#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA2	20	genome.wustl.edu	37	9	139911974	139911974	+	Silent	SNP	C	C	T	rs373098079		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr9:139911974C>T	ENST00000371605.3	-	16	2526	c.2379G>A	c.(2377-2379)gcG>gcA	p.A793A	ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000341511.6_Silent_p.A794A|ABCA2_ENST00000265662.5_Silent_p.A794A			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	793					ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		TGGTGGCCACCGCGTAGACTG	0.617																																						dbGAP											0													50.0	57.0	55.0					9																	139911974		2144	4237	6381	-	-	-	SO:0001819	synonymous_variant	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.2379G>A	9.37:g.139911974C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R144Q	ENST00000371605.3	37	c.431		9																																																																																			ABCA2	-	NULL	ENSG00000107331		0.617	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		42	0.00	0	C	NM_001606		139911974	139911974	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000479446	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.056	T
ABCA4	24	genome.wustl.edu	37	1	94481381	94481381	+	Silent	SNP	C	C	G	rs61750570|rs61750569		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr1:94481381C>G	ENST00000370225.3	-	37	5312	c.5226G>C	c.(5224-5226)gtG>gtC	p.V1742V	ABCA4_ENST00000536513.1_Silent_p.V12V	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	1742					phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		AGATGCCCACCACCAGCCCAG	0.522																																						dbGAP											0													54.0	52.0	53.0					1																	94481381		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.5226G>C	1.37:g.94481381C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15112|O60438|O60915|Q0QD48|Q4LE31	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.V1742	ENST00000370225.3	37	c.5226	CCDS747.1	1																																																																																			ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.522	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	51	0.00	0	C	NM_000350		94481381	94481381	-1	no_errors	ENST00000370225	ensembl	human	known	69_37n	silent	47	39.74	31	SNP	1.000	G
ANKHD1	54882	genome.wustl.edu	37	5	139889648	139889648	+	Missense_Mutation	SNP	T	T	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr5:139889648T>A	ENST00000360839.2	+	22	4140	c.3986T>A	c.(3985-3987)cTt>cAt	p.L1329H	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.L1329H|ANKHD1_ENST00000297183.6_Missense_Mutation_p.L1329H	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1329						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)	p.L1329R(2)|p.L540R(1)		breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATACGCCACTTTGGCTGGCA	0.443																																						dbGAP											3	Substitution - Missense(3)	kidney(3)											149.0	139.0	142.0					5																	139889648		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.3986T>A	5.37:g.139889648T>A	ENSP00000354085:p.Leu1329His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.L1329H	ENST00000360839.2	37	c.3986	CCDS4225.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	26.9|26.9	4.785221|4.785221	0.90282|0.90282	.|.	.|.	ENSG00000131503|ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000246149|ENST00000360839;ENST00000422011;ENST00000297183;ENST00000253810;ENST00000310356;ENST00000235510;ENST00000421134;ENST00000412116;ENST00000532219	.|T;T;T;T;T	.|0.79352	.|-1.26;-1.26;-1.26;-1.26;-1.26	5.54|5.54	5.54|5.54	0.83059|0.83059	.|Ankyrin repeat-containing domain (4);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.92893|0.92893	0.7739|0.7739	H|H	0.98646|0.98646	4.29|4.29	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D	.|0.91635	.|0.994;0.999;0.998;0.999;0.999	D|D	0.95562|0.95562	0.8630|0.8630	5|10	.|0.87932	.|D	.|0	.|.	15.9628|15.9628	0.79945|0.79945	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|540;1329;1348;1329;1329	.|E7ET58;Q8IWZ3-4;E9PDP5;Q8IWZ2;Q8IWZ3	.|.;.;.;.;ANKH1_HUMAN	I|H	555|1329;1362;1329;1329;863;540;1348;482;1329	.|ENSP00000354085:L1329H;ENSP00000297183:L1329H;ENSP00000394489:L1348H;ENSP00000405602:L482H;ENSP00000432016:L1329H	.|ENSP00000432016:L1329H	F|L	+|+	1|2	0|0	ANKHD1|ANKHD1-EIF4EBP3;ANKHD1	139869832|139869832	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	8.040000|8.040000	0.89188|0.89188	2.233000|2.233000	0.73108|0.73108	0.482000|0.482000	0.46254|0.46254	TTT|CTT	ANKHD1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000131503		0.443	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1	HGNC	protein_coding	OTTHUMT00000251672.1	95	0.00	0	T	NM_017747		139889648	139889648	+1	no_errors	ENST00000297183	ensembl	human	known	69_37n	missense	23	43.90	18	SNP	1.000	A
AP1M2	10053	genome.wustl.edu	37	19	10692038	10692038	+	Nonsense_Mutation	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:10692038C>A	ENST00000250244.6	-	6	659	c.577G>T	c.(577-579)Gaa>Taa	p.E193*	AP1M2_ENST00000590923.1_Nonsense_Mutation_p.E193*	NM_005498.4	NP_005489.2	Q9Y6Q5	AP1M2_HUMAN	adaptor-related protein complex 1, mu 2 subunit	193	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein targeting (GO:0006605)|regulation of defense response to virus by virus (GO:0050690)|vesicle targeting (GO:0006903)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(4)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	9			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			CCGACGATTTCGCTCAGAAGG	0.582											OREG0025241	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													54.0	56.0	56.0					19																	10692038		2083	4228	6311	-	-	-	SO:0001587	stop_gained	0			AF020797	CCDS45964.1	19p13.2	2008-10-07				ENSG00000129354			558	protein-coding gene	gene with protein product		607309				10338135	Standard	NM_005498		Approved	HSMU1B, mu2, AP1-mu2	uc002mpc.3	Q9Y6Q5		ENST00000250244.6:c.577G>T	19.37:g.10692038C>A	ENSP00000250244:p.Glu193*	Somatic	666	WXS	Illumina GAIIx	Phase_IV	B2RDV5|Q9BSI8	Nonsense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.E193*	ENST00000250244.6	37	c.577	CCDS45964.1	19	.	.	.	.	.	.	.	.	.	.	c	38	6.767546	0.97825	.	.	ENSG00000129354	ENST00000250244	.	.	.	5.28	5.28	0.74379	.	0.056499	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-41.7473	17.7477	0.88425	0.0:1.0:0.0:0.0	.	.	.	.	X	193	.	ENSP00000250244:E193X	E	-	1	0	AP1M2	10553038	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	7.773000	0.85462	2.473000	0.83533	0.549000	0.68633	GAA	AP1M2	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C	ENSG00000129354		0.582	AP1M2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP1M2	HGNC	protein_coding	OTTHUMT00000452034.1	68	0.00	0	C			10692038	10692038	-1	no_errors	ENST00000590923	ensembl	human	known	69_37n	nonsense	40	18.00	9	SNP	1.000	A
ASXL1	171023	genome.wustl.edu	37	20	31023752	31023752	+	Silent	SNP	C	C	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr20:31023752C>G	ENST00000375687.4	+	13	3661	c.3237C>G	c.(3235-3237)tcC>tcG	p.S1079S	ASXL1_ENST00000306058.5_Silent_p.S1074S	NM_015338.5	NP_056153	Q8IXJ9	ASXL1_HUMAN	additional sex combs like transcriptional regulator 1	1079					bone development (GO:0060348)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of peroxisome proliferator activated receptor signaling pathway (GO:0035359)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to retinoic acid (GO:0032526)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nuclear chromatin (GO:0000790)|PR-DUB complex (GO:0035517)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|peroxisome proliferator activated receptor binding (GO:0042975)|retinoic acid receptor binding (GO:0042974)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(655)|kidney(5)|large_intestine(18)|liver(1)|lung(27)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	722						TCCCAGATTCCCTACTGCTGG	0.562			"""F, N, Mis"""		"""MDS, CMML"""																																	dbGAP		Rec	yes		20	20q11.1	171023	additional sex combs like 1		L	0													106.0	90.0	96.0					20																	31023752		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ438952	CCDS13201.1	20q11	2014-09-17	2014-06-17		ENSG00000171456	ENSG00000171456			18318	protein-coding gene	gene with protein product		612990	"""additional sex combs like 1 (Drosophila)"""			12657473	Standard	NM_015338		Approved	KIAA0978	uc002wxs.3	Q8IXJ9	OTTHUMG00000032218	ENST00000375687.4:c.3237C>G	20.37:g.31023752C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP59|Q5JWS9|Q8IYY7|Q9H466|Q9NQF8|Q9UFJ0|Q9UFP8|Q9Y2I4	Silent	SNP	NULL	p.S1079	ENST00000375687.4	37	c.3237	CCDS13201.1	20																																																																																			ASXL1	-	NULL	ENSG00000171456		0.562	ASXL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASXL1	HGNC	protein_coding	OTTHUMT00000078624.2	45	0.00	0	C	NM_015338		31023752	31023752	+1	no_errors	ENST00000375687	ensembl	human	known	69_37n	silent	22	33.33	11	SNP	0.894	G
ASXL3	80816	genome.wustl.edu	37	18	31250678	31250678	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr18:31250678G>T	ENST00000269197.5	+	6	519	c.519G>T	c.(517-519)atG>atT	p.M173I		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	173					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GAGTCTCAATGATGGTAAACA	0.353																																						dbGAP											0													76.0	79.0	78.0					18																	31250678		1872	4092	5964	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.519G>T	18.37:g.31250678G>T	ENSP00000269197:p.Met173Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.M173I	ENST00000269197.5	37	c.519	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	13.70	2.313974	0.40996	.	.	ENSG00000141431	ENST00000269197	T	0.15139	2.45	5.48	5.48	0.80851	.	.	.	.	.	T	0.13157	0.0319	N	0.19112	0.55	0.41251	D	0.986716	B	0.30406	0.278	B	0.24155	0.051	T	0.10200	-1.0640	9	0.30854	T	0.27	.	19.3689	0.94477	0.0:0.0:1.0:0.0	.	173	Q9C0F0	ASXL3_HUMAN	I	173	ENSP00000269197:M173I	ENSP00000269197:M173I	M	+	3	0	ASXL3	29504676	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.159000	0.77483	2.595000	0.87683	0.655000	0.94253	ATG	ASXL3	-	NULL	ENSG00000141431		0.353	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	38	0.00	0	G			31250678	31250678	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	1.000	T
C10orf91	170393	genome.wustl.edu	37	10	134261353	134261353	+	Missense_Mutation	SNP	A	A	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr10:134261353A>G	ENST00000392630.3	+	3	287	c.226A>G	c.(226-228)Acg>Gcg	p.T76A	C10orf91_ENST00000490765.1_3'UTR|C10orf91_ENST00000321248.2_Missense_Mutation_p.T76A	NM_173541.2	NP_775812.1	Q5T1B1	CJ091_HUMAN	chromosome 10 open reading frame 91	76										endometrium(1)|kidney(1)|lung(1)|ovary(2)	5		all_cancers(35;6.69e-12)|all_epithelial(44;1.55e-08)|Lung NSC(174;0.000845)|all_lung(145;0.00144)|all_neural(114;0.0299)|Breast(234;0.106)|Colorectal(31;0.109)|Melanoma(40;0.123)|Glioma(114;0.203)|all_hematologic(284;0.224)		OV - Ovarian serous cystadenocarcinoma(35;6.95e-05)|Epithelial(32;0.000142)|all cancers(32;0.000162)		ACCCCAGACCACGAGAGCGCT	0.627																																						dbGAP											0													148.0	149.0	149.0					10																	134261353		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030794	CCDS7668.1	10q26.3	2004-03-16			ENSG00000180066	ENSG00000180066			27275	protein-coding gene	gene with protein product						12477932	Standard	NM_173541		Approved	bA432J24.4	uc001llm.3	Q5T1B1	OTTHUMG00000019289	ENST00000392630.3:c.226A>G	10.37:g.134261353A>G	ENSP00000376407:p.Thr76Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N0T7	Missense_Mutation	SNP	NULL	p.T76A	ENST00000392630.3	37	c.226	CCDS7668.1	10	.	.	.	.	.	.	.	.	.	.	A	9.638	1.138266	0.21123	.	.	ENSG00000180066	ENST00000392630;ENST00000321248	T;T	0.06294	3.32;3.32	1.92	-2.56	0.06268	.	.	.	.	.	T	0.02767	0.0083	N	0.08118	0	0.09310	N	1	B	0.19073	0.033	B	0.23419	0.046	T	0.44513	-0.9323	9	0.87932	D	0	.	0.1835	0.00126	0.3485:0.254:0.1717:0.2258	.	76	Q5T1B1	CJ091_HUMAN	A	76	ENSP00000376407:T76A;ENSP00000323241:T76A	ENSP00000323241:T76A	T	+	1	0	C10orf91	134111343	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.537000	0.06128	-0.661000	0.05345	-0.464000	0.05259	ACG	C10orf91	-	NULL	ENSG00000180066		0.627	C10orf91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf91	HGNC	protein_coding	OTTHUMT00000051078.2	39	0.00	0	A	NM_173541		134261353	134261353	+1	no_errors	ENST00000321248	ensembl	human	known	69_37n	missense	25	26.47	9	SNP	0.001	G
C16orf87	388272	genome.wustl.edu	37	16	46843576	46843576	+	Missense_Mutation	SNP	A	A	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr16:46843576A>C	ENST00000285697.4	-	3	546	c.285T>G	c.(283-285)caT>caG	p.H95Q	C16orf87_ENST00000394806.2_Intron|C16orf87_ENST00000564250.1_5'UTR	NM_001001436.2	NP_001001436.1	Q6PH81	CP087_HUMAN	chromosome 16 open reading frame 87	95										large_intestine(4)|urinary_tract(1)	5						CTCGTCTGATATGATCTGAAT	0.363																																						dbGAP											0													294.0	267.0	276.0					16																	46843576		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10724.1	16q11.2	2008-08-08			ENSG00000155330	ENSG00000155330			33754	protein-coding gene	gene with protein product							Standard	NM_001001436		Approved		uc002eek.1	Q6PH81	OTTHUMG00000132538	ENST00000285697.4:c.285T>G	16.37:g.46843576A>C	ENSP00000285697:p.His95Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HN9	Missense_Mutation	SNP	pfam_UPF0547	p.H95Q	ENST00000285697.4	37	c.285	CCDS10724.1	16	.	.	.	.	.	.	.	.	.	.	A	18.28	3.588628	0.66105	.	.	ENSG00000155330	ENST00000285697	.	.	.	6.16	3.94	0.45596	.	0.093114	0.85682	D	0.000000	T	0.19327	0.0464	N	0.08118	0	0.33049	D	0.53249	B	0.33073	0.396	B	0.26310	0.068	T	0.22836	-1.0205	9	0.25106	T	0.35	.	9.319	0.37952	0.8006:0.0:0.1994:0.0	.	95	Q6PH81	CP087_HUMAN	Q	95	.	ENSP00000285697:H95Q	H	-	3	2	C16orf87	45401077	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.914000	0.39966	0.574000	0.29417	0.528000	0.53228	CAT	C16orf87	-	NULL	ENSG00000155330		0.363	C16orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf87	HGNC	protein_coding	OTTHUMT00000255738.2	85	0.00	0	A	NM_001001436		46843576	46843576	-1	no_errors	ENST00000285697	ensembl	human	known	69_37n	missense	98	15.52	18	SNP	1.000	C
C16orf87	388272	genome.wustl.edu	37	16	46843631	46843631	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr16:46843631A>T	ENST00000285697.4	-	3	491	c.230T>A	c.(229-231)gTa>gAa	p.V77E	C16orf87_ENST00000394806.2_Intron|C16orf87_ENST00000564250.1_5'UTR	NM_001001436.2	NP_001001436.1	Q6PH81	CP087_HUMAN	chromosome 16 open reading frame 87	77										large_intestine(4)|urinary_tract(1)	5						ATCTTTATTTACTGTAGAATT	0.378																																						dbGAP											0													224.0	202.0	209.0					16																	46843631		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10724.1	16q11.2	2008-08-08			ENSG00000155330	ENSG00000155330			33754	protein-coding gene	gene with protein product							Standard	NM_001001436		Approved		uc002eek.1	Q6PH81	OTTHUMG00000132538	ENST00000285697.4:c.230T>A	16.37:g.46843631A>T	ENSP00000285697:p.Val77Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HN9	Missense_Mutation	SNP	pfam_UPF0547	p.V77E	ENST00000285697.4	37	c.230	CCDS10724.1	16	.	.	.	.	.	.	.	.	.	.	A	17.54	3.414118	0.62511	.	.	ENSG00000155330	ENST00000285697	.	.	.	6.16	5.06	0.68205	.	0.248271	0.42821	D	0.000647	T	0.42177	0.1191	N	0.14661	0.345	0.45227	D	0.998232	B	0.17268	0.021	B	0.15484	0.013	T	0.25328	-1.0135	9	0.59425	D	0.04	.	13.6844	0.62506	0.8712:0.1288:0.0:0.0	.	77	Q6PH81	CP087_HUMAN	E	77	.	ENSP00000285697:V77E	V	-	2	0	C16orf87	45401132	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.180000	0.58296	1.121000	0.41925	0.528000	0.53228	GTA	C16orf87	-	NULL	ENSG00000155330		0.378	C16orf87-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf87	HGNC	protein_coding	OTTHUMT00000255738.2	70	0.00	0	A	NM_001001436		46843631	46843631	-1	no_errors	ENST00000285697	ensembl	human	known	69_37n	missense	96	11.93	13	SNP	1.000	T
C5orf42	65250	genome.wustl.edu	37	5	37108550	37108550	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr5:37108550G>A	ENST00000508244.1	-	50	9355	c.9262C>T	c.(9262-9264)Ctg>Ttg	p.L3088L	C5orf42_ENST00000274258.7_Silent_p.L1986L|C5orf42_ENST00000425232.2_Silent_p.L3088L			Q9H799	CE042_HUMAN	chromosome 5 open reading frame 42	3088						integral component of membrane (GO:0016021)				breast(5)|endometrium(3)|kidney(8)|large_intestine(24)|lung(28)|ovary(4)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	79	all_lung(31;0.000616)		COAD - Colon adenocarcinoma(61;0.14)|Epithelial(62;0.177)|Colorectal(62;0.202)			GTATGCTGCAGACTATGACAC	0.418																																						dbGAP											0													125.0	112.0	116.0					5																	37108550		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34146.1, CCDS34146.2	5p13.2	2014-01-28			ENSG00000197603	ENSG00000197603			25801	protein-coding gene	gene with protein product		614571				22264561	Standard	NM_023073		Approved	FLJ13231, JBTS17	uc011cpa.1	Q9H799	OTTHUMG00000160492	ENST00000508244.1:c.9262C>T	5.37:g.37108550G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB7|B7ZLV7|Q4G174|Q6DK46|Q8N8L4|Q9H5T1|Q9H8T9	Silent	SNP	superfamily_Quino_amine_DH_bsu	p.L3088	ENST00000508244.1	37	c.9262	CCDS34146.2	5																																																																																			C5orf42	-	NULL	ENSG00000197603		0.418	C5orf42-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	C5orf42	HGNC	protein_coding	OTTHUMT00000360806.1	49	0.00	0	G	NM_023073		37108550	37108550	-1	no_errors	ENST00000425232	ensembl	human	known	69_37n	silent	42	10.64	5	SNP	0.001	A
CABYR	26256	genome.wustl.edu	37	18	21736512	21736512	+	Missense_Mutation	SNP	A	A	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr18:21736512A>C	ENST00000399481.2	+	2	905	c.753A>C	c.(751-753)gaA>gaC	p.E251D	CABYR_ENST00000415309.2_Intron|CABYR_ENST00000399499.1_Intron|CABYR_ENST00000327201.6_Intron|RP11-799B12.4_ENST00000583267.1_lincRNA|CABYR_ENST00000581397.1_Intron|CABYR_ENST00000399496.3_Intron			O75952	CABYR_HUMAN	calcium binding tyrosine-(Y)-phosphorylation regulated	349					epithelial cilium movement (GO:0003351)|sperm capacitation (GO:0048240)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	calcium ion binding (GO:0005509)|enzyme binding (GO:0019899)|protein heterodimerization activity (GO:0046982)|SH3 domain binding (GO:0017124)			breast(1)|endometrium(2)|large_intestine(4)|lung(4)	11	all_cancers(21;9.13e-05)|all_epithelial(16;5.49e-07)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0305)|Ovarian(20;0.17)					CTGTAGTAGAAAAGACCACCT	0.383																																						dbGAP											0													61.0	65.0	64.0					18																	21736512		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF088868	CCDS11881.1, CCDS11882.1, CCDS11883.1, CCDS42420.1, CCDS45840.1	18q11.2	2009-08-06	2007-11-22		ENSG00000154040	ENSG00000154040			15569	protein-coding gene	gene with protein product	"""fibrousheathin 2"", ""cancer/testis antigen 88"""	612135				11820818, 17317841, 16139264	Standard	NM_012189		Approved	FSP-2, CBP86, CT88	uc002kux.3	O75952	OTTHUMG00000037365	ENST00000399481.2:c.753A>C	18.37:g.21736512A>C	ENSP00000382404:p.Glu251Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R857|Q8WXW5|Q9HAY3|Q9HAY4|Q9HAY5|Q9HCY9	Missense_Mutation	SNP	pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b	p.E349D	ENST00000399481.2	37	c.1047		18	.	.	.	.	.	.	.	.	.	.	A	8.440	0.850596	0.17034	.	.	ENSG00000154040	ENST00000399481	T	0.23348	1.91	4.9	-0.183	0.13284	.	13.242900	0.00166	N	0.000000	T	0.16471	0.0396	N	0.22421	0.69	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.12243	-1.0555	9	.	.	.	7.7488	3.4777	0.07590	0.3092:0.4253:0.0:0.2655	.	331;349	O75952-2;O75952	.;CABYR_HUMAN	D	251	ENSP00000382404:E251D	.	E	+	3	2	CABYR	19990510	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	-0.421000	0.07053	-0.004000	0.14419	-1.243000	0.01532	GAA	CABYR	-	NULL	ENSG00000154040		0.383	CABYR-201	KNOWN	basic	protein_coding	CABYR	HGNC	protein_coding		32	0.00	0	A	NM_153770		21736512	21736512	+1	no_errors	ENST00000463087	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	0.000	C
CACNA1G	8913	genome.wustl.edu	37	17	48653606	48653606	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:48653606G>T	ENST00000359106.5	+	8	1843	c.1843G>T	c.(1843-1845)Ggg>Tgg	p.G615W	CACNA1G_ENST00000510366.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000512389.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000514717.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000507510.2_Missense_Mutation_p.G615W|CACNA1G_ENST00000352832.5_Missense_Mutation_p.G615W|CACNA1G_ENST00000514181.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000514079.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000442258.2_Missense_Mutation_p.G615W|CACNA1G_ENST00000513964.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000429973.2_Missense_Mutation_p.G615W|CACNA1G_ENST00000507609.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000503485.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000515411.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000513689.2_Missense_Mutation_p.G615W|CACNA1G_ENST00000502264.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000354983.4_Missense_Mutation_p.G615W|CACNA1G_ENST00000510115.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000360761.4_Missense_Mutation_p.G615W|CACNA1G_ENST00000358244.5_Missense_Mutation_p.G615W|CACNA1G_ENST00000416767.4_Missense_Mutation_p.G615W|CACNA1G_ENST00000505165.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000515765.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000515165.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000507896.1_Missense_Mutation_p.G615W|CACNA1G_ENST00000507336.1_Missense_Mutation_p.G615W	NM_018896.4	NP_061496.2	O43497	CAC1G_HUMAN	calcium channel, voltage-dependent, T type, alpha 1G subunit	615					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|response to nickel cation (GO:0010045)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|scaffold protein binding (GO:0097110)			breast(5)|cervix(1)|endometrium(13)|kidney(5)|lung(23)	47	Breast(11;6.7e-17)		BRCA - Breast invasive adenocarcinoma(22;7.52e-09)		Cinnarizine(DB00568)|Ethosuximide(DB00593)|Flunarizine(DB04841)|Methsuximide(DB05246)|Spironolactone(DB00421)|Trimethadione(DB00347)|Verapamil(DB00661)|Zonisamide(DB00909)	TGCCAGCTCTGGGCCCCCAAC	0.627																																						dbGAP											0													12.0	17.0	15.0					17																	48653606		2043	4179	6222	-	-	-	SO:0001583	missense	0			AC004590	CCDS45730.1, CCDS45731.1, CCDS45732.1, CCDS45733.1, CCDS45734.1, CCDS45735.1, CCDS45736.1, CCDS45737.1, CCDS54142.1, CCDS54143.1, CCDS54144.1, CCDS54145.1, CCDS54146.1, CCDS58565.1, CCDS58566.1, CCDS58567.1, CCDS58568.1, CCDS58569.1, CCDS58570.1, CCDS58571.1, CCDS58572.1, CCDS58573.1, CCDS58574.1, CCDS58575.1, CCDS58576.1	17q22	2012-03-07	2007-02-16		ENSG00000006283	ENSG00000006283		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1394	protein-coding gene	gene with protein product		604065				9495342, 16382099	Standard	NM_001256334		Approved	Cav3.1, NBR13	uc002irk.2	O43497	OTTHUMG00000162180	ENST00000359106.5:c.1843G>T	17.37:g.48653606G>T	ENSP00000352011:p.Gly615Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RA64|E7EPR0|O43498|O94770|Q19QY8|Q19QY9|Q19QZ0|Q19QZ1|Q19QZ2|Q19QZ3|Q19QZ4|Q19QZ5|Q19QZ6|Q19QZ7|Q19QZ8|Q19QZ9|Q19R00|Q19R01|Q19R02|Q19R03|Q19R04|Q19R05|Q19R06|Q19R07|Q19R08|Q19R09|Q19R10|Q19R11|Q19R12|Q19R13|Q19R15|Q19R16|Q19R17|Q19R18|Q2TAC4|Q9NYU4|Q9NYU5|Q9NYU6|Q9NYU7|Q9NYU8|Q9NYU9|Q9NYV0|Q9NYV1|Q9UHN9|Q9UHP0|Q9ULU6|Q9UNG7|Q9Y5T2|Q9Y5T3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.G615W	ENST00000359106.5	37	c.1843	CCDS45730.1	17	.	.	.	.	.	.	.	.	.	.	g	17.70	3.455006	0.63290	.	.	ENSG00000006283	ENST00000360761;ENST00000352832;ENST00000416767;ENST00000354983;ENST00000442258;ENST00000502264;ENST00000512389;ENST00000513964;ENST00000514717;ENST00000510366;ENST00000503485;ENST00000507510;ENST00000507336;ENST00000513689;ENST00000507609;ENST00000510115;ENST00000515165;ENST00000514181;ENST00000515765;ENST00000514079;ENST00000358244;ENST00000359106;ENST00000429973;ENST00000515411;ENST00000505165;ENST00000507896	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97089	-4.08;-4.08;-4.24;-4.02;-4.07;-4.07;-4.11;-4.18;-4.15;-4.16;-4.17;-4.04;-4.06;-4.12;-4.07;-4.01;-4.1;-4.06;-4.04;-4.11;-4.07;-4.06;-4.1;-4.04;-4.1;-4.1	5.55	4.58	0.56647	.	0.811226	0.11336	N	0.574541	D	0.97729	0.9255	L	0.52011	1.625	0.41713	D	0.989461	D;P;P;P;P;P;D;P;D;B;D;P;P;P;D;P;P;P;P;P;D;P;P;P;D;P	0.89917	0.985;0.78;0.887;0.901;0.889;0.943;0.988;0.901;0.988;0.007;0.986;0.86;0.78;0.777;0.967;0.889;0.777;0.917;0.945;0.81;1.0;0.78;0.887;0.78;1.0;0.857	P;B;P;P;P;P;P;P;P;B;P;P;B;P;P;P;B;P;P;P;D;B;P;B;D;P	0.97110	0.786;0.438;0.471;0.757;0.642;0.653;0.85;0.713;0.85;0.008;0.599;0.641;0.438;0.471;0.653;0.541;0.371;0.668;0.713;0.541;0.998;0.438;0.576;0.325;1.0;0.575	D	0.95936	0.8942	10	0.87932	D	0	.	13.0301	0.58837	0.0751:0.0:0.9249:0.0	.	615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615;615	Q19QZ5;Q19QZ1;Q19QZ4;Q19R07;Q19QY8;Q19R10;Q19QZ6;Q19QZ3;Q19R06;Q19R00;Q19R04;O43497-10;Q19QZ9;Q19QZ7;Q19R08;Q19QZ8;Q19R03;O43497-4;Q19R02;Q19R12;Q19R17;Q19R11;Q2TAC4;O43497;Q19R13;O43497-11	.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;CAC1G_HUMAN;.;.	W	615	ENSP00000353990:G615W;ENSP00000339302:G615W;ENSP00000392390:G615W;ENSP00000347078:G615W;ENSP00000409759:G615W;ENSP00000425522:G615W;ENSP00000426261:G615W;ENSP00000425451:G615W;ENSP00000422407:G615W;ENSP00000426814:G615W;ENSP00000427238:G615W;ENSP00000423112:G615W;ENSP00000420918:G615W;ENSP00000426172:G615W;ENSP00000423045:G615W;ENSP00000427173:G615W;ENSP00000426098:G615W;ENSP00000425698:G615W;ENSP00000426232:G615W;ENSP00000423317:G615W;ENSP00000350979:G615W;ENSP00000352011:G615W;ENSP00000414388:G615W;ENSP00000423155:G615W;ENSP00000422268:G615W;ENSP00000421518:G615W	ENSP00000339302:G615W	G	+	1	0	CACNA1G	46008605	1.000000	0.71417	0.979000	0.43373	0.917000	0.54804	4.724000	0.61972	1.348000	0.45733	0.591000	0.81541	GGG	CACNA1G	-	NULL	ENSG00000006283		0.627	CACNA1G-013	KNOWN	basic|CCDS	protein_coding	CACNA1G	HGNC	protein_coding	OTTHUMT00000367895.1	46	0.00	0	G	NM_018896		48653606	48653606	+1	no_errors	ENST00000359106	ensembl	human	known	69_37n	missense	16	50.00	16	SNP	0.991	T
CARD11	84433	genome.wustl.edu	37	7	2962874	2962874	+	Silent	SNP	G	G	T	rs200784314		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr7:2962874G>T	ENST00000396946.4	-	16	2437	c.2034C>A	c.(2032-2034)tcC>tcA	p.S678S		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	678	PDZ.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		GGGTGAGCTGGGAGGTGAGGC	0.701			Mis		DLBCL																																	dbGAP		Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													42.0	44.0	44.0					7																	2962874		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2034C>A	7.37:g.2962874G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.S678	ENST00000396946.4	37	c.2034	CCDS5336.2	7																																																																																			CARD11	-	superfamily_PDZ	ENSG00000198286		0.701	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	90	0.00	0	G	NM_032415		2962874	2962874	-1	no_errors	ENST00000396946	ensembl	human	known	69_37n	silent	36	49.30	35	SNP	0.002	T
CASR	846	genome.wustl.edu	37	3	121976050	121976050	+	Missense_Mutation	SNP	C	C	G	rs199734455		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr3:121976050C>G	ENST00000490131.1	+	3	680	c.308C>G	c.(307-309)aCc>aGc	p.T103S	CASR_ENST00000296154.5_Missense_Mutation_p.T103S|CASR_ENST00000498619.1_Missense_Mutation_p.T103S	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	103					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	ACTTGCAACACCGTTTCTAAG	0.453																																						dbGAP											0													138.0	135.0	136.0					3																	121976050		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.308C>G	3.37:g.121976050C>G	ENSP00000418685:p.Thr103Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.T103S	ENST00000490131.1	37	c.308	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	C	20.4	3.988735	0.74589	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.85088	-1.94;-1.94;-1.94	5.75	5.75	0.90469	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.86100	0.5852	N	0.17379	0.485	0.58432	D	0.999994	D;D	0.76494	0.999;0.999	D;D	0.83275	0.992;0.996	T	0.82345	-0.0503	10	0.15499	T	0.54	.	18.936	0.92586	0.0:1.0:0.0:0.0	.	103;103	E7ENE0;P41180	.;CASR_HUMAN	S	103	ENSP00000418685:T103S;ENSP00000420194:T103S;ENSP00000296154:T103S	ENSP00000296154:T103S	T	+	2	0	CASR	123458740	1.000000	0.71417	0.998000	0.56505	0.938000	0.57974	7.818000	0.86416	2.712000	0.92718	0.591000	0.81541	ACC	CASR	-	pfam_ANF_lig-bd_rcpt	ENSG00000036828		0.453	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	38	0.00	0	C	NM_000388		121976050	121976050	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.999	G
CCNT1	904	genome.wustl.edu	37	12	49093563	49093563	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr12:49093563C>T	ENST00000261900.3	-	5	716	c.494G>A	c.(493-495)cGa>cAa	p.R165Q		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	165					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						TTCCTTACCTCGAACAAGTTG	0.358																																						dbGAP											0													278.0	273.0	275.0					12																	49093563		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.494G>A	12.37:g.49093563C>T	ENSP00000261900:p.Arg165Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.R165Q	ENST00000261900.3	37	c.494	CCDS8766.1	12	.	.	.	.	.	.	.	.	.	.	c	24.1	4.494690	0.85069	.	.	ENSG00000129315	ENST00000261900	T	0.42513	0.97	4.99	4.99	0.66335	Cyclin-like (1);	0.000000	0.85682	D	0.000000	T	0.42562	0.1208	M	0.73319	2.225	0.80722	D	1	P	0.34546	0.456	B	0.22152	0.038	T	0.51803	-0.8659	10	0.72032	D	0.01	-11.2056	17.4291	0.87534	0.0:1.0:0.0:0.0	.	165	O60563	CCNT1_HUMAN	Q	165	ENSP00000261900:R165Q	ENSP00000261900:R165Q	R	-	2	0	CCNT1	47379830	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.796000	0.85898	2.481000	0.83766	0.650000	0.86243	CGA	CCNT1	-	superfamily_Cyclin-like	ENSG00000129315		0.358	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNT1	HGNC	protein_coding	OTTHUMT00000408853.1	44	0.00	0	C	NM_001240		49093563	49093563	-1	no_errors	ENST00000261900	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	1.000	T
CDCA4	55038	genome.wustl.edu	37	14	105478225	105478226	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr14:105478225_105478226insT	ENST00000336219.3	-	2	196_197	c.41_42insA	c.(40-42)gagfs	p.E14fs	CDCA4_ENST00000392590.3_Frame_Shift_Ins_p.E14fs	NM_017955.3	NP_060425.2	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	14						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		CCACGTCTTCCTCGTGGCCAAC	0.559																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BG354577	CCDS9996.1	14q32.33	2014-02-14			ENSG00000170779	ENSG00000170779			14625	protein-coding gene	gene with protein product	"""hematopoietic progenitor protein"""	612270				12188893	Standard	NM_145701		Approved	FLJ20764, Hepp	uc001yqb.2	Q9BXL8	OTTHUMG00000170767	ENST00000336219.3:c.42dupA	14.37:g.105478226_105478226dupT	ENSP00000337226:p.Glu14fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB18|Q9NWK7	Frame_Shift_Ins	INS	pfam_SERTA,pfscan_SERTA	p.E15fs	ENST00000336219.3	37	c.42_41	CCDS9996.1	14																																																																																			CDCA4	-	NULL	ENSG00000170779		0.559	CDCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA4	HGNC	protein_coding	OTTHUMT00000410311.1	31	0.00	0	-	NM_145701		105478225	105478226	-1	no_errors	ENST00000336219	ensembl	human	known	69_37n	frame_shift_ins	5	28.57	2	INS	0.986:0.995	T
CIB2	10518	genome.wustl.edu	37	15	78401589	78401589	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr15:78401589A>T	ENST00000258930.3	-	4	662	c.334T>A	c.(334-336)Ttc>Atc	p.F112I	CIB2_ENST00000539011.1_Missense_Mutation_p.F69I|CIB2_ENST00000560618.1_Missense_Mutation_p.F69I|CIB2_ENST00000557846.1_Missense_Mutation_p.F63I	NM_006383.2	NP_006374.1	O75838	CIB2_HUMAN	calcium and integrin binding family member 2	112	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion homeostasis (GO:0055074)|photoreceptor cell maintenance (GO:0045494)	blood microparticle (GO:0072562)|muscle tendon junction (GO:0005927)|neuromuscular junction (GO:0031594)|photoreceptor inner segment (GO:0001917)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	11						TAGATCTTGAAGGCATAGTTT	0.562																																						dbGAP											0													99.0	85.0	90.0					15																	78401589		2196	4293	6489	-	-	-	SO:0001583	missense	0			BC047381	CCDS10296.1, CCDS61722.1, CCDS61723.1	15q24	2013-01-10			ENSG00000136425	ENSG00000136425		"""EF-hand domain containing"""	24579	protein-coding gene	gene with protein product		605564	"""deafness, autosomal recessive 48"", ""Usher syndrome 1J (autosomal recessive)"""	DFNB48, USH1J		9931475, 23023331	Standard	NM_006383		Approved	KIP2	uc002bdb.2	O75838	OTTHUMG00000143731	ENST00000258930.3:c.334T>A	15.37:g.78401589A>T	ENSP00000258930:p.Phe112Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDF0|H0YM71|Q05BT6	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.F112I	ENST00000258930.3	37	c.334	CCDS10296.1	15	.	.	.	.	.	.	.	.	.	.	A	27.7	4.855712	0.91355	.	.	ENSG00000136425	ENST00000258930;ENST00000539011	D;D	0.92299	-3.01;-3.01	4.63	3.47	0.39725	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.96592	0.8888	H	0.95679	3.705	0.80722	D	1	P;D	0.61697	0.9;0.99	P;D	0.66847	0.675;0.947	D	0.95997	0.8990	10	0.87932	D	0	-32.4769	9.977	0.41791	0.8482:0.0:0.0:0.1518	.	112;112	B4DDF0;O75838	.;CIB2_HUMAN	I	112;69	ENSP00000258930:F112I;ENSP00000442459:F69I	ENSP00000258930:F112I	F	-	1	0	CIB2	76188644	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.091000	0.94151	0.700000	0.31782	0.482000	0.46254	TTC	CIB2	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000136425		0.562	CIB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIB2	HGNC	protein_coding	OTTHUMT00000289798.1	84	0.00	0	A	NM_006383		78401589	78401589	-1	no_errors	ENST00000258930	ensembl	human	known	69_37n	missense	46	32.35	22	SNP	1.000	T
CLIP4	79745	genome.wustl.edu	37	2	29368177	29368178	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr2:29368177_29368178insA	ENST00000320081.5	+	8	1220_1221	c.965_966insA	c.(964-969)ggaaaafs	p.GK322fs	CLIP4_ENST00000401617.2_Frame_Shift_Ins_p.GK215fs|CLIP4_ENST00000401605.1_Frame_Shift_Ins_p.GK322fs|CLIP4_ENST00000404424.1_Frame_Shift_Ins_p.GK322fs	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	322	CAP-Gly 1. {ECO:0000255|PROSITE- ProRule:PRU00045}.									endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					GAACCAGAAGGAAAAAATAATG	0.347																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.971dupA	2.37:g.29368183_29368183dupA	ENSP00000327009:p.Gly322fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Frame_Shift_Ins	INS	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.N324fs	ENST00000320081.5	37	c.965_966	CCDS1770.1	2																																																																																			CLIP4	-	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	ENSG00000115295		0.347	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP4	HGNC	protein_coding	OTTHUMT00000215123.2	88	0.00	0	-	NM_024692		29368177	29368178	+1	no_errors	ENST00000402240	ensembl	human	known	69_37n	frame_shift_ins	76	14.61	13	INS	1.000:0.863	A
CNTNAP1	8506	genome.wustl.edu	37	17	40838951	40838951	+	Missense_Mutation	SNP	C	C	T	rs544700921		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:40838951C>T	ENST00000264638.4	+	7	1148	c.931C>T	c.(931-933)Cgg>Tgg	p.R311W	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	311	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		GGGCGCCGCGCGGAAGAACCT	0.647																																						dbGAP											0													33.0	31.0	32.0					17																	40838951		2203	4300	6503	-	-	-	SO:0001583	missense	0			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.931C>T	17.37:g.40838951C>T	ENSP00000264638:p.Arg311Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R311W	ENST00000264638.4	37	c.931	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754093	0.49362	.	.	ENSG00000108797	ENST00000264638	T	0.80304	-1.36	5.53	3.37	0.38596	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	1.071310	0.07200	N	0.857384	T	0.80369	0.4610	L	0.46819	1.47	0.09310	N	1	P	0.48911	0.917	P	0.46975	0.533	T	0.68416	-0.5414	10	0.87932	D	0	.	11.0853	0.48082	0.449:0.551:0.0:0.0	.	311	P78357	CNTP1_HUMAN	W	311	ENSP00000264638:R311W	ENSP00000264638:R311W	R	+	1	2	CNTNAP1	38092477	0.533000	0.26354	0.002000	0.10522	0.308000	0.27856	2.387000	0.44389	1.274000	0.44362	0.561000	0.74099	CGG	CNTNAP1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000108797		0.647	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	64	0.00	0	C	NM_003632		40838951	40838951	+1	no_errors	ENST00000264638	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	0.001	T
CNTRL	11064	genome.wustl.edu	37	9	123908390	123908390	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr9:123908390C>A	ENST00000373855.1	+	23	3575	c.3315C>A	c.(3313-3315)aaC>aaA	p.N1105K	CNTRL_ENST00000373847.1_Missense_Mutation_p.N553K|CNTRL_ENST00000373850.1_Missense_Mutation_p.N553K|CNTRL_ENST00000238341.5_Missense_Mutation_p.N1105K			Q7Z7A1	CNTRL_HUMAN	centriolin	1105					cell division (GO:0051301)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)				haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|lung(2)|ovary(4)|skin(3)	20						TTACAGACAACAAAGGAGGCT	0.308																																						dbGAP											0													45.0	47.0	46.0					9																	123908390		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF513978	CCDS35118.1	9q33.2	2014-02-20	2011-05-23	2011-05-23	ENSG00000119397	ENSG00000119397			1858	protein-coding gene	gene with protein product		605496	"""centrosomal protein 1"", ""centrosomal protein 110kDa"""	CEP1, CEP110		10688839	Standard	XM_005251679		Approved		uc004bkx.1	Q7Z7A1	OTTHUMG00000020581	ENST00000373855.1:c.3315C>A	9.37:g.123908390C>A	ENSP00000362962:p.Asn1105Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y1|B2RP67|Q3MN79|Q5FWF8|Q5JVD0|Q6MZR3|Q6PKC1|Q8TEP3|Q9Y489	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Leu-rich_rpt_typical-subtyp	p.N1105K	ENST00000373855.1	37	c.3315	CCDS35118.1	9	.	.	.	.	.	.	.	.	.	.	C	8.925	0.962024	0.18583	.	.	ENSG00000119397	ENST00000373855;ENST00000238341;ENST00000454238;ENST00000373851;ENST00000373850;ENST00000373847	T;T;T;T	0.32753	1.77;1.77;1.44;1.46	5.16	2.21	0.28008	.	.	.	.	.	T	0.15435	0.0372	L	0.27053	0.805	0.24052	N	0.996042	B;B	0.10296	0.003;0.002	B;B	0.08055	0.003;0.001	T	0.36311	-0.9753	9	0.05833	T	0.94	.	4.6544	0.12610	0.158:0.6013:0.0:0.2407	.	1105;1105	F5GZN0;Q7Z7A1	.;CNTRL_HUMAN	K	1105;1105;1105;587;553;553	ENSP00000362962:N1105K;ENSP00000238341:N1105K;ENSP00000362956:N553K;ENSP00000362953:N553K	ENSP00000238341:N1105K	N	+	3	2	CNTRL	122948211	0.972000	0.33761	0.984000	0.44739	0.564000	0.35744	0.545000	0.23268	0.228000	0.21019	0.650000	0.86243	AAC	CNTRL	-	NULL	ENSG00000119397		0.308	CNTRL-010	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTRL	HGNC	protein_coding	OTTHUMT00000250216.1	47	0.00	0	C	NM_007018		123908390	123908390	+1	no_errors	ENST00000238341	ensembl	human	known	69_37n	missense	46	36.99	27	SNP	0.985	A
COL12A1	1303	genome.wustl.edu	37	6	75875406	75875406	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr6:75875406C>T	ENST00000322507.8	-	14	3109	c.2800G>A	c.(2800-2802)Ggt>Agt	p.G934S	COL12A1_ENST00000416123.2_Missense_Mutation_p.G934S|COL12A1_ENST00000483888.2_Missense_Mutation_p.G934S|COL12A1_ENST00000345356.6_Intron	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	934	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						ACCCTGTAACCGCGAACCATT	0.418																																						dbGAP											0													125.0	117.0	120.0					6																	75875406		1878	4108	5986	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.2800G>A	6.37:g.75875406C>T	ENSP00000325146:p.Gly934Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.G934S	ENST00000322507.8	37	c.2800	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	C	3.613	-0.079162	0.07141	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.60040	0.22;0.22;0.22	5.3	5.3	0.74995	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.204905	0.33875	N	0.004478	T	0.34890	0.0913	M	0.74647	2.275	0.09310	N	1	P	0.40660	0.726	B	0.31812	0.136	T	0.33137	-0.9880	10	0.33940	T	0.23	.	9.7402	0.40413	0.0:0.7086:0.2144:0.077	.	934	Q99715	COCA1_HUMAN	S	934	ENSP00000325146:G934S;ENSP00000412864:G934S;ENSP00000421216:G934S	ENSP00000325146:G934S	G	-	1	0	COL12A1	75932126	0.000000	0.05858	0.949000	0.38748	0.964000	0.63967	-0.036000	0.12185	2.469000	0.83416	0.563000	0.77884	GGT	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.418	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	92	0.00	0	C	NM_004370		75875406	75875406	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	42	30.00	18	SNP	0.181	T
CPNE8	144402	genome.wustl.edu	37	12	39155972	39155972	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr12:39155972G>T	ENST00000331366.5	-	9	718	c.622C>A	c.(622-624)Cca>Aca	p.P208T	CPNE8_ENST00000360449.3_Missense_Mutation_p.P196T	NM_153634.2	NP_705898.1	Q86YQ8	CPNE8_HUMAN	copine VIII	208	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(1)|large_intestine(6)|lung(6)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	21	Esophageal squamous(101;0.187)	Lung NSC(34;0.137)|Melanoma(24;0.152)|all_lung(34;0.157)				TGCCATACTGGATTTAGAGTG	0.303																																						dbGAP											0													110.0	104.0	106.0					12																	39155972		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY177785	CCDS8733.1	12q12	2008-02-05				ENSG00000139117			23498	protein-coding gene	gene with protein product						12670487	Standard	NM_153634		Approved		uc001rls.1	Q86YQ8	OTTHUMG00000169396	ENST00000331366.5:c.622C>A	12.37:g.39155972G>T	ENSP00000329748:p.Pro208Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TB41|Q86VY2	Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.P208T	ENST00000331366.5	37	c.622	CCDS8733.1	12	.	.	.	.	.	.	.	.	.	.	G	18.66	3.672697	0.67928	.	.	ENSG00000139117	ENST00000331366;ENST00000360449	T;T	0.81247	-1.47;-1.47	3.9	3.9	0.45041	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.122577	0.56097	D	0.000027	D	0.91613	0.7350	H	0.97214	3.96	0.80722	D	1	D	0.60575	0.988	P	0.56612	0.802	D	0.94829	0.7994	10	0.87932	D	0	-9.5028	15.5382	0.76018	0.0:0.0:1.0:0.0	.	208	Q86YQ8	CPNE8_HUMAN	T	208;196	ENSP00000329748:P208T;ENSP00000353633:P196T	ENSP00000329748:P208T	P	-	1	0	CPNE8	37442239	1.000000	0.71417	0.971000	0.41717	0.894000	0.52154	9.419000	0.97397	2.131000	0.65755	0.650000	0.86243	CCA	CPNE8	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000139117		0.303	CPNE8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE8	HGNC	protein_coding	OTTHUMT00000403856.1	56	0.00	0	G	NM_153634		39155972	39155972	-1	no_errors	ENST00000331366	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	1.000	T
CRB1	23418	genome.wustl.edu	37	1	197313516	197313516	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr1:197313516G>T	ENST00000367400.3	+	3	893	c.758G>T	c.(757-759)gGa>gTa	p.G253V	CRB1_ENST00000538660.1_Missense_Mutation_p.G253V|CRB1_ENST00000367399.2_Intron|CRB1_ENST00000543483.1_5'UTR|CRB1_ENST00000535699.1_Missense_Mutation_p.G184V	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	253	EGF-like 6; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TGTGCCCCTGGATTCCTGGGG	0.493																																						dbGAP											0													230.0	212.0	218.0					1																	197313516		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.758G>T	1.37:g.197313516G>T	ENSP00000356370:p.Gly253Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G253V	ENST00000367400.3	37	c.758	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.378076	0.82682	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400	D;D;D	0.98221	-4.8;-4.8;-4.8	5.35	5.35	0.76521	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.99504	0.9823	H	0.99182	4.46	0.80722	D	1	D;D;D;D	0.89917	1.0;0.993;0.999;1.0	D;D;D;D	0.97110	0.992;0.932;0.966;1.0	D	0.97855	1.0277	9	0.72032	D	0.01	.	19.0475	0.93027	0.0:0.0:1.0:0.0	.	253;184;253;278	B7Z5T2;F5H0L2;P82279;Q59H36	.;.;CRUM1_HUMAN;.	V	184;253;253	ENSP00000438786:G184V;ENSP00000438091:G253V;ENSP00000356370:G253V	ENSP00000356370:G253V	G	+	2	0	CRB1	195580139	1.000000	0.71417	0.860000	0.33809	0.606000	0.37113	9.174000	0.94824	2.481000	0.83766	0.650000	0.86243	GGA	CRB1	-	pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000134376		0.493	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	134	0.00	0	G	NM_201253		197313516	197313516	+1	no_errors	ENST00000367400	ensembl	human	known	69_37n	missense	99	19.51	24	SNP	1.000	T
CXADR	1525	genome.wustl.edu	37	21	18933695	18933695	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr21:18933695G>A	ENST00000284878.7	+	6	1482	c.734G>A	c.(733-735)gGa>gAa	p.G245E	CXADR_ENST00000400169.1_Missense_Mutation_p.G245E|CXADR_ENST00000356275.6_Intron|CXADR_ENST00000306618.10_Missense_Mutation_p.G204E|CXADR_ENST00000400165.1_Intron|CXADR_ENST00000400166.1_Intron	NM_001338.4	NP_001329.1	P78310	CXAR_HUMAN	coxsackie virus and adenovirus receptor	245					actin cytoskeleton reorganization (GO:0031532)|AV node cell to bundle of His cell communication (GO:0086067)|blood coagulation (GO:0007596)|cardiac muscle fiber development (GO:0048739)|cell-cell junction organization (GO:0045216)|defense response to virus (GO:0051607)|epithelial structure maintenance (GO:0010669)|gamma-delta T cell activation (GO:0046629)|germ cell migration (GO:0008354)|heart development (GO:0007507)|heterophilic cell-cell adhesion (GO:0007157)|homotypic cell-cell adhesion (GO:0034109)|leukocyte migration (GO:0050900)|mitochondrion organization (GO:0007005)|neutrophil chemotaxis (GO:0030593)|regulation of immune response (GO:0050776)|transepithelial transport (GO:0070633)|viral process (GO:0016032)	acrosomal vesicle (GO:0001669)|adherens junction (GO:0005912)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|filopodium (GO:0030175)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|membrane raft (GO:0045121)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|cell adhesion molecule binding (GO:0050839)|connexin binding (GO:0071253)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|PDZ domain binding (GO:0030165)|receptor binding (GO:0005102)|virus receptor activity (GO:0001618)			endometrium(2)|large_intestine(5)|lung(1)|ovary(1)|prostate(2)	11				Epithelial(23;0.000206)|all cancers(11;0.000302)|OV - Ovarian serous cystadenocarcinoma(11;0.0194)|Lung(58;0.0233)|COAD - Colon adenocarcinoma(22;0.0389)|Colorectal(24;0.0483)|LUSC - Lung squamous cell carcinoma(23;0.0782)		GCCATTATAGGAACTTTGCTT	0.328																																						dbGAP											0													33.0	33.0	33.0					21																	18933695		2201	4295	6496	-	-	-	SO:0001583	missense	0			Y07593	CCDS33519.1, CCDS56204.1, CCDS56205.1, CCDS56206.1, CCDS56207.1	21q21.1	2013-01-29			ENSG00000154639	ENSG00000154639		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2559	protein-coding gene	gene with protein product		602621				9036860, 9096397	Standard	NM_001338		Approved	CAR	uc002yki.3	P78310	OTTHUMG00000074508	ENST00000284878.7:c.734G>A	21.37:g.18933695G>A	ENSP00000284878:p.Gly245Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V8|B7WPI3|D3YHP0|O00694|Q8WWT6|Q8WWT7|Q8WWT8|Q9UKV4	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.G245E	ENST00000284878.7	37	c.734	CCDS33519.1	21	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711968	0.68730	.	.	ENSG00000154639	ENST00000284878;ENST00000400169;ENST00000306618	D;D;D	0.95103	-1.63;-1.71;-3.61	4.49	4.49	0.54785	.	0.217884	0.46758	D	0.000268	D	0.97126	0.9061	M	0.82630	2.6	0.43234	D	0.995132	D;D	0.89917	1.0;0.998	D;D	0.71656	0.965;0.974	D	0.97636	1.0145	10	0.59425	D	0.04	.	16.5447	0.84426	0.0:0.0:1.0:0.0	.	245;245	B7WPI3;P78310	.;CXAR_HUMAN	E	245;245;204	ENSP00000284878:G245E;ENSP00000383033:G245E;ENSP00000303395:G204E	ENSP00000284878:G245E	G	+	2	0	CXADR	17855566	1.000000	0.71417	0.963000	0.40424	0.979000	0.70002	6.430000	0.73391	2.216000	0.71823	0.591000	0.81541	GGA	CXADR	-	NULL	ENSG00000154639		0.328	CXADR-001	KNOWN	basic|CCDS	protein_coding	CXADR	HGNC	protein_coding	OTTHUMT00000158209.1	58	0.00	0	G			18933695	18933695	+1	no_errors	ENST00000284878	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.997	A
DHX37	57647	genome.wustl.edu	37	12	125465270	125465272	+	In_Frame_Del	DEL	CTC	CTC	-	rs376470858		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr12:125465270_125465272delCTC	ENST00000308736.2	-	4	600_602	c.502_504delGAG	c.(502-504)gagdel	p.E168del	DHX37_ENST00000544745.1_5'Flank	NM_032656.3	NP_116045.2	Q8IY37	DHX37_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 37	168							ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.E168delE(3)		breast(5)|cervix(1)|endometrium(9)|kidney(5)|large_intestine(11)|liver(1)|lung(27)|ovary(1)|prostate(2)|skin(3)	65	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;8.05e-05)|Epithelial(86;0.000486)|all cancers(50;0.00653)		CCGATTCCGActcctcctcctcc	0.69																																						dbGAP											3	Deletion - In frame(3)	breast(2)|prostate(1)																																								-	-	-	SO:0001651	inframe_deletion	0			AB040950	CCDS9261.1	12q24.31	2004-03-25	2003-06-13	2003-06-20		ENSG00000150990		"""DEAH-boxes"""	17210	protein-coding gene	gene with protein product			"""DEAD/DEAH box helicase DDX37"""	DDX37		10819331	Standard	NM_032656		Approved	KIAA1517, MGC4322, MGC2695	uc001ugy.3	Q8IY37		ENST00000308736.2:c.502_504delGAG	12.37:g.125465279_125465281delCTC	ENSP00000311135:p.Glu168del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUI7|Q9P211	In_Frame_Del	DEL	pfam_DUF1605,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_T2SS_protein-E,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E168in_frame_del	ENST00000308736.2	37	c.504_502	CCDS9261.1	12																																																																																			DHX37	-	NULL	ENSG00000150990		0.690	DHX37-201	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX37	HGNC	protein_coding		75	0.00	0	CTC	NM_032656		125465270	125465272	-1	no_errors	ENST00000308736	ensembl	human	known	69_37n	in_frame_del	37	11.90	5	DEL	0.904:0.904:0.905	-
DOCK5	80005	genome.wustl.edu	37	8	25222170	25222170	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr8:25222170G>T	ENST00000276440.7	+	30	3117	c.3073G>T	c.(3073-3075)Gct>Tct	p.A1025S		NM_024940.6	NP_079216.4	Q9H7D0	DOCK5_HUMAN	dedicator of cytokinesis 5	1025					positive regulation of GTPase activity (GO:0043547)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(9)|large_intestine(13)|lung(20)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		all_cancers(63;0.0361)|Ovarian(32;0.000711)|all_epithelial(46;0.0153)|Hepatocellular(4;0.115)|Prostate(55;0.13)|Breast(100;0.143)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0267)|Epithelial(17;1.07e-11)|Colorectal(74;0.0276)|COAD - Colon adenocarcinoma(73;0.0828)		AAATCAGTTTGCTGAAGTTCT	0.428																																					Pancreas(145;34 1887 3271 10937 30165)	dbGAP											0													139.0	118.0	125.0					8																	25222170		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6047.1	8p21.2	2009-04-17			ENSG00000147459	ENSG00000147459			23476	protein-coding gene	gene with protein product						12432077	Standard	NM_024940		Approved	FLJ21034	uc003xeg.3	Q9H7D0	OTTHUMG00000131991	ENST00000276440.7:c.3073G>T	8.37:g.25222170G>T	ENSP00000276440:p.Ala1025Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNY0|Q5XKD5|Q6AI11|Q6PJS6|Q6ZTS6	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.A1025S	ENST00000276440.7	37	c.3073	CCDS6047.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.55|10.55	1.382577|1.382577	0.25031|0.25031	.|.	.|.	ENSG00000147459|ENSG00000147459	ENST00000276440|ENST00000444569	T|.	0.33865|.	1.39|.	5.62|5.62	0.225|0.225	0.15325|0.15325	.|.	0.465056|.	0.25106|.	N|.	0.033085|.	T|T	0.22666|0.22666	0.0547|0.0547	N|N	0.05592|0.05592	-0.015|-0.015	0.36576|0.36576	D|D	0.873295|0.873295	B;B;B|.	0.11235|.	0.004;0.002;0.002|.	B;B;B|.	0.15484|.	0.013;0.006;0.003|.	T|T	0.12293|0.12293	-1.0553|-1.0553	10|5	0.06891|.	T|.	0.86|.	.|.	4.0468|4.0468	0.09776|0.09776	0.3479:0.0:0.4023:0.2498|0.3479:0.0:0.4023:0.2498	.|.	1015;800;1025|.	D3DSS6;Q68DL4;Q9H7D0|.	.;.;DOCK5_HUMAN|.	S|F	1025|796	ENSP00000276440:A1025S|.	ENSP00000276440:A1025S|.	A|C	+|+	1|2	0|0	DOCK5|DOCK5	25278087|25278087	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.948000|0.948000	0.59901|0.59901	0.884000|0.884000	0.28214|0.28214	0.011000|0.011000	0.14865|0.14865	0.650000|0.650000	0.86243|0.86243	GCT|TGC	DOCK5	-	superfamily_ARM-type_fold	ENSG00000147459		0.428	DOCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK5	HGNC	protein_coding	OTTHUMT00000254955.2	51	0.00	0	G	NM_024940		25222170	25222170	+1	no_errors	ENST00000276440	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	0.996	T
DSC2	1824	genome.wustl.edu	37	18	28648096	28648096	+	Missense_Mutation	SNP	G	G	A	rs202031070		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr18:28648096G>A	ENST00000280904.6	-	16	3034	c.2591C>T	c.(2590-2592)tCg>tTg	p.S864L	DSC2_ENST00000251081.6_3'UTR	NM_024422.3	NP_077740.1	Q02487	DSC2_HUMAN	desmocollin 2	864					bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell-cardiac muscle cell adhesion (GO:0086042)|cell adhesion (GO:0007155)|cellular response to starvation (GO:0009267)|homophilic cell adhesion (GO:0007156)|regulation of heart rate by cardiac conduction (GO:0086091)|ventricular cardiac muscle cell action potential (GO:0086005)	cell-cell adherens junction (GO:0005913)|cytoplasmic vesicle (GO:0031410)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)	21			OV - Ovarian serous cystadenocarcinoma(10;0.0241)			CCCAGCCACCGATCCTCTTCC	0.423													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15000	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													102.0	88.0	93.0					18																	28648096		2203	4300	6503	-	-	-	SO:0001583	missense	0			X56807	CCDS11892.1, CCDS11893.1	18q12.1	2014-09-17			ENSG00000134755	ENSG00000134755		"""Cadherins / Major cadherins"""	3036	protein-coding gene	gene with protein product		125645		DSC3		7774948	Standard	NM_024422		Approved	CDHF2	uc002kwl.4	Q02487	OTTHUMG00000131981	ENST00000280904.6:c.2591C>T	18.37:g.28648096G>A	ENSP00000280904:p.Ser864Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin,prints_Desmo_cadherin	p.S864L	ENST00000280904.6	37	c.2591	CCDS11892.1	18	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	17.45	3.393368	0.62066	.	.	ENSG00000134755	ENST00000280904;ENST00000438199;ENST00000399347	D	0.82344	-1.6	5.87	4.95	0.65309	Cadherin, cytoplasmic domain (1);	0.000000	0.29466	N	0.012077	D	0.93070	0.7794	M	0.92604	3.325	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.93972	0.7250	10	0.72032	D	0.01	.	16.8437	0.85975	0.0:0.1282:0.8718:0.0	.	864	Q02487	DSC2_HUMAN	L	864;630;877	ENSP00000280904:S864L	ENSP00000280904:S864L	S	-	2	0	DSC2	26902094	1.000000	0.71417	0.132000	0.22025	0.250000	0.25880	6.207000	0.72159	2.941000	0.99782	0.655000	0.94253	TCG	DSC2	-	pfam_Cadherin_cytoplasmic-dom,prints_Desmo_cadherin	ENSG00000134755		0.423	DSC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSC2	HGNC	protein_coding	OTTHUMT00000254943.1	71	0.00	0	G	NM_004949		28648096	28648096	-1	no_errors	ENST00000280904	ensembl	human	known	69_37n	missense	43	12.24	6	SNP	0.828	A
DUSP15	128853	genome.wustl.edu	37	20	30436212	30436212	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr20:30436212G>A	ENST00000278979.3	-	10	959	c.883C>T	c.(883-885)Cgc>Tgc	p.R295C	FOXS1_ENST00000375978.3_5'Flank			Q9H1R2	DUS15_HUMAN	dual specificity phosphatase 15	295					positive regulation of JNK cascade (GO:0046330)|protein dephosphorylation (GO:0006470)|regulation of cell proliferation (GO:0042127)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(1)|lung(4)|pancreas(1)|stomach(1)	7			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TGCCTTCAGCGGGTACAAGAA	0.637																																						dbGAP											0													48.0	48.0	48.0					20																	30436212		876	1991	2867	-	-	-	SO:0001583	missense	0				CCDS13193.1, CCDS42862.1	20q11.21	2011-06-09	2005-03-09		ENSG00000149599	ENSG00000149599		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	16236	protein-coding gene	gene with protein product			"""dual specificity phosphatase-like 15"""			15138252	Standard	NM_080611		Approved	bA243J16.6, VHY	uc002wwx.1	Q9H1R2	OTTHUMG00000032182	ENST00000278979.3:c.883C>T	20.37:g.30436212G>A	ENSP00000278979:p.Arg295Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH79|A8MVC8|Q5QP62|Q5QP63|Q5QP65|Q6PGN7|Q8N826|Q9BX24	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,superfamily_SMAD_FHA_domain,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP	p.R295C	ENST00000278979.3	37	c.883		20	.	.	.	.	.	.	.	.	.	.	G	5.814	0.334470	0.11013	.	.	ENSG00000149599	ENST00000278979	T	0.05996	3.36	3.59	-2.09	0.07232	.	.	.	.	.	T	0.04363	0.0120	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.01281	0.0	T	0.41538	-0.9503	8	0.87932	D	0	.	3.4139	0.07368	0.4882:0.0:0.3212:0.1906	.	295	Q9H1R2	DUS15_HUMAN	C	295	ENSP00000278979:R295C	ENSP00000278979:R295C	R	-	1	0	DUSP15	29899873	0.002000	0.14202	0.000000	0.03702	0.009000	0.06853	0.054000	0.14205	-0.272000	0.09259	-0.657000	0.03884	CGC	DUSP15	-	NULL	ENSG00000149599		0.637	DUSP15-004	KNOWN	basic	protein_coding	DUSP15	HGNC	protein_coding	OTTHUMT00000078555.3	39	0.00	0	G	NM_080611		30436212	30436212	-1	no_errors	ENST00000278979	ensembl	human	known	69_37n	missense	23	25.81	8	SNP	0.000	A
ECEL1	9427	genome.wustl.edu	37	2	233347316	233347316	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr2:233347316C>A	ENST00000304546.1	-	11	1898	c.1688G>T	c.(1687-1689)tGg>tTg	p.W563L	ECEL1_ENST00000409941.1_Missense_Mutation_p.W561L	NM_004826.2	NP_004817.2	O95672	ECEL1_HUMAN	endothelin converting enzyme-like 1	563					neuropeptide signaling pathway (GO:0007218)|respiratory system process (GO:0003016)	integral component of plasma membrane (GO:0005887)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;7.17e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000771)|Lung(119;0.00213)|LUSC - Lung squamous cell carcinoma(224;0.00746)		GGGGAGCAGCCACCTGTGGAG	0.622																																						dbGAP											0													64.0	71.0	69.0					2																	233347316		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y16187	CCDS2493.1	2q37.1	2010-09-29			ENSG00000171551	ENSG00000171551			3147	protein-coding gene	gene with protein product	"""damage induced neuronal endopeptidase"""	605896				9931490, 11352565	Standard	NM_004826		Approved	XCE, DINE	uc002vsv.2	O95672	OTTHUMG00000133262	ENST00000304546.1:c.1688G>T	2.37:g.233347316C>A	ENSP00000302051:p.Trp563Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q45UD9|Q53RF9|Q6UW86|Q86TH4|Q9NY95	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.W563L	ENST00000304546.1	37	c.1688	CCDS2493.1	2	.	.	.	.	.	.	.	.	.	.	C	17.76	3.468520	0.63625	.	.	ENSG00000171551	ENST00000304546;ENST00000409941	D;D	0.83673	-1.75;-1.75	5.46	5.46	0.80206	Peptidase M13, neprilysin, C-terminal (1);Metallopeptidase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92280	0.7551	M	0.84773	2.715	0.80722	D	1	D;P	0.89917	1.0;0.78	D;B	0.81914	0.995;0.335	D	0.93136	0.6537	10	0.87932	D	0	-17.605	19.3138	0.94204	0.0:1.0:0.0:0.0	.	561;563	O95672-2;O95672	.;ECEL1_HUMAN	L	563;561	ENSP00000302051:W563L;ENSP00000386333:W561L	ENSP00000302051:W563L	W	-	2	0	ECEL1	233055560	1.000000	0.71417	0.998000	0.56505	0.072000	0.16883	7.784000	0.85713	2.561000	0.86390	0.655000	0.94253	TGG	ECEL1	-	prints_Peptidase_M13_C	ENSG00000171551		0.622	ECEL1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ECEL1	HGNC	protein_coding	OTTHUMT00000257039.2	32	0.00	0	C	NM_004826		233347316	233347316	-1	no_errors	ENST00000304546	ensembl	human	known	69_37n	missense	30	33.33	15	SNP	1.000	A
EXOSC9	5393	genome.wustl.edu	37	4	122725813	122725813	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr4:122725813C>T	ENST00000243498.5	+	5	529	c.421C>T	c.(421-423)Cat>Tat	p.H141Y	EXOSC9_ENST00000509980.1_3'UTR|EXOSC9_ENST00000512454.1_Missense_Mutation_p.H125Y|EXOSC9_ENST00000379663.3_Missense_Mutation_p.H141Y	NM_005033.2	NP_005024.2	Q06265	EXOS9_HUMAN	exosome component 9	141	ARE binding.				exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|immune response (GO:0006955)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear polyadenylation-dependent rRNA catabolic process (GO:0071035)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of cell growth (GO:0030307)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|intermediate filament cytoskeleton (GO:0045111)|nuclear exosome (RNase complex) (GO:0000176)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|AU-rich element binding (GO:0017091)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|urinary_tract(1)	16						TTTATTAAATCATGATGGAAA	0.363																																						dbGAP											0													104.0	104.0	104.0					4																	122725813		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58460	CCDS3722.2, CCDS34057.1	4q27	2010-05-07	2004-06-16	2004-06-18	ENSG00000123737	ENSG00000123737	3.1.13.-		9137	protein-coding gene	gene with protein product	"""polymyositis/scleroderma autoantigen 1 (75kD)"""	606180	"""polymyositis/scleroderma autoantigen 1, 75kDa"""	PMSCL1			Standard	XR_427545		Approved	PM/Scl-75, Rrp45p, RRP45, p5, p6	uc003idz.3	Q06265	OTTHUMG00000128783	ENST00000243498.5:c.421C>T	4.37:g.122725813C>T	ENSP00000243498:p.His141Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q12883|Q4W5P5|Q86Y41|Q86Y48	Missense_Mutation	SNP	pfam_ExoRNase_PH_dom1,pfam_ExoRNase_PH_dom2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ExoRNase_PH_dom2	p.H141Y	ENST00000243498.5	37	c.421	CCDS3722.2	4	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416146	0.83449	.	.	ENSG00000123737	ENST00000243498;ENST00000379663;ENST00000512454	T;T;T	0.63096	-0.02;-0.02;-0.02	5.46	5.46	0.80206	Ribosomal protein S5 domain 2-type fold (1);Exoribonuclease, phosphorolytic domain 1 (1);	0.043439	0.85682	D	0.000000	T	0.73016	0.3533	L	0.37630	1.12	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.961	D;D;P	0.77004	0.989;0.986;0.695	T	0.73161	-0.4070	10	0.52906	T	0.07	-3.2638	19.6664	0.95894	0.0:1.0:0.0:0.0	.	125;141;141	D6RIY6;Q06265;Q06265-2	.;EXOS9_HUMAN;.	Y	141;141;125	ENSP00000243498:H141Y;ENSP00000368984:H141Y;ENSP00000425782:H125Y	ENSP00000243498:H141Y	H	+	1	0	EXOSC9	122945263	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.183000	0.58317	2.723000	0.93209	0.650000	0.86243	CAT	EXOSC9	-	pfam_ExoRNase_PH_dom1,superfamily_Ribosomal_S5_D2-typ_fold	ENSG00000123737		0.363	EXOSC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOSC9	HGNC	protein_coding	OTTHUMT00000250708.2	58	0.00	0	C	NM_005033		122725813	122725813	+1	no_errors	ENST00000379663	ensembl	human	known	69_37n	missense	55	21.43	15	SNP	1.000	T
F5	2153	genome.wustl.edu	37	1	169494107	169494107	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr1:169494107G>T	ENST00000367797.3	-	19	5957	c.5756C>A	c.(5755-5757)tCt>tAt	p.S1919Y	F5_ENST00000367796.3_Missense_Mutation_p.S1924Y	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1919	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CTGTGAATCAGATATGATACC	0.378																																						dbGAP											0													126.0	110.0	116.0					1																	169494107		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.5756C>A	1.37:g.169494107G>T	ENSP00000356771:p.Ser1919Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S1924Y	ENST00000367797.3	37	c.5771	CCDS1281.1	1	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738712	0.69304	.	.	ENSG00000198734	ENST00000367797;ENST00000367796	D;D	0.98937	-5.25;-5.25	5.88	3.96	0.45880	Coagulation factor 5/8 C-terminal type domain (2);Galactose-binding domain-like (1);	0.947543	0.08960	N	0.868784	D	0.97028	0.9029	M	0.73962	2.25	0.27250	N	0.958905	D	0.54397	0.966	P	0.47299	0.543	D	0.93901	0.7188	9	0.62326	D	0.03	-2.9512	6.4561	0.21930	0.1326:0.0:0.6987:0.1688	.	1919	P12259	FA5_HUMAN	Y	1919;1924	ENSP00000356771:S1919Y;ENSP00000356770:S1924Y	ENSP00000356770:S1924Y	S	-	2	0	F5	167760731	0.997000	0.39634	0.982000	0.44146	0.995000	0.86356	1.641000	0.37197	1.431000	0.47355	0.655000	0.94253	TCT	F5	-	superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000198734		0.378	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	44	0.00	0	G	NM_000130		169494107	169494107	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.984	T
FGF18	8817	genome.wustl.edu	37	5	170863146	170863146	+	Missense_Mutation	SNP	A	A	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr5:170863146A>G	ENST00000274625.5	+	3	663	c.119A>G	c.(118-120)cAg>cGg	p.Q40R		NM_003862.2	NP_003853.1	O76093	FGF18_HUMAN	fibroblast growth factor 18	40					anatomical structure morphogenesis (GO:0009653)|angiogenesis (GO:0001525)|cell-cell signaling (GO:0007267)|chondrocyte development (GO:0002063)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intramembranous ossification (GO:0001957)|lung development (GO:0030324)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|nucleolus (GO:0005730)	growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(1)	9	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GTGGAGAACCAGACGCGGGCT	0.627																																						dbGAP											0													70.0	63.0	65.0					5																	170863146		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007422	CCDS4378.1	5q34	2008-02-05			ENSG00000156427	ENSG00000156427			3674	protein-coding gene	gene with protein product		603726				9660775, 9742123	Standard	NM_003862		Approved	FGF-18, ZFGF5	uc003mbk.3	O76093	OTTHUMG00000130464	ENST00000274625.5:c.119A>G	5.37:g.170863146A>G	ENSP00000274625:p.Gln40Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQL7|Q6UWF1	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	p.Q40R	ENST00000274625.5	37	c.119	CCDS4378.1	5	.	.	.	.	.	.	.	.	.	.	A	25.8	4.676746	0.88445	.	.	ENSG00000156427	ENST00000274625	D	0.88277	-2.36	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.90577	0.7046	L	0.43923	1.385	0.58432	D	0.999997	D	0.76494	0.999	P	0.62649	0.905	D	0.90602	0.4545	10	0.51188	T	0.08	-0.6029	12.4051	0.55434	1.0:0.0:0.0:0.0	.	40	O76093	FGF18_HUMAN	R	40	ENSP00000274625:Q40R	ENSP00000274625:Q40R	Q	+	2	0	FGF18	170795751	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.771000	0.74996	1.763000	0.52060	0.482000	0.46254	CAG	FGF18	-	superfamily_Cytokine_IL1-like	ENSG00000156427		0.627	FGF18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF18	HGNC	protein_coding	OTTHUMT00000252857.2	41	0.00	0	A	NM_033649, NM_003862		170863146	170863146	+1	no_errors	ENST00000274625	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	1.000	G
FSCN2	25794	genome.wustl.edu	37	17	79495875	79495875	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:79495875G>A	ENST00000417245.2	+	1	454	c.318G>A	c.(316-318)ccG>ccA	p.P106P	RP13-766D20.2_ENST00000430912.1_RNA|RP13-766D20.2_ENST00000442532.1_RNA|FSCN2_ENST00000334850.7_Silent_p.P106P	NM_001077182.2|NM_012418.3	NP_001070650.1|NP_036550.1	O14926	FSCN2_HUMAN	fascin actin-bundling protein 2, retinal	106					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|anatomical structure morphogenesis (GO:0009653)|eye photoreceptor cell development (GO:0042462)|visual perception (GO:0007601)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|stereocilium (GO:0032420)	actin binding (GO:0003779)|actin filament binding (GO:0051015)			endometrium(1)|lung(1)|prostate(1)|urinary_tract(1)	4	all_neural(118;0.0878)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0371)			GGTCCGAGCCGCACGGCCGCT	0.721																																						dbGAP											0													4.0	5.0	5.0					17																	79495875		2022	4056	6078	-	-	-	SO:0001819	synonymous_variant	0			AF030165	CCDS45810.1, CCDS45811.1	17q25	2014-02-03	2014-02-03		ENSG00000186765	ENSG00000186765		"""Fascins"""	3960	protein-coding gene	gene with protein product		607643	"""fascin (Strongylocentrotus purpuratus) homolog 2 (actin-bundling protein, retinal)"", ""fascin homolog 2, actin-bundling protein, retinal (Strongylocentrotus purpuratus)"""			10234509	Standard	NM_012418		Approved	RP30, RFSN	uc010wuo.2	O14926	OTTHUMG00000167477	ENST00000417245.2:c.318G>A	17.37:g.79495875G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVC4|A8MRA6	Silent	SNP	pfam_Fascin-domain,superfamily_Actin_cross-linking	p.P106	ENST00000417245.2	37	c.318	CCDS45811.1	17																																																																																			FSCN2	-	pfam_Fascin-domain,superfamily_Actin_cross-linking	ENSG00000186765		0.721	FSCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCN2	HGNC	protein_coding	OTTHUMT00000394746.1	19	0.00	0	G	NM_012418		79495875	79495875	+1	no_errors	ENST00000334850	ensembl	human	known	69_37n	silent	5	58.33	7	SNP	0.602	A
FYB	2533	genome.wustl.edu	37	5	39203057	39203057	+	Silent	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr5:39203057C>T	ENST00000351578.6	-	2	196	c.6G>A	c.(4-6)gcG>gcA	p.A2A	FYB_ENST00000505428.1_Silent_p.A2A|FYB_ENST00000512982.1_Silent_p.A2A|FYB_ENST00000540520.1_Silent_p.A12A|FYB_ENST00000515010.1_Silent_p.A2A	NM_199335.3	NP_955367.1	O15117	FYB_HUMAN	FYN binding protein	2					immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|NLS-bearing protein import into nucleus (GO:0006607)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	receptor binding (GO:0005102)			endometrium(2)|kidney(4)|large_intestine(6)|liver(1)|lung(29)|ovary(2)|upper_aerodigestive_tract(1)	45	all_lung(31;0.000343)		Epithelial(62;0.235)			TGTTATATTTCGCCATGAGGG	0.433																																						dbGAP											0													86.0	80.0	82.0					5																	39203057		1858	4097	5955	-	-	-	SO:0001819	synonymous_variant	0			U93049	CCDS47200.1, CCDS54848.1	5p13.1	2012-05-04	2010-05-04		ENSG00000082074	ENSG00000082074			4036	protein-coding gene	gene with protein product		602731	"""FYN-binding protein (FYB-120/130)"""			9115214, 9207119	Standard	NM_001465		Approved	SLAP-130, FYB-120/130	uc011cpl.2	O15117	OTTHUMG00000162071	ENST00000351578.6:c.6G>A	5.37:g.39203057C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y8|B4DLN2|E9PBV9|O00359|Q9NZI9	Silent	SNP	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain	p.A12	ENST00000351578.6	37	c.36	CCDS47200.1	5																																																																																			FYB	-	NULL	ENSG00000082074		0.433	FYB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FYB	HGNC	protein_coding	OTTHUMT00000367098.1	68	0.00	0	C	NM_001465		39203057	39203057	-1	no_errors	ENST00000540520	ensembl	human	known	69_37n	silent	75	22.68	22	SNP	1.000	T
GABRE	2564	genome.wustl.edu	37	X	151129811	151129811	+	Missense_Mutation	SNP	A	A	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chrX:151129811A>T	ENST00000370328.3	-	5	643	c.590T>A	c.(589-591)cTc>cAc	p.L197H	MIR452_ENST00000385020.1_RNA|GABRE_ENST00000370325.1_Missense_Mutation_p.L197H|MIR224_ENST00000384889.1_RNA|GABRE_ENST00000393914.3_Intron	NM_004961.3	NP_004952.2	P78334	GBRE_HUMAN	gamma-aminobutyric acid (GABA) A receptor, epsilon	197					gamma-aminobutyric acid signaling pathway (GO:0007214)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|skin(1)	27	Acute lymphoblastic leukemia(192;6.56e-05)				Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	GAGCATGTGGAGTGAGCATCC	0.517																																						dbGAP											0													132.0	119.0	124.0					X																	151129811		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y09765	CCDS14703.1	Xq28	2012-06-22			ENSG00000102287	ENSG00000102287		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4085	protein-coding gene	gene with protein product	"""GABA(A) receptor, epsilon"""	300093				9039914, 9084408	Standard	NM_004961		Approved		uc004ffi.3	P78334	OTTHUMG00000024176	ENST00000370328.3:c.590T>A	X.37:g.151129811A>T	ENSP00000359353:p.Leu197His	Somatic		WXS	Illumina GAIIx	Phase_IV	E7ET93|O15345|O15346|Q6PCD2|Q99520	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAe_rcpt,prints_GABAAa_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.L197H	ENST00000370328.3	37	c.590	CCDS14703.1	X	.	.	.	.	.	.	.	.	.	.	A	18.79	3.698612	0.68501	.	.	ENSG00000102287	ENST00000370328;ENST00000370325	T;T	0.81330	-1.48;-1.48	5.6	5.6	0.85130	Neurotransmitter-gated ion-channel ligand-binding (3);Neurotransmitter-gated ion-channel, conserved site (1);	0.147205	0.31381	N	0.007755	D	0.88474	0.6446	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	D	0.89656	0.3873	10	0.87932	D	0	.	12.5806	0.56388	1.0:0.0:0.0:0.0	.	197	P78334	GBRE_HUMAN	H	197	ENSP00000359353:L197H;ENSP00000359350:L197H	ENSP00000359350:L197H	L	-	2	0	GABRE	150880467	0.998000	0.40836	0.110000	0.21437	0.565000	0.35776	8.660000	0.91121	1.878000	0.54408	0.486000	0.48141	CTC	GABRE	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Neur_channel,tigrfam_Neur_channel	ENSG00000102287		0.517	GABRE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRE	HGNC	protein_coding	OTTHUMT00000060903.1	30	0.00	0	A	NM_004961, NM_021990, NM_021984		151129811	151129811	-1	no_errors	ENST00000370328	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	0.933	T
GALNT16	57452	genome.wustl.edu	37	14	69806254	69806254	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr14:69806254C>T	ENST00000337827.4	+	11	1432	c.1105C>T	c.(1105-1107)Cgc>Tgc	p.R369C	GALNT16_ENST00000448469.3_Missense_Mutation_p.R369C|GALNT16_ENST00000553669.1_Missense_Mutation_p.R369C	NM_001168368.1|NM_020692.2	NP_001161840.1|NP_065743.2	Q8N428	GLT16_HUMAN	polypeptide N-acetylgalactosaminyltransferase 16	369					protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)										GAATACTAAGCGCACTGCAGA	0.527																																						dbGAP											0													104.0	102.0	103.0					14																	69806254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032956	CCDS32107.1	14q24.1	2014-03-13	2014-03-13	2013-01-25	ENSG00000100626	ENSG00000100626	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23233	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 16"""	615132	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 1"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 16"""	GALNTL1		10574461, 22186971	Standard	NM_020692		Approved	KIAA1130, GalNAc-T16	uc010aqu.2	Q8N428	OTTHUMG00000171231	ENST00000337827.4:c.1105C>T	14.37:g.69806254C>T	ENSP00000336729:p.Arg369Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMG3|Q58A55|Q9ULT9	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R369C	ENST00000337827.4	37	c.1105	CCDS32107.1	14	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900343	0.72754	.	.	ENSG00000100626	ENST00000337827;ENST00000448469;ENST00000553669	T;T;T	0.71103	-0.54;-0.54;-0.54	5.14	4.24	0.50183	.	0.000000	0.85682	D	0.000000	D	0.90741	0.7094	H	0.99211	4.47	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94347	0.7576	10	0.87932	D	0	.	15.1614	0.72788	0.1418:0.8582:0.0:0.0	.	369;369	Q8N428;Q58A55	GLTL1_HUMAN;.	C	369	ENSP00000336729:R369C;ENSP00000402970:R369C;ENSP00000451200:R369C	ENSP00000336729:R369C	R	+	1	0	GALNTL1	68876007	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	3.565000	0.53798	1.141000	0.42275	0.462000	0.41574	CGC	GALNTL1	-	NULL	ENSG00000100626		0.527	GALNT16-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL1	HGNC	protein_coding	OTTHUMT00000412434.1	77	0.00	0	C	NM_001168368		69806254	69806254	+1	no_errors	ENST00000337827	ensembl	human	known	69_37n	missense	29	34.09	15	SNP	1.000	T
GCLM	2730	genome.wustl.edu	37	1	94363437	94363437	+	Missense_Mutation	SNP	C	C	G	rs12062047		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr1:94363437C>G	ENST00000370238.3	-	4	541	c.295G>C	c.(295-297)Gaa>Caa	p.E99Q	GCLM_ENST00000467772.1_5'UTR	NM_002061.2	NP_002052.1	P48507	GSH0_HUMAN	glutamate-cysteine ligase, modifier subunit	99					apoptotic mitochondrial changes (GO:0008637)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of glutamate-cysteine ligase activity (GO:0035229)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	glutamate-cysteine ligase activity (GO:0004357)|glutamate-cysteine ligase catalytic subunit binding (GO:0035226)			endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10		all_lung(203;0.000815)|Lung NSC(277;0.00363)		all cancers(265;0.00566)|GBM - Glioblastoma multiforme(16;0.0203)|Epithelial(280;0.131)	L-Cysteine(DB00151)	GAGTTTGATTCTACAATGAAC	0.299																																						dbGAP											0													77.0	75.0	76.0					1																	94363437		2203	4291	6494	-	-	-	SO:0001583	missense	0			L35546	CCDS746.1	1p21	2008-02-05			ENSG00000023909	ENSG00000023909	6.3.2.2		4312	protein-coding gene	gene with protein product	"""gamma-glutamylcysteine synthetase"""	601176		GLCLR		7826375	Standard	NM_002061		Approved		uc001dqg.1	P48507	OTTHUMG00000010562	ENST00000370238.3:c.295G>C	1.37:g.94363437C>G	ENSP00000359258:p.Glu99Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K334|D3DT45|M5A959|Q6FHC1|Q9NPX9|Q9NU74	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.E99Q	ENST00000370238.3	37	c.295	CCDS746.1	1	.	.	.	.	.	.	.	.	.	.	C	12.55	1.972232	0.34754	.	.	ENSG00000023909	ENST00000370238	T	0.25414	1.8	5.18	5.18	0.71444	NADP-dependent oxidoreductase domain (3);	0.339525	0.35067	N	0.003479	T	0.09774	0.0240	L	0.38531	1.155	0.25831	N	0.984161	B	0.23937	0.094	B	0.26693	0.072	T	0.07501	-1.0769	10	0.28530	T	0.3	.	12.4331	0.55584	0.0:0.9232:0.0:0.0768	.	99	P48507	GSH0_HUMAN	Q	99	ENSP00000359258:E99Q	ENSP00000359258:E99Q	E	-	1	0	GCLM	94136025	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.791000	0.55469	2.560000	0.86352	0.650000	0.86243	GAA	GCLM	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000023909		0.299	GCLM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLM	HGNC	protein_coding	OTTHUMT00000029169.1	38	0.00	0	C	NM_002061		94363437	94363437	-1	no_errors	ENST00000370238	ensembl	human	known	69_37n	missense	20	93.61	293	SNP	1.000	G
GEMIN4	50628	genome.wustl.edu	37	17	649083	649085	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:649083_649085delCCA	ENST00000319004.5	-	2	2316_2318	c.2198_2200delTGG	c.(2197-2202)ctggag>cag	p.733_734LE>Q	GEMIN4_ENST00000576778.1_In_Frame_Del_p.722_723LE>Q	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	733	Leucine-zipper. {ECO:0000255}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CACAGGAGCTCCAGGATATGGAT	0.532																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.2198_2200delTGG	17.37:g.649083_649085delCCA	ENSP00000321706:p.Leu733_Glu734delinsGln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZS7|Q9UG32|Q9Y4Q2	In_Frame_Del	DEL	NULL	p.LE733in_frame_delQ	ENST00000319004.5	37	c.2200_2198	CCDS45559.1	17																																																																																			GEMIN4	-	NULL	ENSG00000179409		0.532	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1	30	0.00	0	CCA	NM_015721		649083	649085	-1	no_errors	ENST00000319004	ensembl	human	known	69_37n	in_frame_del	18	14.29	3	DEL	0.094:0.129:0.999	-
GEMIN4	50628	genome.wustl.edu	37	17	649104	649104	+	Frame_Shift_Del	DEL	C	C	-			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:649104delC	ENST00000319004.5	-	2	2297	c.2179delG	c.(2179-2181)gatfs	p.D727fs	GEMIN4_ENST00000576778.1_Frame_Shift_Del_p.D716fs	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	727	Leucine-zipper. {ECO:0000255}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		ATCGCTAGATCCTTCCTATCC	0.542																																						dbGAP											0													23.0	24.0	24.0					17																	649104		1938	4149	6087	-	-	-	SO:0001589	frameshift_variant	0			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.2179delG	17.37:g.649104delC	ENSP00000321706:p.Asp727fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZS7|Q9UG32|Q9Y4Q2	Frame_Shift_Del	DEL	NULL	p.D727fs	ENST00000319004.5	37	c.2179	CCDS45559.1	17																																																																																			GEMIN4	-	NULL	ENSG00000179409		0.542	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1	30	0.00	0	C	NM_015721		649104	649104	-1	no_errors	ENST00000319004	ensembl	human	known	69_37n	frame_shift_del	11	21.43	3	DEL	1.000	-
GFPT2	9945	genome.wustl.edu	37	5	179740926	179740927	+	Frame_Shift_Ins	INS	-	-	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr5:179740926_179740927insA	ENST00000253778.8	-	14	1480_1481	c.1311_1312insT	c.(1309-1314)tgtaagfs	p.K438fs	GFPT2_ENST00000520165.1_5'Flank	NM_005110.2	NP_005101.1	O94808	GFPT2_HUMAN	glutamine-fructose-6-phosphate transaminase 2	438	SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glutamine metabolic process (GO:0006541)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)	carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	34	all_cancers(89;4.97e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	Medulloblastoma(196;0.0392)|all_neural(177;0.0529)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		L-Glutamine(DB00130)	CCGCGGTCCTTACAGTAGCGCA	0.708																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB016789	CCDS43411.1	5q	2008-07-18			ENSG00000131459	ENSG00000131459			4242	protein-coding gene	gene with protein product	"""glutamine: fructose-6-phosphate aminotransferase 2"""	603865				10198162	Standard	NM_005110		Approved	GFAT2	uc003mlw.1	O94808	OTTHUMG00000163442	ENST00000253778.8:c.1312dupT	5.37:g.179740927_179740927dupA	ENSP00000253778:p.Lys438fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XM2|Q9BWS4	Frame_Shift_Ins	INS	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.K437fs	ENST00000253778.8	37	c.1312_1311	CCDS43411.1	5																																																																																			GFPT2	-	pfam_SIS,tigrfam_GlmS_trans	ENSG00000131459		0.708	GFPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFPT2	HGNC	protein_coding	OTTHUMT00000373444.4	48	0.00	0	-	NM_005110		179740926	179740927	-1	no_errors	ENST00000253778	ensembl	human	known	69_37n	frame_shift_ins	11	15.38	2	INS	1.000:0.889	A
GLUD2	2747	genome.wustl.edu	37	X	120181966	120181966	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chrX:120181966G>A	ENST00000328078.1	+	1	505	c.428G>A	c.(427-429)cGc>cAc	p.R143H		NM_012084.3	NP_036216.2	P49448	DHE4_HUMAN	glutamate dehydrogenase 2	143					glutamate biosynthetic process (GO:0006537)|glutamate catabolic process (GO:0006538)|glutamate metabolic process (GO:0006536)|oxidation-reduction process (GO:0055114)	mitochondrion (GO:0005739)	ADP binding (GO:0043531)|glutamate dehydrogenase (NAD+) activity (GO:0004352)|glutamate dehydrogenase [NAD(P)+] activity (GO:0004353)|GTP binding (GO:0005525)|leucine binding (GO:0070728)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|urinary_tract(1)	38						AGCCAGCACCGCACGCCCTGC	0.567																																						dbGAP											0													75.0	56.0	62.0					X																	120181966		2202	4300	6502	-	-	-	SO:0001583	missense	0			U08997	CCDS14603.1	Xq24-q25	2008-02-05	2003-02-24	2003-02-28	ENSG00000182890	ENSG00000182890			4336	protein-coding gene	gene with protein product		300144	"""glutamate dehydrogenase pseudogene 1"""	GLUDP1		8207021, 9109504	Standard	NM_012084		Approved		uc004eto.3	P49448	OTTHUMG00000022320	ENST00000328078.1:c.428G>A	X.37:g.120181966G>A	ENSP00000327589:p.Arg143His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8G0|Q9UDQ4	Missense_Mutation	SNP	pfam_Glu/Leu/Phe/Val_DH_C,pfam_Glu/Leu/Phe/Val_DH_dimer_dom,smart_Glu/Leu/Phe/Val_DH_C,prints_Glu/Leu/Phe/Val_DH	p.R143H	ENST00000328078.1	37	c.428	CCDS14603.1	X	.	.	.	.	.	.	.	.	.	.	G	17.67	3.447586	0.63178	.	.	ENSG00000182890	ENST00000328078	D	0.97016	-4.21	1.8	0.91	0.19337	Glutamate/phenylalanine/leucine/valine dehydrogenase, dimerisation domain (1);	0.059193	0.64402	D	0.000004	D	0.97390	0.9146	H	0.97491	4.015	0.52501	D	0.999954	P	0.48640	0.913	P	0.49226	0.603	D	0.95406	0.8494	10	0.87932	D	0	.	6.0866	0.19970	0.1851:0.0:0.8149:0.0	.	143	P49448	DHE4_HUMAN	H	143	ENSP00000327589:R143H	ENSP00000327589:R143H	R	+	2	0	GLUD2	120009647	1.000000	0.71417	0.963000	0.40424	0.926000	0.56050	4.515000	0.60489	0.259000	0.21709	-0.412000	0.06146	CGC	GLUD2	-	pfam_Glu/Leu/Phe/Val_DH_dimer_dom	ENSG00000182890		0.567	GLUD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLUD2	HGNC	protein_coding	OTTHUMT00000058133.1	157	0.00	0	G	NM_012084		120181966	120181966	+1	no_errors	ENST00000328078	ensembl	human	known	69_37n	missense	129	25.00	43	SNP	1.000	A
GOT2	2806	genome.wustl.edu	37	16	58742155	58742155	+	Missense_Mutation	SNP	C	C	G	rs200575445		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr16:58742155C>G	ENST00000245206.5	-	10	1341	c.1213G>C	c.(1213-1215)Gat>Cat	p.D405H	GOT2_ENST00000434819.2_Missense_Mutation_p.D362H	NM_002080.2	NP_002071.2	P00505	AATM_HUMAN	glutamic-oxaloacetic transaminase 2, mitochondrial	405					2-oxoglutarate metabolic process (GO:0006103)|4-hydroxyproline catabolic process (GO:0019470)|aspartate biosynthetic process (GO:0006532)|aspartate catabolic process (GO:0006533)|aspartate metabolic process (GO:0006531)|carbohydrate metabolic process (GO:0005975)|cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|fatty acid transport (GO:0015908)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glutamate catabolic process to 2-oxoglutarate (GO:0019551)|glutamate catabolic process to aspartate (GO:0019550)|glutamate metabolic process (GO:0006536)|oxaloacetate metabolic process (GO:0006107)|response to ethanol (GO:0045471)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	kynurenine-oxoglutarate transaminase activity (GO:0016212)|L-aspartate:2-oxoglutarate aminotransferase activity (GO:0004069)|L-phenylalanine:2-oxoglutarate aminotransferase activity (GO:0080130)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|prostate(2)|skin(1)	22					L-Aspartic Acid(DB00128)	ATGCGGCCATCTTTTGTCATG	0.567																																						dbGAP											0													71.0	67.0	68.0					16																	58742155		2198	4300	6498	-	-	-	SO:0001583	missense	0				CCDS10801.1, CCDS67045.1	16q21	2013-05-29	2013-05-29		ENSG00000125166	ENSG00000125166	2.6.1.1		4433	protein-coding gene	gene with protein product	"""kynurenine aminotransferase IV"", ""aspartate aminotransferase 2"", ""aspartate transaminase 2"""	138150	"""glutamic-oxaloacetic transaminase 2, mitochondrial (aspartate aminotransferase 2)"""			17442055	Standard	NM_002080		Approved	mitAAT, KATIV, KAT4	uc002eof.1	P00505	OTTHUMG00000133769	ENST00000245206.5:c.1213G>C	16.37:g.58742155C>G	ENSP00000245206:p.Asp405His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJA6|E7ERW2|Q53FL3|Q9BWA3	Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_Asp_trans	p.D405H	ENST00000245206.5	37	c.1213	CCDS10801.1	16	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551296	0.86127	.	.	ENSG00000125166	ENST00000245206;ENST00000434819	D;D	0.97328	-4.34;-4.34	5.7	5.7	0.88788	Aminotransferase, class I/classII (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.98994	0.9657	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.81914	0.995;0.983	D	0.99453	1.0941	9	.	.	.	0.9697	18.8056	0.92035	0.0:1.0:0.0:0.0	.	362;405	E7ERW2;P00505	.;AATM_HUMAN	H	405;362	ENSP00000245206:D405H;ENSP00000394100:D362H	.	D	-	1	0	GOT2	57299656	1.000000	0.71417	0.996000	0.52242	0.757000	0.42996	7.670000	0.83925	2.682000	0.91365	0.655000	0.94253	GAT	GOT2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000125166		0.567	GOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOT2	HGNC	protein_coding	OTTHUMT00000258289.3	25	0.00	0	C			58742155	58742155	-1	no_errors	ENST00000245206	ensembl	human	known	69_37n	missense	21	27.59	8	SNP	1.000	G
GP6	51206	genome.wustl.edu	37	19	55526454	55526454	+	Silent	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:55526454C>A	ENST00000417454.1	-	8	882	c.855G>T	c.(853-855)ggG>ggT	p.G285G	GP6_ENST00000310373.3_Missense_Mutation_p.V287F|CTC-550B14.7_ENST00000586845.1_RNA|GP6_ENST00000333884.2_Silent_p.G267G|CTC-550B14.7_ENST00000593060.1_RNA	NM_016363.4	NP_057447	Q9HCN6	GPVI_HUMAN	glycoprotein VI (platelet)	285					blood coagulation (GO:0007596)|enzyme linked receptor protein signaling pathway (GO:0007167)|leukocyte migration (GO:0050900)|platelet activation (GO:0030168)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	collagen binding (GO:0005518)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19			BRCA - Breast invasive adenocarcinoma(297;0.156)	GBM - Glioblastoma multiforme(193;0.0515)		CTGCCAGAAACCCCGCCAGGA	0.667																																						dbGAP											0													11.0	13.0	12.0					19																	55526454		1959	4168	6127	-	-	-	SO:0001819	synonymous_variant	0			AB035073	CCDS42626.1, CCDS46184.1, CCDS58678.1	19q13.4	2013-01-29			ENSG00000088053	ENSG00000088053		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14388	protein-coding gene	gene with protein product		605546				11027634	Standard	NM_001083899		Approved	GPVI	uc002qil.3	Q9HCN6	OTTHUMG00000159709	ENST00000417454.1:c.855G>T	19.37:g.55526454C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HCN7|Q9UIF2	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2	p.V287F	ENST00000417454.1	37	c.859	CCDS46184.1	19	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239584	0.39598	.	.	ENSG00000088053	ENST00000310373	T	0.00561	6.59	3.16	-1.69	0.08186	.	.	.	.	.	T	0.00356	0.0011	.	.	.	0.09310	N	0.999997	B	0.28636	0.218	B	0.21917	0.037	T	0.42766	-0.9432	8	0.59425	D	0.04	.	2.8704	0.05615	0.3774:0.3942:0.0:0.2284	.	287	Q9HCN6-3	.	F	287	ENSP00000308782:V287F	ENSP00000308782:V287F	V	-	1	0	GP6	60218266	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-1.007000	0.03667	-0.213000	0.10094	-0.142000	0.14014	GTT	GP6	-	NULL	ENSG00000088053		0.667	GP6-001	KNOWN	basic|CCDS	protein_coding	GP6	HGNC	protein_coding	OTTHUMT00000357006.1	55	0.00	0	C			55526454	55526454	-1	no_errors	ENST00000310373	ensembl	human	known	69_37n	missense	34	24.44	11	SNP	0.000	A
HERC2P2	400322	genome.wustl.edu	37	15	23282925	23282925	+	RNA	SNP	G	G	T	rs148730893		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr15:23282925G>T	ENST00000560464.1	-	0	5325									hect domain and RLD 2 pseudogene 2																		GTGGATGAAAGCTTTAAAACT	0.443																																						dbGAP											0																																										-	-	-			0			AF041080		15q11.2	2014-03-18			ENSG00000140181				4870	pseudogene	pseudogene						9730612	Standard	NR_002824		Approved	D15F37S3	uc001yvq.2		OTTHUMG00000171926		15.37:g.23282925G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000560464.1	37	NULL		15																																																																																			HERC2P2	-	-	ENSG00000140181		0.443	HERC2P2-001	KNOWN	basic	processed_transcript	HERC2P2	HGNC	pseudogene	OTTHUMT00000415936.1	19	0.00	0	G			23282925	23282925	-1	no_errors	ENST00000560464	ensembl	human	known	69_37n	rna	15	31.82	7	SNP	0.971	T
HNF1A	6927	genome.wustl.edu	37	12	121434696	121434696	+	Missense_Mutation	SNP	T	T	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr12:121434696T>A	ENST00000402929.1	+	6	1595	c.1460T>A	c.(1459-1461)aTc>aAc	p.I487N	HNF1A_ENST00000257555.6_Intron|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000541395.1_Intron|HNF1A_ENST00000544413.1_Intron|HNF1A_ENST00000543427.1_Missense_Mutation_p.I370N|HNF1A_ENST00000400024.2_Intron			P20823	HNF1A_HUMAN	HNF1 homeobox A	0			S -> N (in dbSNP:rs2464196). {ECO:0000269|PubMed:9112026, ECO:0000269|PubMed:9133564, ECO:0000269|PubMed:9287055, ECO:0000269|PubMed:9604876, ECO:0000269|PubMed:9621514, ECO:0000269|Ref.6}.		glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ctgtgctacatcagtgatacc	0.473									Hepatic Adenoma, Familial Clustering of																													dbGAP											0																																										-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000402929.1:c.1460T>A	12.37:g.121434696T>A	ENSP00000475300:p.Ile487Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Lambda_DNA-bd_dom,smart_Homeodomain,pfscan_Homeodomain	p.I370N	ENST00000402929.1	37	c.1109		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	8.264|8.264	0.811913|0.811913	0.16537|0.16537	.|.	.|.	ENSG00000135100|ENSG00000135100	ENST00000543427|ENST00000344370	D|.	0.99900|.	-7.63|.	2.95|2.95	-1.95|-1.95	0.07548|0.07548	.|.	.|.	.|.	.|.	.|.	T|T	0.34832|0.34832	0.0911|0.0911	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.37384|0.37384	-0.9708|-0.9708	6|5	0.46703|0.40728	T|T	0.11|0.16	.|.	7.6004|7.6004	0.28073|0.28073	0.0:0.5929:0.0:0.4071|0.0:0.5929:0.0:0.4071	.|.	.|.	.|.	.|.	N|T	370|487	ENSP00000439721:I370N|.	ENSP00000439721:I370N|ENSP00000342683:S487T	I|S	+|+	2|1	0|0	HNF1A|HNF1A	119919079|119919079	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.014000|0.014000	0.08584|0.08584	-0.520000|-0.520000	0.06252|0.06252	-0.429000|-0.429000	0.07329|0.07329	0.451000|0.451000	0.29950|0.29950	ATC|TCA	HNF1A	-	NULL	ENSG00000135100		0.473	HNF1A-003	PUTATIVE	basic	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320959.3	34	0.00	0	T	NM_000545		121434696	121434696	+1	no_errors	ENST00000543427	ensembl	human	known	69_37n	missense	8	55.56	10	SNP	0.000	A
HOXA3	3200	genome.wustl.edu	37	7	27155873	27155873	+	Intron	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr7:27155873G>A	ENST00000396352.4	-	1	80				HOXA-AS2_ENST00000518046.1_RNA|HOXA3_ENST00000317201.2_Intron|HOXA-AS2_ENST00000518088.1_RNA|HOXA-AS2_ENST00000593438.1_RNA|HOXA-AS2_ENST00000517635.2_RNA|HOXA3_ENST00000521401.1_Intron|HOXA-AS2_ENST00000522193.1_RNA	NM_030661.4	NP_109377.1	O43365	HXA3_HUMAN	homeobox A3						angiogenesis (GO:0001525)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(18)|skin(1)	29						AAAGGTGCCCGTGGTGTCTTT	0.547																																					Esophageal Squamous(136;1368 1743 5685 7935 50360)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS5404.1	7p15.2	2011-06-20	2005-12-22		ENSG00000105997	ENSG00000105997		"""Homeoboxes / ANTP class : HOXL subclass"""	5104	protein-coding gene	gene with protein product		142954	"""homeo box A3"""	HOX1E, HOX1		1973146, 1358459	Standard	XM_005249730		Approved		uc011jzl.2	O43365	OTTHUMG00000023209	ENST00000396352.4:c.119+3261C>T	7.37:g.27155873G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D181	RNA	SNP	-	NULL	ENST00000396352.4	37	NULL	CCDS5404.1	7																																																																																			HOXA-AS2	-	-	ENSG00000253552		0.547	HOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA-AS2	HGNC	protein_coding	OTTHUMT00000358708.2	48	0.00	0	G			27155873	27155873	+1	no_errors	ENST00000517635	ensembl	human	known	69_37n	rna	37	48.61	35	SNP	0.004	A
HS3ST2	9956	genome.wustl.edu	37	16	22926804	22926805	+	Missense_Mutation	DNP	TA	TA	AT			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T|A	T|A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr16:22926804_22926805TA>AT	ENST00000261374.3	+	2	1459_1460	c.1025_1026TA>AT	c.(1024-1026)aTA>aAT	p.I342N		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	342					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		CCTGAAGTGATAGACCAGCTCC	0.436																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	Exception_encountered	16.37:g.22926804_22926805delinsAT	ENSP00000261374:p.Ile342Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LZ1	Missense_Mutation|Silent	SNP	pfam_Sulfotransferase_dom	p.I342K|p.I342	ENST00000261374.3	37	c.1025|c.1026	CCDS10606.1	16																																																																																			HS3ST2	-	pfam_Sulfotransferase_dom	ENSG00000122254		0.436	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST2	HGNC	protein_coding	OTTHUMT00000211598.1	14	0.00	0	T|A	NM_006043		22926804|22926805	22926804|22926805	+1	no_errors	ENST00000261374	ensembl	human	known	69_37n	missense|silent	14	30.00	6	SNP	1.000|0.998	A|T
IGF2R	3482	genome.wustl.edu	37	6	160450647	160450647	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr6:160450647C>T	ENST00000356956.1	+	7	990	c.842C>T	c.(841-843)gCg>gTg	p.A281V		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	281					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)	p.A281V(1)		breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	CACAGCCCTGCGGTGACTATT	0.512																																						dbGAP											1	Substitution - Missense(1)	lung(1)											124.0	103.0	110.0					6																	160450647		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.842C>T	6.37:g.160450647C>T	ENSP00000349437:p.Ala281Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.A281V	ENST00000356956.1	37	c.842	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	C	18.50	3.637195	0.67130	.	.	ENSG00000197081	ENST00000356956	T	0.13778	2.56	4.91	4.91	0.64330	Mannose-6-phosphate receptor, binding (1);	0.000000	0.85682	D	0.000000	T	0.35595	0.0937	M	0.85630	2.765	0.51767	D	0.999937	D	0.89917	1.0	D	0.87578	0.998	T	0.34304	-0.9834	10	0.66056	D	0.02	-30.9266	17.4451	0.87575	0.0:1.0:0.0:0.0	.	281	P11717	MPRI_HUMAN	V	281	ENSP00000349437:A281V	ENSP00000349437:A281V	A	+	2	0	IGF2R	160370637	1.000000	0.71417	0.034000	0.17996	0.159000	0.22180	5.926000	0.70070	2.433000	0.82419	0.655000	0.94253	GCG	IGF2R	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000197081		0.512	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	65	0.00	0	C	NM_000876		160450647	160450647	+1	no_errors	ENST00000356956	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	0.274	T
ILVBL	10994	genome.wustl.edu	37	19	15227044	15227044	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:15227044G>C	ENST00000263383.3	-	12	1529	c.1390C>G	c.(1390-1392)Ctg>Gtg	p.L464V	ILVBL_ENST00000534378.1_Missense_Mutation_p.L357V	NM_006844.3	NP_006835.2	A1L0T0	ILVBL_HUMAN	ilvB (bacterial acetolactate synthase)-like	464						integral component of membrane (GO:0016021)|membrane (GO:0016020)	magnesium ion binding (GO:0000287)|thiamine pyrophosphate binding (GO:0030976)|transferase activity (GO:0016740)			NS(3)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(1)	26						TCCACCACCAGAATTGAGTTG	0.657																																						dbGAP											0													120.0	103.0	109.0					19																	15227044		2202	4300	6502	-	-	-	SO:0001583	missense	0			U61263	CCDS12325.1	19p13.1	2008-07-16			ENSG00000105135	ENSG00000105135			6041	protein-coding gene	gene with protein product	"""acetolactate synthase homolog"""	605770				8954801	Standard	NM_006844		Approved	209L8, AHAS, ILV2H, MGC1269, FLJ39061, MGC19535	uc002nam.3	A1L0T0	OTTHUMG00000165630	ENST00000263383.3:c.1390C>G	19.37:g.15227044G>C	ENSP00000263383:p.Leu464Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O43341|Q96F08|Q99651|Q9BWN5|Q9UEB2	Missense_Mutation	SNP	pfam_Thiamin_PyroP_enz_TPP-bd_dom,pfam_TPP_enzyme-bd_C,pfam_Thiamin_PyroP_enz_cen_dom	p.L464V	ENST00000263383.3	37	c.1390	CCDS12325.1	19	.	.	.	.	.	.	.	.	.	.	G	9.932	1.214982	0.22373	.	.	ENSG00000105135	ENST00000263383	T	0.38240	1.15	5.12	4.09	0.47781	.	0.064264	0.64402	D	0.000019	T	0.32645	0.0836	L	0.61218	1.895	0.40211	D	0.977622	P	0.39326	0.668	B	0.37943	0.261	T	0.09885	-1.0654	10	0.21540	T	0.41	-16.6158	9.5831	0.39499	0.0978:0.0:0.9022:0.0	.	464	A1L0T0	ILVBL_HUMAN	V	464	ENSP00000263383:L464V	ENSP00000263383:L464V	L	-	1	2	ILVBL	15088044	1.000000	0.71417	0.635000	0.29338	0.053000	0.15095	4.434000	0.59935	1.161000	0.42604	0.561000	0.74099	CTG	ILVBL	-	NULL	ENSG00000105135		0.657	ILVBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILVBL	HGNC	protein_coding	OTTHUMT00000385439.1	50	0.00	0	G	NM_006844		15227044	15227044	-1	no_errors	ENST00000263383	ensembl	human	known	69_37n	missense	40	20.00	10	SNP	0.962	C
ITSN2	50618	genome.wustl.edu	37	2	24432862	24432862	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr2:24432862C>T	ENST00000355123.4	-	35	4741	c.4298G>A	c.(4297-4299)cGg>cAg	p.R1433Q	ITSN2_ENST00000361999.3_Missense_Mutation_p.R1406Q	NM_006277.2	NP_006268.2	Q9NZM3	ITSN2_HUMAN	intersectin 2	1433					endocytosis (GO:0006897)|positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(8)|large_intestine(11)|liver(3)|lung(28)|ovary(2)|stomach(1)	61	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAAGAGCTTCCGGGGCCCCAG	0.448																																						dbGAP											0													135.0	133.0	133.0					2																	24432862		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033082	CCDS1710.2, CCDS1711.2, CCDS46230.1	2p23.3	2013-09-19	2002-10-30		ENSG00000198399	ENSG00000198399		"""Rho guanine nucleotide exchange factors"", ""EF-hand domain containing"""	6184	protein-coding gene	gene with protein product	"""SH3 domain protein 1B"", ""SH3P18-like WASP associated protein"""	604464	"""SH3 domain protein 1B"""	SH3D1B		10922467, 11748279	Standard	NM_006277		Approved	KIAA1256, SWAP, SH3P18, SWA, PRO2015	uc002rfe.2	Q9NZM3	OTTHUMG00000090818	ENST00000355123.4:c.4298G>A	2.37:g.24432862C>T	ENSP00000347244:p.Arg1433Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O95062|Q15812|Q9HAK4|Q9NXE6|Q9NYG0|Q9NZM2|Q9ULG4	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,pfam_C2_Ca-dep,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain,prints_p67phox	p.R1433Q	ENST00000355123.4	37	c.4298	CCDS1710.2	2	.	.	.	.	.	.	.	.	.	.	C	22.0	4.227343	0.79576	.	.	ENSG00000198399	ENST00000361999;ENST00000355123;ENST00000380868	T;T;T	0.72282	-0.64;-0.64;-0.64	4.26	4.26	0.50523	Pleckstrin homology-type (1);	0.000000	0.32357	U	0.006218	D	0.86033	0.5836	M	0.86420	2.815	0.53005	D	0.999963	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89343	0.3655	10	0.87932	D	0	.	17.0717	0.86576	0.0:1.0:0.0:0.0	.	1406;1433	Q9NZM3-2;Q9NZM3	.;ITSN2_HUMAN	Q	1406;1433;1406	ENSP00000354561:R1406Q;ENSP00000347244:R1433Q;ENSP00000370250:R1406Q	ENSP00000347244:R1433Q	R	-	2	0	ITSN2	24286366	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.487000	0.81328	2.102000	0.63906	0.455000	0.32223	CGG	ITSN2	-	NULL	ENSG00000198399		0.448	ITSN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ITSN2	HGNC	protein_coding	OTTHUMT00000207620.2	77	0.00	0	C	NM_006277		24432862	24432862	-1	no_errors	ENST00000355123	ensembl	human	known	69_37n	missense	69	16.87	14	SNP	1.000	T
KCNAB2	8514	genome.wustl.edu	37	1	6142261	6142261	+	Nonsense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr1:6142261G>T	ENST00000164247.1	+	6	772	c.208G>T	c.(208-210)Gag>Tag	p.E70*	KCNAB2_ENST00000378097.1_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000378087.3_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000458166.2_Nonsense_Mutation_p.E3*|KCNAB2_ENST00000352527.1_Nonsense_Mutation_p.E56*|KCNAB2_ENST00000378111.1_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000602612.1_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000341524.1_Nonsense_Mutation_p.E70*|KCNAB2_ENST00000378083.3_Nonsense_Mutation_p.E103*|KCNAB2_ENST00000378092.1_Nonsense_Mutation_p.E56*	NM_001199860.1	NP_001186789.1	Q13303	KCAB2_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 2	70					hematopoietic progenitor cell differentiation (GO:0002244)|protein heterooligomerization (GO:0051291)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|juxtaparanode region of axon (GO:0044224)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			large_intestine(1)|lung(4)|skin(3)	8	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;4.88e-22)|all_lung(118;4.21e-08)|Lung NSC(185;9.77e-07)|all_hematologic(16;2.78e-06)|all_neural(13;3.18e-06)|Acute lymphoblastic leukemia(12;0.000272)|Breast(487;0.000496)|Renal(390;0.0007)|Colorectal(325;0.00106)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0393)|Medulloblastoma(700;0.211)		Epithelial(90;6.9e-37)|GBM - Glioblastoma multiforme(13;8.8e-31)|OV - Ovarian serous cystadenocarcinoma(86;1.45e-19)|Colorectal(212;2.46e-07)|COAD - Colon adenocarcinoma(227;2.07e-05)|Kidney(185;7.88e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00131)|BRCA - Breast invasive adenocarcinoma(365;0.00133)|STAD - Stomach adenocarcinoma(132;0.00391)|READ - Rectum adenocarcinoma(331;0.0649)		TCAGATGGCAGAGCAGCTCAT	0.582																																						dbGAP											0													124.0	112.0	116.0					1																	6142261		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U33429	CCDS55.1, CCDS56.1, CCDS55570.1, CCDS55571.1	1p36.3	2008-02-05			ENSG00000069424	ENSG00000069424		"""Potassium channels"", ""Aldo-keto reductases"""	6229	protein-coding gene	gene with protein product		601142				8838324	Standard	NM_003636		Approved	AKR6A5, KCNA2B, HKvbeta2.1, HKvbeta2.2	uc001aly.2	Q13303	OTTHUMG00000000795	ENST00000164247.1:c.208G>T	1.37:g.6142261G>T	ENSP00000164247:p.Glu70*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVM9|A8K1A4|B0AZR7|O43659|Q5TG82|Q5TG83|Q6ZNE4|Q99411	Nonsense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_K_chnl_volt-dep_bsu_KCNAB1,prints_K_chnl_volt-dep_bsu_KCNAB2,prints_K_chnl_volt-dep_bsu_KCNAB-rel,prints_K_chnl_volt-dep_bsu_KCNAB3,tigrfam_K_chnl_volt-dep_bsu_KCNAB	p.E103*	ENST00000164247.1	37	c.307	CCDS55.1	1	.	.	.	.	.	.	.	.	.	.	G	38	6.686903	0.97764	.	.	ENSG00000069424	ENST00000378111;ENST00000378097;ENST00000378092;ENST00000428161;ENST00000389632;ENST00000378087;ENST00000341524;ENST00000352527;ENST00000435937;ENST00000164247;ENST00000378083;ENST00000458166	.	.	.	5.33	5.33	0.75918	.	0.048672	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	-35.5636	17.5837	0.87974	0.0:0.0:1.0:0.0	.	.	.	.	X	70;70;56;56;70;70;70;56;56;70;103;3	.	ENSP00000164247:E70X	E	+	1	0	KCNAB2	6064848	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	8.470000	0.90399	2.482000	0.83794	0.563000	0.77884	GAG	KCNAB2	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,tigrfam_K_chnl_volt-dep_bsu_KCNAB	ENSG00000069424		0.582	KCNAB2-006	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	KCNAB2	HGNC	protein_coding	OTTHUMT00000002114.3	85	0.00	0	G	NM_172130		6142261	6142261	+1	no_errors	ENST00000378083	ensembl	human	known	69_37n	nonsense	25	13.79	4	SNP	1.000	T
KCNJ15	3772	genome.wustl.edu	37	21	39671401	39671401	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr21:39671401C>A	ENST00000328656.4	+	4	521	c.218C>A	c.(217-219)aCt>aAt	p.T73N	KCNJ15_ENST00000398932.1_Missense_Mutation_p.T73N|KCNJ15_ENST00000398930.1_Missense_Mutation_p.T73N|KCNJ15_ENST00000398938.2_Missense_Mutation_p.T73N|KCNJ15_ENST00000398934.1_Missense_Mutation_p.T73N	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	73					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	TTCGCTGCCACTTTTGTGATG	0.468																																						dbGAP											0													153.0	127.0	136.0					21																	39671401		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.218C>A	21.37:g.39671401C>A	ENSP00000331698:p.Thr73Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.3,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir1.1	p.T73N	ENST00000328656.4	37	c.218	CCDS13656.1	21	.	.	.	.	.	.	.	.	.	.	C	21.1	4.096774	0.76870	.	.	ENSG00000157551	ENST00000328656;ENST00000398928;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934;ENST00000398927;ENST00000419868	D;D;D;D;D;D;D;D;D	0.94376	-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41;-3.41	4.87	4.87	0.63330	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	U	0.000000	D	0.96147	0.8744	M	0.67625	2.065	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.95695	0.8744	9	.	.	.	.	18.3748	0.90432	0.0:1.0:0.0:0.0	.	73	Q99712	IRK15_HUMAN	N	73	ENSP00000331698:T73N;ENSP00000381902:T73N;ENSP00000381911:T73N;ENSP00000381905:T73N;ENSP00000414487:T73N;ENSP00000381904:T73N;ENSP00000381907:T73N;ENSP00000381901:T73N;ENSP00000400849:T73N	.	T	+	2	0	KCNJ15	38593271	1.000000	0.71417	0.934000	0.37439	0.849000	0.48306	7.776000	0.85560	2.421000	0.82119	0.467000	0.42956	ACT	KCNJ15	-	pfam_K_chnl_inward-rec_Kir_Cr2,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2	ENSG00000157551		0.468	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ15	HGNC	protein_coding	OTTHUMT00000207181.2	92	0.00	0	C	NM_002243		39671401	39671401	+1	no_errors	ENST00000328656	ensembl	human	known	69_37n	missense	63	17.11	13	SNP	1.000	A
KCNJ15	3772	genome.wustl.edu	37	21	39671427	39671427	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr21:39671427G>A	ENST00000328656.4	+	4	547	c.244G>A	c.(244-246)Gga>Aga	p.G82R	KCNJ15_ENST00000398932.1_Missense_Mutation_p.G82R|KCNJ15_ENST00000398930.1_Missense_Mutation_p.G82R|KCNJ15_ENST00000398938.2_Missense_Mutation_p.G82R|KCNJ15_ENST00000398934.1_Missense_Mutation_p.G82R	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	82					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	GTTCCTTTTTGGAGTCATCTA	0.478																																						dbGAP											0													142.0	127.0	132.0					21																	39671427		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.244G>A	21.37:g.39671427G>A	ENSP00000331698:p.Gly82Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.3,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir1.1	p.G82R	ENST00000328656.4	37	c.244	CCDS13656.1	21	.	.	.	.	.	.	.	.	.	.	G	22.0	4.232287	0.79688	.	.	ENSG00000157551	ENST00000328656;ENST00000398928;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934;ENST00000398927;ENST00000419868	D;D;D;D;D;D;D;D;D	0.95588	-3.75;-3.75;-3.75;-3.75;-3.75;-3.75;-3.75;-3.75;-3.75	4.87	4.87	0.63330	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	U	0.000000	D	0.98362	0.9456	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99643	1.0989	9	.	.	.	.	18.3748	0.90432	0.0:0.0:1.0:0.0	.	82	Q99712	IRK15_HUMAN	R	82	ENSP00000331698:G82R;ENSP00000381902:G82R;ENSP00000381911:G82R;ENSP00000381905:G82R;ENSP00000414487:G82R;ENSP00000381904:G82R;ENSP00000381907:G82R;ENSP00000381901:G82R;ENSP00000400849:G82R	.	G	+	1	0	KCNJ15	38593297	1.000000	0.71417	0.571000	0.28486	0.887000	0.51463	9.813000	0.99286	2.421000	0.82119	0.467000	0.42956	GGA	KCNJ15	-	pfam_K_chnl_inward-rec_Kir_Cr2,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2	ENSG00000157551		0.478	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ15	HGNC	protein_coding	OTTHUMT00000207181.2	110	0.00	0	G	NM_002243		39671427	39671427	+1	no_errors	ENST00000328656	ensembl	human	known	69_37n	missense	61	15.28	11	SNP	1.000	A
KCNJ15	3772	genome.wustl.edu	37	21	39671430	39671430	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr21:39671430G>T	ENST00000328656.4	+	4	550	c.247G>T	c.(247-249)Gtc>Ttc	p.V83F	KCNJ15_ENST00000398932.1_Missense_Mutation_p.V83F|KCNJ15_ENST00000398930.1_Missense_Mutation_p.V83F|KCNJ15_ENST00000398938.2_Missense_Mutation_p.V83F|KCNJ15_ENST00000398934.1_Missense_Mutation_p.V83F	NM_001276437.1|NM_001276438.1|NM_001276439.1|NM_002243.3	NP_001263366.1|NP_001263367.1|NP_001263368.1|NP_002234.2	Q99712	KCJ15_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 15	83					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	24					Yohimbine(DB01392)	CCTTTTTGGAGTCATCTACTA	0.483																																						dbGAP											0													144.0	128.0	134.0					21																	39671430		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10745	CCDS13656.1	21q22.2	2011-07-05			ENSG00000157551	ENSG00000157551		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6261	protein-coding gene	gene with protein product		602106				9299242, 8995301, 16382105	Standard	NM_170736		Approved	Kir4.2, Kir1.3, IRKK	uc002ywx.4	Q99712	OTTHUMG00000090609	ENST00000328656.4:c.247G>T	21.37:g.39671430G>T	ENSP00000331698:p.Val83Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSH5|O00564|Q96L28|Q99446	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.3,prints_K_chnl_inward-rec_Kir_Cr2,prints_K_chnl_inward-rec_Kir1.1	p.V83F	ENST00000328656.4	37	c.247	CCDS13656.1	21	.	.	.	.	.	.	.	.	.	.	G	12.51	1.960390	0.34565	.	.	ENSG00000157551	ENST00000328656;ENST00000398928;ENST00000398938;ENST00000398932;ENST00000438657;ENST00000398930;ENST00000398934;ENST00000398927;ENST00000419868	D;D;D;D;D;D;D;D;D	0.95885	-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84;-3.84	4.87	4.87	0.63330	Potassium channel, inwardly rectifying, Kir, conserved region 2 (2);	0.000000	0.85682	U	0.000000	D	0.96451	0.8842	L	0.42632	1.34	0.50467	D	0.999874	D	0.89917	1.0	D	0.79784	0.993	D	0.95831	0.8858	9	.	.	.	.	18.3748	0.90432	0.0:0.0:1.0:0.0	.	83	Q99712	IRK15_HUMAN	F	83	ENSP00000331698:V83F;ENSP00000381902:V83F;ENSP00000381911:V83F;ENSP00000381905:V83F;ENSP00000414487:V83F;ENSP00000381904:V83F;ENSP00000381907:V83F;ENSP00000381901:V83F;ENSP00000400849:V83F	.	V	+	1	0	KCNJ15	38593300	0.982000	0.34865	0.188000	0.23233	0.835000	0.47333	1.916000	0.39986	2.421000	0.82119	0.467000	0.42956	GTC	KCNJ15	-	pfam_K_chnl_inward-rec_Kir_Cr2,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir_Cr2	ENSG00000157551		0.483	KCNJ15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ15	HGNC	protein_coding	OTTHUMT00000207181.2	112	0.00	0	G	NM_002243		39671430	39671430	+1	no_errors	ENST00000328656	ensembl	human	known	69_37n	missense	63	14.86	11	SNP	0.858	T
KEL	3792	genome.wustl.edu	37	7	142649695	142649695	+	Silent	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr7:142649695C>T	ENST00000355265.2	-	10	1578	c.1104G>A	c.(1102-1104)ggG>ggA	p.G368G	KEL_ENST00000479768.2_5'UTR	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase	368					vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					TCACCACCAGCCCTAAGATCA	0.537																																						dbGAP											0													94.0	80.0	85.0					7																	142649695		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159	ENST00000355265.2:c.1104G>A	7.37:g.142649695C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV4|Q96RS8|Q99885	Silent	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.G368	ENST00000355265.2	37	c.1104	CCDS34766.1	7																																																																																			KEL	-	pfam_Peptidase_M13_N	ENSG00000197993		0.537	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KEL	HGNC	protein_coding	OTTHUMT00000347671.2	55	0.00	0	C	NM_000420		142649695	142649695	-1	no_errors	ENST00000355265	ensembl	human	known	69_37n	silent	32	27.27	12	SNP	0.675	T
KIF16B	55614	genome.wustl.edu	37	20	16337021	16337021	+	Missense_Mutation	SNP	A	A	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr20:16337021A>G	ENST00000354981.2	-	23	3732	c.3575T>C	c.(3574-3576)gTc>gCc	p.V1192A	KIF16B_ENST00000378003.2_Intron|KIF16B_ENST00000355755.3_Missense_Mutation_p.V1192A	NM_001199865.1|NM_024704.4	NP_001186794.1|NP_078980.3	Q96L93	KI16B_HUMAN	kinesin family member 16B	1192	PX. {ECO:0000255|PROSITE- ProRule:PRU00147}.				ATP catabolic process (GO:0006200)|early endosome to late endosome transport (GO:0045022)|endoderm development (GO:0007492)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|formation of primary germ layer (GO:0001704)|Golgi to endosome transport (GO:0006895)|microtubule-based movement (GO:0007018)|receptor catabolic process (GO:0032801)|regulation of receptor recycling (GO:0001919)	early endosome (GO:0005769)|endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|plus-end-directed microtubule motor activity (GO:0008574)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(24)|ovary(1)|prostate(15)|skin(3)|upper_aerodigestive_tract(2)	74						CCCGCAGAGGACGTAGCGTGG	0.498																																						dbGAP											0													134.0	105.0	115.0					20																	16337021		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000142	CCDS13122.1, CCDS56178.1	20p11.23	2008-03-03	2008-03-03	2008-03-03	ENSG00000089177	ENSG00000089177		"""Kinesins"""	15869	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 23"""	C20orf23		16084724, 16782399	Standard	NM_024704		Approved	FLJ20135, dJ971B4.1, SNX23	uc010gci.2	Q96L93	OTTHUMG00000031927	ENST00000354981.2:c.3575T>C	20.37:g.16337021A>G	ENSP00000347076:p.Val1192Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKJ9|A7E2A8|B1AKG3|B1AKT7|C9JDN5|C9JI52|C9JSM8|C9JWJ7|Q2TBF5|Q5HYC0|Q5HYK1|Q5JWW3|Q5TFK5|Q86VL9|Q86YS5|Q8IYU0|Q9BQJ8|Q9BQM0|Q9BQM1|Q9BQM5|Q9H5U0|Q9HCI2|Q9NXN9	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Phox,pfam_FHA_dom,superfamily_SMAD_FHA_domain,superfamily_Phox,smart_Kinesin_motor_dom,smart_Phox,pfscan_Phox,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V1192A	ENST00000354981.2	37	c.3575	CCDS13122.1	20	.	.	.	.	.	.	.	.	.	.	A	15.78	2.934859	0.52866	.	.	ENSG00000089177	ENST00000354981;ENST00000355755;ENST00000377997	T;T	0.29917	1.55;1.55	5.6	5.6	0.85130	Phox homologous domain (4);	.	.	.	.	T	0.24470	0.0593	L	0.33245	0.995	0.80722	D	1	B	0.11235	0.004	B	0.14578	0.011	T	0.04386	-1.0955	9	0.54805	T	0.06	.	10.4425	0.44474	0.9272:0.0:0.0728:0.0	.	1192	Q96L93	KI16B_HUMAN	A	1192;1192;1036	ENSP00000347076:V1192A;ENSP00000347995:V1192A	ENSP00000347076:V1192A	V	-	2	0	KIF16B	16285021	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	6.779000	0.75057	2.255000	0.74692	0.523000	0.50628	GTC	KIF16B	-	superfamily_Phox,smart_Phox,pfscan_Phox	ENSG00000089177		0.498	KIF16B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF16B	HGNC	protein_coding	OTTHUMT00000078104.2	47	0.00	0	A	NM_017683		16337021	16337021	-1	no_errors	ENST00000354981	ensembl	human	known	69_37n	missense	22	43.59	17	SNP	1.000	G
KRT75	9119	genome.wustl.edu	37	12	52818468	52818468	+	Missense_Mutation	SNP	C	C	T	rs201563619		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr12:52818468C>T	ENST00000252245.5	-	9	1709	c.1489G>A	c.(1489-1491)Ggt>Agt	p.G497S	RP11-1020M18.10_ENST00000548135.1_RNA	NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	497	Tail.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		CTGCCCCCACCGAGGCCCAGG	0.622													C|||	1	0.000199681	0.0	0.0	5008	,	,		17682	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													61.0	66.0	65.0					12																	52818468		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.1489G>A	12.37:g.52818468C>T	ENSP00000252245:p.Gly497Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQU4|Q9NSA9	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G497S	ENST00000252245.5	37	c.1489	CCDS8827.1	12	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.283	-0.985390	0.02180	.	.	ENSG00000170454	ENST00000252245	D	0.86865	-2.18	4.88	-3.48	0.04739	.	0.860418	0.09901	N	0.741082	T	0.77405	0.4125	L	0.58101	1.795	0.09310	N	1	B	0.19200	0.034	B	0.06405	0.002	T	0.61734	-0.7002	10	0.02654	T	1	.	5.8159	0.18492	0.1348:0.3326:0.0:0.5326	.	497	O95678	K2C75_HUMAN	S	497	ENSP00000252245:G497S	ENSP00000252245:G497S	G	-	1	0	KRT75	51104735	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	-1.026000	0.03596	-1.041000	0.03266	0.591000	0.81541	GGT	KRT75	-	NULL	ENSG00000170454		0.622	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT75	HGNC	protein_coding	OTTHUMT00000404968.1	98	0.00	0	C	NM_004693		52818468	52818468	-1	no_errors	ENST00000252245	ensembl	human	known	69_37n	missense	49	20.97	13	SNP	0.001	T
LAMA1	284217	genome.wustl.edu	37	18	7036046	7036046	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr18:7036046G>A	ENST00000389658.3	-	13	1872	c.1779C>T	c.(1777-1779)taC>taT	p.Y593Y		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	593	Laminin IV type A 1. {ECO:0000255|PROSITE-ProRule:PRU00458}.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				CCGGAATATCGTAGGACACCG	0.448																																						dbGAP											0													171.0	123.0	140.0					18																	7036046		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.1779C>T	18.37:g.7036046G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.Y593	ENST00000389658.3	37	c.1779	CCDS32787.1	18																																																																																			LAMA1	-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV	ENSG00000101680		0.448	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	60	0.00	0	G	NM_005559		7036046	7036046	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	silent	29	14.71	5	SNP	0.949	A
HSPB6	126393	genome.wustl.edu	37	19	36245034	36245034	+	IGR	SNP	G	G	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:36245034G>C	ENST00000592984.1	-	0	1634				AC002398.11_ENST00000591091.1_RNA|LIN37_ENST00000301159.9_Missense_Mutation_p.E187D|AC002398.9_ENST00000591613.2_3'UTR|AC002398.12_ENST00000587767.1_RNA			O14558	HSPB6_HUMAN	heat shock protein, alpha-crystallin-related, B6						regulation of muscle contraction (GO:0006937)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)|structural constituent of eye lens (GO:0005212)			lung(1)	1	all_lung(56;3.33e-07)|Lung NSC(56;5.02e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGCAGCCTGAGATGCAGGGCA	0.632																																						dbGAP											0													51.0	57.0	55.0					19																	36245034		2067	4197	6264	-	-	-	SO:0001628	intergenic_variant	0			AJ278121	CCDS12475.1	19q13.13	2014-06-12			ENSG00000004776	ENSG00000004776		"""Heat shock proteins / HSPB"""	26511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 91"""	610695				12820654, 14717697	Standard	NM_144617		Approved	FLJ32389, Hsp20, PPP1R91	uc002obn.2	O14558	OTTHUMG00000048122		19.37:g.36245034G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O14551|Q6NVI3|Q96MG9	Missense_Mutation	SNP	NULL	p.E187D	ENST00000592984.1	37	c.561	CCDS12475.1	19	.	.	.	.	.	.	.	.	.	.	G	10.65	1.410138	0.25465	.	.	ENSG00000188223	ENST00000301159	T	0.44482	0.92	5.3	4.27	0.50696	.	0.158783	0.56097	D	0.000030	T	0.33147	0.0853	L	0.46157	1.445	0.36900	D	0.890364	P	0.45827	0.867	B	0.41236	0.351	T	0.31280	-0.9949	10	0.29301	T	0.29	-12.2636	7.8078	0.29213	0.1811:0.0:0.8189:0.0	.	187	Q96GY3	LIN37_HUMAN	D	187	ENSP00000301159:E187D	ENSP00000301159:E187D	E	+	3	2	LIN37	40936874	1.000000	0.71417	1.000000	0.80357	0.555000	0.35460	2.034000	0.41145	1.472000	0.48140	0.655000	0.94253	GAG	LIN37	-	NULL	ENSG00000267796		0.632	HSPB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN37	HGNC	protein_coding	OTTHUMT00000109498.3	64	0.00	0	G	NM_144617		36245034	36245034	+1	no_errors	ENST00000301159	ensembl	human	known	69_37n	missense	46	30.30	20	SNP	1.000	C
LIPC	3990	genome.wustl.edu	37	15	58855765	58855765	+	Missense_Mutation	SNP	G	G	A	rs559266901		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr15:58855765G>A	ENST00000356113.6	+	10	1846	c.1231G>A	c.(1231-1233)Ggc>Agc	p.G411S	LIPC_ENST00000414170.3_Missense_Mutation_p.G411S|LIPC_ENST00000433326.2_Missense_Mutation_p.G350S|LIPC_ENST00000299022.5_Missense_Mutation_p.G411S			P11150	LIPC_HUMAN	lipase, hepatic	411	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|chylomicron remnant clearance (GO:0034382)|fatty acid biosynthetic process (GO:0006633)|high-density lipoprotein particle remodeling (GO:0034375)|intermediate-density lipoprotein particle remodeling (GO:0034373)|low-density lipoprotein particle remodeling (GO:0034374)|phosphatidylcholine catabolic process (GO:0034638)|reverse cholesterol transport (GO:0043691)|triglyceride catabolic process (GO:0019433)|triglyceride homeostasis (GO:0070328)|very-low-density lipoprotein particle remodeling (GO:0034372)	extracellular space (GO:0005615)|high-density lipoprotein particle (GO:0034364)	apolipoprotein binding (GO:0034185)|heparin binding (GO:0008201)|low-density lipoprotein particle binding (GO:0030169)|phospholipase activity (GO:0004620)|triglyceride lipase activity (GO:0004806)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Colorectal(260;0.215)		GBM - Glioblastoma multiforme(80;0.00213)|all cancers(107;0.00548)		TGTGGATATCGGCGAGCTGAT	0.468													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20734	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													137.0	111.0	120.0					15																	58855765		2192	4292	6484	-	-	-	SO:0001583	missense	0				CCDS10166.1	15q21-q23	2012-10-02			ENSG00000166035	ENSG00000166035	3.1.1.3		6619	protein-coding gene	gene with protein product		151670					Standard	NM_000236		Approved	HL, HTGL	uc002afa.2	P11150	OTTHUMG00000132632	ENST00000356113.6:c.1231G>A	15.37:g.58855765G>A	ENSP00000348425:p.Gly411Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUB4|A8K9B6|O43571|P78529|Q99465	Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase_hep,prints_Lipase,prints_Lipo_Lipase,pfscan_LipOase_LH2	p.G411S	ENST00000356113.6	37	c.1231	CCDS10166.1	15	.	.	.	.	.	.	.	.	.	.	G	21.3	4.133582	0.77662	.	.	ENSG00000166035	ENST00000356113;ENST00000414170;ENST00000299022;ENST00000433326	T;D;T;T	0.90385	-1.19;-2.66;-1.19;-1.19	5.9	5.9	0.94986	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.000000	0.85682	D	0.000000	D	0.96204	0.8762	M	0.87971	2.92	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79784	0.993;0.99	D	0.96129	0.9091	10	0.87932	D	0	.	20.282	0.98514	0.0:0.0:1.0:0.0	.	350;411	E7EUK6;P11150	.;LIPC_HUMAN	S	411;411;411;350	ENSP00000348425:G411S;ENSP00000395569:G411S;ENSP00000299022:G411S;ENSP00000395002:G350S	ENSP00000299022:G411S	G	+	1	0	LIPC	56643057	1.000000	0.71417	0.336000	0.25522	0.111000	0.19643	8.979000	0.93455	2.786000	0.95864	0.563000	0.77884	GGC	LIPC	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase,pfscan_LipOase_LH2	ENSG00000166035		0.468	LIPC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LIPC	HGNC	protein_coding	OTTHUMT00000416209.1	53	0.00	0	G			58855765	58855765	+1	no_errors	ENST00000299022	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	1.000	A
LRRC66	339977	genome.wustl.edu	37	4	52861808	52861808	+	Silent	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr4:52861808C>A	ENST00000343457.3	-	4	1386	c.1380G>T	c.(1378-1380)gtG>gtT	p.V460V		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	460						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						GTGGCTGTGTCACCCAGAAAG	0.567																																						dbGAP											0													80.0	85.0	83.0					4																	52861808		2024	4176	6200	-	-	-	SO:0001819	synonymous_variant	0			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.1380G>T	4.37:g.52861808C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.V460	ENST00000343457.3	37	c.1380	CCDS43229.1	4																																																																																			LRRC66	-	NULL	ENSG00000188993		0.567	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1	123	0.00	0	C	NM_001024611		52861808	52861808	-1	no_errors	ENST00000343457	ensembl	human	known	69_37n	silent	103	17.60	22	SNP	0.000	A
LRRC66	339977	genome.wustl.edu	37	4	52883476	52883476	+	Missense_Mutation	SNP	A	A	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr4:52883476A>C	ENST00000343457.3	-	1	310	c.304T>G	c.(304-306)Tta>Gta	p.L102V		NM_001024611.1	NP_001019782.1	Q68CR7	LRC66_HUMAN	leucine rich repeat containing 66	102						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(8)|lung(34)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	58						AAAGGGCTTAAGGTTATTTTT	0.373																																						dbGAP											0													157.0	148.0	151.0					4																	52883476		1879	4121	6000	-	-	-	SO:0001583	missense	0			BC040414	CCDS43229.1	4q12	2008-08-08			ENSG00000188993	ENSG00000188993			34299	protein-coding gene	gene with protein product							Standard	XM_005265739		Approved		uc003gzi.3	Q68CR7	OTTHUMG00000160623	ENST00000343457.3:c.304T>G	4.37:g.52883476A>C	ENSP00000341944:p.Leu102Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L102V	ENST00000343457.3	37	c.304	CCDS43229.1	4	.	.	.	.	.	.	.	.	.	.	A	11.14	1.550670	0.27739	.	.	ENSG00000188993	ENST00000343457	T	0.56776	0.44	5.54	0.373	0.16178	.	0.698564	0.11404	N	0.567515	T	0.32704	0.0838	N	0.12746	0.255	0.09310	N	1	P	0.47409	0.895	P	0.46026	0.501	T	0.12116	-1.0560	10	0.34782	T	0.22	-0.5698	3.5633	0.07890	0.4359:0.0:0.158:0.4061	.	102	Q68CR7	LRC66_HUMAN	V	102	ENSP00000341944:L102V	ENSP00000341944:L102V	L	-	1	2	LRRC66	52578233	0.175000	0.23083	0.025000	0.17156	0.139000	0.21198	0.715000	0.25822	0.056000	0.16144	0.528000	0.53228	TTA	LRRC66	-	pfam_Leu-rich_rpt	ENSG00000188993		0.373	LRRC66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC66	HGNC	protein_coding	OTTHUMT00000361473.1	41	0.00	0	A	NM_001024611		52883476	52883476	-1	no_errors	ENST00000343457	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	0.006	C
MORC3	23515	genome.wustl.edu	37	21	37713805	37713805	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr21:37713805G>A	ENST00000400485.1	+	6	793	c.717G>A	c.(715-717)agG>agA	p.R239R	MORC3_ENST00000487909.1_3'UTR	NM_015358.2	NP_056173.1	Q14149	MORC3_HUMAN	MORC family CW-type zinc finger 3	239					cell aging (GO:0007569)|maintenance of protein location in nucleus (GO:0051457)|negative regulation of fibroblast proliferation (GO:0048147)|peptidyl-serine phosphorylation (GO:0018105)|post-embryonic development (GO:0009791)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)	PML body (GO:0016605)	zinc ion binding (GO:0008270)			breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(9)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	35						AGCAGGAAAGGATGGACCAGA	0.413																																						dbGAP											0													136.0	148.0	144.0					21																	37713805		1879	4114	5993	-	-	-	SO:0001819	synonymous_variant	0			AK025327	CCDS42924.1	21q22.13	2005-06-15	2005-06-15	2005-06-15	ENSG00000159256	ENSG00000159256			23572	protein-coding gene	gene with protein product		610078	"""zinc finger, CW-type with coiled-coil domain 3"", ""zinc finger, CW type with coiled-coil domain 3"""	ZCWCC3		14607086	Standard	NM_015358		Approved	ZCW5, NXP2, KIAA0136	uc002yvi.3	Q14149	OTTHUMG00000086620	ENST00000400485.1:c.717G>A	21.37:g.37713805G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA92|Q9UEZ2	Silent	SNP	pfam_Znf_CW,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,pfscan_Znf_CW	p.R239	ENST00000400485.1	37	c.717	CCDS42924.1	21																																																																																			MORC3	-	superfamily_ATPase-like_ATP-bd	ENSG00000159256		0.413	MORC3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MORC3	HGNC	protein_coding	OTTHUMT00000194640.1	39	0.00	0	G	NM_015358		37713805	37713805	+1	no_errors	ENST00000400485	ensembl	human	known	69_37n	silent	31	20.51	8	SNP	0.527	A
MPP4	58538	genome.wustl.edu	37	2	202510093	202510093	+	Missense_Mutation	SNP	T	T	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr2:202510093T>A	ENST00000409474.3	-	22	1961	c.1754A>T	c.(1753-1755)cAa>cTa	p.Q585L	MPP4_ENST00000428900.2_Missense_Mutation_p.Q561L|TMEM237_ENST00000409444.2_5'Flank|TMEM237_ENST00000409883.2_5'Flank|MPP4_ENST00000447335.2_Missense_Mutation_p.Q578L|RNU6-651P_ENST00000411040.1_RNA|MPP4_ENST00000359962.5_Missense_Mutation_p.Q585L|MPP4_ENST00000315506.7_Missense_Mutation_p.Q541L|MPP4_ENST00000409143.1_Missense_Mutation_p.Q527L|MPP4_ENST00000396886.3_Missense_Mutation_p.Q510L	NM_033066.2	NP_149055	Q96JB8	MPP4_HUMAN	membrane protein, palmitoylated 4 (MAGUK p55 subfamily member 4)	585	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				protein localization to synapse (GO:0035418)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|presynaptic membrane (GO:0042734)				kidney(1)|lung(11)	12						TTCCATTCTTTGGGCTAAATT	0.373																																						dbGAP											0													63.0	63.0	63.0					2																	202510093		1863	4106	5969	-	-	-	SO:0001583	missense	0			AF316032	CCDS46491.1	2q33.2	2008-05-15			ENSG00000082126	ENSG00000082126			13680	protein-coding gene	gene with protein product		606575		DLG6		11414766	Standard	NM_033066		Approved		uc002uyk.4	Q96JB8	OTTHUMG00000154525	ENST00000409474.3:c.1754A>T	2.37:g.202510093T>A	ENSP00000387278:p.Gln585Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZK4|Q53TT3|Q6ZNH6|Q96Q43|Q96Q44	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_L27_C,pfam_PDZ,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.Q585L	ENST00000409474.3	37	c.1754	CCDS46491.1	2	.	.	.	.	.	.	.	.	.	.	T	17.95	3.512952	0.64522	.	.	ENSG00000082126	ENST00000409474;ENST00000315506;ENST00000396886;ENST00000359962;ENST00000315549;ENST00000374605;ENST00000428900;ENST00000409143;ENST00000447335	T;T;T;T;T;T	0.15603	2.41;2.41;2.41;2.41;2.41;2.41	5.38	4.23	0.50019	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.303301	0.31797	N	0.007047	T	0.22360	0.0539	L	0.42008	1.315	0.35550	D	0.803776	P;B;P;P;P;P;P;P	0.45634	0.835;0.407;0.863;0.863;0.835;0.775;0.863;0.837	B;B;P;P;B;P;P;P	0.49953	0.39;0.405;0.627;0.524;0.39;0.627;0.627;0.535	T	0.19516	-1.0303	10	0.59425	D	0.04	.	10.6361	0.45565	0.0:0.0746:0.0:0.9254	.	527;510;561;554;541;578;585;550	F6Q0Y6;B4DUF3;E7ET46;B7ZM19;Q96JB8-2;E7EUL8;Q96JB8;Q96JB8-4	.;.;.;.;.;.;MPP4_HUMAN;.	L	585;541;510;585;550;514;561;527;578	ENSP00000387278:Q585L;ENSP00000319363:Q541L;ENSP00000353047:Q585L;ENSP00000416781:Q561L;ENSP00000387293:Q527L;ENSP00000406160:Q578L	ENSP00000319363:Q541L	Q	-	2	0	MPP4	202218338	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.534000	0.53568	2.035000	0.60131	0.533000	0.62120	CAA	MPP4	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin	ENSG00000082126		0.373	MPP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MPP4	HGNC	protein_coding	OTTHUMT00000335748.2	42	0.00	0	T			202510093	202510093	-1	no_errors	ENST00000359962	ensembl	human	known	69_37n	missense	38	26.92	14	SNP	0.997	A
MTMR3	8897	genome.wustl.edu	37	22	30405064	30405064	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr22:30405064G>A	ENST00000401950.2	+	12	1409	c.1067G>A	c.(1066-1068)cGg>cAg	p.R356Q	MTMR3_ENST00000323630.5_Missense_Mutation_p.R220Q|CTA-85E5.10_ENST00000429350.1_RNA|MTMR3_ENST00000333027.3_Missense_Mutation_p.R356Q|MTMR3_ENST00000406629.1_Missense_Mutation_p.R356Q|MTMR3_ENST00000351488.3_Missense_Mutation_p.R356Q	NM_021090.3	NP_066576.1	Q13615	MTMR3_HUMAN	myotubularin related protein 3	356	Myotubularin phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00669}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|membrane (GO:0016020)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphatidylinositol-3,5-bisphosphate 3-phosphatase activity (GO:0052629)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|large_intestine(3)|ovary(2)|skin(8)|upper_aerodigestive_tract(1)	17			OV - Ovarian serous cystadenocarcinoma(5;0.00204)|Epithelial(10;0.06)|all cancers(5;0.107)			CATTCTATTCGGAGGAGTTTT	0.413																																						dbGAP											0													196.0	184.0	188.0					22																	30405064		2203	4300	6503	-	-	-	SO:0001583	missense	0			U58034	CCDS13870.1, CCDS13871.1, CCDS46682.1	22q12.2	2011-06-09			ENSG00000100330	ENSG00000100330		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7451	protein-coding gene	gene with protein product		603558				8640223, 9736772	Standard	NM_153050		Approved	KIAA0371, ZFYVE10, FYVE-DSP1	uc003agv.4	Q13615	OTTHUMG00000151278	ENST00000401950.2:c.1067G>A	22.37:g.30405064G>A	ENSP00000384651:p.Arg356Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL26|A7MD32|Q9NYN5|Q9NYN6|Q9UDX6|Q9UEG3	Missense_Mutation	SNP	pfam_Myotub-related,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Tyr_Pase_cat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.R356Q	ENST00000401950.2	37	c.1067	CCDS13870.1	22	.	.	.	.	.	.	.	.	.	.	G	36	5.841985	0.97016	.	.	ENSG00000100330	ENST00000401950;ENST00000333027;ENST00000323630;ENST00000351488;ENST00000406629	D;D;D;D;D	0.93906	-3.31;-3.31;-3.31;-3.31;-3.31	5.84	5.84	0.93424	Myotubularin phosphatase domain (1);	0.000000	0.85682	D	0.000000	D	0.96667	0.8912	M	0.73430	2.235	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.956;1.0	D	0.96722	0.9533	10	0.87932	D	0	.	19.1228	0.93371	0.0:0.0:1.0:0.0	.	356;356;356	Q13615-3;Q13615;Q13615-2	.;MTMR3_HUMAN;.	Q	356;356;220;356;356	ENSP00000384651:R356Q;ENSP00000331649:R356Q;ENSP00000318070:R220Q;ENSP00000307271:R356Q;ENSP00000384077:R356Q	ENSP00000318070:R220Q	R	+	2	0	MTMR3	28735064	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.765000	0.95021	0.655000	0.94253	CGG	MTMR3	-	NULL	ENSG00000100330		0.413	MTMR3-001	KNOWN	basic|CCDS	protein_coding	MTMR3	HGNC	protein_coding	OTTHUMT00000322066.1	47	0.00	0	G	NM_021090		30405064	30405064	+1	no_errors	ENST00000401950	ensembl	human	known	69_37n	missense	9	65.38	17	SNP	1.000	A
MYOM1	8736	genome.wustl.edu	37	18	3094299	3094299	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr18:3094299G>C	ENST00000356443.4	-	26	4066	c.3733C>G	c.(3733-3735)Cca>Gca	p.P1245A	MYOM1_ENST00000261606.7_Missense_Mutation_p.P1149A|RNU7-25P_ENST00000516544.1_RNA|MYOM1_ENST00000400569.3_Missense_Mutation_p.P1245A	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	1245					muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						GATTTAACTGGGACAGCTATG	0.358																																						dbGAP											0													45.0	43.0	43.0					18																	3094299		1811	4075	5886	-	-	-	SO:0001583	missense	0			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.3733C>G	18.37:g.3094299G>C	ENSP00000348821:p.Pro1245Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14BD6|Q6H969|Q6ZUU0	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.P1245A	ENST00000356443.4	37	c.3733	CCDS45824.1	18	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979130	0.53827	.	.	ENSG00000101605	ENST00000356443;ENST00000400569;ENST00000261606	T;T;T	0.04758	3.56;3.56;3.56	5.55	4.67	0.58626	.	0.097634	0.64402	N	0.000001	T	0.11153	0.0272	M	0.80183	2.485	0.80722	D	1	P;B	0.39624	0.681;0.012	B;B	0.38458	0.274;0.016	T	0.02885	-1.1098	10	0.62326	D	0.03	.	16.5653	0.84577	0.0:0.1304:0.8696:0.0	.	1149;1245	P52179-2;P52179	.;MYOM1_HUMAN	A	1245;1245;1149	ENSP00000348821:P1245A;ENSP00000383413:P1245A;ENSP00000261606:P1149A	ENSP00000261606:P1149A	P	-	1	0	MYOM1	3084299	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	7.758000	0.85224	1.557000	0.49525	0.655000	0.94253	CCA	MYOM1	-	NULL	ENSG00000101605		0.358	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	HGNC	protein_coding	OTTHUMT00000441037.2	61	0.00	0	G	NM_003803		3094299	3094299	-1	no_errors	ENST00000356443	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	1.000	C
NCKAP5	344148	genome.wustl.edu	37	2	133540920	133540920	+	Missense_Mutation	SNP	T	T	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr2:133540920T>A	ENST00000409261.1	-	14	3837	c.3464A>T	c.(3463-3465)aAg>aTg	p.K1155M	NCKAP5_ENST00000409213.1_Intron|NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000317721.6_Missense_Mutation_p.K1155M|NCKAP5_ENST00000405974.3_Intron	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1155								p.K1155R(1)		NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						CTGGGGAGACTTCATGAGCAC	0.483																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											99.0	100.0	99.0					2																	133540920		1986	4155	6141	-	-	-	SO:0001583	missense	0			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.3464A>T	2.37:g.133540920T>A	ENSP00000387128:p.Lys1155Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Missense_Mutation	SNP	NULL	p.K1155M	ENST00000409261.1	37	c.3464	CCDS46418.1	2	.	.	.	.	.	.	.	.	.	.	T	19.06	3.753367	0.69648	.	.	ENSG00000176771	ENST00000409261;ENST00000317721	T;T	0.26373	1.74;1.74	5.26	4.12	0.48240	.	0.000000	0.40385	U	0.001101	T	0.36880	0.0983	L	0.34521	1.04	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.12553	-1.0543	10	0.72032	D	0.01	.	9.6297	0.39772	0.0:0.0783:0.0:0.9217	.	1155	O14513	NCKP5_HUMAN	M	1155	ENSP00000387128:K1155M;ENSP00000380603:K1155M	ENSP00000380603:K1155M	K	-	2	0	NCKAP5	133257390	1.000000	0.71417	1.000000	0.80357	0.930000	0.56654	6.419000	0.73345	1.029000	0.39812	0.533000	0.62120	AAG	NCKAP5	-	NULL	ENSG00000176771		0.483	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	77	0.00	0	T	NM_207481		133540920	133540920	-1	no_errors	ENST00000317721	ensembl	human	known	69_37n	missense	64	27.27	24	SNP	1.000	A
NFASC	23114	genome.wustl.edu	37	1	204950942	204950942	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr1:204950942C>T	ENST00000401399.1	+	20	2463	c.2264C>T	c.(2263-2265)tCg>tTg	p.S755L	NFASC_ENST00000339876.6_Missense_Mutation_p.S755L|NFASC_ENST00000338515.6_Missense_Mutation_p.S755L|NFASC_ENST00000513543.1_Missense_Mutation_p.S751L|NFASC_ENST00000367171.4_Missense_Mutation_p.S740L|NFASC_ENST00000404907.1_Missense_Mutation_p.S751L|NFASC_ENST00000539706.1_Missense_Mutation_p.S751L|NFASC_ENST00000338586.6_Missense_Mutation_p.S755L|NFASC_ENST00000404076.1_Missense_Mutation_p.S734L|NFASC_ENST00000367172.4_Missense_Mutation_p.S755L|NFASC_ENST00000367169.4_Missense_Mutation_p.S755L|NFASC_ENST00000367170.4_Missense_Mutation_p.S755L|NFASC_ENST00000360049.4_Missense_Mutation_p.S751L			O94856	NFASC_HUMAN	neurofascin	755	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|myelination (GO:0042552)|paranodal junction assembly (GO:0030913)|peripheral nervous system development (GO:0007422)|protein localization to juxtaparanode region of axon (GO:0071205)|protein localization to paranode region of axon (GO:0002175)|synapse organization (GO:0050808)|transmission of nerve impulse (GO:0019226)	axon initial segment (GO:0043194)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|node of Ranvier (GO:0033268)|paranodal junction (GO:0033010)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)	81	all_cancers(21;0.0375)|Breast(84;0.0437)|all_epithelial(62;0.171)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			AATGCCACCTCGGCCTTTGGC	0.627																																						dbGAP											0													62.0	57.0	59.0					1																	204950942		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027553	CCDS30982.1, CCDS53460.1, CCDS53461.1, CCDS53462.1	1q32.1	2013-02-11	2010-06-24		ENSG00000163531	ENSG00000163531		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29866	protein-coding gene	gene with protein product		609145	"""neurofascin homolog (chicken)"""			1377696, 8672144	Standard	NM_015090		Approved	NRCAML, KIAA0756, FLJ46866, NF	uc001hbj.3	O94856	OTTHUMG00000151697	ENST00000401399.1:c.2264C>T	1.37:g.204950942C>T	ENSP00000385637:p.Ser755Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNN8|B3KQZ1|B5MDP6|B5MDR6|B7ZMD8|Q149P5|Q5T2F0|Q5T2F1|Q5T2F2|Q5T2F3|Q5T2F4|Q5T2F5|Q5T2F6|Q5T2F7|Q5T2F9|Q5T2G0|Q5W9F8|Q68DH3|Q6ZQV6|Q7Z3K1|Q96HT1|Q96K50	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S755L	ENST00000401399.1	37	c.2264	CCDS53460.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.31|17.31	3.357690|3.357690	0.61403|0.61403	.|.	.|.	ENSG00000163531|ENSG00000163531	ENST00000367173|ENST00000367172;ENST00000367171;ENST00000367170;ENST00000338515;ENST00000339876;ENST00000338586;ENST00000295776;ENST00000539706;ENST00000360049;ENST00000367169;ENST00000404076;ENST00000401399;ENST00000404907;ENST00000513543;ENST00000430393	.|T;T;T;T;T;T;T;T;T;T;T;T;T;T	.|0.58940	.|0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3;0.3	5.55|5.55	4.59|4.59	0.56863|0.56863	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.516847	.|0.15827	.|N	.|0.242713	T|T	0.40546|0.40546	0.1121|0.1121	N|N	0.02315|0.02315	-0.6|-0.6	0.30033|0.30033	N|N	0.813334|0.813334	.|P;P;P;B;P;D;P	.|0.65815	.|0.572;0.622;0.82;0.256;0.517;0.995;0.82	.|B;B;B;B;B;P;B	.|0.51866	.|0.2;0.103;0.187;0.05;0.126;0.682;0.187	T|T	0.28364|0.28364	-1.0046|-1.0046	5|10	.|0.30854	.|T	.|0.27	.|.	11.6248|11.6248	0.51138|0.51138	0.3365:0.6635:0.0:0.0|0.3365:0.6635:0.0:0.0	.|.	.|755;766;751;755;740;755;751	.|O94856;O94856-11;O94856-8;O94856-4;F8W791;O94856-9;O94856-3	.|NFASC_HUMAN;.;.;.;.;.;.	W|L	725|755;740;755;755;755;755;766;751;751;755;734;755;751;751;742	.|ENSP00000356140:S755L;ENSP00000356139:S740L;ENSP00000356138:S755L;ENSP00000342128:S755L;ENSP00000344786:S755L;ENSP00000343509:S755L;ENSP00000438614:S751L;ENSP00000353154:S751L;ENSP00000356137:S755L;ENSP00000385676:S734L;ENSP00000385637:S755L;ENSP00000384061:S751L;ENSP00000425908:S751L;ENSP00000415031:S742L	.|ENSP00000295776:S766L	R|S	+|+	1|2	2|0	NFASC|NFASC	203217565|203217565	0.977000|0.977000	0.34250|0.34250	0.985000|0.985000	0.45067|0.45067	0.992000|0.992000	0.81027|0.81027	4.075000|4.075000	0.57584|0.57584	2.614000|2.614000	0.88457|0.88457	0.563000|0.563000	0.77884|0.77884	CGG|TCG	NFASC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000163531		0.627	NFASC-001	KNOWN	basic|CCDS	protein_coding	NFASC	HGNC	protein_coding	OTTHUMT00000131237.1	51	0.00	0	C	NM_001005388		204950942	204950942	+1	no_errors	ENST00000367172	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	0.827	T
NOD2	64127	genome.wustl.edu	37	16	50745994	50745994	+	Silent	SNP	A	A	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr16:50745994A>C	ENST00000300589.2	+	4	2277	c.2172A>C	c.(2170-2172)ccA>ccC	p.P724P	RP11-327F22.6_ENST00000602304.1_RNA	NM_022162.1	NP_071445.1	Q9HC29	NOD2_HUMAN	nucleotide-binding oligomerization domain containing 2	724					activation of MAPK activity (GO:0000187)|activation of MAPK activity involved in innate immune response (GO:0035419)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to peptidoglycan (GO:0071224)|cytokine production involved in immune response (GO:0002367)|defense response (GO:0006952)|defense response to bacterium (GO:0042742)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterium (GO:0016045)|detection of biotic stimulus (GO:0009595)|detection of muramyl dipeptide (GO:0032498)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|innate immune response (GO:0045087)|innate immune response in mucosa (GO:0002227)|intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|macrophage inflammatory protein-1 alpha production (GO:0071608)|maintenance of gastrointestinal epithelium (GO:0030277)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-18 production (GO:0032701)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of macrophage apoptotic process (GO:2000110)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of T cell mediated immunity (GO:0002710)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of tumor necrosis factor production (GO:0032720)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070431)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of B cell activation (GO:0050871)|positive regulation of biosynthetic process of antibacterial peptides active against Gram-positive bacteria (GO:0006965)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell cytokine production (GO:0002732)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gamma-delta T cell activation (GO:0046645)|positive regulation of humoral immune response mediated by circulating immunoglobulin (GO:0002925)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-17 production (GO:0032740)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JNK cascade (GO:0046330)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phagocytosis (GO:0050766)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of prostaglandin-E synthase activity (GO:2000363)|positive regulation of prostaglandin-endoperoxide synthase activity (GO:0060585)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of stress-activated MAPK cascade (GO:0032874)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type 2 immune response (GO:0002830)|protein oligomerization (GO:0051259)|regulation of inflammatory response (GO:0050727)|regulation of neutrophil chemotaxis (GO:0090022)|response to exogenous dsRNA (GO:0043330)|response to lipopolysaccharide (GO:0032496)|response to muramyl dipeptide (GO:0032495)|response to nutrient (GO:0007584)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|vesicle (GO:0031982)	ATP binding (GO:0005524)|CARD domain binding (GO:0050700)|enzyme binding (GO:0019899)|muramyl dipeptide binding (GO:0032500)|peptidoglycan binding (GO:0042834)|protein kinase binding (GO:0019901)			cervix(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(30)|ovary(3)|skin(3)	52		all_cancers(37;0.0156)				CCATCCCGCCAGCTGCACCGG	0.672																																						dbGAP											0													43.0	42.0	42.0					16																	50745994		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AF178930	CCDS10746.1	16q12	2014-09-17	2006-12-08	2006-12-08	ENSG00000167207	ENSG00000167207		"""Nucleotide-binding domain and leucine rich repeat containing"""	5331	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 2"", ""NOD-like receptor C2"", ""NLR family, CARD domain containing 2"""	605956	"""caspase recruitment domain family, member 15"""	IBD1, CARD15		7809109, 8587604	Standard	XM_005256084		Approved	BLAU, CD, PSORAS1, CLR16.3, NLRC2	uc002egm.1	Q9HC29	OTTHUMG00000133171	ENST00000300589.2:c.2172A>C	16.37:g.50745994A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E2JEQ6|Q96RH5|Q96RH6|Q96RH8	Silent	SNP	pfam_CARD,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD	p.P724	ENST00000300589.2	37	c.2172	CCDS10746.1	16																																																																																			NOD2	-	NULL	ENSG00000167207		0.672	NOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOD2	HGNC	protein_coding	OTTHUMT00000256876.2	50	0.00	0	A	NM_022162		50745994	50745994	+1	no_errors	ENST00000300589	ensembl	human	known	69_37n	silent	40	23.08	12	SNP	0.001	C
NOS1	4842	genome.wustl.edu	37	12	117669907	117669907	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr12:117669907G>A	ENST00000338101.4	-	22	3371	c.3367C>T	c.(3367-3369)Cgc>Tgc	p.R1123C	NOS1_ENST00000317775.6_Missense_Mutation_p.R1089C|NOS1_ENST00000344089.3_3'UTR			Q8WY41	NANO1_HUMAN	nitric oxide synthase 1 (neuronal)	0					cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(21)|lung(43)|ovary(3)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	117	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0561)		GGCGGGAGGCGGAGCTCGTCT	0.602																																					Esophageal Squamous(162;1748 2599 51982 52956)	dbGAP											0													65.0	73.0	70.0					12																	117669907		2151	4264	6415	-	-	-	SO:0001583	missense	0				CCDS41842.1, CCDS55890.1	12q24.22	2013-09-19			ENSG00000089250	ENSG00000089250	1.14.13.39		7872	protein-coding gene	gene with protein product		163731		NOS		1385308, 7682706	Standard	NM_001204213		Approved	nNOS	uc001twn.2	P29475	OTTHUMG00000137376	ENST00000338101.4:c.3367C>T	12.37:g.117669907G>A	ENSP00000337459:p.Arg1123Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NO_synthase_oxygenase_dom,pfam_FAD-binding_1,pfam_Flavodoxin/NO_synth,pfam_OxRdtase_FAD/NAD-bd,pfam_PDZ,superfamily_NO_synthase_oxygenase_dom,superfamily_Riboflavin_synthase-like_b-brl,superfamily_PDZ,smart_PDZ,pirsf_NOS_met,pfscan_PDZ,pfscan_Flavodoxin/NO_synth,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase,prints_Flavdoxin	p.R1089C	ENST00000338101.4	37	c.3265	CCDS55890.1	12	.	.	.	.	.	.	.	.	.	.	G	19.18	3.777046	0.70107	.	.	ENSG00000089250	ENST00000397605;ENST00000317775;ENST00000541241;ENST00000338101	T;T	0.34275	1.37;1.37	4.55	4.55	0.56014	Riboflavin synthase-like beta-barrel (1);FAD-binding, type 1 (1);NADPH-cytochrome p450 reductase, FAD-binding, alpha-helical domain-3 (1);Ferredoxin reductase-type FAD-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.66992	0.2846	M	0.89095	3.005	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75513	-0.3291	10	0.87932	D	0	-30.7161	17.4925	0.87708	0.0:0.0:1.0:0.0	.	1089	P29475	NOS1_HUMAN	C	984;1089;1089;1123	ENSP00000320758:R1089C;ENSP00000337459:R1123C	ENSP00000320758:R1089C	R	-	1	0	NOS1	116154290	1.000000	0.71417	0.976000	0.42696	0.256000	0.26092	9.657000	0.98554	2.371000	0.80710	0.305000	0.20034	CGC	NOS1	-	pfam_FAD-binding_1,superfamily_Riboflavin_synthase-like_b-brl,pirsf_NOS_met	ENSG00000089250		0.602	NOS1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	NOS1	HGNC	protein_coding	OTTHUMT00000268053.1	101	0.00	0	G			117669907	117669907	-1	no_errors	ENST00000317775	ensembl	human	known	69_37n	missense	42	32.26	20	SNP	1.000	A
NUB1	51667	genome.wustl.edu	37	7	151052933	151052933	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr7:151052933G>A	ENST00000355851.4	+	6	572	c.495G>A	c.(493-495)gcG>gcA	p.A165A	NUB1_ENST00000477666.1_3'UTR|NUB1_ENST00000413040.2_Silent_p.A189A|NUB1_ENST00000566856.1_Silent_p.A165A|NUB1_ENST00000568733.1_Silent_p.A189A	NM_001243351.1	NP_001230280.1	Q9Y5A7	NUB1_HUMAN	negative regulator of ubiquitin-like proteins 1	165					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein ubiquitination (GO:0016567)|response to interferon-gamma (GO:0034341)|response to tumor necrosis factor (GO:0034612)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)				endometrium(1)|large_intestine(7)|lung(3)	11			OV - Ovarian serous cystadenocarcinoma(82;0.00569)	UCEC - Uterine corpus endometrioid carcinoma (81;0.172)		AAGAGGACGCGAGGAAAAACT	0.423																																						dbGAP											0													66.0	58.0	61.0					7																	151052933		1867	4112	5979	-	-	-	SO:0001819	synonymous_variant	0			AF300717	CCDS47751.1, CCDS47751.2, CCDS59089.1	7q36	2006-07-27			ENSG00000013374	ENSG00000013374			17623	protein-coding gene	gene with protein product	"""NEDD8 ultimate buster-1"""	607981				10508479, 11259415	Standard	NM_001243351		Approved	BS4, NYREN18	uc003wjx.3	Q9Y5A7	OTTHUMG00000157365	ENST00000355851.4:c.495G>A	7.37:g.151052933G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95422|Q75MR9|Q8IX22|Q9BXR2	Silent	SNP	pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.A189	ENST00000355851.4	37	c.567		7																																																																																			NUB1	-	NULL	ENSG00000013374		0.423	NUB1-201	KNOWN	basic|appris_principal	protein_coding	NUB1	HGNC	protein_coding		36	0.00	0	G	NM_016118		151052933	151052933	+1	no_errors	ENST00000568733	ensembl	human	known	69_37n	silent	41	24.07	13	SNP	0.000	A
OR4M1	441670	genome.wustl.edu	37	14	20248587	20248587	+	Silent	SNP	T	T	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr14:20248587T>C	ENST00000315957.4	+	1	187	c.106T>C	c.(106-108)Ttg>Ctg	p.L36L		NM_001005500.1	NP_001005500.1	Q8NGD0	OR4M1_HUMAN	olfactory receptor, family 4, subfamily M, member 1	36						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(32)|prostate(1)|skin(2)	42	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;2.95e-06)	GBM - Glioblastoma multiforme(265;0.00327)		ATCCTTCTATTTGTTCATCCT	0.428																																						dbGAP											0													214.0	230.0	225.0					14																	20248587		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS32021.1	14q11.2	2013-09-23			ENSG00000176299	ENSG00000176299		"""GPCR / Class A : Olfactory receptors"""	14735	protein-coding gene	gene with protein product							Standard	NM_001005500		Approved		uc010tku.2	Q8NGD0	OTTHUMG00000170599	ENST00000315957.4:c.106T>C	14.37:g.20248587T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH18|Q6IFA3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L36	ENST00000315957.4	37	c.106	CCDS32021.1	14																																																																																			OR4M1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000176299		0.428	OR4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4M1	HGNC	protein_coding	OTTHUMT00000409770.1	123	0.00	0	T			20248587	20248587	+1	no_errors	ENST00000315957	ensembl	human	known	69_37n	silent	80	12.09	11	SNP	0.236	C
PCDHA4	56144	genome.wustl.edu	37	5	140188134	140188134	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr5:140188134G>A	ENST00000530339.1	+	1	1362	c.1362G>A	c.(1360-1362)gcG>gcA	p.A454A	PCDHA4_ENST00000512229.2_Silent_p.A454A|PCDHA2_ENST00000526136.1_Intron|PCDHA4_ENST00000356878.4_Silent_p.A454A|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018907.2	NP_061730.1	Q9UN74	PCDA4_HUMAN	protocadherin alpha 4	454	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(33)|ovary(6)|pancreas(1)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACGCTCCGGCGTTCGCGCAGC	0.647																																						dbGAP											0													71.0	72.0	72.0					5																	140188134		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152482	CCDS54916.1	5q31	2010-11-26				ENSG00000204967		"""Cadherins / Protocadherins : Clustered"""	8670	other	complex locus constituent	"""ortholog of mouse CNR1, KIAA0345-like 10"""	606310				10380929, 10662547	Standard	NM_018907		Approved	CNR1, CRNR1, PCDH-ALPHA4, CNRN1		Q9UN74		ENST00000530339.1:c.1362G>A	5.37:g.140188134G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75285|Q2M253	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.A454	ENST00000530339.1	37	c.1362	CCDS54916.1	5																																																																																			PCDHA4	-	superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000204967		0.647	PCDHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA4	HGNC	protein_coding	OTTHUMT00000372864.2	118	0.00	0	G	NM_018907		140188134	140188134	+1	no_errors	ENST00000530339	ensembl	human	known	69_37n	silent	98	32.88	48	SNP	0.000	A
PCLO	27445	genome.wustl.edu	37	7	82544297	82544297	+	Frame_Shift_Del	DEL	G	G	-			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr7:82544297delG	ENST00000333891.9	-	7	13342	c.13005delC	c.(13003-13005)gccfs	p.A4335fs	PCLO_ENST00000437081.1_Frame_Shift_Del_p.A1055fs|PCLO_ENST00000423517.2_Frame_Shift_Del_p.A4335fs	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein											breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						GCTTAGTTCTGGCAGAGGATG	0.433																																						dbGAP											0													89.0	86.0	87.0					7																	82544297		1887	4109	5996	-	-	-	SO:0001589	frameshift_variant	0			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.13005delC	7.37:g.82544297delG	ENSP00000334319:p.Ala4335fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.R4336fs	ENST00000333891.9	37	c.13005	CCDS47630.1	7																																																																																			PCLO	-	NULL	ENSG00000186472		0.433	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	52	0.00	0	G	NM_014510		82544297	82544297	-1	no_errors	ENST00000333891	ensembl	human	known	69_37n	frame_shift_del	37	25.00	13	DEL	0.760	-
PDZD7	79955	genome.wustl.edu	37	10	102783752	102783752	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr10:102783752G>A	ENST00000370215.3	-	3	525	c.300C>T	c.(298-300)agC>agT	p.S100S	PDZD7_ENST00000470414.1_Silent_p.S100S	NM_024895.4	NP_079171.1	Q9H5P4	PDZD7_HUMAN	PDZ domain containing 7	100	PDZ 1. {ECO:0000255|PROSITE- ProRule:PRU00143}.					cilium (GO:0005929)|extracellular space (GO:0005615)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22				Epithelial(162;6.98e-09)|all cancers(201;3.55e-07)		CCCCGCGCACGCTGAAGCCCA	0.587																																						dbGAP											0													96.0	87.0	90.0					10																	102783752		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK026862	CCDS31269.1, CCDS73182.1	10q24.32	2006-01-24		2006-01-24	ENSG00000186862	ENSG00000186862			26257	protein-coding gene	gene with protein product		612971		PDZK7		12477932	Standard	NM_024895		Approved	FLJ23209, bA108L7.8	uc021pxc.1	Q9H5P4	OTTHUMG00000018916	ENST00000370215.3:c.300C>T	10.37:g.102783752G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D5FJ77|Q8N321	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S100	ENST00000370215.3	37	c.300	CCDS31269.1	10																																																																																			PDZD7	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000186862		0.587	PDZD7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD7	HGNC	protein_coding	OTTHUMT00000049883.1	45	0.00	0	G	NM_024895		102783752	102783752	-1	no_errors	ENST00000370215	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	0.649	A
PDZRN4	29951	genome.wustl.edu	37	12	41961642	41961642	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr12:41961642G>A	ENST00000402685.2	+	9	1533	c.1525G>A	c.(1525-1527)Gag>Aag	p.E509K	PDZRN4_ENST00000298919.7_Missense_Mutation_p.E249K|PDZRN4_ENST00000539469.2_Missense_Mutation_p.E251K	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4	509							ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				GTTAAACTTGGAGATGTTGGA	0.398																																						dbGAP											0													97.0	88.0	91.0					12																	41961642		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.1525G>A	12.37:g.41961642G>A	ENSP00000384197:p.Glu509Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.E509K	ENST00000402685.2	37	c.1525	CCDS53777.1	12	.	.	.	.	.	.	.	.	.	.	G	17.54	3.416163	0.62511	.	.	ENSG00000165966	ENST00000402685;ENST00000539469;ENST00000298919	T;T;T	0.72942	-0.7;3.78;3.77	4.85	3.95	0.45737	.	0.246393	0.34362	N	0.004031	T	0.65913	0.2737	L	0.58101	1.795	0.45502	D	0.998465	P;B;B	0.35077	0.483;0.061;0.003	B;B;B	0.35182	0.122;0.197;0.055	T	0.68610	-0.5363	10	0.62326	D	0.03	-11.5463	11.0372	0.47808	0.0:0.1398:0.715:0.1452	.	509;249;251	Q6ZMN7;Q6ZMN7-4;Q6ZMN7-2	PZRN4_HUMAN;.;.	K	509;251;249	ENSP00000384197:E509K;ENSP00000439990:E251K;ENSP00000298919:E249K	ENSP00000298919:E249K	E	+	1	0	PDZRN4	40247909	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	6.438000	0.73426	1.347000	0.45714	0.585000	0.79938	GAG	PDZRN4	-	NULL	ENSG00000165966		0.398	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZRN4	HGNC	protein_coding	OTTHUMT00000403701.1	82	0.00	0	G	NM_013377		41961642	41961642	+1	no_errors	ENST00000402685	ensembl	human	known	69_37n	missense	48	15.79	9	SNP	1.000	A
PIK3C3	5289	genome.wustl.edu	37	18	39593429	39593429	+	Silent	SNP	A	A	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr18:39593429A>G	ENST00000262039.4	+	11	1280	c.1194A>G	c.(1192-1194)caA>caG	p.Q398Q	PIK3C3_ENST00000398870.3_Silent_p.Q335Q	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	398	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)			breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						ACCTATTACAATTGGTCCAGG	0.294										TSP Lung(28;0.18)																											NSCLC(37;552 1060 2683 16430 37914)	dbGAP											0													68.0	75.0	73.0					18																	39593429		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.1194A>G	18.37:g.39593429A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15134	Silent	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pirsf_PI3K_Vps34,pfscan_PI3/4_kinase_cat_dom	p.Q398	ENST00000262039.4	37	c.1194	CCDS11920.1	18																																																																																			PIK3C3	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom,pirsf_PI3K_Vps34	ENSG00000078142		0.294	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C3	HGNC	protein_coding	OTTHUMT00000255804.1	36	0.00	0	A	NM_002647		39593429	39593429	+1	no_errors	ENST00000262039	ensembl	human	known	69_37n	silent	39	11.36	5	SNP	0.992	G
PLEKHM1	9842	genome.wustl.edu	37	17	43514454	43514454	+	3'UTR	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:43514454C>T	ENST00000430334.3	-	0	4074				PLEKHM1_ENST00000580404.1_5'UTR|ARHGAP27_ENST00000528273.1_5'Flank|PLEKHM1_ENST00000421073.2_3'UTR	NM_014798.2	NP_055613.1	Q9Y4G2	PKHM1_HUMAN	pleckstrin homology domain containing, family M (with RUN domain) member 1						intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(6)|large_intestine(1)|lung(10)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26	Renal(3;0.0405)					CCAGTCATTTCTCCTTCTCCT	0.627																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			X85792	CCDS32671.1	17q21.31	2013-01-11				ENSG00000225190		"""Pleckstrin homology (PH) domain containing"""	29017	protein-coding gene	gene with protein product		611466				9205841, 12820725	Standard	NM_014798		Approved	KIAA0356	uc002ija.3	Q9Y4G2		ENST00000430334.3:c.*770G>A	17.37:g.43514454C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2R5|Q8TEL9|Q9NPP5|Q9NYA0	RNA	SNP	-	NULL	ENST00000430334.3	37	NULL	CCDS32671.1	17																																																																																			PLEKHM1	-	-	ENSG00000225190		0.627	PLEKHM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHM1	HGNC	protein_coding	OTTHUMT00000444659.1	49	0.00	0	C	NM_014798		43514454	43514454	-1	no_errors	ENST00000580404	ensembl	human	known	69_37n	rna	51	17.74	11	SNP	0.000	T
QSER1	79832	genome.wustl.edu	37	11	32956872	32956872	+	Silent	SNP	T	T	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr11:32956872T>A	ENST00000399302.2	+	4	4016	c.3681T>A	c.(3679-3681)tcT>tcA	p.S1227S	QSER1_ENST00000527788.1_Silent_p.S988S	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1227										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					AACATTTATCTTCATTTTCTT	0.363																																						dbGAP											0													144.0	144.0	144.0					11																	32956872		1826	4080	5906	-	-	-	SO:0001819	synonymous_variant	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.3681T>A	11.37:g.32956872T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.L248H	ENST00000399302.2	37	c.743	CCDS41631.1	11	.	.	.	.	.	.	.	.	.	.	T	0.609	-0.825885	0.02734	.	.	ENSG00000060749	ENST00000524678	.	.	.	5.31	4.13	0.48395	.	.	.	.	.	T	0.56292	0.1975	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54153	-0.8336	4	.	.	.	.	6.8521	0.24020	0.1347:0.0738:0.0:0.7915	.	.	.	.	H	248	.	.	L	+	2	0	QSER1	32913448	1.000000	0.71417	1.000000	0.80357	0.423000	0.31445	0.559000	0.23485	2.017000	0.59298	0.383000	0.25322	CTT	QSER1	-	NULL	ENSG00000060749		0.363	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	34	0.00	0	T	NM_024774		32956872	32956872	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524678	ensembl	human	putative	69_37n	missense	29	25.64	10	SNP	0.998	A
RASGRP2	10235	genome.wustl.edu	37	11	64502632	64502632	+	Missense_Mutation	SNP	C	C	T	rs569602568	byFrequency	TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr11:64502632C>T	ENST00000354024.3	-	12	1616	c.1364G>A	c.(1363-1365)cGt>cAt	p.R455H	RASGRP2_ENST00000394432.3_Missense_Mutation_p.R455H|RASGRP2_ENST00000377494.1_Missense_Mutation_p.R455H|RASGRP2_ENST00000377497.3_Missense_Mutation_p.R455H	NM_153819.1	NP_722541.1	Q7LDG7	GRP2_HUMAN	RAS guanyl releasing protein 2 (calcium and DAG-regulated)	455	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.|EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				blood coagulation (GO:0007596)|cellular response to calcium ion (GO:0071277)|platelet activation (GO:0030168)|positive regulation of Rap GTPase activity (GO:0032854)|Ras protein signal transduction (GO:0007265)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|diacylglycerol binding (GO:0019992)|guanyl-nucleotide exchange factor activity (GO:0005085)|lipid binding (GO:0008289)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAAGTTCCCACGGATGATCTG	0.592													C|||	2	0.000399361	0.0	0.0	5008	,	,		19981	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													133.0	107.0	116.0					11																	64502632		2201	4297	6498	-	-	-	SO:0001583	missense	0			U78170	CCDS31598.1	11q13	2014-09-17			ENSG00000068831	ENSG00000068831		"""EF-hand domain containing"""	9879	protein-coding gene	gene with protein product		605577				9789079	Standard	NM_001098670		Approved	CALDAG-GEFI	uc009ypv.3	Q7LDG7	OTTHUMG00000045420	ENST00000354024.3:c.1364G>A	11.37:g.64502632C>T	ENSP00000338864:p.Arg455His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDC7|O00538|Q9UL65	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,smart_EF_hand_Ca-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_EF_HAND_2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.R455H	ENST00000354024.3	37	c.1364	CCDS31598.1	11	.	.	.	.	.	.	.	.	.	.	C	28.4	4.920566	0.92249	.	.	ENSG00000068831	ENST00000377494;ENST00000394432;ENST00000377497;ENST00000354024	T;T;T;T	0.54866	0.55;0.55;0.55;0.55	4.79	4.79	0.61399	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.60130	0.2245	L	0.51422	1.61	0.80722	D	1	D;D	0.71674	0.998;0.998	P;P	0.54140	0.743;0.743	T	0.64453	-0.6404	10	0.66056	D	0.02	-15.0391	15.7071	0.77592	0.0:1.0:0.0:0.0	.	455;455	Q7LDG7;A6NDC7	GRP2_HUMAN;.	H	455	ENSP00000366714:R455H;ENSP00000377953:R455H;ENSP00000366717:R455H;ENSP00000338864:R455H	ENSP00000338864:R455H	R	-	2	0	RASGRP2	64259208	0.813000	0.29090	1.000000	0.80357	0.998000	0.95712	1.576000	0.36504	2.375000	0.81037	0.561000	0.74099	CGT	RASGRP2	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000068831		0.592	RASGRP2-002	NOVEL	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	RASGRP2	HGNC	protein_coding	OTTHUMT00000142062.1	58	0.00	0	C	NM_153819		64502632	64502632	-1	no_errors	ENST00000377494	ensembl	human	known	69_37n	missense	34	15.00	6	SNP	1.000	T
PPFIA1	8500	genome.wustl.edu	37	11	70211384	70211384	+	Intron	SNP	C	C	T	rs60917762	byFrequency	TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr11:70211384C>T	ENST00000253925.7	+	21	3080				PPFIA1_ENST00000389547.3_Intron|AP000487.6_ENST00000528607.1_RNA|PPFIA1_ENST00000530548.1_3'UTR	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1						cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			CTCCTCGGCCCCTTCTCTGTG	0.537													C|||	848	0.169329	0.3608	0.2075	5008	,	,		17575	0.0407		0.1233	False		,,,				2504	0.0634					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.2865+2790C>T	11.37:g.70211384C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLE3|Q13135|Q14567|Q8N4I2	RNA	SNP	-	NULL	ENST00000253925.7	37	NULL	CCDS31627.1	11																																																																																			PPFIA1	-	-	ENSG00000131626		0.537	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA1	HGNC	protein_coding	OTTHUMT00000393905.1	8	0.00	0	C	NM_003626		70211384	70211384	+1	no_errors	ENST00000530548	ensembl	human	known	69_37n	rna	10	33.33	5	SNP	0.957	T
RYR3	6263	genome.wustl.edu	37	15	34021156	34021156	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr15:34021156C>G	ENST00000389232.4	+	47	7202	c.7132C>G	c.(7132-7134)Caa>Gaa	p.Q2378E	RYR3_ENST00000415757.3_Missense_Mutation_p.Q2378E	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2378	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CATTAAGGATCAAACTTTTCT	0.448																																						dbGAP											0													79.0	78.0	78.0					15																	34021156		1866	4096	5962	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7132C>G	15.37:g.34021156C>G	ENSP00000373884:p.Gln2378Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.Q2378E	ENST00000389232.4	37	c.7132	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843800	0.91197	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.86432	-2.12;-2.12	4.85	4.85	0.62838	.	0.000000	0.85682	D	0.000000	D	0.93497	0.7925	M	0.83953	2.67	0.80722	D	1	D;D	0.64830	0.979;0.994	P;D	0.64687	0.725;0.928	D	0.94055	0.7321	10	0.66056	D	0.02	.	18.5111	0.90917	0.0:1.0:0.0:0.0	.	2378;2378	Q15413-2;Q15413	.;RYR3_HUMAN	E	2378	ENSP00000373884:Q2378E;ENSP00000399610:Q2378E	ENSP00000354735:Q2378E	Q	+	1	0	RYR3	31808448	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.609000	0.82925	2.687000	0.91594	0.563000	0.77884	CAA	RYR3	-	NULL	ENSG00000198838		0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	75	0.00	0	C			34021156	34021156	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	88	27.87	34	SNP	1.000	G
RYR3	6263	genome.wustl.edu	37	15	34021165	34021165	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr15:34021165C>A	ENST00000389232.4	+	47	7211	c.7141C>A	c.(7141-7143)Ctg>Atg	p.L2381M	RYR3_ENST00000415757.3_Missense_Mutation_p.L2381M	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	2381	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		TCAAACTTTTCTGCTCCACTT	0.448																																						dbGAP											0													76.0	75.0	75.0					15																	34021165		1861	4093	5954	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.7141C>A	15.37:g.34021165C>A	ENSP00000373884:p.Leu2381Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L2381M	ENST00000389232.4	37	c.7141	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	C	19.34	3.808842	0.70797	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.89196	-2.48;-2.48	4.85	3.93	0.45458	.	0.000000	0.64402	D	0.000004	D	0.93966	0.8068	M	0.79926	2.475	0.49915	D	0.999838	D;D	0.89917	0.999;1.0	D;D	0.83275	0.996;0.99	D	0.94515	0.7722	10	0.72032	D	0.01	.	13.3754	0.60736	0.0:0.9238:0.0:0.0762	.	2381;2381	Q15413-2;Q15413	.;RYR3_HUMAN	M	2381	ENSP00000373884:L2381M;ENSP00000399610:L2381M	ENSP00000354735:L2381M	L	+	1	2	RYR3	31808457	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	3.893000	0.56243	1.415000	0.47037	0.563000	0.77884	CTG	RYR3	-	NULL	ENSG00000198838		0.448	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	80	0.00	0	C			34021165	34021165	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	87	29.27	36	SNP	1.000	A
RYR3	6263	genome.wustl.edu	37	15	34080597	34080597	+	Silent	SNP	G	G	T	rs375009869		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr15:34080597G>T	ENST00000389232.4	+	67	9838	c.9768G>T	c.(9766-9768)gcG>gcT	p.A3256A	RYR3_ENST00000415757.3_Silent_p.A3256A	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3256					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		ACGAGTTCGCGGTCCTCTGCA	0.572																																						dbGAP											0													75.0	79.0	78.0					15																	34080597		2030	4200	6230	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.9768G>T	15.37:g.34080597G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.A3256	ENST00000389232.4	37	c.9768	CCDS45210.1	15																																																																																			RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.572	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	55	0.00	0	G			34080597	34080597	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	30	11.76	4	SNP	0.103	T
SDHAP1	255812	genome.wustl.edu	37	3	195711498	195711498	+	RNA	SNP	G	G	A	rs551198163		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr3:195711498G>A	ENST00000427841.1	-	0	449					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		GCTCCGTCACGTAGTGGATGG	0.587													-|||	1	0.000199681	0.0008	0.0	5008	,	,		29030	0.0		0.0	False		,,,				2504	0.0				Ovarian(67;1158 1227 12109 20189 43170)	dbGAP											0																																										-	-	-			0			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195711498G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-	ENSG00000185485		0.587	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	219	0.00	0	G			195711498	195711498	-1	no_errors	ENST00000427841	ensembl	human	known	69_37n	rna	207	11.16	26	SNP	1.000	A
SIN3B	23309	genome.wustl.edu	37	19	16980796	16980796	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:16980796C>T	ENST00000248054.5	+	13	2353	c.2332C>T	c.(2332-2334)Cgg>Tgg	p.R778W	SIN3B_ENST00000595541.1_Missense_Mutation_p.R368W|SIN3B_ENST00000379803.1_Missense_Mutation_p.R810W					SIN3 transcription regulator family member B											endometrium(4)|kidney(2)|large_intestine(8)|lung(8)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26						TCTGGAGTATCGGACCGAGAA	0.627																																						dbGAP											0													37.0	35.0	36.0					19																	16980796		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014600	CCDS32946.1, CCDS74308.1	19p13.12	2013-08-21	2013-08-21						19354	protein-coding gene	gene with protein product		607777	"""SIN3 homolog B, transcription regulator (yeast)"", ""SIN3 transcription regulator homolog B (yeast)"""			9734811	Standard	XM_005259832		Approved	KIAA0700	uc002ney.2	O75182		ENST00000248054.5:c.2332C>T	19.37:g.16980796C>T	ENSP00000248054:p.Arg778Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PAH,pfam_HDAC_interact,superfamily_PAH,smart_HDAC_interact	p.R810W	ENST00000248054.5	37	c.2428		19	.	.	.	.	.	.	.	.	.	.	C	18.58	3.655596	0.67586	.	.	ENSG00000127511	ENST00000379803;ENST00000248054	T;T	0.47869	0.83;0.83	4.56	3.44	0.39384	.	0.000000	0.64402	D	0.000001	T	0.52853	0.1760	N	0.21194	0.64	0.53005	D	0.999966	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.972;0.96	T	0.57300	-0.7835	10	0.56958	D	0.05	-47.5174	13.264	0.60122	0.1596:0.8404:0.0:0.0	.	368;778;810	B7Z392;O75182-2;O75182	.;.;SIN3B_HUMAN	W	810;778	ENSP00000369131:R810W;ENSP00000248054:R778W	ENSP00000248054:R778W	R	+	1	2	SIN3B	16841796	0.925000	0.31364	0.806000	0.32338	0.922000	0.55478	2.012000	0.40932	2.084000	0.62774	0.313000	0.20887	CGG	SIN3B	-	NULL	ENSG00000127511		0.627	SIN3B-001	KNOWN	basic|appris_principal	protein_coding	SIN3B	HGNC	protein_coding	OTTHUMT00000462846.1	58	0.00	0	C	NM_015260		16980796	16980796	+1	no_errors	ENST00000379803	ensembl	human	known	69_37n	missense	40	22.64	12	SNP	0.974	T
SLC26A4	5172	genome.wustl.edu	37	7	107355875	107355875	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr7:107355875G>A	ENST00000265715.3	+	21	2551	c.2327G>A	c.(2326-2328)cGt>cAt	p.R776H	SLC26A4_ENST00000544569.1_Missense_Mutation_p.R363H|SLC26A4_ENST00000543100.1_Missense_Mutation_p.R345H|SLC26A4_ENST00000541474.1_Missense_Mutation_p.R337H	NM_000441.1	NP_000432.1	O43511	S26A4_HUMAN	solute carrier family 26 (anion exchanger), member 4	776			R -> C (retains its ability to transport iodide in vitro; dbSNP:rs111033255). {ECO:0000269|PubMed:15689455, ECO:0000269|PubMed:16684826, ECO:0000269|PubMed:19204907}.		chloride transmembrane transport (GO:1902476)|inorganic anion transport (GO:0015698)|ion transport (GO:0006811)|regulation of pH (GO:0006885)|regulation of protein localization (GO:0032880)|sensory perception of sound (GO:0007605)|sulfate transmembrane transport (GO:1902358)|sulfate transport (GO:0008272)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	chloride transmembrane transporter activity (GO:0015108)|iodide transmembrane transporter activity (GO:0015111)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sulfate transmembrane transporter activity (GO:0015116)			central_nervous_system(2)|endometrium(1)|kidney(5)|large_intestine(8)|lung(16)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						CAGGCTATGCGTACACTTGCA	0.368									Pendred syndrome																													dbGAP											0													169.0	166.0	167.0					7																	107355875		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Goiter-Deafness syndrome	AF030880	CCDS5746.1	7q31	2013-07-18	2013-07-18		ENSG00000091137	ENSG00000091137		"""Solute carriers"""	8818	protein-coding gene	gene with protein product	"""pendrin"""	605646	"""solute carrier family 26, member 4"""	DFNB4		9500541, 11087667	Standard	NM_000441		Approved	PDS	uc003vep.3	O43511	OTTHUMG00000154807	ENST00000265715.3:c.2327G>A	7.37:g.107355875G>A	ENSP00000265715:p.Arg776His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z266|O43170	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.R776H	ENST00000265715.3	37	c.2327	CCDS5746.1	7	.	.	.	.	.	.	.	.	.	.	G	21.0	4.078618	0.76528	.	.	ENSG00000091137	ENST00000265715;ENST00000541474;ENST00000544569;ENST00000543100	D;D;D;D	0.95103	-3.27;-3.55;-3.61;-3.61	5.76	5.76	0.90799	.	0.174134	0.38436	N	0.001695	D	0.93051	0.7788	N	0.08118	0	0.45567	D	0.998515	D;D;D	0.76494	0.999;0.998;0.995	D;P;P	0.80764	0.994;0.791;0.719	D	0.91810	0.5459	10	0.25751	T	0.34	.	15.8335	0.78778	0.0:0.0:1.0:0.0	.	337;363;776	F5H104;B7Z6M6;O43511	.;.;S26A4_HUMAN	H	776;337;363;345	ENSP00000265715:R776H;ENSP00000439743:R337H;ENSP00000437427:R363H;ENSP00000441209:R345H	ENSP00000265715:R776H	R	+	2	0	SLC26A4	107143111	1.000000	0.71417	0.998000	0.56505	0.459000	0.32528	4.696000	0.61774	2.880000	0.98712	0.650000	0.86243	CGT	SLC26A4	-	NULL	ENSG00000091137		0.368	SLC26A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A4	HGNC	protein_coding	OTTHUMT00000337148.1	70	0.00	0	G	NM_000441		107355875	107355875	+1	no_errors	ENST00000265715	ensembl	human	known	69_37n	missense	42	30.00	18	SNP	1.000	A
SLMAP	7871	genome.wustl.edu	37	3	57846447	57846447	+	Nonsense_Mutation	SNP	C	C	T	rs201411146		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr3:57846447C>T	ENST00000428312.1	+	8	803	c.709C>T	c.(709-711)Cga>Tga	p.R237*	SLMAP_ENST00000295951.3_Nonsense_Mutation_p.R237*|SLMAP_ENST00000416870.1_5'UTR|SLMAP_ENST00000295952.3_Nonsense_Mutation_p.R237*|SLMAP_ENST00000449503.2_Nonsense_Mutation_p.R237*|SLMAP_ENST00000383718.3_Nonsense_Mutation_p.R237*			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	237					muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		AGATAGTTTACGAAAGGAACT	0.294																																						dbGAP											0													28.0	30.0	29.0					3																	57846447		2198	4299	6497	-	-	-	SO:0001587	stop_gained	0			AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.709C>T	3.37:g.57846447C>T	ENSP00000398661:p.Arg237*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Nonsense_Mutation	SNP	pfam_FHA_dom,pfam_PFD_beta-like,superfamily_SMAD_FHA_domain,superfamily_Prefoldin,smart_FHA_dom,pfscan_FHA_dom	p.R237*	ENST00000428312.1	37	c.709		3	.	.	.	.	.	.	.	.	.	.	C	34	5.318064	0.95682	.	.	ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000383718;ENST00000428312;ENST00000449503	.	.	.	5.36	4.39	0.52855	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.3468	14.8759	0.70493	0.2374:0.7625:0.0:0.0	.	.	.	.	X	237	.	ENSP00000295951:R237X	R	+	1	2	SLMAP	57821487	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.505000	0.53356	2.474000	0.83562	0.655000	0.94253	CGA	SLMAP	-	NULL	ENSG00000163681		0.294	SLMAP-013	KNOWN	basic	protein_coding	SLMAP	HGNC	protein_coding	OTTHUMT00000351584.1	15	0.00	0	C	NM_007159		57846447	57846447	+1	no_errors	ENST00000428312	ensembl	human	known	69_37n	nonsense	5	72.22	13	SNP	1.000	T
SMG6	23293	genome.wustl.edu	37	17	2202914	2202915	+	Missense_Mutation	DNP	GG	GG	AT			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:2202914_2202915GG>AT	ENST00000263073.6	-	2	1182_1183	c.1132_1133CC>AT	c.(1132-1134)CCt>ATt	p.P378I	SMG6_ENST00000544865.1_Missense_Mutation_p.P347I	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	378	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						GCCTTTGTCAGGCTTTCCTCTA	0.505																																					Melanoma(59;28 1088 11621 25887 46638 50814)	dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.1132_1133delinsAT	17.37:g.2202914_2202915delinsAT	ENSP00000263073:p.Pro378Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	pfam_EST1,smart_PINc_nuc-bd	p.P378L|p.P378T	ENST00000263073.6	37	c.1133|c.1132	CCDS11016.1	17																																																																																			SMG6	-	NULL	ENSG00000070366		0.505	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	41	0.00	0	G			2202914|2202915	2202914|2202915	-1	no_errors	ENST00000263073	ensembl	human	known	69_37n	missense	42	42.47	31	SNP	0.008|0.004	A|T
SMG6	23293	genome.wustl.edu	37	17	2203052	2203052	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:2203052G>A	ENST00000263073.6	-	2	1045	c.995C>T	c.(994-996)tCt>tTt	p.S332F	SMG6_ENST00000544865.1_Missense_Mutation_p.S301F	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	332	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CCCACGGCCAGACCAGTTTCT	0.473																																					Melanoma(59;28 1088 11621 25887 46638 50814)	dbGAP											0													128.0	120.0	123.0					17																	2203052		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.995C>T	17.37:g.2203052G>A	ENSP00000263073:p.Ser332Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z874|O94837|Q86VH6|Q9UF60	Missense_Mutation	SNP	pfam_EST1,smart_PINc_nuc-bd	p.S332F	ENST00000263073.6	37	c.995	CCDS11016.1	17	.	.	.	.	.	.	.	.	.	.	G	12.28	1.891905	0.33442	.	.	ENSG00000070366	ENST00000263073;ENST00000544865	T;T	0.09073	3.02;3.02	5.35	5.35	0.76521	.	0.677726	0.15375	N	0.265637	T	0.07548	0.0190	N	0.19112	0.55	0.25634	N	0.986274	P	0.38642	0.641	B	0.31751	0.135	T	0.25187	-1.0139	10	0.87932	D	0	-5.2683	19.0567	0.93069	0.0:0.0:1.0:0.0	.	332	Q86US8	EST1A_HUMAN	F	332;301	ENSP00000263073:S332F;ENSP00000443920:S301F	ENSP00000263073:S332F	S	-	2	0	SMG6	2149802	0.985000	0.35326	1.000000	0.80357	0.998000	0.95712	2.756000	0.47549	2.490000	0.84030	0.655000	0.94253	TCT	SMG6	-	NULL	ENSG00000070366		0.473	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	95	0.00	0	G			2203052	2203052	-1	no_errors	ENST00000263073	ensembl	human	known	69_37n	missense	54	49.53	53	SNP	0.608	A
SMG6	23293	genome.wustl.edu	37	17	2203543	2203543	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:2203543G>A	ENST00000263073.6	-	2	554	c.504C>T	c.(502-504)gtC>gtT	p.V168V	SMG6_ENST00000544865.1_Silent_p.V137V	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor	168	Interaction with telomeric DNA.				gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						CCTGGTTGAGGACTTCTTCCT	0.483																																					Melanoma(59;28 1088 11621 25887 46638 50814)	dbGAP											0													190.0	202.0	198.0					17																	2203543		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.504C>T	17.37:g.2203543G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z874|O94837|Q86VH6|Q9UF60	Silent	SNP	pfam_EST1,smart_PINc_nuc-bd	p.V168	ENST00000263073.6	37	c.504	CCDS11016.1	17																																																																																			SMG6	-	NULL	ENSG00000070366		0.483	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	84	0.00	0	G			2203543	2203543	-1	no_errors	ENST00000263073	ensembl	human	known	69_37n	silent	52	54.31	63	SNP	0.020	A
STAG1	10274	genome.wustl.edu	37	3	136221598	136221598	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr3:136221598C>G	ENST00000383202.2	-	8	956	c.700G>C	c.(700-702)Gtg>Ctg	p.V234L	STAG1_ENST00000236698.5_Missense_Mutation_p.V234L|STAG1_ENST00000434713.2_Missense_Mutation_p.V8L	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	234					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						GCAACATTCACCAGAGCAGTC	0.333																																						dbGAP											0													90.0	82.0	85.0					3																	136221598		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.700G>C	3.37:g.136221598C>G	ENSP00000372689:p.Val234Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00539|Q6P275	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.V234L	ENST00000383202.2	37	c.700	CCDS3090.1	3	.	.	.	.	.	.	.	.	.	.	C	35	5.503793	0.96371	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713	T;T;T	0.52295	0.67;0.67;0.67	5.67	5.67	0.87782	STAG (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.78046	0.4222	M	0.93594	3.435	0.80722	D	1	D;D;D	0.71674	0.998;0.998;0.998	D;D;D	0.87578	0.986;0.998;0.986	T	0.81450	-0.0927	10	0.46703	T	0.11	.	19.7542	0.96283	0.0:1.0:0.0:0.0	.	251;234;234	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	L	234;234;8	ENSP00000372689:V234L;ENSP00000236698:V234L;ENSP00000404396:V8L	ENSP00000236698:V234L	V	-	1	0	STAG1	137704288	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.786000	0.85741	2.677000	0.91161	0.491000	0.48974	GTG	STAG1	-	pfam_STAG,superfamily_ARM-type_fold	ENSG00000118007		0.333	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1	40	0.00	0	C	NM_005862		136221598	136221598	-1	no_errors	ENST00000383202	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	1.000	G
STX11	8676	genome.wustl.edu	37	6	144508475	144508475	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr6:144508475G>A	ENST00000367568.4	+	2	894	c.711G>A	c.(709-711)aaG>aaA	p.K237K		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	237	t-SNARE coiled-coil homology. {ECO:0000255|PROSITE-ProRule:PRU00202}.				cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		TGGTGGAGAAGCAGGCCGACA	0.632									Familial Hemophagocytic Lymphohistiocytosis																													dbGAP											0													60.0	51.0	54.0					6																	144508475		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.711G>A	6.37:g.144508475G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P598|O75378|O95148|Q5TCL6	Silent	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.K237	ENST00000367568.4	37	c.711	CCDS5205.1	6																																																																																			STX11	-	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	ENSG00000135604		0.632	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX11	HGNC	protein_coding	OTTHUMT00000042544.1	57	0.00	0	G			144508475	144508475	+1	no_errors	ENST00000367568	ensembl	human	known	69_37n	silent	48	18.64	11	SNP	1.000	A
TECRL	253017	genome.wustl.edu	37	4	65274933	65274933	+	Missense_Mutation	SNP	A	A	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr4:65274933A>G	ENST00000381210.3	-	1	247	c.137T>C	c.(136-138)cTa>cCa	p.L46P	TECRL_ENST00000507440.1_Missense_Mutation_p.L46P	NM_001010874.4	NP_001010874.2	Q5HYJ1	TECRL_HUMAN	trans-2,3-enoyl-CoA reductase-like	46					lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	oxidoreductase activity, acting on the CH-CH group of donors (GO:0016627)			endometrium(2)|kidney(5)|large_intestine(7)|lung(30)|prostate(1)|skin(1)|stomach(1)	47						AGTTGGTCTTAGAGGGCCCGC	0.383																																						dbGAP											0													78.0	78.0	78.0					4																	65274933		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833108	CCDS33990.1	4q13.1	2009-07-21			ENSG00000205678	ENSG00000205678			27365	protein-coding gene	gene with protein product	"""glycoprotein, synaptic 2-like"""					12477932	Standard	NM_001010874		Approved	GPSN2L, SRD5A2L2, DKFZp313D0829, DKFZp313B2333, TERL	uc003hcv.3	Q5HYJ1	OTTHUMG00000160680	ENST00000381210.3:c.137T>C	4.37:g.65274933A>G	ENSP00000370607:p.Leu46Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_3-oxo-5_a-steroid_4-DH_C,pfscan_3-oxo-5_a-steroid_4-DH_C	p.L46P	ENST00000381210.3	37	c.137	CCDS33990.1	4	.	.	.	.	.	.	.	.	.	.	A	12.95	2.090421	0.36855	.	.	ENSG00000205678	ENST00000507440;ENST00000381210;ENST00000509536	T;T;T	0.41400	1.0;1.0;1.0	4.99	4.99	0.66335	.	0.236083	0.30043	N	0.010549	T	0.57621	0.2066	L	0.59436	1.845	0.58432	D	0.999996	D;D	0.69078	0.997;0.989	D;P	0.66351	0.943;0.831	T	0.60919	-0.7167	10	0.72032	D	0.01	-12.7687	12.3572	0.55182	1.0:0.0:0.0:0.0	.	46;46	Q6IN47;Q5HYJ1	.;TECRL_HUMAN	P	46	ENSP00000426043:L46P;ENSP00000370607:L46P;ENSP00000422497:L46P	ENSP00000370607:L46P	L	-	2	0	TECRL	64957528	0.972000	0.33761	0.839000	0.33178	0.004000	0.04260	5.792000	0.69052	2.001000	0.58596	0.533000	0.62120	CTA	TECRL	-	NULL	ENSG00000205678		0.383	TECRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECRL	HGNC	protein_coding	OTTHUMT00000361705.4	56	0.00	0	A	NM_001010874		65274933	65274933	-1	no_errors	ENST00000381210	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	0.976	G
THSD4	79875	genome.wustl.edu	37	15	72057488	72057488	+	Missense_Mutation	SNP	T	T	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr15:72057488T>A	ENST00000355327.3	+	16	2853	c.2719T>A	c.(2719-2721)Tgc>Agc	p.C907S	THSD4_ENST00000357769.4_Missense_Mutation_p.C547S|THSD4_ENST00000261862.6_Missense_Mutation_p.C907S|THSD4_ENST00000567838.1_3'UTR			Q6ZMP0	THSD4_HUMAN	thrombospondin, type I, domain containing 4	907	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				elastic fiber assembly (GO:0048251)	extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)			breast(1)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(20)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						CCAGCAATCCTGCCACCTCAA	0.517																																						dbGAP											0													94.0	95.0	94.0					15																	72057488		1932	4149	6081	-	-	-	SO:0001583	missense	0			AK023772	CCDS10238.2, CCDS66817.1	15q23	2009-11-09			ENSG00000187720	ENSG00000187720			25835	protein-coding gene	gene with protein product		614476				19734141	Standard	NM_001286429		Approved	FVSY9334, PRO34005, FLJ13710, ADAMTSL6	uc002atb.1	Q6ZMP0	OTTHUMG00000133389	ENST00000355327.3:c.2719T>A	15.37:g.72057488T>A	ENSP00000347484:p.Cys907Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTY3|B4DR13|Q6MZI3|Q6UXZ8|Q9H8E4	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.C907S	ENST00000355327.3	37	c.2719	CCDS10238.2	15	.	.	.	.	.	.	.	.	.	.	T	24.7	4.555012	0.86231	.	.	ENSG00000187720	ENST00000355327;ENST00000261862;ENST00000357769	D;D;D	0.96459	-4.02;-4.02;-4.02	4.5	4.5	0.54988	.	.	.	.	.	D	0.98943	0.9641	H	0.99444	4.57	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.98565	1.0643	9	0.87932	D	0	.	11.7735	0.51972	0.0:0.0:0.0:1.0	.	547;907	B4DR13;Q6ZMP0	.;THSD4_HUMAN	S	907;907;547	ENSP00000347484:C907S;ENSP00000261862:C907S;ENSP00000350413:C547S	ENSP00000261862:C907S	C	+	1	0	THSD4	69844542	1.000000	0.71417	0.995000	0.50966	0.984000	0.73092	7.398000	0.79919	1.872000	0.54250	0.379000	0.24179	TGC	THSD4	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000187720		0.517	THSD4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THSD4	HGNC	protein_coding	OTTHUMT00000257253.2	89	0.00	0	T	NM_024817		72057488	72057488	+1	no_errors	ENST00000261862	ensembl	human	known	69_37n	missense	55	12.70	8	SNP	1.000	A
THSD7A	221981	genome.wustl.edu	37	7	11676273	11676273	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr7:11676273G>A	ENST00000423059.4	-	2	757	c.506C>T	c.(505-507)gCg>gTg	p.A169V	THSD7A_ENST00000480061.1_5'UTR	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	169					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.A169E(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		GATATCCTCCGCAGGAATGTC	0.478										HNSCC(18;0.044)																												dbGAP											1	Substitution - Missense(1)	large_intestine(1)											97.0	95.0	95.0					7																	11676273		2011	4203	6214	-	-	-	SO:0001583	missense	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.506C>T	7.37:g.11676273G>A	ENSP00000406482:p.Ala169Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.A169V	ENST00000423059.4	37	c.506	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	G	10.61	1.398225	0.25205	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.57273	0.41	5.57	5.57	0.84162	.	0.044879	0.85682	D	0.000000	T	0.31167	0.0788	N	0.05199	-0.095	0.80722	D	1	B	0.28178	0.202	B	0.26864	0.074	T	0.28808	-1.0032	10	0.02654	T	1	.	19.9278	0.97110	0.0:0.0:1.0:0.0	.	169	Q9UPZ6	THS7A_HUMAN	V	169	ENSP00000406482:A169V	ENSP00000262042:A169V	A	-	2	0	THSD7A	11642798	1.000000	0.71417	0.179000	0.23059	0.634000	0.38068	8.009000	0.88606	2.770000	0.95276	0.650000	0.86243	GCG	THSD7A	-	superfamily_Thrombospondin_1_rpt	ENSG00000005108		0.478	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	32	0.00	0	G	XM_928187.2		11676273	11676273	-1	no_errors	ENST00000423059	ensembl	human	known	69_37n	missense	26	31.58	12	SNP	0.992	A
TLE1	7088	genome.wustl.edu	37	9	84202721	84202721	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr9:84202721C>G	ENST00000376499.3	-	17	2916	c.1852G>C	c.(1852-1854)Gga>Cga	p.G618R		NM_005077.3	NP_005068.2	Q04724	TLE1_HUMAN	transducin-like enhancer of split 1 (E(sp1) homolog, Drosophila)	618					multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation of gene expression (GO:0010628)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription factor binding (GO:0008134)	p.G618R(2)|p.G618*(1)		NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	29						CAGCTGGCTCCGTCTGTGTGG	0.502																																					NSCLC(155;1437 1995 30668 39354 45875)|Melanoma(16;266 781 14000 47728 51870)	dbGAP											3	Substitution - Missense(2)|Substitution - Nonsense(1)	lung(2)|endometrium(1)											79.0	78.0	78.0					9																	84202721		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6661.1	9q21.32	2013-01-10	2001-11-28		ENSG00000196781	ENSG00000196781		"""WD repeat domain containing"""	11837	protein-coding gene	gene with protein product	"""enhancer of split groucho 1"""	600189	"""transducin-like enhancer of split 1, homolog of Drosophila E(sp1)"""			8365415, 8808280	Standard	NM_005077		Approved	ESG1, GRG1, ESG	uc004aly.3	Q04724	OTTHUMG00000021008	ENST00000376499.3:c.1852G>C	9.37:g.84202721C>G	ENSP00000365682:p.Gly618Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K495|Q5T3G4|Q969V9	Missense_Mutation	SNP	pfam_Groucho/TLE_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.G618R	ENST00000376499.3	37	c.1852	CCDS6661.1	9	.	.	.	.	.	.	.	.	.	.	c	32	5.189676	0.94923	.	.	ENSG00000196781	ENST00000376499	T	0.60797	0.16	5.76	5.76	0.90799	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.65471	0.2694	N	0.16790	0.44	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70368	-0.4891	10	0.87932	D	0	-12.0128	19.9738	0.97296	0.0:1.0:0.0:0.0	.	603;618	B4DEF9;Q04724	.;TLE1_HUMAN	R	618	ENSP00000365682:G618R	ENSP00000365682:G618R	G	-	1	0	TLE1	83392541	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	7.818000	0.86416	2.732000	0.93576	0.655000	0.94253	GGA	TLE1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196781		0.502	TLE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLE1	HGNC	protein_coding	OTTHUMT00000055407.1	48	0.00	0	C	NM_005077		84202721	84202721	-1	no_errors	ENST00000376499	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	1.000	G
TLR8	51311	genome.wustl.edu	37	X	12939277	12939277	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chrX:12939277C>A	ENST00000218032.6	+	2	2205	c.2118C>A	c.(2116-2118)agC>agA	p.S706R	TLR8_ENST00000311912.5_Missense_Mutation_p.S724R	NM_138636.4	NP_619542.1	Q9NR97	TLR8_HUMAN	toll-like receptor 8	706					cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immunoglobulin mediated immune response (GO:0016064)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|regulation of cytokine secretion (GO:0050707)|response to virus (GO:0009615)|toll-like receptor 8 signaling pathway (GO:0034158)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	endolysosome membrane (GO:0036020)|endoplasmic reticulum membrane (GO:0005789)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|receptor activity (GO:0004872)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	50					Imiquimod(DB00724)	TAACTGATAGCCTATCTGACT	0.413																																						dbGAP											0													114.0	110.0	111.0					X																	12939277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF246971	CCDS14152.1, CCDS14153.1	Xp22	2009-11-23			ENSG00000101916	ENSG00000101916		"""CD molecules"""	15632	protein-coding gene	gene with protein product		300366				11022119	Standard	NM_138636		Approved	CD288	uc004cve.3	Q9NR97	OTTHUMG00000021145	ENST00000218032.6:c.2118C>A	X.37:g.12939277C>A	ENSP00000218032:p.Ser706Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3Y654|D1CS70|D1CS76|Q495P4|Q6UXL6|Q9NYG9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.S706R	ENST00000218032.6	37	c.2118	CCDS14152.1	X	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.455947	0.00173	.	.	ENSG00000101916	ENST00000218032;ENST00000311912	T;T	0.81078	-1.45;-1.45	5.82	3.74	0.42951	.	0.618308	0.14418	N	0.320829	T	0.55862	0.1947	N	0.10760	0.04	0.09310	N	1	P;P	0.42735	0.788;0.788	B;B	0.39876	0.312;0.312	T	0.49113	-0.8973	10	0.10111	T	0.7	.	3.5017	0.07676	0.1926:0.5298:0.1129:0.1648	.	706;724	Q9NR97;D1CS70	TLR8_HUMAN;.	R	706;724	ENSP00000218032:S706R;ENSP00000312082:S724R	ENSP00000218032:S706R	S	+	3	2	TLR8	12849198	0.000000	0.05858	0.202000	0.23494	0.008000	0.06430	-1.315000	0.02713	1.228000	0.43614	0.600000	0.82982	AGC	TLR8	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000101916		0.413	TLR8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR8	HGNC	protein_coding	OTTHUMT00000055784.2	23	0.00	0	C	NM_016610		12939277	12939277	+1	no_errors	ENST00000218032	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	0.000	A
TRANK1	9881	genome.wustl.edu	37	3	36872500	36872500	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr3:36872500G>A	ENST00000429976.2	-	21	8689	c.8442C>T	c.(8440-8442)gaC>gaT	p.D2814D	TRANK1_ENST00000428977.2_Silent_p.D2264D|TRANK1_ENST00000301807.6_Silent_p.D2264D	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2814							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						TTTGCTCGATGTCCTGCACCA	0.537																																						dbGAP											0													259.0	253.0	255.0					3																	36872500		2115	4229	6344	-	-	-	SO:0001819	synonymous_variant	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.8442C>T	3.37:g.36872500G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8K0	Silent	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.D2814	ENST00000429976.2	37	c.8442	CCDS46789.2	3																																																																																			TRANK1	-	NULL	ENSG00000168016		0.537	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		39	0.00	0	G	NM_014831		36872500	36872500	-1	no_errors	ENST00000429976	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.971	A
TRMT1	55621	genome.wustl.edu	37	19	13216335	13216335	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:13216335C>A	ENST00000592062.1	-	16	2239	c.1669G>T	c.(1669-1671)Gcc>Tcc	p.A557S	TRMT1_ENST00000221504.8_Missense_Mutation_p.A528S|TRMT1_ENST00000437766.1_Missense_Mutation_p.A557S|TRMT1_ENST00000357720.4_Missense_Mutation_p.A557S|LYL1_ENST00000264824.4_5'Flank			Q9NXH9	TRM1_HUMAN	tRNA methyltransferase 1 homolog (S. cerevisiae)	557							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|tRNA (guanine-N2-)-methyltransferase activity (GO:0004809)|tRNA binding (GO:0000049)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	14			OV - Ovarian serous cystadenocarcinoma(19;6.08e-22)	GBM - Glioblastoma multiforme(1328;0.0356)		CCCCAGTTGGCCTCCGGGTTA	0.662																																						dbGAP											0													61.0	72.0	68.0					19																	13216335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF196479	CCDS12293.1, CCDS45997.1	19p13.13	2012-06-12	2012-06-12						25980	protein-coding gene	gene with protein product		611669				10982862	Standard	NM_001142554		Approved	FLJ20244, TRM1	uc002mwl.3	Q9NXH9		ENST00000592062.1:c.1669G>T	19.37:g.13216335C>A	ENSP00000466967:p.Ala557Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O76103|Q548Y5|Q8WVA6	Missense_Mutation	SNP	pfam_tRNA_MeTrfase_TRM1,pfam_Znf_CCCH,pfam_tRNA_Trfase_Trm5/Tyw2,smart_Znf_CCCH,tigrfam_tRNA_MeTrfase_TRM1	p.A557S	ENST00000592062.1	37	c.1669	CCDS12293.1	19	.	.	.	.	.	.	.	.	.	.	C	13.45	2.240689	0.39598	.	.	ENSG00000104907	ENST00000357720;ENST00000437766;ENST00000221504	T;T;T	0.09163	3.01;3.01;3.01	4.4	3.34	0.38264	.	0.137128	0.47455	D	0.000226	T	0.13200	0.0320	L	0.60957	1.885	0.45330	D	0.998323	B;B	0.33512	0.415;0.129	B;B	0.38458	0.274;0.041	T	0.06899	-1.0801	10	0.17369	T	0.5	-21.6924	11.906	0.52713	0.0:0.8221:0.1779:0.0	.	528;557	Q9NXH9-2;Q9NXH9	.;TRM1_HUMAN	S	557;557;528	ENSP00000350352:A557S;ENSP00000416149:A557S;ENSP00000221504:A528S	ENSP00000221504:A528S	A	-	1	0	TRMT1	13077335	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	2.508000	0.45450	1.048000	0.40298	0.462000	0.41574	GCC	TRMT1	-	NULL	ENSG00000104907		0.662	TRMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT1	HGNC	protein_coding	OTTHUMT00000452780.2	36	0.00	0	C	NM_017722		13216335	13216335	-1	no_errors	ENST00000357720	ensembl	human	known	69_37n	missense	22	47.62	20	SNP	1.000	A
TSHZ3	57616	genome.wustl.edu	37	19	31769718	31769718	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:31769718C>G	ENST00000240587.4	-	2	1308	c.981G>C	c.(979-981)gaG>gaC	p.E327D		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	327					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GGAGCTCCAGCTCCAGGGAAG	0.527																																						dbGAP											0													125.0	129.0	128.0					19																	31769718		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.981G>C	19.37:g.31769718C>G	ENSP00000240587:p.Glu327Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0G6|Q9P254	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E327D	ENST00000240587.4	37	c.981	CCDS12421.2	19	.	.	.	.	.	.	.	.	.	.	C	0.583	-0.836437	0.02692	.	.	ENSG00000121297	ENST00000240587	T	0.11063	2.81	5.46	3.31	0.37934	.	0.113720	0.64402	D	0.000014	T	0.05090	0.0136	N	0.11724	0.165	0.49798	D	0.999826	B	0.11235	0.004	B	0.08055	0.003	T	0.21177	-1.0253	10	0.02654	T	1	-36.7611	11.6612	0.51347	0.0:0.8553:0.0:0.1447	.	327	Q63HK5	TSH3_HUMAN	D	327	ENSP00000240587:E327D	ENSP00000240587:E327D	E	-	3	2	TSHZ3	36461558	1.000000	0.71417	1.000000	0.80357	0.835000	0.47333	3.191000	0.50981	1.268000	0.44264	0.655000	0.94253	GAG	TSHZ3	-	NULL	ENSG00000121297		0.527	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	70	0.00	0	C	NM_020856		31769718	31769718	-1	no_errors	ENST00000240587	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	G
CFAP46	54777	genome.wustl.edu	37	10	134733643	134733643	+	Silent	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr10:134733643C>T	ENST00000368586.5	-	14	1750	c.1650G>A	c.(1648-1650)gcG>gcA	p.A550A	TTC40_ENST00000368582.2_Silent_p.A550A	NM_001200049.2	NP_001186978.2														breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						GCCACGCCTTCGCACAGAGGT	0.637																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0																														ENST00000368586.5:c.1650G>A	10.37:g.134733643C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.A550	ENST00000368586.5	37	c.1650	CCDS58101.1	10																																																																																			TTC40	-	NULL	ENSG00000171811		0.637	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	94	0.00	0	C			134733643	134733643	-1	no_errors	ENST00000368582	ensembl	human	known	69_37n	silent	48	21.31	13	SNP	0.011	T
TXNIP	10628	genome.wustl.edu	37	1	145441247	145441247	+	3'UTR	SNP	C	C	G	rs371598136		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr1:145441247C>G	ENST00000369317.4	+	0	1539				TXNIP_ENST00000475171.1_3'UTR	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein						cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					GCAGCTTTACCTACTTGTTTC	0.438																																						dbGAP											0													87.0	84.0	85.0					1																	145441247		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.*29C>G	1.37:g.145441247C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3D3|Q16226|Q6PML0|Q9BXG9	RNA	SNP	-	NULL	ENST00000369317.4	37	NULL	CCDS913.1	1																																																																																			TXNIP	-	-	ENSG00000117289		0.438	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNIP	HGNC	protein_coding	OTTHUMT00000038547.1	83	0.00	0	C	NM_006472		145441247	145441247	+1	no_errors	ENST00000475171	ensembl	human	known	69_37n	rna	60	14.29	10	SNP	0.035	G
CCDC144A	9720	genome.wustl.edu	37	17	16706676	16706676	+	3'UTR	SNP	C	C	G			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:16706676C>G	ENST00000443444.2	+	0	7821				USP32P1_ENST00000393005.2_RNA|RP11-219A15.4_ENST00000602730.1_RNA|RP11-219A15.2_ENST00000582895.1_lincRNA|RP11-219A15.1_ENST00000448331.3_3'UTR			A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A																		AGTGGTTGTTCTTTTCCGTGT	0.388																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000443444.2:c.*3397C>G	17.37:g.16706676C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O60311|Q6ZU57	RNA	SNP	-	NULL	ENST00000443444.2	37	NULL	CCDS45621.1	17																																																																																			USP32P1	-	-	ENSG00000188933		0.388	CCDC144A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP32P1	HGNC	protein_coding		138	0.00	0	C			16706676	16706676	+1	no_errors	ENST00000341745	ensembl	human	known	69_37n	rna	73	26.26	26	SNP	0.557	G
USP32	84669	genome.wustl.edu	37	17	58258807	58258807	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr17:58258807G>C	ENST00000300896.4	-	32	4620	c.4426C>G	c.(4426-4428)Cat>Gat	p.H1476D	USP32_ENST00000592339.1_Missense_Mutation_p.H1146D	NM_032582.3	NP_115971.2	Q8NFA0	UBP32_HUMAN	ubiquitin specific peptidase 32	1476	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			NS(3)|breast(5)|endometrium(5)|kidney(4)|large_intestine(12)|liver(1)|lung(24)|pancreas(1)|prostate(3)|skin(3)|urinary_tract(1)	62	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;2.02e-11)|all cancers(12;5.23e-10)|Colorectal(3;0.198)			CATGCTTCATGCTCATAAAGG	0.502																																						dbGAP											0													108.0	94.0	99.0					17																	58258807		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF533230	CCDS32697.1	17q23.3	2013-01-10	2005-08-08		ENSG00000170832	ENSG00000170832		"""Ubiquitin-specific peptidases"", ""EF-hand domain containing"""	19143	protein-coding gene	gene with protein product		607740	"""ubiquitin specific protease 32"""			12838346	Standard	NM_032582		Approved	NY-REN-60, USP10	uc002iyo.1	Q8NFA0		ENST00000300896.4:c.4426C>G	17.37:g.58258807G>C	ENSP00000300896:p.His1476Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5T3|Q9BX85|Q9Y591	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_EF_hand_Ca-bd,smart_Pept_C19_DUSP,pfscan_EF_HAND_2,pfscan_Peptidase_C19,prints_Recoverin	p.H1476D	ENST00000300896.4	37	c.4426	CCDS32697.1	17	.	.	.	.	.	.	.	.	.	.	G	15.00	2.703249	0.48412	.	.	ENSG00000170832	ENST00000300896	T	0.40756	1.02	5.37	5.37	0.77165	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.070853	0.64402	D	0.000014	T	0.30355	0.0762	N	0.14661	0.345	0.80722	D	1	B	0.23185	0.081	B	0.25506	0.061	T	0.06092	-1.0846	10	0.26408	T	0.33	.	18.4546	0.90715	0.0:0.0:1.0:0.0	.	1476	Q8NFA0	UBP32_HUMAN	D	1476	ENSP00000300896:H1476D	ENSP00000300896:H1476D	H	-	1	0	USP32	55613589	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.847000	0.62867	2.682000	0.91365	0.555000	0.69702	CAT	USP32	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000170832		0.502	USP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP32	HGNC	protein_coding	OTTHUMT00000449235.2	140	0.00	0	G	NM_032582		58258807	58258807	-1	no_errors	ENST00000300896	ensembl	human	known	69_37n	missense	177	15.31	32	SNP	1.000	C
VWF	7450	genome.wustl.edu	37	12	6134806	6134806	+	Silent	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr12:6134806C>T	ENST00000261405.5	-	24	3416	c.3162G>A	c.(3160-3162)acG>acA	p.T1054T		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1054	VWFD 3. {ECO:0000255|PROSITE- ProRule:PRU00580}.				blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	AATCCACCATCGTCTGCTTCA	0.557																																						dbGAP											0													23.0	23.0	23.0					12																	6134806		2201	4274	6475	-	-	-	SO:0001819	synonymous_variant	0				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3162G>A	12.37:g.6134806C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCE8|Q99806	Silent	SNP	pirsf_VWF,pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.T1054	ENST00000261405.5	37	c.3162	CCDS8539.1	12																																																																																			VWF	-	pirsf_VWF,smart_Unchr_dom_Cys-rich	ENSG00000110799		0.557	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	58	0.00	0	C	NM_000552		6134806	6134806	-1	no_errors	ENST00000261405	ensembl	human	known	69_37n	silent	65	14.47	11	SNP	0.587	T
WDR83OS	51398	genome.wustl.edu	37	19	12779224	12779224	+	Silent	SNP	G	G	A			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:12779224G>A	ENST00000596731.1	-	4	2222	c.270C>T	c.(268-270)gcC>gcT	p.A90A	WDR83_ENST00000242796.4_5'Flank|MAN2B1_ENST00000456935.2_5'Flank|CTD-2192J16.24_ENST00000597961.1_Intron|WDR83_ENST00000418543.3_Intron|MAN2B1_ENST00000221363.4_5'Flank|WDR83OS_ENST00000600694.1_5'Flank|WDR83OS_ENST00000222190.5_Silent_p.A88A	NM_016145.3	NP_057229.1	Q9Y284	ASTER_HUMAN	WD repeat domain 83 opposite strand	90						integral component of membrane (GO:0016021)											ACATCACCACGGCAGAGATGG	0.567																																						dbGAP											0													85.0	66.0	73.0					19																	12779224		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151898	CCDS12274.1	19p13.2	2011-11-24	2011-11-24	2011-11-24	ENSG00000105583	ENSG00000105583			30203	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 56"""	C19orf56		10810093	Standard	NM_016145		Approved	PTD008	uc002mud.2	Q9Y284		ENST00000596731.1:c.270C>T	19.37:g.12779224G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4T8|Q9BVI3	Silent	SNP	pfam_UPF0139	p.A90	ENST00000596731.1	37	c.270	CCDS12274.1	19																																																																																			WDR83OS	-	pfam_UPF0139	ENSG00000105583		0.567	WDR83OS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR83OS	HGNC	protein_coding	OTTHUMT00000462702.1	89	0.00	0	G	NM_016145		12779224	12779224	-1	no_errors	ENST00000222190	ensembl	human	known	69_37n	silent	49	18.33	11	SNP	0.355	A
WDR91	29062	genome.wustl.edu	37	7	134871826	134871826	+	Silent	SNP	G	G	A	rs201303963		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr7:134871826G>A	ENST00000354475.4	-	14	2008	c.1977C>T	c.(1975-1977)agC>agT	p.S659S	WDR91_ENST00000344400.5_Missense_Mutation_p.R622W|WDR91_ENST00000423565.1_Silent_p.S624S	NM_014149.3	NP_054868.3	A4D1P6	WDR91_HUMAN	WD repeat domain 91	659										breast(3)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	40						GCTTGTAGCCGCTGTATCCAG	0.557													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18618	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													91.0	93.0	92.0					7																	134871826		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF161534	CCDS34758.1	7q33	2013-01-09			ENSG00000105875	ENSG00000105875		"""WD repeat domain containing"""	24997	protein-coding gene	gene with protein product						11042152, 11230166	Standard	NM_014149		Approved	HSPC049	uc003vsp.2	A4D1P6	OTTHUMG00000155414	ENST00000354475.4:c.1977C>T	7.37:g.134871826G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK54|C9JMI4|Q6FI65|Q6MZQ1|Q6P4I1|Q96AE5|Q96G63|Q9H062|Q9H9B6|Q9NVG7|Q9NZY6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.R622W	ENST00000354475.4	37	c.1864	CCDS34758.1	7	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195080	0.58017	.	.	ENSG00000105875	ENST00000344400	T	0.35236	1.32	5.41	2.55	0.30701	.	.	.	.	.	T	0.37705	0.1013	.	.	.	0.27531	N	0.951083	.	.	.	.	.	.	T	0.26985	-1.0087	6	0.56958	D	0.05	-32.3103	8.841	0.35142	0.3618:0.0:0.6382:0.0	.	.	.	.	W	622	ENSP00000340877:R622W	ENSP00000340877:R622W	R	-	1	2	WDR91	134522366	0.738000	0.28186	1.000000	0.80357	0.980000	0.70556	0.014000	0.13333	0.742000	0.32697	0.591000	0.81541	CGG	WDR91	-	NULL	ENSG00000105875		0.557	WDR91-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR91	HGNC	protein_coding	OTTHUMT00000340019.1	46	0.00	0	G	NM_014149		134871826	134871826	-1	no_errors	ENST00000344400	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	A
CFAP43	80217	genome.wustl.edu	37	10	105932288	105932288	+	Silent	SNP	C	C	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr10:105932288C>T	ENST00000278064.2	-	20	2584	c.2259G>A	c.(2257-2259)ctG>ctA	p.L753L	WDR96_ENST00000357060.3_Silent_p.L822L|WDR96_ENST00000428666.1_Silent_p.L823L																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CCATCATATTCAGAATCTGAA	0.294																																						dbGAP											0													60.0	54.0	56.0					10																	105932288		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000278064.2:c.2259G>A	10.37:g.105932288C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu	p.L822	ENST00000278064.2	37	c.2466		10																																																																																			WDR96	-	NULL	ENSG00000197748		0.294	WDR96-003	KNOWN	basic	protein_coding	WDR96	HGNC	protein_coding	OTTHUMT00000050200.1	74	0.00	0	C			105932288	105932288	-1	no_errors	ENST00000357060	ensembl	human	known	69_37n	silent	65	17.72	14	SNP	0.000	T
XKR9	389668	genome.wustl.edu	37	8	71619175	71619175	+	Missense_Mutation	SNP	T	T	C			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr8:71619175T>C	ENST00000408926.3	+	4	814	c.280T>C	c.(280-282)Ttt>Ctt	p.F94L	XKR9_ENST00000520030.1_Missense_Mutation_p.F94L|XKR9_ENST00000520273.1_3'UTR	NM_001011720.1	NP_001011720.1	Q5GH70	XKR9_HUMAN	XK, Kell blood group complex subunit-related family, member 9	94						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(4)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	19	Breast(64;0.0716)		Epithelial(68;0.00301)|all cancers(69;0.0165)|OV - Ovarian serous cystadenocarcinoma(28;0.0524)|BRCA - Breast invasive adenocarcinoma(89;0.166)			TAGGTATTGGTTTGCCTTAAA	0.284																																						dbGAP											0													55.0	58.0	57.0					8																	71619175		2203	4298	6501	-	-	-	SO:0001583	missense	0			AY534247	CCDS34905.1	8q13.3	2006-01-12	2006-01-12			ENSG00000221947			20937	protein-coding gene	gene with protein product			"""X Kell blood group precursor-related family, member 9"""				Standard	NM_001287258		Approved		uc003xyq.3	Q5GH70		ENST00000408926.3:c.280T>C	8.37:g.71619175T>C	ENSP00000386141:p.Phe94Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNS9|B9EH74	Missense_Mutation	SNP	pfam_Transport_prot_XK	p.F94L	ENST00000408926.3	37	c.280	CCDS34905.1	8	.	.	.	.	.	.	.	.	.	.	T	8.045	0.764825	0.15914	.	.	ENSG00000221947	ENST00000408926;ENST00000520030	T;T	0.62788	-0.0;-0.0	5.29	2.75	0.32379	.	0.485937	0.23648	N	0.045950	T	0.51822	0.1697	M	0.63428	1.95	0.40126	D	0.976665	B	0.21381	0.055	B	0.24974	0.057	T	0.41324	-0.9515	10	0.22109	T	0.4	-16.948	4.0256	0.09685	0.1537:0.1676:0.0:0.6787	.	94	Q5GH70	XKR9_HUMAN	L	94	ENSP00000386141:F94L;ENSP00000431088:F94L	ENSP00000386141:F94L	F	+	1	0	XKR9	71781729	1.000000	0.71417	1.000000	0.80357	0.713000	0.41058	0.982000	0.29539	0.856000	0.35383	0.455000	0.32223	TTT	XKR9	-	pfam_Transport_prot_XK	ENSG00000221947		0.284	XKR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XKR9	HGNC	protein_coding	OTTHUMT00000378752.1	74	0.00	0	T	NM_001011720		71619175	71619175	+1	no_errors	ENST00000408926	ensembl	human	known	69_37n	missense	90	17.43	19	SNP	1.000	C
XPA	7507	genome.wustl.edu	37	9	100437634	100437634	+	3'UTR	DEL	T	T	-			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr9:100437634delT	ENST00000375128.4	-	0	973				XPA_ENST00000485042.1_5'UTR	NM_000380.3	NP_000371.1	P23025	XPA_HUMAN	xeroderma pigmentosum, complementation group A						DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|response to oxidative stress (GO:0006979)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercellular bridge (GO:0045171)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|metal ion binding (GO:0046872)|protein domain specific binding (GO:0019904)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(4)|large_intestine(1)|lung(4)|prostate(1)	11		Acute lymphoblastic leukemia(62;0.158)				AAGATGTTGCTTTTTTTTTTG	0.264			"""Mis, N, F, S"""			"""skin basal cell, skin squamous cell, melanoma"""		Nucleotide excision repair (NER)	Xeroderma Pigmentosum																													dbGAP	yes	Rec		Xeroderma pigmentosum (A)	9	9q22.3	7507	"""xeroderma pigmentosum, complementation group A"""		E	0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	D14533	CCDS6729.1	9q22.3	2014-09-17			ENSG00000136936	ENSG00000136936			12814	protein-coding gene	gene with protein product		611153					Standard	NM_000380		Approved	XPAC, XP1	uc004axr.4	P23025	OTTHUMG00000020330	ENST00000375128.4:c.*87A>-	9.37:g.100437634delT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1U9|Q6LCW7|Q6LD02	RNA	DEL	-	NULL	ENST00000375128.4	37	NULL	CCDS6729.1	9																																																																																			XPA	-	-	ENSG00000136936		0.264	XPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPA	HGNC	protein_coding	OTTHUMT00000053332.1	13	0.00	0	T	NM_000380		100437634	100437634	-1	no_errors	ENST00000485042	ensembl	human	known	69_37n	rna	15	16.67	3	DEL	0.004	-
ZCCHC3	85364	genome.wustl.edu	37	20	279371	279371	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr20:279371G>T	ENST00000382352.3	+	1	1635	c.1144G>T	c.(1144-1146)Gcc>Tcc	p.A382S		NM_033089.6	NP_149080	Q9NUD5	ZCHC3_HUMAN	zinc finger, CCHC domain containing 3	382							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|prostate(2)	8		all_cancers(10;0.000209)|Lung NSC(37;0.0417)|all_lung(30;0.0713)|all_epithelial(17;0.0748)|Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.149)			GCGAGGACACGCCTTTGCCCA	0.637																																						dbGAP											0													37.0	41.0	40.0					20																	279371		2073	4211	6284	-	-	-	SO:0001583	missense	0			AL034548	CCDS42844.1	20p13-p12.2	2014-04-10	2004-07-14	2004-07-14	ENSG00000177764	ENSG00000247315		"""Zinc fingers, CCHC domain containing"""	16230	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 99"""	C20orf99			Standard	NM_033089		Approved	dJ1103G7.7	uc002wdf.3	Q9NUD5	OTTHUMG00000188280	ENST00000382352.3:c.1144G>T	20.37:g.279371G>T	ENSP00000371789:p.Ala382Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7J3|Q6NT79	Missense_Mutation	SNP	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	p.A382S	ENST00000382352.3	37	c.1144	CCDS42844.1	20	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799270	0.50208	.	.	ENSG00000177764	ENST00000382352	.	.	.	5.03	4.08	0.47627	Zinc finger, CCHC retroviral-type (1);Zinc finger, CCHC-type (3);	0.181255	0.35970	N	0.002878	T	0.35364	0.0929	N	0.08118	0	0.31338	N	0.683962	D	0.69078	0.997	P	0.58266	0.836	T	0.21861	-1.0233	9	0.34782	T	0.22	-21.9157	11.2158	0.48825	0.0904:0.0:0.9095:0.0	.	382	Q9NUD5	ZCHC3_HUMAN	S	382	.	ENSP00000371789:A382S	A	+	1	0	ZCCHC3	227371	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	1.549000	0.36212	2.771000	0.95319	0.561000	0.74099	GCC	ZCCHC3	-	pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,pfscan_Znf_CCHC	ENSG00000177764		0.637	ZCCHC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC3	HGNC	protein_coding	OTTHUMT00000077447.1	24	0.00	0	G			279371	279371	+1	no_errors	ENST00000382352	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	1.000	T
ZDHHC5	25921	genome.wustl.edu	37	11	57467477	57467477	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr11:57467477G>T	ENST00000287169.3	+	12	3484	c.2122G>T	c.(2122-2124)Ggt>Tgt	p.G708C	ZDHHC5_ENST00000527985.1_Missense_Mutation_p.G655C	NM_015457.2	NP_056272.2	Q9C0B5	ZDHC5_HUMAN	zinc finger, DHHC-type containing 5	708					protein palmitoylation (GO:0018345)	dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)	p.G708S(1)		endometrium(6)|kidney(3)|large_intestine(3)|lung(5)|skin(1)	18						AGGGGTTGGTGGTACCACCTA	0.647																																						dbGAP											1	Substitution - Missense(1)	lung(1)											71.0	64.0	66.0					11																	57467477		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB051535	CCDS7965.1	11q13.1	2008-05-02			ENSG00000156599	ENSG00000156599		"""Zinc fingers, DHHC-type"""	18472	protein-coding gene	gene with protein product		614586				11214970	Standard	NM_015457		Approved	KIAA1748, ZNF375	uc001nkx.1	Q9C0B5	OTTHUMG00000167198	ENST00000287169.3:c.2122G>T	11.37:g.57467477G>T	ENSP00000287169:p.Gly708Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TGF0|Q6ZMF0|Q8TAK8|Q9H923|Q9UFI7	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,superfamily_Plexin-like_fold,pfscan_Znf_DHHC_palmitoyltrfase	p.G708C	ENST00000287169.3	37	c.2122	CCDS7965.1	11	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187153	0.78789	.	.	ENSG00000156599	ENST00000527985;ENST00000287169	D;T	0.84223	-1.82;-0.93	5.41	5.41	0.78517	.	0.425336	0.25172	N	0.032581	D	0.91908	0.7438	M	0.68317	2.08	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.92114	0.5698	10	0.87932	D	0	-14.586	18.9814	0.92756	0.0:0.0:1.0:0.0	.	708	Q9C0B5	ZDHC5_HUMAN	C	655;708	ENSP00000432202:G655C;ENSP00000287169:G708C	ENSP00000287169:G708C	G	+	1	0	ZDHHC5	57224053	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.070000	0.93974	2.826000	0.97356	0.655000	0.94253	GGT	ZDHHC5	-	NULL	ENSG00000156599		0.647	ZDHHC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDHHC5	HGNC	protein_coding	OTTHUMT00000393694.1	74	0.00	0	G	NM_015457		57467477	57467477	+1	no_errors	ENST00000287169	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	1.000	T
ZFP82	284406	genome.wustl.edu	37	19	36884213	36884213	+	Silent	SNP	G	G	A	rs112210948		TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:36884213G>A	ENST00000392161.3	-	5	1271	c.1029C>T	c.(1027-1029)tgC>tgT	p.C343C	ZFP82_ENST00000392171.1_Silent_p.C343C	NM_133466.2	NP_597723.1	Q8N141	ZFP82_HUMAN	ZFP82 zinc finger protein	343					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.C343C(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(7)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AGGCCTTCCCGCATTCCTTAC	0.428																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											96.0	97.0	96.0					19																	36884213		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834267	CCDS12493.1	19q13.13	2013-01-08	2012-11-27	2008-07-01		ENSG00000181007		"""Zinc fingers, C2H2-type"", ""-"""	28682	protein-coding gene	gene with protein product			"""zinc finger protein 545"", ""zinc finger protein 82 homolog (mouse)"", ""zinc finger protein 82"""	ZNF545		11853319	Standard	NM_133466		Approved	MGC45380, KIAA1948	uc002ody.1	Q8N141		ENST00000392161.3:c.1029C>T	19.37:g.36884213G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC63|Q8TF53	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C343	ENST00000392161.3	37	c.1029	CCDS12493.1	19																																																																																			ZFP82	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181007		0.428	ZFP82-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFP82	HGNC	protein_coding	OTTHUMT00000109552.2	57	0.00	0	G	NM_133466		36884213	36884213	-1	no_errors	ENST00000392161	ensembl	human	known	69_37n	silent	49	15.52	9	SNP	1.000	A
ZNF676	163223	genome.wustl.edu	37	19	22363736	22363737	+	Missense_Mutation	DNP	TC	TC	AG	rs559970266|rs572031376	byFrequency	TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	T|C	T|C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:22363736_22363737TC>AG	ENST00000397121.2	-	3	1099_1100	c.782_783GA>CT	c.(781-783)gGA>gCT	p.G261A		NM_001001411.2	NP_001001411.2	Q8N7Q3	ZN676_HUMAN	zinc finger protein 676	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(49)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	67		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.114)				CGCTACTAAATCCTTTGCCACA	0.391																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AK097798	CCDS42539.1	19p12	2013-01-08				ENSG00000196109		"""Zinc fingers, C2H2-type"""	20429	protein-coding gene	gene with protein product							Standard	NM_001001411		Approved		uc002nqs.1	Q8N7Q3		ENST00000397121.2:c.782_783delinsAG	19.37:g.22363736_22363737delinsAG	ENSP00000380310:p.Gly261Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVX5	Silent|Missense_Mutation	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G261|p.G261A	ENST00000397121.2	37	c.783|c.782	CCDS42539.1	19																																																																																			ZNF676	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196109		0.391	ZNF676-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF676	HGNC	protein_coding	OTTHUMT00000464392.1	34	0.00	0	T|C	NM_001001411		22363736|22363737	22363736|22363737	-1	no_errors	ENST00000397121	ensembl	human	known	69_37n	silent|missense	34	10.53	4	SNP	0.028|0.018	A|G
ZNF160	90338	genome.wustl.edu	37	19	53571593	53571593	+	Missense_Mutation	SNP	G	G	T			TCGA-OL-A5RZ-01A-11D-A28B-09	TCGA-OL-A5RZ-10A-01D-A28E-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	baa7b066-2bc9-4bfe-9a76-5ba80f843b94	ba54e456-4cfc-4425-8d0c-615fc01715e1	g.chr19:53571593G>T	ENST00000429604.1	-	7	2609	c.2194C>A	c.(2194-2196)Cct>Act	p.P732T	ZNF160_ENST00000601421.1_Missense_Mutation_p.P696T|ZNF160_ENST00000599056.1_Missense_Mutation_p.P732T|ZNF160_ENST00000418871.1_Missense_Mutation_p.P732T	NM_001102603.1|NM_198893.2	NP_001096073.1|NP_942596.1	Q9HCG1	ZN160_HUMAN	zinc finger protein 160	732					hemopoiesis (GO:0030097)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(8)|lung(10)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	35				GBM - Glioblastoma multiforme(134;0.02)		CATTTGTAAGGTTTTTTCCCA	0.448																																						dbGAP											0													140.0	133.0	135.0					19																	53571593		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78928	CCDS12859.1	19q13.42	2013-01-08				ENSG00000170949		"""Zinc fingers, C2H2-type"", ""-"""	12948	protein-coding gene	gene with protein product		600398				7774943, 7865130	Standard	NM_198893		Approved	HZF5, F11, KR18, HKr18, FLJ00032, KIAA1611	uc002qar.4	Q9HCG1		ENST00000429604.1:c.2194C>A	19.37:g.53571593G>T	ENSP00000406201:p.Pro732Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14589|Q504Q8|Q96JC5|Q9BVY9|Q9H7N6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P732T	ENST00000429604.1	37	c.2194	CCDS12859.1	19	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160087	0.38119	.	.	ENSG00000170949	ENST00000429604;ENST00000418871	T;T	0.16897	2.31;2.31	2.36	-0.0469	0.13845	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.31796	0.0808	M	0.71206	2.165	0.52099	D	0.999943	D	0.89917	1.0	D	0.91635	0.999	T	0.19128	-1.0315	9	0.72032	D	0.01	.	3.0524	0.06173	0.2629:0.0:0.5111:0.2261	.	732	Q9HCG1	ZN160_HUMAN	T	732	ENSP00000406201:P732T;ENSP00000409597:P732T	ENSP00000409597:P732T	P	-	1	0	ZNF160	58263405	0.000000	0.05858	0.003000	0.11579	0.019000	0.09904	-0.033000	0.12246	0.254000	0.21573	0.561000	0.74099	CCT	ZNF160	-	pfscan_Znf_C2H2	ENSG00000170949		0.448	ZNF160-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF160	HGNC	protein_coding	OTTHUMT00000463994.2	67	0.00	0	G	NM_033288		53571593	53571593	-1	no_errors	ENST00000418871	ensembl	human	known	69_37n	missense	65	25.29	22	SNP	0.824	T
