ENST00000322927.2:c.985G>A	20.37:g.44594384C>T	ENSP00000325326:p.Glu329Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLG7|Q548D0|Q9H684	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E329K	ENST00000322927.2	37	c.985	CCDS13389.1	20	.	.	.	.	.	.	.	.	.	.	C	34	5.367219	0.95900	.	.	ENSG00000198026	ENST00000322927;ENST00000243961;ENST00000426788	T;T	0.10960	2.96;2.82	5.14	5.14	0.70334	.	0.059240	0.64402	D	0.000002	T	0.20577	0.0495	L	0.27053	0.805	0.52501	D	0.999952	D;D	0.56287	0.975;0.97	D;P	0.66351	0.943;0.681	T	0.00706	-1.1601	10	0.72032	D	0.01	-34.9505	15.4719	0.75446	0.0:1.0:0.0:0.0	.	174;329	Q9H4Z2-2;Q9H4Z2	.;ZN335_HUMAN	K	329;106;174	ENSP00000325326:E329K;ENSP00000397098:E174K	ENSP00000243961:E106K	E	-	1	0	ZNF335	44027791	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	5.860000	0.69546	2.667000	0.90743	0.563000	0.77884	GAG	ZNF335	-	NULL	ENSG00000198026		0.657	ZNF335-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF335	HGNC	protein_coding	OTTHUMT00000079553.1	45	0.00	0	C	NM_022095		44594384	44594384	-1	no_errors	ENST00000322927	ensembl	human	known	69_37n	missense	65	12.16	9	SNP	1.000	T
ZNF394	84124	genome.wustl.edu	37	7	99091434	99091434	+	Silent	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr7:99091434G>C	ENST00000337673.6	-	3	1607	c.1404C>G	c.(1402-1404)ccC>ccG	p.P468P	ZNF394_ENST00000426306.2_3'UTR|ZNF789_ENST00000493485.1_Intron|ZNF789_ENST00000494186.1_Intron|ZNF394_ENST00000394177.3_5'Flank	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	468					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CACACTTATAGGGTCTTTCCC	0.443																																					Ovarian(24;589 697 9939 12704 40742)	dbGAP											0													116.0	116.0	116.0					7																	99091434		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.1404C>G	7.37:g.99091434G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.P468	ENST00000337673.6	37	c.1404	CCDS5666.1	7																																																																																			ZNF394	-	pfscan_Znf_C2H2	ENSG00000160908		0.443	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF394	HGNC	protein_coding	OTTHUMT00000336498.1	57	0.00	0	G	NM_032164		99091434	99091434	-1	no_errors	ENST00000337673	ensembl	human	known	69_37n	silent	59	70.53	146	SNP	0.124	C
ZNF577	84765	genome.wustl.edu	37	19	52376202	52376202	+	Silent	SNP	A	A	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:52376202A>C	ENST00000301399.5	-	7	1406	c.1041T>G	c.(1039-1041)acT>acG	p.T347T	ZNF577_ENST00000485702.1_Intron|ZNF577_ENST00000412216.1_Intron|ZNF577_ENST00000420592.1_Silent_p.T288T|ZNF577_ENST00000451628.2_Silent_p.T288T	NM_032679.2	NP_116068.2	Q9BSK1	ZN577_HUMAN	zinc finger protein 577	347					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00161)|OV - Ovarian serous cystadenocarcinoma(262;0.019)		CTCCAGTGTGAGTACGCTGAT	0.438																																						dbGAP											0													71.0	68.0	69.0					19																	52376202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832871	CCDS12842.2, CCDS46160.1	19q13.41	2013-09-20			ENSG00000161551	ENSG00000161551		"""Zinc fingers, C2H2-type"", ""-"""	28673	protein-coding gene	gene with protein product						12477932	Standard	NM_032679		Approved	MGC4400	uc010yde.2	Q9BSK1	OTTHUMG00000157045	ENST00000301399.5:c.1041T>G	19.37:g.52376202A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0B4|A8K6Z7|C9JFB9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T347	ENST00000301399.5	37	c.1041	CCDS12842.2	19																																																																																			ZNF577	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000161551		0.438	ZNF577-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF577	HGNC	protein_coding	OTTHUMT00000347243.1	36	0.00	0	A	NM_032679		52376202	52376202	-1	no_errors	ENST00000301399	ensembl	human	known	69_37n	silent	36	33.33	18	SNP	0.958	C
ZNF639	51193	genome.wustl.edu	37	3	179051646	179051646	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr3:179051646C>G	ENST00000326361.3	+	7	1339	c.894C>G	c.(892-894)ttC>ttG	p.F298L	ZNF639_ENST00000484866.1_Missense_Mutation_p.F298L|ZNF639_ENST00000496856.1_Missense_Mutation_p.F298L	NM_016331.1	NP_057415.1	Q9UID6	ZN639_HUMAN	zinc finger protein 639	298					negative regulation by host of viral transcription (GO:0043922)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell growth (GO:0030307)|transcription, DNA-templated (GO:0006351)|viral entry into host cell (GO:0046718)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein self-association (GO:0043621)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(10)|urinary_tract(1)	16	all_cancers(143;7.9e-17)|Ovarian(172;0.0172)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;5.78e-26)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0923)			ATGTACAGTTCTCCTCAAGCA	0.418																																						dbGAP											0													150.0	137.0	141.0					3																	179051646		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020500	CCDS3227.1	3q27.1	2010-03-26			ENSG00000121864	ENSG00000121864		"""Zinc fingers, C2H2-type"""	30950	protein-coding gene	gene with protein product	"""zinc finger amplified in esophageal squamous cell carcinomas 1"""					14522885	Standard	NM_016331		Approved	ANC-2H01, ZASC1	uc003fjr.1	Q9UID6	OTTHUMG00000157439	ENST00000326361.3:c.894C>G	3.37:g.179051646C>G	ENSP00000325634:p.Phe298Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A9X3Z9|D3DNR3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F298L	ENST00000326361.3	37	c.894	CCDS3227.1	3	.	.	.	.	.	.	.	.	.	.	C	13.65	2.301457	0.40694	.	.	ENSG00000121864	ENST00000496856;ENST00000326361;ENST00000484866	T;T;T	0.46063	0.88;0.88;0.88	5.78	5.78	0.91487	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.134693	0.52532	N	0.000073	T	0.60573	0.2279	M	0.62209	1.925	0.46678	D	0.999153	D	0.57257	0.979	D	0.71414	0.973	T	0.60084	-0.7332	10	0.62326	D	0.03	.	13.5678	0.61828	0.0:0.9288:0.0:0.0712	.	298	Q9UID6	ZN639_HUMAN	L	298	ENSP00000417740:F298L;ENSP00000325634:F298L;ENSP00000418766:F298L	ENSP00000325634:F298L	F	+	3	2	ZNF639	180534340	1.000000	0.71417	1.000000	0.80357	0.417000	0.31264	1.195000	0.32186	2.890000	0.99128	0.655000	0.94253	TTC	ZNF639	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000121864		0.418	ZNF639-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF639	HGNC	protein_coding	OTTHUMT00000348855.1	59	0.00	0	C	NM_016331		179051646	179051646	+1	no_errors	ENST00000326361	ensembl	human	known	69_37n	missense	165	13.61	26	SNP	1.000	G
ZNF675	171392	genome.wustl.edu	37	19	23836666	23836666	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:23836666C>A	ENST00000359788.4	-	4	1237	c.1069G>T	c.(1069-1071)Gaa>Taa	p.E357*	ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron|ZNF675_ENST00000601935.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	357					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTTTATGTTCAGTAAGTTTT	0.373																																						dbGAP											0													59.0	59.0	59.0					19																	23836666		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1069G>T	19.37:g.23836666C>A	ENSP00000352836:p.Glu357*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N211	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E357*	ENST00000359788.4	37	c.1069	CCDS32981.1	19	.	.	.	.	.	.	.	.	.	.	.	16.68	3.190103	0.58017	.	.	ENSG00000197372	ENST00000359788	.	.	.	0.916	-1.83	0.07833	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.7275	0.08480	0.3357:0.4656:0.1987:0.0	.	.	.	.	X	357	.	ENSP00000352836:E357X	E	-	1	0	ZNF675	23628506	0.000000	0.05858	0.732000	0.30844	0.730000	0.41778	-3.009000	0.00648	-0.839000	0.04212	-0.834000	0.03071	GAA	ZNF675	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197372		0.373	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF675	HGNC	protein_coding	OTTHUMT00000466433.1	27	0.00	0	C	NM_138330		23836666	23836666	-1	no_errors	ENST00000359788	ensembl	human	known	69_37n	nonsense	37	37.29	22	SNP	0.000	A
ZNF813	126017	genome.wustl.edu	37	19	53994508	53994508	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr19:53994508C>T	ENST00000396403.4	+	4	1150	c.1022C>T	c.(1021-1023)tCc>tTc	p.S341F	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	341					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		CAGACGTCATCCCTTACATGC	0.403																																						dbGAP											0													149.0	153.0	152.0					19																	53994508		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1022C>T	19.37:g.53994508C>T	ENSP00000379684:p.Ser341Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S341F	ENST00000396403.4	37	c.1022	CCDS46172.1	19	.	.	.	.	.	.	.	.	.	.	c	10.39	1.338347	0.24253	.	.	ENSG00000198346	ENST00000396403	T	0.16073	2.37	1.28	-0.242	0.13039	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.13884	0.0336	L	0.52011	1.625	0.09310	N	1	P	0.34562	0.457	B	0.37780	0.258	T	0.36065	-0.9763	9	0.11794	T	0.64	.	5.7518	0.18150	0.7182:0.2818:0.0:0.0	.	341	Q6ZN06	ZN813_HUMAN	F	341	ENSP00000379684:S341F	ENSP00000379684:S341F	S	+	2	0	ZNF813	58686320	0.000000	0.05858	0.017000	0.16124	0.492000	0.33523	-5.360000	0.00128	-0.682000	0.05197	0.186000	0.17326	TCC	ZNF813	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198346		0.403	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF813	HGNC	protein_coding	OTTHUMT00000350638.1	50	0.00	0	C	NM_001004301		53994508	53994508	+1	no_errors	ENST00000396403	ensembl	human	known	69_37n	missense	45	39.19	29	SNP	0.002	T
ZSCAN12	9753	genome.wustl.edu	37	6	28359190	28359190	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RW-01A-11D-A28B-09	TCGA-OL-A5RW-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8e4c566c-99f9-4ca5-a8df-c2535130630a	5b3549a7-5b4e-4942-a53d-471d76c3341a	g.chr6:28359190G>C	ENST00000361028.1	-	4	1022	c.877C>G	c.(877-879)Cag>Gag	p.Q293E	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.Q293E			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	293					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						TGGATCCTCTGATGTTCTATG	0.428																																						dbGAP											0													141.0	124.0	129.0					6																	28359190		692	1591	2283	-	-	-	SO:0001583	missense	0			AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.877C>G	6.37:g.28359190G>C	ENSP00000354305:p.Gln293Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43724	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q293E	ENST00000361028.1	37	c.877		6	.	.	.	.	.	.	.	.	.	.	G	10.49	1.364881	0.24684	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.17854	2.25;2.25	4.25	3.29	0.37713	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.586910	0.12978	N	0.423503	T	0.02571	0.0078	N	0.16166	0.38	0.22050	N	0.999398	P;B	0.42757	0.789;0.004	B;B	0.30179	0.112;0.004	T	0.32640	-0.9899	10	0.56958	D	0.05	.	7.5751	0.27931	0.0:0.1588:0.5977:0.2435	.	293;293	A8K187;O43309	.;ZSC12_HUMAN	E	293	ENSP00000354305:Q293E;ENSP00000380039:Q293E	ENSP00000354305:Q293E	Q	-	1	0	ZSCAN12	28467169	0.000000	0.05858	0.992000	0.48379	0.960000	0.62799	0.237000	0.17985	0.814000	0.34374	0.650000	0.86243	CAG	ZSCAN12	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000158691		0.428	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	56	0.00	0	G	NM_014724		28359190	28359190	-1	no_errors	ENST00000361028	ensembl	human	known	69_37n	missense	56	33.33	28	SNP	0.998	C
