#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA2	20	genome.wustl.edu	37	9	139910561	139910561	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr9:139910561C>T	ENST00000371605.3	-	21	3314	c.3167G>A	c.(3166-3168)cGc>cAc	p.R1056H	ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000341511.6_Missense_Mutation_p.R1057H|ABCA2_ENST00000265662.5_Missense_Mutation_p.R1057H			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1056	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CATCTCCGTGCGGATGTCGTG	0.622																																						dbGAP											0													88.0	96.0	93.0					9																	139910561		2148	4239	6387	-	-	-	SO:0001583	missense	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.3167G>A	9.37:g.139910561C>T	ENSP00000360666:p.Arg1056His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.R1057H	ENST00000371605.3	37	c.3170		9	.	.	.	.	.	.	.	.	.	.	c	18.25	3.582020	0.65992	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.93859	-3.3;-3.3;-3.3	4.19	4.19	0.49359	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	U	0.000000	D	0.94650	0.8275	L	0.52126	1.63	0.80722	D	1	D;P	0.63046	0.992;0.889	P;B	0.59889	0.865;0.391	D	0.95454	0.8537	10	0.87932	D	0	.	16.4978	0.84250	0.0:1.0:0.0:0.0	.	1056;1087	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	H	1057;1056;1087;1057	ENSP00000265662:R1057H;ENSP00000360666:R1056H;ENSP00000344155:R1057H	ENSP00000265662:R1057H	R	-	2	0	ABCA2	139030382	1.000000	0.71417	1.000000	0.80357	0.663000	0.39108	5.927000	0.70080	1.876000	0.54355	0.306000	0.20318	CGC	ABCA2	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000107331		0.622	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		61	0.00	0	C	NM_001606		139910561	139910561	-1	no_errors	ENST00000265662	ensembl	human	known	69_37n	missense	55	30.38	24	SNP	1.000	T
ACOT9	23597	genome.wustl.edu	37	X	23723973	23723973	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chrX:23723973G>C	ENST00000336430.7	-	11	949	c.818C>G	c.(817-819)aCt>aGt	p.T273S	ACOT9_ENST00000379303.5_Missense_Mutation_p.T282S|ACOT9_ENST00000379295.1_Missense_Mutation_p.T213S	NM_001033583.2	NP_001028755.2	Q9Y305	ACOT9_HUMAN	acyl-CoA thioesterase 9	273					acyl-CoA metabolic process (GO:0006637)	mitochondrion (GO:0005739)	acetyl-CoA hydrolase activity (GO:0003986)|carboxylic ester hydrolase activity (GO:0052689)			breast(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(4)|pancreas(1)|skin(1)	15						AAAACTTATAGTCCTGTACAA	0.358																																						dbGAP											0													81.0	90.0	87.0					X																	23723973		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132950	CCDS35216.1, CCDS43924.1	Xp22.11	2008-02-05			ENSG00000123130	ENSG00000123130		"""Acyl CoA thioesterases"""	17152	protein-coding gene	gene with protein product		300862				10383425, 10810093, 16103133, 16940157	Standard	XM_005274471		Approved	CGI-16, MT-ACT48, ACATE2	uc004dao.3	Q9Y305	OTTHUMG00000021257	ENST00000336430.7:c.818C>G	X.37:g.23723973G>C	ENSP00000336580:p.Thr273Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNC9|B7ZM94	Missense_Mutation	SNP	pfam_Thioestr_supf	p.T282S	ENST00000336430.7	37	c.845	CCDS35216.1	X	.	.	.	.	.	.	.	.	.	.	G	13.40	2.226966	0.39399	.	.	ENSG00000123130	ENST00000379303;ENST00000336430;ENST00000379295;ENST00000473710	T;T;T	0.30182	1.55;1.54;1.57	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.20941	0.0504	N	0.17723	0.515	0.80722	D	1	B;B;B	0.15930	0.01;0.003;0.015	B;B;B	0.23150	0.02;0.009;0.044	T	0.07083	-1.0791	10	0.05620	T	0.96	-17.5956	18.3373	0.90293	0.0:0.0:1.0:0.0	.	240;273;282	Q9Y305-2;Q9Y305;Q9Y305-4	.;ACOT9_HUMAN;.	S	282;273;213;199	ENSP00000368605:T282S;ENSP00000336580:T273S;ENSP00000368597:T213S	ENSP00000336580:T273S	T	-	2	0	ACOT9	23633894	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	6.444000	0.73452	2.356000	0.79943	0.600000	0.82982	ACT	ACOT9	-	NULL	ENSG00000123130		0.358	ACOT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT9	HGNC	protein_coding	OTTHUMT00000056065.1	69	0.00	0	G	NM_012332		23723973	23723973	-1	no_errors	ENST00000379303	ensembl	human	known	69_37n	missense	66	29.79	28	SNP	1.000	C
ADAM19	8728	genome.wustl.edu	37	5	156934141	156934141	+	Missense_Mutation	SNP	A	A	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:156934141A>G	ENST00000517905.1	-	10	957	c.913T>C	c.(913-915)Tcc>Ccc	p.S305P	ADAM19_ENST00000430702.2_Missense_Mutation_p.S38P|ADAM19_ENST00000394020.1_Missense_Mutation_p.S307P|ADAM19_ENST00000257527.4_Missense_Mutation_p.S305P			Q9H013	ADA19_HUMAN	ADAM metallopeptidase domain 19	305	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				heart development (GO:0007507)|membrane protein ectodomain proteolysis (GO:0006509)	integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Renal(175;0.00488)	Medulloblastoma(196;0.0359)|all_neural(177;0.14)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			CCGTGGAAGGACATGCCCCTG	0.617																																						dbGAP											0													75.0	70.0	72.0					5																	156934141		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311317	CCDS4338.1	5q33.3	2010-06-24	2010-06-24		ENSG00000135074	ENSG00000135074		"""ADAM metallopeptidase domain containing"""	197	protein-coding gene	gene with protein product	"""meltrin beta"""	603640	"""a disintegrin and metalloproteinase domain 19 (meltrin beta)"""			9806848	Standard	NM_033274		Approved	MLTNB	uc003lwz.4	Q9H013	OTTHUMG00000130242	ENST00000517905.1:c.913T>C	5.37:g.156934141A>G	ENSP00000428654:p.Ser305Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BZL5|Q9UHP2	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.S307P	ENST00000517905.1	37	c.919		5	.	.	.	.	.	.	.	.	.	.	A	13.42	2.233232	0.39498	.	.	ENSG00000135074	ENST00000430702;ENST00000257527;ENST00000394020;ENST00000517905	T;D;D;D	0.86956	2.94;-2.19;-2.19;-2.19	5.46	0.397	0.16314	.	0.614922	0.16343	N	0.218576	T	0.75781	0.3896	N	0.21194	0.64	0.36993	D	0.894901	B;B	0.12630	0.006;0.006	B;B	0.11329	0.006;0.003	T	0.62784	-0.6781	10	0.24483	T	0.36	.	10.0262	0.42072	0.6278:0.0:0.3722:0.0	.	305;38	Q9H013-2;E9PD32	.;.	P	38;305;307;305	ENSP00000414088:S38P;ENSP00000257527:S305P;ENSP00000377588:S307P;ENSP00000428654:S305P	ENSP00000257527:S305P	S	-	1	0	ADAM19	156866719	0.024000	0.19004	0.108000	0.21378	0.994000	0.84299	0.346000	0.19997	-0.149000	0.11215	0.528000	0.53228	TCC	ADAM19	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000135074		0.617	ADAM19-003	PUTATIVE	basic	protein_coding	ADAM19	HGNC	protein_coding	OTTHUMT00000373918.1	23	0.00	0	A	NM_033274		156934141	156934141	-1	no_errors	ENST00000394020	ensembl	human	known	69_37n	missense	10	37.50	6	SNP	0.707	G
AGBL4	84871	genome.wustl.edu	37	1	49052811	49052811	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:49052811C>G	ENST00000371839.1	-	11	1248	c.1132G>C	c.(1132-1134)Gtg>Ctg	p.V378L	AGBL4_ENST00000334103.7_Missense_Mutation_p.V111L	NM_032785.3	NP_116174.3	Q5VU57	CBPC6_HUMAN	ATP/GTP binding protein-like 4	378					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytosol (GO:0005829)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|stomach(1)	15				Colorectal(2;0.00349)|COAD - Colon adenocarcinoma(2;0.0037)		CCTGCTTTCACAGCGTCCCGG	0.517																																						dbGAP											0													30.0	33.0	32.0					1																	49052811		2001	4147	6148	-	-	-	SO:0001583	missense	0			AK027348	CCDS44137.1	1p33	2014-06-23			ENSG00000186094	ENSG00000186094			25892	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 6"""					21074048	Standard	NM_032785		Approved	FLJ14442, CCP6	uc001cru.2	Q5VU57	OTTHUMG00000007793	ENST00000371839.1:c.1132G>C	1.37:g.49052811C>G	ENSP00000360905:p.Val378Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT26|B4DG37	Missense_Mutation	SNP	pfam_Peptidase_M14,smart_Peptidase_M14	p.V378L	ENST00000371839.1	37	c.1132	CCDS44137.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.17|16.17	3.047751|3.047751	0.55110|0.55110	.|.	.|.	ENSG00000186094|ENSG00000186094	ENST00000432500|ENST00000371839;ENST00000411952;ENST00000334103	.|T;T	.|0.11821	.|2.74;2.74	5.9|5.9	4.96|4.96	0.65561|0.65561	.|Peptidase M14, carboxypeptidase A (1);	.|0.102031	.|0.64402	.|D	.|0.000003	T|T	0.12646|0.12646	0.0307|0.0307	L|L	0.41356|0.41356	1.27|1.27	0.42268|0.42268	D|D	0.992046|0.992046	.|P;B;B;B;B	.|0.34462	.|0.454;0.186;0.164;0.02;0.055	.|B;B;B;B;B	.|0.34138	.|0.176;0.042;0.098;0.029;0.079	T|T	0.10894|0.10894	-1.0610|-1.0610	5|9	.|.	.|.	.|.	-9.8691|-9.8691	12.7291|12.7291	0.57187|0.57187	0.0:0.917:0.0:0.083|0.0:0.917:0.0:0.083	.|.	.|193;390;111;223;378	.|A0AVJ2;Q5VU57-2;B4DGK1;B1AMW2;Q5VU57	.|.;.;.;.;CBPC6_HUMAN	S|L	106|378;372;111	.|ENSP00000360905:V378L;ENSP00000335516:V111L	.|.	C|V	-|-	2|1	0|0	AGBL4|AGBL4	48825398|48825398	1.000000|1.000000	0.71417|0.71417	0.887000|0.887000	0.34795|0.34795	0.986000|0.986000	0.74619|0.74619	5.726000|5.726000	0.68515|0.68515	1.426000|1.426000	0.47256|0.47256	0.549000|0.549000	0.68633|0.68633	TGT|GTG	AGBL4	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000186094		0.517	AGBL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL4	HGNC	protein_coding	OTTHUMT00000021346.4	37	0.00	0	C	NM_032785		49052811	49052811	-1	no_errors	ENST00000371839	ensembl	human	known	69_37n	missense	27	40.00	18	SNP	0.998	G
ALDH1L2	160428	genome.wustl.edu	37	12	105418256	105418256	+	Splice_Site	SNP	A	A	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:105418256A>C	ENST00000258494.9	-	23	2858	c.2718T>G	c.(2716-2718)ggT>ggG	p.G906G	C12orf45_ENST00000548583.1_Intron	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	906	Aldehyde dehydrogenase.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						GAGCTTCCTCACCTAGGGAAG	0.448																																						dbGAP											0													158.0	132.0	141.0					12																	105418256		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.2717-1T>G	12.37:g.105418256A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY68|Q68D62|Q6AI55|Q8N922	Silent	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.G906	ENST00000258494.9	37	c.2718	CCDS31891.1	12																																																																																			ALDH1L2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,pirsf_10_FTHF_DH	ENSG00000136010		0.448	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L2	HGNC	protein_coding	OTTHUMT00000406098.1	41	0.00	0	A	XM_090294	Silent	105418256	105418256	-1	no_errors	ENST00000258494	ensembl	human	known	69_37n	silent	30	31.82	14	SNP	1.000	C
ANGPTL3	27329	genome.wustl.edu	37	1	63069994	63069994	+	Intron	DEL	A	A	-			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:63069994delA	ENST00000371129.3	+	6	1278				DOCK7_ENST00000251157.5_Intron|ANGPTL3_ENST00000493994.1_3'UTR|DOCK7_ENST00000340370.5_Intron|DOCK7_ENST00000404627.2_Intron	NM_014495.2	NP_055310.1	Q9Y5C1	ANGL3_HUMAN	angiopoietin-like 3						acylglycerol homeostasis (GO:0055090)|artery morphogenesis (GO:0048844)|cell-matrix adhesion (GO:0007160)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|fatty acid metabolic process (GO:0006631)|glycerol metabolic process (GO:0006071)|integrin-mediated signaling pathway (GO:0007229)|lipid homeostasis (GO:0055088)|lipid storage (GO:0019915)|negative regulation of lipoprotein lipase activity (GO:0051005)|negative regulation of phospholipase activity (GO:0010519)|phospholipid catabolic process (GO:0009395)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of lipid catabolic process (GO:0050996)|response to hormone (GO:0009725)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	cell surface (GO:0009986)|extracellular space (GO:0005615)	enzyme inhibitor activity (GO:0004857)|growth factor activity (GO:0008083)|integrin binding (GO:0005178)|phospholipase inhibitor activity (GO:0004859)			breast(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|urinary_tract(1)	13						GACAACTTTTAAAAATCCGAA	0.313																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF152562	CCDS622.1	1p31.3	2013-02-06			ENSG00000132855	ENSG00000132855		"""Fibrinogen C domain containing"""	491	protein-coding gene	gene with protein product	"""angiopoietin 5"""	604774		ANGPT5		10644446	Standard	NM_014495		Approved		uc001das.2	Q9Y5C1	OTTHUMG00000009146	ENST00000371129.3:c.1198+88A>-	1.37:g.63069994delA		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLS0|B1ALJ0|B2RCW1	RNA	DEL	-	NULL	ENST00000371129.3	37	NULL	CCDS622.1	1																																																																																			ANGPTL3	-	-	ENSG00000132855		0.313	ANGPTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANGPTL3	HGNC	protein_coding	OTTHUMT00000025344.1	23	0.00	0	A	NM_014495		63069994	63069994	+1	no_errors	ENST00000493994	ensembl	human	putative	69_37n	rna	19	35.48	11	DEL	0.617	-
ANK2	287	genome.wustl.edu	37	4	114277295	114277295	+	Silent	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr4:114277295C>T	ENST00000357077.4	+	38	7574	c.7521C>T	c.(7519-7521)tcC>tcT	p.S2507S	ANK2_ENST00000510275.2_Intron|ANK2_ENST00000394537.3_Intron|ANK2_ENST00000509550.1_Intron|ANK2_ENST00000506722.1_Intron|ANK2_ENST00000264366.6_Silent_p.S2474S	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	2507					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		CTGTGCGGTCCCGGCTACTCC	0.537																																						dbGAP											0													71.0	73.0	73.0					4																	114277295		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.7521C>T	4.37:g.114277295C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.S2507	ENST00000357077.4	37	c.7521	CCDS3702.1	4																																																																																			ANK2	-	NULL	ENSG00000145362		0.537	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	23	0.00	0	C	NM_001148		114277295	114277295	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	silent	19	20.83	5	SNP	0.922	T
ANKRD39	51239	genome.wustl.edu	37	2	97514138	97514138	+	Missense_Mutation	SNP	T	T	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:97514138T>A	ENST00000393537.4	-	4	559	c.452A>T	c.(451-453)cAa>cTa	p.Q151L		NM_016466.5	NP_057550.3	Q53RE8	ANR39_HUMAN	ankyrin repeat domain 39	151										NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)	6						TGGGCTGTGTTGCAGGAGGAG	0.617																																						dbGAP											0													90.0	79.0	83.0					2																	97514138		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031303	CCDS2028.1	2q11.2	2013-01-10			ENSG00000213337	ENSG00000213337		"""Ankyrin repeat domain containing"""	28640	protein-coding gene	gene with protein product						11042152	Standard	NM_016466		Approved	MGC41816	uc002sxd.4	Q53RE8	OTTHUMG00000130530	ENST00000393537.4:c.452A>T	2.37:g.97514138T>A	ENSP00000377170:p.Gln151Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59FU2|Q8N5X5|Q9P0S5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.Q151L	ENST00000393537.4	37	c.452	CCDS2028.1	2	.	.	.	.	.	.	.	.	.	.	T	16.36	3.102091	0.56183	.	.	ENSG00000213337	ENST00000393537	T	0.65178	-0.14	5.62	4.45	0.53987	Ankyrin repeat-containing domain (4);	0.510541	0.17581	U	0.169136	T	0.48484	0.1502	N	0.20766	0.605	0.34085	D	0.659993	B	0.24043	0.096	B	0.28465	0.09	T	0.57359	-0.7825	10	0.59425	D	0.04	-7.5246	10.8046	0.46509	0.0:0.0:0.1588:0.8412	.	151	Q53RE8	ANR39_HUMAN	L	151	ENSP00000377170:Q151L	ENSP00000377170:Q151L	Q	-	2	0	ANKRD39	96877865	0.995000	0.38212	0.589000	0.28718	0.888000	0.51559	2.167000	0.42415	0.958000	0.37956	0.477000	0.44152	CAA	ANKRD39	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000213337		0.617	ANKRD39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD39	HGNC	protein_coding	OTTHUMT00000252951.2	56	0.00	0	T	NM_016466		97514138	97514138	-1	no_errors	ENST00000393537	ensembl	human	known	69_37n	missense	35	36.36	20	SNP	0.997	A
ARFGAP1	55738	genome.wustl.edu	37	20	61907911	61907911	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr20:61907911C>T	ENST00000370283.4	+	4	390	c.250C>T	c.(250-252)Cga>Tga	p.R84*	ARFGAP1_ENST00000519604.1_Nonsense_Mutation_p.R31*|ARFGAP1_ENST00000547204.1_Nonsense_Mutation_p.R10*|ARFGAP1_ENST00000353546.3_Nonsense_Mutation_p.R84*|ARFGAP1_ENST00000519273.2_Silent_p.S4S|ARFGAP1_ENST00000370275.4_Nonsense_Mutation_p.R84*	NM_018209.2	NP_060679.1	Q8N6T3	ARFG1_HUMAN	ADP-ribosylation factor GTPase activating protein 1	84	Arf-GAP. {ECO:0000255|PROSITE- ProRule:PRU00288}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPI coating of Golgi vesicle (GO:0048205)|endoplasmic reticulum unfolded protein response (GO:0030968)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cytosol (GO:0005829)|Golgi-associated vesicle membrane (GO:0030660)|synapse (GO:0045202)	ARF GTPase activator activity (GO:0008060)|GTPase activator activity (GO:0005096)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|pancreas(1)	13	all_cancers(38;1.59e-09)					TGCTAAGTTCCGAGAGTTCCT	0.507																																						dbGAP											0													133.0	110.0	118.0					20																	61907911		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK001629	CCDS13515.1, CCDS13516.1, CCDS63326.1, CCDS63327.1, CCDS63328.1	20q13.33	2009-11-30	2002-08-20	2002-08-23	ENSG00000101199	ENSG00000101199		"""ADP-ribosylation factor GTPase activating proteins"""	15852	protein-coding gene	gene with protein product		608377	"""ADP-ribosylation factor 1 GTPase activating protein"""	ARF1GAP		11210549	Standard	NM_018209		Approved	FLJ10767, bA261N11.3	uc002yel.3	Q8N6T3	OTTHUMG00000032965	ENST00000370283.4:c.250C>T	20.37:g.61907911C>T	ENSP00000359306:p.Arg84*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3U0|B7Z8H8|B7ZBI3|E1P5I9|E7EV62|Q6PK71|Q96KC4|Q96T02|Q9NSU3|Q9NVF6|Q9UIL0	Nonsense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.R84*	ENST00000370283.4	37	c.250	CCDS13515.1	20	.	.	.	.	.	.	.	.	.	.	C	24.5	4.534974	0.85812	.	.	ENSG00000101199	ENST00000370283;ENST00000547204;ENST00000549047;ENST00000519604;ENST00000370275;ENST00000518601;ENST00000353546;ENST00000522403;ENST00000550188	.	.	.	4.76	3.8	0.43715	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.2388	14.5096	0.67776	0.1482:0.8518:0.0:0.0	.	.	.	.	X	84;10;10;31;84;10;84;84;84	.	ENSP00000314615:R84X	R	+	1	2	ARFGAP1	61378356	1.000000	0.71417	0.980000	0.43619	0.674000	0.39518	3.710000	0.54860	1.090000	0.41315	0.563000	0.77884	CGA	ARFGAP1	-	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP	ENSG00000101199		0.507	ARFGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGAP1	HGNC	protein_coding	OTTHUMT00000080134.3	67	0.00	0	C	NM_018209		61907911	61907911	+1	no_errors	ENST00000353546	ensembl	human	known	69_37n	nonsense	80	28.57	32	SNP	1.000	T
ARHGAP26	23092	genome.wustl.edu	37	5	142526879	142526879	+	Missense_Mutation	SNP	T	T	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:142526879T>G	ENST00000274498.4	+	20	2299	c.1921T>G	c.(1921-1923)Tta>Gta	p.L641V	ARHGAP26_ENST00000378004.3_Missense_Mutation_p.L641V	NM_015071.4	NP_055886.1	Q9UNA1	RHG26_HUMAN	Rho GTPase activating protein 26	641	Ser-rich.				actin cytoskeleton organization (GO:0030036)|filopodium assembly (GO:0046847)|nervous system development (GO:0007399)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(7)|ovary(1)	25		all_hematologic(541;0.0416)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CAGCAGCAGCTTACAGCCCAA	0.512																																						dbGAP											0													126.0	113.0	117.0					5																	142526879		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014521	CCDS4277.1, CCDS47297.1	5q31	2011-06-29			ENSG00000145819	ENSG00000145819		"""Rho GTPase activating proteins"""	17073	protein-coding gene	gene with protein product	"""GTPase regulator associated with the focal adhesion kinase pp125"""	605370				9858476, 8649427	Standard	NM_001135608		Approved	GRAF, KIAA0621, OPHN1L, OPHN1L1	uc011dbj.2	Q9UNA1	OTTHUMG00000059705	ENST00000274498.4:c.1921T>G	5.37:g.142526879T>G	ENSP00000274498:p.Leu641Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O75117|Q5D035|Q9BYS6|Q9BYS7|Q9UJ00	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_IRSp53/MIM_homology_IMD,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_RhoGAP_dom,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L641V	ENST00000274498.4	37	c.1921	CCDS4277.1	5	.	.	.	.	.	.	.	.	.	.	T	17.29	3.353198	0.61293	.	.	ENSG00000145819	ENST00000274498;ENST00000378004;ENST00000418668	T;T	0.08102	3.19;3.13	5.31	1.89	0.25635	.	0.585236	0.16028	N	0.232986	T	0.05777	0.0151	N	0.24115	0.695	0.22648	N	0.998893	B;B;B	0.23316	0.083;0.034;0.058	B;B;B	0.23574	0.034;0.021;0.047	T	0.41179	-0.9523	10	0.28530	T	0.3	.	8.3912	0.32528	0.0:0.6944:0.0:0.3056	.	641;214;641	Q9UNA1;B3KT96;Q9UNA1-2	RHG26_HUMAN;.;.	V	641;641;214	ENSP00000274498:L641V;ENSP00000367243:L641V	ENSP00000274498:L641V	L	+	1	2	ARHGAP26	142507072	0.379000	0.25123	0.974000	0.42286	0.988000	0.76386	0.774000	0.26675	0.095000	0.17434	0.533000	0.62120	TTA	ARHGAP26	-	NULL	ENSG00000145819		0.512	ARHGAP26-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP26	HGNC	protein_coding	OTTHUMT00000132744.3	35	0.00	0	T	NM_015071		142526879	142526879	+1	no_errors	ENST00000274498	ensembl	human	known	69_37n	missense	33	29.79	14	SNP	0.700	G
ARHGAP6	395	genome.wustl.edu	37	X	11206927	11206927	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chrX:11206927G>C	ENST00000337414.4	-	4	1870	c.998C>G	c.(997-999)tCt>tGt	p.S333C	ARHGAP6_ENST00000380732.3_Missense_Mutation_p.S365C|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.S142C|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.S333C|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.S130C|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.S130C|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.S158C	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	333					actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TGAGCTGAGAGATGAGTTACT	0.507																																						dbGAP											0													163.0	124.0	137.0					X																	11206927		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.998C>G	X.37:g.11206927G>C	ENSP00000338967:p.Ser333Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S333C	ENST00000337414.4	37	c.998	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	G	23.5	4.427309	0.83667	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.25912	1.81;1.79;1.79;1.77;1.82;1.78;1.88;1.89	5.66	5.66	0.87406	.	0.000000	0.53938	D	0.000055	T	0.42471	0.1204	L	0.36672	1.1	0.80722	D	1	D;D;D;D;D	0.89917	0.996;0.994;0.998;0.999;1.0	P;P;D;D;D	0.71656	0.846;0.893;0.927;0.946;0.974	T	0.10894	-1.0610	10	0.37606	T	0.19	.	18.7976	0.92001	0.0:0.0:1.0:0.0	.	142;130;333;333;333	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	C	158;130;130;333;169;333;142;365	ENSP00000438135:S158C;ENSP00000370112:S130C;ENSP00000302312:S130C;ENSP00000338967:S333C;ENSP00000370093:S169C;ENSP00000370094:S333C;ENSP00000389394:S142C;ENSP00000370108:S365C	ENSP00000302312:S130C	S	-	2	0	ARHGAP6	11116848	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.273000	0.95719	2.385000	0.81259	0.600000	0.82982	TCT	ARHGAP6	-	NULL	ENSG00000047648		0.507	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	57	0.00	0	G	NM_013427		11206927	11206927	-1	no_errors	ENST00000337414	ensembl	human	known	69_37n	missense	37	47.89	34	SNP	1.000	C
BAIAP3	8938	genome.wustl.edu	37	16	1395284	1395284	+	Missense_Mutation	SNP	G	G	T	rs116719702	byFrequency	TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr16:1395284G>T	ENST00000324385.5	+	22	2238	c.2080G>T	c.(2080-2082)Gcc>Tcc	p.A694S	BAIAP3_ENST00000397489.1_Missense_Mutation_p.A676S|BAIAP3_ENST00000397488.2_Missense_Mutation_p.A676S|BAIAP3_ENST00000426824.3_Missense_Mutation_p.A659S|BAIAP3_ENST00000568887.1_Missense_Mutation_p.A631S|BAIAP3_ENST00000421665.2_Missense_Mutation_p.A623S|BAIAP3_ENST00000562208.1_Missense_Mutation_p.A636S	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	694	MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)	p.A694T(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				TGGCATCCACGCCCCCTTCCT	0.642																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											70.0	65.0	66.0					16																	1395284		2199	4300	6499	-	-	-	SO:0001583	missense	0			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.2080G>T	16.37:g.1395284G>T	ENSP00000324510:p.Ala694Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Munc13_subgr_dom-2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A694S	ENST00000324385.5	37	c.2080	CCDS10434.1	16	.	.	.	.	.	.	.	.	.	.	G	5.349	0.249696	0.10130	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000421665	T;T;T;T;T	0.71222	-0.55;-0.55;-0.55;-0.55;-0.55	4.6	-7.7	0.01259	Munc13 homology 1 (1);	1.026490	0.07676	N	0.936301	T	0.31009	0.0783	N	0.02011	-0.69	0.09310	N	1	B;B;B;B	0.13145	0.007;0.005;0.005;0.005	B;B;B;B	0.15870	0.014;0.01;0.01;0.01	T	0.27971	-1.0058	10	0.11485	T	0.65	-3.3579	2.9734	0.05929	0.4416:0.1109:0.3361:0.1114	.	623;636;694;676	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	S	659;676;694;676;623	ENSP00000407242:A659S;ENSP00000380625:A676S;ENSP00000324510:A694S;ENSP00000380626:A676S;ENSP00000409533:A623S	ENSP00000324510:A694S	A	+	1	0	BAIAP3	1335285	0.000000	0.05858	0.014000	0.15608	0.201000	0.24016	-0.246000	0.08878	-0.687000	0.05162	-1.976000	0.00459	GCC	BAIAP3	-	NULL	ENSG00000007516		0.642	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	HGNC	protein_coding	OTTHUMT00000109056.3	60	0.00	0	G			1395284	1395284	+1	no_errors	ENST00000324385	ensembl	human	known	69_37n	missense	60	34.78	32	SNP	0.001	T
BCAN	63827	genome.wustl.edu	37	1	156615885	156615886	+	Missense_Mutation	DNP	CC	CC	AA			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:156615885_156615886CC>AA	ENST00000329117.5	+	2	375_376	c.39_40CC>AA	c.(37-42)gtCCtg>gtAAtg	p.L14M	RP11-284F21.10_ENST00000605886.1_RNA|RP11-284F21.7_ENST00000448869.1_RNA|BCAN_ENST00000361588.5_Missense_Mutation_p.L14M	NM_021948.4	NP_068767.3	Q96GW7	PGCB_HUMAN	brevican	14					carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hippocampus development (GO:0021766)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|hyaluronic acid binding (GO:0005540)			cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	55	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAGCCCTGGTCCTGGCCCAGGC	0.579																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC027971	CCDS1149.1, CCDS1150.1	1q31	2013-05-07			ENSG00000132692	ENSG00000132692		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	23059	protein-coding gene	gene with protein product	"""chondroitin sulfate proteoglycan 7"", ""brevican proteoglycan"""	600347				11054543, 11873941	Standard	NM_021948		Approved	BEHAB, MGC13038, CSPG7	uc001fpp.3	Q96GW7	OTTHUMG00000033322	Exception_encountered	1.37:g.156615885_156615886delinsAA	ENSP00000331210:p.Leu14Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVC2|Q5SZ10|Q5T3I5|Q8TBB9|Q9HBK1|Q9HBK4	Silent|Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Link,smart_EGF-like,smart_C-type_lectin,smart_Sushi_SCR_CCP,prints_Link,prints_AntifreezeII,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like	p.V13|p.L14M	ENST00000329117.5	37	c.39|c.40	CCDS1149.1	1																																																																																			BCAN	-	NULL	ENSG00000132692		0.579	BCAN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCAN	HGNC	protein_coding	OTTHUMT00000081844.2	73	0.00	0	C	NM_021948		156615885|156615886	156615885|156615886	+1	no_errors	ENST00000329117	ensembl	human	known	69_37n	silent|missense	50	31.51	23	SNP	0.103|0.122	A
NUTM1	256646	genome.wustl.edu	37	15	34640421	34640421	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr15:34640421G>T	ENST00000333756.4	+	2	423	c.268G>T	c.(268-270)Gtc>Ttc	p.V90F	NUTM1_ENST00000438749.3_Missense_Mutation_p.V108F|NUTM1_ENST00000537011.1_Missense_Mutation_p.V118F	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	90	Pro-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)											CAAGGTCATTGTCAAAGTCAA	0.577																																						dbGAP											0													69.0	68.0	68.0					15																	34640421		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.268G>T	15.37:g.34640421G>T	ENSP00000329448:p.Val90Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.V90F	ENST00000333756.4	37	c.268	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	G	18.14	3.557511	0.65425	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000354999;ENST00000333756	T;T;T	0.36520	1.25;1.25;1.25	5.69	2.74	0.32292	Nuclear Testis  protein, N-terminal (1);	0.265230	0.26871	N	0.022076	T	0.54498	0.1862	M	0.80183	2.485	0.33287	D	0.562972	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.81914	0.995;0.992;0.979	T	0.63269	-0.6675	10	0.54805	T	0.06	.	5.093	0.14718	0.1813:0.1734:0.6453:0.0	.	108;118;90	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	F	118;108;90;90	ENSP00000444896:V118F;ENSP00000407031:V108F;ENSP00000329448:V90F	ENSP00000329448:V90F	V	+	1	0	C15orf55	32427713	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	0.788000	0.26872	0.726000	0.32339	0.650000	0.86243	GTC	C15orf55	-	NULL	ENSG00000184507		0.577	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf55	HGNC	protein_coding	OTTHUMT00000418026.1	28	0.00	0	G	NM_175741		34640421	34640421	+1	no_errors	ENST00000333756	ensembl	human	known	69_37n	missense	19	34.48	10	SNP	0.994	T
CCDC180	100499483	genome.wustl.edu	37	9	100127907	100127907	+	Intron	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr9:100127907G>T	ENST00000357054.1	+	42	4882				MIR1302-8_ENST00000408342.1_RNA|CCDC180_ENST00000395220.1_Intron|CCDC180_ENST00000529487.1_Intron|RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Intron			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GTCCATGTTTGTGTGTCTAGA	0.517																																						dbGAP											0													120.0	121.0	121.0					9																	100127907		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.3948-48G>T	9.37:g.100127907G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	RNA	SNP	-	NULL	ENST00000357054.1	37	NULL		9																																																																																			C9orf174	-	-	ENSG00000197816		0.517	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		103	0.00	0	G	NM_020893		100127907	100127907	+1	no_errors	ENST00000483504	ensembl	human	known	69_37n	rna	75	25.74	26	SNP	0.000	T
CCDC144A	9720	genome.wustl.edu	37	17	16638398	16638398	+	Missense_Mutation	SNP	T	T	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr17:16638398T>C	ENST00000360524.8	+	12	2889	c.2813T>C	c.(2812-2814)cTt>cCt	p.L938P	CCDC144A_ENST00000456009.1_Missense_Mutation_p.L658P|CCDC144A_ENST00000399273.1_Missense_Mutation_p.L938P|CCDC144A_ENST00000443444.2_Missense_Mutation_p.L938P|RP11-219A15.1_ENST00000448331.3_Missense_Mutation_p.L938P	NM_014695.1	NP_055510.1	A2RUR9	C144A_HUMAN	coiled-coil domain containing 144A	938																	GACCTAAAACTTGATTTCCAG	0.388																																						dbGAP											0													13.0	13.0	13.0					17																	16638398		1500	3472	4972	-	-	-	SO:0001583	missense	0			BC133019	CCDS45621.1	17p11.2	2008-10-23			ENSG00000170160	ENSG00000170160			29072	protein-coding gene	gene with protein product						9628581, 11997339	Standard	NM_014695		Approved	KIAA0565, FLJ43983	uc002gqk.1	A2RUR9	OTTHUMG00000059178	ENST00000360524.8:c.2813T>C	17.37:g.16638398T>C	ENSP00000353717:p.Leu938Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O60311|Q6ZU57	Missense_Mutation	SNP	pfam_DUF3496	p.L938P	ENST00000360524.8	37	c.2813	CCDS45621.1	17	.	.	.	.	.	.	.	.	.	.	.	8.921	0.961156	0.18583	.	.	ENSG00000170160	ENST00000399273;ENST00000443444;ENST00000360524;ENST00000456009	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	2.08	0.734	0.18294	.	.	.	.	.	T	0.27765	0.0683	L	0.43646	1.37	0.36191	D	0.850058	P;D	0.64830	0.732;0.994	P;D	0.66602	0.561;0.945	T	0.40001	-0.9586	9	0.54805	T	0.06	.	2.5199	0.04677	0.2629:0.0:0.268:0.4691	.	658;938	A2RUR9-3;A2RUR9	.;C144A_HUMAN	P	938;938;938;658	ENSP00000382215:L938P;ENSP00000439262:L938P;ENSP00000353717:L938P;ENSP00000394201:L658P	ENSP00000353717:L938P	L	+	2	0	CCDC144A	16579123	0.045000	0.20229	0.945000	0.38365	0.066000	0.16364	2.316000	0.43761	0.952000	0.37798	0.324000	0.21423	CTT	CCDC144A	-	NULL	ENSG00000170160		0.388	CCDC144A-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC144A	HGNC	protein_coding	OTTHUMT00000444093.1	74	0.00	0	T			16638398	16638398	+1	no_errors	ENST00000360524	ensembl	human	known	69_37n	missense	39	43.48	30	SNP	0.992	C
CCDC85A	114800	genome.wustl.edu	37	2	56420533	56420533	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:56420533G>A	ENST00000407595.2	+	2	1700	c.1198G>A	c.(1198-1200)Gac>Aac	p.D400N	RP11-482H16.1_ENST00000607540.1_RNA	NM_001080433.1	NP_001073902.1	Q96PX6	CC85A_HUMAN	coiled-coil domain containing 85A	400										breast(6)|cervix(2)|endometrium(5)|kidney(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)	38			LUSC - Lung squamous cell carcinoma(58;0.127)|Lung(47;0.132)			GGCACAGGAGGACGGGTCACC	0.622																																						dbGAP											0													41.0	50.0	47.0					2																	56420533		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB067499	CCDS46290.1	2p16.1	2006-03-29			ENSG00000055813	ENSG00000055813			29400	protein-coding gene	gene with protein product						11572484	Standard	NM_001080433		Approved	KIAA1912	uc002rzn.3	Q96PX6	OTTHUMG00000152033	ENST00000407595.2:c.1198G>A	2.37:g.56420533G>A	ENSP00000384040:p.Asp400Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DUF2216_coiled-coil	p.D400N	ENST00000407595.2	37	c.1198	CCDS46290.1	2	.	.	.	.	.	.	.	.	.	.	G	17.12	3.306994	0.60305	.	.	ENSG00000055813	ENST00000407595	.	.	.	5.11	5.11	0.69529	.	0.048645	0.85682	D	0.000000	T	0.47967	0.1474	L	0.36672	1.1	0.80722	D	1	P	0.38922	0.651	B	0.35859	0.212	T	0.42137	-0.9469	9	0.19147	T	0.46	-0.6033	18.5199	0.90948	0.0:0.0:1.0:0.0	.	400	Q96PX6	CC85A_HUMAN	N	400	.	ENSP00000384040:D400N	D	+	1	0	CCDC85A	56274037	1.000000	0.71417	0.223000	0.23860	0.684000	0.39900	9.230000	0.95299	2.376000	0.81061	0.484000	0.47621	GAC	CCDC85A	-	NULL	ENSG00000055813		0.622	CCDC85A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC85A	HGNC	protein_coding	OTTHUMT00000324993.1	77	0.00	0	G			56420533	56420533	+1	no_errors	ENST00000407595	ensembl	human	known	69_37n	missense	46	34.29	24	SNP	1.000	A
CDH1	999	genome.wustl.edu	37	16	68856094	68856094	+	Silent	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr16:68856094G>A	ENST00000261769.5	+	12	2093	c.1902G>A	c.(1900-1902)gcG>gcA	p.A634A	CDH1_ENST00000422392.2_Silent_p.A573A|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	634	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.		A -> V (found in a gastric cancer sample; cells exhibited decreased aggregation increased invasiveness and non-uniform migration in vitro compared to cells transfected with wild-type sequence). {ECO:0000269|PubMed:12588804}.	ASA -> RVP (in Ref. 3; AAA61259). {ECO:0000305}.	adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CACACGGGGCGAGTGCCAACT	0.498			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													95.0	79.0	85.0					16																	68856094		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1902G>A	16.37:g.68856094G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A634	ENST00000261769.5	37	c.1902	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000039068		0.498	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	43	0.00	0	G	NM_004360		68856094	68856094	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	silent	23	23.33	7	SNP	0.170	A
CDH17	1015	genome.wustl.edu	37	8	95164236	95164236	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr8:95164236C>G	ENST00000027335.3	-	13	1780	c.1656G>C	c.(1654-1656)aaG>aaC	p.K552N	CDH17_ENST00000450165.2_Missense_Mutation_p.K552N|CDH17_ENST00000441892.2_Missense_Mutation_p.K338N	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	552	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			TAAGCGTGAACTTGGCAAAAG	0.413																																						dbGAP											0													153.0	133.0	140.0					8																	95164236		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1656G>C	8.37:g.95164236C>G	ENSP00000027335:p.Lys552Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15336|Q2M2E0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.K552N	ENST00000027335.3	37	c.1656	CCDS6260.1	8	.	.	.	.	.	.	.	.	.	.	C	6.744	0.506131	0.12883	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165	T;T;T	0.37915	1.17;1.17;1.17	5.67	-11.3	0.00108	Cadherin (3);Cadherin-like (1);	1.246890	0.05675	N	0.589332	T	0.18923	0.0454	L	0.31476	0.935	0.09310	N	1	B;P	0.37914	0.27;0.611	B;B	0.38755	0.281;0.124	T	0.03095	-1.1073	10	0.16420	T	0.52	-1.6638	5.6056	0.17377	0.1925:0.4754:0.2506:0.0814	.	338;552	E7EN24;Q12864	.;CAD17_HUMAN	N	552;338;552	ENSP00000027335:K552N;ENSP00000392811:K338N;ENSP00000401468:K552N	ENSP00000027335:K552N	K	-	3	2	CDH17	95233412	0.000000	0.05858	0.000000	0.03702	0.210000	0.24377	-5.446000	0.00121	-3.759000	0.00110	-0.136000	0.14681	AAG	CDH17	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000079112		0.413	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH17	HGNC	protein_coding	OTTHUMT00000378560.1	83	0.00	0	C	NM_004063		95164236	95164236	-1	no_errors	ENST00000027335	ensembl	human	known	69_37n	missense	88	23.48	27	SNP	0.000	G
CIZ1	25792	genome.wustl.edu	37	9	130942759	130942759	+	Frame_Shift_Del	DEL	T	T	-			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr9:130942759delT	ENST00000393608.1	-	7	928	c.726delA	c.(724-726)aaafs	p.K242fs	CIZ1_ENST00000277465.4_Frame_Shift_Del_p.K242fs|CIZ1_ENST00000357558.5_Frame_Shift_Del_p.K242fs|CIZ1_ENST00000476727.2_5'UTR|CIZ1_ENST00000538431.1_Frame_Shift_Del_p.K242fs|CIZ1_ENST00000372938.5_Frame_Shift_Del_p.K242fs|CIZ1_ENST00000325721.8_Frame_Shift_Del_p.K213fs|CIZ1_ENST00000372948.3_Frame_Shift_Del_p.K242fs|CIZ1_ENST00000372954.1_Frame_Shift_Del_p.K218fs|CIZ1_ENST00000541172.1_Frame_Shift_Del_p.K141fs	NM_012127.2	NP_036259.2	Q9ULV3	CIZ1_HUMAN	CDKN1A interacting zinc finger protein 1	242					maintenance of protein location in nucleus (GO:0051457)|positive regulation of DNA-dependent DNA replication initiation (GO:0032298)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|liver(1)|lung(9)|ovary(3)|prostate(2)|urinary_tract(2)	35						CTGGAGTGCGTTTTTCCTTGG	0.567																																						dbGAP											0													265.0	222.0	236.0					9																	130942759		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB030835	CCDS6894.1, CCDS48033.1, CCDS48034.1, CCDS75910.1	9q34.1	2012-10-05			ENSG00000148337	ENSG00000148337			16744	protein-coding gene	gene with protein product		611420				10529385	Standard	NM_001131015		Approved	LSFR1, ZNF356	uc011mas.2	Q9ULV3	OTTHUMG00000020735	ENST00000393608.1:c.726delA	9.37:g.130942759delT	ENSP00000377232:p.Lys242fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9J8|B4E131|B7ZAS8|Q5SYW3|Q5SYW5|Q8WU72|Q9H868|Q9NYM8|Q9UHK4|Q9Y3F9|Q9Y3G0	Frame_Shift_Del	DEL	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,pfscan_Znf_C2H2_matrin	p.K242fs	ENST00000393608.1	37	c.726	CCDS6894.1	9																																																																																			CIZ1	-	NULL	ENSG00000148337		0.567	CIZ1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CIZ1	HGNC	protein_coding	OTTHUMT00000054399.1	53	0.00	0	T	NM_012127		130942759	130942759	-1	no_errors	ENST00000538431	ensembl	human	known	69_37n	frame_shift_del	28	40.43	19	DEL	0.001	-
CREB1	1385	genome.wustl.edu	37	2	208441407	208441407	+	Intron	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:208441407G>A	ENST00000432329.2	+	8	981				CREB1_ENST00000374397.4_Intron|CREB1_ENST00000430624.1_Intron|CREB1_ENST00000353267.3_Intron|CREB1_ENST00000536726.1_3'UTR|CREB1_ENST00000539789.1_3'UTR	NM_134442.3	NP_604391.1	P16220	CREB1_HUMAN	cAMP responsive element binding protein 1						activation of phospholipase C activity (GO:0007202)|axon guidance (GO:0007411)|cellular response to zinc ion (GO:0071294)|circadian rhythm (GO:0007623)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|lactation (GO:0007595)|lung saccule development (GO:0060430)|memory (GO:0007613)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of transcription by competitive promoter binding (GO:0010944)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|phosphatidylinositol-mediated signaling (GO:0048015)|pituitary gland development (GO:0021983)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of hormone secretion (GO:0046887)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of cell size (GO:0008361)|response to drug (GO:0042493)|response to glucagon (GO:0033762)|response to organic substance (GO:0010033)|secretory granule organization (GO:0033363)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription from RNA polymerase II promoter (GO:0006366)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|Type I pneumocyte differentiation (GO:0060509)|viral process (GO:0016032)	nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding (GO:0035497)|enzyme binding (GO:0019899)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		EWSR1/CREB1(44)	NS(1)|breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|upper_aerodigestive_tract(1)	5				LUSC - Lung squamous cell carcinoma(261;0.0768)|Epithelial(149;0.127)|Lung(261;0.145)	Adenosine monophosphate(DB00131)|Naloxone(DB01183)	CTGAACGTCAGTTTGAAGATG	0.269			T	EWSR1	"""clear cell sarcoma, angiomatoid fibrous histiocytoma"""																																	dbGAP		Dom	yes		2	2q34	1385	cAMP responsive element binding protein 1		M	0																																										-	-	-	SO:0001627	intron_variant	0			M27691	CCDS2374.1, CCDS2375.1	2q34	2013-01-10			ENSG00000118260	ENSG00000118260		"""basic leucine zipper proteins"""	2345	protein-coding gene	gene with protein product		123810					Standard	NM_134442		Approved		uc002vcc.3	P16220	OTTHUMG00000132936	ENST00000432329.2:c.731-822G>A	2.37:g.208441407G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P21934|Q6V963|Q9UMA7	RNA	SNP	-	NULL	ENST00000432329.2	37	NULL	CCDS2375.1	2																																																																																			CREB1	-	-	ENSG00000118260		0.269	CREB1-001	KNOWN	basic|CCDS	protein_coding	CREB1	HGNC	protein_coding	OTTHUMT00000256467.3	33	0.00	0	G	NM_134442		208441407	208441407	+1	no_errors	ENST00000494983	ensembl	human	known	69_37n	rna	28	42.86	21	SNP	1.000	A
CSF1R	1436	genome.wustl.edu	37	5	149450043	149450043	+	Silent	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:149450043G>A	ENST00000286301.3	-	8	1465	c.1174C>T	c.(1174-1176)Ctg>Ttg	p.L392L		NM_005211.3	NP_005202.2	P07333	CSF1R_HUMAN	colony stimulating factor 1 receptor	392	Ig-like C2-type 4.				cell proliferation (GO:0008283)|cell-cell junction maintenance (GO:0045217)|cellular response to cytokine stimulus (GO:0071345)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cytokine-mediated signaling pathway (GO:0019221)|hemopoiesis (GO:0030097)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage differentiation (GO:0030225)|mammary gland duct morphogenesis (GO:0060603)|monocyte differentiation (GO:0030224)|multicellular organismal development (GO:0007275)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine secretion (GO:0090197)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of bone resorption (GO:0045124)|regulation of cell shape (GO:0008360)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|macrophage colony-stimulating factor receptor activity (GO:0005011)|protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(38)|kidney(2)|large_intestine(6)|liver(3)|lung(23)|ovary(2)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	93			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)		Imatinib(DB00619)|Sunitinib(DB01268)	TCAAACGTCAGAGCTCTCCAG	0.667																																						dbGAP											0													27.0	29.0	28.0					5																	149450043		2194	4286	6480	-	-	-	SO:0001819	synonymous_variant	0			U63963	CCDS4302.1	5q32	2013-01-11	2008-08-01		ENSG00000182578	ENSG00000182578		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	2433	protein-coding gene	gene with protein product		164770	"""McDonough feline sarcoma viral (v-fms) oncogene homolog"""	FMS		1611909	Standard	NM_005211		Approved	C-FMS, CSFR, CD115	uc003lrm.3	P07333	OTTHUMG00000130050	ENST00000286301.3:c.1174C>T	5.37:g.149450043G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5A955|D3DQG2|Q6LDW5|Q6LDY4|Q86VW7	Silent	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L392	ENST00000286301.3	37	c.1174	CCDS4302.1	5																																																																																			CSF1R	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,smart_Ig_sub	ENSG00000182578		0.667	CSF1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF1R	HGNC	protein_coding	OTTHUMT00000252329.2	57	0.00	0	G	NM_005211		149450043	149450043	-1	no_errors	ENST00000286301	ensembl	human	known	69_37n	silent	36	34.55	19	SNP	0.586	A
CSNK2A1	1457	genome.wustl.edu	37	20	472933	472934	+	Frame_Shift_Ins	INS	-	-	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr20:472933_472934insC	ENST00000217244.3	-	9	960_961	c.585_586insG	c.(583-588)cgatacfs	p.Y196fs	CSNK2A1_ENST00000400227.3_Frame_Shift_Ins_p.Y196fs|CSNK2A1_ENST00000349736.5_Frame_Shift_Ins_p.Y196fs|CSNK2A1_ENST00000400217.2_Frame_Shift_Ins_p.Y60fs	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	196	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			CCTTTGAAGTATCGGGAAGCAA	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.585_586insG	20.37:g.472933_472934insC	ENSP00000217244:p.Tyr196fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y195fs	ENST00000217244.3	37	c.586_585	CCDS13003.1	20																																																																																			CSNK2A1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000101266		0.401	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CSNK2A1	HGNC	protein_coding	OTTHUMT00000077466.1	27	0.00	0	-	NM_001895		472933	472934	-1	no_errors	ENST00000217244	ensembl	human	known	69_37n	frame_shift_ins	27	18.18	6	INS	1.000:1.000	C
CST9L	128821	genome.wustl.edu	37	20	23546647	23546647	+	Silent	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr20:23546647G>A	ENST00000376979.3	-	2	616	c.318C>T	c.(316-318)gaC>gaT	p.D106D		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	106						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					AATGGCAGTTGTCAATGTCGT	0.483																																						dbGAP											0													282.0	227.0	246.0					20																	23546647		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.318C>T	20.37:g.23546647G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5A1	Silent	SNP	pfam_Prot_inh_cystat	p.D106	ENST00000376979.3	37	c.318	CCDS13157.1	20																																																																																			CST9L	-	pfam_Prot_inh_cystat	ENSG00000101435		0.483	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST9L	HGNC	protein_coding	OTTHUMT00000078338.1	107	0.00	0	G	NM_080610		23546647	23546647	-1	no_errors	ENST00000376979	ensembl	human	known	69_37n	silent	65	17.72	14	SNP	0.380	A
CST9L	128821	genome.wustl.edu	37	20	23546655	23546655	+	Missense_Mutation	SNP	C	C	T	rs545793477		TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr20:23546655C>T	ENST00000376979.3	-	2	608	c.310G>A	c.(310-312)Gac>Aac	p.D104N		NM_080610.2	NP_542177.1	Q9H4G1	CST9L_HUMAN	cystatin 9-like	104						extracellular region (GO:0005576)	cysteine-type endopeptidase inhibitor activity (GO:0004869)	p.D104N(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|prostate(1)	8	Colorectal(13;0.0431)|Lung NSC(19;0.235)					TTGTCAATGTCGTCTTCAAAT	0.478																																						dbGAP											1	Substitution - Missense(1)	breast(1)											278.0	227.0	244.0					20																	23546655		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13157.1	20p11.21	2012-08-14	2008-03-06		ENSG00000101435	ENSG00000101435			16233	protein-coding gene	gene with protein product			"""cystatin 9 (mouse)-like"""			20565543	Standard	NM_080610		Approved	bA218C14.1, CTES7B	uc002wtk.4	Q9H4G1	OTTHUMG00000032073	ENST00000376979.3:c.310G>A	20.37:g.23546655C>T	ENSP00000366178:p.Asp104Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5A1	Missense_Mutation	SNP	pfam_Prot_inh_cystat	p.D104N	ENST00000376979.3	37	c.310	CCDS13157.1	20	.	.	.	.	.	.	.	.	.	.	C	12.30	1.895631	0.33442	.	.	ENSG00000101435	ENST00000376979	T	0.12255	2.7	1.92	-0.948	0.10379	Proteinase inhibitor I25, cystatin (2);	0.000000	0.39759	N	0.001279	T	0.20495	0.0493	L	0.50333	1.59	0.09310	N	1	D	0.89917	1.0	D	0.75484	0.986	T	0.14783	-1.0460	10	0.23302	T	0.38	.	4.5382	0.12043	0.0:0.4111:0.0:0.5889	.	104	Q9H4G1	CST9L_HUMAN	N	104	ENSP00000366178:D104N	ENSP00000366178:D104N	D	-	1	0	CST9L	23494655	0.003000	0.15002	0.000000	0.03702	0.006000	0.05464	0.366000	0.20365	-0.238000	0.09724	-0.339000	0.08088	GAC	CST9L	-	pfam_Prot_inh_cystat	ENSG00000101435		0.478	CST9L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CST9L	HGNC	protein_coding	OTTHUMT00000078338.1	103	0.00	0	C	NM_080610		23546655	23546655	-1	no_errors	ENST00000376979	ensembl	human	known	69_37n	missense	57	18.57	13	SNP	0.000	T
CTTNBP2	83992	genome.wustl.edu	37	7	117450855	117450855	+	Silent	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:117450855G>A	ENST00000160373.3	-	3	469	c.378C>T	c.(376-378)tcC>tcT	p.S126S		NM_033427.2	NP_219499.1	Q8WZ74	CTTB2_HUMAN	cortactin binding protein 2	126					brain development (GO:0007420)	cell projection (GO:0042995)|synaptic vesicle (GO:0008021)		p.S126S(1)		breast(3)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(36)|ovary(4)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83	Lung NSC(10;0.0018)|all_lung(10;0.002)			LUSC - Lung squamous cell carcinoma(290;0.133)		CCAGCTGTGCGGACATCCTTT	0.502																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											231.0	221.0	225.0					7																	117450855		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5774.1	7q31	2013-01-10	2004-06-08	2004-06-09	ENSG00000077063	ENSG00000077063		"""Ankyrin repeat domain containing"""	15679	protein-coding gene	gene with protein product		609772	"""cortactin binding protein 2"""	CORTBP2, C7orf8		11707066	Standard	XM_005250635		Approved	KIAA1758, Orf4	uc003vjf.3	Q8WZ74	OTTHUMG00000022880	ENST00000160373.3:c.378C>T	7.37:g.117450855G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43389|Q7LG11|Q9C0A5	Silent	SNP	pfam_Cortactin-binding_p2_N,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S126	ENST00000160373.3	37	c.378	CCDS5774.1	7																																																																																			CTTNBP2	-	pfam_Cortactin-binding_p2_N	ENSG00000077063		0.502	CTTNBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTTNBP2	HGNC	protein_coding	OTTHUMT00000059201.4	74	0.00	0	G	NM_033427		117450855	117450855	-1	no_errors	ENST00000160373	ensembl	human	known	69_37n	silent	63	16.00	12	SNP	0.988	A
DACT2	168002	genome.wustl.edu	37	6	168708999	168709000	+	Missense_Mutation	DNP	GG	GG	CT			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr6:168708999_168709000GG>CT	ENST00000366795.3	-	4	1525_1526	c.1437_1438CC>AG	c.(1435-1440)gcCCac>gcAGac	p.H480D	DACT2_ENST00000607983.1_Missense_Mutation_p.H72D|DACT2_ENST00000610183.1_Missense_Mutation_p.H310D|DACT2_ENST00000366796.3_Intron	NM_214462.3	NP_999627.2	Q5SW24	DACT2_HUMAN	dishevelled-binding antagonist of beta-catenin 2	480					epithelial cell morphogenesis (GO:0003382)|hematopoietic progenitor cell differentiation (GO:0002244)|inner medullary collecting duct development (GO:0072061)|negative regulation of cell adhesion (GO:0007162)|negative regulation of nodal signaling pathway (GO:1900108)|skin development (GO:0043588)	mitochondrion (GO:0005739)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)|transcription factor binding (GO:0008134)			endometrium(1)	1		Breast(66;1.46e-05)|Ovarian(120;0.0728)		OV - Ovarian serous cystadenocarcinoma(33;5.33e-21)|BRCA - Breast invasive adenocarcinoma(81;1.18e-06)|GBM - Glioblastoma multiforme(31;0.000957)		AAGGATGGGTGGGCAAAGTGCC	0.564																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF318336	CCDS47519.1, CCDS69241.1, CCDS75554.1	6q27	2013-05-15	2013-05-15	2003-09-17	ENSG00000164488	ENSG00000164488			21231	protein-coding gene	gene with protein product		608966	"""chromosome 6 open reading frame 116"", ""dapper homolog 2, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 2 (Xenopus laevis)"""	C6orf116			Standard	NM_001286351		Approved	bA503C24.7, DAPPER2	uc003qwq.3	Q5SW24	OTTHUMG00000016046	ENST00000366795.3:c.1437_1438delinsCT	6.37:g.168708999_168709000delinsCT	ENSP00000355760:p.His480Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKJ2|Q569G0|Q8WYW2	Missense_Mutation|Silent	SNP	NULL	p.H480D|p.A479	ENST00000366795.3	37	c.1438|c.1437	CCDS47519.1	6																																																																																			DACT2	-	NULL	ENSG00000164488		0.564	DACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DACT2	HGNC	protein_coding	OTTHUMT00000043193.1	53	0.00	0	G			168708999|168709000	168708999|168709000	-1	no_errors	ENST00000366795	ensembl	human	known	69_37n	missense|silent	14	65.00|64.10	26|25	SNP	0.014	C|T
DNAH10	196385	genome.wustl.edu	37	12	124414288	124414288	+	Silent	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:124414288C>G	ENST00000409039.3	+	71	12265	c.12240C>G	c.(12238-12240)ctC>ctG	p.L4080L	CCDC92_ENST00000544798.1_Intron|DNAH10OS_ENST00000514254.2_3'UTR	NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	4080					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGGGCAGCCTCAAGTACCTAA	0.562																																						dbGAP											0													34.0	34.0	34.0					12																	124414288		1888	4102	5990	-	-	-	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.12240C>G	12.37:g.124414288C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.L4080	ENST00000409039.3	37	c.12240	CCDS9255.2	12																																																																																			DNAH10	-	pfam_Dynein_heavy	ENSG00000197653		0.562	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	15	0.00	0	C			124414288	124414288	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	silent	20	33.33	10	SNP	1.000	G
ECD	11319	genome.wustl.edu	37	10	74923576	74923576	+	Silent	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr10:74923576C>T	ENST00000372979.4	-	2	326	c.120G>A	c.(118-120)gaG>gaA	p.E40E	ECD_ENST00000610256.1_5'UTR|ECD_ENST00000454759.2_Silent_p.E40E|ECD_ENST00000430082.2_Silent_p.E40E	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	40					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					TGATTATTCTCTCAATGTACT	0.423																																						dbGAP											0													154.0	144.0	148.0					10																	74923576		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.120G>A	10.37:g.74923576C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JX46|E9PAW8	Silent	SNP	pfam_SGT1	p.E40	ENST00000372979.4	37	c.120	CCDS7321.1	10																																																																																			ECD	-	pfam_SGT1	ENSG00000122882		0.423	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECD	HGNC	protein_coding	OTTHUMT00000048606.1	47	0.00	0	C	NM_007265		74923576	74923576	-1	no_errors	ENST00000430082	ensembl	human	known	69_37n	silent	29	36.96	17	SNP	0.140	T
EHD3	30845	genome.wustl.edu	37	2	31489541	31489541	+	Frame_Shift_Del	DEL	C	C	-			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:31489541delC	ENST00000322054.5	+	6	1864	c.1579delC	c.(1579-1581)cccfs	p.P528fs	EHD3_ENST00000541626.1_3'UTR	NM_014600.2	NP_055415.1	Q9NZN3	EHD3_HUMAN	EH-domain containing 3	528	EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				blood coagulation (GO:0007596)|endocytic recycling (GO:0032456)|protein homooligomerization (GO:0051260)|protein targeting to plasma membrane (GO:0072661)|regulation of cardiac muscle cell membrane potential (GO:0086036)	cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|endosome membrane (GO:0010008)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(11)|lung(12)|ovary(1)|skin(3)	33	Acute lymphoblastic leukemia(172;0.155)					CCACCTCCTGCCCCCGTCCAA	0.607																																						dbGAP											0													49.0	50.0	49.0					2																	31489541		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF181264	CCDS1774.1	2p21	2013-01-10			ENSG00000013016	ENSG00000013016		"""EF-hand domain containing"""	3244	protein-coding gene	gene with protein product		605891		PAST3		10673336	Standard	NM_014600		Approved		uc002rnu.3	Q9NZN3	OTTHUMG00000099365	ENST00000322054.5:c.1579delC	2.37:g.31489541delC	ENSP00000327116:p.Pro528fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFR5|D6W574|Q8N514|Q9NZB3	Frame_Shift_Del	DEL	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.P528fs	ENST00000322054.5	37	c.1579	CCDS1774.1	2																																																																																			EHD3	-	smart_EPS15_homology,pfscan_EPS15_homology	ENSG00000013016		0.607	EHD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD3	HGNC	protein_coding	OTTHUMT00000216810.1	49	0.00	0	C	NM_014600		31489541	31489541	+1	no_errors	ENST00000322054	ensembl	human	known	69_37n	frame_shift_del	32	42.86	24	DEL	1.000	-
EHMT2	10919	genome.wustl.edu	37	6	31855981	31855981	+	Missense_Mutation	SNP	T	T	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr6:31855981T>A	ENST00000375537.4	-	13	1588	c.1582A>T	c.(1582-1584)Aat>Tat	p.N528Y	EHMT2_ENST00000375530.4_Missense_Mutation_p.N494Y|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Missense_Mutation_p.N551Y|EHMT2_ENST00000395728.3_Missense_Mutation_p.N585Y	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	528					DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						ACCATCCCATTCAGCTGAGAC	0.637																																						dbGAP											0													73.0	68.0	70.0					6																	31855981		1508	2709	4217	-	-	-	SO:0001583	missense	0			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.1582A>T	6.37:g.31855981T>A	ENSP00000364687:p.Asn528Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.N585Y	ENST00000375537.4	37	c.1753	CCDS4725.1	6	.	.	.	.	.	.	.	.	.	.	T	16.66	3.185262	0.57909	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	T;T;T;T	0.72615	-0.67;-0.55;-0.5;-0.66	4.82	4.82	0.62117	.	0.137858	0.49916	D	0.000139	T	0.74854	0.3771	L	0.60455	1.87	0.35668	D	0.813096	D;D;D;D	0.69078	0.994;0.997;0.994;0.994	P;D;P;P	0.66716	0.76;0.946;0.885;0.885	T	0.79943	-0.1590	10	0.87932	D	0	.	13.4893	0.61386	0.0:0.0:0.0:1.0	.	551;494;528;342	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	Y	585;551;494;528;342	ENSP00000379078:N585Y;ENSP00000364678:N551Y;ENSP00000364680:N494Y;ENSP00000364687:N528Y	ENSP00000364678:N551Y	N	-	1	0	EHMT2	31963960	1.000000	0.71417	0.999000	0.59377	0.983000	0.72400	4.258000	0.58822	2.028000	0.59812	0.454000	0.30748	AAT	EHMT2	-	NULL	ENSG00000204371		0.637	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	HGNC	protein_coding	OTTHUMT00000076355.5	21	0.00	0	T	NM_006709		31855981	31855981	-1	no_errors	ENST00000395728	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	1.000	A
EMILIN3	90187	genome.wustl.edu	37	20	39990702	39990702	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr20:39990702C>G	ENST00000332312.3	-	4	1699	c.1507G>C	c.(1507-1509)Gta>Cta	p.V503L		NM_052846.1	NP_443078.1	Q9NT22	EMIL3_HUMAN	elastin microfibril interfacer 3	503						cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)				biliary_tract(1)|endometrium(2)|kidney(1)|large_intestine(2)|liver(1)|lung(15)|ovary(1)|prostate(2)|skin(3)|urinary_tract(2)	30		Myeloproliferative disorder(115;0.00425)				TCTGTCTGTACAAGGGGCCGA	0.632																																						dbGAP											0													70.0	64.0	66.0					20																	39990702		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031667	CCDS13316.1	20q12	2005-11-06	2004-03-02	2004-03-02	ENSG00000183798	ENSG00000183798		"""EMI domain containing"""	16123	protein-coding gene	gene with protein product	"""chromosome 20 open reading frame 130"""	608929	"""elastin microfibril interfacer 5"""	C20orf130, EMILIN5		12221002	Standard	NM_052846		Approved	dJ620E11.4	uc002xjy.1	Q9NT22	OTTHUMG00000046304	ENST00000332312.3:c.1507G>C	20.37:g.39990702C>G	ENSP00000332806:p.Val503Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495S5|Q495S6|Q495S7|Q76KT4	Missense_Mutation	SNP	pfam_EMI_domain,pfscan_EMI_domain	p.V503L	ENST00000332312.3	37	c.1507	CCDS13316.1	20	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.669450	0.00765	.	.	ENSG00000183798	ENST00000332312	T	0.13778	2.56	5.12	3.05	0.35203	.	0.485143	0.19674	N	0.108661	T	0.08133	0.0203	L	0.29908	0.895	0.31042	N	0.716238	B	0.10296	0.003	B	0.08055	0.003	T	0.13818	-1.0495	9	.	.	.	-10.9907	4.1838	0.10388	0.1273:0.4678:0.3153:0.0896	.	503	Q9NT22	EMIL3_HUMAN	L	503	ENSP00000332806:V503L	.	V	-	1	0	EMILIN3	39424116	0.006000	0.16342	0.668000	0.29813	0.044000	0.14063	0.214000	0.17541	1.147000	0.42369	0.561000	0.74099	GTA	EMILIN3	-	NULL	ENSG00000183798		0.632	EMILIN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN3	HGNC	protein_coding	OTTHUMT00000106876.2	18	0.00	0	C	XM_029741		39990702	39990702	-1	no_errors	ENST00000332312	ensembl	human	known	69_37n	missense	34	34.62	18	SNP	0.488	G
EPHA5	2044	genome.wustl.edu	37	4	66280012	66280012	+	Silent	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr4:66280012G>T	ENST00000273854.3	-	7	2277	c.1677C>A	c.(1675-1677)acC>acA	p.T559T	EPHA5_ENST00000354839.4_Silent_p.T559T|EPHA5_ENST00000432638.2_Silent_p.T395T|EPHA5_ENST00000511294.1_Silent_p.T559T	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	559	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						ACACTGGGGTGGTTTCAAACT	0.458										TSP Lung(17;0.13)																												dbGAP											0													138.0	118.0	125.0					4																	66280012		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1677C>A	4.37:g.66280012G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3F2	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.T559	ENST00000273854.3	37	c.1677	CCDS3513.1	4																																																																																			EPHA5	-	superfamily_Fibronectin_type3,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3	ENSG00000145242		0.458	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	33	0.00	0	G	NM_004439		66280012	66280012	-1	no_errors	ENST00000273854	ensembl	human	known	69_37n	silent	22	15.38	4	SNP	1.000	T
FAF2	23197	genome.wustl.edu	37	5	175875473	175875473	+	Splice_Site	SNP	T	T	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:175875473T>G	ENST00000261942.6	+	1	116		c.e1+2			NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2						lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						CAGTTTCAGGTAGCAGCGAGT	0.607																																						dbGAP											0													36.0	35.0	35.0					5																	175875473		2197	4293	6490	-	-	-	SO:0001630	splice_region_variant	0			BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.63+2T>G	5.37:g.175875473T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O94963|Q8IUF2|Q9BRP2|Q9BVM7	Splice_Site	SNP	-	e1+2	ENST00000261942.6	37	c.63+2	CCDS34296.1	5	.	.	.	.	.	.	.	.	.	.	T	20.5	4.008000	0.75046	.	.	ENSG00000113194	ENST00000261942;ENST00000540174	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6452	0.68756	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAF2	175808079	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.756000	0.62205	2.127000	0.65507	0.491000	0.48974	.	FAF2	-	-	ENSG00000113194		0.607	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF2	HGNC	protein_coding	OTTHUMT00000372194.1	78	0.00	0	T	NM_014613	Intron	175875473	175875473	+1	no_errors	ENST00000261942	ensembl	human	known	69_37n	splice_site	38	45.71	32	SNP	1.000	G
FAT1	2195	genome.wustl.edu	37	4	187539493	187539493	+	Missense_Mutation	SNP	C	C	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr4:187539493C>A	ENST00000441802.2	-	10	8456	c.8247G>T	c.(8245-8247)gaG>gaT	p.E2749D		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	2749	Cadherin 25. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						TCACAAAGGACTCATCCCTAT	0.458										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)	dbGAP											0													139.0	136.0	137.0					4																	187539493		1929	4149	6078	-	-	-	SO:0001583	missense	0			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.8247G>T	4.37:g.187539493C>A	ENSP00000406229:p.Glu2749Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.E2749D	ENST00000441802.2	37	c.8247	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	C	3.624	-0.076918	0.07184	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	T	0.60299	0.2	4.8	-0.145	0.13436	Cadherin (4);Cadherin-like (1);	0.272836	0.40640	N	0.001050	T	0.26159	0.0638	N	0.11154	0.105	0.26282	N	0.978256	B	0.14012	0.009	B	0.22386	0.039	T	0.07986	-1.0744	10	0.11794	T	0.64	.	0.7769	0.01034	0.2012:0.2068:0.3119:0.2801	.	2749	Q14517	FAT1_HUMAN	D	2749;2751	ENSP00000406229:E2749D	ENSP00000260147:E2751D	E	-	3	2	FAT1	187776487	0.266000	0.24112	0.851000	0.33527	0.853000	0.48598	-0.308000	0.08156	-0.168000	0.10853	-0.136000	0.14681	GAG	FAT1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000083857		0.458	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	25	0.00	0	C	NM_005245		187539493	187539493	-1	no_errors	ENST00000441802	ensembl	human	known	69_37n	missense	27	32.50	13	SNP	0.007	A
FAT2	2196	genome.wustl.edu	37	5	150922996	150922998	+	In_Frame_Del	DEL	TCC	TCC	-			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	TCC	TCC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:150922996_150922998delTCC	ENST00000261800.5	-	9	7702_7704	c.7690_7692delGGA	c.(7690-7692)ggadel	p.G2564del		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	2564	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGCTACTCTTCCTCCTCCATCC	0.468																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.7690_7692delGGA	5.37:g.150923002_150923004delTCC	ENSP00000261800:p.Gly2564del	Somatic		WXS	Illumina GAIIx	Phase_IV	O75091|Q9NSR7	In_Frame_Del	DEL	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.G2564in_frame_del	ENST00000261800.5	37	c.7692_7690	CCDS4317.1	5																																																																																			FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.468	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	64	0.00	0	TCC	NM_001447		150922996	150922998	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	in_frame_del	30	30.23	13	DEL	0.946:1.000:1.000	-
ACOXL	55289	genome.wustl.edu	37	2	111858020	111858020	+	Intron	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:111858020C>T	ENST00000439055.1	+	17	1766				AC096670.3_ENST00000376593.2_RNA	NM_001142807.1	NP_001136279.1	Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like						fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						ACCAAAAACTCGTTCACTAAG	0.438																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000439055.1:c.1542+7477C>T	2.37:g.111858020C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	RNA	SNP	-	NULL	ENST00000439055.1	37	NULL	CCDS46389.1	2																																																																																			AC096670.3	-	-	ENSG00000204581		0.438	ACOXL-013	KNOWN	basic|CCDS	protein_coding	FLJ44006	Clone_based_vega_gene	protein_coding	OTTHUMT00000376017.1	33	0.00	0	C	NM_018308		111858020	111858020	-1	no_errors	ENST00000376593	ensembl	human	known	69_37n	rna	16	40.74	11	SNP	0.000	T
FOXD3	27022	genome.wustl.edu	37	1	63789409	63789409	+	Missense_Mutation	SNP	A	A	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:63789409A>G	ENST00000371116.2	+	1	680	c.680A>G	c.(679-681)aAc>aGc	p.N227S	RP4-792G4.2_ENST00000426393.1_RNA|RP4-792G4.2_ENST00000449386.1_RNA|RP4-792G4.2_ENST00000418244.1_RNA|RP4-792G4.2_ENST00000431294.1_RNA|RP4-792G4.2_ENST00000427268.1_RNA	NM_012183.2	NP_036315.1	Q9UJU5	FOXD3_HUMAN	forkhead box D3	227					embryonic placenta development (GO:0001892)|in utero embryonic development (GO:0001701)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|trophectodermal cell differentiation (GO:0001829)	nuclear chromatin (GO:0000790)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|lung(2)|upper_aerodigestive_tract(1)	5						ATGTTCGACAACGGCAGCTTC	0.647																																					Pancreas(68;276 1750 11966 31252)	dbGAP											0													51.0	61.0	58.0					1																	63789409		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF197560	CCDS624.1	1p31.3	2008-04-10			ENSG00000187140	ENSG00000187140		"""Forkhead boxes"""	3804	protein-coding gene	gene with protein product		611539				8499623	Standard	NM_012183		Approved	Genesis, HFH2	uc001dax.2	Q9UJU5	OTTHUMG00000009141	ENST00000371116.2:c.680A>G	1.37:g.63789409A>G	ENSP00000360157:p.Asn227Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BYM2|Q9UDD1	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.N227S	ENST00000371116.2	37	c.680	CCDS624.1	1	.	.	.	.	.	.	.	.	.	.	A	19.30	3.801543	0.70682	.	.	ENSG00000187140	ENST00000371116	D	0.95518	-3.73	2.39	2.39	0.29439	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.115165	0.56097	U	0.000028	D	0.93051	0.7788	M	0.68728	2.09	0.58432	D	0.999999	P	0.45428	0.858	P	0.46917	0.531	D	0.93034	0.6451	10	0.87932	D	0	.	10.71	0.45977	1.0:0.0:0.0:0.0	.	227	Q9UJU5	FOXD3_HUMAN	S	227	ENSP00000360157:N227S	ENSP00000360157:N227S	N	+	2	0	FOXD3	63561997	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.229000	0.72294	1.340000	0.45581	0.377000	0.23210	AAC	FOXD3	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000187140		0.647	FOXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD3	HGNC	protein_coding	OTTHUMT00000025331.1	85	0.00	0	A			63789409	63789409	+1	no_errors	ENST00000371116	ensembl	human	known	69_37n	missense	64	34.69	34	SNP	1.000	G
GABRR3	200959	genome.wustl.edu	37	3	97753780	97753780	+	RNA	SNP	T	T	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr3:97753780T>C	ENST00000472788.1	-	0	53					NM_001105580.2	NP_001099050.1	A8MPY1	GBRR3_HUMAN	gamma-aminobutyric acid (GABA) A receptor, rho 3 (gene/pseudogene)						gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			large_intestine(2)|lung(1)	3					Adinazolam(DB00546)|Bromazepam(DB01558)|Cinolazepam(DB01594)|Clotiazepam(DB01559)|Diazepam(DB00829)|Estazolam(DB01215)|Fludiazepam(DB01567)|Flurazepam(DB00690)|Halazepam(DB00801)|Midazolam(DB00683)|Nitrazepam(DB01595)|Oxazepam(DB00842)|Prazepam(DB01588)|Quazepam(DB01589)|Temazepam(DB00231)|Triazolam(DB00897)	ACATTTGGTTTCAATATGATC	0.433																																						dbGAP											0													135.0	126.0	129.0					3																	97753780		1903	4125	6028	-	-	-			0			Y18994	CCDS54617.1	3q11.2	2014-03-25	2014-03-25		ENSG00000183185	ENSG00000183185		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	17969	protein-coding gene	gene with protein product	"""GABA(A) receptor, rho 3"""		"""gamma-aminobutyric acid (GABA) receptor, rho 3"", ""gamma-aminobutyric acid (GABA) A receptor, rho 3"""			10542332	Standard	NM_001105580		Approved		uc021xbp.1	A8MPY1	OTTHUMG00000159135		3.37:g.97753780T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UIV9	Missense_Mutation	SNP	NULL	p.K18E	ENST00000472788.1	37	c.52		3																																																																																			GABRR3	-	NULL	ENSG00000183185		0.433	GABRR3-002	KNOWN	not_organism_supported|basic	polymorphic_pseudogene	GABRR3	HGNC	polymorphic_pseudogene	OTTHUMT00000353445.2	48	0.00	0	T			97753780	97753780	-1	pseudogene	ENST00000472788	ensembl	human	known	69_37n	missense	46	20.69	12	SNP	0.001	C
GPR116	221395	genome.wustl.edu	37	6	46847554	46847554	+	Splice_Site	SNP	C	C	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr6:46847554C>A	ENST00000283296.7	-	9	1325		c.e9+1		GPR116_ENST00000362015.4_Splice_Site|GPR116_ENST00000265417.7_Splice_Site|GPR116_ENST00000456426.2_Intron	NM_001098518.1	NP_001091988.1	Q8IZF2	GP116_HUMAN	G protein-coupled receptor 116						energy reserve metabolic process (GO:0006112)|fat cell differentiation (GO:0045444)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|neuropeptide signaling pathway (GO:0007218)|regulation of lipid metabolic process (GO:0019216)|surfactant homeostasis (GO:0043129)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(21)|ovary(1)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	59			Lung(136;0.192)			TGGAGACCTACCTGCATCACC	0.408																																					NSCLC(59;410 1274 8751 36715 50546)	dbGAP											0													151.0	130.0	137.0					6																	46847554		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB018301	CCDS4919.1	6p12.3	2014-08-08			ENSG00000069122	ENSG00000069122		"""-"", ""GPCR / Class B : Orphans"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19030	protein-coding gene	gene with protein product						12435584	Standard	NM_001098518		Approved	DKFZp564O1923, KIAA0758	uc003oyo.3	Q8IZF2	OTTHUMG00000014793	ENST00000283296.7:c.1036+1G>T	6.37:g.46847554C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O94858|Q5TF06|Q6RGN2|Q86SP0|Q9Y3Z2	Splice_Site	SNP	-	e8+1	ENST00000283296.7	37	c.1036+1	CCDS4919.1	6	.	.	.	.	.	.	.	.	.	.	C	11.35	1.612158	0.28712	.	.	ENSG00000069122	ENST00000452370;ENST00000283296;ENST00000362015;ENST00000265417	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.7148	0.77658	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GPR116	46955513	0.986000	0.35501	0.984000	0.44739	0.043000	0.13939	3.522000	0.53480	2.785000	0.95823	0.591000	0.81541	.	GPR116	-	-	ENSG00000069122		0.408	GPR116-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR116	HGNC	protein_coding	OTTHUMT00000040806.2	59	0.00	0	C	NM_015234	Intron	46847554	46847554	-1	no_errors	ENST00000265417	ensembl	human	known	69_37n	splice_site	49	39.51	32	SNP	0.983	A
GPR137B	7107	genome.wustl.edu	37	1	236341763	236341763	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:236341763G>C	ENST00000366592.3	+	3	605	c.514G>C	c.(514-516)Gtg>Ctg	p.V172L	GPR137B_ENST00000366591.4_Intron	NM_003272.3	NP_003263.1	O60478	G137B_HUMAN	G protein-coupled receptor 137B	172						integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|membrane (GO:0016020)				endometrium(2)|large_intestine(1)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	16	Ovarian(103;0.0634)|Breast(184;0.247)	all_cancers(173;0.197)|Prostate(94;0.219)|Acute lymphoblastic leukemia(190;0.226)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)			TTTCCTGTTGGTGAATTTAAC	0.517																																						dbGAP											0													171.0	147.0	155.0					1																	236341763		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF027826	CCDS1609.1	1q42-q43	2012-08-10	2006-01-26	2006-01-26	ENSG00000077585	ENSG00000077585			11862	protein-coding gene	gene with protein product		604658	"""transmembrane 7 superfamily member 1 (upregulated in kidney)"""	TM7SF1		9521871	Standard	NM_003272		Approved		uc001hxq.3	O60478	OTTHUMG00000037994	ENST00000366592.3:c.514G>C	1.37:g.236341763G>C	ENSP00000355551:p.Val172Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53EK7|Q5TAE6|Q6FHI3	Missense_Mutation	SNP	NULL	p.V172L	ENST00000366592.3	37	c.514	CCDS1609.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	34|34	5.312211|5.312211	0.95655|0.95655	.|.	.|.	ENSG00000077585|ENSG00000077585	ENST00000366592;ENST00000391852|ENST00000454895	T|.	0.57907|.	0.37|.	5.59|5.59	5.59|5.59	0.84812|0.84812	.|.	0.056766|.	0.64402|.	D|.	0.000001|.	T|T	0.81823|0.81823	0.4904|0.4904	M|M	0.80746|0.80746	2.51|2.51	0.80722|0.80722	D|D	1|1	D|.	0.67145|.	0.996|.	D|.	0.77557|.	0.99|.	T|T	0.81856|0.81856	-0.0740|-0.0740	10|5	0.51188|.	T|.	0.08|.	-13.7349|-13.7349	19.5832|19.5832	0.95478|0.95478	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	172|.	O60478|.	G137B_HUMAN|.	L|C	172;171|35	ENSP00000355551:V172L|.	ENSP00000355551:V172L|.	V|W	+|+	1|3	0|0	GPR137B|GPR137B	234408386|234408386	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.346000|9.346000	0.97056|0.97056	2.625000|2.625000	0.88918|0.88918	0.561000|0.561000	0.74099|0.74099	GTG|TGG	GPR137B	-	NULL	ENSG00000077585		0.517	GPR137B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR137B	HGNC	protein_coding	OTTHUMT00000092761.1	119	0.00	0	G	NM_003272		236341763	236341763	+1	no_errors	ENST00000366592	ensembl	human	known	69_37n	missense	157	14.21	26	SNP	1.000	C
GPR39	2863	genome.wustl.edu	37	2	133402929	133402929	+	Missense_Mutation	SNP	A	A	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:133402929A>T	ENST00000329321.3	+	2	1581	c.1112A>T	c.(1111-1113)gAg>gTg	p.E371V	GPR39_ENST00000470071.1_3'UTR|LYPD1_ENST00000397463.2_3'UTR	NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	371					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						GCCAACCACGAGAAGCGCCTG	0.662																																						dbGAP											0													50.0	50.0	50.0					2																	133402929		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.1112A>T	2.37:g.133402929A>T	ENSP00000327417:p.Glu371Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.E371V	ENST00000329321.3	37	c.1112	CCDS2170.1	2	.	.	.	.	.	.	.	.	.	.	A	15.27	2.784851	0.49997	.	.	ENSG00000183840	ENST00000329321	T	0.37411	1.2	5.15	3.98	0.46160	.	13.638300	0.00166	N	0.000000	T	0.38453	0.1041	L	0.50333	1.59	0.58432	D	0.999991	B	0.31125	0.309	B	0.29942	0.109	T	0.04495	-1.0947	10	0.32370	T	0.25	.	10.2826	0.43548	0.9195:0.0:0.0805:0.0	.	371	O43194	GPR39_HUMAN	V	371	ENSP00000327417:E371V	ENSP00000327417:E371V	E	+	2	0	GPR39	133119399	1.000000	0.71417	0.016000	0.15963	0.908000	0.53690	4.932000	0.63476	0.973000	0.38340	0.529000	0.55759	GAG	GPR39	-	NULL	ENSG00000183840		0.662	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR39	HGNC	protein_coding	OTTHUMT00000254582.1	24	0.00	0	A			133402929	133402929	+1	no_errors	ENST00000329321	ensembl	human	known	69_37n	missense	15	51.61	16	SNP	0.502	T
GRM3	2913	genome.wustl.edu	37	7	86493602	86493602	+	Silent	SNP	T	T	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:86493602T>C	ENST00000361669.2	+	6	3670	c.2571T>C	c.(2569-2571)tcT>tcC	p.S857S	GRM3_ENST00000394720.2_Missense_Mutation_p.C500R|GRM3_ENST00000546348.1_Silent_p.S449S|GRM3_ENST00000439827.1_Missense_Mutation_p.C502R|GRM3_ENST00000536043.1_Silent_p.S729S	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	857					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)			NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TTCCAGCCTCTGCAAGCACGT	0.483																																					GBM(52;969 1098 3139 52280)	dbGAP											0													225.0	190.0	202.0					7																	86493602		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.2571T>C	7.37:g.86493602T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt	p.C500R	ENST00000361669.2	37	c.1498	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	T	4.914	0.169871	0.09339	.	.	ENSG00000198822	ENST00000439827;ENST00000394720	D;D	0.90504	-2.68;-2.68	5.99	-2.1	0.07210	.	.	.	.	.	D	0.82733	0.5101	.	.	.	0.39781	D	0.972291	B	0.02656	0.0	B	0.04013	0.001	T	0.71265	-0.4644	8	0.87932	D	0	.	3.4324	0.07433	0.0954:0.2601:0.1058:0.5386	.	502	G5E9K2	.	R	502;500	ENSP00000398767:C502R;ENSP00000378209:C500R	ENSP00000378209:C500R	C	+	1	0	GRM3	86331538	0.777000	0.28628	0.998000	0.56505	0.846000	0.48090	-0.265000	0.08644	-0.071000	0.12886	-1.151000	0.01829	TGC	GRM3	-	NULL	ENSG00000198822		0.483	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	54	0.00	0	T			86493602	86493602	+1	no_errors	ENST00000394720	ensembl	human	known	69_37n	missense	42	32.26	20	SNP	0.989	C
HSD17B3	3293	genome.wustl.edu	37	9	99006675	99006675	+	Splice_Site	SNP	G	G	A	rs119481076		TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr9:99006675G>A	ENST00000375263.3	-	9	655	c.608C>T	c.(607-609)gCg>gTg	p.A203V	HSD17B3_ENST00000375262.2_Splice_Site_p.A203V|RP11-240L7.4_ENST00000448857.1_RNA|HSD17B3_ENST00000464104.1_5'UTR	NM_000197.1	NP_000188.1	P37058	DHB3_HUMAN	hydroxysteroid (17-beta) dehydrogenase 3	203			A -> V (in MPH). {ECO:0000269|PubMed:8075637}.		androgen biosynthetic process (GO:0006702)|male genitalia development (GO:0030539)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	testosterone 17-beta-dehydrogenase (NADP+) activity (GO:0047045)			breast(1)|endometrium(3)|large_intestine(2)|lung(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13		Acute lymphoblastic leukemia(62;0.0171)|all_hematologic(171;0.214)				GCACACAAACGCCTGGAGCAA	0.542																																						dbGAP											0			GRCh37	CM940951	HSD17B3	M	rs119481076						143.0	130.0	134.0					9																	99006675		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS6716.1	9q22	2011-09-20			ENSG00000130948	ENSG00000130948	1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	5212	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 12C, member 2"""	605573				8075637, 19027726	Standard	NM_000197		Approved	SDR12C2	uc004awa.1	P37058	OTTHUMG00000020292	ENST00000375263.3:c.607-1C>T	9.37:g.99006675G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5U0Q6	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.A203V	ENST00000375263.3	37	c.608	CCDS6716.1	9	.	.	.	.	.	.	.	.	.	.	G	13.54	2.269077	0.40095	.	.	ENSG00000130948	ENST00000375263;ENST00000375262	D;D	0.90676	-2.71;-2.71	4.84	4.84	0.62591	Short-chain dehydrogenase/reductase, conserved site (1);NAD(P)-binding domain (1);	0.118045	0.64402	D	0.000019	D	0.93575	0.7949	M	0.88377	2.95	0.45390	A	0.998375	P;P	0.52170	0.951;0.711	P;B	0.49085	0.6;0.351	D	0.93923	0.7207	9	0.36615	T	0.2	-0.1144	16.8908	0.86087	0.0:0.0:1.0:0.0	.	203;203	Q5U0Q6;P37058	.;DHB3_HUMAN	V	203	ENSP00000364412:A203V;ENSP00000364411:A203V	ENSP00000364411:A203V	A	-	2	0	HSD17B3	98046496	1.000000	0.71417	0.983000	0.44433	0.052000	0.14988	3.532000	0.53553	2.525000	0.85131	0.650000	0.86243	GCG	HSD17B3	-	pfam_DH_sc/Rdtase_SDR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	ENSG00000130948		0.542	HSD17B3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HSD17B3	HGNC	protein_coding	OTTHUMT00000053259.1	42	0.00	0	G	NM_000197	Missense_Mutation	99006675	99006675	-1	no_errors	ENST00000375263	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	1.000	A
HEBP1	50865	genome.wustl.edu	37	12	13153397	13153397	+	5'Flank	SNP	G	G	C	rs5021038	byFrequency	TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:13153397G>C	ENST00000014930.4	-	0	0				HEBP1_ENST00000536942.1_5'Flank|RP11-377D9.3_ENST00000543321.1_lincRNA	NM_015987.4	NP_057071.2	Q9NRV9	HEBP1_HUMAN	heme binding protein 1						circadian rhythm (GO:0007623)	cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	heme binding (GO:0020037)			breast(1)|endometrium(1)|large_intestine(3)|lung(1)|urinary_tract(1)	7		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.153)		gggcagcagtgcagcagtgca	0.736																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AF117615	CCDS31749.1	12p13.2	2014-01-30			ENSG00000013583	ENSG00000013583		"""Endogenous ligands"""	17176	protein-coding gene	gene with protein product		605826				10640688	Standard	NM_015987		Approved	HEBP, HBP	uc001rbd.3	Q9NRV9	OTTHUMG00000168771		12.37:g.13153397G>C	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1G2|Q9Y5Z5	RNA	SNP	-	NULL	ENST00000014930.4	37	NULL	CCDS31749.1	12																																																																																			HTR7P1	-	-	ENSG00000183935		0.736	HEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR7P1	HGNC	protein_coding	OTTHUMT00000401001.1	8	0.00	0	G			13153397	13153397	+1	no_errors	ENST00000535469	ensembl	human	known	69_37n	rna	6	50.00	6	SNP	0.000	C
IGHV4-61	28391	genome.wustl.edu	37	14	107095423	107095423	+	RNA	SNP	G	G	A	rs201399631	byFrequency	TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr14:107095423G>A	ENST00000390630.2	-	0	157				RNA5SP389_ENST00000362610.1_RNA					immunoglobulin heavy variable 4-61																		GCTGCACCTGGGACAGGACCC	0.617													.|||	545	0.108826	0.1778	0.0519	5008	,	,		8491	0.0427		0.0278	False		,,,				2504	0.2076					dbGAP											0													14.0	27.0	23.0					14																	107095423		1750	4010	5760	-	-	-			0			M29811		14q32.33	2012-02-08			ENSG00000211970	ENSG00000211970		"""Immunoglobulins / IGH locus"""	5655	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151976		14.37:g.107095423G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S19	ENST00000390630.2	37	c.57		14																																																																																			IGHV4-61	-	pfscan_Ig-like	ENSG00000211970		0.617	IGHV4-61-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV4-61	HGNC	IG_V_gene	OTTHUMT00000324623.1	37	0.00	0	G	NG_001019		107095423	107095423	-1	no_stop_codon	ENST00000390630	ensembl	human	known	69_37n	silent	24	20.00	6	SNP	0.987	A
ILF2	3608	genome.wustl.edu	37	1	153634800	153634800	+	3'UTR	SNP	A	A	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:153634800A>C	ENST00000361891.4	-	0	1370				ILF2_ENST00000480213.1_5'UTR	NM_001267809.1|NM_004515.3	NP_001254738.1|NP_004506.2	Q12905	ILF2_HUMAN	interleukin enhancer binding factor 2						immune response (GO:0006955)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|transferase activity (GO:0016740)			cervix(1)|kidney(1)|lung(4)|skin(1)	7	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			GTCTGTCACCATGTAAAGCCC	0.473																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U10323	CCDS1050.1, CCDS72919.1	1q21.3	2012-12-04	2012-12-04		ENSG00000143621	ENSG00000143621			6037	protein-coding gene	gene with protein product		603181	"""interleukin enhancer binding factor 2, 45kD"", ""interleukin enhancer binding factor 2, 45kDa"""			7519613	Standard	NM_004515		Approved	NF45	uc001fcr.4	Q12905	OTTHUMG00000037087	ENST00000361891.4:c.*72T>G	1.37:g.153634800A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDB0|B2R8G7|Q5SR10|Q5SR11|Q7L7R3|Q9BWD4|Q9P1N0	RNA	SNP	-	NULL	ENST00000361891.4	37	NULL	CCDS1050.1	1																																																																																			ILF2	-	-	ENSG00000143621		0.473	ILF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILF2	HGNC	protein_coding	OTTHUMT00000090040.1	50	0.00	0	A	NM_004515		153634800	153634800	-1	no_errors	ENST00000480213	ensembl	human	known	69_37n	rna	39	44.29	31	SNP	0.068	C
KCNA1	3736	genome.wustl.edu	37	12	5020749	5020749	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:5020749C>T	ENST00000382545.3	+	2	1312	c.205C>T	c.(205-207)Cgc>Tgc	p.R69C	KCNA1_ENST00000543874.2_Intron	NM_000217.2	NP_000208.2	Q09470	KCNA1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 1 (episodic ataxia with myokymia)	69					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|dendrite (GO:0030425)|juxtaparanode region of axon (GO:0044224)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|potassium ion transmembrane transporter activity (GO:0015079)	p.R69C(1)		NS(1)|breast(3)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(14)|lung(23)|ovary(3)|pancreas(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63					Amitriptyline(DB00321)|Dalfampridine(DB06637)|Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Nifedipine(DB01115)|Sevoflurane(DB01236)	CCCTAAGAAACGCATGCGCTA	0.627																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											62.0	63.0	63.0					12																	5020749		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02750	CCDS8535.1	12p13	2012-07-05			ENSG00000111262	ENSG00000111262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6218	protein-coding gene	gene with protein product		176260		AEMK		1349297, 8821794, 16382104	Standard	NM_000217		Approved	Kv1.1, RBK1, HUK1, MBK1	uc001qnh.3	Q09470	OTTHUMG00000044398	ENST00000382545.3:c.205C>T	12.37:g.5020749C>T	ENSP00000371985:p.Arg69Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM83|Q3MIQ9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.1,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv1.3	p.R69C	ENST00000382545.3	37	c.205	CCDS8535.1	12	.	.	.	.	.	.	.	.	.	.	C	16.38	3.107420	0.56291	.	.	ENSG00000111262	ENST00000382545;ENST00000228858	T	0.78246	-1.16	4.31	4.31	0.51392	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.88518	0.6458	M	0.85777	2.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.88446	0.3045	10	0.37606	T	0.19	.	16.3111	0.82872	0.0:1.0:0.0:0.0	.	69	Q09470	KCNA1_HUMAN	C	69	ENSP00000371985:R69C	ENSP00000228858:R69C	R	+	1	0	KCNA1	4891010	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	2.317000	0.43770	2.388000	0.81334	0.650000	0.86243	CGC	KCNA1	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv1.3	ENSG00000111262		0.627	KCNA1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KCNA1	HGNC	protein_coding	OTTHUMT00000103343.2	74	0.00	0	C	NM_000217		5020749	5020749	+1	no_errors	ENST00000382545	ensembl	human	known	69_37n	missense	63	39.42	41	SNP	0.999	T
KCNH6	81033	genome.wustl.edu	37	17	61613419	61613419	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr17:61613419G>T	ENST00000583023.1	+	6	1502	c.1491G>T	c.(1489-1491)atG>atT	p.M497I	KCNH6_ENST00000581784.1_Missense_Mutation_p.M444I|KCNH6_ENST00000456941.2_Missense_Mutation_p.M444I|KCNH6_ENST00000580652.1_Missense_Mutation_p.M497I|KCNH6_ENST00000314672.5_Missense_Mutation_p.M497I	NM_030779.2	NP_110406.1	Q9H252	KCNH6_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 6	497					potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(4)|large_intestine(6)|lung(20)|ovary(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	54					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TCTGCGTCATGCTCATCGGCT	0.507																																						dbGAP											0													86.0	73.0	78.0					17																	61613419		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311913	CCDS11638.1, CCDS11639.1, CCDS62290.1	17q23.3	2012-07-05				ENSG00000173826		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18862	protein-coding gene	gene with protein product		608168				16382104	Standard	NM_030779		Approved	Kv11.2, erg2, HERG2	uc002jay.3	Q9H252		ENST00000583023.1:c.1491G>T	17.37:g.61613419G>T	ENSP00000463533:p.Met497Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BRD7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,prints_K_chnl_volt-dep_ELK,prints_2pore_dom_K_chnl,pfscan_cNMP-bd_dom	p.M497I	ENST00000583023.1	37	c.1491	CCDS11638.1	17	.	.	.	.	.	.	.	.	.	.	G	14.25	2.479732	0.44044	.	.	ENSG00000173826	ENST00000314672;ENST00000456941	D;D	0.97870	-4.58;-4.16	4.36	4.36	0.52297	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98216	0.9410	L	0.58428	1.81	0.46927	D	0.999255	D;D;D;D;D	0.89917	0.988;0.998;1.0;0.996;0.993	D;D;D;D;D	0.77004	0.979;0.989;0.987;0.968;0.973	D	0.99667	1.0995	10	0.87932	D	0	.	17.0722	0.86577	0.0:0.0:1.0:0.0	.	374;497;444;497;497	B4DPJ3;B4DKC0;Q9H252-2;Q9H252;Q9H252-3	.;.;.;KCNH6_HUMAN;.	I	497;444	ENSP00000318212:M497I;ENSP00000396900:M444I	ENSP00000318212:M497I	M	+	3	0	KCNH6	58967151	1.000000	0.71417	1.000000	0.80357	0.801000	0.45260	9.657000	0.98554	2.244000	0.73946	0.313000	0.20887	ATG	KCNH6	-	pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_2pore_dom_K_chnl	ENSG00000173826		0.507	KCNH6-005	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH6	HGNC	protein_coding	OTTHUMT00000443853.1	91	0.00	0	G	NM_030779		61613419	61613419	+1	no_errors	ENST00000583023	ensembl	human	known	69_37n	missense	69	29.59	29	SNP	1.000	T
KIAA0825	285600	genome.wustl.edu	37	5	93739293	93739296	+	Frame_Shift_Del	DEL	GTTA	GTTA	-			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	GTTA	GTTA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:93739293_93739296delGTTA	ENST00000513200.3	-	15	2937_2940	c.2865_2868delTAAC	c.(2863-2868)actaacfs	p.TN955fs	KIAA0825_ENST00000427991.2_Frame_Shift_Del_p.TN955fs	NM_001145678.1	NP_001139150.1	Q8IV33	K0825_HUMAN	KIAA0825	955										breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(1)	13						ATTCTTTCCTGTTAGTTTCTTTTG	0.338																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BX648338	CCDS4070.1	5q15	2011-02-23	2011-02-23	2011-02-23	ENSG00000185261	ENSG00000185261			28532	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 36"""	C5orf36		12477932	Standard	NM_173665		Approved	DKFZp686F0372, MGC34713	uc011cuk.2	Q8IV33	OTTHUMG00000131331	ENST00000513200.3:c.2865_2868delTAAC	5.37:g.93739293_93739296delGTTA	ENSP00000424618:p.Thr955fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O94914|Q6ZNN2	Frame_Shift_Del	DEL	NULL	p.N956fs	ENST00000513200.3	37	c.2868_2865		5																																																																																			KIAA0825	-	NULL	ENSG00000185261		0.338	KIAA0825-001	KNOWN	not_organism_supported|basic	protein_coding	KIAA0825	HGNC	protein_coding	OTTHUMT00000254102.5	27	0.00	0	GTTA	NM_173665		93739293	93739296	-1	no_errors	ENST00000427991	ensembl	human	known	69_37n	frame_shift_del	33	22.73	10	DEL	0.453:0.408:0.407:0.360	-
KIAA1755	85449	genome.wustl.edu	37	20	36868033	36868033	+	Silent	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr20:36868033G>A	ENST00000279024.4	-	4	1915	c.1644C>T	c.(1642-1644)tcC>tcT	p.S548S		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	548										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				CTCTTTCTGGGGAGCCTGCAG	0.617																																						dbGAP											0													45.0	49.0	47.0					20																	36868033		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.1644C>T	20.37:g.36868033G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9C0A8	Silent	SNP	superfamily_CRAL-TRIO_dom	p.S548	ENST00000279024.4	37	c.1644	CCDS33467.1	20																																																																																			KIAA1755	-	NULL	ENSG00000149633		0.617	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	38	0.00	0	G	NM_001029864		36868033	36868033	-1	no_errors	ENST00000279024	ensembl	human	known	69_37n	silent	47	16.07	9	SNP	0.034	A
LAMB1	3912	genome.wustl.edu	37	7	107618513	107618513	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:107618513G>A	ENST00000222399.6	-	9	1209	c.979C>T	c.(979-981)Cga>Tga	p.R327*	LAMB1_ENST00000393561.1_Nonsense_Mutation_p.R351*|LAMB1_ENST00000393560.1_Nonsense_Mutation_p.R327*	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	327	Laminin EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						TTGCTGTTTCGGCCTTCAGCA	0.443																																						dbGAP											0													124.0	118.0	120.0					7																	107618513		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.979C>T	7.37:g.107618513G>A	ENSP00000222399:p.Arg327*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14D91	Nonsense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R327*	ENST00000222399.6	37	c.979	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.148396	0.98096	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	19.0709	0.93136	0.0:0.0:1.0:0.0	.	.	.	.	X	351;327;327	.	ENSP00000222399:R327X	R	-	1	2	LAMB1	107405749	1.000000	0.71417	0.985000	0.45067	0.465000	0.32709	7.430000	0.80321	2.745000	0.94114	0.462000	0.41574	CGA	LAMB1	-	smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000091136		0.443	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	53	0.00	0	G	NM_002291		107618513	107618513	-1	no_errors	ENST00000222399	ensembl	human	known	69_37n	nonsense	30	11.76	4	SNP	1.000	A
LRRC43	254050	genome.wustl.edu	37	12	122669297	122669297	+	Missense_Mutation	SNP	T	T	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:122669297T>G	ENST00000339777.4	+	2	410	c.382T>G	c.(382-384)Ttc>Gtc	p.F128V	LRRC43_ENST00000425921.1_5'UTR	NM_152759.4	NP_689972.3	Q8N309	LRC43_HUMAN	leucine rich repeat containing 43	128										NS(1)|endometrium(1)|large_intestine(4)|lung(10)|skin(1)|upper_aerodigestive_tract(2)	19	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000312)|Epithelial(86;0.000539)|BRCA - Breast invasive adenocarcinoma(302;0.225)		CTACTCCTACTTCCGGTCCCT	0.567																																						dbGAP											0													27.0	28.0	28.0					12																	122669297		1995	4175	6170	-	-	-	SO:0001583	missense	0			AK124107	CCDS45001.1	12q24.31	2014-09-11			ENSG00000158113	ENSG00000158113			28562	protein-coding gene	gene with protein product						12477932	Standard	NM_152759		Approved	MGC35140	uc009zxm.3	Q8N309	OTTHUMG00000168915	ENST00000339777.4:c.382T>G	12.37:g.122669297T>G	ENSP00000344233:p.Phe128Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZVT9	Missense_Mutation	SNP	NULL	p.F128V	ENST00000339777.4	37	c.382	CCDS45001.1	12	.	.	.	.	.	.	.	.	.	.	T	20.9	4.067974	0.76301	.	.	ENSG00000158113	ENST00000339777	T	0.61392	0.11	4.9	4.9	0.64082	.	.	.	.	.	T	0.73651	0.3614	M	0.78801	2.425	0.80722	D	1	D	0.67145	0.996	D	0.75484	0.986	T	0.76233	-0.3034	9	0.59425	D	0.04	-24.6309	10.3743	0.44073	0.1467:0.0:0.0:0.8533	.	128	Q8N309	LRC43_HUMAN	V	128	ENSP00000344233:F128V	ENSP00000344233:F128V	F	+	1	0	LRRC43	121235250	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	1.765000	0.38481	1.840000	0.53500	0.379000	0.24179	TTC	LRRC43	-	NULL	ENSG00000158113		0.567	LRRC43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC43	HGNC	protein_coding	OTTHUMT00000401589.1	45	0.00	0	T	NM_152759		122669297	122669297	+1	no_errors	ENST00000339777	ensembl	human	known	69_37n	missense	42	32.26	20	SNP	1.000	G
LRRC73	221424	genome.wustl.edu	37	6	43475012	43475012	+	Silent	SNP	T	T	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr6:43475012T>A	ENST00000372441.1	-	6	1815	c.915A>T	c.(913-915)ggA>ggT	p.G305G		NM_001012974.1	NP_001012992.1	Q5JTD7	LRC73_HUMAN	leucine rich repeat containing 73	305																	TGTCCCCTAGTCCTGACGTCA	0.532											OREG0017453	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													182.0	145.0	157.0					6																	43475012		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34456.1	6p21.1	2011-11-25	2011-11-25	2011-11-25	ENSG00000204052	ENSG00000204052			21375	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 154"""	C6orf154			Standard	NM_001012974		Approved	dJ337H4.2	uc003ovk.2	Q5JTD7	OTTHUMG00000014737	ENST00000372441.1:c.915A>T	6.37:g.43475012T>A		Somatic	916	WXS	Illumina GAIIx	Phase_IV		Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.G305	ENST00000372441.1	37	c.915	CCDS34456.1	6																																																																																			LRRC73	-	NULL	ENSG00000204052		0.532	LRRC73-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRRC73	HGNC	protein_coding	OTTHUMT00000040635.1	26	0.00	0	T	NM_001012974		43475012	43475012	-1	no_errors	ENST00000372441	ensembl	human	novel	69_37n	silent	4	63.64	7	SNP	1.000	A
MAGEB18	286514	genome.wustl.edu	37	X	26157580	26157580	+	Missense_Mutation	SNP	C	C	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chrX:26157580C>A	ENST00000325250.1	+	2	665	c.478C>A	c.(478-480)Ctt>Att	p.L160I		NM_173699.3	NP_775970	Q96M61	MAGBI_HUMAN	melanoma antigen family B, 18	160	Interaction with LNX1.|MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.					cytoplasm (GO:0005737)		p.L160I(1)|p.L160F(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(17)|skin(2)|stomach(1)|urinary_tract(2)	33						GGAGCTGGCACTTGGTGTTGA	0.418																																						dbGAP											2	Substitution - Missense(2)	lung(1)|skin(1)											53.0	41.0	45.0					X																	26157580		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK057361	CCDS14216.1	Xp21.3	2008-02-05			ENSG00000176774	ENSG00000176774			28515	protein-coding gene	gene with protein product							Standard	NM_173699		Approved	MGC33889	uc004dbq.2	Q96M61	OTTHUMG00000021282	ENST00000325250.1:c.478C>A	X.37:g.26157580C>A	ENSP00000314543:p.Leu160Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.L160I	ENST00000325250.1	37	c.478	CCDS14216.1	X	.	.	.	.	.	.	.	.	.	.	C	10.06	1.246935	0.22796	.	.	ENSG00000176774	ENST00000325250	T	0.04758	3.56	4.56	1.88	0.25563	.	0.104526	0.64402	D	0.000003	T	0.03564	0.0102	N	0.24115	0.695	0.09310	N	0.999996	B	0.29232	0.238	B	0.31101	0.124	T	0.38499	-0.9658	10	0.87932	D	0	.	5.8019	0.18417	0.0:0.2406:0.0:0.7594	.	160	Q96M61	MAGBI_HUMAN	I	160	ENSP00000314543:L160I	ENSP00000314543:L160I	L	+	1	0	MAGEB18	26067501	0.977000	0.34250	0.798000	0.32154	0.475000	0.33008	1.107000	0.31110	0.248000	0.21435	-0.366000	0.07423	CTT	MAGEB18	-	pfam_MAGE,pfscan_MAGE	ENSG00000176774		0.418	MAGEB18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB18	HGNC	protein_coding	OTTHUMT00000056120.1	31	0.00	0	C	NM_173699		26157580	26157580	+1	no_errors	ENST00000325250	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	0.762	A
MAP1A	4130	genome.wustl.edu	37	15	43814751	43814751	+	Silent	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr15:43814751G>A	ENST00000300231.5	+	4	1530	c.1080G>A	c.(1078-1080)gaG>gaA	p.E360E	MAP1A_ENST00000382031.1_Silent_p.E598E|MAP1A_ENST00000399453.1_Silent_p.E360E			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	360	Lys-rich (basic).				microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CCAAGACAGAGAAGAAGGCAA	0.562																																						dbGAP											0													34.0	40.0	38.0					15																	43814751		2101	4219	6320	-	-	-	SO:0001819	synonymous_variant	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1080G>A	15.37:g.43814751G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Silent	SNP	NULL	p.E360	ENST00000300231.5	37	c.1080	CCDS42031.1	15																																																																																			MAP1A	-	NULL	ENSG00000166963		0.562	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	29	0.00	0	G	NM_002373		43814751	43814751	+1	no_errors	ENST00000399453	ensembl	human	known	69_37n	silent	14	44.00	11	SNP	0.991	A
MAPKAPK2	9261	genome.wustl.edu	37	1	206906058	206906058	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:206906058C>T	ENST00000367103.3	+	10	1391	c.1198C>T	c.(1198-1200)Cac>Tac	p.H400Y	MAPKAPK2_ENST00000294981.4_3'UTR	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2	400					3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GGCTCTGGCCCACTGAGCCAC	0.527																																						dbGAP											0													53.0	59.0	57.0					1																	206906058		2203	4300	6503	-	-	-	SO:0001583	missense	0			U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.1198C>T	1.37:g.206906058C>T	ENSP00000356070:p.His400Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY30|Q5SY41|Q8IYD6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.H400Y	ENST00000367103.3	37	c.1198	CCDS31001.1	1	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302883	0.60195	.	.	ENSG00000162889	ENST00000367103	T	0.67345	-0.26	5.33	5.33	0.75918	.	.	.	.	.	T	0.45816	0.1361	N	0.08118	0	0.37762	D	0.926362	P	0.44521	0.837	B	0.34991	0.193	T	0.61983	-0.6950	9	0.87932	D	0	.	16.1735	0.81833	0.0:1.0:0.0:0.0	.	400	P49137	MAPK2_HUMAN	Y	400	ENSP00000356070:H400Y	ENSP00000356070:H400Y	H	+	1	0	MAPKAPK2	204972681	0.998000	0.40836	0.998000	0.56505	0.965000	0.64279	3.997000	0.57016	2.501000	0.84356	0.655000	0.94253	CAC	MAPKAPK2	-	NULL	ENSG00000162889		0.527	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPKAPK2	HGNC	protein_coding	OTTHUMT00000088465.1	62	0.00	0	C	NM_004759		206906058	206906058	+1	no_errors	ENST00000367103	ensembl	human	known	69_37n	missense	34	39.29	22	SNP	0.999	T
MCIDAS	345643	genome.wustl.edu	37	5	54516300	54516300	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:54516300C>T	ENST00000513312.1	-	7	1228	c.1052G>A	c.(1051-1053)cGc>cAc	p.R351H	MCIDAS_ENST00000515336.1_5'Flank	NM_001190787.1	NP_001177716.1	D6RGH6	MCIN_HUMAN	multiciliate differentiation and DNA synthesis associated cell cycle protein	351	Necessary and sufficient for proper nuclear localization.				cell cycle (GO:0007049)|cilium assembly (GO:0042384)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of DNA replication (GO:0006275)|regulation of mitotic cell cycle (GO:0007346)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	identical protein binding (GO:0042802)|transcription coactivator activity (GO:0003713)										GCTGCGGATGCGGGTGCTGAA	0.662																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			FR854393	CCDS54853.1	5q11.2	2013-02-28	2013-02-28	2013-02-28	ENSG00000234602	ENSG00000234602			40050	protein-coding gene	gene with protein product	"""multicilin"""	614086	"""multiciliate cell differentiation 1"""	MCIN		21543332, 22231168	Standard	NM_001190787		Approved	MCI, IDAS	uc021xyp.1	D6RGH6	OTTHUMG00000162600	ENST00000513312.1:c.1052G>A	5.37:g.54516300C>T	ENSP00000426359:p.Arg351His	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JGY3|D6R920|F8KGQ8	Missense_Mutation	SNP	pfam_Geminin_fam	p.R351H	ENST00000513312.1	37	c.1052	CCDS54853.1	5	.	.	.	.	.	.	.	.	.	.	C	15.92	2.974959	0.53720	.	.	ENSG00000234602	ENST00000513312	.	.	.	4.75	2.91	0.33838	.	.	.	.	.	T	0.19046	0.0457	N	0.08118	0	0.21675	N	0.999596	B	0.26195	0.144	B	0.08055	0.003	T	0.15150	-1.0447	8	0.54805	T	0.06	.	10.3045	0.43672	0.0:0.1478:0.7001:0.1521	.	351	D6RGH6	IDAS_HUMAN	H	351	.	ENSP00000426359:R351H	R	-	2	0	RP11-528L24.3	54552057	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.036000	0.57304	0.561000	0.29186	-0.128000	0.14901	CGC	MCIN	-	NULL	ENSG00000234602		0.662	MCIDAS-001	NOVEL	basic|appris_principal|CCDS	protein_coding	MCIN	HGNC	protein_coding	OTTHUMT00000369710.1	49	0.00	0	C	NM_001190787		54516300	54516300	-1	no_errors	ENST00000513312	ensembl	human	novel	69_37n	missense	34	46.88	30	SNP	0.998	T
MICU1	10367	genome.wustl.edu	37	10	74326529	74326529	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr10:74326529G>A	ENST00000361114.5	-	2	119	c.23C>T	c.(22-24)tCt>tTt	p.S8F	MICU1_ENST00000401998.3_Missense_Mutation_p.S8F|MICU1_ENST00000398761.4_Missense_Mutation_p.S8F|MICU1_ENST00000604025.1_5'UTR	NM_001195518.1|NM_006077.3	NP_001182447.1|NP_006068.2	Q9BPX6	MICU1_HUMAN	mitochondrial calcium uptake 1	8					calcium ion import (GO:0070509)|calcium ion transmembrane import into mitochondrion (GO:0036444)|defense response (GO:0006952)|mitochondrial calcium ion homeostasis (GO:0051560)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein homooligomerization (GO:0051260)	calcium channel complex (GO:0034704)|integral component of mitochondrial membrane (GO:0032592)|intracellular (GO:0005622)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|uniplex complex (GO:1990246)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)										TGCCAAAGCAGAAAGTGAGTT	0.463																																						dbGAP											0													59.0	59.0	59.0					10																	74326529		1958	4156	6114	-	-	-	SO:0001583	missense	0			Y17711	CCDS55714.1, CCDS55715.1	10q22.1	2013-01-10	2011-06-23	2011-06-23	ENSG00000107745	ENSG00000107745		"""EF-hand domain containing"""	1530	protein-coding gene	gene with protein product		605084	"""calcium binding atopy-related autoantigen 1"""	CBARA1		9806765, 20693986	Standard	NM_006077		Approved	CALC, EFHA3, FLJ12684	uc001jtb.2	Q9BPX6	OTTHUMG00000018437	ENST00000361114.5:c.23C>T	10.37:g.74326529G>A	ENSP00000354415:p.Ser8Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV96|B3KN20|B4DJH9|B4DPI1|B5MBY3|D3YTJ3|O75785|Q9H9N6|Q9UFX0	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S8F	ENST00000361114.5	37	c.23	CCDS55715.1	10	.	.	.	.	.	.	.	.	.	.	G	16.43	3.121197	0.56613	.	.	ENSG00000107745	ENST00000361114;ENST00000398761;ENST00000401998	T;T;T	0.81078	-1.45;-1.45;-1.45	5.91	5.0	0.66597	.	0.328087	0.33457	N	0.004887	T	0.75309	0.3832	L	0.29908	0.895	0.80722	D	1	P	0.38642	0.641	B	0.41723	0.365	T	0.77590	-0.2531	10	0.62326	D	0.03	.	15.355	0.74421	0.0:0.0:0.8591:0.1409	.	8	Q9BPX6	MICU1_HUMAN	F	8	ENSP00000354415:S8F;ENSP00000381745:S8F;ENSP00000384068:S8F	ENSP00000354415:S8F	S	-	2	0	MICU1	73996535	1.000000	0.71417	0.844000	0.33320	0.989000	0.77384	4.608000	0.61141	1.484000	0.48361	0.655000	0.94253	TCT	MICU1	-	NULL	ENSG00000107745		0.463	MICU1-002	KNOWN	overlapping_uORF|basic|appris_candidate_longest|CCDS	protein_coding	MICU1	HGNC	protein_coding	OTTHUMT00000048586.1	14	0.00	0	G	NM_006077		74326529	74326529	-1	no_errors	ENST00000398761	ensembl	human	known	69_37n	missense	13	40.91	9	SNP	0.995	A
ZNRF2	223082	genome.wustl.edu	37	7	30329454	30329456	+	Intron	DEL	TGT	TGT	-	rs373052300	byFrequency	TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	TGT	TGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:30329454_30329456delTGT	ENST00000323037.4	+	1	1520				MIR550A1_ENST00000385037.1_RNA	NM_147128.3	NP_667339.1	Q8NHG8	ZNRF2_HUMAN	zinc and ring finger 2							cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|endosome (GO:0005768)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|synapse (GO:0045202)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|lung(2)|prostate(1)	5						GTAAGAGCCCTGTTGTTGTAAGA	0.493														60	0.0119808	0.0197	0.0159	5008	,	,		16444	0.0		0.0139	False		,,,				2504	0.0092					dbGAP											0										257,3721		19,219,1751						-0.5	0.0			141	846,6652		32,782,2935	no	intron	ZNRF2	NM_147128.3		51,1001,4686	A1A1,A1R,RR		11.283,6.4605,9.6114				1103,10373				-	-	-	SO:0001627	intron_variant	0			AF513707	CCDS5426.1	7p15.1	2013-01-09			ENSG00000180233	ENSG00000180233		"""RING-type (C3HC4) zinc fingers"""	22316	protein-coding gene	gene with protein product		612061					Standard	NM_147128		Approved	RNF202	uc003tat.3	Q8NHG8	OTTHUMG00000097759	ENST00000323037.4:c.469+4012TGT>-	7.37:g.30329460_30329462delTGT		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000323037.4	37	NULL	CCDS5426.1	7																																																																																			MIR550A1	-	-	ENSG00000207771		0.493	ZNRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR550A1	HGNC	protein_coding	OTTHUMT00000214992.1	62	0.00	0	TGT	NM_147128		30329454	30329456	+1	no_errors	ENST00000385037	ensembl	human	known	69_37n	rna	86	13.86	14	DEL	0.000:0.002:0.010	-
MOB2	81532	genome.wustl.edu	37	11	1492541	1492541	+	Silent	SNP	C	C	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr11:1492541C>A	ENST00000329957.6	-	4	663	c.474G>T	c.(472-474)gtG>gtT	p.V158V	MOB2_ENST00000526462.1_5'UTR	NM_001172223.1	NP_001165694.1	Q70IA6	MOB2_HUMAN	MOB kinase activator 2	127					actin cytoskeleton organization (GO:0030036)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein phosphorylation (GO:0001934)	cytoplasm (GO:0005737)|neuron projection terminus (GO:0044306)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|kidney(2)|lung(1)	4						TTGTGGGGAACACGTCCTCAT	0.587																																						dbGAP											0													104.0	119.0	114.0					11																	1492541		2159	4250	6409	-	-	-	SO:0001819	synonymous_variant	0				CCDS53591.1	11p15.5	2011-09-28			ENSG00000182208	ENSG00000182208		"""MOB kinase activators"""	24904	protein-coding gene	gene with protein product	"""MOB2 Mps One Binder homolog (yeast)"""	611969				11223154, 15067004	Standard	NM_053005		Approved	HCCA2	uc010qwz.2	Q70IA6	OTTHUMG00000165545	ENST00000329957.6:c.474G>T	11.37:g.1492541C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKP3|Q96M67	Silent	SNP	pfam_Mob1_phocein,superfamily_Mob1_phocein	p.V158	ENST00000329957.6	37	c.474	CCDS53591.1	11																																																																																			MOB2	-	pfam_Mob1_phocein,superfamily_Mob1_phocein	ENSG00000182208		0.587	MOB2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MOB2	HGNC	protein_coding	OTTHUMT00000384770.1	87	0.00	0	C	NM_053005		1492541	1492541	-1	no_errors	ENST00000329957	ensembl	human	novel	69_37n	silent	49	26.87	18	SNP	1.000	A
MYO15A	51168	genome.wustl.edu	37	17	18075556	18075556	+	Silent	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr17:18075556C>T	ENST00000205890.5	+	64	10640	c.10302C>T	c.(10300-10302)atC>atT	p.I3434I	MYO15A_ENST00000418233.3_Silent_p.I698I|MYO15A_ENST00000451725.2_Missense_Mutation_p.S228F|RP11-258F1.1_ENST00000577847.1_RNA	NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	3434	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Tail.				inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					CCCCTTGCATCCTTGCCATCA	0.587																																						dbGAP											0													95.0	99.0	98.0					17																	18075556		2117	4224	6341	-	-	-	SO:0001819	synonymous_variant	0			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.10302C>T	17.37:g.18075556C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFC7	Missense_Mutation	SNP	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	p.S228F	ENST00000205890.5	37	c.683	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	C	15.34	2.805845	0.50421	.	.	ENSG00000091536	ENST00000451725	D	0.98120	-4.73	5.81	0.359	0.16088	.	.	.	.	.	D	0.94265	0.8158	.	.	.	0.26946	N	0.96614	B	0.13145	0.007	B	0.09377	0.004	D	0.88249	0.2915	8	0.87932	D	0	.	6.3562	0.21402	0.1199:0.6281:0.0:0.252	.	228	B4DQJ3	.	F	228	ENSP00000409098:S228F	ENSP00000409098:S228F	S	+	2	0	MYO15A	18016281	1.000000	0.71417	0.957000	0.39632	0.851000	0.48451	0.867000	0.27968	-0.110000	0.12022	-0.136000	0.14681	TCC	MYO15A	-	NULL	ENSG00000091536		0.587	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	32	0.00	0	C	NM_016239		18075556	18075556	+1	no_errors	ENST00000451725	ensembl	human	known	69_37n	missense	22	29.03	9	SNP	1.000	T
NDUFV3	4731	genome.wustl.edu	37	21	44324236	44324236	+	Intron	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr21:44324236G>T	ENST00000340344.4	+	3	235				NDUFV3_ENST00000460259.1_3'UTR|NDUFV3_ENST00000354250.2_Nonsense_Mutation_p.E372*	NM_001001503.1	NP_001001503.1	P56181	NDUV3_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 3, 10kDa						cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(2)|skin(1)	10				STAD - Stomach adenocarcinoma(101;0.0606)		GGCAATCGTGGAAGATCAGAT	0.572																																						dbGAP											0													73.0	66.0	68.0					21																	44324236		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS33572.1, CCDS33573.1	21q22.3	2011-07-04	2002-08-29		ENSG00000160194	ENSG00000160194	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7719	protein-coding gene	gene with protein product	"""complex I 10kDa subunit"""	602184	"""NADH dehydrogenase (ubiquinone) flavoprotein 3 (10kD)"""			9344673	Standard	NM_021075		Approved	CI-10k	uc002zcm.3	P56181	OTTHUMG00000086823	ENST00000340344.4:c.170-4738G>T	21.37:g.44324236G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0M1|J3KNX7|Q6FGD3|Q8WU60|Q9HCR5	Nonsense_Mutation	SNP	NULL	p.E372*	ENST00000340344.4	37	c.1114	CCDS33573.1	21	.	.	.	.	.	.	.	.	.	.	G	16.34	3.095638	0.56075	.	.	ENSG00000160194	ENST00000354250	.	.	.	4.13	3.23	0.37069	.	0.270196	0.29707	N	0.011413	.	.	.	.	.	.	0.20196	N	0.999923	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-8.8441	6.8545	0.24032	0.1229:0.0:0.8771:0.0	.	.	.	.	X	372	.	ENSP00000346196:E372X	E	+	1	0	NDUFV3	43197305	0.912000	0.30974	0.057000	0.19452	0.003000	0.03518	2.298000	0.43602	2.234000	0.73211	0.561000	0.74099	GAA	NDUFV3	-	NULL	ENSG00000160194		0.572	NDUFV3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFV3	HGNC	protein_coding	OTTHUMT00000195448.2	51	0.00	0	G			44324236	44324236	+1	no_errors	ENST00000354250	ensembl	human	known	69_37n	nonsense	29	27.50	11	SNP	0.044	T
NEB	4703	genome.wustl.edu	37	2	152506885	152506885	+	Silent	SNP	A	A	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:152506885A>G	ENST00000172853.10	-	54	7383	c.7236T>C	c.(7234-7236)taT>taC	p.Y2412Y	NEB_ENST00000604864.1_Silent_p.Y2412Y|NEB_ENST00000603639.1_Silent_p.Y2412Y|NEB_ENST00000409198.1_Silent_p.Y2412Y|NEB_ENST00000397345.3_Silent_p.Y2412Y|NEB_ENST00000427231.2_Silent_p.Y2412Y			P20929	NEBU_HUMAN	nebulin	2412					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GGTCAGATTTATATAGATTCT	0.428																																						dbGAP											0													64.0	61.0	62.0					2																	152506885		1867	4102	5969	-	-	-	SO:0001819	synonymous_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.7236T>C	2.37:g.152506885A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.Y2412	ENST00000172853.10	37	c.7236		2																																																																																			NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.428	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		33	0.00	0	A	NM_004543		152506885	152506885	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	silent	31	35.42	17	SNP	1.000	G
NHSL2	340527	genome.wustl.edu	37	X	71363117	71363117	+	IGR	SNP	T	T	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chrX:71363117T>A	ENST00000373677.1	+	0	3978				NHSL2_ENST00000540800.1_Missense_Mutation_p.L1124Q			Q5HYW2	NHSL2_HUMAN	NHS-like 2											NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					AAAAGGAAGCTGCTCGGCTGG	0.498																																						dbGAP											0													46.0	41.0	43.0					X																	71363117		692	1591	2283	-	-	-	SO:0001628	intergenic_variant	0					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807		X.37:g.71363117T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN94	Missense_Mutation	SNP	NULL	p.L1124Q	ENST00000373677.1	37	c.3371		X	.	.	.	.	.	.	.	.	.	.	T	20.8	4.048966	0.75846	.	.	ENSG00000204131	ENST00000540800	T	0.35605	1.3	5.91	5.91	0.95273	.	.	.	.	.	T	0.49440	0.1557	L	0.38175	1.15	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	T	0.51309	-0.8722	9	0.72032	D	0.01	.	13.0181	0.58771	0.0:0.0:0.0:1.0	.	1124	F5H593	.	Q	1124	ENSP00000444617:L1124Q	ENSP00000444617:L1124Q	L	+	2	0	NHSL2	71279842	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	7.905000	0.87416	1.982000	0.57802	0.486000	0.48141	CTG	NHSL2	-	NULL	ENSG00000204131		0.498	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	46	0.00	0	T	NM_001013627		71363117	71363117	+1	no_errors	ENST00000540800	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	A
NMBR	4829	genome.wustl.edu	37	6	142399958	142399958	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr6:142399958C>T	ENST00000258042.1	-	2	645	c.505G>A	c.(505-507)Gtg>Atg	p.V169M	NMBR_ENST00000480652.1_5'Flank	NM_002511.2	NP_002502.2	P28336	NMBR_HUMAN	neuromedin B receptor	169					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			breast(2)|central_nervous_system(3)|endometrium(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	23	Breast(32;0.155)			OV - Ovarian serous cystadenocarcinoma(155;9.93e-06)|GBM - Glioblastoma multiforme(68;0.0013)		ACGGAGACCACCCAGATACCC	0.532																																						dbGAP											0													110.0	94.0	100.0					6																	142399958		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5196.1	6q24.1	2014-02-21			ENSG00000135577	ENSG00000135577		"""GPCR / Class A : Bombesin receptors"""	7843	protein-coding gene	gene with protein product	"""bombesin receptor 1"""	162341					Standard	NM_002511		Approved	BB1	uc003qiu.3	P28336	OTTHUMG00000015704	ENST00000258042.1:c.505G>A	6.37:g.142399958C>T	ENSP00000258042:p.Val169Met	Somatic		WXS	Illumina GAIIx	Phase_IV	E9KL38|Q5VUK8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_NeuroB_rcpt,prints_Bombsn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.V169M	ENST00000258042.1	37	c.505	CCDS5196.1	6	.	.	.	.	.	.	.	.	.	.	C	14.20	2.465307	0.43839	.	.	ENSG00000135577	ENST00000258042	T	0.40476	1.03	5.48	4.55	0.56014	GPCR, rhodopsin-like superfamily (1);	0.434403	0.25863	N	0.027802	T	0.34424	0.0897	L	0.60904	1.88	0.46298	D	0.99897	B	0.31290	0.318	P	0.46389	0.515	T	0.31420	-0.9944	10	0.30854	T	0.27	-12.0681	6.8797	0.24166	0.1456:0.7094:0.0:0.145	.	169	P28336	NMBR_HUMAN	M	169	ENSP00000258042:V169M	ENSP00000258042:V169M	V	-	1	0	NMBR	142441651	0.990000	0.36364	0.987000	0.45799	0.371000	0.29859	0.258000	0.18387	2.575000	0.86900	0.585000	0.79938	GTG	NMBR	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000135577		0.532	NMBR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMBR	HGNC	protein_coding	OTTHUMT00000042479.1	38	0.00	0	C			142399958	142399958	-1	no_errors	ENST00000258042	ensembl	human	known	69_37n	missense	19	32.14	9	SNP	0.998	T
NMUR1	10316	genome.wustl.edu	37	2	232393177	232393177	+	Silent	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:232393177G>A	ENST00000305141.4	-	2	688	c.555C>T	c.(553-555)gtC>gtT	p.V185V		NM_006056.4	NP_006047.3	Q9HB89	NMUR1_HUMAN	neuromedin U receptor 1	185					activation of phospholipase C activity (GO:0007202)|calcium ion transport (GO:0006816)|calcium-mediated signaling (GO:0019722)|chloride transport (GO:0006821)|G-protein coupled receptor signaling pathway (GO:0007186)|inositol phosphate-mediated signaling (GO:0048016)|neuropeptide signaling pathway (GO:0007218)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|smooth muscle contraction (GO:0006939)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|neuromedin U receptor activity (GO:0001607)|neuropeptide receptor activity (GO:0008188)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(12)|pancreas(1)|skin(1)	24		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;8.37e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0142)		CAAGACCCCAGACGGCCCCAA	0.677																																						dbGAP											0													35.0	33.0	34.0					2																	232393177		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF044600	CCDS2486.1	2q37.1	2012-08-08	2004-05-27	2004-05-28	ENSG00000171596	ENSG00000171596		"""GPCR / Class A : Neuromedin U receptors"""	4518	protein-coding gene	gene with protein product		604153	"""G protein-coupled receptor 66"""	GPR66		9782091	Standard	NM_006056		Approved	GPC-R, FM-3, NMU1R	uc002vry.4	Q9HB89	OTTHUMG00000133225	ENST00000305141.4:c.555C>T	2.37:g.232393177G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43664|Q7LDP6|Q8NE20	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_NeuromedU_rcpt_1,prints_NeuromedU_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V185	ENST00000305141.4	37	c.555	CCDS2486.1	2																																																																																			NMUR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000171596		0.677	NMUR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMUR1	HGNC	protein_coding	OTTHUMT00000256961.1	56	0.00	0	G	NM_006056		232393177	232393177	-1	no_errors	ENST00000305141	ensembl	human	known	69_37n	silent	26	44.68	21	SNP	0.983	A
NR1D1	9572	genome.wustl.edu	37	17	38253556	38253556	+	Silent	SNP	C	C	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr17:38253556C>A	ENST00000246672.3	-	2	762	c.132G>T	c.(130-132)ctG>ctT	p.L44L		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	44	Modulating.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					AGCCTTGGGTCAGGGACTGGA	0.607																																						dbGAP											0													93.0	96.0	95.0					17																	38253556		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.132G>T	17.37:g.38253556C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P5Z4|Q15304	Silent	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.L44	ENST00000246672.3	37	c.132	CCDS11361.1	17																																																																																			NR1D1	-	NULL	ENSG00000126368		0.607	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D1	HGNC	protein_coding	OTTHUMT00000257135.1	62	0.00	0	C			38253556	38253556	-1	no_errors	ENST00000246672	ensembl	human	known	69_37n	silent	30	40.00	20	SNP	0.994	A
NRCAM	4897	genome.wustl.edu	37	7	107831699	107831699	+	Splice_Site	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:107831699G>A	ENST00000425651.2	-	16	1931	c.1932C>T	c.(1930-1932)taC>taT	p.Y644Y	NRCAM_ENST00000413765.2_Splice_Site_p.Y625Y|NRCAM_ENST00000379028.3_Splice_Site_p.Y644Y|NRCAM_ENST00000379024.4_Splice_Site_p.Y625Y|NRCAM_ENST00000379022.4_Splice_Site_p.Y644Y|NRCAM_ENST00000351718.4_Intron	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	644					angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TTAGTTTACCGTAAACGGGAG	0.318																																						dbGAP											0													59.0	60.0	60.0					7																	107831699		1824	4081	5905	-	-	-	SO:0001630	splice_region_variant	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.1933+1C>T	7.37:g.107831699G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Y644	ENST00000425651.2	37	c.1932	CCDS47686.1	7																																																																																			NRCAM	-	superfamily_Fibronectin_type3	ENSG00000091129		0.318	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	29	0.00	0	G	NM_001037132	Silent	107831699	107831699	-1	no_errors	ENST00000379028	ensembl	human	known	69_37n	silent	7	50.00	7	SNP	1.000	A
OAT	4942	genome.wustl.edu	37	10	126090320	126090320	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr10:126090320C>T	ENST00000368845.5	-	8	1081	c.989G>A	c.(988-990)tGc>tAc	p.C330Y	OAT_ENST00000467675.1_5'UTR|OAT_ENST00000539214.1_Missense_Mutation_p.C192Y	NM_000274.3	NP_000265.1	P04181	OAT_HUMAN	ornithine aminotransferase	330					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|L-proline biosynthetic process (GO:0055129)|protein hexamerization (GO:0034214)|small molecule metabolic process (GO:0044281)|visual perception (GO:0007601)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ornithine-oxo-acid transaminase activity (GO:0004587)|pyridoxal phosphate binding (GO:0030170)			endometrium(2)|large_intestine(1)|lung(2)	5		all_lung(145;0.0271)|Lung NSC(174;0.0436)|Colorectal(57;0.102)|all_neural(114;0.116)			L-Ornithine(DB00129)	GGCCACTCGGCAGCCTAGTGG	0.493																																						dbGAP											0													68.0	55.0	60.0					10																	126090320		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016928	CCDS7639.1, CCDS53586.1	10q26	2014-09-17	2010-01-20		ENSG00000065154	ENSG00000065154	2.6.1.13		8091	protein-coding gene	gene with protein product	"""Ornithine aminotransferase"", ""ornithine aminotransferase precursor"", ""gyrate atrophy"""	613349				1682785	Standard	NM_000274		Approved	HOGA	uc001lhp.3	P04181	OTTHUMG00000019213	ENST00000368845.5:c.989G>A	10.37:g.126090320C>T	ENSP00000357838:p.Cys330Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRF0|Q16068|Q16069|Q68CS0|Q6IAV9|Q9UD03	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_Orn_aminotrans	p.C330Y	ENST00000368845.5	37	c.989	CCDS7639.1	10	.	.	.	.	.	.	.	.	.	.	C	15.07	2.722703	0.48728	.	.	ENSG00000065154	ENST00000539214;ENST00000368845	D;D	0.87491	-2.26;-2.26	4.71	3.81	0.43845	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.086699	0.85682	D	0.000000	D	0.95900	0.8665	H	0.98295	4.195	0.80722	D	1	P	0.51791	0.948	D	0.64877	0.93	D	0.97760	1.0220	10	0.87932	D	0	-16.9452	15.7204	0.77705	0.0:0.8625:0.1375:0.0	.	330	P04181	OAT_HUMAN	Y	192;330	ENSP00000439042:C192Y;ENSP00000357838:C330Y	ENSP00000357838:C330Y	C	-	2	0	OAT	126080310	1.000000	0.71417	1.000000	0.80357	0.111000	0.19643	5.781000	0.68964	1.301000	0.44836	-0.257000	0.10917	TGC	OAT	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_Orn_aminotrans	ENSG00000065154		0.493	OAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAT	HGNC	protein_coding	OTTHUMT00000050863.1	40	0.00	0	C	NM_000274		126090320	126090320	-1	no_errors	ENST00000368845	ensembl	human	known	69_37n	missense	25	39.02	16	SNP	1.000	T
OR2G6	391211	genome.wustl.edu	37	1	248685080	248685080	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:248685080C>T	ENST00000343414.4	+	1	165	c.133C>T	c.(133-135)Ctc>Ttc	p.L45F		NM_001013355.1	NP_001013373.1	Q5TZ20	OR2G6_HUMAN	olfactory receptor, family 2, subfamily G, member 6	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L45I(1)		NS(1)|cervix(1)|endometrium(2)|large_intestine(7)|lung(40)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0156)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GAACACTGCCCTCATACTAGT	0.468																																						dbGAP											1	Substitution - Missense(1)	lung(1)											150.0	130.0	137.0					1																	248685080		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31119.1	1q44	2012-08-09			ENSG00000188558	ENSG00000188558		"""GPCR / Class A : Olfactory receptors"""	27019	protein-coding gene	gene with protein product							Standard	NM_001013355		Approved		uc001ien.1	Q5TZ20	OTTHUMG00000040462	ENST00000343414.4:c.133C>T	1.37:g.248685080C>T	ENSP00000341291:p.Leu45Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP33	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L45F	ENST00000343414.4	37	c.133	CCDS31119.1	1	.	.	.	.	.	.	.	.	.	.	-	6.545	0.468827	0.12461	.	.	ENSG00000188558	ENST00000343414	T	0.00514	6.88	3.83	2.6	0.31112	GPCR, rhodopsin-like superfamily (1);	0.153844	0.29972	U	0.010725	T	0.00580	0.0019	M	0.69185	2.1	0.09310	N	1	B	0.21905	0.062	B	0.18263	0.021	T	0.42207	-0.9465	10	0.87932	D	0	.	9.807	0.40799	0.6707:0.3293:0.0:0.0	.	45	Q5TZ20	OR2G6_HUMAN	F	45	ENSP00000341291:L45F	ENSP00000341291:L45F	L	+	1	0	OR2G6	246751703	0.004000	0.15560	0.887000	0.34795	0.147000	0.21601	0.089000	0.15002	0.535000	0.28714	-0.736000	0.03550	CTC	OR2G6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000188558		0.468	OR2G6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2G6	HGNC	protein_coding	OTTHUMT00000097358.1	40	0.00	0	C	XM_372842		248685080	248685080	+1	no_errors	ENST00000343414	ensembl	human	known	69_37n	missense	26	32.50	13	SNP	0.106	T
OR4C13	283092	genome.wustl.edu	37	11	49974581	49974581	+	Missense_Mutation	SNP	T	T	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr11:49974581T>C	ENST00000555099.1	+	1	639	c.607T>C	c.(607-609)Ttc>Ctc	p.F203L		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						CAACAGTGGGTTCATATGCCT	0.463																																						dbGAP											0													203.0	170.0	181.0					11																	49974581		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.607T>C	11.37:g.49974581T>C	ENSP00000452277:p.Phe203Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F203L	ENST00000555099.1	37	c.607	CCDS31495.1	11	.	.	.	.	.	.	.	.	.	.	.	0.225	-1.025822	0.02045	.	.	ENSG00000258817	ENST00000555099	T	0.34667	1.35	2.7	-0.0148	0.13979	GPCR, rhodopsin-like superfamily (1);	0.135912	0.33959	N	0.004397	T	0.13286	0.0322	N	0.12527	0.23	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.08351	-1.0726	9	.	.	.	.	0.3271	0.00312	0.2195:0.1481:0.2245:0.4079	.	203	Q8NGP0	OR4CD_HUMAN	L	203	ENSP00000452277:F203L	.	F	+	1	0	OR4C13	49931157	0.001000	0.12720	0.832000	0.32986	0.337000	0.28794	0.005000	0.13129	0.289000	0.22422	0.156000	0.16432	TTC	OR4C13	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000258817		0.463	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C13	HGNC	protein_coding	OTTHUMT00000391103.1	87	0.00	0	T	NM_001001955		49974581	49974581	+1	no_errors	ENST00000555099	ensembl	human	known	69_37n	missense	66	38.89	42	SNP	0.012	C
OTOF	9381	genome.wustl.edu	37	2	26695482	26695482	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:26695482C>G	ENST00000272371.2	-	30	3895	c.3769G>C	c.(3769-3771)Ggg>Cgg	p.G1257R	OTOF_ENST00000339598.3_Intron|OTOF_ENST00000402415.3_Missense_Mutation_p.G567R|OTOF_ENST00000403946.3_Missense_Mutation_p.G1257R|OTOF_ENST00000338581.6_Intron	NM_194248.2	NP_919224.1	Q9HC10	OTOF_HUMAN	otoferlin	1257					membrane fusion (GO:0061025)|sensory perception of sound (GO:0007605)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	calcium ion binding (GO:0005509)	p.G567W(1)|p.G1257W(1)		NS(1)|autonomic_ganglia(1)|breast(9)|central_nervous_system(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(35)|ovary(8)|pancreas(1)|prostate(5)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	106	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAGGAGCCCCCATTGCACAGC	0.577																																					GBM(102;732 1451 20652 24062 31372)	dbGAP											2	Substitution - Missense(2)	lung(2)											59.0	50.0	53.0					2																	26695482		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF107403	CCDS1724.1, CCDS1725.1, CCDS1726.1, CCDS46241.1, CCDS74497.1	2p23.1	2014-06-27			ENSG00000115155	ENSG00000115155			8515	protein-coding gene	gene with protein product	"""fer-1-like family member 2"""	603681		DFNB9		10192385, 18381613	Standard	NM_194248		Approved	FER1L2, DFNB6	uc002rhk.3	Q9HC10	OTTHUMG00000096977	ENST00000272371.2:c.3769G>C	2.37:g.26695482C>G	ENSP00000272371:p.Gly1257Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJX0|B5MCC1|B9A0H6|Q53R90|Q9HC08|Q9HC09|Q9Y650	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.G1257R	ENST00000272371.2	37	c.3769	CCDS1725.1	2	.	.	.	.	.	.	.	.	.	.	C	14.09	2.430434	0.43122	.	.	ENSG00000115155	ENST00000402415;ENST00000272371;ENST00000403946	T;T;T	0.79940	-1.04;-1.32;-1.32	4.93	4.93	0.64822	C2 calcium/lipid-binding domain, CaLB (1);	0.464051	0.23378	N	0.048832	D	0.88433	0.6435	M	0.67953	2.075	0.58432	D	0.999998	D;B	0.89917	1.0;0.001	D;B	0.91635	0.999;0.004	D	0.88126	0.2835	9	.	.	.	-24.9528	16.7288	0.85430	0.0:1.0:0.0:0.0	.	1257;567	Q9HC10;Q9HC10-3	OTOF_HUMAN;.	R	567;1257;1257	ENSP00000383906:G567R;ENSP00000272371:G1257R;ENSP00000385255:G1257R	.	G	-	1	0	OTOF	26548986	1.000000	0.71417	1.000000	0.80357	0.643000	0.38383	2.287000	0.43505	2.295000	0.77249	0.561000	0.74099	GGG	OTOF	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000115155		0.577	OTOF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OTOF	HGNC	protein_coding	OTTHUMT00000214047.3	28	0.00	0	C			26695482	26695482	-1	no_errors	ENST00000272371	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	1.000	G
PCMTD1	115294	genome.wustl.edu	37	8	52733164	52733164	+	Missense_Mutation	SNP	G	G	C	rs149898988		TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr8:52733164G>C	ENST00000360540.5	-	7	1227	c.821C>G	c.(820-822)cCc>cGc	p.P274R	PCMTD1_ENST00000544451.1_Missense_Mutation_p.P198R|PCMTD1_ENST00000519559.1_5'UTR|PCMTD1_ENST00000522514.1_Missense_Mutation_p.P274R	NM_052937.2	NP_443169.2	Q96MG8	PCMD1_HUMAN	protein-L-isoaspartate (D-aspartate) O-methyltransferase domain containing 1	274						cytoplasm (GO:0005737)	protein-L-isoaspartate (D-aspartate) O-methyltransferase activity (GO:0004719)			NS(2)|endometrium(1)|kidney(3)|large_intestine(3)|lung(17)|prostate(2)|skin(8)|soft_tissue(1)	37		Lung NSC(129;0.0795)|all_lung(136;0.144)				TTTCCTTTTGGGTGGAGCCCT	0.408																																						dbGAP											0													130.0	136.0	134.0					8																	52733164		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6148.1, CCDS69480.1	8q11.23	2010-08-05			ENSG00000168300	ENSG00000168300			30483	protein-coding gene	gene with protein product							Standard	XM_005251146		Approved	FLJ10883	uc003xqx.4	Q96MG8	OTTHUMG00000164246	ENST00000360540.5:c.821C>G	8.37:g.52733164G>C	ENSP00000353739:p.Pro274Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96FK9	Missense_Mutation	SNP	pfam_PCMT	p.P274R	ENST00000360540.5	37	c.821	CCDS6148.1	8	.	.	.	.	.	.	.	.	.	.	G	11.62	1.691913	0.30052	.	.	ENSG00000168300	ENST00000360540;ENST00000544451;ENST00000522514	T;T;T	0.48201	0.82;0.82;0.82	5.97	5.97	0.96955	.	0.058223	0.64402	D	0.000001	T	0.61652	0.2364	L	0.55990	1.75	0.58432	D	0.999998	P;D;P	0.89917	0.875;1.0;0.855	B;D;P	0.74674	0.307;0.984;0.448	T	0.52646	-0.8548	10	0.02654	T	1	-6.8456	20.4238	0.99064	0.0:0.0:1.0:0.0	.	144;198;274	B4E2B4;F5H1M8;Q96MG8	.;.;PCMD1_HUMAN	R	274;198;274	ENSP00000353739:P274R;ENSP00000444026:P198R;ENSP00000428099:P274R	ENSP00000353739:P274R	P	-	2	0	PCMTD1	52895717	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.412000	0.66392	2.828000	0.97474	0.655000	0.94253	CCC	PCMTD1	-	NULL	ENSG00000168300		0.408	PCMTD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PCMTD1	HGNC	protein_coding	OTTHUMT00000377909.2	111	0.89	1	G	NM_052937		52733164	52733164	-1	no_errors	ENST00000360540	ensembl	human	known	69_37n	missense	97	10.19	11	SNP	1.000	C
PDZD2	23037	genome.wustl.edu	37	5	32089647	32089647	+	Silent	SNP	T	T	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:32089647T>G	ENST00000438447.1	+	20	6481	c.6093T>G	c.(6091-6093)gcT>gcG	p.A2031A	PDZD2_ENST00000282493.3_Silent_p.A2031A			O15018	PDZD2_HUMAN	PDZ domain containing 2	2031					cell adhesion (GO:0007155)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)				NS(2)|breast(4)|central_nervous_system(5)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(31)|lung(58)|ovary(6)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	148						CGCCCCGTGCTGACTCCGGGC	0.637																																						dbGAP											0													125.0	138.0	134.0					5																	32089647		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002298	CCDS34137.1	5p14.1	2008-02-05	2006-01-24	2006-01-24		ENSG00000133401			18486	protein-coding gene	gene with protein product		610697	"""PDZ domain containing 3"""	PDZK3		9205841	Standard	XM_005248271		Approved	KIAA0300	uc003jhm.3	O15018		ENST00000438447.1:c.6093T>G	5.37:g.32089647T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXD4	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.A2031	ENST00000438447.1	37	c.6093	CCDS34137.1	5																																																																																			PDZD2	-	NULL	ENSG00000133401		0.637	PDZD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD2	HGNC	protein_coding	OTTHUMT00000366608.1	23	0.00	0	T			32089647	32089647	+1	no_errors	ENST00000282493	ensembl	human	known	69_37n	silent	17	29.17	7	SNP	0.000	G
PKHD1L1	93035	genome.wustl.edu	37	8	110491846	110491846	+	Silent	SNP	G	G	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr8:110491846G>C	ENST00000378402.5	+	54	9260	c.9156G>C	c.(9154-9156)ggG>ggC	p.G3052G		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3052	G8 2. {ECO:0000255|PROSITE- ProRule:PRU00817}.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTCACCCAGGGGCAAATGTGA	0.343										HNSCC(38;0.096)																												dbGAP											0													98.0	87.0	90.0					8																	110491846		1855	4085	5940	-	-	-	SO:0001819	synonymous_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9156G>C	8.37:g.110491846G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.G3052	ENST00000378402.5	37	c.9156	CCDS47911.1	8																																																																																			PKHD1L1	-	pfam_G8_domain	ENSG00000205038		0.343	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	39	0.00	0	G	NM_177531		110491846	110491846	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	silent	46	26.98	17	SNP	1.000	C
PON3	5446	genome.wustl.edu	37	7	94991698	94991698	+	Missense_Mutation	SNP	G	G	C	rs201950740		TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:94991698G>C	ENST00000265627.5	-	8	892	c.882C>G	c.(880-882)aaC>aaG	p.N294K	PON3_ENST00000427422.1_Intron|PON3_ENST00000451904.1_3'UTR|PON1_ENST00000542556.1_Intron	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	294					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	GGTCCTCAGGGTTATAGTTCA	0.463																																						dbGAP											0													86.0	83.0	84.0					7																	94991698		2203	4300	6503	-	-	-	SO:0001583	missense	0			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.882C>G	7.37:g.94991698G>C	ENSP00000265627:p.Asn294Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase2	p.N294K	ENST00000265627.5	37	c.882	CCDS5639.1	7	.	.	.	.	.	.	.	.	.	.	G	14.22	2.469387	0.43839	.	.	ENSG00000105852	ENST00000265627	T	0.49139	0.79	4.98	3.18	0.36537	Six-bladed beta-propeller, TolB-like (1);	0.139336	0.64402	D	0.000004	T	0.54822	0.1882	M	0.78637	2.42	0.80722	D	1	P	0.47409	0.895	P	0.50860	0.652	T	0.56980	-0.7889	10	0.87932	D	0	-13.1868	6.5525	0.22442	0.3856:0.0:0.6144:0.0	.	294	Q15166	PON3_HUMAN	K	294	ENSP00000265627:N294K	ENSP00000265627:N294K	N	-	3	2	PON3	94829634	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	1.505000	0.35736	0.819000	0.34492	-0.145000	0.13849	AAC	PON3	-	pfam_SGL,prints_Paraoxonase2	ENSG00000105852		0.463	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PON3	HGNC	protein_coding	OTTHUMT00000333007.1	41	0.00	0	G	NM_000940		94991698	94991698	-1	no_errors	ENST00000265627	ensembl	human	known	69_37n	missense	9	55.00	11	SNP	1.000	C
PRAM1	84106	genome.wustl.edu	37	19	8564204	8564204	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr19:8564204G>A	ENST00000423345.4	-	2	1008	c.488C>T	c.(487-489)cCg>cTg	p.P163L	PRAM1_ENST00000255612.3_Missense_Mutation_p.P163L			Q96QH2	PRAM_HUMAN	PML-RARA regulated adaptor molecule 1	211	8 X 12 AA repeats of K-P-P-[PQ]-P-[EQ]- [VAF]-T-D-L-P-K.|Pro-rich.				integrin-mediated signaling pathway (GO:0007229)|regulation of neutrophil degranulation (GO:0043313)		lipid binding (GO:0008289)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(1)|skin(1)	19						TTTCCGGGCCGGCGCACCAGG	0.677																																						dbGAP											0													12.0	14.0	13.0					19																	8564204		1896	4040	5936	-	-	-	SO:0001583	missense	0			BC028012	CCDS45954.1, CCDS45954.2	19p13.2	2009-01-21				ENSG00000133246			30091	protein-coding gene	gene with protein product		606466				11301322, 15572693	Standard	NM_032152		Approved	PML-RAR	uc002mkd.3	Q96QH2		ENST00000423345.4:c.488C>T	19.37:g.8564204G>A	ENSP00000408342:p.Pro163Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6W7	Missense_Mutation	SNP	superfamily_SH3_domain	p.P163L	ENST00000423345.4	37	c.488	CCDS45954.2	19	.	.	.	.	.	.	.	.	.	.	G	1.747	-0.490286	0.04322	.	.	ENSG00000133246	ENST00000255612;ENST00000423345	T;T	0.13196	2.61;2.61	3.36	-1.86	0.07760	.	3.446800	0.00945	N	0.002887	T	0.05914	0.0154	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.001;0.002	T	0.23048	-1.0199	10	0.07990	T	0.79	.	3.4369	0.07449	0.3667:0.0:0.4297:0.2036	.	163;211	Q96QH2-2;Q96QH2	.;PRAM_HUMAN	L	163	ENSP00000255612:P163L;ENSP00000408342:P163L	ENSP00000255612:P163L	P	-	2	0	PRAM1	8470204	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.417000	0.02464	-0.615000	0.05679	-0.469000	0.05056	CCG	PRAM1	-	NULL	ENSG00000133246		0.677	PRAM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRAM1	HGNC	protein_coding	OTTHUMT00000397040.3	24	0.00	0	G	NM_032152		8564204	8564204	-1	no_errors	ENST00000423345	ensembl	human	known	69_37n	missense	31	32.61	15	SNP	0.000	A
PRKG1	5592	genome.wustl.edu	37	10	54048489	54048489	+	Silent	SNP	A	A	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr10:54048489A>G	ENST00000401604.2	+	15	1862	c.1668A>G	c.(1666-1668)ccA>ccG	p.P556P	PRKG1_ENST00000373975.2_Silent_p.P274P|PRKG1_ENST00000373980.4_Silent_p.P571P|PRKG1-AS1_ENST00000452247.2_RNA|PRKG1-AS1_ENST00000426785.2_RNA|PRKG1_ENST00000373985.1_Silent_p.P544P			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	556	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		CTTGCAGCCCACCTTTCTCAG	0.363																																						dbGAP											0													116.0	120.0	119.0					10																	54048489		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.1668A>G	10.37:g.54048489A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Silent	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom	p.P571	ENST00000401604.2	37	c.1713	CCDS44399.1	10																																																																																			PRKG1	-	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000185532		0.363	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		37	0.00	0	A			54048489	54048489	+1	no_errors	ENST00000373980	ensembl	human	known	69_37n	silent	15	51.61	16	SNP	0.959	G
PRUNE2	158471	genome.wustl.edu	37	9	79229449	79229449	+	3'UTR	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr9:79229449G>A	ENST00000376718.3	-	0	9427				PRUNE2_ENST00000466266.2_Intron|PRUNE2_ENST00000443509.2_3'UTR|PRUNE2_ENST00000428286.1_3'UTR	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)						apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						ACAGAACCATGAACCAGAAAA	0.398																																						dbGAP											0													100.0	88.0	91.0					9																	79229449		1568	3582	5150	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.*37C>T	9.37:g.79229449G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	RNA	SNP	-	NULL	ENST00000376718.3	37	NULL	CCDS47982.1	9																																																																																			PRUNE2	-	-	ENSG00000106772		0.398	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	21	0.00	0	G	NM_138818		79229449	79229449	-1	no_errors	ENST00000464414	ensembl	human	known	69_37n	rna	12	40.00	8	SNP	0.002	A
PTPN23	25930	genome.wustl.edu	37	3	47449250	47449250	+	Missense_Mutation	SNP	T	T	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr3:47449250T>C	ENST00000265562.4	+	13	1144	c.1067T>C	c.(1066-1068)aTc>aCc	p.I356T	PTPN23_ENST00000431726.1_Missense_Mutation_p.I230T	NM_015466.2	NP_056281.1	Q9H3S7	PTN23_HUMAN	protein tyrosine phosphatase, non-receptor type 23	356	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.				cilium morphogenesis (GO:0060271)|negative regulation of epithelial cell migration (GO:0010633)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of adherens junction organization (GO:1903393)|positive regulation of early endosome to late endosome transport (GO:2000643)|positive regulation of homophilic cell adhesion (GO:1903387)|protein transport (GO:0015031)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|central_nervous_system(1)|large_intestine(5)|lung(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.000271)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		GGCCCTGACATCTTTGCCAAA	0.617																																						dbGAP											0													101.0	101.0	101.0					3																	47449250		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB025194	CCDS2754.1	3p21.3	2011-06-09			ENSG00000076201	ENSG00000076201		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	14406	protein-coding gene	gene with protein product		606584				11095967	Standard	NM_015466		Approved	DKFZP564F0923, KIAA1471, HD-PTP	uc003crf.1	Q9H3S7	OTTHUMG00000133520	ENST00000265562.4:c.1067T>C	3.37:g.47449250T>C	ENSP00000265562:p.Ile356Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0D7|Q7KZF8|Q8N6Z5|Q9BSR5|Q9P257|Q9UG03|Q9UMZ4	Missense_Mutation	SNP	pfam_BRO1_dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_BRO1_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.I356T	ENST00000265562.4	37	c.1067	CCDS2754.1	3	.	.	.	.	.	.	.	.	.	.	T	24.5	4.538642	0.85917	.	.	ENSG00000076201	ENST00000456408;ENST00000265562	T	0.18960	2.18	5.09	5.09	0.68999	BRO1 domain (3);	0.070486	0.56097	D	0.000029	T	0.50888	0.1642	M	0.87758	2.905	0.80722	D	1	P;D	0.57899	0.754;0.981	D;D	0.70935	0.971;0.948	T	0.59484	-0.7446	10	0.87932	D	0	-23.6387	13.9978	0.64414	0.0:0.0:0.0:1.0	.	230;356	B4DST5;Q9H3S7	.;PTN23_HUMAN	T	321;356	ENSP00000265562:I356T	ENSP00000265562:I356T	I	+	2	0	PTPN23	47424254	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.966000	0.70395	2.129000	0.65627	0.533000	0.62120	ATC	PTPN23	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000076201		0.617	PTPN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN23	HGNC	protein_coding	OTTHUMT00000257492.2	49	0.00	0	T	NM_015466		47449250	47449250	+1	no_errors	ENST00000265562	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	C
PYGM	5837	genome.wustl.edu	37	11	64519463	64519463	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr11:64519463C>G	ENST00000164139.3	-	14	2099	c.1701G>C	c.(1699-1701)caG>caC	p.Q567H	PYGM_ENST00000462303.1_5'UTR|PYGM_ENST00000377432.3_Missense_Mutation_p.Q479H	NM_005609.2	NP_005600.1	P11217	PYGM_HUMAN	phosphorylase, glycogen, muscle	567					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	glycogen phosphorylase activity (GO:0008184)|nucleotide binding (GO:0000166)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(21)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						TCCGCTTCACCTGGATGTCGA	0.507																																						dbGAP											0													219.0	185.0	197.0					11																	64519463		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8079.1, CCDS53659.1	11q12-q13.2	2013-03-01	2008-07-31		ENSG00000068976	ENSG00000068976	2.4.1.1	"""Glycogen phosphorylases"""	9726	protein-coding gene	gene with protein product	"""McArdle syndrome"", ""glycogen storage disease type V"", ""glycogen phosphorylase, muscle form"""	608455	"""phosphorylase, glycogen; muscle"""				Standard	NM_005609		Approved		uc001oax.4	P11217	OTTHUMG00000066835	ENST00000164139.3:c.1701G>C	11.37:g.64519463C>G	ENSP00000164139:p.Gln567His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVK1|A6NDY6	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.Q567H	ENST00000164139.3	37	c.1701	CCDS8079.1	11	.	.	.	.	.	.	.	.	.	.	C	11.21	1.570153	0.28003	.	.	ENSG00000068976	ENST00000377432;ENST00000164139;ENST00000540450	D;D	0.94280	-3.39;-3.31	5.71	4.79	0.61399	.	0.000000	0.53938	D	0.000052	D	0.89649	0.6776	L	0.52011	1.625	0.52099	D	0.999948	B;B	0.19445	0.005;0.036	B;B	0.22152	0.02;0.038	D	0.85271	0.1056	10	0.41790	T	0.15	-33.8622	7.8095	0.29221	0.1598:0.7577:0.0:0.0826	.	479;567	A6NDY6;P11217	.;PYGM_HUMAN	H	479;567;548	ENSP00000366650:Q479H;ENSP00000164139:Q567H	ENSP00000164139:Q567H	Q	-	3	2	PYGM	64276039	0.969000	0.33509	1.000000	0.80357	0.991000	0.79684	0.201000	0.17276	1.394000	0.46624	0.561000	0.74099	CAG	PYGM	-	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000068976		0.507	PYGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGM	HGNC	protein_coding	OTTHUMT00000143254.2	97	0.00	0	C	NM_005609		64519463	64519463	-1	no_errors	ENST00000164139	ensembl	human	known	69_37n	missense	61	35.79	34	SNP	1.000	G
RBM27	54439	genome.wustl.edu	37	5	145651128	145651128	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr5:145651128G>T	ENST00000265271.5	+	19	3045	c.2879G>T	c.(2878-2880)gGa>gTa	p.G960V	RBM27_ENST00000506502.1_Missense_Mutation_p.G905V	NM_018989.1	NP_061862.1	Q9P2N5	RBM27_HUMAN	RNA binding motif protein 27	960					mRNA processing (GO:0006397)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(2)|breast(1)|central_nervous_system(3)|endometrium(4)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGGCGTGGAGGAAGAGGAAGG	0.493																																						dbGAP											0													154.0	151.0	152.0					5																	145651128		1568	3582	5150	-	-	-	SO:0001583	missense	0			AL833706	CCDS43378.1	5q32	2013-01-09				ENSG00000091009		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	29243	protein-coding gene	gene with protein product	"""acidic rich RS domain containing 1"""					10718198, 15741184	Standard	NM_018989		Approved	KIAA1311, ARRS1, Psc1, ZC3H18	uc003lnz.4	Q9P2N5		ENST00000265271.5:c.2879G>T	5.37:g.145651128G>T	ENSP00000265271:p.Gly960Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYW9	Missense_Mutation	SNP	pfam_PWI,pfam_Znf_CCCH,smart_RRM_dom,pfscan_RRM_dom	p.G960V	ENST00000265271.5	37	c.2879	CCDS43378.1	5	.	.	.	.	.	.	.	.	.	.	G	13.90	2.373931	0.42105	.	.	ENSG00000091009	ENST00000265271	T	0.54279	0.58	5.04	4.11	0.48088	.	0.290298	0.28718	N	0.014376	T	0.52175	0.1718	M	0.76328	2.33	0.80722	D	1	B	0.13594	0.008	B	0.12156	0.007	T	0.50783	-0.8787	10	0.21014	T	0.42	-12.791	15.2726	0.73717	0.0:0.2531:0.7469:0.0	.	960	Q9P2N5	RBM27_HUMAN	V	960	ENSP00000265271:G960V	ENSP00000265271:G960V	G	+	2	0	RBM27	145631321	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.190000	0.50973	2.517000	0.84864	0.650000	0.86243	GGA	RBM27	-	NULL	ENSG00000091009		0.493	RBM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM27	HGNC	protein_coding	OTTHUMT00000373420.1	42	0.00	0	G	XM_291128		145651128	145651128	+1	no_errors	ENST00000265271	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.903	T
RBMS3	27303	genome.wustl.edu	37	3	29476234	29476234	+	Splice_Site	SNP	C	C	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr3:29476234C>A	ENST00000383767.2	+	2	412	c.76C>A	c.(76-78)Cag>Aag	p.Q26K	RBMS3_ENST00000396583.3_Splice_Site_p.Q26K|RBMS3_ENST00000383766.2_Intron|RBMS3_ENST00000445033.1_Splice_Site_p.Q26K|RBMS3_ENST00000434693.2_Intron|RBMS3_ENST00000452462.1_Splice_Site_p.Q26K|RBMS3_ENST00000456853.1_Splice_Site_p.Q26K|RBMS3_ENST00000273139.9_Splice_Site_p.Q26K			Q6XE24	RBMS3_HUMAN	RNA binding motif, single stranded interacting protein 3	26					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|large_intestine(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	11		Ovarian(412;0.0956)				CTGTTTCCAGCAGTCCTATGC	0.517																																						dbGAP											0													115.0	107.0	110.0					3																	29476234		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF023259	CCDS33724.1, CCDS33725.1, CCDS33726.1, CCDS54557.1, CCDS54558.1	3p24-p23	2013-02-12	2010-04-20		ENSG00000144642	ENSG00000144642		"""RNA binding motif (RRM) containing"""	13427	protein-coding gene	gene with protein product	"""RNA-binding protein"""	605786	"""RNA binding motif, single stranded interacting protein"""			10675610	Standard	NM_001003793		Approved		uc003cel.3	Q6XE24	OTTHUMG00000155699	ENST00000383767.2:c.76-1C>A	3.37:g.29476234C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S4|B7ZL17|G5E9J9|O75876|Q17RI0|Q6XE23	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,prints_Hud_Sxl_RNA,pfscan_RRM_dom	p.Q26K	ENST00000383767.2	37	c.76	CCDS33724.1	3	.	.	.	.	.	.	.	.	.	.	C	23.5	4.418822	0.83559	.	.	ENSG00000144642	ENST00000396583;ENST00000383767;ENST00000445033;ENST00000273139;ENST00000452462;ENST00000456853	T;T;T;T;T;T	0.35789	1.64;1.29;1.29;1.29;1.29;1.64	5.49	5.49	0.81192	.	0.566618	0.16176	N	0.226049	T	0.47764	0.1463	L	0.31420	0.93	0.53005	D	0.99996	P;B;B	0.43578	0.811;0.058;0.034	P;B;B	0.57846	0.828;0.022;0.01	T	0.20405	-1.0276	9	.	.	.	.	19.3665	0.94464	0.0:1.0:0.0:0.0	.	26;26;26	G5E9J9;Q6XE24-2;Q6XE24	.;.;RBMS3_HUMAN	K	26	ENSP00000379828:Q26K;ENSP00000373277:Q26K;ENSP00000391934:Q26K;ENSP00000273139:Q26K;ENSP00000397926:Q26K;ENSP00000400519:Q26K	.	Q	+	1	0	RBMS3	29451238	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.814000	0.86154	2.583000	0.87209	0.561000	0.74099	CAG	RBMS3	-	NULL	ENSG00000144642		0.517	RBMS3-001	KNOWN	basic|CCDS	protein_coding	RBMS3	HGNC	protein_coding	OTTHUMT00000341306.1	42	0.00	0	C	NM_001003792	Missense_Mutation	29476234	29476234	+1	no_errors	ENST00000383767	ensembl	human	known	69_37n	missense	53	34.57	28	SNP	1.000	A
RDH13	112724	genome.wustl.edu	37	19	55558755	55558755	+	Splice_Site	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr19:55558755C>T	ENST00000415061.3	-	6	903	c.760G>A	c.(760-762)Ggg>Agg	p.G254R	CTC-550B14.6_ENST00000585492.1_RNA|CTC-550B14.7_ENST00000593060.1_RNA|RDH13_ENST00000396247.3_Splice_Site_p.G183R	NM_001145971.1	NP_001139443.1	Q8NBN7	RDH13_HUMAN	retinol dehydrogenase 13 (all-trans/9-cis)	254					eye photoreceptor cell development (GO:0042462)|response to high light intensity (GO:0009644)|retina layer formation (GO:0010842)	mitochondrion (GO:0005739)	oxidoreductase activity (GO:0016491)			endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	12			BRCA - Breast invasive adenocarcinoma(297;0.199)	GBM - Glioblastoma multiforme(193;0.0504)	Vitamin A(DB00162)	GGGGACTCACCGAGTGTGGTG	0.677																																						dbGAP											0													58.0	73.0	68.0					19																	55558755		2080	4212	6292	-	-	-	SO:0001630	splice_region_variant	0				CCDS42627.1, CCDS54320.1	19q13.42	2011-09-14	2006-05-09			ENSG00000160439	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	19978	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 3"""		"""retinol dehydrogenase 13 (all-trans and 9-cis)"""			12226107, 19027726	Standard	NM_138412		Approved	SDR7C3	uc002qio.3	Q8NBN7		ENST00000415061.3:c.760+1G>A	19.37:g.55558755C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX79|Q96G88	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.G254R	ENST00000415061.3	37	c.760	CCDS54320.1	19	.	.	.	.	.	.	.	.	.	.	C	9.759	1.169478	0.21621	.	.	ENSG00000160439	ENST00000415061;ENST00000396247	D;D	0.94576	-3.46;-3.46	4.8	4.8	0.61643	NAD(P)-binding domain (1);	0.198272	0.45361	D	0.000362	D	0.88448	0.6439	N	0.20328	0.56	0.39146	D	0.962144	B	0.22541	0.071	B	0.10450	0.005	D	0.85257	0.1048	10	0.15499	T	0.54	.	15.7825	0.78272	0.0:1.0:0.0:0.0	.	254	Q8NBN7	RDH13_HUMAN	R	254;183	ENSP00000391121:G254R;ENSP00000379547:G183R	ENSP00000379547:G183R	G	-	1	0	RDH13	60250567	0.979000	0.34478	0.975000	0.42487	0.837000	0.47467	2.256000	0.43231	2.402000	0.81655	0.456000	0.33151	GGG	RDH13	-	NULL	ENSG00000160439		0.677	RDH13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RDH13	HGNC	protein_coding	OTTHUMT00000451470.1	73	0.00	0	C	NM_138412	Missense_Mutation	55558755	55558755	-1	no_errors	ENST00000415061	ensembl	human	known	69_37n	missense	66	31.25	30	SNP	0.994	T
RNF17	56163	genome.wustl.edu	37	13	25418854	25418854	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr13:25418854G>A	ENST00000255324.5	+	21	2948	c.2896G>A	c.(2896-2898)Gat>Aat	p.D966N	RNF17_ENST00000339524.3_Missense_Mutation_p.D18N|RNF17_ENST00000381921.1_Missense_Mutation_p.D966N	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	966	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		ATGGGAAAATGATATGCACTG	0.343																																						dbGAP											0													109.0	113.0	112.0					13																	25418854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2896G>A	13.37:g.25418854G>A	ENSP00000255324:p.Asp966Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.D966N	ENST00000255324.5	37	c.2896	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	G	11.75	1.733087	0.30684	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120;ENST00000339524	T;T;T;T	0.11385	2.78;2.78;2.78;2.78	4.8	3.86	0.44501	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.208186	0.33534	N	0.004814	T	0.05868	0.0153	N	0.08118	0	0.80722	D	1	B;B;B;B	0.21606	0.058;0.058;0.01;0.033	B;B;B;B	0.28465	0.055;0.09;0.012;0.067	T	0.39881	-0.9592	10	0.26408	T	0.33	-11.1724	9.7866	0.40679	0.1107:0.0:0.8893:0.0	.	966;18;966;966	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	N	966;966;825;290;18	ENSP00000255324:D966N;ENSP00000371346:D966N;ENSP00000388892:D290N;ENSP00000344776:D18N	ENSP00000255324:D966N	D	+	1	0	RNF17	24316854	0.989000	0.36119	1.000000	0.80357	0.995000	0.86356	2.217000	0.42880	2.484000	0.83849	0.591000	0.81541	GAT	RNF17	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000132972		0.343	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	26	0.00	0	G	NM_031994		25418854	25418854	+1	no_errors	ENST00000255324	ensembl	human	known	69_37n	missense	20	23.08	6	SNP	1.000	A
RNF17	56163	genome.wustl.edu	37	13	25418881	25418881	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr13:25418881G>C	ENST00000255324.5	+	21	2975	c.2923G>C	c.(2923-2925)Gat>Cat	p.D975H	RNF17_ENST00000339524.3_Missense_Mutation_p.D27H|RNF17_ENST00000381921.1_Missense_Mutation_p.D975H	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	975	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TAAGATCCAAGATAAAAATCA	0.358																																						dbGAP											0													108.0	110.0	109.0					13																	25418881		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2923G>C	13.37:g.25418881G>C	ENSP00000255324:p.Asp975His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.D975H	ENST00000255324.5	37	c.2923	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	G	17.65	3.442726	0.63067	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120;ENST00000339524	T;T;T;T	0.09630	2.96;2.96;2.96;2.96	4.8	4.8	0.61643	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.510052	0.18628	N	0.135670	T	0.18964	0.0455	N	0.19112	0.55	0.80722	D	1	D;D;P;D	0.71674	0.998;0.992;0.828;0.997	D;P;P;D	0.68943	0.961;0.866;0.646;0.936	T	0.02991	-1.1085	10	0.54805	T	0.06	-7.5304	14.8511	0.70297	0.0:0.0:1.0:0.0	.	975;27;975;975	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	H	975;975;834;299;27	ENSP00000255324:D975H;ENSP00000371346:D975H;ENSP00000388892:D299H;ENSP00000344776:D27H	ENSP00000255324:D975H	D	+	1	0	RNF17	24316881	0.992000	0.36948	0.998000	0.56505	0.985000	0.73830	3.112000	0.50368	2.484000	0.83849	0.591000	0.81541	GAT	RNF17	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000132972		0.358	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	34	0.00	0	G	NM_031994		25418881	25418881	+1	no_errors	ENST00000255324	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.988	C
RNF17	56163	genome.wustl.edu	37	13	25418926	25418926	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr13:25418926G>C	ENST00000255324.5	+	21	3020	c.2968G>C	c.(2968-2970)Gac>Cac	p.D990H	RNF17_ENST00000339524.3_Missense_Mutation_p.D42H|RNF17_ENST00000381921.1_Missense_Mutation_p.D990H	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	990	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		AATGGTTACAGACACATTGGT	0.353																																						dbGAP											0													94.0	92.0	93.0					13																	25418926		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2968G>C	13.37:g.25418926G>C	ENSP00000255324:p.Asp990His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.D990H	ENST00000255324.5	37	c.2968	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885874	0.51908	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120;ENST00000339524	T;T;T;T	0.10573	2.86;2.86;2.86;2.86	4.86	3.99	0.46301	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.605814	0.16475	N	0.212791	T	0.17195	0.0413	N	0.24115	0.695	0.80722	D	1	D;D;D;P	0.60160	0.987;0.973;0.986;0.942	D;P;P;P	0.64877	0.93;0.863;0.789;0.873	T	0.01323	-1.1385	10	0.62326	D	0.03	-15.8125	10.8998	0.47045	0.0925:0.0:0.9075:0.0	.	990;42;990;990	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	H	990;990;849;314;42	ENSP00000255324:D990H;ENSP00000371346:D990H;ENSP00000388892:D314H;ENSP00000344776:D42H	ENSP00000255324:D990H	D	+	1	0	RNF17	24316926	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.071000	0.57556	2.520000	0.84964	0.591000	0.81541	GAC	RNF17	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000132972		0.353	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	31	0.00	0	G	NM_031994		25418926	25418926	+1	no_errors	ENST00000255324	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	1.000	C
RNF17	56163	genome.wustl.edu	37	13	25419111	25419111	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr13:25419111G>T	ENST00000255324.5	+	22	3047	c.2995G>T	c.(2995-2997)Gat>Tat	p.D999Y	RNF17_ENST00000339524.3_Missense_Mutation_p.D51Y|RNF17_ENST00000381921.1_Missense_Mutation_p.D999Y	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	999	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		CTTGCTGTATGATGTGGGTGT	0.318																																						dbGAP											0													124.0	129.0	127.0					13																	25419111		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.2995G>T	13.37:g.25419111G>T	ENSP00000255324:p.Asp999Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.D999Y	ENST00000255324.5	37	c.2995	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392310	0.62066	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120;ENST00000339524	D;D;D;D	0.83506	-1.73;-1.73;-1.73;-1.73	4.86	4.86	0.63082	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.139019	0.47852	D	0.000212	D	0.86406	0.5925	L	0.32530	0.975	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;1.0	D	0.87836	0.2648	10	0.87932	D	0	-16.9159	15.0001	0.71464	0.0:0.0:1.0:0.0	.	999;51;999;999	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	Y	999;999;858;323;51	ENSP00000255324:D999Y;ENSP00000371346:D999Y;ENSP00000388892:D323Y;ENSP00000344776:D51Y	ENSP00000255324:D999Y	D	+	1	0	RNF17	24317111	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.957000	0.56730	2.520000	0.84964	0.591000	0.81541	GAT	RNF17	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000132972		0.318	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	67	0.00	0	G	NM_031994		25419111	25419111	+1	no_errors	ENST00000255324	ensembl	human	known	69_37n	missense	38	28.30	15	SNP	1.000	T
RNF17	56163	genome.wustl.edu	37	13	25419123	25419123	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr13:25419123G>A	ENST00000255324.5	+	22	3059	c.3007G>A	c.(3007-3009)Gaa>Aaa	p.E1003K	RNF17_ENST00000339524.3_Missense_Mutation_p.E55K|RNF17_ENST00000381921.1_Missense_Mutation_p.E1003K	NM_001184993.1|NM_031277.2	NP_001171922.1|NP_112567.2	Q9BXT8	RNF17_HUMAN	ring finger protein 17	1003	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(15)|ovary(1)|prostate(3)|skin(6)	36		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0114)|OV - Ovarian serous cystadenocarcinoma(117;0.0311)|Epithelial(112;0.0524)		TGTGGGTGTTGAACTAGTAGT	0.323																																						dbGAP											0													127.0	135.0	132.0					13																	25419123		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285602, AK001907	CCDS9308.2	13q12.13	2013-01-23			ENSG00000132972	ENSG00000132972		"""RING-type (C3HC4) zinc fingers"", ""Tudor domain containing"""	10060	protein-coding gene	gene with protein product	"""spermatogenesis associated 23"""	605793	"""tudor domain containing 4"""	TDRD4		11279525	Standard	NM_001184993		Approved	Mmip-2, SPATA23, FLJ11045	uc001upr.3	Q9BXT8	OTTHUMG00000016589	ENST00000255324.5:c.3007G>A	13.37:g.25419123G>A	ENSP00000255324:p.Glu1003Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2J9|Q6P1W3|Q9BXT7|Q9NUY9	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor,pfscan_Znf_RING	p.E1003K	ENST00000255324.5	37	c.3007	CCDS9308.2	13	.	.	.	.	.	.	.	.	.	.	G	10.02	1.236354	0.22626	.	.	ENSG00000132972	ENST00000255324;ENST00000381921;ENST00000429047;ENST00000418120;ENST00000339524	T;T;T;T	0.09538	2.97;2.97;2.97;2.97	4.86	2.92	0.33932	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.225911	0.37761	N	0.001951	T	0.04679	0.0127	N	0.11560	0.145	0.80722	D	1	B;B;B;B	0.28324	0.207;0.007;0.004;0.064	B;B;B;B	0.29524	0.103;0.025;0.032;0.027	T	0.36456	-0.9747	10	0.09338	T	0.73	-21.3605	7.4212	0.27073	0.1032:0.176:0.7208:0.0	.	1003;55;1003;1003	B7Z7S1;Q5T6R1;Q9BXT8-5;Q9BXT8	.;.;.;RNF17_HUMAN	K	1003;1003;862;327;55	ENSP00000255324:E1003K;ENSP00000371346:E1003K;ENSP00000388892:E327K;ENSP00000344776:E55K	ENSP00000255324:E1003K	E	+	1	0	RNF17	24317123	0.997000	0.39634	1.000000	0.80357	0.980000	0.70556	1.394000	0.34509	1.242000	0.43836	-0.282000	0.10007	GAA	RNF17	-	pfam_Tudor,smart_Tudor,pfscan_Tudor	ENSG00000132972		0.323	RNF17-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF17	HGNC	protein_coding	OTTHUMT00000044217.1	63	0.00	0	G	NM_031994		25419123	25419123	+1	no_errors	ENST00000255324	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	0.998	A
RPL32	6161	genome.wustl.edu	37	3	12881039	12881039	+	Intron	SNP	A	A	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr3:12881039A>G	ENST00000429711.2	-	3	196				RPL32_ENST00000396957.1_Intron|RPL32_ENST00000435983.1_Intron|SNORA7A_ENST00000384765.1_RNA|RPL32_ENST00000396953.2_Intron|RPL32_ENST00000273223.6_Silent_p.Y47Y	NM_000994.3	NP_000985.1	P62910	RL32_HUMAN	ribosomal protein L32						cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						GCTGAAGGAAATAATACACAG	0.468																																						dbGAP											0													139.0	141.0	140.0					3																	12881039		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			CA436299, CF124158, CR608027	CCDS2614.1	3q13.3-q21	2011-04-06			ENSG00000144713	ENSG00000144713		"""L ribosomal proteins"""	10336	protein-coding gene	gene with protein product						9284913	Standard	NM_001007073		Approved	L32	uc003bxl.3	P62910	OTTHUMG00000129804	ENST00000429711.2:c.97-10T>C	3.37:g.12881039A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4Q3|P02433	Silent	SNP	pfam_Ribosomal_L32e,superfamily_Ribosomal_L32e	p.Y47	ENST00000429711.2	37	c.141	CCDS2614.1	3																																																																																			RPL32	-	pfam_Ribosomal_L32e,superfamily_Ribosomal_L32e	ENSG00000144713		0.468	RPL32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL32	HGNC	protein_coding	OTTHUMT00000252032.2	76	0.00	0	A	NM_000994		12881039	12881039	-1	no_errors	ENST00000273223	ensembl	human	novel	69_37n	silent	76	23.23	23	SNP	0.003	G
RPS4X	6191	genome.wustl.edu	37	X	71493127	71493127	+	Silent	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chrX:71493127G>T	ENST00000316084.6	-	6	749	c.645C>A	c.(643-645)ggC>ggA	p.G215G	RPS4X_ENST00000486733.1_5'UTR	NM_001007.4	NP_000998.1	P62701	RS4X_HUMAN	ribosomal protein S4, X-linked	215					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of cell proliferation (GO:0008284)|positive regulation of translation (GO:0045727)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|ribosome (GO:0005840)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			NS(1)|large_intestine(1)	2	Renal(35;0.156)					CAAAGCTGTTGCCATTGGCAT	0.463																																						dbGAP											0													69.0	57.0	61.0					X																	71493127		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14418.1	Xq13.1	2011-04-05			ENSG00000198034	ENSG00000198034		"""S ribosomal proteins"""	10424	protein-coding gene	gene with protein product	"""40S ribosomal protein S4, X isoform"", ""ribosomal protein S4X isoform"", ""single-copy abundant mRNA"", ""cell cycle gene 2"""	312760				1795030, 8139551	Standard	NM_001007		Approved	DXS306, CCG2, SCAR, SCR10, FLJ40595, RPS4, S4	uc004ear.3	P62701	OTTHUMG00000021813	ENST00000316084.6:c.645C>A	X.37:g.71493127G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P12631|P12750|P27576|P55831|Q14727|Q6IPY4	Silent	SNP	pfam_Ribosomal_S4e_central,pfam_Ribosomal_S4e_N,pfam_S4_RNA-bd,pfam_KOW,smart_S4_RNA-bd,pirsf_Ribosomal_S4e,pfscan_S4_RNA-bd	p.G215	ENST00000316084.6	37	c.645	CCDS14418.1	X																																																																																			RPS4X	-	pirsf_Ribosomal_S4e	ENSG00000198034		0.463	RPS4X-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS4X	HGNC	protein_coding	OTTHUMT00000057188.1	45	0.00	0	G	NM_001007		71493127	71493127	-1	no_errors	ENST00000316084	ensembl	human	known	69_37n	silent	41	35.94	23	SNP	1.000	T
RREB1	6239	genome.wustl.edu	37	6	7249005	7249005	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr6:7249005C>G	ENST00000349384.6	+	12	5182	c.4868C>G	c.(4867-4869)gCc>gGc	p.A1623G	RREB1_ENST00000379933.3_Missense_Mutation_p.A1623G|RREB1_ENST00000379938.2_Missense_Mutation_p.A1678G|RREB1_ENST00000334984.6_Missense_Mutation_p.A1412G	NM_001003698.3	NP_001003698.1	Q92766	RREB1_HUMAN	ras responsive element binding protein 1	1623					multicellular organismal development (GO:0007275)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(18)|ovary(5)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58	Ovarian(93;0.0398)	all_hematologic(90;0.0384)|Prostate(151;0.191)				GAGGGCTTGGCCAGTGCCACC	0.662																																						dbGAP											0													49.0	48.0	48.0					6																	7249005		2201	4300	6501	-	-	-	SO:0001583	missense	0			U26914	CCDS34335.1, CCDS34336.1, CCDS54963.1	6p25	2013-01-08			ENSG00000124782	ENSG00000124782		"""Zinc fingers, C2H2-type"""	10449	protein-coding gene	gene with protein product	"""hindsight homolog (drosophila)"""	602209				9367691, 18394891	Standard	NM_001003698		Approved	HNT	uc003mxb.3	Q92766	OTTHUMG00000014201	ENST00000349384.6:c.4868C>G	6.37:g.7249005C>G	ENSP00000305560:p.Ala1623Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRF5|E2GM80|E2GM81|O75567|O75568|Q5VYB2|Q6BEP5|Q6BEP6|Q6BEP8|Q86SU2|Q9Y474	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A1678G	ENST00000349384.6	37	c.5033	CCDS34336.1	6	.	.	.	.	.	.	.	.	.	.	C	7.923	0.739011	0.15642	.	.	ENSG00000124782	ENST00000379933;ENST00000379938;ENST00000349384;ENST00000334984	T;T;T;T	0.13778	2.8;2.76;2.8;2.56	4.7	4.7	0.59300	.	0.433661	0.19322	N	0.117106	T	0.06371	0.0164	L	0.47716	1.5	0.20307	N	0.999913	B;B;P	0.51449	0.253;0.267;0.945	B;B;B	0.44044	0.088;0.04;0.439	T	0.23226	-1.0194	10	0.24483	T	0.36	-28.0312	11.4624	0.50219	0.0:0.9129:0.0:0.0871	.	1412;1623;1678	Q92766-3;Q92766;Q92766-2	.;RREB1_HUMAN;.	G	1623;1678;1623;1412	ENSP00000369265:A1623G;ENSP00000369270:A1678G;ENSP00000305560:A1623G;ENSP00000335574:A1412G	ENSP00000335574:A1412G	A	+	2	0	RREB1	7194004	0.705000	0.27846	0.354000	0.25760	0.005000	0.04900	1.640000	0.37186	2.127000	0.65507	0.655000	0.94253	GCC	RREB1	-	NULL	ENSG00000124782		0.662	RREB1-002	KNOWN	basic|CCDS	protein_coding	RREB1	HGNC	protein_coding	OTTHUMT00000352985.1	31	0.00	0	C			7249005	7249005	+1	no_errors	ENST00000379938	ensembl	human	known	69_37n	missense	42	30.00	18	SNP	0.862	G
SBNO2	22904	genome.wustl.edu	37	19	1127657	1127657	+	Silent	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr19:1127657G>A	ENST00000361757.3	-	5	624	c.387C>T	c.(385-387)ctC>ctT	p.L129L	SBNO2_ENST00000438103.2_Silent_p.L72L|SBNO2_ENST00000587024.1_Silent_p.L129L	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	129					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACACCTGGTTGAGGCTGTCAG	0.632																																						dbGAP											0													81.0	94.0	90.0					19																	1127657		2126	4231	6357	-	-	-	SO:0001819	synonymous_variant	0			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.387C>T	19.37:g.1127657G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Silent	SNP	NULL	p.L129	ENST00000361757.3	37	c.387	CCDS45894.1	19																																																																																			SBNO2	-	NULL	ENSG00000064932		0.632	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO2	HGNC	protein_coding	OTTHUMT00000458065.2	47	0.00	0	G	NM_014963		1127657	1127657	-1	no_errors	ENST00000361757	ensembl	human	known	69_37n	silent	30	18.92	7	SNP	1.000	A
SCIN	85477	genome.wustl.edu	37	7	12611252	12611252	+	Intron	SNP	T	T	C	rs6460967	byFrequency	TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:12611252T>C	ENST00000297029.5	+	1	300				AC005281.2_ENST00000433040.1_RNA	NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin						actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		CAGATAGAAGTAAGAAAAAAA	0.333													C|||	2594	0.517971	0.6293	0.4438	5008	,	,		14678	0.4008		0.5179	False		,,,				2504	0.5409					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.199+641T>C	7.37:g.12611252T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Splice_Site	SNP	-	e2+2	ENST00000297029.5	37	c.280+2	CCDS47545.1	7	1071	0.49038461538461536	304	0.6178861788617886	175	0.48342541436464087	208	0.36363636363636365	384	0.5065963060686016	C	0.022	-1.409671	0.01155	.	.	ENSG00000006747	ENST00000417018	.	.	.	2.94	-5.89	0.02282	.	.	.	.	.	.	.	.	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.2759	0.00238	0.35:0.1423:0.2318:0.2759	rs6460967;rs6460967	.	.	.	.	-1	.	.	.	+	.	.	SCIN	12577777	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.255000	0.02872	-2.353000	0.00615	-1.783000	0.00646	.	SCIN	-	-	ENSG00000006747		0.333	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCIN	HGNC	protein_coding	OTTHUMT00000326041.1	9	0.00	0	T	NM_033128		12611252	12611252	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000417018	ensembl	human	novel	69_37n	splice_site	13	23.53	4	SNP	0.000	C
SIX4	51804	genome.wustl.edu	37	14	61190202	61190202	+	Silent	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr14:61190202G>T	ENST00000216513.4	-	1	650	c.591C>A	c.(589-591)gcC>gcA	p.A197A		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	197					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		GCCGGCCGCGGGCTCGCTCGG	0.657																																						dbGAP											0													11.0	13.0	12.0					14																	61190202		2196	4289	6485	-	-	-	SO:0001819	synonymous_variant	0			AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.591C>A	14.37:g.61190202G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4QQH5|Q4V764	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.A197	ENST00000216513.4	37	c.591	CCDS9749.2	14																																																																																			SIX4	-	NULL	ENSG00000100625		0.657	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX4	HGNC	protein_coding	OTTHUMT00000072397.2	69	0.00	0	G			61190202	61190202	-1	no_errors	ENST00000216513	ensembl	human	known	69_37n	silent	32	56.76	42	SNP	1.000	T
SERPINA5	5104	genome.wustl.edu	37	14	95053962	95053962	+	Missense_Mutation	SNP	A	A	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr14:95053962A>G	ENST00000554866.1	+	2	377	c.263A>G	c.(262-264)aAg>aGg	p.K88R	SERPINA5_ENST00000554276.1_Missense_Mutation_p.K88R|SERPINA5_ENST00000553780.1_Missense_Mutation_p.K88R|SERPINA5_ENST00000329597.7_Missense_Mutation_p.K88R			P05154	IPSP_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5	88					fusion of sperm to egg plasma membrane (GO:0007342)|lipid transport (GO:0006869)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of proteolysis (GO:0045861)|regulation of proteolysis (GO:0030162)|spermatogenesis (GO:0007283)	acrosomal membrane (GO:0002080)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|platelet alpha granule (GO:0031091)|platelet dense tubular network (GO:0031094)|protein C inhibitor-coagulation factor V complex (GO:0097181)|protein C inhibitor-coagulation factor Xa complex (GO:0097182)|protein C inhibitor-coagulation factor XI complex (GO:0097183)|protein C inhibitor-KLK3 complex (GO:0036029)|protein C inhibitor-plasma kallikrein complex (GO:0036030)|protein C inhibitor-PLAT complex (GO:0036026)|protein C inhibitor-PLAU complex (GO:0036027)|protein C inhibitor-thrombin complex (GO:0036028)|protein C inhibitor-TMPRSS11E complex (GO:0036025)|protein C inhibitor-TMPRSS7 complex (GO:0036024)|protein complex (GO:0043234)	acrosin binding (GO:0032190)|glycosaminoglycan binding (GO:0005539)|heparin binding (GO:0008201)|phosphatidylcholine binding (GO:0031210)|protease binding (GO:0002020)|retinoic acid binding (GO:0001972)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(3)|large_intestine(5)|lung(18)|ovary(2)|skin(5)|upper_aerodigestive_tract(3)	36				COAD - Colon adenocarcinoma(157;0.21)	Drotrecogin alfa(DB00055)|Urokinase(DB00013)	TCCAGCACAAAGATGCAGATC	0.607																																						dbGAP											0													25.0	27.0	26.0					14																	95053962		2203	4300	6503	-	-	-	SO:0001583	missense	0			M68516	CCDS9928.1	14q32.1	2014-02-18	2005-08-18		ENSG00000188488	ENSG00000188488		"""Serine (or cysteine) peptidase inhibitors"""	8723	protein-coding gene	gene with protein product		601841	"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 5"""	PLANH3, PCI		1714450, 8381582, 24172014	Standard	NM_000624		Approved	PAI3, PROCI	uc001ydm.3	P05154	OTTHUMG00000170860	ENST00000554866.1:c.263A>G	14.37:g.95053962A>G	ENSP00000451126:p.Lys88Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q07616|Q9UG30	Missense_Mutation	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.K88R	ENST00000554866.1	37	c.263	CCDS9928.1	14	.	.	.	.	.	.	.	.	.	.	A	0.899	-0.722959	0.03158	.	.	ENSG00000188488	ENST00000554220;ENST00000553780;ENST00000554760;ENST00000554866;ENST00000329597;ENST00000556775;ENST00000553511;ENST00000555681;ENST00000554276;ENST00000557598	D;D;D;D;D;D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81;-1.81	4.11	2.98	0.34508	Serpin domain (3);	0.438333	0.21131	N	0.079655	T	0.73560	0.3602	L	0.35487	1.065	0.09310	N	1	B;B	0.26081	0.083;0.141	B;B	0.34301	0.103;0.179	T	0.56547	-0.7961	10	0.08381	T	0.77	.	4.734	0.12979	0.7356:0.0:0.0946:0.1698	.	88;88	G3V5Q9;P05154	.;IPSP_HUMAN	R	88	ENSP00000450484:K88R;ENSP00000450837:K88R;ENSP00000452469:K88R;ENSP00000451126:K88R;ENSP00000333203:K88R;ENSP00000450745:K88R;ENSP00000451215:K88R;ENSP00000451650:K88R;ENSP00000451610:K88R;ENSP00000450485:K88R	ENSP00000333203:K88R	K	+	2	0	SERPINA5	94123715	0.003000	0.15002	0.092000	0.20876	0.269000	0.26545	0.545000	0.23268	1.862000	0.54008	0.459000	0.35465	AAG	SERPINA5	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000188488		0.607	SERPINA5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINA5	HGNC	protein_coding	OTTHUMT00000410726.1	20	0.00	0	A	NM_000624		95053962	95053962	+1	no_errors	ENST00000329597	ensembl	human	known	69_37n	missense	8	60.00	12	SNP	0.003	G
SLC44A5	204962	genome.wustl.edu	37	1	75684231	75684231	+	Silent	SNP	T	T	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:75684231T>C	ENST00000370855.5	-	17	1586	c.1473A>G	c.(1471-1473)aaA>aaG	p.K491K	SLC44A5_ENST00000535611.1_Silent_p.K361K|SLC44A5_ENST00000370859.3_Silent_p.K491K	NM_152697.4	NP_689910.2	Q8NCS7	CTL5_HUMAN	solute carrier family 44, member 5	491					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				kidney(1)|large_intestine(13)|lung(35)|ovary(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	61						CATCAGGTTTTTTCATGGCCC	0.413																																						dbGAP											0													172.0	160.0	164.0					1																	75684231		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC034580	CCDS667.1, CCDS44164.1	1p31.1	2013-05-22			ENSG00000137968	ENSG00000137968		"""Solute carriers"""	28524	protein-coding gene	gene with protein product						15715662	Standard	NM_152697		Approved	MGC34032, CTL5	uc001dgu.3	Q8NCS7	OTTHUMG00000009721	ENST00000370855.5:c.1473A>G	1.37:g.75684231T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCU3|Q4G0K0|Q8NA44|Q8NB86	Silent	SNP	pfam_Choline_transptr-like	p.K491	ENST00000370855.5	37	c.1473	CCDS667.1	1																																																																																			SLC44A5	-	pfam_Choline_transptr-like	ENSG00000137968		0.413	SLC44A5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC44A5	HGNC	protein_coding	OTTHUMT00000026921.1	48	0.00	0	T	NM_152697		75684231	75684231	-1	no_errors	ENST00000370855	ensembl	human	known	69_37n	silent	34	35.85	19	SNP	0.019	C
SLC4A2	6522	genome.wustl.edu	37	7	150761400	150761400	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:150761400G>A	ENST00000485713.1	+	3	1203	c.163G>A	c.(163-165)Ggg>Agg	p.G55R	SLC4A2_ENST00000413384.2_Missense_Mutation_p.G55R|SLC4A2_ENST00000310317.5_Intron|SLC4A2_ENST00000392826.2_Missense_Mutation_p.G46R|SLC4A2_ENST00000461735.1_Missense_Mutation_p.G41R	NM_001199692.1	NP_001186621.1	P04920	B3A2_HUMAN	solute carrier family 4 (anion exchanger), member 2	55	Pro-rich.				anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	anion transmembrane transporter activity (GO:0008509)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(2)|liver(2)|lung(14)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	33			OV - Ovarian serous cystadenocarcinoma(82;0.0121)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ACAGGAGGCCGGGTCTCGTGG	0.662																																						dbGAP											0													35.0	34.0	34.0					7																	150761400		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5917.1, CCDS56520.1, CCDS56521.1	7q36.1	2013-07-19	2013-07-19		ENSG00000164889	ENSG00000164889		"""Solute carriers"""	11028	protein-coding gene	gene with protein product	"""anion exchanger 2 type a"", ""anion exchanger 2 type b1"", ""anion exchanger 2 type b2"""	109280	"""erythrocyte membrane protein band 3-like 1"", ""solute carrier family 4, anion exchanger, member 2 (erythrocyte membrane protein band 3-like 1)"""	EPB3L1, AE2		8434259	Standard	NM_003040		Approved	HKB3, BND3L, NBND3	uc003wit.4	P04920	OTTHUMG00000158443	ENST00000485713.1:c.163G>A	7.37:g.150761400G>A	ENSP00000419412:p.Gly55Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6T0|B4DIT0|D3DX05|F8W682|Q45EY5|Q969L3	Missense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_2,tigrfam_HCO3_transpt_euk	p.G55R	ENST00000485713.1	37	c.163	CCDS5917.1	7	.	.	.	.	.	.	.	.	.	.	g	12.56	1.973190	0.34848	.	.	ENSG00000164889	ENST00000483786;ENST00000485713;ENST00000413384;ENST00000490898;ENST00000482950;ENST00000463414;ENST00000488420;ENST00000392826;ENST00000461735	T;T;T;T;T;T;T;T;T	0.74737	0.94;-0.87;-0.87;1.54;0.95;0.95;0.52;-0.86;-0.86	4.42	4.42	0.53409	.	0.208477	0.41823	D	0.000806	T	0.66268	0.2772	L	0.44542	1.39	0.80722	D	1	D;D;D	0.63880	0.993;0.993;0.988	B;B;B	0.43018	0.405;0.405;0.342	T	0.69807	-0.5045	10	0.54805	T	0.06	.	10.4573	0.44559	0.0:0.1977:0.8023:0.0	.	46;41;55	F8W682;P04920-2;P04920	.;.;B3A2_HUMAN	R	55;55;55;55;55;55;55;46;41	ENSP00000417808:G55R;ENSP00000419412:G55R;ENSP00000405600:G55R;ENSP00000418114:G55R;ENSP00000419379:G55R;ENSP00000418584:G55R;ENSP00000417221:G55R;ENSP00000376571:G46R;ENSP00000419164:G41R	ENSP00000376571:G46R	G	+	1	0	SLC4A2	150392333	0.928000	0.31464	0.934000	0.37439	0.721000	0.41392	2.590000	0.46154	2.299000	0.77371	0.454000	0.30748	GGG	SLC4A2	-	prints_Anion_exchange_2	ENSG00000164889		0.662	SLC4A2-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC4A2	HGNC	protein_coding	OTTHUMT00000351039.1	34	0.00	0	G	NM_003040		150761400	150761400	+1	no_errors	ENST00000413384	ensembl	human	known	69_37n	missense	30	31.82	14	SNP	0.750	A
SNAPIN	23557	genome.wustl.edu	37	1	153633731	153633731	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr1:153633731C>T	ENST00000368685.5	+	4	455	c.365C>T	c.(364-366)gCa>gTa	p.A122V	ILF2_ENST00000480213.1_5'Flank|SNAPIN_ENST00000478558.1_3'UTR	NM_012437.5	NP_036569.1	O95295	SNAPN_HUMAN	SNAP-associated protein	122	Interaction with TOR1A.				anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|negative regulation of neuron projection development (GO:0010977)|neuron projection development (GO:0031175)|neurotransmitter secretion (GO:0007269)|positive regulation of late endosome to lysosome transport (GO:1902824)|regulation of protein binding (GO:0043393)|synaptic vesicle exocytosis (GO:0016079)|synaptic vesicle fusion to presynaptic membrane (GO:0031629)|synaptic vesicle maturation (GO:0016188)|synaptic vesicle transport (GO:0048489)|terminal button organization (GO:0072553)|viral process (GO:0016032)	BLOC-1 complex (GO:0031083)|cell junction (GO:0030054)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|perinuclear region of cytoplasm (GO:0048471)|secretory granule (GO:0030141)|synapse (GO:0045202)|synaptic vesicle (GO:0008021)	SNARE binding (GO:0000149)			lung(3)	3	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)			CGCAGGAGAGCAATGCTGGAT	0.507																																						dbGAP											0													101.0	98.0	99.0					1																	153633731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF086837	CCDS1049.1	1q22	2013-09-27		2007-11-14	ENSG00000143553	ENSG00000143553		"""Biogenesis of lysosomal organelles complex-1 subunits"""	17145	protein-coding gene	gene with protein product	"""snapin"", ""SNAP-25-binding protein"", ""biogenesis of lysosomal organelles complex-1, subunit 7"""	607007		SNAPAP		10195194, 12659861	Standard	NM_012437		Approved	BLOC1S7	uc001fcq.4	O95295	OTTHUMG00000037086	ENST00000368685.5:c.365C>T	1.37:g.153633731C>T	ENSP00000357674:p.Ala122Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV56|Q5SXU8	Missense_Mutation	SNP	pirsf_Snapin	p.A122V	ENST00000368685.5	37	c.365	CCDS1049.1	1	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501966	0.85176	.	.	ENSG00000143553	ENST00000368685	T	0.48522	0.81	5.3	5.3	0.74995	.	0.061336	0.64402	D	0.000003	T	0.32941	0.0846	L	0.47716	1.5	0.47994	D	0.999569	P	0.45957	0.869	B	0.42087	0.375	T	0.18745	-1.0327	10	0.51188	T	0.08	-16.5497	14.3314	0.66559	0.0:1.0:0.0:0.0	.	122	O95295	SNAPN_HUMAN	V	122	ENSP00000357674:A122V	ENSP00000357674:A122V	A	+	2	0	SNAPIN	151900355	1.000000	0.71417	0.995000	0.50966	0.995000	0.86356	6.611000	0.74183	2.759000	0.94783	0.557000	0.71058	GCA	SNAPIN	-	pirsf_Snapin	ENSG00000143553		0.507	SNAPIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPIN	HGNC	protein_coding	OTTHUMT00000090036.1	33	0.00	0	C	NM_012437		153633731	153633731	+1	no_errors	ENST00000368685	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	1.000	T
SNRPG	6637	genome.wustl.edu	37	2	70520828	70520828	+	5'UTR	SNP	G	G	C	rs373447773		TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:70520828G>C	ENST00000272348.2	-	0	75				SNRPG_ENST00000454893.1_5'UTR|SNRPG_ENST00000413456.2_5'Flank|SNRPG_ENST00000449935.2_5'Flank|SNRPG_ENST00000438261.1_5'Flank|SNRPG_ENST00000482975.2_5'Flank|SNRPG_ENST00000429728.1_5'UTR	NM_003096.2	NP_003087.1	P62308	RUXG_HUMAN	small nuclear ribonucleoprotein polypeptide G						gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal complex assembly (GO:0000245)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytosol (GO:0005829)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	poly(A) RNA binding (GO:0044822)			endometrium(1)	1						GCAACGCACGGCTTTCCTCAC	0.542																																					NSCLC(57;761 1258 15082 39958 48415)	dbGAP											0													96.0	84.0	88.0					2																	70520828		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			X85373	CCDS1903.1	2p13.3	2011-10-11			ENSG00000143977	ENSG00000143977			11163	protein-coding gene	gene with protein product		603542				7744013	Standard	NM_003096		Approved	Sm-G	uc002sgp.3	P62308	OTTHUMG00000129670	ENST00000272348.2:c.-47C>G	2.37:g.70520828G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5G6|Q15357|Q6IB86	RNA	SNP	-	NULL	ENST00000272348.2	37	NULL	CCDS1903.1	2																																																																																			SNRPG	-	-	ENSG00000143977		0.542	SNRPG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPG	HGNC	protein_coding	OTTHUMT00000251871.2	24	0.00	0	G			70520828	70520828	-1	no_errors	ENST00000429728	ensembl	human	known	69_37n	rna	32	25.58	11	SNP	0.000	C
SPAG9	9043	genome.wustl.edu	37	17	49075939	49075939	+	Silent	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr17:49075939C>T	ENST00000262013.7	-	15	1912	c.1704G>A	c.(1702-1704)aaG>aaA	p.K568K	SPAG9_ENST00000505279.1_Silent_p.K558K|SPAG9_ENST00000357122.4_Silent_p.K554K|SPAG9_ENST00000510283.1_Silent_p.K411K	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	568					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			GTTCAGGCTTCTTAGTCGTGT	0.448																																						dbGAP											0													160.0	135.0	144.0					17																	49075939		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.1704G>A	17.37:g.49075939C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.K568	ENST00000262013.7	37	c.1704	CCDS45740.1	17																																																																																			SPAG9	-	NULL	ENSG00000008294		0.448	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	61	0.00	0	C	NM_003971		49075939	49075939	-1	no_errors	ENST00000262013	ensembl	human	known	69_37n	silent	37	33.93	19	SNP	1.000	T
SPHKAP	80309	genome.wustl.edu	37	2	228855842	228855842	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:228855842G>C	ENST00000392056.3	-	11	4879	c.4833C>G	c.(4831-4833)atC>atG	p.I1611M	SPHKAP_ENST00000344657.5_Missense_Mutation_p.I1582M	NM_001142644.1	NP_001136116.1	Q2M3C7	SPKAP_HUMAN	SPHK1 interactor, AKAP domain containing	1611						extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|Z disc (GO:0030018)	protein kinase A binding (GO:0051018)			NS(5)|breast(5)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(25)|lung(86)|ovary(6)|pancreas(1)|prostate(6)|skin(17)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	185		Renal(207;0.025)|all_hematologic(139;0.15)|all_lung(227;0.204)|Acute lymphoblastic leukemia(138;0.205)|Esophageal squamous(248;0.23)		Epithelial(121;8.17e-11)|all cancers(144;7.92e-08)|Lung(261;0.0168)|LUSC - Lung squamous cell carcinoma(224;0.0232)		GGTCAAAGTTGATCACCAGCA	0.557																																						dbGAP											0													47.0	49.0	48.0					2																	228855842		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33389.1, CCDS46537.1	2q36.3	2010-08-20			ENSG00000153820	ENSG00000153820		"""A-kinase anchor proteins"""	30619	protein-coding gene	gene with protein product	"""sphingosine kinase type 1-interacting protein"""	611646				12080051, 11214970	Standard	NM_030623		Approved	SKIP	uc002vpq.2	Q2M3C7	OTTHUMG00000153584	ENST00000392056.3:c.4833C>G	2.37:g.228855842G>C	ENSP00000375909:p.Ile1611Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DA3|Q68DR8|Q9C0I5	Missense_Mutation	SNP	pfam_AKAP_110_C	p.I1611M	ENST00000392056.3	37	c.4833	CCDS46537.1	2	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241568	0.58995	.	.	ENSG00000153820	ENST00000392056;ENST00000344657	T;T	0.06371	3.31;3.31	6.17	5.22	0.72569	A-kinase anchor 110kDa, C-terminal (1);	0.105868	0.64402	D	0.000005	T	0.16981	0.0408	L	0.50919	1.6	0.43133	D	0.994876	D;D	0.76494	0.999;0.999	D;D	0.77004	0.989;0.978	T	0.00033	-1.2269	10	0.72032	D	0.01	.	9.1138	0.36744	0.0779:0.0:0.6902:0.2319	.	1611;1582	Q2M3C7;Q2M3C7-2	SPKAP_HUMAN;.	M	1611;1582	ENSP00000375909:I1611M;ENSP00000339886:I1582M	ENSP00000339886:I1582M	I	-	3	3	SPHKAP	228564086	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.932000	0.28884	2.941000	0.99782	0.655000	0.94253	ATC	SPHKAP	-	pfam_AKAP_110_C	ENSG00000153820		0.557	SPHKAP-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPHKAP	HGNC	protein_coding	OTTHUMT00000331750.1	34	0.00	0	G	NM_030623		228855842	228855842	-1	no_errors	ENST00000392056	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	C
SPON1	10418	genome.wustl.edu	37	11	14280995	14280995	+	RNA	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr11:14280995C>T	ENST00000310358.7	+	0	2197							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		ACGAGGAGTGCTGTGAGTGGG	0.677																																						dbGAP											0													19.0	22.0	21.0					11																	14280995		2119	4219	6338	-	-	-			0			AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14280995C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6W5|O94862|Q8NCD7|Q8WUR5	RNA	SNP	-	NULL	ENST00000310358.7	37	NULL		11																																																																																			SPON1	-	-	ENSG00000152268		0.677	SPON1-201	KNOWN	basic	processed_transcript	SPON1	HGNC	processed_transcript		29	0.00	0	C	NM_145584		14280995	14280995	+1	no_errors	ENST00000310358	ensembl	human	known	69_37n	rna	27	28.95	11	SNP	1.000	T
STAB1	23166	genome.wustl.edu	37	3	52548716	52548716	+	Splice_Site	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr3:52548716G>T	ENST00000321725.6	+	35	3754		c.e35-1			NM_015136.2	NP_055951.2	Q9NY15	STAB1_HUMAN	stabilin 1						cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|defense response to bacterium (GO:0042742)|inflammatory response (GO:0006954)|negative regulation of angiogenesis (GO:0016525)|oxidation-reduction process (GO:0055114)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	hyaluronic acid binding (GO:0005540)|low-density lipoprotein particle binding (GO:0030169)|low-density lipoprotein receptor activity (GO:0005041)|protein disulfide oxidoreductase activity (GO:0015035)|scavenger receptor activity (GO:0005044)			breast(4)|central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(13)|liver(1)|lung(27)|ovary(1)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	76				BRCA - Breast invasive adenocarcinoma(193;1.73e-05)|Kidney(197;0.00182)|KIRC - Kidney renal clear cell carcinoma(197;0.00205)|OV - Ovarian serous cystadenocarcinoma(275;0.0482)		CCTCTCCCCAGCCTGAGGTGA	0.662																																						dbGAP											0													78.0	82.0	81.0					3																	52548716		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ275213	CCDS33768.1	3p21.31	2008-07-18			ENSG00000010327	ENSG00000010327			18628	protein-coding gene	gene with protein product	"""MS-1 antigen"", ""fasciclin egf-like, laminin-type egf-like, and link domain-containing scavenger receptor-1"", ""common lymphatic endothelial and vascular endothelial receptor-1"""	608560				11829752, 12077138	Standard	XM_005264973		Approved	KIAA0246, STAB-1, FEEL-1, CLEVER-1, FELE-1, FEX1	uc003dej.3	Q9NY15	OTTHUMG00000158574	ENST00000321725.6:c.3679-1G>T	3.37:g.52548716G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E297|Q8IUH0|Q8IUH1|Q93072	Splice_Site	SNP	-	e35-1	ENST00000321725.6	37	c.3679-1	CCDS33768.1	3	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373318	0.82573	.	.	ENSG00000010327	ENST00000321725	.	.	.	5.72	5.72	0.89469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3771	0.74615	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	STAB1	52523756	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	5.987000	0.70571	2.709000	0.92574	0.561000	0.74099	.	STAB1	-	-	ENSG00000010327		0.662	STAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAB1	HGNC	protein_coding	OTTHUMT00000351380.2	29	0.00	0	G	NM_015136	Intron	52548716	52548716	+1	no_errors	ENST00000321725	ensembl	human	known	69_37n	splice_site	9	55.00	11	SNP	1.000	T
TBC1D3P5	440419	genome.wustl.edu	37	17	25746840	25746840	+	RNA	SNP	T	T	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr17:25746840T>C	ENST00000586223.1	+	0	364					NR_033892.1				TBC1 domain family, member 3 pseudogene 5																		CTAAAGCCTGTTGGAATCTAC	0.557																																						dbGAP											0																																										-	-	-			0					17q11.1	2014-03-20			ENSG00000266433	ENSG00000266433			43567	pseudogene	pseudogene							Standard	NR_033892		Approved		uc002gzg.3		OTTHUMG00000179156		17.37:g.25746840T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	NULL	ENST00000586223.1	37	c.NULL		17																																																																																			TBC1D3P5	-	-	ENSG00000266433		0.557	TBC1D3P5-003	KNOWN	non_canonical_TEC|basic	processed_transcript	TBC1D3P5	HGNC	pseudogene	OTTHUMT00000451073.1	89	0.00	0	T	NR_033892		25746840	25746840	+1	no_coding_region:pseudogene	ENST00000579401	ensembl	human	known	69_37n	splice_site	61	40.20	41	SNP	0.383	C
TBC1D8	11138	genome.wustl.edu	37	2	101627398	101627398	+	Missense_Mutation	SNP	A	A	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:101627398A>G	ENST00000376840.4	-	19	2962	c.2963T>C	c.(2962-2964)aTg>aCg	p.M988T	TBC1D8_ENST00000409318.1_Missense_Mutation_p.M1003T|RPL31_ENST00000409028.4_Intron|RPL31_ENST00000409650.1_Intron|RPL31_ENST00000409038.1_Intron			O95759	TBCD8_HUMAN	TBC1 domain family, member 8 (with GRAM domain)	988					blood circulation (GO:0008015)|positive regulation of cell proliferation (GO:0008284)	membrane (GO:0016020)	calcium ion binding (GO:0005509)|Rab GTPase activator activity (GO:0005097)			breast(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(2)|lung(12)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	32						TACCTGGCTCATTTTGGGCAA	0.403																																						dbGAP											0													200.0	185.0	189.0					2																	101627398		1824	4077	5901	-	-	-	SO:0001583	missense	0			AB024057	CCDS46375.1	2q12.1	2011-11-30			ENSG00000204634	ENSG00000204634			17791	protein-coding gene	gene with protein product	"""BUB2-like protein 1"", ""vascular Rab-GAP/TBC-containing protein"""					10373574	Standard	NM_001102426		Approved	HBLP1, VRP, AD3	uc010fiv.3	O95759	OTTHUMG00000153040	ENST00000376840.4:c.2963T>C	2.37:g.101627398A>G	ENSP00000366036:p.Met988Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDL4|A8K9W1|B9A6K4|Q53SQ4|Q9UQ32	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_GRAM,superfamily_Rab-GTPase-TBC_dom,smart_GRAM,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.M1003T	ENST00000376840.4	37	c.3008	CCDS46375.1	2	.	.	.	.	.	.	.	.	.	.	A	18.38	3.610730	0.66558	.	.	ENSG00000204634	ENST00000376840;ENST00000409318	T;T	0.06768	3.26;3.28	4.54	4.54	0.55810	EF-hand-like domain (1);	0.000000	0.64402	D	0.000001	T	0.28928	0.0718	M	0.80616	2.505	0.40965	D	0.984655	D	0.71674	0.998	D	0.67900	0.954	T	0.08330	-1.0727	10	0.52906	T	0.07	-43.3972	14.598	0.68419	1.0:0.0:0.0:0.0	.	988	O95759	TBCD8_HUMAN	T	988;1003	ENSP00000366036:M988T;ENSP00000386856:M1003T	ENSP00000366036:M988T	M	-	2	0	TBC1D8	100993830	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.554000	0.90689	1.994000	0.58287	0.533000	0.62120	ATG	TBC1D8	-	NULL	ENSG00000204634		0.403	TBC1D8-011	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D8	HGNC	protein_coding	OTTHUMT00000376092.1	52	0.00	0	A	NM_007063		101627398	101627398	-1	no_errors	ENST00000409318	ensembl	human	known	69_37n	missense	37	38.33	23	SNP	1.000	G
TENC1	23371	genome.wustl.edu	37	12	53451843	53451843	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:53451843G>C	ENST00000314250.6	+	14	1342	c.1052G>C	c.(1051-1053)tGc>tCc	p.C351S	TENC1_ENST00000552570.1_Missense_Mutation_p.C351S|TENC1_ENST00000546602.1_Missense_Mutation_p.C351S|TENC1_ENST00000451358.1_Missense_Mutation_p.C351S|TENC1_ENST00000379902.3_Missense_Mutation_p.C227S|TENC1_ENST00000549700.1_Missense_Mutation_p.C351S|TENC1_ENST00000314276.3_Missense_Mutation_p.C361S	NM_170754.2	NP_736610.2	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)	351	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						CAGCAGCTTTGCATCAGCCTG	0.592																																						dbGAP											0													68.0	64.0	66.0					12																	53451843		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730	ENST00000314250.6:c.1052G>C	12.37:g.53451843G>C	ENSP00000319684:p.Cys351Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	Missense_Mutation	SNP	pfam_PTB,pfam_Tensin_phosphatase_C2-dom,pfam_SH2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.C361S	ENST00000314250.6	37	c.1082	CCDS8843.1	12	.	.	.	.	.	.	.	.	.	.	G	18.82	3.705468	0.68615	.	.	ENSG00000111077	ENST00000379902;ENST00000314276;ENST00000314250;ENST00000451358;ENST00000443113;ENST00000546602;ENST00000552570;ENST00000549700	T;T;T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28;2.28;2.28	4.87	4.87	0.63330	Tensin phosphatase, C2 domain (2);C2 calcium/lipid-binding domain, CaLB (1);	0.058105	0.64402	D	0.000001	T	0.27278	0.0669	L	0.60845	1.875	0.37565	D	0.919215	P;P;P	0.47191	0.891;0.864;0.867	P;P;B	0.48270	0.482;0.572;0.35	T	0.12167	-1.0558	10	0.59425	D	0.04	-2.9585	15.8737	0.79145	0.0:0.0:1.0:0.0	.	351;351;361	Q63HR2;F8W661;Q63HR2-4	TENC1_HUMAN;.;.	S	227;361;351;351;351;351;351;351	ENSP00000369232:C227S;ENSP00000319756:C361S;ENSP00000319684:C351S;ENSP00000393362:C351S;ENSP00000449363:C351S;ENSP00000447021:C351S;ENSP00000449361:C351S	ENSP00000319684:C351S	C	+	2	0	TENC1	51738110	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	7.058000	0.76676	2.419000	0.82065	0.655000	0.94253	TGC	TENC1	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tensin_phosphatase_C2-dom	ENSG00000111077		0.592	TENC1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TENC1	HGNC	protein_coding	OTTHUMT00000405779.1	16	0.00	0	G	NM_170754		53451843	53451843	+1	no_errors	ENST00000314276	ensembl	human	known	69_37n	missense	12	29.41	5	SNP	1.000	C
TIAM1	7074	genome.wustl.edu	37	21	32624364	32624364	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr21:32624364C>T	ENST00000286827.3	-	6	1576	c.1105G>A	c.(1105-1107)Gac>Aac	p.D369N	TIAM1_ENST00000469412.1_5'UTR|TIAM1_ENST00000541036.1_Missense_Mutation_p.D369N	NM_003253.2	NP_003244.2	Q13009	TIAM1_HUMAN	T-cell lymphoma invasion and metastasis 1	369					apoptotic signaling pathway (GO:0097190)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|ephrin receptor signaling pathway (GO:0048013)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell-cell contact zone (GO:0044291)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	phospholipid binding (GO:0005543)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			autonomic_ganglia(3)|breast(7)|central_nervous_system(2)|endometrium(13)|kidney(4)|large_intestine(33)|lung(44)|ovary(2)|prostate(3)|skin(2)|urinary_tract(2)	115						CTGCCGCTGTCGCTGCCCACA	0.642																																						dbGAP											0													91.0	99.0	96.0					21																	32624364		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13609.1	21q22.1	2013-01-10			ENSG00000156299	ENSG00000156299		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11805	protein-coding gene	gene with protein product		600687				8595894, 15340013	Standard	NM_003253		Approved		uc002yow.1	Q13009	OTTHUMG00000084869	ENST00000286827.3:c.1105G>A	21.37:g.32624364C>T	ENSP00000286827:p.Asp369Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLR6|F5GZ53|Q17RT7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Raf-like_ras-bd,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_Pleckstrin_homology,smart_Raf-like_ras-bd,smart_PDZ,smart_DH-domain,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Raf-like_ras-bd,pfscan_DH-domain	p.D369N	ENST00000286827.3	37	c.1105	CCDS13609.1	21	.	.	.	.	.	.	.	.	.	.	C	33	5.250418	0.95305	.	.	ENSG00000156299	ENST00000286827;ENST00000399841;ENST00000541036	T;T	0.46451	0.9;0.87	4.86	4.86	0.63082	.	0.049003	0.85682	D	0.000000	T	0.60650	0.2285	L	0.53249	1.67	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;P;D	0.83275	0.917;0.829;0.996	T	0.57969	-0.7719	10	0.38643	T	0.18	.	18.1782	0.89768	0.0:1.0:0.0:0.0	.	369;369;369	F5GZ53;B7ZLR6;Q13009	.;.;TIAM1_HUMAN	N	369;210;369	ENSP00000286827:D369N;ENSP00000441570:D369N	ENSP00000286827:D369N	D	-	1	0	TIAM1	31546235	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.132000	0.77251	2.497000	0.84241	0.655000	0.94253	GAC	TIAM1	-	NULL	ENSG00000156299		0.642	TIAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAM1	HGNC	protein_coding	OTTHUMT00000192552.1	70	0.00	0	C	NM_003253		32624364	32624364	-1	no_errors	ENST00000286827	ensembl	human	known	69_37n	missense	84	11.58	11	SNP	1.000	T
TMEM132E	124842	genome.wustl.edu	37	17	32953280	32953280	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr17:32953280G>T	ENST00000321639.5	+	2	530	c.202G>T	c.(202-204)Gtc>Ttc	p.V68F		NM_207313.1	NP_997196.1	Q6IEE7	T132E_HUMAN	transmembrane protein 132E	68						integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(28)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	57				BRCA - Breast invasive adenocarcinoma(366;0.231)		GTCACCCGCGGTCGCCAACAG	0.711																																						dbGAP											0													15.0	15.0	15.0					17																	32953280		2200	4288	6488	-	-	-	SO:0001583	missense	0			BN000149	CCDS11283.1	17q12	2012-11-01			ENSG00000181291	ENSG00000181291			26991	protein-coding gene	gene with protein product							Standard	NM_207313		Approved		uc002hif.3	Q6IEE7	OTTHUMG00000132927	ENST00000321639.5:c.202G>T	17.37:g.32953280G>T	ENSP00000316532:p.Val68Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUF4|Q8WVA5	Missense_Mutation	SNP	NULL	p.V68F	ENST00000321639.5	37	c.202	CCDS11283.1	17	.	.	.	.	.	.	.	.	.	.	G	10.04	1.242136	0.22796	.	.	ENSG00000181291	ENST00000321639	T	0.12039	2.72	4.54	3.32	0.38043	.	1.418460	0.05053	U	0.478442	T	0.10680	0.0261	N	0.22421	0.69	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.13602	-1.0503	10	0.46703	T	0.11	-11.0977	5.9371	0.19171	0.2893:0.0:0.7107:0.0	.	68	Q6IEE7	T132E_HUMAN	F	68	ENSP00000316532:V68F	ENSP00000316532:V68F	V	+	1	0	TMEM132E	29977393	0.000000	0.05858	0.002000	0.10522	0.632000	0.37999	0.490000	0.22403	2.063000	0.61619	0.478000	0.44815	GTC	TMEM132E	-	NULL	ENSG00000181291		0.711	TMEM132E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132E	HGNC	protein_coding	OTTHUMT00000256440.2	65	0.00	0	G	NM_207313		32953280	32953280	+1	no_errors	ENST00000321639	ensembl	human	known	69_37n	missense	47	39.74	31	SNP	0.000	T
TLK2	11011	genome.wustl.edu	37	17	60598145	60598145	+	Missense_Mutation	SNP	T	T	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr17:60598145T>G	ENST00000326270.9	+	3	361	c.93T>G	c.(91-93)aaT>aaG	p.N31K	TLK2_ENST00000343388.7_Missense_Mutation_p.N31K|TLK2_ENST00000346027.5_Missense_Mutation_p.N31K|TLK2_ENST00000542523.1_Missense_Mutation_p.N31K|TLK2_ENST00000582809.1_De_novo_Start_OutOfFrame	NM_001284333.1	NP_001271262.1	Q86UE8	TLK2_HUMAN	tousled-like kinase 2	31					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|negative regulation of autophagy (GO:0010507)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of chromatin assembly or disassembly (GO:0001672)	intermediate filament (GO:0005882)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(4)|large_intestine(6)|liver(2)|lung(10)|prostate(1)|stomach(1)|urinary_tract(1)	39						GACCACTTAATAGTGAGTCTT	0.343																																						dbGAP											0													81.0	74.0	76.0					17																	60598145		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB004884	CCDS11633.1, CCDS45753.1, CCDS62283.1	17q23	2008-07-18							11842	protein-coding gene	gene with protein product		608439				9427565, 10523312	Standard	NM_006852		Approved	PKU-ALPHA, MGC44450	uc002izz.4	Q86UE8		ENST00000326270.9:c.93T>G	17.37:g.60598145T>G	ENSP00000316512:p.Asn31Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU07|Q9UKI7|Q9Y4F7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.N31K	ENST00000326270.9	37	c.93		17	.	.	.	.	.	.	.	.	.	.	T	11.19	1.565338	0.27915	.	.	ENSG00000146872	ENST00000346027;ENST00000343388;ENST00000326270;ENST00000542523	D;D;D;D	0.84223	-1.82;-1.82;-1.82;-1.82	5.49	2.1	0.27182	.	0.086244	0.85682	D	0.000000	T	0.80065	0.4555	L	0.56769	1.78	0.42061	D	0.991162	B;B;B	0.14012	0.009;0.005;0.009	B;B;B	0.15052	0.008;0.012;0.012	T	0.71810	-0.4480	10	0.59425	D	0.04	.	7.7385	0.28827	0.0:0.3282:0.0:0.6718	.	31;31;31	Q86UE8;Q86UE8-3;Q86UE8-2	TLK2_HUMAN;.;.	K	31	ENSP00000275780:N31K;ENSP00000340800:N31K;ENSP00000316512:N31K;ENSP00000442311:N31K	ENSP00000316512:N31K	N	+	3	2	TLK2	57951877	1.000000	0.71417	1.000000	0.80357	0.907000	0.53573	1.095000	0.30964	0.088000	0.17205	0.482000	0.46254	AAT	TLK2	-	NULL	ENSG00000146872		0.343	TLK2-004	KNOWN	basic	protein_coding	TLK2	HGNC	protein_coding	OTTHUMT00000445140.1	52	0.00	0	T	NM_006852		60598145	60598145	+1	no_errors	ENST00000326270	ensembl	human	known	69_37n	missense	45	37.50	27	SNP	1.000	G
TMEM182	130827	genome.wustl.edu	37	2	103378743	103378743	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:103378743G>A	ENST00000412401.2	+	1	272	c.67G>A	c.(67-69)Gtg>Atg	p.V23M	TMEM182_ENST00000409173.1_Intron|TMEM182_ENST00000409528.1_Intron	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	23						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						ACTCTTTTTGGTGGCTTTTGG	0.383																																						dbGAP											0													164.0	158.0	160.0					2																	103378743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.67G>A	2.37:g.103378743G>A	ENSP00000394178:p.Val23Met	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Missense_Mutation	SNP	NULL	p.V23M	ENST00000412401.2	37	c.67	CCDS2064.1	2	.	.	.	.	.	.	.	.	.	.	G	20.3	3.973702	0.74246	.	.	ENSG00000170417	ENST00000412401	T	0.60424	0.19	6.02	6.02	0.97574	.	0.236653	0.44483	D	0.000454	T	0.69993	0.3173	L	0.51422	1.61	0.36981	D	0.894287	D	0.53462	0.96	P	0.57776	0.827	T	0.73493	-0.3965	10	0.72032	D	0.01	-15.3289	20.1511	0.98086	0.0:0.0:1.0:0.0	.	23	Q6ZP80	TM182_HUMAN	M	23	ENSP00000394178:V23M	ENSP00000394178:V23M	V	+	1	0	TMEM182	102745175	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	2.707000	0.47143	2.865000	0.98341	0.655000	0.94253	GTG	TMEM182	-	NULL	ENSG00000170417		0.383	TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM182	HGNC	protein_coding	OTTHUMT00000253293.1	49	0.00	0	G	NM_144632		103378743	103378743	+1	no_errors	ENST00000412401	ensembl	human	known	69_37n	missense	38	33.33	19	SNP	1.000	A
TRAF3IP1	26146	genome.wustl.edu	37	2	239237696	239237696	+	Missense_Mutation	SNP	A	A	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:239237696A>C	ENST00000373327.4	+	5	850	c.628A>C	c.(628-630)Aac>Cac	p.N210H	TRAF3IP1_ENST00000391993.3_Missense_Mutation_p.N210H|TRAF3IP1_ENST00000391994.2_Missense_Mutation_p.N210H	NM_015650.3	NP_056465.2	Q8TDR0	MIPT3_HUMAN	TNF receptor-associated factor 3 interacting protein 1	210	Abolishes microtubules-binding when missing.				cilium assembly (GO:0042384)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic heart tube development (GO:0035050)|intraciliary transport (GO:0042073)|negative regulation of defense response to virus (GO:0050687)|negative regulation of interferon-beta production (GO:0032688)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|neural tube patterning (GO:0021532)|post-anal tail morphogenesis (GO:0036342)	axoneme (GO:0005930)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|skin(2)	23		all_epithelial(40;3.22e-10)|Breast(86;0.000523)|Renal(207;0.00571)|Ovarian(221;0.156)|all_hematologic(139;0.182)		Epithelial(121;9.92e-24)|OV - Ovarian serous cystadenocarcinoma(60;7.85e-12)|Kidney(56;3.21e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.01e-07)|BRCA - Breast invasive adenocarcinoma(100;7.72e-05)|Lung(119;0.00942)|LUSC - Lung squamous cell carcinoma(224;0.0184)		gaatggcggaaacagacacag	0.527																																						dbGAP											0													78.0	63.0	68.0					2																	239237696		2044	3935	5979	-	-	-	SO:0001583	missense	0			AF230877	CCDS33415.1, CCDS46557.1	2q37.3	2014-02-21			ENSG00000204104	ENSG00000204104		"""Intraflagellar transport homologs"""	17861	protein-coding gene	gene with protein product	"""microtubule interacting protein that associates with TRAF3"""	607380				10791955, 12935900	Standard	NM_015650		Approved	MIP-T3, DKFZP434F124, MIPT3, IFT54	uc002vye.3	Q8TDR0	OTTHUMG00000152872	ENST00000373327.4:c.628A>C	2.37:g.239237696A>C	ENSP00000362424:p.Asn210His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PCT1|Q7L8N9|Q9NRD6|Q9Y4Q1	Missense_Mutation	SNP	pfam_Microtubule/TRAF3/DISC1-bd	p.N210H	ENST00000373327.4	37	c.628	CCDS33415.1	2	.	.	.	.	.	.	.	.	.	.	A	14.50	2.552914	0.45487	.	.	ENSG00000204104	ENST00000391993;ENST00000373327;ENST00000391994;ENST00000440998	T;T;T	0.14516	2.5;2.5;2.5	4.48	3.56	0.40772	.	0.645085	0.15676	N	0.250105	T	0.08670	0.0215	N	0.08118	0	0.23406	N	0.997749	B;B	0.31351	0.32;0.256	B;B	0.35470	0.128;0.203	T	0.30736	-0.9968	10	0.49607	T	0.09	-13.8401	10.9347	0.47239	0.0893:0.0:0.9107:0.0	.	210;210	Q8TDR0-2;Q8TDR0	.;MIPT3_HUMAN	H	210	ENSP00000375851:N210H;ENSP00000362424:N210H;ENSP00000375852:N210H	ENSP00000362424:N210H	N	+	1	0	TRAF3IP1	238902435	1.000000	0.71417	0.083000	0.20561	0.257000	0.26127	4.448000	0.60027	1.005000	0.39183	-0.177000	0.13119	AAC	TRAF3IP1	-	pfam_Microtubule/TRAF3/DISC1-bd	ENSG00000204104		0.527	TRAF3IP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRAF3IP1	HGNC	protein_coding	OTTHUMT00000328312.1	16	0.00	0	A	NM_015650		239237696	239237696	+1	no_errors	ENST00000373327	ensembl	human	known	69_37n	missense	4	50.00	4	SNP	0.749	C
TRIAP1	51499	genome.wustl.edu	37	12	120882406	120882406	+	3'UTR	SNP	A	A	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:120882406A>C	ENST00000546954.1	-	0	539				AL021546.6_ENST00000551806.1_Intron|GATC_ENST00000551765.1_5'Flank|TRIAP1_ENST00000302432.3_5'UTR	NM_016399.2	NP_057483.1	O43715	TRIA1_HUMAN	TP53 regulated inhibitor of apoptosis 1						cellular response to UV (GO:0034644)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|negative regulation of release of cytochrome c from mitochondria (GO:0090201)|phospholipid transport (GO:0015914)|positive regulation of phospholipid transport (GO:2001140)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of membrane lipid distribution (GO:0097035)	mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|protein complex (GO:0043234)	p53 binding (GO:0002039)					all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					ATTTATGTAAAGCTGATTCCA	0.388																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS9198.1	12q24.31	2012-10-15			ENSG00000170855	ENSG00000170855			26937	protein-coding gene	gene with protein product	"""p53-inducible cell-survival factor"", ""mitochondrial distribution and morphology 35 homolog (S. cerevisiae)"""	614943				11042152, 15735003	Standard	NM_016399		Approved	P53CSV, WF-1, HSPC132, p53CSV, MDM35	uc001tyg.3	O43715	OTTHUMG00000047787	ENST00000546954.1:c.*269T>G	12.37:g.120882406A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4Z7|Q5RKS5|Q6LCA7	RNA	SNP	-	NULL	ENST00000546954.1	37	NULL	CCDS9198.1	12																																																																																			TRIAP1	-	-	ENSG00000170855		0.388	TRIAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIAP1	HGNC	protein_coding	OTTHUMT00000108980.3	48	0.00	0	A	NM_016399		120882406	120882406	-1	no_errors	ENST00000302432	ensembl	human	putative	69_37n	rna	13	43.48	10	SNP	0.441	C
TSHZ1	10194	genome.wustl.edu	37	18	72999753	72999753	+	Silent	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr18:72999753C>T	ENST00000580243.1	+	2	2739	c.2391C>T	c.(2389-2391)gcC>gcT	p.A797A	TSHZ1_ENST00000322038.5_Silent_p.A752A			Q6ZSZ6	TSH1_HUMAN	teashirt zinc finger homeobox 1	797					anterior/posterior pattern specification (GO:0009952)|middle ear morphogenesis (GO:0042474)|regulation of transcription, DNA-templated (GO:0006355)|soft palate development (GO:0060023)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(11)|liver(1)|lung(14)|ovary(1)|skin(6)|upper_aerodigestive_tract(2)	42		Esophageal squamous(42;0.129)|Prostate(75;0.142)|Melanoma(33;0.211)		Colorectal(1;0.000501)|READ - Rectum adenocarcinoma(2;0.00226)|BRCA - Breast invasive adenocarcinoma(31;0.246)		AGGCCGATGCCATCGACCGCT	0.577																																						dbGAP											0													49.0	48.0	48.0					18																	72999753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF039698	CCDS12009.1	18q22.3	2013-11-20	2007-07-16	2006-03-14	ENSG00000179981	ENSG00000179981		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	10669	protein-coding gene	gene with protein product		614427	"""serologically defined colon cancer antigen 33"", ""teashirt zinc finger 1"", ""teashirt family zinc finger 1"""	SDCCAG33		17586487	Standard	NM_005786		Approved	NY-CO-33, TSH1	uc002lly.4	Q6ZSZ6	OTTHUMG00000132859	ENST00000580243.1:c.2391C>T	18.37:g.72999753C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60534|Q4LE29|Q53EU4	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.A797	ENST00000580243.1	37	c.2391		18																																																																																			TSHZ1	-	NULL	ENSG00000179981		0.577	TSHZ1-005	KNOWN	basic|appris_principal	protein_coding	TSHZ1	HGNC	protein_coding	OTTHUMT00000444913.1	19	0.00	0	C	NM_005786		72999753	72999753	+1	no_errors	ENST00000580243	ensembl	human	known	69_37n	silent	13	27.78	5	SNP	1.000	T
TUBA1C	84790	genome.wustl.edu	37	12	49666681	49666681	+	Missense_Mutation	SNP	A	A	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:49666681A>T	ENST00000301072.6	+	4	1296	c.1021A>T	c.(1021-1023)Atc>Ttc	p.I341F	RP11-161H23.5_ENST00000550468.2_RNA|TUBA1C_ENST00000541364.1_Missense_Mutation_p.I411F	NM_032704.3	NP_116093.1	Q9BQE3	TBA1C_HUMAN	tubulin, alpha 1c	341					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			endometrium(1)|large_intestine(3)|liver(1)|lung(7)|skin(1)	13						CAAGCGTACCATCCAGTTTGT	0.532																																						dbGAP											0													96.0	79.0	85.0					12																	49666681		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC004949	CCDS8782.1	12q13.12	2007-03-16	2007-02-12	2007-02-12		ENSG00000167553		"""Tubulins"""	20768	protein-coding gene	gene with protein product			"""tubulin, alpha 6"""	TUBA6		7821789	Standard	NM_032704		Approved	MGC14580, MGC10851, bcm948	uc001rtt.1	Q9BQE3		ENST00000301072.6:c.1021A>T	12.37:g.49666681A>T	ENSP00000301072:p.Ile341Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.I341F	ENST00000301072.6	37	c.1021	CCDS8782.1	12	.	.	.	.	.	.	.	.	.	.	A	17.00	3.277605	0.59758	.	.	ENSG00000167553	ENST00000541364;ENST00000301072;ENST00000321665	D;D	0.84660	-1.88;-1.88	4.89	4.89	0.63831	Tubulin/FtsZ, 2-layer sandwich domain (3);Tubulin/FtsZ, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.92567	0.7639	M	0.92784	3.345	0.80722	D	1	P;P	0.51537	0.946;0.542	P;P	0.57009	0.811;0.505	D	0.94262	0.7503	10	0.87932	D	0	.	14.2423	0.65966	1.0:0.0:0.0:0.0	.	411;341	F5H5D3;Q9BQE3	.;TBA1C_HUMAN	F	411;341;211	ENSP00000443475:I411F;ENSP00000301072:I341F	ENSP00000301072:I341F	I	+	1	0	TUBA1C	47952948	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	8.809000	0.91944	2.154000	0.67381	0.454000	0.30748	ATC	TUBA1C	-	pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Beta_tubulin	ENSG00000167553		0.532	TUBA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1C	HGNC	protein_coding	OTTHUMT00000404424.1	85	0.00	0	A	NM_032704		49666681	49666681	+1	no_errors	ENST00000301072	ensembl	human	known	69_37n	missense	66	29.79	28	SNP	1.000	T
UBE3B	89910	genome.wustl.edu	37	12	109928922	109928922	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr12:109928922C>G	ENST00000342494.3	+	9	1298	c.703C>G	c.(703-705)Cta>Gta	p.L235V	UBE3B_ENST00000434735.2_Missense_Mutation_p.L235V|UBE3B_ENST00000280774.5_Missense_Mutation_p.L235V|UBE3B_ENST00000537063.1_3'UTR|UBE3B_ENST00000540230.1_3'UTR	NM_130466.3	NP_569733.2	Q7Z3V4	UBE3B_HUMAN	ubiquitin protein ligase E3B	235					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(3)|endometrium(6)|kidney(4)|large_intestine(7)|lung(20)|ovary(2)|urinary_tract(2)	45						AGCTTTTTCTCTAGCGTTACG	0.428																																						dbGAP											0													116.0	103.0	107.0					12																	109928922		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032301	CCDS9129.1, CCDS58277.1	12q24.12	2004-03-02			ENSG00000151148	ENSG00000151148			13478	protein-coding gene	gene with protein product		608047					Standard	NM_130466		Approved		uc001toq.4	Q7Z3V4	OTTHUMG00000169254	ENST00000342494.3:c.703C>G	12.37:g.109928922C>G	ENSP00000340596:p.Leu235Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8Z3|Q05BX9|Q659F7|Q7Z7Q1|Q9BXZ4	Missense_Mutation	SNP	pfam_HECT,pfam_IQ_motif_EF-hand-BS,superfamily_HECT,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.L235V	ENST00000342494.3	37	c.703	CCDS9129.1	12	.	.	.	.	.	.	.	.	.	.	C	16.40	3.113869	0.56398	.	.	ENSG00000151148	ENST00000434735;ENST00000280774;ENST00000539599;ENST00000342494	T;T;T;T	0.60171	0.63;0.21;0.85;0.63	5.84	4.95	0.65309	.	0.000000	0.85682	D	0.000000	T	0.54935	0.1889	M	0.66297	2.02	0.80722	D	1	P	0.46987	0.888	B	0.40901	0.343	T	0.61525	-0.7045	10	0.87932	D	0	-13.6925	10.3277	0.43803	0.0:0.851:0.0:0.149	.	235	Q7Z3V4	UBE3B_HUMAN	V	235	ENSP00000391529:L235V;ENSP00000280774:L235V;ENSP00000443131:L235V;ENSP00000340596:L235V	ENSP00000280774:L235V	L	+	1	2	UBE3B	108413305	0.987000	0.35691	0.799000	0.32177	0.546000	0.35178	2.617000	0.46385	1.482000	0.48325	0.655000	0.94253	CTA	UBE3B	-	NULL	ENSG00000151148		0.428	UBE3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3B	HGNC	protein_coding	OTTHUMT00000403119.1	56	0.00	0	C	NM_183415		109928922	109928922	+1	no_errors	ENST00000342494	ensembl	human	known	69_37n	missense	27	20.59	7	SNP	0.915	G
UGT1A1	54658	genome.wustl.edu	37	2	234669368	234669368	+	Missense_Mutation	SNP	T	T	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:234669368T>G	ENST00000608383.1	+	1	435	c.435T>G	c.(433-435)ttT>ttG	p.F145L	UGT1A6_ENST00000373424.1_Intron|UGT1A10_ENST00000344644.5_Intron|UGT1A1_ENST00000373450.4_Intron|UGT1A1_ENST00000608381.1_Intron|UGT1A3_ENST00000482026.1_Intron|UGT1A1_ENST00000609637.1_Intron|UGT1A9_ENST00000354728.4_Intron|UGT1A6_ENST00000406651.1_Intron|UGT1A1_ENST00000609767.1_Intron|UGT1A6_ENST00000305139.6_Intron|UGT1A4_ENST00000373409.3_Intron|UGT1A5_ENST00000373414.3_Intron|UGT1A8_ENST00000305208.5_Missense_Mutation_p.F145L|UGT1A1_ENST00000360418.3_Missense_Mutation_p.F145L|UGT1A7_ENST00000373426.3_Intron|UGT1A10_ENST00000373445.1_Intron			P22309	UD11_HUMAN	UDP glucuronosyltransferase 1 family, polypeptide A1	145					acute-phase response (GO:0006953)|bilirubin conjugation (GO:0006789)|biphenyl catabolic process (GO:0070980)|cellular glucuronidation (GO:0052695)|cellular response to ethanol (GO:0071361)|cellular response to glucocorticoid stimulus (GO:0071385)|digestion (GO:0007586)|drug metabolic process (GO:0017144)|estrogen metabolic process (GO:0008210)|flavone metabolic process (GO:0051552)|flavonoid glucuronidation (GO:0052696)|heme catabolic process (GO:0042167)|heterocycle metabolic process (GO:0046483)|liver development (GO:0001889)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cellular glucuronidation (GO:2001030)|negative regulation of steroid metabolic process (GO:0045939)|organ regeneration (GO:0031100)|porphyrin-containing compound metabolic process (GO:0006778)|response to drug (GO:0042493)|response to lipopolysaccharide (GO:0032496)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|retinoic acid metabolic process (GO:0042573)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic glucuronidation (GO:0052697)|xenobiotic metabolic process (GO:0006805)	cytochrome complex (GO:0070069)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|glucuronosyltransferase activity (GO:0015020)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|retinoic acid binding (GO:0001972)|steroid binding (GO:0005496)			breast(1)|central_nervous_system(2)|endometrium(7)|large_intestine(5)|lung(9)|skin(4)|urinary_tract(2)	30		Breast(86;0.000766)|all_lung(227;0.00271)|Renal(207;0.00339)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0461)|Lung SC(224;0.128)		Epithelial(121;4.1e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000435)|Lung(119;0.00211)|LUSC - Lung squamous cell carcinoma(224;0.0054)	Abacavir(DB01048)|Acetaminophen(DB00316)|Adenine(DB00173)|Atorvastatin(DB01076)|Axitinib(DB06626)|Diclofenac(DB00586)|Dolutegravir(DB08930)|Eltrombopag(DB06210)|Erlotinib(DB00530)|Estradiol(DB00783)|Etoposide(DB00773)|Ezetimibe(DB00973)|Ezogabine(DB04953)|Flunitrazepam(DB01544)|Flurbiprofen(DB00712)|Fluvastatin(DB01095)|Ibuprofen(DB01050)|Indacaterol(DB05039)|Indomethacin(DB00328)|Irinotecan(DB00762)|Losartan(DB00678)|Lovastatin(DB00227)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Mycophenolic acid(DB01024)|Naltrexone(DB00704)|Naproxen(DB00788)|Nilotinib(DB04868)|Pazopanib(DB06589)|Propofol(DB00818)|Raltegravir(DB06817)|Regorafenib(DB08896)|Rifampicin(DB01045)|Simvastatin(DB00641)|Sorafenib(DB00398)|Suprofen(DB00870)|Testosterone Propionate(DB01420)	AAAGCAGCTTTGATGTCATGC	0.512																																						dbGAP											0													147.0	139.0	142.0					2																	234669368		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57899	CCDS2510.1	2q37.1	2014-09-17	2005-07-20		ENSG00000242366	ENSG00000242366	2.4.1.17	"""UDP glucuronosyltransferases"""	12530	other	complex locus constituent		191740	"""UDP glycosyltransferase 1 family, polypeptide A1"""	UGT1, GNT1		9295054, 9535849	Standard	NM_000463		Approved	UGT1A		P22309	OTTHUMG00000059117	ENST00000608383.1:c.435T>G	2.37:g.234669368T>G	ENSP00000476741:p.Phe145Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJC3|B8K286	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.F145L	ENST00000608383.1	37	c.435	CCDS2510.1	2	.	.	.	.	.	.	.	.	.	.	T	17.49	3.401832	0.62288	.	.	ENSG00000241635	ENST00000305208;ENST00000360418	T;T	0.63580	-0.05;-0.05	6.16	-12.1	0.00011	.	.	.	.	.	T	0.76104	0.3941	M	0.83852	2.665	0.30149	N	0.803268	D;P	0.89917	1.0;0.94	D;P	0.85130	0.997;0.766	D	0.85052	0.0929	9	0.72032	D	0.01	.	17.2478	0.87033	0.0715:0.0797:0.0:0.8488	.	145;145	A6NJC3;P22309	.;UD11_HUMAN	L	145	ENSP00000304845:F145L;ENSP00000353593:F145L	ENSP00000304845:F145L	F	+	3	2	UGT1A1	234334107	0.000000	0.05858	0.002000	0.10522	0.010000	0.07245	-1.882000	0.01624	-2.495000	0.00514	-0.248000	0.11899	TTT	UGT1A1	-	pfam_UDP_glucos_trans	ENSG00000241635		0.512	UGT1A1-203	KNOWN	basic|CCDS	protein_coding	UGT1A1	HGNC	protein_coding		45	0.00	0	T			234669368	234669368	+1	no_errors	ENST00000305208	ensembl	human	known	69_37n	missense	28	31.71	13	SNP	0.468	G
VPS8	23355	genome.wustl.edu	37	3	184556530	184556530	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr3:184556530C>G	ENST00000437079.3	+	6	647	c.476C>G	c.(475-477)gCa>gGa	p.A159G	VPS8_ENST00000424463.2_Missense_Mutation_p.A159G|VPS8_ENST00000287546.4_Missense_Mutation_p.A159G|VPS8_ENST00000446204.2_Missense_Mutation_p.A159G|VPS8_ENST00000436792.2_Missense_Mutation_p.A159G	NM_001009921.2	NP_001009921.1	Q8N3P4	VPS8_HUMAN	vacuolar protein sorting 8 homolog (S. cerevisiae)	159							zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	54	all_cancers(143;2.51e-11)|Ovarian(172;0.0339)|Breast(254;0.247)		Epithelial(37;1.02e-33)|OV - Ovarian serous cystadenocarcinoma(80;4.81e-22)			TTGCCTACAGCAATTGTAAGT	0.264																																						dbGAP											0													42.0	41.0	41.0					3																	184556530		1753	3983	5736	-	-	-	SO:0001583	missense	0			AK056661	CCDS46972.1	3q27.2	2006-07-07	2006-07-07	2006-07-07	ENSG00000156931	ENSG00000156931			29122	protein-coding gene	gene with protein product			"""KIAA0804"""	KIAA0804		9872452	Standard	NM_001009921		Approved	FLJ32099	uc003fpb.1	Q8N3P4	OTTHUMG00000156707	ENST00000437079.3:c.476C>G	3.37:g.184556530C>G	ENSP00000397879:p.Ala159Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q8|B9EIQ1|C9JB61|O94896|Q63HP2|Q9BVP9|Q9H9B0	Missense_Mutation	SNP	superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Znf_RING,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A159G	ENST00000437079.3	37	c.476	CCDS46971.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.4|27.4	4.826449|4.826449	0.90955|0.90955	.|.	.|.	ENSG00000156931|ENSG00000156931	ENST00000287546;ENST00000437079;ENST00000436792;ENST00000446204;ENST00000422105;ENST00000424463|ENST00000426319	D;D;T;T;T;T|.	0.94576|.	-3.46;-3.46;-0.09;-0.09;2.03;2.03|.	5.91|5.91	5.91|5.91	0.95273|0.95273	.|.	0.047756|.	0.85682|.	D|.	0.000000|.	T|T	0.60405|0.60405	0.2266|0.2266	L|L	0.32530|0.32530	0.975|0.975	0.80722|0.80722	D|D	1|1	D;P;D|.	0.69078|.	0.996;0.882;0.997|.	D;P;D|.	0.77557|.	0.99;0.477;0.92|.	T|T	0.52426|0.52426	-0.8577|-0.8577	10|5	0.87932|.	D|.	0|.	-23.0478|-23.0478	19.0661|19.0661	0.93110|0.93110	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	159;159;159|.	Q8N3P4-2;C9JP71;Q8N3P4-3|.	.;.;.|.	G|E	159|61	ENSP00000287546:A159G;ENSP00000397879:A159G;ENSP00000404704:A159G;ENSP00000405483:A159G;ENSP00000415161:A159G;ENSP00000389480:A159G|.	ENSP00000287546:A159G|.	A|Q	+|+	2|1	0|0	VPS8|VPS8	186039224|186039224	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.987000|0.987000	0.75469|0.75469	6.280000|6.280000	0.72626|0.72626	2.804000|2.804000	0.96469|0.96469	0.462000|0.462000	0.41574|0.41574	GCA|CAA	VPS8	-	superfamily_Quinonprotein_ADH-like	ENSG00000156931		0.264	VPS8-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS8	HGNC	protein_coding		65	0.00	0	C	NM_015303		184556530	184556530	+1	no_errors	ENST00000287546	ensembl	human	known	69_37n	missense	39	39.06	25	SNP	1.000	G
VRK2	7444	genome.wustl.edu	37	2	58366890	58366890	+	Missense_Mutation	SNP	C	C	A	rs140015622	byFrequency	TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:58366890C>A	ENST00000435505.2	+	14	1691	c.946C>A	c.(946-948)Cat>Aat	p.H316N	VRK2_ENST00000440705.2_Missense_Mutation_p.H293N|VRK2_ENST00000412104.2_Missense_Mutation_p.H316N|VRK2_ENST00000340157.4_Missense_Mutation_p.H316N|VRK2_ENST00000417641.2_Missense_Mutation_p.H316N			Q86Y07	VRK2_HUMAN	vaccinia related kinase 2	316	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to oxidative stress (GO:0034599)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interleukin-1-mediated signaling pathway (GO:2000659)|regulation of MAPK cascade (GO:0043408)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)	24						TTTGAACCCTCATGGAATACC	0.363																																						dbGAP											0													80.0	75.0	76.0					2																	58366890		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK058199	CCDS1859.1, CCDS46291.1, CCDS46292.1	2p16.1	2008-05-15			ENSG00000028116	ENSG00000028116			12719	protein-coding gene	gene with protein product		602169					Standard	NM_001130480		Approved		uc002rzv.3	Q86Y07	OTTHUMG00000129348	ENST00000435505.2:c.946C>A	2.37:g.58366890C>A	ENSP00000408002:p.His316Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKL0|D6W5D4|D6W5D6|Q49AK9|Q53EU9|Q53S39|Q53S77|Q53TU1|Q86Y08|Q86Y09|Q86Y10|Q86Y11|Q86Y12|Q8IXI5|Q99987	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.H316N	ENST00000435505.2	37	c.946	CCDS1859.1	2	.	.	.	.	.	.	.	.	.	.	C	0.290	-0.980373	0.02197	.	.	ENSG00000028116	ENST00000435505;ENST00000417641;ENST00000412104;ENST00000340157;ENST00000394539;ENST00000440705	T;T;T;T;T	0.19250	2.16;2.16;2.16;2.16;2.16	5.15	-3.53	0.04667	Protein kinase, catalytic domain (1);	0.715250	0.13537	N	0.380512	T	0.08044	0.0201	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.37337	-0.9710	10	0.18276	T	0.48	0.2275	8.7023	0.34334	0.6723:0.1293:0.1984:0.0	.	316;316;316	Q86Y07-2;Q86Y07-5;Q86Y07	.;.;VRK2_HUMAN	N	316;316;316;316;316;293	ENSP00000408002:H316N;ENSP00000402375:H316N;ENSP00000404156:H316N;ENSP00000342381:H316N;ENSP00000398323:H293N	ENSP00000342381:H316N	H	+	1	0	VRK2	58220394	0.000000	0.05858	0.004000	0.12327	0.026000	0.11368	-0.364000	0.07583	-0.626000	0.05596	-0.766000	0.03442	CAT	VRK2	-	pfscan_Prot_kinase_cat_dom	ENSG00000028116		0.363	VRK2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VRK2	HGNC	protein_coding	OTTHUMT00000325304.2	47	0.00	0	C	NM_006296		58366890	58366890	+1	no_errors	ENST00000340157	ensembl	human	known	69_37n	missense	26	39.53	17	SNP	0.000	A
CFAP43	80217	genome.wustl.edu	37	10	105893361	105893361	+	5'UTR	SNP	G	G	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr10:105893361G>T	ENST00000479392.1	-	0	376				WDR96_ENST00000357060.3_Intron|WDR96_ENST00000428666.1_Intron																NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(14)|lung(21)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						CTATGTAGGGGGGTAGGGAGA	0.338																																						dbGAP											0													83.0	78.0	80.0					10																	105893361		2203	4299	6502	-	-	-	SO:0001623	5_prime_UTR_variant	0																														ENST00000479392.1:c.-150C>A	10.37:g.105893361G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000479392.1	37	NULL		10																																																																																			WDR96	-	-	ENSG00000197748		0.338	WDR96-004	KNOWN	basic	processed_transcript	WDR96	HGNC	protein_coding	OTTHUMT00000050201.1	31	0.00	0	G			105893361	105893361	-1	no_errors	ENST00000479392	ensembl	human	known	69_37n	rna	29	19.44	7	SNP	0.000	T
ZAN	7455	genome.wustl.edu	37	7	100364817	100364817	+	RNA	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr7:100364817C>G	ENST00000348028.3	+	0	4962				ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			TCTCCTACATCAAAGCCGTCC	0.577																																						dbGAP											0													50.0	51.0	51.0					7																	100364817		2083	4205	6288	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100364817C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.I1599M	ENST00000348028.3	37	c.4797		7	.	.	.	.	.	.	.	.	.	.	C	12.99	2.103648	0.37145	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	T;T;T;T	0.60548	0.18;0.18;0.18;0.18	4.63	2.77	0.32553	von Willebrand factor, type D domain (3);	0.673379	0.12269	N	0.483981	T	0.58119	0.2100	L	0.42581	1.335	0.23795	N	0.996828	P;P	0.50819	0.925;0.939	P;P	0.49799	0.487;0.622	T	0.49862	-0.8894	10	0.66056	D	0.02	.	11.7954	0.52098	0.0:0.6161:0.3839:0.0	.	1599;1599	F5H0T8;Q9Y493	.;ZAN_HUMAN	M	1599;1599;1599;176	ENSP00000445943:I1599M;ENSP00000445091:I1599M;ENSP00000444427:I1599M;ENSP00000441117:I176M	ENSP00000423579:I1599M	I	+	3	3	ZAN	100202753	0.000000	0.05858	0.016000	0.15963	0.013000	0.08279	-1.008000	0.03663	0.604000	0.29930	-0.304000	0.09214	ATC	ZAN	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000146839		0.577	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	42	0.00	0	C	NM_003386		100364817	100364817	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	31	22.50	9	SNP	0.895	G
ZAP70	7535	genome.wustl.edu	37	2	98341118	98341118	+	Intron	SNP	C	C	G			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr2:98341118C>G	ENST00000264972.5	+	3	617				ZAP70_ENST00000442208.1_5'Flank|ZAP70_ENST00000463643.1_3'UTR	NM_001079.3	NP_001070.2	P43403	ZAP70_HUMAN	zeta-chain (TCR) associated protein kinase 70kDa						adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|beta selection (GO:0043366)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative thymic T cell selection (GO:0045060)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of alpha-beta T cell proliferation (GO:0046641)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of T cell differentiation (GO:0045582)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell activation (GO:0042110)|T cell aggregation (GO:0070489)|T cell differentiation (GO:0030217)|T cell migration (GO:0072678)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	29						CTGAGCGATGCTATGGTGCTC	0.662																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			L05148	CCDS33254.1, CCDS33255.1	2q11-q13	2014-09-17	2002-08-29		ENSG00000115085	ENSG00000115085		"""SH2 domain containing"""	12858	protein-coding gene	gene with protein product		176947	"""zeta-chain (TCR) associated protein kinase (70 kD)"""	SRK		1423621	Standard	NM_001079		Approved	ZAP-70, STD	uc002syd.1	P43403	OTTHUMG00000153060	ENST00000264972.5:c.402+217C>G	2.37:g.98341118C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFP4|Q6PIA4|Q8IXD6|Q9UBS6	RNA	SNP	-	NULL	ENST00000264972.5	37	NULL	CCDS33254.1	2																																																																																			ZAP70	-	-	ENSG00000115085		0.662	ZAP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAP70	HGNC	protein_coding	OTTHUMT00000329278.1	65	0.00	0	C			98341118	98341118	+1	no_errors	ENST00000463643	ensembl	human	known	69_37n	rna	35	32.69	17	SNP	0.064	G
ZFYVE19	84936	genome.wustl.edu	37	15	41105030	41105030	+	Silent	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr15:41105030C>T	ENST00000355341.4	+	7	1461	c.960C>T	c.(958-960)aaC>aaT	p.N320N	ZFYVE19_ENST00000336455.5_Silent_p.N310N|ZFYVE19_ENST00000564258.1_Silent_p.N145N|ZFYVE19_ENST00000299173.10_Intron|ZFYVE19_ENST00000570108.1_Silent_p.N297N	NM_001077268.1	NP_001070736.1	Q96K21	ANCHR_HUMAN	zinc finger, FYVE domain containing 19	320					abscission (GO:0009838)|cell division (GO:0051301)|cytokinesis checkpoint (GO:0031565)|negative regulation of cytokinesis (GO:0032466)	centrosome (GO:0005813)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|midbody (GO:0030496)	phosphatidylinositol-3-phosphate binding (GO:0032266)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	9		all_cancers(109;3.31e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;2.76e-05)|COAD - Colon adenocarcinoma(120;0.151)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GGGAGGAGAACACGAGGCAGG	0.622																																						dbGAP											0													74.0	85.0	81.0					15																	41105030		2080	4199	6279	-	-	-	SO:0001819	synonymous_variant	0			AK027746	CCDS42025.1, CCDS58353.1, CCDS58354.1, CCDS58355.1	15q14	2008-05-02				ENSG00000166140		"""Zinc fingers, FYVE domain containing"""	20758	protein-coding gene	gene with protein product							Standard	NM_001077268		Approved	FLJ14840	uc031qrk.1	Q96K21		ENST00000355341.4:c.960C>T	15.37:g.41105030C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB2|C9JNF4|H3BUF9|Q86WC2|Q8WU96	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.H248Y	ENST00000355341.4	37	c.742	CCDS42025.1	15																																																																																			ZFYVE19	-	NULL	ENSG00000166140		0.622	ZFYVE19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE19	HGNC	protein_coding	OTTHUMT00000418996.1	60	0.00	0	C	NM_032850		41105030	41105030	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000561617	ensembl	human	novel	69_37n	missense	45	28.57	18	SNP	1.000	T
ZNF462	58499	genome.wustl.edu	37	9	109689355	109689355	+	Silent	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr9:109689355C>T	ENST00000277225.5	+	3	3451	c.3162C>T	c.(3160-3162)ccC>ccT	p.P1054P	ZNF462_ENST00000457913.1_Silent_p.P1054P|ZNF462_ENST00000441147.2_5'Flank			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1054					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						AGAAACACCCCGAAGAAAAGG	0.443																																						dbGAP											0													193.0	189.0	190.0					9																	109689355		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.3162C>T	9.37:g.109689355C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0T4|Q8N408	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P1054	ENST00000277225.5	37	c.3162	CCDS35096.1	9																																																																																			ZNF462	-	NULL	ENSG00000148143		0.443	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	27	0.00	0	C	NM_021224		109689355	109689355	+1	no_errors	ENST00000457913	ensembl	human	known	69_37n	silent	28	31.71	13	SNP	0.002	T
ZNF645	158506	genome.wustl.edu	37	X	22291680	22291680	+	Missense_Mutation	SNP	C	C	T	rs187258946		TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chrX:22291680C>T	ENST00000323684.1	+	1	616	c.572C>T	c.(571-573)cCg>cTg	p.P191L		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	191					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						GTGTCACTACCGTCTGTGCAA	0.478													C|||	1	0.000264901	0.0008	0.0	3775	,	,		15109	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													150.0	111.0	124.0					X																	22291680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.572C>T	X.37:g.22291680C>T	ENSP00000323348:p.Pro191Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV29|A0AV31|E3SBK4|Q6DJY9	Missense_Mutation	SNP	pfscan_Znf_RING,pfscan_Znf_C2H2	p.P191L	ENST00000323684.1	37	c.572	CCDS14205.1	X	2	0.0012055455093429777	0	0.0	0	0.0	0	0.0	0	0.0	C	12.34	1.908483	0.33721	.	.	ENSG00000175809	ENST00000323684	T	0.33865	1.39	3.25	-0.709	0.11237	.	0.414041	0.23139	N	0.051492	T	0.20700	0.0498	L	0.45137	1.4	0.19575	N	0.999968	P	0.39480	0.675	B	0.28553	0.091	T	0.11348	-1.0591	10	0.37606	T	0.19	.	7.6702	0.28455	0.0:0.5556:0.0:0.4444	.	191	Q8N7E2	ZN645_HUMAN	L	191	ENSP00000323348:P191L	ENSP00000323348:P191L	P	+	2	0	ZNF645	22201601	0.002000	0.14202	0.000000	0.03702	0.018000	0.09664	1.422000	0.34826	-0.315000	0.08703	0.600000	0.82982	CCG	ZNF645	-	NULL	ENSG00000175809		0.478	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF645	HGNC	protein_coding	OTTHUMT00000056037.1	37	0.00	0	C	NM_152577		22291680	22291680	+1	no_errors	ENST00000323684	ensembl	human	known	69_37n	missense	22	38.89	14	SNP	0.000	T
ZNF74	7625	genome.wustl.edu	37	22	20748932	20748932	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr22:20748932C>T	ENST00000400451.2	+	1	528	c.14C>T	c.(13-15)gCc>gTc	p.A5V	ZNF74_ENST00000405993.1_Missense_Mutation_p.A5V|ZNF74_ENST00000357502.5_Intron|ZNF74_ENST00000403682.3_Missense_Mutation_p.A5V|ZNF74_ENST00000356671.5_Missense_Mutation_p.A5V	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	5					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			GAGATCCCTGCCCCGGAGCCC	0.577																																						dbGAP											0													88.0	94.0	92.0					22																	20748932		1961	4150	6111	-	-	-	SO:0001583	missense	0			X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.14C>T	22.37:g.20748932C>T	ENSP00000383301:p.Ala5Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A5V	ENST00000400451.2	37	c.14	CCDS42982.1	22	.	.	.	.	.	.	.	.	.	.	t	4.771	0.143300	0.09083	.	.	ENSG00000185252	ENST00000400451;ENST00000403682;ENST00000420626;ENST00000356671;ENST00000405993	T;T;T;T	0.39997	3.45;1.05;3.45;3.32	3.62	0.0113	0.14086	.	1.239830	0.06061	N	0.658357	T	0.22360	0.0539	N	0.08118	0	0.09310	N	1	B	0.30068	0.267	B	0.27500	0.08	T	0.26643	-1.0097	10	0.66056	D	0.02	.	5.6075	0.17387	0.0:0.4942:0.391:0.1148	.	5	Q16587	ZNF74_HUMAN	V	5	ENSP00000383301:A5V;ENSP00000397011:A5V;ENSP00000349098:A5V;ENSP00000385855:A5V	ENSP00000349098:A5V	A	+	2	0	ZNF74	19078932	0.018000	0.18449	0.001000	0.08648	0.018000	0.09664	0.821000	0.27338	0.110000	0.17919	-0.320000	0.08662	GCC	ZNF74	-	NULL	ENSG00000185252		0.577	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF74	HGNC	protein_coding	OTTHUMT00000319648.2	16	0.00	0	C	NM_003426		20748932	20748932	+1	no_errors	ENST00000356671	ensembl	human	known	69_37n	missense	7	56.25	9	SNP	0.001	T
ZNF91	7644	genome.wustl.edu	37	19	23578125	23578125	+	Splice_Site	SNP	A	A	C			TCGA-PE-A5DC-01A-12D-A27P-09	TCGA-PE-A5DC-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7b62179b-7b95-441a-8fe2-6e1f604ee077	d9f3df49-ebb8-4208-985d-aa9fee51715f	g.chr19:23578125A>C	ENST00000300619.7	-	1	236		c.e1+1		ZNF91_ENST00000599743.1_Splice_Site|ZNF91_ENST00000397082.2_Splice_Site	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				TGGCAGTCTCACCATTTCTAG	0.622																																						dbGAP											0													78.0	81.0	80.0					19																	23578125		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.30+1T>G	19.37:g.23578125A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E1|B7Z6G6	Splice_Site	SNP	-	e1+2	ENST00000300619.7	37	c.30+2	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	A	4.688	0.127997	0.08981	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	.	.	.	0.225	0.225	0.15325	.	.	.	.	.	.	.	.	.	.	.	0.25691	N	0.98569	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF91	23369965	0.094000	0.21725	0.084000	0.20598	0.085000	0.17905	0.349000	0.20055	0.257000	0.21650	0.254000	0.18369	.	ZNF91	-	-	ENSG00000167232		0.622	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	45	0	0	A	NM_003430	Intron	23578125	23578125	-1	no_errors	ENST00000300619	ensembl	human	known	69_37n	splice_site	51	27.14	19	SNP	0.099	C
