#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
C16orf71	146562	genome.wustl.edu	37	16	4790474	4790474	+	Silent	SNP	C	C	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr16:4790474C>T	ENST00000299320.5	+	4	1075	c.597C>T	c.(595-597)ctC>ctT	p.L199L	C16orf71_ENST00000590191.1_Silent_p.L213L|RP11-127I20.7_ENST00000588099.1_RNA	NM_139170.2	NP_631909.2	Q8IYS4	CP071_HUMAN	chromosome 16 open reading frame 71	199										breast(1)|central_nervous_system(1)|large_intestine(4)|lung(4)|ovary(1)	11						GCCGGGCCCTCCGACAGGAGA	0.612																																						dbGAP											0													38.0	40.0	39.0					16																	4790474		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AF447587	CCDS10521.1	16p13.3	2008-02-05			ENSG00000166246	ENSG00000166246			25081	protein-coding gene	gene with protein product						12477932	Standard	XM_005255144		Approved	FLJ43261, DKFZp686H2240	uc002cxn.3	Q8IYS4	OTTHUMG00000129480	ENST00000299320.5:c.597C>T	16.37:g.4790474C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NCV0	Silent	SNP	NULL	p.L199	ENST00000299320.5	37	c.597	CCDS10521.1	16																																																																																			C16orf71	-	NULL	ENSG00000166246		0.612	C16orf71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C16orf71	HGNC	protein_coding	OTTHUMT00000251644.1	33	0.00	0	C	NM_139170		4790474	4790474	+1	no_errors	ENST00000299320	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	0.952	T
C1orf112	55732	genome.wustl.edu	37	1	169818727	169818727	+	Silent	SNP	G	G	C	rs138665936		TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr1:169818727G>C	ENST00000286031.6	+	21	2845	c.2145G>C	c.(2143-2145)gcG>gcC	p.A715A	C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000359326.4_Silent_p.A715A	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	715										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCTTGGAGGCGTTTACTCAGT	0.383																																						dbGAP											0													99.0	95.0	96.0					1																	169818727		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.2145G>C	1.37:g.169818727G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Silent	SNP	NULL	p.A715	ENST00000286031.6	37	c.2145	CCDS1285.1	1																																																																																			C1orf112	-	NULL	ENSG00000000460		0.383	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf112	HGNC	protein_coding	OTTHUMT00000087126.3	42	0.00	0	G	NM_018186		169818727	169818727	+1	no_errors	ENST00000286031	ensembl	human	known	69_37n	silent	80	10.11	9	SNP	0.993	C
C8G	733	genome.wustl.edu	37	9	139841102	139841102	+	Splice_Site	SNP	G	G	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr9:139841102G>T	ENST00000224181.3	+	6	616		c.e6-1		FBXW5_ENST00000483559.1_5'Flank|FBXW5_ENST00000325285.3_5'Flank|C8G_ENST00000465773.1_Splice_Site	NM_000606.2	NP_000597.2	P07360	CO8G_HUMAN	complement component 8, gamma polypeptide						complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	retinol binding (GO:0019841)			NS(1)|prostate(1)|skin(1)	3	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.88e-06)|Epithelial(140;0.000107)		TGGGCCCCCAGGCTTCTGCGA	0.677																																						dbGAP											0													39.0	42.0	41.0					9																	139841102		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			X06465	CCDS7017.1	9q	2011-11-15			ENSG00000176919	ENSG00000176919		"""Complement system"", ""Lipocalins"""	1354	protein-coding gene	gene with protein product		120930					Standard	NM_000606		Approved		uc004cka.2	P07360	OTTHUMG00000020955	ENST00000224181.3:c.557-1G>T	9.37:g.139841102G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CT8|Q14CU0|Q5SQ07	Splice_Site	SNP	-	e6-1	ENST00000224181.3	37	c.557-1	CCDS7017.1	9	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333655	0.60853	.	.	ENSG00000176919	ENST00000224181	.	.	.	3.45	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5624	0.56288	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C8G	138960923	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	5.149000	0.64863	1.923000	0.55706	0.561000	0.74099	.	C8G	-	-	ENSG00000176919		0.677	C8G-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C8G	HGNC	protein_coding	OTTHUMT00000055178.1	48	0	0	G		Intron	139841102	139841102	+1	no_errors	ENST00000224181	ensembl	human	known	69_37n	splice_site	59	13.24	9	SNP	0.999	T
C8G	733	genome.wustl.edu	37	9	139841102	139841102	+	Splice_Site	SNP	G	G	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr9:139841102G>T	ENST00000224181.3	+	6	616		c.e6-1		FBXW5_ENST00000483559.1_5'Flank|FBXW5_ENST00000325285.3_5'Flank|C8G_ENST00000465773.1_Splice_Site	NM_000606.2	NP_000597.2	P07360	CO8G_HUMAN	complement component 8, gamma polypeptide						complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)	retinol binding (GO:0019841)			NS(1)|prostate(1)|skin(1)	3	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;7.88e-06)|Epithelial(140;0.000107)		TGGGCCCCCAGGCTTCTGCGA	0.677																																						dbGAP											0													39.0	42.0	41.0					9																	139841102		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			X06465	CCDS7017.1	9q	2011-11-15			ENSG00000176919	ENSG00000176919		"""Complement system"", ""Lipocalins"""	1354	protein-coding gene	gene with protein product		120930					Standard	NM_000606		Approved		uc004cka.2	P07360	OTTHUMG00000020955	ENST00000224181.3:c.557-1G>T	9.37:g.139841102G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CT8|Q14CU0|Q5SQ07	Splice_Site	SNP	-	e6-1	ENST00000224181.3	37	c.557-1	CCDS7017.1	9	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333655	0.60853	.	.	ENSG00000176919	ENST00000224181	.	.	.	3.45	3.45	0.39498	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5624	0.56288	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C8G	138960923	1.000000	0.71417	0.996000	0.52242	0.973000	0.67179	5.149000	0.64863	1.923000	0.55706	0.561000	0.74099	.	C8G	-	-	ENSG00000176919		0.677	C8G-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C8G	HGNC	protein_coding	OTTHUMT00000055178.1	48	0.00	0	G		Intron	139841102	139841102	+1	no_errors	ENST00000224181	ensembl	human	known	69_37n	splice_site	59	13.24	9	SNP	0.999	T
CRIM1	51232	genome.wustl.edu	37	2	36623762	36623762	+	Missense_Mutation	SNP	A	A	C			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr2:36623762A>C	ENST00000280527.2	+	2	704	c.337A>C	c.(337-339)Aac>Cac	p.N113H		NM_016441.2	NP_057525.1	Q9NZV1	CRIM1_HUMAN	cysteine rich transmembrane BMP regulator 1 (chordin-like)	113					insulin-like growth factor receptor signaling pathway (GO:0048009)|nervous system development (GO:0007399)|regulation of cell growth (GO:0001558)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	insulin-like growth factor-activated receptor activity (GO:0005010)|PDZ domain binding (GO:0030165)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(15)|liver(2)|lung(11)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	45		all_hematologic(82;0.131)|Acute lymphoblastic leukemia(82;0.154)				TACAGATGAGAACTGGACTGA	0.398																																						dbGAP											0													87.0	85.0	86.0					2																	36623762		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF168681	CCDS1783.1	2p21	2010-06-29	2005-07-25		ENSG00000150938	ENSG00000150938			2359	protein-coding gene	gene with protein product		606189	"""cysteine-rich motor neuron 1"""	S52		10642437	Standard	NM_016441		Approved		uc002rpd.3	Q9NZV1	OTTHUMG00000099419	ENST00000280527.2:c.337A>C	2.37:g.36623762A>C	ENSP00000280527:p.Asn113His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2G4|Q59GH0|Q7LCQ5|Q9H318	Missense_Mutation	SNP	pfam_VWF_C,pfam_Prot_inh_I15_antistasin-like,superfamily_Prot_inh_I14/15_hirudin/antisn,smart_IGFBP-like,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	p.N113H	ENST00000280527.2	37	c.337	CCDS1783.1	2	.	.	.	.	.	.	.	.	.	.	A	17.85	3.489690	0.64074	.	.	ENSG00000150938	ENST00000280527	T	0.04317	3.65	5.25	4.1	0.47936	.	0.198943	0.43919	D	0.000509	T	0.06096	0.0158	L	0.50333	1.59	0.42030	D	0.991027	P	0.39624	0.681	B	0.37833	0.259	T	0.30880	-0.9963	10	0.52906	T	0.07	-11.9021	9.4884	0.38944	0.9151:0.0:0.0849:0.0	.	113	Q9NZV1	CRIM1_HUMAN	H	113	ENSP00000280527:N113H	ENSP00000280527:N113H	N	+	1	0	CRIM1	36477266	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.862000	0.62976	0.849000	0.35215	0.477000	0.44152	AAC	CRIM1	-	NULL	ENSG00000150938		0.398	CRIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIM1	HGNC	protein_coding	OTTHUMT00000216878.2	66	0.00	0	A	NM_016441		36623762	36623762	+1	no_errors	ENST00000280527	ensembl	human	known	69_37n	missense	63	16.00	12	SNP	1.000	C
CYLD	1540	genome.wustl.edu	37	16	50783709	50783709	+	Missense_Mutation	SNP	C	C	G	rs538206791		TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr16:50783709C>G	ENST00000427738.3	+	2	305	c.100C>G	c.(100-102)Caa>Gaa	p.Q34E	CYLD_ENST00000568704.2_Missense_Mutation_p.Q34E|CYLD_ENST00000566206.1_Missense_Mutation_p.Q34E|CYLD_ENST00000569418.1_Missense_Mutation_p.Q34E|CYLD_ENST00000398568.2_Missense_Mutation_p.Q34E|CYLD_ENST00000311559.9_Missense_Mutation_p.Q34E|CYLD_ENST00000564326.1_Missense_Mutation_p.Q34E|CYLD_ENST00000540145.1_Missense_Mutation_p.Q34E			Q9NQC7	CYLD_HUMAN	cylindromatosis (turban tumor syndrome)	34					cell cycle (GO:0007049)|innate immune response (GO:0045087)|necroptotic process (GO:0070266)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|protein K63-linked deubiquitination (GO:0070536)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of mitotic cell cycle (GO:0007346)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule (GO:0005874)|nucleus (GO:0005634)	Lys63-specific deubiquitinase activity (GO:0061578)|proline-rich region binding (GO:0070064)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(9)|lung(17)|pancreas(1)|skin(22)|upper_aerodigestive_tract(1)	62		all_cancers(37;0.0156)				TACAGACAAACAAACACAAAA	0.418			"""Mis, N, F, S"""		cylindroma	cylindroma			Multiple Trichoepithelioma, Familial;Familial Cylindromatosis																													dbGAP	yes	Rec	yes	Familial cylindromatosis	16	16q12-q13	1540	familial cylindromatosis gene		E	0													90.0	85.0	87.0					16																	50783709		1856	4094	5950	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;FADC, Turban Tumor syndrome, Epithelioma Adenoides Cysticum of Brooke, Hereditary Multiple Benign Cystic Epithelioma, Dermal Eccrine Cylindromatosis, Brooke-Spiegler s.	AB020656	CCDS42164.1, CCDS45482.1	16q12-q13	2014-09-17							2584	protein-coding gene	gene with protein product	"""ubiquitin specific peptidase like 2"""	605018		CYLD1		7493027	Standard	NM_015247		Approved	KIAA0849, USPL2	uc002egq.1	Q9NQC7		ENST00000427738.3:c.100C>G	16.37:g.50783709C>G	ENSP00000392025:p.Gln34Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O94934|Q7L3N6|Q96EH0|Q9NZX9	Missense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Peptidase_C19,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain,pfscan_Peptidase_C19	p.Q34E	ENST00000427738.3	37	c.100	CCDS45482.1	16	.	.	.	.	.	.	.	.	.	.	C	14.03	2.414648	0.42817	.	.	ENSG00000083799	ENST00000540145;ENST00000311559;ENST00000427738;ENST00000398568	D;D;D;D	0.93659	-3.26;-3.26;-3.26;-3.26	5.87	5.87	0.94306	.	0.054667	0.85682	D	0.000000	D	0.88647	0.6493	N	0.19112	0.55	0.53005	D	0.999968	B;P;P;B	0.36171	0.406;0.541;0.541;0.406	B;B;B;B	0.32090	0.066;0.14;0.14;0.066	D	0.87810	0.2631	10	0.54805	T	0.06	-22.9971	20.5827	0.99408	0.0:1.0:0.0:0.0	.	34;34;34;34	A8KAB0;F5H2R7;Q9NQC7-2;Q9NQC7	.;.;.;CYLD_HUMAN	E	34	ENSP00000445447:Q34E;ENSP00000308928:Q34E;ENSP00000392025:Q34E;ENSP00000381574:Q34E	ENSP00000308928:Q34E	Q	+	1	0	CYLD	49341210	1.000000	0.71417	0.996000	0.52242	0.214000	0.24535	7.209000	0.77916	2.941000	0.99782	0.655000	0.94253	CAA	CYLD	-	NULL	ENSG00000083799		0.418	CYLD-010	KNOWN	basic|CCDS	protein_coding	CYLD	HGNC	protein_coding	OTTHUMT00000422998.2	38	0.00	0	C			50783709	50783709	+1	no_errors	ENST00000311559	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	G
DCAF12L2	340578	genome.wustl.edu	37	X	125298898	125298898	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chrX:125298898C>T	ENST00000360028.2	-	1	1036	c.1010G>A	c.(1009-1011)cGc>cAc	p.R337H	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.R337H			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	337										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GTTCTGCTGGCGCTGGCGCGG	0.622																																						dbGAP											0													55.0	59.0	57.0					X																	125298898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.1010G>A	X.37:g.125298898C>T	ENSP00000353128:p.Arg337His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN42	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R337H	ENST00000360028.2	37	c.1010	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	C	7.417	0.635902	0.14386	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.63580	-0.05;-0.05	4.05	2.22	0.28083	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.964031	0.08457	N	0.943000	T	0.44371	0.1290	L	0.29908	0.895	0.29364	N	0.864442	D	0.54772	0.968	B	0.38327	0.271	T	0.38286	-0.9668	10	0.40728	T	0.16	.	5.4353	0.16478	0.0:0.4876:0.3958:0.1165	.	337	Q5VW00	DC122_HUMAN	H	337	ENSP00000441489:R337H;ENSP00000353128:R337H	ENSP00000353128:R337H	R	-	2	0	DCAF12L2	125126579	0.005000	0.15991	0.248000	0.24265	0.814000	0.46013	0.315000	0.19451	0.458000	0.26988	0.544000	0.68410	CGC	DCAF12L2	-	superfamily_WD40_repeat_dom	ENSG00000198354		0.622	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	51	0.00	0	C	NM_001013628		125298898	125298898	-1	no_errors	ENST00000360028	ensembl	human	known	69_37n	missense	46	40.26	31	SNP	0.964	T
DLX5	1749	genome.wustl.edu	37	7	96651538	96651538	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr7:96651538G>A	ENST00000222598.4	-	2	972	c.499C>T	c.(499-501)Cgc>Tgc	p.R167C	DLX5_ENST00000493764.1_5'UTR|DLX5_ENST00000486603.2_Missense_Mutation_p.R167C	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	167					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					AGCTCGGCGCGTTCCGGCAAG	0.552																																						dbGAP											0													102.0	102.0	102.0					7																	96651538		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.499C>T	7.37:g.96651538G>A	ENSP00000222598:p.Arg167Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4P3|Q9UPL1	Missense_Mutation	SNP	pfam_Distal-less_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.R167C	ENST00000222598.4	37	c.499	CCDS5647.1	7	.	.	.	.	.	.	.	.	.	.	G	22.2	4.258294	0.80246	.	.	ENSG00000105880	ENST00000222598	D	0.97529	-4.42	5.41	5.41	0.78517	Homeobox, eukaryotic (1);Homeodomain-related (1);Helix-turn-helix motif, lambda-like repressor (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98972	0.9650	H	0.96633	3.855	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99104	1.0844	10	0.87932	D	0	-13.4354	14.7076	0.69203	0.0:0.0:0.8546:0.1454	.	167;167	B7Z4P3;P56178	.;DLX5_HUMAN	C	167	ENSP00000222598:R167C	ENSP00000222598:R167C	R	-	1	0	DLX5	96489474	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	2.207000	0.42788	2.816000	0.96949	0.563000	0.77884	CGC	DLX5	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	ENSG00000105880		0.552	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX5	HGNC	protein_coding	OTTHUMT00000334371.2	42	0.00	0	G			96651538	96651538	-1	no_errors	ENST00000222598	ensembl	human	known	69_37n	missense	35	35.19	19	SNP	1.000	A
FSIP2	401024	genome.wustl.edu	37	2	186656657	186656657	+	Silent	SNP	C	C	T	rs10173807	byFrequency	TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr2:186656657C>T	ENST00000424728.1	+	16	4794	c.4794C>T	c.(4792-4794)aaC>aaT	p.N1598N	FSIP2_ENST00000343098.5_Silent_p.N1687N|AC008174.3_ENST00000429929.1_RNA|AC008174.3_ENST00000436557.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	1598										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						GGTTTGCCAACGGACATTTAG	0.353													T|||	3157	0.630391	0.6868	0.5605	5008	,	,		19033	0.5357		0.6223	False		,,,				2504	0.7096					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.4794C>T	2.37:g.186656657C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Silent	SNP	NULL	p.N1687	ENST00000424728.1	37	c.5061		2																																																																																			FSIP2	-	NULL	ENSG00000188738		0.353	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	10	0.00	0	C	NM_173651		186656657	186656657	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	silent	14	26.32	5	SNP	0.966	T
GATA4	2626	genome.wustl.edu	37	8	11606457	11606457	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr8:11606457G>C	ENST00000335135.4	+	3	1204	c.646G>C	c.(646-648)Gag>Cag	p.E216Q	GATA4_ENST00000528712.1_Missense_Mutation_p.E10Q|GATA4_ENST00000532059.1_Missense_Mutation_p.E217Q	NM_002052.3	NP_002043.2	P43694	GATA4_HUMAN	GATA binding protein 4	216					atrial septum morphogenesis (GO:0060413)|atrial septum primum morphogenesis (GO:0003289)|atrial septum secundum morphogenesis (GO:0003290)|atrioventricular valve morphogenesis (GO:0003181)|blood coagulation (GO:0007596)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle hypertrophy in response to stress (GO:0014898)|cardiac right ventricle morphogenesis (GO:0003215)|cardiac ventricle morphogenesis (GO:0003208)|cell growth involved in cardiac muscle cell development (GO:0061049)|cell-cell signaling (GO:0007267)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to glucose stimulus (GO:0071333)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic foregut morphogenesis (GO:0048617)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|endocardial cushion development (GO:0003197)|endoderm development (GO:0007492)|endoderm formation (GO:0001706)|epithelial cell fate commitment (GO:0072148)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|intestinal epithelial cell differentiation (GO:0060575)|lung lobe formation (GO:0060464)|male gonad development (GO:0008584)|negative regulation of autophagy (GO:0010507)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to mechanical stimulus (GO:0009612)|seminiferous tubule development (GO:0072520)|Sertoli cell differentiation (GO:0060008)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|DNA binding (GO:0003677)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(10)	13	all_epithelial(15;0.0839)		STAD - Stomach adenocarcinoma(15;0.00225)	COAD - Colon adenocarcinoma(149;0.199)		AGAAGGCAGAGAGTGTGTCAA	0.517																																						dbGAP											0													141.0	138.0	139.0					8																	11606457		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097060	CCDS5983.1	8p23.1-p22	2013-01-25	2001-11-28		ENSG00000136574	ENSG00000136574		"""GATA zinc finger domain containing"""	4173	protein-coding gene	gene with protein product		600576	"""GATA-binding protein 4"""			7665171	Standard	NM_002052		Approved		uc003wuc.2	P43694	OTTHUMG00000090800	ENST00000335135.4:c.646G>C	8.37:g.11606457G>C	ENSP00000334458:p.Glu216Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKX0|B7ZKZ4|Q3MJ45|Q5IFM8	Missense_Mutation	SNP	pfam_GATA_N,pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA_4/5/6,pfscan_Znf_GATA,prints_Znf_GATA	p.E216Q	ENST00000335135.4	37	c.646	CCDS5983.1	8	.	.	.	.	.	.	.	.	.	.	G	26.9	4.778805	0.90195	.	.	ENSG00000136574	ENST00000528712;ENST00000526716;ENST00000335135;ENST00000259090;ENST00000532059	D;D;D;D	0.99663	-6.33;-6.33;-6.33;-6.33	5.61	4.74	0.60224	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (3);	0.000000	0.64402	D	0.000001	D	0.99013	0.9663	L	0.41079	1.255	0.80722	D	1	P;P	0.50272	0.737;0.933	P;P	0.54499	0.559;0.754	D	0.99226	1.0880	10	0.87932	D	0	-16.1421	13.8808	0.63682	0.0729:0.0:0.9271:0.0	.	217;216	B7ZKZ4;P43694	.;GATA4_HUMAN	Q	10;10;216;215;217	ENSP00000435043:E10Q;ENSP00000435347:E10Q;ENSP00000334458:E216Q;ENSP00000435712:E217Q	ENSP00000259090:E215Q	E	+	1	0	GATA4	11643866	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.515000	0.98015	1.508000	0.48769	0.655000	0.94253	GAG	GATA4	-	smart_Znf_GATA,pirsf_TF_GATA_4/5/6,pfscan_Znf_GATA,prints_Znf_GATA	ENSG00000136574		0.517	GATA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA4	HGNC	protein_coding	OTTHUMT00000207587.2	43	0.00	0	G	NM_002052		11606457	11606457	+1	no_errors	ENST00000335135	ensembl	human	known	69_37n	missense	36	46.27	31	SNP	1.000	C
KCNQ4	9132	genome.wustl.edu	37	1	41303356	41303356	+	Missense_Mutation	SNP	C	C	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr1:41303356C>T	ENST00000347132.5	+	13	1847	c.1765C>T	c.(1765-1767)Cgg>Tgg	p.R589W	KCNQ4_ENST00000506017.1_3'UTR|KCNQ4_ENST00000509682.2_Missense_Mutation_p.R535W	NM_004700.3|NM_172163.2	NP_004691.2|NP_751895.1	P56696	KCNQ4_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 4	589	A-domain (Tetramerization).				inner ear morphogenesis (GO:0042472)|potassium ion transport (GO:0006813)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(13)|skin(1)	26	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.38e-17)		Ezogabine(DB04953)	AATTGTGGGTCGGGGGCCCGG	0.622																																						dbGAP											0													24.0	28.0	26.0					1																	41303356		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105202	CCDS456.1	1p34	2012-07-05			ENSG00000117013	ENSG00000117013		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6298	protein-coding gene	gene with protein product		603537		DFNA2		10025409, 16382104	Standard	NM_004700		Approved	Kv7.4	uc001cgh.2	P56696	OTTHUMG00000007730	ENST00000347132.5:c.1765C>T	1.37:g.41303356C>T	ENSP00000262916:p.Arg589Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O96025	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.R589W	ENST00000347132.5	37	c.1765	CCDS456.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.75|18.75	3.690663|3.690663	0.68271|0.68271	.|.	.|.	ENSG00000117013|ENSG00000117013	ENST00000347132;ENST00000509682|ENST00000443478	D;D|.	0.99732|.	-6.57;-6.57|.	4.64|4.64	3.71|3.71	0.42584|0.42584	Potassium channel, voltage dependent, KCNQ, C-terminal (1);|.	0.066778|.	0.64402|.	D|.	0.000011|.	T|T	0.71221|0.71221	0.3314|0.3314	M|M	0.73962|0.73962	2.25|2.25	0.54753|0.54753	D|D	0.999986|0.999986	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.85130|.	0.978;0.997|.	T|T	0.70597|0.70597	-0.4828|-0.4828	10|5	0.72032|.	D|.	0.01|.	-17.6108|-17.6108	11.7818|11.7818	0.52020|0.52020	0.1773:0.8227:0.0:0.0|0.1773:0.8227:0.0:0.0	.|.	535;589|.	P56696-2;P56696|.	.;KCNQ4_HUMAN|.	W|L	589;535|449	ENSP00000262916:R589W;ENSP00000423756:R535W|.	ENSP00000262916:R589W|.	R|S	+|+	1|2	2|0	KCNQ4|KCNQ4	41075943|41075943	0.998000|0.998000	0.40836|0.40836	0.993000|0.993000	0.49108|0.49108	0.968000|0.968000	0.65278|0.65278	1.889000|1.889000	0.39718|0.39718	0.923000|0.923000	0.37045|0.37045	0.462000|0.462000	0.41574|0.41574	CGG|TCG	KCNQ4	-	pfam_K_chnl_volt-dep_KCNQ_C	ENSG00000117013		0.622	KCNQ4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KCNQ4	HGNC	protein_coding	OTTHUMT00000020812.1	48	0.00	0	C	NM_004700		41303356	41303356	+1	no_errors	ENST00000347132	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	1.000	T
KCTD15	79047	genome.wustl.edu	37	19	34304928	34304928	+	3'UTR	DEL	C	C	-	rs547685187	byFrequency	TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr19:34304928delC	ENST00000430256.3	+	0	2335				KCTD15_ENST00000284006.6_3'UTR|KCTD15_ENST00000592363.1_3'UTR			Q96SI1	KCD15_HUMAN	potassium channel tetramerization domain containing 15						multicellular organismal development (GO:0007275)|protein homooligomerization (GO:0051260)					endometrium(1)|lung(2)|pancreas(1)|urinary_tract(1)	5	Esophageal squamous(110;0.162)					CAAAGATGGACCCCCCCTGGC	0.627													?|CCCCCCC|CCCCCC|unsure	3	0.000599042	0.0	0.0014	5008	,	,		15260	0.002		0.0	False		,,,				2504	0.0				Melanoma(36;646 1094 5145 14504 45302)|GBM(25;193 541 1518 14388 52178)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AK025590	CCDS12434.1, CCDS46039.1	19q13.12	2013-06-20	2013-06-20			ENSG00000153885			23297	protein-coding gene	gene with protein product		615240	"""potassium channel tetramerisation domain containing 15"""			12477932	Standard	NM_024076		Approved	MGC25497	uc002nuw.4	Q96SI1		ENST00000430256.3:c.*1075C>-	19.37:g.34304928delC		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K600|Q9BVI6	RNA	DEL	-	NULL	ENST00000430256.3	37	NULL	CCDS46039.1	19																																																																																			KCTD15	-	-	ENSG00000153885		0.627	KCTD15-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KCTD15	HGNC	protein_coding	OTTHUMT00000451462.2	26	0.00	0	C	NM_024076		34304928	34304928	+1	no_errors	ENST00000592363	ensembl	human	putative	69_37n	rna	24	52.83	28	DEL	0.001	-
KRT8P11	347265	genome.wustl.edu	37	9	102067538	102067538	+	IGR	SNP	A	A	C			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr9:102067538A>C								RN7SKP225 (20883 upstream) : NAMA (50153 downstream)																							TGGCGTCTGCATCAGCTCCTT	0.632																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															9.37:g.102067538A>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.I49L		37	c.145		9	.	.	.	.	.	.	.	.	.	.	A	0.088	-1.171449	0.01660	.	.	ENSG00000222039	ENST00000409686	T	0.81078	-1.45	0.522	-1.04	0.10068	.	.	.	.	.	T	0.59128	0.2171	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.31916	-0.9926	6	0.13108	T	0.6	.	3.9627	0.09418	0.5939:0.2111:0.195:0.0	.	.	.	.	L	49	ENSP00000404011:I49L	ENSP00000404011:I49L	I	+	1	0	KRT8P11	101107359	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-0.219000	0.09228	-2.799000	0.00353	-2.381000	0.00232	ATC	KRT8P11	-	NULL	ENSG00000259197	0	0.632					KRT8P11	HGNC			44	0.00	0	A			102067538	102067538	+1	no_errors	ENST00000409686	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.000	C
LCA5L	150082	genome.wustl.edu	37	21	40795074	40795075	+	Frame_Shift_Ins	INS	-	-	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr21:40795074_40795075insT	ENST00000358268.2	-	5	1192_1193	c.664_665insA	c.(664-666)agafs	p.R222fs	LCA5L_ENST00000380671.2_Frame_Shift_Ins_p.R222fs|LCA5L_ENST00000288350.3_Frame_Shift_Ins_p.R222fs|LCA5L_ENST00000485895.2_Frame_Shift_Ins_p.R222fs			O95447	LCA5L_HUMAN	Leber congenital amaurosis 5-like	222										breast(1)|cervix(1)|endometrium(3)|large_intestine(8)|lung(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	24		Prostate(19;1.2e-06)				AGATAGAGTTCTTTCCTTTTCC	0.347																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF121781	CCDS13665.1	21q22.2	2007-12-18	2007-12-18	2007-12-18	ENSG00000157578	ENSG00000157578			1255	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 13"""	C21orf13			Standard	XM_005260926		Approved	MGC33295	uc002yxu.3	O95447	OTTHUMG00000066280	ENST00000358268.2:c.665dupA	21.37:g.40795077_40795077dupT	ENSP00000351008:p.Arg222fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSI0|Q3ZCT0	Frame_Shift_Ins	INS	NULL	p.R222fs	ENST00000358268.2	37	c.665_664	CCDS13665.1	21																																																																																			LCA5L	-	NULL	ENSG00000157578		0.347	LCA5L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LCA5L	HGNC	protein_coding	OTTHUMT00000141807.2	80	0.00	0	-	NM_152505		40795074	40795075	-1	no_errors	ENST00000288350	ensembl	human	known	69_37n	frame_shift_ins	66	34.00	34	INS	0.296:0.317	T
COMMD9	29099	genome.wustl.edu	37	11	36292941	36292941	+	IGR	SNP	A	A	G	rs537517066	byFrequency	TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr11:36292941A>G	ENST00000263401.5	-	0	1745				COMMD9_ENST00000533308.1_5'Flank|LINC00610_ENST00000355500.1_lincRNA	NM_014186.3	NP_054905.2	Q9P000	COMD9_HUMAN	COMM domain containing 9											kidney(1)|large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	5	all_lung(20;0.211)	all_hematologic(20;0.107)				TTATTTCCCAACCCAGGGGTA	0.478													A|||	2	0.000399361	0.0015	0.0	5008	,	,		21971	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													17.0	18.0	18.0					11																	36292941		1656	2992	4648	-	-	-	SO:0001628	intergenic_variant	0			AY542164	CCDS7900.1, CCDS44571.1	11p13	2008-02-05			ENSG00000110442	ENSG00000110442			25014	protein-coding gene	gene with protein product		612299				15799966	Standard	NM_014186		Approved	HSPC166, FLJ31106	uc001mwn.4	Q9P000	OTTHUMG00000166333		11.37:g.36292941A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PAN2|Q96FI2|Q9H0R0	RNA	SNP	-	NULL	ENST00000263401.5	37	NULL	CCDS7900.1	11																																																																																			LINC00610	-	-	ENSG00000196559		0.478	COMMD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINC00610	HGNC	protein_coding	OTTHUMT00000389196.1	9	0.00	0	A	NM_014186		36292941	36292941	-1	no_errors	ENST00000355500	ensembl	human	known	69_37n	rna	11	45.00	9	SNP	0.000	G
LMBRD2	92255	genome.wustl.edu	37	5	36104192	36104192	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr5:36104192G>A	ENST00000296603.4	-	18	2506	c.2044C>T	c.(2044-2046)Cga>Tga	p.R682*		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	682						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			GAGAGATATCGTCCACCAGGC	0.373																																						dbGAP											0													95.0	85.0	89.0					5																	36104192		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.2044C>T	5.37:g.36104192G>A	ENSP00000296603:p.Arg682*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRB6|Q9NTC7	Nonsense_Mutation	SNP	pfam_LMBR1-like_membr_prot	p.R682*	ENST00000296603.4	37	c.2044	CCDS34145.1	5	.	.	.	.	.	.	.	.	.	.	G	42	9.711697	0.99245	.	.	ENSG00000164187	ENST00000296603;ENST00000546130	.	.	.	5.48	3.45	0.39498	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.6403	10.71	0.45977	0.0:0.0:0.4687:0.5313	.	.	.	.	X	682;576	.	ENSP00000296603:R682X	R	-	1	2	LMBRD2	36139949	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.702000	0.37836	1.255000	0.44051	0.491000	0.48974	CGA	LMBRD2	-	NULL	ENSG00000164187		0.373	LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD2	HGNC	protein_coding	OTTHUMT00000367552.1	23	0.00	0	G	NM_001007527		36104192	36104192	-1	no_errors	ENST00000296603	ensembl	human	known	69_37n	nonsense	23	28.12	9	SNP	1.000	A
LONRF2	164832	genome.wustl.edu	37	2	100903452	100903452	+	Missense_Mutation	SNP	G	G	C	rs182810197		TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr2:100903452G>C	ENST00000393437.3	-	11	2633	c.1994C>G	c.(1993-1995)gCg>gGg	p.A665G	LONRF2_ENST00000409647.1_Missense_Mutation_p.A422G	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	665	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						CTGGAGAGACGCGAACCAGGA	0.488																																						dbGAP											0													124.0	103.0	110.0					2																	100903452		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1994C>G	2.37:g.100903452G>C	ENSP00000377086:p.Ala665Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A006|Q6ZSR4	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.A665G	ENST00000393437.3	37	c.1994	CCDS2046.2	2	.	.	.	.	.	.	.	.	.	.	G	14.38	2.518614	0.44763	.	.	ENSG00000170500	ENST00000393437;ENST00000409647	T;T	0.43688	0.94;0.94	4.95	3.1	0.35709	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.358147	0.30901	N	0.008647	T	0.29716	0.0742	N	0.14661	0.345	0.18873	N	0.999986	B	0.33964	0.434	B	0.42163	0.378	T	0.22068	-1.0227	10	0.23891	T	0.37	-0.2116	10.2149	0.43162	0.0749:0.1365:0.7885:0.0	.	665	Q1L5Z9	LONF2_HUMAN	G	665;422	ENSP00000377086:A665G;ENSP00000386823:A422G	ENSP00000377086:A665G	A	-	2	0	LONRF2	100269884	1.000000	0.71417	0.001000	0.08648	0.826000	0.46750	5.277000	0.65586	0.462000	0.27095	0.655000	0.94253	GCG	LONRF2	-	pfam_Pept_S16_N,superfamily_PUA-like_domain,smart_Pept_S16_N	ENSG00000170500		0.488	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	HGNC	protein_coding	OTTHUMT00000253161.2	31	0.00	0	G	NM_198461		100903452	100903452	-1	no_errors	ENST00000393437	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	0.391	C
LYST	1130	genome.wustl.edu	37	1	235972478	235972478	+	Missense_Mutation	SNP	C	C	A			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr1:235972478C>A	ENST00000389794.3	-	5	1814	c.1640G>T	c.(1639-1641)tGc>tTc	p.C547F	LYST_ENST00000536965.1_Missense_Mutation_p.C547F|LYST_ENST00000389793.2_Missense_Mutation_p.C547F			Q99698	LYST_HUMAN	lysosomal trafficking regulator	547					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)				NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			AATGCAACAGCACCGCTCAGG	0.468																																						dbGAP											0													82.0	78.0	79.0					1																	235972478		2203	4300	6503	-	-	-	SO:0001583	missense	0			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.1640G>T	1.37:g.235972478C>A	ENSP00000374444:p.Cys547Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.C547F	ENST00000389794.3	37	c.1640	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239724	0.39598	.	.	ENSG00000143669	ENST00000389794;ENST00000389793;ENST00000536965	T;T;T	0.66280	-0.2;-0.2;1.16	5.46	5.46	0.80206	.	0.044496	0.85682	D	0.000000	T	0.77110	0.4082	L	0.56769	1.78	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.71184	0.972;0.962	T	0.78326	-0.2247	10	0.66056	D	0.02	.	19.2976	0.94129	0.0:1.0:0.0:0.0	.	547;547	Q99698-3;Q99698	.;LYST_HUMAN	F	547	ENSP00000374444:C547F;ENSP00000374443:C547F;ENSP00000438315:C547F	ENSP00000374443:C547F	C	-	2	0	LYST	234039101	1.000000	0.71417	0.998000	0.56505	0.057000	0.15508	7.487000	0.81328	2.547000	0.85894	0.650000	0.86243	TGC	LYST	-	superfamily_ARM-type_fold	ENSG00000143669		0.468	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	21	0.00	0	C			235972478	235972478	-1	no_errors	ENST00000389793	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	1.000	A
MYH4	4622	genome.wustl.edu	37	17	10354183	10354183	+	Missense_Mutation	SNP	C	C	G			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr17:10354183C>G	ENST00000255381.2	-	29	4005	c.3895G>C	c.(3895-3897)Gat>Cat	p.D1299H	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1299					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						ACCATAGCATCTTTTTCATCT	0.368																																						dbGAP											0													151.0	139.0	143.0					17																	10354183		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3895G>C	17.37:g.10354183C>G	ENSP00000255381:p.Asp1299His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.D1299H	ENST00000255381.2	37	c.3895	CCDS11154.1	17	.	.	.	.	.	.	.	.	.	.	C	27.6	4.845340	0.91197	.	.	ENSG00000141048	ENST00000255381	T	0.78364	-1.17	5.71	5.71	0.89125	Myosin tail (1);	0.187209	0.24666	U	0.036598	D	0.84840	0.5561	L	0.54323	1.7	0.80722	D	1	B	0.33694	0.421	P	0.50049	0.629	D	0.83870	0.0273	10	0.87932	D	0	.	20.2175	0.98301	0.0:1.0:0.0:0.0	.	1299	Q9Y623	MYH4_HUMAN	H	1299	ENSP00000255381:D1299H	ENSP00000255381:D1299H	D	-	1	0	MYH4	10294908	1.000000	0.71417	0.995000	0.50966	0.970000	0.65996	3.312000	0.51927	2.850000	0.98022	0.655000	0.94253	GAT	MYH4	-	pfam_Myosin_tail	ENSG00000264424		0.368	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	68	0.00	0	C	NM_017533		10354183	10354183	-1	no_errors	ENST00000255381	ensembl	human	known	69_37n	missense	68	15.00	12	SNP	1.000	G
NRD1	4898	genome.wustl.edu	37	1	52257716	52257716	+	Splice_Site	SNP	A	A	C			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr1:52257716A>C	ENST00000354831.7	-	28	3270		c.e28+1		NRD1_ENST00000539524.1_Splice_Site|RP4-657D16.3_ENST00000586761.1_RNA|RP4-657D16.3_ENST00000588291.1_RNA|NRD1_ENST00000352171.7_Splice_Site|NRD1_ENST00000485608.1_Splice_Site	NM_002525.2	NP_002516.2	O43847	NRDC_HUMAN	nardilysin (N-arginine dibasic convertase)						cell migration (GO:0016477)|cell proliferation (GO:0008283)|neuromuscular junction development (GO:0007528)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|proteolysis (GO:0006508)|regulation of endopeptidase activity (GO:0052548)	cell surface (GO:0009986)|cytosol (GO:0005829)	epidermal growth factor binding (GO:0048408)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			NS(1)|breast(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(1)|skin(1)	27						CAGCTGACTTACCCAAGGGTC	0.507																																						dbGAP											0													85.0	77.0	80.0					1																	52257716		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X93207	CCDS559.1, CCDS41335.1, CCDS55599.1	1p32.2-p32.1	2008-07-18			ENSG00000078618	ENSG00000078618			7995	protein-coding gene	gene with protein product		602651				9581555, 9479496	Standard	NM_002525		Approved	hNRD1, hNRD2	uc001ctc.4	O43847	OTTHUMG00000008278	ENST00000354831.7:c.3080+1T>G	1.37:g.52257716A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI41|O15241|O15242|Q5VUL0|Q96HB2|Q9NU57	Splice_Site	SNP	-	e28+2	ENST00000354831.7	37	c.3080+2	CCDS559.1	1	.	.	.	.	.	.	.	.	.	.	A	24.1	4.496297	0.85069	.	.	ENSG00000078618	ENST00000440943;ENST00000352171;ENST00000354831;ENST00000539524;ENST00000371665;ENST00000546169	.	.	.	5.26	5.26	0.73747	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3531	0.74405	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	NRD1	52030304	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.761000	0.91691	2.207000	0.71202	0.533000	0.62120	.	NRD1	-	-	ENSG00000078618		0.507	NRD1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRD1	HGNC	protein_coding	OTTHUMT00000023045.1	34	0	0	A	NM_002525	Intron	52257716	52257716	-1	no_errors	ENST00000354831	ensembl	human	known	69_37n	splice_site	37	11.9	5	SNP	1.000	C
NXPH1	30010	genome.wustl.edu	37	7	8790942	8790942	+	Missense_Mutation	SNP	G	G	C			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr7:8790942G>C	ENST00000405863.1	+	3	1270	c.359G>C	c.(358-360)gGa>gCa	p.G120A	NXPH1_ENST00000497400.1_3'UTR|NXPH1_ENST00000602349.1_Missense_Mutation_p.G3A	NM_152745.2	NP_689958.1	P58417	NXPH1_HUMAN	neurexophilin 1	120	III.					extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|ovary(1)	17		Ovarian(82;0.0628)		UCEC - Uterine corpus endometrioid carcinoma (126;0.101)		AAAATGTTTGGATGGGGCGAT	0.453																																						dbGAP											0													82.0	80.0	80.0					7																	8790942		1852	4083	5935	-	-	-	SO:0001583	missense	0			AB047362	CCDS47540.1	7p22	2003-03-20			ENSG00000122584	ENSG00000122584			20693	protein-coding gene	gene with protein product		604639				9570794	Standard	NM_152745		Approved		uc003srv.3	P58417	OTTHUMG00000151941	ENST00000405863.1:c.359G>C	7.37:g.8790942G>C	ENSP00000384551:p.Gly120Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB31	Missense_Mutation	SNP	pirsf_Neurexophilin	p.G120A	ENST00000405863.1	37	c.359	CCDS47540.1	7	.	.	.	.	.	.	.	.	.	.	G	19.13	3.768632	0.69878	.	.	ENSG00000122584	ENST00000405863;ENST00000417186;ENST00000438764;ENST00000429542	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	D	0.84584	0.5504	M	0.84511	2.7	0.80722	D	1	D	0.65815	0.995	D	0.70016	0.967	D	0.85771	0.1355	9	0.87932	D	0	-7.6207	20.3368	0.98748	0.0:0.0:1.0:0.0	.	120	P58417	NXPH1_HUMAN	A	120;3;120;120	.	ENSP00000384551:G120A	G	+	2	0	NXPH1	8757467	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.835000	0.99442	2.805000	0.96524	0.655000	0.94253	GGA	NXPH1	-	pirsf_Neurexophilin	ENSG00000122584		0.453	NXPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXPH1	HGNC	protein_coding	OTTHUMT00000324591.1	28	0.00	0	G	NM_152745		8790942	8790942	+1	no_errors	ENST00000405863	ensembl	human	known	69_37n	missense	18	33.33	9	SNP	1.000	C
PABPC3	5042	genome.wustl.edu	37	13	25671129	25671129	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr13:25671129C>T	ENST00000281589.3	+	1	830	c.793C>T	c.(793-795)Cga>Tga	p.R265*		NM_030979.2	NP_112241.2	Q9H361	PABP3_HUMAN	poly(A) binding protein, cytoplasmic 3	265	RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA metabolic process (GO:0016071)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	nucleotide binding (GO:0000166)|poly(A) binding (GO:0008143)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(21)|ovary(4)|pancreas(1)|skin(3)	47		Lung SC(185;0.0225)|Breast(139;0.0602)		all cancers(112;0.0071)|Epithelial(112;0.0398)|OV - Ovarian serous cystadenocarcinoma(117;0.151)|GBM - Glioblastoma multiforme(144;0.222)|Lung(94;0.241)		TTACGTTGGTCGAGCTCAGAA	0.403																																						dbGAP											0													149.0	135.0	140.0					13																	25671129		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF132026	CCDS9311.1	13q12-q13	2013-02-12	2001-11-28		ENSG00000151846	ENSG00000151846		"""RNA binding motif (RRM) containing"""	8556	protein-coding gene	gene with protein product	"""testis PABP"""	604680	"""poly(A)-binding protein, cytoplasmic 3"""	PABPL3		8432538, 10543404	Standard	NM_030979		Approved	PABP3, tPABP	uc001upy.3	Q9H361	OTTHUMG00000016601	ENST00000281589.3:c.793C>T	13.37:g.25671129C>T	ENSP00000281589:p.Arg265*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHV0|Q9H086	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_PABP_HYD,superfamily_PABP_HYD,smart_RRM_dom,smart_RRM_dom_euk,smart_PABP_HYD,pfscan_RRM_dom,tigrfam_PABP_1234	p.R265*	ENST00000281589.3	37	c.793	CCDS9311.1	13	.	.	.	.	.	.	.	.	.	.	C	38	6.870043	0.97901	.	.	ENSG00000151846	ENST00000281589	.	.	.	0.875	0.875	0.19130	.	0.000000	0.40385	U	0.001106	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	7.5489	0.27783	0.0:1.0:0.0:0.0	.	.	.	.	X	265	.	ENSP00000281589:R265X	R	+	1	2	PABPC3	24569129	1.000000	0.71417	0.991000	0.47740	0.924000	0.55760	3.630000	0.54273	0.759000	0.33084	0.313000	0.20887	CGA	PABPC3	-	pfscan_RRM_dom,tigrfam_PABP_1234	ENSG00000151846		0.403	PABPC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PABPC3	HGNC	protein_coding	OTTHUMT00000044220.2	49	0.00	0	C	NM_030979		25671129	25671129	+1	no_errors	ENST00000281589	ensembl	human	known	69_37n	nonsense	53	13.11	8	SNP	1.000	T
PCDHA13	56136	genome.wustl.edu	37	5	140263105	140263105	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr5:140263105G>A	ENST00000289272.2	+	1	1252	c.1252G>A	c.(1252-1254)Gta>Ata	p.V418I	PCDHA8_ENST00000531613.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.V418I|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	418	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V418I(2)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCGCGAGAGCGTATCAGCCTA	0.637																																					Melanoma(147;1739 1852 5500 27947 37288)	dbGAP											2	Substitution - Missense(2)	large_intestine(1)|haematopoietic_and_lymphoid_tissue(1)											129.0	129.0	129.0					5																	140263105		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.1252G>A	5.37:g.140263105G>A	ENSP00000289272:p.Val418Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.V418I	ENST00000289272.2	37	c.1252	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	G	1.597	-0.527658	0.04141	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.49139	0.79;0.79	5.19	0.3	0.15776	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.36138	0.0956	L	0.33792	1.035	0.09310	N	1	B;B;B	0.27416	0.178;0.085;0.148	B;B;B	0.29716	0.106;0.068;0.041	T	0.26258	-1.0108	9	0.41790	T	0.15	.	10.2037	0.43101	0.433:0.0:0.567:0.0	.	418;418;418	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	I	418	ENSP00000386821:V418I;ENSP00000289272:V418I	ENSP00000289272:V418I	V	+	1	0	PCDHA13	140243289	0.000000	0.05858	0.002000	0.10522	0.007000	0.05969	-0.312000	0.08113	-0.177000	0.10690	-0.459000	0.05422	GTA	PCDHA13	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000239389		0.637	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	95	0.00	0	G	NM_018904		140263105	140263105	+1	no_errors	ENST00000289272	ensembl	human	known	69_37n	missense	53	20.90	14	SNP	0.000	A
RAI1	10743	genome.wustl.edu	37	17	17696487	17696487	+	Silent	SNP	C	C	G	rs144981212		TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr17:17696487C>G	ENST00000353383.1	+	3	694	c.225C>G	c.(223-225)gcC>gcG	p.A75A	RAI1_ENST00000261641.6_Silent_p.A75A	NM_030665.3	NP_109590.3	Q7Z5J4	RAI1_HUMAN	retinoic acid induced 1	75					circadian regulation of gene expression (GO:0032922)|negative regulation of multicellular organism growth (GO:0040015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	enhancer binding (GO:0035326)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(5)|urinary_tract(7)	48				READ - Rectum adenocarcinoma(1115;0.0276)		CGGTGGCCGCCGACAAGTACC	0.682																																						dbGAP											0													13.0	15.0	14.0					17																	17696487		2189	4274	6463	-	-	-	SO:0001819	synonymous_variant	0			AJ230819	CCDS11188.1	17p11.2	2011-02-08			ENSG00000108557	ENSG00000108557			9834	protein-coding gene	gene with protein product		607642	"""Smith-Magenis syndrome chromosome region"""	SMCR		10036180	Standard	NM_030665		Approved	DKFZP434A139, SMS, KIAA1820, MGC12824	uc002grm.3	Q7Z5J4	OTTHUMG00000059314	ENST00000353383.1:c.225C>G	17.37:g.17696487C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N3B4|Q8ND08|Q8WU64|Q96JK5|Q9H1C1|Q9H1C2|Q9UF69	Silent	SNP	smart_Znf_PHD	p.A75	ENST00000353383.1	37	c.225	CCDS11188.1	17																																																																																			RAI1	-	NULL	ENSG00000108557		0.682	RAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI1	HGNC	protein_coding	OTTHUMT00000131775.1	36	0.00	0	C	NM_030665		17696487	17696487	+1	no_errors	ENST00000353383	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	0.005	G
RBM5	10181	genome.wustl.edu	37	3	50137998	50137998	+	Missense_Mutation	SNP	A	A	G			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr3:50137998A>G	ENST00000347869.3	+	6	618	c.443A>G	c.(442-444)tAt>tGt	p.Y148C	RBM5_ENST00000469838.1_3'UTR	NM_005778.3	NP_005769.1	P52756	RBM5_HUMAN	RNA binding motif protein 5	148	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(3)|large_intestine(4)|lung(6)|prostate(2)	19				BRCA - Breast invasive adenocarcinoma(193;0.000121)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GTGGAGTTTTATCACTTGCAA	0.413																																						dbGAP											0													157.0	131.0	140.0					3																	50137998		2203	4300	6503	-	-	-	SO:0001583	missense	0			U23946	CCDS2810.1	3p21.3	2013-08-15			ENSG00000003756	ENSG00000003756		"""G patch domain containing"", ""RNA binding motif (RRM) containing"""	9902	protein-coding gene	gene with protein product		606884				10352938, 23935508	Standard	NM_005778		Approved	LUCA15, H37	uc003cyg.3	P52756	OTTHUMG00000156785	ENST00000347869.3:c.443A>G	3.37:g.50137998A>G	ENSP00000343054:p.Tyr148Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA45|B4DM16|B4DMF9|B4DZ63|Q93021|Q9BU14|Q9HDA6|Q9UKY8|Q9UL24	Missense_Mutation	SNP	pfam_G_patch_dom,pfam_RRM_dom,pfam_Znf_RanBP2,smart_RRM_dom,smart_Znf_RanBP2,smart_G_patch_dom,pfscan_Znf_RanBP2,pfscan_Znf_C2H2,pfscan_G_patch_dom,pfscan_RRM_dom	p.Y148C	ENST00000347869.3	37	c.443	CCDS2810.1	3	.	.	.	.	.	.	.	.	.	.	A	18.48	3.633846	0.67130	.	.	ENSG00000003756	ENST00000347869;ENST00000543047	T	0.07327	3.2	6.04	6.04	0.98038	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.26231	0.0640	L	0.58810	1.83	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.00273	-1.1858	10	0.37606	T	0.19	-10.5876	16.5763	0.84648	1.0:0.0:0.0:0.0	.	148	P52756	RBM5_HUMAN	C	148;147	ENSP00000343054:Y148C	ENSP00000343054:Y148C	Y	+	2	0	RBM5	50113002	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.327000	0.79147	2.317000	0.78254	0.459000	0.35465	TAT	RBM5	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000003756		0.413	RBM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM5	HGNC	protein_coding	OTTHUMT00000345797.3	48	0.00	0	A	NM_005778		50137998	50137998	+1	no_errors	ENST00000347869	ensembl	human	known	69_37n	missense	45	25.00	15	SNP	1.000	G
RGS7	6000	genome.wustl.edu	37	1	240963987	240963987	+	Frame_Shift_Del	DEL	T	T	-			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr1:240963987delT	ENST00000407727.1	-	17	1447	c.1448delA	c.(1447-1449)aacfs	p.N483fs	RGS7_ENST00000446183.2_Frame_Shift_Del_p.N381fs|RGS7_ENST00000366564.1_Intron|RGS7_ENST00000331110.7_Frame_Shift_Del_p.N439fs|RGS7_ENST00000401882.1_Frame_Shift_Del_p.N412fs|RGS7_ENST00000366562.4_Intron|RGS7_ENST00000366563.1_Frame_Shift_Del_p.N465fs|RGS7_ENST00000366565.1_Intron|RGS7_ENST00000348120.2_Frame_Shift_Del_p.N412fs			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	483					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			TGGTGTACAGTTTTTATGGCA	0.383																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1448delA	1.37:g.240963987delT	ENSP00000384428:p.Asn483fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Frame_Shift_Del	DEL	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.N483fs	ENST00000407727.1	37	c.1448		1																																																																																			RGS7	-	NULL	ENSG00000182901		0.383	RGS7-204	KNOWN	basic	protein_coding	RGS7	HGNC	protein_coding		65	0.00	0	T	NM_002924		240963987	240963987	-1	no_errors	ENST00000407727	ensembl	human	known	69_37n	frame_shift_del	52	14.75	9	DEL	1.000	-
SEMA6A	57556	genome.wustl.edu	37	5	115782950	115782951	+	Missense_Mutation	DNP	GG	GG	TT			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr5:115782950_115782951GG>TT	ENST00000343348.6	-	19	3238_3239	c.2451_2452CC>AA	c.(2449-2454)gtCCtg>gtAAtg	p.L818M	SEMA6A_ENST00000503865.1_Missense_Mutation_p.L197M|CTB-118N6.3_ENST00000514214.1_RNA|CTB-118N6.3_ENST00000510682.1_RNA|SEMA6A_ENST00000257414.8_Missense_Mutation_p.L835M|CTB-118N6.3_ENST00000512128.1_RNA|SEMA6A_ENST00000513137.1_Missense_Mutation_p.L245M|SEMA6A_ENST00000510263.1_Missense_Mutation_p.L818M|CTB-118N6.3_ENST00000508640.1_RNA|SEMA6A_ENST00000282394.6_Missense_Mutation_p.L295M|CTB-118N6.3_ENST00000508424.1_RNA	NM_020796.3	NP_065847	Q9H2E6	SEM6A_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6A	818	Pro-rich.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|centrosome localization (GO:0051642)|cytoskeleton organization (GO:0007010)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|organ morphogenesis (GO:0009887)|positive regulation of neuron migration (GO:2001224)|semaphorin-plexin signaling pathway (GO:0071526)	axon (GO:0030424)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		all_cancers(142;0.00316)|all_epithelial(76;5.71e-05)|Prostate(80;0.00845)|Ovarian(225;0.0796)|Lung NSC(810;0.171)|all_lung(232;0.203)		OV - Ovarian serous cystadenocarcinoma(64;1.59e-08)|Epithelial(69;2e-08)|all cancers(49;5.7e-08)|COAD - Colon adenocarcinoma(49;0.151)		GTGATGGGCAGGACCACCACGC	0.658																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB037789	CCDS47256.1, CCDS75288.1	5q23.1	2014-07-29			ENSG00000092421			"""Semaphorins"""	10738	protein-coding gene	gene with protein product	"""sema VIa"""	605885		SEMAQ		9204478, 10993894	Standard	XM_006714663		Approved	KIAA1368, SEMA6A1, SEMA, HT018	uc010jck.3	Q9H2E6	OTTHUMG00000162987	ENST00000343348.6:c.2451_2452delinsTT	5.37:g.115782950_115782951delinsTT	ENSP00000345512:p.Leu818Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2H9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag|pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.L835M|p.S332Y	ENST00000343348.6	37	c.2503|c.995	CCDS47256.1	5																																																																																			SEMA6A	-	NULL	ENSG00000092421		0.658	SEMA6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA6A	HGNC	protein_coding	OTTHUMT00000371270.1	47|48	0.00	0	G	NM_020796		115782950|115782951	115782950|115782951	-1	no_errors|no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000257414|ENST00000515129	ensembl	human	known|putative	69_37n	missense	32|31	21.95|22.50	9	SNP	1.000|0.998	T
SPATA13	221178	genome.wustl.edu	37	13	24860471	24860471	+	Silent	SNP	G	G	A			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr13:24860471G>A	ENST00000382095.4	+	5	953	c.546G>A	c.(544-546)aaG>aaA	p.K182K	SPATA13_ENST00000399949.2_Silent_p.K104K|SPATA13_ENST00000409126.1_Silent_p.K104K|RP11-307N16.6_ENST00000382141.4_Silent_p.K685K|SPATA13_ENST00000424834.2_Silent_p.K807K|SPATA13_ENST00000382108.3_Silent_p.K807K|SPATA13_ENST00000343003.6_Silent_p.K126K	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	182	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		CCTCCAACAAGGACTGGTGGT	0.577																																						dbGAP											0													72.0	69.0	70.0					13																	24860471		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.546G>A	13.37:g.24860471G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.G723R	ENST00000382095.4	37	c.2167	CCDS9305.1	13	.	.	.	.	.	.	.	.	.	.	G	9.966	1.224257	0.22457	.	.	ENSG00000182957	ENST00000424834	.	.	.	5.25	3.54	0.40534	.	.	.	.	.	T	0.55657	0.1934	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49051	-0.8979	4	.	.	.	.	6.873	0.24131	0.3587:0.0:0.6413:0.0	.	.	.	.	R	845	.	.	G	+	1	0	SPATA13	23758471	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	1.320000	0.33666	0.622000	0.30249	0.655000	0.94253	GGA	SPATA13	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000182957		0.577	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPATA13	HGNC	protein_coding	OTTHUMT00000044180.2	36	0.00	0	G	NM_153023		24860471	24860471	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000382141	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	1.000	A
STON1	11037	genome.wustl.edu	37	2	48809570	48809570	+	Nonsense_Mutation	SNP	C	C	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr2:48809570C>T	ENST00000406226.1	+	3	1993	c.1798C>T	c.(1798-1800)Cga>Tga	p.R600*	STON1-GTF2A1L_ENST00000405008.1_Nonsense_Mutation_p.R600*|STON1_ENST00000309835.3_Nonsense_Mutation_p.R600*|STON1_ENST00000404752.1_Nonsense_Mutation_p.R600*|STON1-GTF2A1L_ENST00000394754.1_Nonsense_Mutation_p.R600*|STON1-GTF2A1L_ENST00000309827.2_Nonsense_Mutation_p.R600*|STON1-GTF2A1L_ENST00000402114.2_Nonsense_Mutation_p.R600*|STON1-GTF2A1L_ENST00000394751.3_Nonsense_Mutation_p.R600*	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	600	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AATGAACCGCCGAGCATGTCT	0.483																																						dbGAP											0													68.0	70.0	69.0					2																	48809570		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.1798C>T	2.37:g.48809570C>T	ENSP00000384615:p.Arg600*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Nonsense_Mutation	SNP	pfam_TFIIA_asu/bsu,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pfscan_Clathrin_mu_C,pfscan_SHD	p.R600*	ENST00000406226.1	37	c.1798	CCDS1841.1	2	.	.	.	.	.	.	.	.	.	.	C	38	6.646426	0.97730	.	.	ENSG00000243244;ENSG00000243244;ENSG00000243244;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781;ENSG00000068781	ENST00000404752;ENST00000406226;ENST00000309835;ENST00000405008;ENST00000402114;ENST00000394754;ENST00000309827;ENST00000394751	.	.	.	5.65	2.61	0.31194	.	0.192185	0.53938	D	0.000055	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	15.421	0.75011	0.7349:0.2651:0.0:0.0	.	.	.	.	X	600	.	ENSP00000310969:R600X	R	+	1	2	STON1-GTF2A1L;STON1	48663074	1.000000	0.71417	0.822000	0.32727	0.712000	0.41017	2.948000	0.49066	0.328000	0.23435	0.655000	0.94253	CGA	STON1-GTF2A1L	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pfscan_Clathrin_mu_C	ENSG00000068781		0.483	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000323848.2	42	0.00	0	C	NM_006873		48809570	48809570	+1	no_errors	ENST00000309827	ensembl	human	known	69_37n	nonsense	46	16.36	9	SNP	0.998	T
TAS2R43	259289	genome.wustl.edu	37	12	11244634	11244634	+	Silent	SNP	G	G	A	rs200893955		TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr12:11244634G>A	ENST00000531678.1	-	1	278	c.195C>T	c.(193-195)aaC>aaT	p.N65N	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	65					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TTGAATACCAGTTTAATAATA	0.408																																						dbGAP											0													52.0	46.0	48.0					12																	11244634		1928	3963	5891	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.195C>T	12.37:g.11244634G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.N65	ENST00000531678.1	37	c.195	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.408	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	29	0.00	0	G	NM_176884		11244634	11244634	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	23	20.69	6	SNP	0.001	A
TAS2R43	259289	genome.wustl.edu	37	12	11244646	11244646	+	Silent	SNP	T	T	C	rs201583586		TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr12:11244646T>C	ENST00000531678.1	-	1	266	c.183A>G	c.(181-183)gtA>gtG	p.V61V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	61					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		TTAATAATAATACCCAGAGCA	0.393																																						dbGAP											0													52.0	47.0	49.0					12																	11244646		1950	3985	5935	-	-	-	SO:0001819	synonymous_variant	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.183A>G	12.37:g.11244646T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P59546|Q645X4	Silent	SNP	pfam_TAS2_rcpt	p.V61	ENST00000531678.1	37	c.183	CCDS53749.1	12																																																																																			TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.393	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	27	0.00	0	T	NM_176884		11244646	11244646	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	silent	22	21.43	6	SNP	0.001	C
TAS2R43	259289	genome.wustl.edu	37	12	11244687	11244687	+	Missense_Mutation	SNP	G	G	C	rs200922417|rs113197337	byFrequency	TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr12:11244687G>C	ENST00000531678.1	-	1	225	c.142C>G	c.(142-144)Ctc>Gtc	p.L48V	TAS2R14_ENST00000381852.4_Intron|PRR4_ENST00000536668.1_Intron	NM_176884.2	NP_795365.2	P59537	T2R43_HUMAN	taste receptor, type 2, member 43	48					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			endometrium(1)|ovary(1)|prostate(2)|urinary_tract(1)	5			OV - Ovarian serous cystadenocarcinoma(49;0.0344)	BRCA - Breast invasive adenocarcinoma(232;0.196)		AGAGCAGTGAGAATTTGGTCA	0.383																																						dbGAP											0													53.0	48.0	49.0					12																	11244687		2019	4101	6120	-	-	-	SO:0001583	missense	0			AF494237	CCDS53749.1	12p13.2	2012-08-22				ENSG00000255374		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18875	protein-coding gene	gene with protein product		612668				12379855	Standard	NM_176884		Approved	T2R52	uc001qzq.1	P59537		ENST00000531678.1:c.142C>G	12.37:g.11244687G>C	ENSP00000431719:p.Leu48Val	Somatic		WXS	Illumina GAIIx	Phase_IV	P59546|Q645X4	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.L48V	ENST00000531678.1	37	c.142	CCDS53749.1	12	.	.	.	.	.	.	.	.	.	.	-	6.625	0.483814	0.12581	.	.	ENSG00000255374	ENST00000531678	T	0.01484	4.84	1.97	0.973	0.19710	.	.	.	.	.	T	0.06142	0.0159	M	0.90145	3.09	0.80722	P	0.0	B	0.34264	0.446	B	0.43867	0.434	T	0.01048	-1.1469	8	0.56958	D	0.05	.	6.121	0.20154	0.0:0.3247:0.6753:0.0	.	48	P59537	T2R43_HUMAN	V	48	ENSP00000431719:L48V	ENSP00000431719:L48V	L	-	1	0	TAS2R43	11135954	0.601000	0.26907	0.010000	0.14722	0.027000	0.11550	1.075000	0.30716	0.130000	0.18549	0.184000	0.17185	CTC	TAS2R43	-	pfam_TAS2_rcpt	ENSG00000255374		0.383	TAS2R43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R43	HGNC	protein_coding	OTTHUMT00000383561.1	26	0.00	0	G	NM_176884		11244687	11244687	-1	no_errors	ENST00000531678	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.022	C
TCF25	22980	genome.wustl.edu	37	16	89967200	89967200	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr16:89967200G>A	ENST00000263346.8	+	12	1435	c.1379G>A	c.(1378-1380)gGa>gAa	p.G460E	TCF25_ENST00000263347.7_Missense_Mutation_p.G225E	NM_014972.2	NP_055787.1	Q9BQ70	TCF25_HUMAN	transcription factor 25 (basic helix-loop-helix)	460					heart development (GO:0007507)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(2)|large_intestine(1)|lung(8)|ovary(3)|skin(1)|urinary_tract(2)	18		all_cancers(9;4.71e-08)|Lung NSC(15;0.000192)|all_lung(18;0.000319)|all_neural(9;0.0122)|all_hematologic(23;0.027)		BRCA - Breast invasive adenocarcinoma(80;0.0288)		ATGTTCCCTGGAGGTGAGTGA	0.637																																						dbGAP											0													51.0	46.0	48.0					16																	89967200		2198	4300	6498	-	-	-	SO:0001583	missense	0			AF322111	CCDS10987.1	16q24.3	2008-02-05			ENSG00000141002	ENSG00000141002			29181	protein-coding gene	gene with protein product		612326				12107429, 16574069	Standard	NM_014972		Approved	Nulp1, KIAA1049	uc002fpb.2	Q9BQ70	OTTHUMG00000138986	ENST00000263346.8:c.1379G>A	16.37:g.89967200G>A	ENSP00000263346:p.Gly460Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2MK75|Q9UPV3	Nonsense_Mutation	SNP	pfam_TCF25	p.W321*	ENST00000263346.8	37	c.963	CCDS10987.1	16	.	.	.	.	.	.	.	.	.	.	G	17.57	3.422101	0.62622	.	.	ENSG00000141002	ENST00000263346;ENST00000263347	.	.	.	5.65	4.7	0.59300	.	0.100911	0.64402	N	0.000002	T	0.70072	0.3182	L	0.55743	1.74	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.68765	0.928;0.96	T	0.73366	-0.4005	9	0.87932	D	0	.	13.7167	0.62700	0.0737:0.0:0.9263:0.0	.	225;460	Q9H384;Q9BQ70	.;TCF25_HUMAN	E	460;225	.	ENSP00000263346:G460E	G	+	2	0	TCF25	88494701	1.000000	0.71417	1.000000	0.80357	0.439000	0.31926	5.851000	0.69481	1.407000	0.46875	-0.140000	0.14226	GGA	TCF25	-	pfam_TCF25	ENSG00000141002		0.637	TCF25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF25	HGNC	protein_coding	OTTHUMT00000272875.2	43	0.00	0	G	NM_014972		89967200	89967200	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000562256	ensembl	human	putative	69_37n	nonsense	24	17.24	5	SNP	1.000	A
TMED1	11018	genome.wustl.edu	37	19	10943615	10943616	+	3'UTR	DEL	AT	AT	-			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr19:10943615_10943616delAT	ENST00000214869.2	-	0	837_838				TMED1_ENST00000591695.1_Stop_Codon_Del	NM_006858.2	NP_006849.1	Q13445	TMED1_HUMAN	transmembrane emp24 protein transport domain containing 1						cell-cell signaling (GO:0007267)|protein transport (GO:0015031)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(2)|lung(2)|ovary(3)|prostate(1)|skin(1)	10						CCCAAGTCTCATATGCACACAC	0.609																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U41804	CCDS12249.1	19p13.2	2008-02-05	2005-08-26			ENSG00000099203			17291	protein-coding gene	gene with protein product		605395	"""transmembrane emp24 domain containing 1"""			11466339, 8621446	Standard	NM_006858		Approved	ST2L, MGC1270, IL1RL1LG, Il1rl1l	uc002mpy.3	Q13445		ENST00000214869.2:c.*56AT>-	19.37:g.10943617_10943618delAT		Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_GOLD,superfamily_GOLD	p.I185fs	ENST00000214869.2	37	c.556_555	CCDS12249.1	19																																																																																			TMED1	-	NULL	ENSG00000099203		0.609	TMED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED1	HGNC	protein_coding	OTTHUMT00000452614.1	40	0.00	0	AT	NM_006858		10943615	10943616	-1	no_errors	ENST00000591695	ensembl	human	putative	69_37n	frame_shift_del	36	26.53	13	DEL	0.003:0.000	-
TP53	7157	genome.wustl.edu	37	17	7574003	7574003	+	Nonsense_Mutation	SNP	G	G	A			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr17:7574003G>A	ENST00000269305.4	-	10	1213	c.1024C>T	c.(1024-1026)Cga>Tga	p.R342*	TP53_ENST00000455263.2_3'UTR|TP53_ENST00000445888.2_Nonsense_Mutation_p.R342*|TP53_ENST00000420246.2_3'UTR|TP53_ENST00000413465.2_Intron|TP53_ENST00000359597.4_Intron	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	342	Interaction with CARM1.|Interaction with HIPK1. {ECO:0000250}.|Interaction with HIPK2.|Oligomerization.		R -> L (in a sporadic cancer; somatic mutation).|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in sporadic cancers; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R342*(70)|p.0?(8)|p.R342fs*3(8)|p.?(1)|p.R342_N345delRELN(1)|p.I332fs*5(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCAGCTCTCGGAACATCTCG	0.557		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	89	Substitution - Nonsense(70)|Whole gene deletion(8)|Deletion - Frameshift(7)|Insertion - Frameshift(2)|Deletion - In frame(1)|Unknown(1)	breast(16)|upper_aerodigestive_tract(11)|large_intestine(9)|central_nervous_system(9)|ovary(7)|lung(6)|skin(5)|liver(5)|haematopoietic_and_lymphoid_tissue(4)|pancreas(4)|bone(4)|stomach(2)|urinary_tract(2)|oesophagus(2)|kidney(1)|peritoneum(1)|endometrium(1)	GRCh37	CM004908	TP53	M							62.0	48.0	53.0					17																	7574003		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.1024C>T	17.37:g.7574003G>A	ENSP00000269305:p.Arg342*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R342*	ENST00000269305.4	37	c.1024	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	37	6.061927	0.97246	.	.	ENSG00000141510	ENST00000269305;ENST00000445888;ENST00000396473	.	.	.	5.43	3.43	0.39272	.	0.217683	0.37906	N	0.001893	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09338	T	0.73	-0.3792	6.4477	0.21885	0.0845:0.0:0.5925:0.323	.	.	.	.	X	342;342;331	.	ENSP00000269305:R342X	R	-	1	2	TP53	7514728	0.820000	0.29190	0.702000	0.30337	0.859000	0.49053	2.169000	0.42434	0.657000	0.30906	0.561000	0.74099	CGA	TP53	-	pfam_p53_tetrameristn,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	ENSG00000141510		0.557	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	21	0.00	0	G	NM_000546		7574003	7574003	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	14	22.22	4	SNP	0.307	A
USP24	23358	genome.wustl.edu	37	1	55619828	55619828	+	Silent	SNP	C	C	T			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr1:55619828C>T	ENST00000294383.6	-	15	1775	c.1776G>A	c.(1774-1776)agG>agA	p.R592R	USP24_ENST00000407756.1_Silent_p.R448R	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	592					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						TGATGTAGCTCCTCTTGATTG	0.438																																						dbGAP											0													132.0	125.0	127.0					1																	55619828		1941	4156	6097	-	-	-	SO:0001819	synonymous_variant	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.1776G>A	1.37:g.55619828C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZSY2|Q8N2Y4|Q9NXD1	Silent	SNP	pfam_Peptidase_C19,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19	p.R592	ENST00000294383.6	37	c.1776	CCDS44154.2	1																																																																																			USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.438	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	36	0.00	0	C			55619828	55619828	-1	no_errors	ENST00000294383	ensembl	human	known	69_37n	silent	40	14.89	7	SNP	1.000	T
WDR5	11091	genome.wustl.edu	37	9	137013427	137013427	+	Silent	SNP	T	T	C			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr9:137013427T>C	ENST00000358625.3	+	8	717	c.546T>C	c.(544-546)gaT>gaC	p.D182D	WDR5_ENST00000425041.1_Silent_p.D182D	NM_017588.2	NP_060058.1	P61964	WDR5_HUMAN	WD repeat domain 5	182					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|histone H3-K4 methylation (GO:0051568)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|positive regulation of gluconeogenesis (GO:0045722)|regulation of transcription, DNA-templated (GO:0006355)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|histone acetyltransferase complex (GO:0000123)|histone methyltransferase complex (GO:0035097)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)				endometrium(1)|kidney(1)|large_intestine(2)|lung(5)	9		Myeloproliferative disorder(178;0.0255)|Medulloblastoma(224;0.123)		Epithelial(140;6.61e-13)|all cancers(34;5.66e-12)|OV - Ovarian serous cystadenocarcinoma(145;3.93e-08)|GBM - Glioblastoma multiforme(294;0.00326)|READ - Rectum adenocarcinoma(205;0.154)		TTAATCGTGATGGATCCTTGA	0.388																																						dbGAP											0													212.0	197.0	202.0					9																	137013427		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ011376	CCDS6981.1	9q34	2014-09-03			ENSG00000196363	ENSG00000196363		"""WD repeat domain containing"""	12757	protein-coding gene	gene with protein product	"""SWD3, Set1c WD40 repeat protein, homolog (S. cerevisiae)"", ""cilia and flagella associated protein 89"""	609012				11551928	Standard	XM_005272163		Approved	SWD3, CFAP89	uc004cey.3	P61964	OTTHUMG00000131707	ENST00000358625.3:c.546T>C	9.37:g.137013427T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q91VA5|Q9NWX7|Q9UGP9	Silent	SNP	pfam_WD40_repeat,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D182	ENST00000358625.3	37	c.546	CCDS6981.1	9																																																																																			WDR5	-	pfam_WD40_repeat,pfam_TIF2A_beta_prop-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000196363		0.388	WDR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR5	HGNC	protein_coding	OTTHUMT00000254621.1	67	0.00	0	T	NM_052821		137013427	137013427	+1	no_errors	ENST00000358625	ensembl	human	known	69_37n	silent	61	11.59	8	SNP	1.000	C
ZAN	7455	genome.wustl.edu	37	7	100383642	100383642	+	RNA	SNP	C	C	G	rs182830568	byFrequency	TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr7:100383642C>G	ENST00000348028.3	+	0	7022				ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GGGTCTCCAGCGGTTGCACGG	0.607																																						dbGAP											0													33.0	34.0	34.0					7																	100383642		1924	4129	6053	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100383642C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.S2285R	ENST00000348028.3	37	c.6855		7	.	.	.	.	.	.	.	.	.	.	C	10.71	1.425970	0.25726	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.05025	3.51;3.51;3.51;3.51	4.77	-9.54	0.00572	von Willebrand factor, type C (1);	2.543660	0.01210	N	0.007819	T	0.03390	0.0098	.	.	.	0.09310	N	1	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.09377	0.001;0.002;0.004	T	0.28839	-1.0031	9	0.30078	T	0.28	.	2.2708	0.04090	0.2596:0.3462:0.256:0.1382	.	759;2285;2286	F5GX59;F5H0T8;Q9Y493	.;.;ZAN_HUMAN	R	2285;2285;2285;759	ENSP00000445943:S2285R;ENSP00000445091:S2285R;ENSP00000444427:S2285R;ENSP00000441117:S759R	ENSP00000445091:S2285R	S	+	3	2	ZAN	100221578	0.000000	0.05858	0.000000	0.03702	0.054000	0.15201	-3.469000	0.00460	-3.780000	0.00108	-0.294000	0.09567	AGC	ZAN	-	smart_VWC_out	ENSG00000146839		0.607	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	30	0.00	0	C	NM_003386		100383642	100383642	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	40	23.08	12	SNP	0.000	G
ZBTB48	3104	genome.wustl.edu	37	1	6648359	6648359	+	Missense_Mutation	SNP	G	G	A			TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chr1:6648359G>A	ENST00000377674.4	+	9	1696	c.1538G>A	c.(1537-1539)cGc>cAc	p.R513H		NM_001278647.1|NM_001278648.1|NM_005341.2	NP_001265576.1|NP_001265577.1|NP_005332.1	P10074	ZBT48_HUMAN	zinc finger and BTB domain containing 48	513					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(1)|large_intestine(1)|liver(2)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;7.39e-28)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;1.35e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(304;0.00109)|STAD - Stomach adenocarcinoma(132;0.017)|READ - Rectum adenocarcinoma(331;0.0642)		AAGCACAACCGCACCCACACC	0.657																																					Esophageal Squamous(125;1449 1657 4031 29866 49542)	dbGAP											0													73.0	63.0	67.0					1																	6648359		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC013573	CCDS84.1	1p36.3	2013-01-08	2006-09-20	2006-09-20	ENSG00000204859	ENSG00000204859		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	4930	protein-coding gene	gene with protein product		165270	"""GLI-Kruppel family member HKR3"""	HKR3		2850480, 8661141	Standard	NM_001278647		Approved	ZNF855	uc001anx.3	P10074	OTTHUMG00000001438	ENST00000377674.4:c.1538G>A	1.37:g.6648359G>A	ENSP00000366902:p.Arg513His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY19	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R513H	ENST00000377674.4	37	c.1538	CCDS84.1	1	.	.	.	.	.	.	.	.	.	.	G	22.6	4.310069	0.81247	.	.	ENSG00000204859	ENST00000377674	T	0.25749	1.78	5.24	4.33	0.51752	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.153345	0.64402	D	0.000013	T	0.55433	0.1920	M	0.88181	2.935	0.58432	D	0.999999	D	0.89917	1.0	D	0.69824	0.966	T	0.65236	-0.6217	10	0.87932	D	0	-21.7854	13.3107	0.60378	0.0767:0.0:0.9233:0.0	.	513	P10074	ZBT48_HUMAN	H	513	ENSP00000366902:R513H	ENSP00000366902:R513H	R	+	2	0	ZBTB48	6570946	1.000000	0.71417	1.000000	0.80357	0.772000	0.43724	9.852000	0.99516	1.369000	0.46134	0.514000	0.50259	CGC	ZBTB48	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204859		0.657	ZBTB48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB48	HGNC	protein_coding	OTTHUMT00000004193.1	14	0.00	0	G	NM_005341		6648359	6648359	+1	no_errors	ENST00000377674	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	A
ZNF711	7552	genome.wustl.edu	37	X	84520170	84520170	+	Silent	SNP	A	A	C	rs377298262		TCGA-OL-A66I-01A-21D-A29N-09	TCGA-OL-A66I-10A-01D-A29N-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	58314df9-cc1a-41b7-adb9-c74f43781912	854b2ea6-3de2-47bf-b7cd-b8de234014a9	g.chrX:84520170A>C	ENST00000373165.3	+	6	1131	c.825A>C	c.(823-825)tcA>tcC	p.S275S	ZNF711_ENST00000395402.1_Silent_p.S253S|ZNF711_ENST00000360700.4_Silent_p.S275S|ZNF711_ENST00000276123.3_Silent_p.S275S|ZNF711_ENST00000542798.1_Silent_p.S71S	NM_021998.4	NP_068838.3	Q9Y462	ZN711_HUMAN	zinc finger protein 711	275					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(14)|ovary(3)|skin(4)	28						GTGGACATTCAGTAGCTGGAG	0.393																																						dbGAP											0													87.0	81.0	83.0					X																	84520170		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006349	CCDS35344.1	Xq21.1	2014-02-19	2006-06-29	2006-06-29	ENSG00000147180	ENSG00000147180		"""Zinc fingers, C2H2-type"""	13128	protein-coding gene	gene with protein product		314990	"""zinc finger protein 6 (CMPX1)"", ""zinc finger protein 6"""	ZNF6		19377476	Standard	XM_005262186		Approved	CMPX1, ZNF4, ZNF5, dJ75N13.1, Zfp711, MRX97	uc004eeo.3	Q9Y462	OTTHUMG00000021933	ENST00000373165.3:c.825A>C	X.37:g.84520170A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSV4|Q6NX42|Q9Y4J6	Silent	SNP	pfam_Transcrp_activ_Zfx/Zfy-dom,pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S253	ENST00000373165.3	37	c.759	CCDS35344.1	X																																																																																			ZNF711	-	pfam_Transcrp_activ_Zfx/Zfy-dom	ENSG00000147180		0.393	ZNF711-001	KNOWN	basic|CCDS	protein_coding	ZNF711	HGNC	protein_coding	OTTHUMT00000057388.2	50	0.00	0	A	NM_021998		84520170	84520170	+1	no_errors	ENST00000395402	ensembl	human	known	69_37n	silent	66	10.81	8	SNP	1.000	C
